Global gene expression of the inner cell mass and trophectoderm of the bovine blastocyst

MISSING IMAGE

Material Information

Title:
Global gene expression of the inner cell mass and trophectoderm of the bovine blastocyst
Physical Description:
Mixed Material
Language:
English
Creator:
Ozawa , Manabu
Sakatani, Miki
Yao, JiQiang
Shanker, Savita
Yu, Fahong
Yamashita, Rui
Wakabayashi, Shunichi
Nakai, Kenta
Dobbs, Kyle B.
Sudano, Mateus Jose
Farmerie, William G.
Hansen, Peter J.
Publisher:
BioMed Central

Notes

Abstract:
Background: The first distinct differentiation event in mammals occurs at the blastocyst stage when totipotent blastomeres differentiate into either pluripotent inner cell mass (ICM) or multipotent trophectoderm (TE). Here we determined, for the first time, global gene expression patterns in the ICM and TE isolated from bovine blastocysts. The ICM and TE were isolated from blastocysts harvested at day 8 after insemination by magnetic activated cell sorting, and cDNA sequenced using the SOLiD 4.0 system. Results: A total of 870 genes were differentially expressed between ICM and TE. Several genes characteristic of ICM (for example, NANOG, SOX2, and STAT3) and TE (ELF5, GATA3, and KRT18) in mouse and human showed similar patterns in bovine. Other genes, however, showed differences in expression between ICM and TE that deviates from the expected based on mouse and human. Conclusion: Analysis of gene expression indicated that differentiation of blastomeres of the morula-stage embryo into the ICM and TE of the blastocyst is accompanied by differences between the two cell lineages in expression of genes controlling metabolic processes, endocytosis, hatching from the zona pellucida, paracrine and endocrine signaling with the mother, and genes supporting the changes in cellular architecture, stemness, and hematopoiesis necessary for development of the trophoblast. Keywords: Blastocyst, Trophectoderm, Inner cell mass, Development
General Note:
Publication of this article was funded in part by the University of Florida Open-Access publishing Fund. In addition, requestors receiving funding through the UFOAP project are expected to submit a post-review, final draft of the article to UF's institutional repository at the University of Florida community, with research, news, outreach, and educational materials.
General Note:
Ozawa et al. BMC Developmental Biology 2012, 12:33 http://www.biomedcentral.com/1471-213X/12/33; Pgs. 1-13
General Note:
doi:10.1186/1471-213X-12-33 Cite this article as: Ozawa et al.: Global gene expression of the inner cell mass and trophectoderm of the bovine blastocyst. BMC Developmental Biology 2012 12:33.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
All rights reserved by the source institution.
System ID:
AA00013284:00001

Full Text


Ozawa et al. BMC Developmental Biology 2012, 12:33
http://www.biomedcentral.com/1471-213X/12/33


BMC
Developmental Biology


Global gene expression of the inner cell mass and

trophectoderm of the bovine blastocyst

Manabu Ozawa'l4, Miki Sakatani3, JiQiang Yao2, Savita Shanker 2, Fahong Yu2, Rui Yamashita5,
Shunichi Wakabayashi5, Kenta Nakai5, Kyle B Dobbs', Mateus Jos6 Sudano6, William G Farmerie2
and Peter J Hansen*


Abstract
Background: The first distinct differentiation event in mammals occurs at the blastocyst stage when totipotent
blastomeres differentiate into either pluripotent inner cell mass (ICM) or multipotent trophectoderm (TE). Here we
determined, for the first time, global gene expression patterns in the ICM and TE isolated from bovine blastocysts.
The ICM and TE were isolated from blastocysts harvested at day 8 after insemination by magnetic activated cell
sorting, and cDNA sequenced using the SOLiD 4.0 system.
Results: A total of 870 genes were differentially expressed between ICM and TE. Several genes characteristic of ICM
(for example, NANOG, SOX2, and STAT3) and TE (ELF5, GATA3, and KRT18) in mouse and human showed similar
patterns in bovine. Other genes, however, showed differences in expression between ICM and TE that deviates
from the expected based on mouse and human.
Conclusion: Analysis of gene expression indicated that differentiation of blastomeres of the morula-stage embryo
into the ICM and TE of the blastocyst is accompanied by differences between the two cell lineages in expression of
genes controlling metabolic processes, endocytosis, hatching from the zona pellucida, paracrine and endocrine
signaling with the mother, and genes supporting the changes in cellular architecture, stemness, and hematopoiesis
necessary for development of the trophoblast.
Keywords: Blastocyst, Trophectoderm, Inner cell mass, Development


Background
Following its formation by syngamy of the pronuclei of
the oocyte and sperm, the mammalian embryo begins life
as a totipotent, single cell organism. Subsequent cycles of
cell division and the formation of tight junctions between
blastomeres lead to a condition whereby blastomeres on
the outer face of the embryo exhibit different patterns of
cell polarity, gene expression and protein accumulation
than blastomeres on the inner part of the embryo [1-4].
Non-polarized blastomeres in the inner part of the embryo
are destined to form the pluripotent inner cell mass (ICM)
that gives rise to the embryo while polarized cells in the
outer face of the embryo are fated to differentiate into the
trophectoderm (TE), which develops into extraembryonic


SCorrespondence' Hansen@animalufledu
Department of Animal Sciences and D H Barron Reproductive and Perinata
Biology Research Program, PO Box 110910, Gainesville, FL 32611-0910, USA
Full list of author information is available at the end of the article


membranes. Cell fate may be determined as early as the
4-8 cell stage in the mouse and depend upon differences
between blastomeres in the kinetics of the interaction
between the transcription factor Pou5fl and DNA binding
sites [5]. Nonetheless, blastomeres do not undergo lineage
commitment until about the 32-cell stage (in mice), based
on loss of ability of blastomeres to form either ICM or TE
[2].
Lineage commitment towards ICM or TE is under the
control of specific transcription factors. The exact role
of at least some transcription factors varies with species
[6]. In the best studied species, the mouse, the ICM is
regulated by Sall4, PouSfl, Sox2 and Nanog while TE
formation results from a cascade of events involving
Yapl, Tead4, Gata3, Cdx2, Eomes and Elf5 [7]. Func-
tional properties of the two cell lineages is also diver-
gent. In part, this reflects the processes responsible for
establishment and maintenance of cell lineage, such as


S 2012 Ozawa et al., licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative
Biole Ned Central Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, dtribution, and
reproduction in any medium, provided the original work is properly cited.






Ozawa et al. BMC Developmental Biology 2012, 12:33
http://www.biomedcentral.com/1471-213X/12/33


differences in transcription factor usage, cell signaling
pathways and epigenetic marks [7,8]. In addition, the
function of the ICM, which is fated to undergo a series
of differentiation events in the gastrulation process, is
different from the TE, which is destined to interact with
the lining of the maternal reproductive tract.
In the present study, we i.' ... i. for the first time,
differences in the transcriptome of the ICM and TE with
the objective of understanding the consequences of the
dl. :. ..1 ..1.:: of these two cell types for cellular func-
tion. This was achieved by separating ICM and TE using
a newly-developed immunomagnetic procedure [9] fol-
lowed by next-generation sequencing. Results reveal the
implications of the spatial and developmental differenti-
ation of these first two lineages of the preimplantation
embryo with respect to metabolism, interaction with the
maternal system and changes in cellular architecture. In
addition, aspects of molecular control of the process of
lineage commitment and Ill ..i. ii:..:: are illustrative
of similarities and ,ii .. .. with the prototypical
mouse model.

Methods
Reagents
All reagents were purchased from Sigma-Aldrich (St.
Louis, MO, USA) or Fisher Scientific (Pittsburgh, PA,
USA) unless otherwise specified.

Embryo culture and ICM/TE isolation
Bovine embryos were produced from slaughterhouse-
derived oocytes using procedures for in vitro oocyte
maturation, fertilization, and embryo culture as
described previously [10]. Ovaries were donated by Cen-
tral r .. 1 Center Hill Florida. The day of fertilization
was defined as Day 0. After fertilization for 18-20 h,
embryos were cultured in SOF-BE1 medium [11] at
38.5C in a humidified atmosphere of 5% CO2 and 5%
02 with the balance N2. Embryos were cultured in
groups of 30 in a 50 pl culture drop under mineral oil.
At Day 6, an -:,..:1 -ii..,-i' 5 pl culture medium was added.
At Day 8, blastocysts were harvested and used to pre-
pare preparations of ICM and TE using magnetic acti-
vated cell sorting as reported previously [9].
Three separate pools of TE and ICM for each treat-
ment were obtained. Each pool was prepared using 88 to
102 blastocysts. A total of 15 fertilization procedures
were used to prepare the blastocysts; a set of three bulls
was used for fertilization for each procedure.

RNA preparation, library construction and sequencing
using SOLiD 4 system
Total RNA was isolated from each pool of embryonic
cells using the PicoPure RNA Isolation Kit (Applied Bio-
systems, Foster City, CA, USA) according to the


manufacturer's instructions. The quality of RNA was
assessed using the Agilent 2100 Bioanalyzer (-i. ...r
Technologies, Santa Clara, CA). AnIphl.! ,i cDNA was
prepared from total RNA for RNA-Seq applications
using the Ovation RNA-Seq kit (NuGen Technology,
San Carlos, CA). Barcoded fragment libraries were con-
structed using the SOLiD' '. I fragment library kit
according to the manufacturer's protocol (Applied Bio-
systems). Briefly, double stranded cDNA was sheared to
150-180 bp fragments using a C,.. .: '_ Sonication
system (Covaris, Woburn, MA). The fragmented DNA
was subsequently end-repaired and blunt-end ligated to
P1 and P2 adaptors. The adaptor ligated, purified and
size-selected 200-270 bp fragments were nick-translated
and then 4,piFi..1 using primers specific to P1 and P2
adaptors and Platinum" PCR Amplification Mix (Ap-
plied Biosystems). The quality of the libraries and frag-
ment distribution were verified by running 1 pl of each
library on .jl. ..i DNA 1000 chip (Agilent Technolo-
gies). Amplified libraries (5 'I, 6. 1. libraries pooled for
each slide) were immobilized onto SOLiD P1 DNA
beads (Applied Biosystems). The bead-bound libraries
were then clonally amplified by emulsion PCR according
to the Applied Biosystems SOLiDrM 4 Systems Tem-
plated Bead Preparation Guide. After amplification,
emulsions were 1. ,i.,'i. .1 with 2-butanol and the beads
containing clonally amplified template DNA were P2-
enriched and extended with a bead linker by terminal
transferase. The quantity of the beads was determined
using a NanoDrop ND1000 spectrophotometer
(Thermo Scientific, '';1.'.I... ..I DE). Approximately
600-700M beads were deposited on each slide (ran in
total three slides) and sequenced using 'sequencing by
ligation' chemistry and the 50x5 bp protocol on the
SOLiDTM v4 sequencer (Applied Biosystems) at the
I'. .:1...;ipli,:,i: Center for r.,, ..!..l i,..-. Research,
University of Florida. Results were obtained as color
space fasta files.

Analysis of read data
Raw sequencing reads were initially processed with Gen-
omeQuest tools [12]. Ambiguous residues were trimmed
off from both sides of the sequence. Bases with Phred
quality below 12 from the 3' end of the sequence were
removed. Reads that were shorter than 40 bases or that
contained more than 10 bases with quality below 12
were also discarded as were reads .. i : .i:i:. of repetitive
single bases that accounts for more than 60% of the
length at the 3' end. About 53 ~ 64% of reads were
retained after clean up, proving 102-157 million clean
reads for the three replicates of each treatment.
For mapping to the genome, the Bos taurus genomic
sequence hosTau4 (repeat masked) was downloaded
from the UCSC genome browser (http://genome.ucsc.


Page 2 of 13






Ozawa et al. BMC Developmental Biology 2012, 12:33
http://www.biomedcentral.com/1471-213X/12/33


edu/). Sequencing reads of each sample were mapped in-
dependently to the reference sequences using TopHat
1.2.0 [13]. TopHat split reads to segments and joins seg-
ment alignments. A maximum of one mismatch in each
of the 25 bp segments was allowed. This step mapped
36.8% reads to the genome. The unmapped reads were
..I.. .1.i and mapped to the reference using Bowtie
0.12.7 [14] .11 .... .i; three mismatches. Unmapped reads
were further mapped to cDNA sequences using bfast
0.6.4 [15] while allowing for three mismatches for each
read. The cDNA sequences of B. taurus were down-
loaded from the National Center of Pr.. -, i,'...,. : Infor-
mation. Scaffold and chromosome sequences were
cleared and a total of 35,842 sequences were obtained
(ht tp://ww w.ncbi.nlm.nih.gov/nuccore/?term=txid9913
[Organism:noexp]). Bfast aligned 27.6% of the total reads
to the cDNA sequences. Therefore, a total of 64.4% or
595 million reads were mapped successfully. Of the
mapped reads, 89.8% are uniquely mapped to either the
genome or cDNA sequences. Data were deposited in the
DDBJ Sequence Read Archive at http://ww' l1 -, .."
I ...i. -e.html (Submission DRA000504).
DE,. i 1 gene expression was determined as :i'.....
The number of mapped reads for each individual gene
was counted using the liT-'. tool (http://Awww-huber.
embl.de/users/anders/HTSeq/doc/overview.html) with
intersection-nonempty mode. HTSeq takes two input
files bam or sam-format files of mapped reads and a
gene model file. The Ensemble gene annotation file in
GTF format was downloaded from the UCSC genome
browser. The DESeq package [16] in R was used for
digital gene expression analysis. DESeq uses the negative
binomial ,' ,la, ... with variance and mean linked by
local regression, to model the null distribution of the
count data. ,-.:,..I, III up- and downregulated genes
were selected using two cutoffs: an adjusted P value of
0.05 and a minimum fold-change of 1.5.

Classification of differentially expressed genes into gene
ontology (GO) classes
Differentially expressed genes were annotated by the
Database for Annotation, Visualization and Integrated
Discovery (DAVID; (DAVID Bioinformatics Resources
6.7, http://david.abcc.ncifcrf.gov/) [17]. Most genes were
annotated using the bovine genome as a reference and
additional genes were annotated by comparison to the
human genome. The DAVID database was queried to
identify GO classes enriched for .-t...- .. -,b.: and down-
regulated genes. Functions of i:1' .. 1-1; expressed
genes were further annotated using Kyoto Encyclopedia
of Genes and Genomes (KEGG, http://www.genome.jp/
kegg/). Overview of the differentially regulated KEGG
pathways were mapped on KEGG Pathway Map using
iPath2.0 (http://pathways.embl.de/) [18].


To further analyze patterns of genes differentially
regulated between ICM and TE, k-mean clustering was
performed. The reads count data of the 870 significant
genes for the ICM-control versus TE-control compari-
son were clustered using k-means strategy [19]. To esti-
mate the premium cluster number, k-values from 3 to
100 were tested and the corresponding sum of squares
error (SSE) [20] was calculated for each k value. SSE is
defined as the sum of the squared distance between each
member of a cluster and its cluster centroid. The SSE
values dropped abruptly until k = 8 (results not shown).
To balance the minimum number of SSE and the mini-
mum number of clusters, k = 8 was selected as the pre-
mium parameter for clustering genes and a heatmap was
generated using heatmap.2 of R package.


Enrichment analysis for transcription factor binding sites
For each .i .i. .. f .11; expressed gene, the candidate pro-
moter region was defined as the span of nucleotides
from 200 bp upstream and 50 bp downstream from the
transcriptional start site .i. ::iI., .i in Ensembl. To detect
putative transcription factor binding sites (TFBS) in each
promoter, we i.11....1 the method of Wasserman and
Sandelin [21]. Position-specific weight matrices were
obtained from the JASPAR database [22]. The score was
calculated by formula 1 in Additional File 1. We also cal-
culated the ratio of the score to the maximum score by
formula 2 (Additional File 1). Statistical significance of
each TFBS was evaluated by calculating the hypergeo-
metric distribution using formula 3 ( ..i. i! i file 1).
We performed the 'match' program with 'minSUM' and
minFP' thresholds to detect TFBS [23]. Statistical sig-
nificance of each detected TFBS was evaluated by the
hypergeometric distribution as. I i.. above.


Calculation of GC contents and detection of CpG islands
The method by Gardiner-Garden and Frommer [24] was
used to identify CpG islands in the region encompassing
the 100 nucleotides upstream and 100 nucleotides down-
stream from the start site. Transcriptional start sites for dif-
ferentially expressed genes were obtained from UMD3.1
[25]. For the definition of CpG islands, The GC content
was calculated as ([C]+[G1] '," where [N] denotes the
number of nucleotides "N" within the 200 base window.
The CpG score was calculated as [CG]/([C]*[G]*200). A
gene was I .i,:. as CpG positive when its GC content in
the region spanning the 100 nucleotides upstream and the
100 nucleotides downstream from the start site exceeds 0.5
and when the CpG score in the same region exceeds 0.6.
Otherwise, a gene was classified as CpG negative. Chi-
square analysis was used to determine whether the percent
of genes classified as CpG positive differed between 1)
genes overexpressed in ICM versus genes overexpressed in


Page 3 of 13






Ozawa et al. BMC Developmental Biology 2012, 12:33
http://www.biomedcentral.com/1471-213X/12/33


TE and 2) genes overexpressed in ICM or TE versus the
reference population of 25118 genes in the bovine genome.

Confirmation of differences in gene expression between
ICM and TE by quantitative PCR
An experiment was performed to verify the effect of cell
type (ICM vs TE) and CSF2 on relative mRNA abundance
of the GATA3, ELFS, CDX2, NANOG and SOX2. Embryos
were prepared as described previously and blastocysts
were collected at Day 7. Pools of 25-34 blastocysts were
submitted to magnetic-activated cell sorting [9]. A total of
6 biological replicates of ICM and TE were prepared.
mRNA extraction was performed using the All Prep
DNA/RNA mini Kit (QC. .. Inc., Valencia, CA, USA) fol-
lowed by DNase (Qiagen) treatment and reverse transcrip-
tion (High Capacity cDNA Reverse Transcription Kit,
Applied Biosystems, Foster City, CA). Transcript abun-
dance for GATA3, ELFS, CDX2, NANOG and SOX2 as
well as housekeeping genes GAPDH, SDHA and YWHAZ
were .pi 1i,;:-.. i by a Bio-Rad thermal cycler CFX96-Real-
Time system i':..' .-' :i., Hercules, CA, USA) using SsoFast
EvaGreen Supermix reagent (Bio-Rad, Hercules, CA,
USA). PCR conditions were as follows: 30 sec at 95C fol-
lowed by 40 cycles each of 5 sec at 95C and 1 min at
60C. Data were analyzed using the delta-delta cycle
threshold (Ct) method. The reference gene was the
geometric mean of the Ct values of GAPDH, SDHA
and YWHAZ. Primers for ELFS were based on
NM_001024569.1 and were designed using PrimerQuest
from idtDNA (http://www.idtdna.com) software, Effi-
ciency was '-".. and ;.1. ii,.t of amplicons was -. !.: .i
by sequencing products. The primers were 5' TGC
CATTTCAACATCAGTGGCCTG 3' and 5' AAGGC
CACCCTCAAAGACTATGCT 3'. Other primer pairs
were l,:i I ..I previously: GATA3 [26], CDX2 and
NANOG [9], SOX2 [27] and GAPDH, SD-IA and YWI-IAZ
[28].
Data were analyzed by least-squares analysis of variance
using the General Linear Model :' .1 : procedure of the
Statistical Analysis System, version 9.2 (SAS Institute Inc,
Cary, NC, USA) Sources of variation in the model
included cell type (ICM and TE), replicate and the inter-
action; cell type was considered fixed and replicate was
considered random. L .." :i- !,.. transformation was ap-
plied to CDX2 data to improve normality. All data are
reported as untransformed least-squares means.

Results
Differentially expressed genes
The lists of 1l,. .. n.. ii; expressed genes, determined
using an adjusted P value of <0.05 and > 1.5-fold .I.!. I-
ence as cut-offs, are presented in Additional file 2. There
were a total of 870 genes that were ill .- i .: ; expressed
between ICM and TE, with 411 genes upregulated in the


ICM and 459 downregulated in the ICM (i.e., upregulated
in the TE).

Annotation of genes differentially expressed between
ICM and TE
Differentially expressed genes were annotated using the
Gene ID conversion tool of the DAVID Bioinformatics
Resources 6.7 (http://david.abcc.ncifcrf.gov/conversion.
jsp); 835 of the 870 differentially expressed genes were
annotated (389 genes upregulated in the ICM and 424
genes upregulated in the TE). For the list of genes up-
regulated in ICM, 10 GO terms were listed in the Bio-
logical Process group, 4 GO terms in the Cell
Component group, and 5 terms in the Molecular Func-
tion group (Table 1). Terms related to transcriptional ac-
tivities were dominant including regulation of
transcription, DNA-dependent (25 genes), regulation of
transcription from RNA polymerase II promoter (11
genes), DNA binding (29 genes), transcription regulator
activity (22 genes) and transcription factor activity (17
genes). There were also GO terms related to metabolic
activity ;"',..i ..'11 regulation of RNA metabolic process
(25 genes), positive regulation of macromolecule meta-
bolic process (12 genes), negative regulation of macro-
molecule metabolic process (10 L. .. and enzyme
binding (10 genes).
For genes .. .1 i. 1 in TE, 12 GO terms were listed
in the Biological Process group, 12 in the Cell Compo-
nent .,',,,'. and 9 in the Molecular Function .- ..i'
(Table 2). GO terms enriched for TE were distinct from
those for ICM. A large number of genes represented by
GO terms related with metabolism were upregulated in
TE including proteolysis (27 .... ). oxidation reduction
(23 M, '. lipid biosynthetic processing (11 genes), ster-
oid metabolic process (10 genes), and peptidase activity
(acting on L-amino acid peptides) I2 genes) as well as
genes involved in I.'.."i;,._ reactions [ion i .... i.. (86
.* .. cation binding (83 genes), metal ion i...i",; (81
genes), calcium ion binding (34 genes) and iron ion
binding (12 genes)]. There was also enrichment for
genes associated with endo- or exocytosis, membrane
transport and alterations in cellular architecture as indi-
cated by GO terms for vesicle-mediated transport (15
genes), actin filament-based process (14 :-...-.1 actin
cytoskeleton organization (13 .'- '. cytoskeleton
organization (13 genes), plasma membrane (43 genes),
endoplasmic reticulum (32 genes), cytoplasmic vesicle
(14 :-._-..-` vesicle (14 ,.-..-1 actin cytoskeleton (13
genes), cell projection (12 2- .. vacuole (11 genes),
endoplasmic reticulum part (11 genes), apical part of cell
(10 genes), and cytoskeletal arrangement (20 genes).
Functions of ::r._:._ .:-I expressed genes were further
annotated using KEGG iip. '/wwv L ......-. I-').
Genes ,': *l -li, in ICM were enriched in eight terms


Page 4 of 13







Ozawa et al. BMC Developmental Biology 2012, 12:33
http://www.biomedcentral.com/1471-213X/12/33




Table 1 GO terms enriched for genes upregulated in the ICM as compared to TEa
GO term Count Percent
Biological Process
Regulation of transcription, DNA-dependent 25 6.7
Regulation of RNA metabolic process 25 6.7
Neurological system process 12 3.2
Regulation of cell proliferation 12 3.2
immune response 12 3.2
Positive regulation of macromolecule metabolic process 12 3.2
Cognition 11 2.9
Regulation of transcription from RNA polymerase II promoter 11 2.9
Response to organic substance 10 2.7


Negative reau atic


macromolecule metabolic process


Cell Component
Plasma membrane 34
Extracellular region 30
Extracellular region part 19
Extracellular space 12
Molecular Function
DNA binding 29
Transcription regulator activity 22
Calcium ion binding 18
Transcription factor activity 17
Enzyme binding 10
a Only those GO terms which contained at least 10 differentially expressed genes are listed.
b False discovery rate (x 100).


(Table 3A). These included pathways involved in lineage
commitment (e.g., hematopoietic cell lineage) and differen-
tiation (axon guidance) as well as those involved in main-
tenance of stemness and self renewal (e.g., pathway in
cancer and Jak-STAT -..-:I!.!-' pathway). Genes upregu-
lated in TE were enriched in 12 terms (Table 3B). None of
the terms were in common with KEGG terms enriched for
genes 'i1. nl ta. 1 for ICM. Terms were :'i. I 1 i!. ill re-
lated to transmembrane transport (lysosome, aldosterone-
regulated sodium resabsorption, and ABC i' :.. 'i'i' .
lipid or steroid metabolism (PPAR signaling pathway,
terpenoid backbone biosynthesis, sphingolipid metabol-
ism, steroid hormone biosynthesis, fatty acid metabol-
ism) and other metabolic processes (pantothenate and
CoA biosynthesis). Additional file 3 represents a KEGG
metabolic pathway map in which pathways that were dif-
ferentially enriched between ICM and TE were i.:i._1,-r .:_
using iPath2.0 (http://pathways.embl.de/). Note the
increased metabolic activity in TE as compared to ICM.


K-mean clustering
The 870 genes that were ::,rr....:-r!i expressed between
ICM and TE were clustered into 8 clusters, with 2, 4, 7,


9, 23,48, 149 and 628 genes in each cluster (Additional
file 4). The biggest cluster (628 genes) contained 72.2%
of all the significant genes and genes were included from
almost all the overrepresented pathways (Table 3).
Therefore, the k-mean analysis did not disclose much in-
formation on functional expression patterns of differen-
tially expressed genes.


Comparison of ICM-TE differences in the bovine with the
mouse and human
The literature was used to identify a group of genes that
have been .. II.I. I as being expressed by ICM, TE or
embryonic stem cells in the mouse [29-32] or human
[33-38] ( ....::i:,:. :,! file 5). Among the 119 genes consid-
ered characteristic of ICM or embryonic stem cells, 8
were significantly upregulated in ICM (KDM2B,
NANOG, SOX2, SPIC, STAT3, ZX3HAV1, and OTX2)
and two (IL6R and TFRC) tended (P=0.06 or less) to be
!1." -'l li. .1 in ICM. Conversely, 6 genes considered as
being expressed in ICM or embryonic stem cells in the
mouse or human were upregulated in the TE (DAB2,
DSP, GM2A, SCD, SSFA2, and VAV3). Of 49 genes con-
sidered characteristic of TE, 12 (AQP11, ATP1B3, CGN,


Page 5 of 13






FDRb


P value


0.03
000


0.04


43.9


0.00


46.9


0.02







Ozawa et al. BMC Developmental Biology 2012, 12:33
http://www.biomedcentral.com/1471-213X/12/33




Table 2 GO terms enriched for genes upregulated in the TE as compared to ICMa
GO term Count Percent
Biological Process
Proteolysis 27 6.4
Oxidation reduction 23 5.4
ntracellular signaling cascade 20 4.7
Ion transport 20 4.7
Vesicle-mediated transport 15 3.5
Regulation of cell proliferation 15 3.5


Actin filament-based process
Actin cytoskeleton organizatic
Cytoskeleton organization
Lipid biosynthetic process
Steroid metabolic process
Negative regulation of cell pr
Cell Component
Plasma membrane
Endoplasmic reticulum
Cell fraction
Cytoplasmic vesicle
Vesicle
Actin cytoskeleton
Membrane fraction
nsoluble fraction
Cell projection
Vacuole
Endoplasmic reticulum part
Apical part of cel
Molecular Function
Ion
Cation binding
Metal ion binding
Calcium ion binding
Peptidase activity, acting on L
Cytoskeletal protein binding
Actin binding
ron ion binding


14
13
13
11
10
iferation 10


-amino acid peptides


Lipid binding 11
a Only those GO terms which contained at least 10 differentially expressed genes are listed.
b False discovery rate (x 100).


CYP11A, DSC2, ELF5, GATA3, HISD3B1, KRT18, MSX2,
SFXN or TJP2) were ..... 1..:. 1 in TE. CDH24, a cad-
herin reported to be "p". .' ,i .1 in the TE of the human
[33], was expressed in higher amounts in the ICM.
We also examined expression of ruminant-specific genes
known to be !i" '-. 1 1 .1 in TE. The three examined, IFNT1
[39], PAG2 [40], and TKDP1 [41], were -.*, 1.1 ,, .1 in TE.


We evaluated i.:-i .. .....in expression between ICM
and TE for L --. that have been shown in the mouse [7]
to be important for segregation of ICM and TE lineages
and subsequent TE h:: .. ..t, i:..i (Table 4). Expression
of two genes important for ICM commitment, NANOG
and ,.-'. was significantly higher for ICM than TE
while expression of two other genes important for ICM


Page 6 of 13







FDRb


P value


6.26
10.40
43.10
50.64
5.68
11.09
0.00
0.00


40.40
0.00
2.50
31.04
36.80
0.04


0.14
0.49
0.94
0.00
1.41
0.00
0.04
31.90
38.82







Ozawa et al. BMC Developmental Biology 2012, 12:33
http://www.biomedcentral.com/1471-213X/12/33


Table 3 KEGG Pathways enriched for genes upregulated in the inner cell mass or trophectoderm
Term Genes
Unregulated in nner Cell Mass (A)


Antigen processing and presentation
Complement and coagulation cascades
Chemokine signaling pathway
Axon guidance
Arrhythmogenic right ventricular cardiomyopathy (ARVC)
Pathways in cancer
Jak-STAT signaling pathway
Hematopoietic cell lineage


ysosome


Steroid biosynthesis


CD74, CD8B, HSPAIL, HSPA6, PSME1, BoLA-DRB3
A2M, F2R, C1R, PLAUR, C4BPA,
ITK, CCL24, CXCL7, GNAI1, GNB5, GNG7, PLCB1, STAT1, STAT4, STAT3
EPHA4, CHP, DPYSL2, GNAI1, ROBO1, SEMA4G, SLIT2
CDH2, DES, GJA 1, ITGA2, TCF7L2
CDKN2B, FGF12, FGF16, ITGA2 MMP9, PDGFRA, STAT1, STAT4, STAT3, TCF7L2, FOS, KIT,WNT
IL12RB2, IL19, IL6ST, IL7, STAl, STAT4, STAT3, SPRY2
CD1A, CD8B, ITGA2, IL7, KIT
Upregulated in Trophectoderm (B)
ATP6VOA4, GM2A, NPC, CTSB, CTSH, CTSL2, CTNS, GLAA, GALC, MANBA,
PLA2G15, SCARB2, ATP6VOC, SL 11A2
NSDHL, CYP41A1, FDFT1, SC4MOL


Aldosterone-regulated sodium reabsorption ATP1B3, N
Vascular smooth muscle contraction ACTA2, A
PPAR signaling pathway ACSL4, A
Phosphatidylinositol signaling system CALML3,
Pantothenate and CoA biosynthesis BCAT1, EN
Terpenoid backbone biosynthesis HMGCR, A
Sphingolipid metabolism UGCG, GL
Steroid hormone biosynthesis UGT1A1,
Fatty acid metabolism ACAT2, A
ABC transporters ABCA3,AB


commitment, POU5F1 and SALL4, did not differ signifi-
cantly between ICM and TE. i ,.I. i ..i ; expression of
these latter two genes was higher for ICM. Four genes
were examined that are important for TE commitment
- CDX2, GATA3, TEAD4, and YAP1. Expression of
GATA3 was significantly higher for TE but there were
no significant differences in expression between ICM
and TE for the other three genes. One gene important
for .:ir ir m.-.F. ,r, -:.,. of TE later in development, ELFS, was


IEDD4L, PRKCG, SGK1, SFN
TG2, CALD1, CALML5, ITPR2, MYLK, MYL6, PRKCH, PRKCG
,SL6, FABP5, ACSL3, SCD, SCP2
TPR21NPP4B, INPP5D, PRKCG, SYNJI
IPP1, ENPP3
CAT2, IDI1
A, GALC, SGPP1
UGT1A6, CYP 11A, CYP3A28, HSD3B1
CSL4, ACSL6, ACSL3
CB1, ABCC2,ABCG5


expressed in higher amounts in TE (adjusted P=0.022)
whereas another, EOMES, was barely detectable and not
11il; ... between ICM and TE.


Characteristics of promoter regions of genes differentially
expressed between ICM and TE
The region spanning nucleotide sequences located 200 bp
upstream to 50 bp downstream of the transcription start
site was examined for presence of putative TFBS for each


Table 4 Differences in expression between ICM and TE for genes involved in segregation of ICM and TE in mice'
Gene symbol Role in mouse Mean counts, ICM Mean count, TE Fold change, TE/ICM Adjusted P value
CDX2 TE commitment 5.7 2.8 0.49 0.780
ELF5 TE differentiation 5.3 28.9 5.41 0.022
GATA3 TE commitment 363.6 976.7 2.69 0.018
EOMES TE differentiation 1.4 0.2 0.16 0.934
NANOG ICM commitment 3014.8 620.9 0.21 0.000


POU5FI
SALL4
SOX2
TEAD4
YAP I
a Source: Chen et al. [7].


ICM commitment
ICM commitment
ICM commitment
TE commitment
TE commitment


Page 7 of 13


2394.


0.78


47.9


0.605
0.893


43.0


0.90


.000







Ozawa et al. BMC Developmental Biology 2012, 12:33
http://www.biomedcentral.com/1471-213X/12/33


gene that was differentially expressed between ICM and
TE. Binding sites for three transcription factors (PLAG1,
RELA and RREB1) were significantly enriched for genes
overexpressed in the ICM while binding sites for nine tran-
scription factors (EGR1, GABPA, KLF4, MYF5, SP1, MZF1,
NHLH1, PAX5 and ZFX) were significantly enriched for
TE. For 11 of 12 transcription factors identified as being
used to regulate genes overexpressed in ICM or TE, there
was no difference in expression level between ICM and TE.
The exception was for EGR1, where expression was upre-
gulated in ICM (Additional file 2), even though the TFBS
was enriched for genes overexpressed in TE.


Differences in promoter CpG islands between genes
overexpressed in ICM or TE
The percent of genes overexpressed in ICM that were
classified as CpG positive (46.6%) was lower (P<0.05)
than for genes overexpressed in TE (55.3%). Moreover,
the percent of genes classified as CpG positive for genes
overexpressed in either tissue was higher than the per-
cent that were classified as CpG positive for the entire
bovine genome (39.4%). Thus, DNA methylation may
play a greater role for regulation of genes differentially
regulated in the ICM and TE than it does for the gen-
ome as a whole.
Of the genes that were differentially regulated for ICM
and TE, three were genes involved in epigenetic modifi-
cation. These were DNMT1 and KDM2B, overexpressed
in ICM, and DNMT3A like sequence, overexpressed in
TE (Additional file 2).

Confirmation of differences in gene expression between
ICM and TE by quantitative PCR
Using isolated ICM and TE from a separate set of blas-
tocysts than used for SOLiD sequencing, qPCR was per-
formed to verify treatment effects on gene expression
for 6 genes (GATA3, ELF5, CDX2, NANOG and SOX2).
Results for differences between ICM and TE were gene-
rally consistent with results from deep sequencing
(Figure 1). In particular, expression was higher for TE
than ICM for GATA3 (P=0.07) and ELF5 (P<0.05) and
was higher for ICM than TE for NANOG (P<0.05) and
SOX2 (P<0.05). One discrepancy with deep sequencing
results was for CDX2. While there was no significant dif-
ference between ICM and TE in the deep sequencing
data base (Table 4), mRNA for CDX2 was higher for TE
than ICM as determined by qPCR (Figure 1).

Discussion
Differentiation in the mammalian embryo is dependent
upon spatial position cells on the inside of the embryo re-
main pluripotent for a period until initiation of gastrulation
while cells on the outer face of the embryo differentiate into


TE and ultimately form much of the extraembryonic
membranes. Here, using magnetic-assisted cell sorting and
high-throughput next generation sequencing, we show the
consequences of spatial differences between ICM and TE
and subsequent divergence in lineage commitment for ex-
pression of genes regulating pluripotency and lineage
commitment, cellular metabolism, and interactions with
the maternal system.
Commitment towards the ICM lineage in the mouse is
maintained by actions of Pou5fl (Oct4), Sall4, Sox2 and
Nanog; Cdx2 in the TE inhibits PouSfl expression and
allows differentiation of extraembryonic membranes
[3,4,7]. In the bovine, too, SOX2 and NANOG were over-
expressed in ICM but expression of POUSF1 and SALL4
were not significantly different between ICM and TE. A
high degree of expression of POUSF1 in the TE was
expected because differences in the regulatory region of
the POUSF1 gene in cattle as compared to the mouse gene
make POUSF1 resistant to regulation by CDX2 [6]. None-
theless, POUSF1 expression is greater in the ICM of cattle
[6,42]. In the present study, expression of both POUSF1
and SALL4 were numerically greater for ICM; failure to
find significant differences between ICM and TE may rep-
resent the small sample size. It should also be kept in
mind that embryos produced in vitro have altered patterns
of gene expression relative to embryos produced in vivo
[43]. Such alterations could change some of the differen-
tial gene expression between ICM and TE, as has been
reported for the mouse embryo [44].
Analysis of genes upregulated in ICM provides some
clues as to the signaling pathways required for specifica-
tion, pluripotency, and other functions of the ICM. A
total of 8 genes in the KEGG Jak-STAT signaling pathway
were upregulated. In mice, LIF, which signals through the
Jak-STAT pathway, can promote pluripotency of cells

3.5


2.5


S1.5 P=O.07


c0.5
0
GATA3 ELF5 CDX2 NANOG SOX2
Target genes
Figure 1 Differences between inner cell mass (ICM) and
trophectoderm (TE) in expression of 6 select genes as
determined by quantitative PCR. Blastocysts were harvested at
Day 7 and ICM and TE separated by magnetic activated cell sorting.
Data represent least-squares means + SEM of results from six
biological replicates. Open bars represent ICM and filled bars TE.
*-P<0.05.


Page 8 of 13






Ozawa et al. BMC Developmental Biology 2012, 12:33
http://www.biomedcentral.com/1471-213X/12/33


derived from the ICM [45]. While LIF cannot cause bo-
vine ICM cells to develop into stem cells [46], other
molecules that signal through the Jak-STAT pathway are
likely to be involved in regulation of the ICM. Several
genes related to cellular migration were upregulated in
ICM, as indicated by enrichment of the chemokine sig-
naling pathway (10 genes) and axon guidance (7 genes)
GO terms. In the mouse, blastomeres of the ICM can
change position, at least in part to align position with
subsequent formation of primitive endoderm [47-49].
Perhaps, movement is directed by guidance molecules
such as chemokines.
Outer cells of the mouse blastocyst are committed to-
wards the TE lineage through the actions of Yapl, Tead4,
Gata3, and Cdx2 ([3,4,7]. We found no difference in CDX2
expression between ICM and TE using deep sequencing
even though it is well established that the gene is expressed
to a greater extent in TE of the bovine [6,9,42] and CDX2
expression was higher in TE than ICM in the qPCR experi-
ment. CDX2 expression was very low in the deep sequen-
cing experiment, especially compared to that of POU5F1.
One possibility is that differences in CDX2 expression be-
tween TE and ICM at Day 7 (as detected by qPCR) become
reduced at Day 8. Like seen earlier [6], other homologues of
CDX2 were not detected (CDX1) or were nearly non-
detectable (CDX4) ( .i.1, .., i file 2).
Another gene involved in TE lineage, GATA3, was
expressed in higher amounts in TE. A similar but non-
significant difference in expression between ICM and TE
was noted earlier [42]. There was no significant differ-
ence in TEAD4 or YAP1 expression between ICM and
TE. Similar findings were observed in the bovine for
TEAD4 I] A gene involved in development of extra-
embryonic ectoderm in mice, ELFS [7], was overex-
pressed in TE whereas another gene involved in
development of extraembryonic membranes, EOMES,
was barely detectable. In fact, there appears to be an ab-
sence or very low expression of EOMES in TE between
day 7 and 15 of gestation in cattle [6]. In .i.i. ''..,. by
Day 11 of gestation, trophoblast expression of ELF5 is
,..i,!.-. .i and becomes limited to the *. i-1. i [50].
It is notable that several genes characteristically expressed
in ICM of mouse or human, DAB2, DSP, GM2A, SCD,
SSFA2, and VAV3, [30,32,37] were significantly overex-
pressed in the TE of the bovine while CDH24, reported to
be .i .. .1.. in the TE of the human [33], was expressed
in higher amounts in the ICM of the bovine. Dsp and Dab2
are indispensable for embryonic development in mice and
homologous recombination causes postimplantation em-
bryonic failure [51,52]. Clearly, as first shown by Berg et al.
[6], divergent evolution in the control of early embryonic
development means that study across a wide array of spe-
cies is required to understand developmental processes
fully.


By virtue of its position in the embryo, polarized morph-
ology [53] and tight junctions between its member cells
[1], the TE is fated to be the cell lineage through which
the blastocyst interacts directly with the mother in terms
of nutrient exchange, maternal-conceptus communication,
and placentation. It appears that executing these functions
places increased metabolic demands on the TE as com-
pared to the ICM as indicated by upregulation of genes
involved in metabolism, particularly those involved in lipid
metabolism. Lipid accumulation in cultured bovine
embryos is greater for TE than ICM, although the differ-
ence depends upon medium [54,55].
It is through the TE that nutrients enter the embryo
and from the TE that secretary products of the embryo
must enter the uterine environment. Consistent with a
role for the TE in uptake and delivery was upregulation
of genes involved in endo- or exocytosis and membrane
transport. Lysosomal-like structures have been reported
to be more abundant in TE than ICM in cattle, at least
for certain media [54,55], and the mouse [53].
Molecules involved in signaling to the mother that
were upregulated in TE include IFNTI, PAG2 and
TKDP1. The role for IFNT1 is to act on the maternal
endometrium to block luteolytic release of prostaglandin
F2, [39,56]. While this action is initiated later in preg-
nancy, between Day 15 and 17 of i -i;-. secretion of
IFNT occurs as early as the blastocyst stage [57]. TKDP1
is a member of the Kunitz family of serine proteinase
inhibitors and may function to limit trophoblast inva-
siveness in species like the cow with epitheliochorial pla-
centation [41]. Little is known about the role of PAG2,
which is the mostly abundantly expressed of at least 22
ri :. .... PAG L -.. [40]. Unlike some PAG genes
(the so-called "modern" clade), whose expression is lim-
ited to trophoblast giant cells formed later in develop-
ment, PAG2 is expressed widely in the cotyledonary
trophoblast and is predicted to be an active aspartic pro-
teinase [58].
IFNT1, PAG2 and TKDP1 are all genes that are
p:!; !,..-'.r_. :..!. restricted to ruminants. Another con-
ceptus product that is produced more widely in mam-
mals is estrogen. The role for embryonic estrogen is not
known for most species but blastocyst i i.. .. has been
suggested to be involved in hatching from the zona pel-
lucida in hamsters [59] and in concepts growth in the
pig [60]. The bovine blastocyst, too, produces estrogen
[61] and the i ii: ... of genes involved in terpenoid
backbone biosynthesis and steroid hormone biosynthesis
suggest that the primary source of blastocyst estrogens
is the TE.
1. II..- :!i blastocyst formation, the ruminant tropho-
blast undergoes a series of developmental steps that are
dependent on changes in cell shape and spatial position,
i"i... hatching (which requires actin-based


Page 9 of 13






Ozawa et al. BMC Developmental Biology 2012, 12:33
http://www.biomedcentral.com/1471-213X/12/33


trophectodermal projections [59]), elongation (which
leads to an increase in size of the concepts from about
0.16 mm at Day 8 to as much as 100 mm or more at
Day 16 [62]) and eventual attachment to the maternal
endometrium (commencing around Day 20 in the cow
[63]. The upregulation of genes in the trophoblast for
ontologies such as actin filament-based process, actin
cytoskeleton organization, cell projection and cytoskel-
etal arrangement reflects the extensive changes in cell
architecture required for these processes. In addition,
three cathepsin genes, CTSB, CTSH and CTSL2, were
upregulated in TE; these proteinases have been impli-
cated in blastocyst hatching [59,64].
Differences in gene expression between ICM and TE
are probably due in large part to differences in transcrip-
tion factor usage and to epigenetic modifications. Bind-
ing sites for the transcription factors PLAG1, RELA and
RREB1 were enriched for genes overexpressed in ICM
while I.,!!., sites for nine transcription factors (EGR1,
GABPA, KLF4, MYF, SP1, MZF1, NHLH1, PAX5 and
ZFX) were significantly enriched for TE. RELA is a sub-
unit for NFxB, which in turn has been implicated in dif-
ferentiation of trophoblast lineages from embryonic
stem cells [65] and in function of trophoblast giant cells
[66]. Several of the transcription factors associated with
genes upregulated in TE are involved in hematopoiesis,
.... Il.i,, EGR1 [67], GABPA .--] MZF1 [69], and ZFX
[70]. One of these transcriptional factors, GABPA, can
enhance PouSfl expression in mouse embryonic stem
cells [71] and another, KLF4, is a key regulator of main-
tenance and induction of pluripotency [72]. The .. .II
picture is one where hematopoiesis and sterness is
under positive .._ l:l;.... in the TE. Another transcrip-
tion factor associated with regulation of genes .i," "
lated in TE was SP1. This protein exerts several actions
to regulate trophoblast development and function, in-
cluding activation of expression of other transcription
factors such as Tfap2c [73] and Idl 1- In the cow, SP1
becomes limited to binucleate cells of the trophoblast by
Day 25 [75].
DNA methylation could be important for ,1l :i; ... of
gene expression in the blastocyst because the promoter
regions of over half of the genes that were n .i. .l1 it. 1 in
ICM or TE were .!:- i[*...:i as CpG positive. Indeed, the
percent of genes classified as CpG .-. *.;' for genes over-
expressed in ICM or TE was higher than the percent that
were classified as CpG positive for the entire bovine gen-
ome. Slightly fewer genes that were overexpressed in ICM
were classified as CpG-- ... *:.' than for genes that were
overexpressed in TE, which might suggest more inhibition
of gene expression by methylation in TE. It is noteworthy,
however, that Niemann et al. [76] did not find a correl-
ation between degree of CpG island methylation and
amount of embryonic expression for eight genes


examined. Recent evidence has been interpreted to signify
that it is not the methylation state of individual CpG that
determine gene expression but rather the methylation sta-
tus of large regions of DNA that span multiple genes [77].
In cattle, there are conflicting data as to whether
DNA methylation is less extensive for ICM or for TE
in both embryos produced in vitro and by somatic cell
nuclear transfer [7:. .1;] Another epigenetic mark,
H3K27me3, is similar for both cell types [81]. Of the
genes that were differentially regulated for ICM and
TE, three were genes involved in epigenetic modifica-
tion. Two were overexpressed in ICM: DNM2T1, involved
in maintenance of DNA methylation during succeeding
cell divisions [77], and KDM2B, a i;. 1 .. :.. histone
dimethylase which catalyzes demethylation of H3K4 and
H3K6 [82,83]. In contrast, a DNMT3A like sequence,
which establishes DNA methylation during development
and also participates in methylation maintenance [77],
was overexpressed in TE. The presence of increased tran-
script abundance for DNMT3A could be interpreted to
mean that de novo DNA methylation occurs to a greater
degree in TE, as is indicated by studies with embryos
produced in vitro [79] and by somatic cell nuclear clon-
ing [80]. Further research is necessary to determine dif-
ferences in DNA methylation between TE and ICM at
the gene-specific and genome-wide level.
In general, analysis of a separate set of isolated ICM
and TE by qPCR confirmed the results obtained for dif-
ferences between cell types by deep sequencing. The ex-
ception was for CDX2, where there was no i,1i. .- in
expression as determined by SOLID sequencing but
where expression was greater for TE than ICM as deter-
mined by qPCR. The discrepancy could reflect either
day of ni 1,i .... ,::;i ..... (as discussed earlier) or,
given the often-repeated observation that CDX2 is
expressed to a greater extent in TE than ICM [6,9,-i2]
an error induced by the deep sequencing procedure.
In conclusion, differentiation of blastomeres of the
morula-stage embryo into the ICM and TE of the blasto-
cyst is accompanied by .: i:r...-. between the two cell
lineages in expression of genes i ,.... H.,ll. metabolic
processes, endocytosis, hatching from the zona pellu-
cida, paracrine and endocrine signaling with the mother,
and genes supporting the changes in cellular architec-
ture, stemness, and hematopoiesis necessary for develop-
ment of the trophoblast. Much of the process leading to
this first i,!. .. ii, .t,. ... event seems to be under the
control of genes such as NANOG and GATA3 that play
central role in lineage commitment in the mouse. As
found by others also [i- i '1. there are fundamental .h,. .-
ences from the mouse. Understanding the nature of the
process of preimplantation development in mammals
will necessarily require a comparative approach based
on study of a variety of animal models.


Page 10 of 13








Ozawa et al. BMC Developmental Biology 2012, 12:33
http://www.biomedcentral.com/1471-213X/12/33


Conclusions
Analysis of gene expression indicated that differentiation
of blastomeres of the morula-stage embryo into the ICM
and TE of the blastocyst is accompanied by nII 1.. i. .
between the two cell i .- :.-. in expression of genes con-
trolling metabolic processes, endocytosis, hatching from
the zona I. IlI, ..: i paracrine and endocrine signaling
with the mother, and genes supporting the changes in
cellular architecture, sternness, and hematopoiesis neces-
sary for development of the trophoblast.


Additional files


Additional file 1: Formulas used for enrichment analysis for
transcription factor binding sites.
Additional file 2: Differences in gene expression between ICM and
TE. Genes in which the adjusted P vaue was <005 are color coded (blue
are upregulated in ICM and red are upregu ated in TE)
Additional file 3: KEGG metabolic pathway map in which pathways
that were differentially enriched between ICM (blue) and TE (red)
were identified using iPath2.0.
Additional file 4: Heatmap constructed by k-mean clustering of the
870 genes that differ in expression between ICM and TE. The colors
in the map display the creative standing of tee reads count data; blue
indicates a count value that is lower than the mean value of the row
wh:le red :nd:cates higher than the mean The shades of the color
indicate how far away the data from the mean value of the row
Columns represent individual samples of ICM (C) and TE (TC)
Additional file 5: Differences in expression between inner cell mass
(ICM) and trophectoderm (TE) for genes considered as being
characteristically expressed by ICM and TE in human or mouse.


Abbreviations
DAVID Database for annotation, visualization and integrated discovery;
GO Gene ontology; KEGG Kyoto encyclopedia of genes and genomes;
ICM Inner cell mass; SSE Sum of squares error; TFBS Transcription factor
binding sites; TE Trophectoderm

Competing interests
The authors have declared that no competing interests exist


Author contributions
Conceived and designed the experiments' MO, PJ' WGF Pe'
experiments' MO, SS, KBD, MjS Analyzed Ihe data' MO, MS, J
KN, PJl Wrote initial drafts of the paper MO PJi All author
approved the final manuscript


formed the
QY, RY, SVW
read and


Acknowledgments
This work was supported by Agriculture and Food Research Initiative Grant
Nos 2009-65203-05732 and 2011-67015-30688 from United States Dept of
Agiculture National Institute of Food and Agriculture and by a grant from
the Research Opportunity Fund, University of Florida Research Foundation
[he atulhors thank Wi lham Rembeit, for co lecling occyles, the Chernin
family and Central Packing (Center il, Florida), for donating ovarian tissue
and Scott Randell o Southeastern Semen ( eliborn Florida), for donating
semen

Author details
Department of Animal Sciences and D H Barron Reproductive and Perinata
Biology Research Program, PO Box 110910, Gainesville, FL 32611 0910, USA
interdisciplinary Center for Biotechnology Research, University of Florida,
Gainesville, FL 32611-0910, USA Kyushu-Okinawa Agricultura Research
Center, National Agriculture and Food Research Organization, Kumamoto,
Japan 4Laboratory of Developmental Genetics, Institute of Medical Science,
University of Tokyo, Tokyo, Japan sHuman Genome Center, Institute of


Medical Science, University of Tokyo, Tokyo, Japan "Departamento de
Reproducao Animal e Radiologia Veterindria, Faculdade de Medicina
Veterindria e Zootecnia, UNESP, Botucatu, Sao Paulo, Brasi

Received: 6 June 2012 Accepted: 30 October 2012
Published: 6 November 2012


References
SEckert J I:leming P Tight junction biogenesis during early
development. B Bii iophys Acta 2008, 1778:717-728
2 Marikawa Y, Alarcon VB Establishment of trophectoderm and inner cell
mass lineages in the mouse embryo. Mol Reprod Dev 2009, 76:1019-1032
3 Zernicka Goetz M, Morris SA, Bruce AW' Making a firm decision:
multifaceted regulation of cell fate in the early mouse embryo. Nature
Rev 200, 10:467-477
4 Rossant J, Tar PPL' Blastocyst lineage formation, early embryonic
asymmetries and axis patterning in the mouse. Development 2009
136:701-713
S Plachta N, Bollenbach T, Pease 5, Fraser SE, Pantazis P Oct4 kinetics predict
cell lineage patterning in the early mammalian embryo. Nat Cell Bio!
2011, 13:117-123
6 Berg DK, Smith CS, Pearton DI, Wells DN, Broadhurst R, Donnison ,
Pfeffer PL Trophectoderm lineage determination in cattle. Dev Ceil
2011, 20:244-255
7 Chen I, Wang D, Wu Z, Ma I, Daley GQ Molecular basis of the first cell
fate determination in mouse embryogenesis. Cel; Res 2010, 20:982-993
8 Gasperowicz M, Natale DR Establishing three blastocyst lineages-then
what? Bio! Rep'od 2011, 84:621-630
9 Ozawa M, Hansen PJ' A novel method for purification of inner cell mass
and trophectoderm cells from blastocysts using magnetic activated cell
sorting. Ferti! 5tei! 2011, 95:799-802
10 Loureiro B, Bonilla L, Block J, Fear JM, Bonilla AQS, I ansen PJ Colony-
stimulating factor 2 (CSF-2) improves development and posttransfer
survival of bovine embryos produced in vitro. Endocrinology 2009,
150:5046-5054
11 Fields SD, Hansen Pi, Ealy AD Fibroblast growth factor requirement for
in vitro development of bovine embryos. 2011, 75:1466-1475
12 Zhang 1, Chiodini R, Badr A, Zhang G The impact of next-generation
sequencing on genomics. J Genet Genom 2011, 38:95-109
13 Trapnell C, Pachter L, Salzberg SL TopHat: Discovering splice junctions
with RNA-Seq. Bioinformatics 2009, 25:1105-1 111
14 Langmead B, Trapnell C, Pop M, Salzberg SL Ultrafast and memory-
efficient alignment of short DNA sequences to the human genome.
Genome Bio 2009, 10:R25
15 Homer N, Merriman B, Nelson S BFAST: An alignment tool for large scale
genome resequencing. FLo5 One 2009, 4:e7767
16 Anders S, Huber W Differential expression analysis for sequence count
data. Genome Biol 20 0, 11 :R106
17 Huang DW, Sherman BT, Lempicki RA Bioinformatics enrichment tools:
paths toward the comprehensive functional analysis of large gene lists.
Nucleic Arids Re 2009, 37:1-13
18 Yamada T, Letunic I, Okuda S, Kanehisa M, Bork P iPath2.0: interactive
pathway explorer. NucAdds Res 2011, 39:W412-W415
19 iang ZhSang Xiang Z, He N Expression profile of cuticular genes of
silkworm Bombyx mori. BMC Genor 2010, 11:173
20 Dash R, Mishra D, RaPh AK Acharya M' A hybridized K-means clustering
approach for high dimensional dataset. Int Eng Sci Tech 2011, 2:59-66
21 Wasserman WW, Sandelin A Applied bioinformatics for the identification
of regulatory elements. Not Rev Gene; 2004, 5:276-287
22 Portales-Casamar E, Thongjuea S, Kwon AT, Arenillas D, Zhao X, et a'
JASPAR 2010: the greatly expanded open-access database of
transcription factor binding profiles. Nul Acids Res 2010, 38:D105-D110
23 Wingender E The TRANSFAC project as an example of framework
technology that supports the analysis of genomic regulation. Brief
Bioinform 2008, 9:326-332
24 GardinerGarden M, Frommer M' CpG islands in vertebrate genomes.
J Mot Biol 1987, 196:261-282
25 Hou Y Bickharl DM, Hvinden ML, Li C, Song Boichard DA, Fritz S, Eggen
A, Denise S, Wiggans GR, Sonstegard TS, Van Tassell CP, Liu GE Fine
mapping of copy number variations on two cattle genome assemblies
using high density SNP array. BMC Genomics 2012, 13:376


Page 11 of 13








Ozawa et al. BMC Developmental Biology 2012, 12:33
http://www.biomedcentral.com/1471-213X/12/33


26 Smith CS, Berg DK, Berg M, Pfeffer PL' Nuclear transfer-specific defects are
not apparent during the second week of embryogenesis in cattle. Cell
Reprogram 2010, 12:699-707
27 Ozawa M, Sakatani M, Hankowski KE, Terada N, Dobbs KB, Hansen PJ'
Importance of culture conditions during the morula-to-blastocyst period
on capacity of inner cell-mass cells of bovine blastocysts for
establishment of self-renewing pluripotent cells. Theriogenology 2012,
78:1243-1251
28 Goossens K, Van Poucke M, Van Som A, Vandesompele Van Zeveren A,
Peelman LJ Selection of reference genes for quantitative real-time PCR
in bovine preimplantation embryos. BMC Dev Sio 2005, 5:27
29 Hamatani T, Daikoku T, Wang 1i, Matsumoto H, Carter MG, Ko MS, Dey SK
Global gene expression analysis identifies molecular pathways
distinguishing blastocyst dormancy and activation. Proc NotiAcod Sci USA
2004, 101:10326-10331
30 Saitou M, YabuLa Y, Kurimoto K' Single-cell cDNA high-density
oligonucleotide microarray analysis: detection of individual cell types
and properties in complex biological processes. Reprod Biorred Online
2008, 16:26-40
31 Tesar FJ, Chenoweth JG, Brook FA, Davies IJ, Evans EP, et a' New cell lines
from mouse epiblast share defining features with human embryonic
stem cells. Nature 2007, 448:196-199
32 Chou Y F, Chen H H, Elpte M, Yabuuchi A, Chenoweth JG, et Ca The growth
factor environment defines distinct pluripotent ground states in novel
blastocyst-derived stem cells. Cel 2008, 135:449-461
33 Adjaye J, Hunriss J, Herwig R, BenKahla A, Brink TC, et al Primary
differentiation in the human blastocyst: comparative molecular portraits of
inner cell mass and trophectoderm cells. Stem Cels 2005, 23:151'-1525
34 Edwards RG, I ansis C Initial differentiation of blastomeres in 4-cell
human embryos and its significance for early embryogenesis and
implantation. Reprod Biored Onine 2005, 11:206-218
I5 Kimber SJ, Sneddon S, Bloor DJ, EI-Bareg AM, Havvkhead JA, et al
Expression of genes involved in early cell fate decisions in human
embryos and their regulation by growth factors. Reproduction 2008'
135:635-647
36 Cauffman G, De Fycke M, Sermon K, Liebaers I, Van de Velde H' Markers
that define stemness in ESC are unable to identify the totipotent cells in
human preimplantation embryos. Hum Reprod 2009, 24:63-,70
37 Reiio Pera RA, DeJonge C, Bossert N, Yao M, Hwa Yang JY, Asadi NB, Wong
W, Wong C Firpo MT Gene expression profiles of human inner cell mass
cells and embryonic stem cells. DiffBentiation 2009, 78:18-23
38 Galan A, Simon C Monitoring stemness in long-term hESC cultures by
real-time PCR. Methods Moo! Bio 2010, 584:135-150
39 Roberts RM, Chen Y, Ezashi 7, Walker AM Interferons and the maternal-
conceptus dialog in mammals. ernin Cel Dev Bio! 2008, 19:170-177
40 elugu BP, Walker AM, Greein JA Characterization of the bovine
pregnancy-associated glycoprotein gene family-analysis of gene
sequences, regulatory regions within the promoter and expression of
selected genes. BMC Genom 2009, 10:185
41 Chakrabary A, 2nd MacLean JA, I ughes AL, Roberts RM, Green JA Rapid
evolution of the trophoblast kunitz domain proteins (TKDPs)-a
multigene family in ruminant ungulates. J M'ol Evo'2006, 63:274-282
42 Fujii T, Moriyasu S, Hirayama H, Hashizume T, Sawai K Aberrant expression
patterns of genes involved in segregation of inner cell mass and
trophectoderm lineages in bovine embryos derived from somatic cell
nuclear transfer. Cell Reprogram 2010, 12:617-625
43 Dnver AM, PFtragaricano F, Huang W, Ahmad KR, Hackbart KS, WilFbank MC,
Khatib F RNA-Seq analysis uncovers transcriptomic variations between
morphologically similar in vivo- and in vitro-derived bovine blastocysts.
BMC Genomics 2012, 13:118
44 Giritharan G, Delle Piane L, Donjacour A, Esteban FJ, Ilorcajadas JA, Maltepe
E, Rinauido P In vitro culture of mouse embryos reduces differential gene
expression between inner cell mass and trophectoderm. Reprod Sd 201i2,
19:243-252
45 Smith AG, Nichols i, Robertson M, Fathjen PD Differentiation inhibiting
activity (DIA/LIF) and mouse development. Dev Bio 1992, 151:339-351
46 Cao S, Wang F, Chen Z, Liu Z, Mei C, et al Isolation and culture of primary
bovine embryonic stem cell colonies by a novel method. J Exp Zooi A
Ecol Genet Physio/ 2009, 311:368-376
47 Meilhac SM, Adams RJ, Morris SA, Danckaert A, le Garrec JF, Zernicka
Goetz M Active cell movements coupled to positional induction are


involved in lineage segregation in the mouse blastocyst. Dev Bioi 2009,
331:210-221
48 Morris SA, Teo RT Li H, Robson P, Glover DM, Zernicka-Goe:z M Origin and
formation of the first two distinct cell types of the inner cell mass in the
mouse embryo. Proc Nati Accd Sc USA 2010, 107:6364-6369
49 Yamanaka Y, Lanner F, Rossant J' FGF signal-dependent segregation of
primitive endoderm and epiblast in the mouse blastocyst. Development
2010 137:715-724
50 Pearton DJ, Broadhurst R, Donnison M, Pfeffer PL Elf5 regulation in the
trophectoderm. Dev Biol 2011, 360:343-350
51 Vasioukhin V, Bowers E, Bauer C, Degenstein L, Fuchs E
Desmoplakin is essential in epidermal sheet formation. Not Ceil
Biol 2011, 3:1076-1085
52 Morris SM, Iallquist MD, Rock CO, Cooper JA Dual roles for the Dab2
adaptor protein in embryonic development and kidney transport. EMB
'2002,21:1555-1564
53 Flering IP, Warren PD, Chishoi l JC, Johnson MH' Trophectodermal
processes regulate the expression of totipotency within the inner cell
mass of the mouse expanding blastocyst. J Embryo! Exp Mopho 1984,
84:63-90
54 Abe H, Otoi T, Tachikawa S, Yamashita S, Satoh T, TIoshi I Fine structure of
bovine morulae and blastocysts in vivo and in vitro. Anot Embry/ 1999,
199:519-527
55 Abe i, Yamashita S, Iloh T, Satoh T, I oshi I Ultrastructure of bovine
embryos developed from in vitro-matured and -fertilized oocytes:
comparative morphological evaluation of embryos cultured either in
serum-free medium or in serum-supplemented medium. Mol Reprod Dev
199, 53:325-335
56 Bazer FW, Burghardt RC, Johnson GA, Spencer IE, Wu G Interferons and
progesterone for establishment and maintenance of pregnancy:
interactions among novel cell signaling pathways. Reprod Bio 2008,
8:179-2 1
57 de Moraes AA, Davidson JA, Fleming JG, Bazer FW, Edwards JL, et al Lack
of effect of granulocyte-macrophage colony-stimulating factor on
secretion of interferon-T, other proteins, and prostaglandin E2 by the
bovine and ovine concepts. Domest Anim Endocrinoi 1997, 14:193-197
58 Green jA, Xie S, Roberts RM Pepsin-related molecules secreted by
trophoblast. Rev Reprod 1998, 3:62-69
59 Seshagiri PB, Sen Roy S, Sireesha G, Rao RPI Cellular and molecular
regulation of mammalian blastocyst hatching. i Reprod imunol 2009,
83:79-84
60 Blomberg L, Hashizume K Viebahn C Blastocyst elongation, trophoblastic
differentiation, and embryonic pattern formation. Reproduction 2008,
135:181- 95
61 Gadsby JE, Heap RB, Burton RD Oestrogen production by blastocyst
and early embryonic tissue of various species. J Repnod Fertil 1980,
60:409-417
62 Betteridge KJ, Flechon J-E The anatomy and physiology of pre-
attachment bovine embryos. Theriogenology 1988, 29:155-187
63 King GJ, Atkinson BA, Robertson HA Development of the
intercaruncular areas during early gestation and establishment of the
bovine placenta. J Reprod Feril 1981, 61:469-474
64 Balboula AZ, Yamanaka K Sakatani M, Hegab AO, Zaabel SM, Takahashi Mr
Intracellular cathepsin B activity is inversely correlated with the quality
and developmental competence of bovine preimplantation embryos.
Mo; Reprod Dev 2010, 77:103 -1039
65 Marchand M, Hcrcajadas JA, Esteban Fi, McEIroy SI, Fisher SJ, Giudice IC
Transcriptomic signature of trophoblast differentiation in a human
embryonic stem cell model. Boi Reprod 2011, 84: 258-:271
66 Muggia A, Teesalu T, Neri A, Blasi F, Talarico D Trophoblast giant cells
express NF-KB2 during early mouse development. Dev Genet 1999,
25:23-30
67 Wilson A, Laurenti E, rumpp A Balancing dormant and self-renewing
hematopoietic stem cells. Curr Opin Genet Dev 2009, 19:461-368
68 Yu S, Cul K, Johi R, Zhao DM, Jing X, et al GABP controls a critical
transcription regulatory module that is essential for maintenance and
differentiation of hematopoietic stem/progenitor cells. Biood 2011,
117:2166-2178
69 Hiromas R, Davis B, Rauscher FJ 3rd, Klemsz M, Tenen D, et o!
Hematopoietic transcriptional regulation by the myeloid zinc finger
gene, MZF-1. Curr Top Microbiol irmuni 1996, 211: 59-164


Page 12 of 13








Ozawa et al. BMC Developmental Biology 2012, 12:33 Page 13 of 13
http://www.biomedcentral.com/1471-213X/12/33





70 Galan-Caridad JM, Harel 5, Arenzana TL, Hou ZE, Doetsch FK, et ao Zfx
controls the self-renewal of embryonic and hematopoietic stem cells.
Cell 2007, 129:345-357
71 Kinoshita K, Ura H, Akagi T, Usuda M, Koide H, Yokota T GABPa regulates
Oct-3/4 expression in mouse embryonic stem cells. Biochem Biophys Res
Commun 2007, 353:686-691
72 Papp B, Plath K Reprogramming to pluripotency: stepwise resetting of
the epigenetic landscape. Cell Res 2011, 21:486-501
73 Li M, Kellems RE Spl and Sp3 Are important regulators of AP-2y gene
transcription. Bio Reprod 2003, 69:1220-1230
74 Takeda T, Sakata M, Isobe A, Yamamoto T, Nishimoto F, et al Involvement
of Sp-1 in the regulation of the Id-1 gene during trophoblast cell
differentiation. Placenta 2007, 28:192-198
75 Degrelle SA, Murthi P, Evain-Brion D, Fournier T, Hue I Expression and
localization of DLX3, PPARG and SP1 in bovine trophoblast during
binucleated cell differentiation. Placenta 2011, 32:917-920
76 Niemann H, Carnwath JW, Herrmann D, Wieczorek G, Lemme E, et al DNA
methylation patterns reflect epigenetic reprogramming in bovine
embryos. Cell Reprogram 2010, 12:33-42
77 Jurkowska RZ, Jurkowski TP, Jeltsch A Structure and function of
mammalian DNA methyltransferases. ChemBioChem 2011, 12:206-222
78 Dean W, Santos F, Stojkovic M, Zakhartchenko V, Walter J, et al
Conservation of methylation reprogramming in mammalian
development: aberrant reprogramming in cloned embryos. Proc Nat/
Acad Sd USA 2011, 98:13734-13738
79 Hou J, Liu L, Lei T, Cui X, An X, Chen Y Genomic DNA methylation
patterns in bovine preimplantation embryos derived from in vitro
fertilization. Sc China C Life Sci 2007, 50:56-61
80 Kang YK, Park JS, Koo DB, Choi YH, Kim SU, et ao Limited demethylation
leaves mosaic-type methylation states in cloned bovine pre-implantation
embryos. EMBO J 2002, 21:1092-1100
81 Ross PJ, Ragina NP, Rodriguez RM, lager AE, Siripattarapravat K, et al
Polycomb gene expression and histone H3 lysine 27 trimethylation
changes during bovine preimplantation development. Reproduction 2008,
136:777-785
82 Tsukada Y, Fang J, Erdjument-Bromage H, Warren ME, Borchers CH, et ao
Histone demethylation by a family of JmjC domain-containing proteins.
Nature 2006, 439:811-816
83 Frescas D, Guardavaccaro D, Bassermann F, Koyama-Nasu R, Pagano M
JHDM1B/FBXL10 is a nucleolar protein that represses transcription of
ribosomal RNA genes. Nature 2007, 450:309-313

doi:10.1186/1471-213X-12-33
Cite this article as: Ozawa et ai Global gene expression of the inner cell
mass and trophectoderm of the bovine blastocyst. BMC Developmental
Biology 2012 12'33


Submit your next manuscript to BioMed Central
and take full advantage of:

* Convenient online submission
* Thorough peer review
* No space constraints or color figure charges
* Immediate publication on acceptance
* Inclusion in PubMed, CAS, Scopus and Google Scholar
* Research which is freely available for redistribution

Submit your manuscript at
www.biomedcentral.com/submit 0 BiOIIoMed Central







Formula 1: Position-specific weight matrix (PSWM) scores


score =


log((nf +l)(N,+4)*(1/4))
i=1


where /: length of the matrix; ni,: the observed number of base 'f (A, C, G or T) at the i-
th position in the training; N1: sum of the observed number of all bases at i-th position.


Formula 2: Ratio of the score to the maximum score


ratio =


score min(score)

max(score) min(score)


where min(score): minimum value of each PSWM, max(score): maximum value of each
PSWM.
Formula 3: Hypergeometric distribution


Np

x=i


(Np N(1-p)

x n-x

N

x)


where N: total number of promoters, p: expected frequency of the promoters associated
with a given PSWM (number of associated promoters/N), n: total number of promoters
belonging to a dataset of concern and i : number of the promoters associated with a
given PSWM in a dataset.





O-Mannosyl glycan
biosynthesis


N -Glycan
biosynthesis f


[GIEanBiosyntesi
andMitiIbism U I I


Glycosphingolipid
biosynthesis -
lact and neolacto series
[B] Glycosyltransferases


[B] Proteoglycans


Other glycan
degradation


- w -


Glycosphingolipid
biosynthesis -
lWigl ioseries


- a -b


Arachidonic acid
metabolism


G
bi
k(


cosamir
synthesis
ratan sul


",- =


-)fl


High-mannose type
N-glycan biosynthesis


O-Glycan
biosynthesis


U


-~ U


I

c-an


Glycosamino
degradation


alpha-Linolenic acid
metabolism


-- 1L


-p_ I


Glycebrophospholipid
metabolism


Linoleic acid
metabolism


Phenylpropanoid
biosynthesis


LB] Phytochemical
Compounds


Isoflavonoid
biosynthesis


Flavonoid
biosynthesis


[B] Lipids


Biosynthesis of
unsaturated fatty acids


Carotenoid
biosynthesis


Retinol
metabolism


Flavone and
flavonol
biosynthesis


Anthocyanin
biosynthesis


Limonene and
pinene degradation

Monoterpenoid
biosynthesis

Sesquiterpenoid
biosynthesis






Insect hormone
biosynthesis







Diterpenoid
biosynthesis


M e ta ismI Iof I
Terenidsan PoyktS


Zeatin
biosynthesis


Fatty acid
biosynthesis


Lipoic acid
metabolism


Terpenoid backbone
biosynthesis


Glycerolipid
metabolism


Sphingolipid
metabolism


Fatty acid
metabolism


Ether lipid
metabolism


i-


Lipopolysaccharide
biosynthesis


Glycosaminoglycan
biosynthesis -
chondroitin sulfate


Glycosaminoglycan
biosynthesis -
heparan sulfate


/ Il-lllI


/- Stare


f mcEt~un4:m


- U rn-


Butirosin and
neomycin biosynthesis


Streptomycin
biosynthesis


Biosynthesis of
ansamycins


and sucrose
-I:-


l


sylphosphatidylin ol
-anchor biosynt i


-1i--


Aminc
nucle(
metal


U -


- I


Fructose and
mannose metabolism


sugar and
tide sugar
olism


2


.ab S.t
-Mt m


IIusLU fpi ubphate
mpe-a hnl sm


Peptidc
biosynl


Biosyntl
polyket


Biosynthesis of
polyketide bad


I Butanoate


glycan
esis


iesis of
le prod


Polyketide sugar
unit biosynthesis


Penl
inte


Im o


K


pe II
I-C


Pentose ph
metabolis


3sphate


ose and glucur
conversions


Puromycin
biosynthesis


Purine metabolisnr


r


;corbate and
darate metabolirh


)nate


Biosynthesis of 12-, 14- and
16-membered macrolides


U


jvate
:abolism


type II
:bone


:ty a


Tetrachloroethene degradation


Reductive
carboxylate cycle


Caprolactam
degradation


FSteroid biosynthesis


Photosynthesis -
antenna proteins


Photosy r~


0- I FN


I


cIz


Sulfur
metabolism


Biosynthesis of
siderophore group
nonribosomal
peptides


Phosphonate and
phosphinate metabolism
D-Alanine
_metabolism


oiy iine1,Il s 1ii i~
threonine metal


i


Selendamin
meta lo ism


acid


PropanoatI
metabolism




5-Bra Iched
basic _


S meaool
voaAl


Ism


Synthesis anl
degradation
Ketone bodies


till-'_ _


m U


i


Glycosphingolipid
biosynthesis -
globoseries


r


0 ,.-


I


r ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^


i


-----------
.0.0


-AV


i-i


--I


C


1L -- ^^


/


i


-


:J


-L





Color Key


r _m
C) 0


CM
o a a
I- I- I-


-2 -1 0 1 2
Row Z-Score











Additional File 4. Differences in expression between inner cell mass (ICM) and trophectoderm (TE) for genes considered as being
characteristically expressed by ICM, embryonic stem cells and TE in human or mouse. a


Genes Considered Characteristic of ICM or embryonic stem cells


ACOT9 AMDI ARHGER18 BXL2LI4 CANX CCNBI
DSP E124 EIFIAX EIF2SI EIF5B EPRS
GATADI GJCI GLTSCR2 GM2A GPDIL H19
ITGA5 ITGA6 JAK2 JUNB KDM2B KLF2


CDCA2 CENPF CLDN7 CYP2S1 DAB2 DDX3X
FGFR2 FGFR3 FLG FOXD3 FOXH1 GATA2
HMGBI HNI HSD17B11 IFITM2 IGF2R IL17RA
KTN1 LAMC1 LAMP2 LEFTY1 LRPAP MAP3K3


MRPL15 MTCH2 MUC15 MYC NANOG NANOSI NODAL OTX2 PAX8 PDPN
POU2FI POU5FI PPARD PTP4AI PTTGIlP PUMI PUM2 PYGB RAB12 PYGB
RELL1 RHPN2 RPL14 RPL19 RPL32 RPL7A RUNXI SALL4 SBNO1 SCD


PEG3 PEX3
RAB12 RAB5C
SIN3B SLIT3


SMAD2 SMAD4 SMAD5 SNX3 SOX2 SPATA13 SPETA5LI SPIC SRRM1 SSFA2 STAG2 STAT3 TACCI
TALl TAXBPI TFRC" TGFBRI TGFBR3 TMED2 TOP2A TPRKB TRNAU1 VAV3 XIST ZBTB34 ZC3HAV1
AP
ZFP42 ZNF296


Genes Considered Characteristic of TE


AQP11 ARNT2 ASCL2 ATPIB3 BMP4 CDH19 CDH22 CDH24 CDXI CDX2 CELSR2 CGB CGBI
CGB2 CGN d CLDNIO CLDN2 CSNKIA I CYP11A DAAMI DSC2 ELF5 EOMES ESRRB FGFR2 GCMI

HAND HLA-G HSD3B1 IFNT1 ID2 IRX3 JAM2 KRTI KRT18 LEP LHCGR MSX2 OCLN
PAG2 PCDHI PCDHB7 PSG3 SFN TBXI TEAD2 TEAD4 TKDP1 TJP2


a Genes in blue were upregulated in ICM and genes in red were upregulated in TE. The adjusted P value was <0.05 unless indicated by
superscripts
b adjusted P=0.05

Adjusted P=0.06.
d adjusted P=0.09.


ABL2
DNMT3L
GATA3
IL6Rb

MORCI
PLKI
RAB6A




Full Text

PAGE 1

geneID baseMean baseMean ICM baseMean TE foldChange padj ENSBTAG00000021119 1508.26401 2594.10642 422.4215999 0.162838963 2.05E-13 ENSBTAG00000030483 798.4582506 1363.581842 233.3346588 0.171118925 3.81E-12 ENSBTAG00000007244 18092.01281 29960.0067 6224.018917 0.207744243 1.06E-10 ENSBTAG00000020916 1817.824827 3014.763705 620.8859497 0.205948462 2.66E-10 ENSBTAG00000012128 1650.642549 522.9400706 2778.345026 5.312931983 6.24E-10 ENSBTAG00000032515 823.8189354 228.5604516 1419.077419 6.20876188 9.37E-10 ENSBTAG00000016365 337.0923087 69.31659658 604.8680209 8.72616445 9.37E-10 614942 134.6079711 238.0037257 31.21221649 0.131141714 2.38E-09 ENSBTAG00000036102 680.4244441 194.5441081 1166.30478 5.995066061 4.48E-09 504995 20.91016838 39.45453375 2.365803014 0.059962767 5.24E-09 ENSBTAG00000011338 748.6983951 1233.080387 264.3164031 0.214354559 5.24E-09 514291 343.1586149 556.6606816 129.6565481 0.232918459 1.02E-08 514712 4128.200215 1442.985789 6813.414642 4.721747569 2.15E-08 ENSBTAG00000009786 850.5637888 297.9115112 1403.216066 4.710177398 4.39E-08 ENSBTAG00000012116 1712.018916 2701.007051 723.0307814 0.267689335 1.09E-07 ENSBTAG00000027701 47.18350247 85.57191708 8.795087862 0.102780073 1.30E-07 ENSBTAG00000017869 643.4191798 1048.326128 238.5122319 0.227517206 1.30E-07 100298064 2757.019872 1132.127023 4381.912722 3.870513319 1.97E-07 ENSBTAG00000039035 143.5133294 240.0048347 47.02182404 0.19592032 2.27E-07 ENSBTAG00000018227 3200.164197 5054.563925 1345.764469 0.266247393 2.83E-07 ENSBTAG00000019125 5402.120385 2158.194138 8646.046631 4.006148695 2.93E-07 ENSBTAG00000039866 1883.883119 700.2958882 3067.47035 4.38024898 2.93E-07 ENSBTAG00000036028 478.6710438 169.2699689 788.0721188 4.655711371 2.93E-07 ENSBTAG00000037728 988.3905463 345.3485089 1631.432584 4.724018033 3.85E-07 ENSBTAG00000000271 748.9626389 1183.323921 314.6013564 0.265862416 4.58E-07 ENSBTAG00000023429 12115.77995 5159.185362 19072.37454 3.696780247 6.49E-07 100337021 11432.40922 4631.82093 18232.99751 3.93646425 6.49E-07 ENSBTAG00000014127 66072.53829 26203.4202 105941.6564 4.043046883 6.49E-07 ENSBTAG00000020491 47.88254689 85.28448303 10.48061075 0.122890007 8.07E-07 ENSBTAG00000015177 19626.13406 8197.388577 31054.87954 3.788386905 8.07E-07 282066 9697.145618 4091.76914 15302.5221 3.739830272 8.58E-07 ENSBTAG00000011954 3513.959667 1425.939227 5601.980107 3.928624726 8.58E-07 ENSBTAG00000006326 842.122299 272.1259159 1412.118682 5.189210581 8.58E-07 ENSBTAG00000000183 18.63160151 35.22213105 2.041071981 0.057948566 1.05E-06 ENSBTAG00000001545 14755.68465 5944.237661 23567.13164 3.964702117 1.15E-06 ENSBTAG00000037651 2176.63269 855.970481 3497.294899 4.085765778 1.22E-06 ENSBTAG00000006439 62.96350151 109.466174 16.46082899 0.150373658 2.09E-06 ENSBTAG00000017468 7055.772448 3352.339586 10759.20531 3.209461641 2.15E-06 504813 195.0069642 56.11737041 333.896558 5.949967996 2.62E-06 ENSBTAG00000002326 3602.748606 1494.599135 5710.898077 3.821023273 2.64E-06 ENSBTAG00000004555 21220.70339 8879.039108 33562.36767 3.779954932 2.68E-06 ENSBTAG00000000133 740.5988568 1156.847461 324.3502525 0.280374261 3.27E-06 ENSBTAG00000017100 2088.036621 941.6993036 3234.373939 3.434614347 3.76E-06 ENSBTAG00000012757 2154.863875 905.1475651 3404.580184 3.761353745 3.76E-06 ENSBTAG00000012201 141.6025617 37.25960626 245.9455171 6.600861945 3.86E-06 ENSBTAG00000011700 1105.376803 441.4194605 1769.334145 4.008283057 4.47E-06 ENSBTAG00000003751 46.56838652 8.451358432 84.68541462 10.02033168 4.50E-06 ENSBTAG00000038079 2074.01382 879.4438253 3268.583815 3.716648773 4.56E-06 ENSBTAG00000019315 288.9497985 468.8531828 109.0464142 0.232581154 4.95E-06 100138989 67.33300481 114.6144976 20.051512 0.174947432 4.96E-06 100139725 400.8011984 637.9072024 163.6951943 0.256612864 4.96E-06

PAGE 2

ENSBTAG00000011156 1474.561312 613.6658631 2335.45676 3.805746581 5.03E-06 ENSBTAG00000015007 1536.42214 616.2554742 2456.588805 3.986315591 5.27E-06 ENSBTAG00000009770 2198.473489 995.0510359 3401.895943 3.418815538 5.58E-06 ENSBTAG00000013641 531.2024533 835.3600084 227.0448982 0.271792875 6.62E-06 ENSBTAG00000014614 198.1639757 57.38999464 338.9379567 5.9058719 6.62E-06 ENSBTAG00000010153 2929.977623 1380.007505 4479.947741 3.246321289 6.89E-06 ENSBTAG00000007148 92.27268933 21.8392409 162.7061378 7.450173682 8.31E-06 ENSBTAG00000022449 345.1008561 538.4964268 151.7052854 0.281720134 8.97E-06 ENSBTAG00000003319 380.1805436 604.75078 155.6103072 0.257313115 9.00E-06 ENSBTAG00000001835 259.1032208 414.4802254 103.7262163 0.250256128 9.58E-06 ENSBTAG00000006769 491.6919312 183.5938093 799.7900531 4.356301862 9.87E-06 ENSBTAG00000000720 5040.550319 2327.629276 7753.471362 3.331059392 1.06E-05 100298605 55.17264451 88.63340197 21.71188705 0.244962808 1.12E-05 ENSBTAG00000000205 2905.200798 4405.722721 1404.678875 0.318830522 1.14E-05 ENSBTAG00000027655 238.1492002 385.5612228 90.73717754 0.235337923 1.15E-05 ENSBTAG00000018214 1195.594396 540.1191437 1851.069648 3.427150602 1.15E-05 ENSBTAG00000000874 1004.470513 419.1059389 1589.835087 3.793396703 1.15E-05 ENSBTAG00000016152 2607.512211 1135.637734 4079.386688 3.592154934 1.24E-05 ENSBTAG00000019453 454.5143124 163.1793814 745.8492434 4.570732142 1.24E-05 ENSBTAG00000011256 19452.49559 9359.669194 29545.32198 3.156663058 1.39E-05 281128 6848.674481 3267.561113 10429.78785 3.191918219 1.46E-05 ENSBTAG00000040584 1880.459052 832.2319429 2928.686161 3.519074443 1.50E-05 ENSBTAG00000033096 1934.959981 776.6795367 3093.240424 3.982646997 1.66E-05 ENSBTAG00000009849 1658.528877 729.0696352 2587.988119 3.549713215 1.68E-05 ENSBTAG00000033424 4313.425879 2059.156665 6567.695093 3.189507241 1.74E-05 505995 3194.531664 1536.354734 4852.708593 3.158586025 2.09E-05 ENSBTAG00000003668 121.9978756 199.9438136 44.05193768 0.220321584 2.38E-05 ENSBTAG00000018634 8991.776129 4463.135779 13520.41648 3.029353609 2.81E-05 ENSBTAG00000015381 3748.685232 1816.528222 5680.842241 3.127307449 2.81E-05 ENSBTAG00000011733 474.983394 190.7719883 759.1947998 3.979592636 2.81E-05 280924 3234.208263 1602.315055 4866.101471 3.036919272 3.03E-05 790592 5869.781998 2851.496893 8888.067103 3.116982917 3.03E-05 ENSBTAG00000007428 73.12567114 19.14007463 127.1112676 6.641106166 3.03E-05 ENSBTAG00000024715 436.2452136 169.2695536 703.2208736 4.154443955 3.40E-05 ENSBTAG00000008040 1498.496926 702.6762044 2294.317648 3.265113624 3.50E-05 100300085 20.6062677 35.11203357 6.100501838 0.173743905 4.04E-05 ENSBTAG00000013468 7668.356989 3702.438314 11634.27566 3.142328023 4.04E-05 ENSBTAG00000017104 167.2883484 50.32849885 284.2481979 5.647857664 4.30E-05 ENSBTAG00000021830 350.1593432 138.401717 561.9169695 4.060043341 4.31E-05 ENSBTAG00000000937 1375.180793 626.9524502 2123.409137 3.386874293 4.59E-05 ENSBTAG00000001754 6420.362258 9497.799924 3342.924592 0.35196831 4.75E-05 ENSBTAG00000015106 3487.368883 1557.249584 5417.488181 3.478882407 4.75E-05 ENSBTAG00000040361 2284.399026 3457.59222 1111.205832 0.321381401 4.96E-05 ENSBTAG00000017167 185.3806498 296.2551284 74.50617119 0.251493271 4.97E-05 ENSBTAG00000010105 232.3897252 80.39197418 384.3874761 4.781416056 4.97E-05 ENSBTAG00000012397 2567.14042 3860.255555 1274.025284 0.330036513 5.78E-05 ENSBTAG00000010362 217.62393 343.5884238 91.65943623 0.266771026 5.80E-05 ENSBTAG00000002977 106.8478634 164.475293 49.2204339 0.299257311 5.80E-05 ENSBTAG00000015792 431.0849089 162.4203447 699.7494731 4.308262454 6.01E-05 ENSBTAG00000010399 957.9931433 438.2459457 1477.740341 3.371942982 6.61E-05 ENSBTAG00000005567 25.33401196 44.85168813 5.816335794 0.129679306 6.68E-05 ENSBTAG00000008121 596.2628958 906.6850171 285.8407744 0.315259179 7.05E-05

PAGE 3

ENSBTAG00000007353 393.212839 163.3816159 623.0440622 3.813428204 7.05E-05 ENSBTAG00000019708 2074.304885 1002.520425 3146.089345 3.138179799 7.60E-05 ENSBTAG00000003727 267.6799816 98.7235894 436.6363739 4.422817045 7.60E-05 508150 325.7103157 122.7887456 528.6318858 4.305214483 7.64E-05 ENSBTAG00000026283 8003.452901 4148.016661 11858.88914 2.858929968 7.69E-05 ENSBTAG00000010798 36.64384397 6.726490731 66.56119721 9.895382283 7.96E-05 ENSBTAG00000016529 4103.061262 2083.7619 6122.360625 2.938128691 8.03E-05 ENSBTAG00000021975 935.5918424 433.5721696 1437.611515 3.315737531 8.53E-05 ENSBTAG00000015924 288.5259943 120.911562 456.1404265 3.772512892 9.20E-05 ENSBTAG00000031166 109.8973502 177.091374 42.70332649 0.241137248 9.27E-05 ENSBTAG00000007129 24.7268903 43.52304254 5.930738056 0.136266624 9.33E-05 ENSBTAG00000014170 704.9297469 1062.251161 347.6083332 0.327237424 9.33E-05 533581 21.83104117 38.52197469 5.140107647 0.13343313 9.35E-05 ENSBTAG00000039483 1142.402028 537.6575734 1747.146482 3.249552445 9.69E-05 100299135 69.77155271 18.92847844 120.614627 6.372124806 0.0001022 ENSBTAG00000009470 6124.048048 3144.566594 9103.529502 2.89500293 0.0001063 ENSBTAG00000020684 303.2228424 114.8751819 491.5705028 4.279170614 0.0001132 282598 22.78945622 40.23435736 5.344555082 0.132835602 0.0001172 ENSBTAG00000016073 1365.928462 677.6823754 2054.174549 3.031175996 0.000119 ENSBTAG00000018373 1470.988401 2177.577388 764.3994151 0.351032032 0.0001214 ENSBTAG00000001192 2328.057716 1153.65463 3502.460803 3.03596996 0.0001214 ENSBTAG00000020538 1087.056298 1638.345694 535.7669026 0.327017005 0.0001227 ENSBTAG00000001788 5289.468757 2575.945648 8002.991866 3.106817053 0.0001231 ENSBTAG00000021523 2284.936749 3369.02633 1200.847168 0.356437454 0.0001232 ENSBTAG00000021377 6048.529045 2951.866232 9145.191858 3.098105111 0.0001396 ENSBTAG00000004982 2502.568607 1230.963319 3774.173895 3.066032785 0.0001454 532789 4963.818445 2583.225686 7344.411205 2.843116359 0.0001478 ENSBTAG00000039682 1058.941525 478.7867316 1639.096318 3.423437222 0.0001479 280832 8382.64266 12370.32791 4394.957405 0.355282207 0.0001689 ENSBTAG00000007302 777.3585741 352.1655561 1202.551592 3.414733699 0.0001705 ENSBTAG00000033398 127.401463 43.62398607 211.17894 4.840890505 0.0001705 ENSBTAG00000026275 446.997111 673.1161706 220.8780513 0.328142542 0.0001737 ENSBTAG00000012748 3.733018496 7.466036992 0 0 0.0001857 ENSBTAG00000015147 1971.049961 1016.560853 2925.53907 2.877878941 0.0001925 ENSBTAG00000008101 140.3748503 47.20496204 233.5447386 4.947461632 0.0001925 ENSBTAG00000001526 5.371261657 10.21151548 0.53100783 0.052000884 0.0001946 ENSBTAG00000015596 256.024342 102.592703 409.4559809 3.991082883 0.0002023 508723 17.6054689 31.34095197 3.869985828 0.123480162 0.0002143 ENSBTAG00000003172 47.18221831 76.69271292 17.67172369 0.230422462 0.000224 ENSBTAG00000003711 171.9021152 65.2901791 278.5140512 4.265787827 0.0002301 ENSBTAG00000015780 3377.250888 1819.967998 4934.533778 2.71132997 0.0002527 ENSBTAG00000010347 14139.84296 7356.611693 20923.07422 2.844118338 0.0002527 100298760 1161.446638 570.0134446 1752.879831 3.075155239 0.0002564 ENSBTAG00000002746 3247.491501 1742.685271 4752.297732 2.72699713 0.0002674 ENSBTAG00000019663 500.8087355 233.790508 767.826963 3.284252083 0.00027 ENSBTAG00000013861 466.6405365 710.2228337 223.0582392 0.314067964 0.0002938 ENSBTAG00000033221 452.1633316 199.7822846 704.5443787 3.526560827 0.000305 ENSBTAG00000018523 176.2142196 274.6622222 77.76621708 0.283134013 0.0003059 ENSBTAG00000001774 670.6261438 1000.083777 341.1685107 0.341139931 0.0003191 ENSBTAG00000038293 1615.351259 2386.383055 844.3194634 0.353807182 0.0003197 ENSBTAG00000016269 2222.428364 3227.526854 1217.329875 0.377171107 0.0003322 ENSBTAG00000013953 9253.799409 4748.383991 13759.21483 2.897662627 0.0003369

PAGE 4

ENSBTAG00000001772 12.48336354 22.93153643 2.035190644 0.088750732 0.0003377 ENSBTAG00000038928 5.581017481 11.16203496 0 0 0.0003519 100337107 170.1646119 259.3722582 80.95696564 0.31212654 0.0003519 ENSBTAG00000021945 1034.528311 498.2753217 1570.781301 3.152436479 0.0003578 ENSBTAG00000016284 33.17210767 57.04875132 9.295464015 0.162938957 0.0003634 ENSBTAG00000004796 344.4086465 512.8668174 175.9504757 0.34307245 0.0003634 ENSBTAG00000019187 70.92921255 113.1519755 28.70644963 0.253698175 0.0003698 ENSBTAG00000004430 795.1652678 407.0626451 1183.26789 2.906844695 0.0003834 ENSBTAG00000013919 42.31011593 67.69635098 16.92388089 0.249996944 0.0003856 ENSBTAG00000021190 48.32360581 79.69492167 16.95228995 0.212714808 0.0003924 ENSBTAG00000007872 1132.219577 1650.83616 613.6029943 0.371692243 0.0003924 ENSBTAG00000007335 2625.385155 1391.841524 3858.928787 2.772534602 0.0004094 ENSBTAG00000012171 6.004215675 11.41231506 0.596116286 0.052234475 0.0004126 ENSBTAG00000001395 929.7810312 1387.523132 472.0389301 0.340202566 0.0004179 ENSBTAG00000032603 2128.320133 3105.596063 1151.044204 0.370635517 0.0004179 ENSBTAG00000013761 14812.2601 21409.24056 8215.279636 0.383725878 0.0004179 ENSBTAG00000021254 5171.330638 2882.022549 7460.638727 2.588681595 0.0004179 ENSBTAG00000020073 172.840703 65.82582528 279.8555808 4.251455711 0.0004305 788582 49.49601148 79.58712555 19.40489741 0.243819553 0.0004382 ENSBTAG00000021887 104.8732681 166.1700584 43.57647775 0.262240251 0.0004431 ENSBTAG00000017745 1487.478181 2176.540376 798.4159859 0.366828015 0.0004431 ENSBTAG00000021897 290.9083691 124.7082195 457.1085187 3.665424143 0.0004587 ENSBTAG00000002355 122.8189959 45.12567953 200.5123123 4.443419233 0.0004587 ENSBTAG00000020196 222.6622207 102.9616837 342.3627578 3.325147234 0.000466 100295182 85.72588964 26.91033226 144.541447 5.371224911 0.0004852 ENSBTAG00000012796 53.88241357 85.01303416 22.75179298 0.267627114 0.0005004 ENSBTAG00000012296 98.02998423 155.7342077 40.3257608 0.258939647 0.0005057 ENSBTAG00000005947 3527.999833 1989.320184 5066.679482 2.546940167 0.0005349 ENSBTAG00000010587 1593.345363 2340.723814 845.9669107 0.361412528 0.0005408 ENSBTAG00000019478 435.8485804 218.9930142 652.7041465 2.980479303 0.0005408 618056 527.4321619 225.493415 829.3709087 3.678027177 0.0005408 ENSBTAG00000005085 239.3296944 100.3824511 378.2769378 3.768357253 0.0005408 ENSBTAG00000002415 2515.434206 3579.587293 1451.281119 0.405432526 0.0005416 ENSBTAG00000017969 10.66840495 18.88216621 2.454643692 0.129997992 0.0005868 ENSBTAG00000013406 12854.61782 7200.896245 18508.33939 2.570282748 0.0006058 ENSBTAG00000040552 10.65889759 18.43193577 2.885859415 0.156568439 0.0006298 ENSBTAG00000013929 58.0452329 90.82846072 25.26200507 0.278128737 0.000642 522155 4273.890995 6167.459755 2380.322234 0.385948564 0.000642 ENSBTAG00000001992 2758.528284 1589.225079 3927.83149 2.471538829 0.000642 ENSBTAG00000021127 24.29824882 6.256430942 42.3400667 6.767447303 0.000642 ENSBTAG00000016221 147.6155341 56.96229734 238.2687708 4.182920667 0.0006538 ENSBTAG00000012926 59.1196743 93.19193116 25.04741745 0.268772383 0.0006579 ENSBTAG00000019229 843.2014246 418.4650476 1267.937802 3.029973014 0.0006579 ENSBTAG00000000836 4334.421444 2147.22215 6521.620738 3.037236151 0.0006579 767904 150.6510575 233.5266454 67.77546953 0.290225852 0.0006625 ENSBTAG00000001585 1955.625916 1036.966054 2874.285778 2.771822439 0.0007006 ENSBTAG00000010718 982.6565196 1437.095535 528.2175041 0.367559074 0.0007282 281872 429.5747384 653.3309795 205.8184972 0.315029447 0.0007454 ENSBTAG00000026851 995.9719389 521.6174556 1470.326422 2.818783011 0.0007932 ENSBTAG00000020495 1176.736811 599.0442437 1754.429379 2.928714193 0.0007964 ENSBTAG00000032902 750.0391766 374.8633613 1125.214992 3.001667029 0.0008418 618541 36.76435253 59.48681798 14.04188707 0.236050398 0.0008496

PAGE 5

ENSBTAG00000012109 299.4494976 453.5252635 145.3737317 0.32054164 0.000853 504513 1124.775009 543.9727296 1705.577288 3.135409543 0.000853 100337070 10.91292561 18.71688225 3.108968979 0.166105067 0.0009006 ENSBTAG00000016563 12315.87855 6926.513906 17705.2432 2.556155007 0.0009084 ENSBTAG00000031171 1691.231195 2447.491492 934.9708987 0.38201191 0.0009086 ENSBTAG00000009615 10512.50602 5808.043265 15216.96877 2.619981994 0.0009086 ENSBTAG00000002215 990.1820085 1412.58407 567.7799469 0.401944181 0.0009505 ENSBTAG00000018499 3374.657632 1878.923082 4870.392182 2.59211898 0.0009907 ENSBTAG00000003362 127832.466 66438.44708 189226.485 2.84814732 0.0010149 ENSBTAG00000004710 7.46899536 13.69931182 1.238678898 0.09041906 0.0010324 ENSBTAG00000002317 47.49085393 77.32459432 17.65711354 0.228350549 0.0010691 ENSBTAG00000001517 559.5141505 246.4080684 872.6202325 3.541362253 0.0010691 ENSBTAG00000018137 4660.508192 6715.448843 2605.567542 0.387996038 0.0010713 ENSBTAG00000018280 197.3087823 80.68843092 313.9291338 3.890633765 0.0010713 ENSBTAG00000021291 374.2584204 169.539947 578.9768937 3.414988053 0.0010715 ENSBTAG00000008182 545.7138045 816.1379684 275.2896406 0.337307724 0.0010753 ENSBTAG00000021707 85.56474625 27.73806584 143.3914267 5.169481805 0.0010753 ENSBTAG00000016771 180.1277154 276.56146 83.69397076 0.302623405 0.0010993 788312 1678.227935 943.9089325 2412.546938 2.555910697 0.0010993 ENSBTAG00000009902 589.4626167 280.8740151 898.0512184 3.197345323 0.0010993 ENSBTAG00000015511 211.32393 89.37946618 333.2683938 3.728690806 0.0010993 533181 468.298273 247.9397963 688.6567497 2.777515994 0.0011842 506387 1175.640086 584.2700502 1767.010123 3.024303782 0.0011854 ENSBTAG00000007512 1166.996474 546.6569148 1787.336034 3.26957546 0.0011872 ENSBTAG00000018204 193.672128 285.4554798 101.8887762 0.356934035 0.0012207 ENSBTAG00000020416 104.2961513 41.81807198 166.7742307 3.988089905 0.0012207 ENSBTAG00000008332 23671.7215 13710.13145 33633.31156 2.453172071 0.0012314 ENSBTAG00000004769 31.55907012 9.133014413 53.98512583 5.910986602 0.0012584 509241 34.06800611 56.40861863 11.7273936 0.207900741 0.0013095 ENSBTAG00000015434 9429.950145 5552.575445 13307.32485 2.396604058 0.0013095 100138954 2435.131959 3460.118736 1410.145182 0.407542425 0.0013452 ENSBTAG00000019954 770.0012097 395.2902407 1144.712179 2.895877663 0.0013576 ENSBTAG00000005076 670.1408531 331.7889051 1008.492801 3.039561557 0.0013742 ENSBTAG00000021485 58.16294263 89.89943181 26.42645344 0.293955734 0.0013853 ENSBTAG00000006307 4708.123291 2848.488741 6567.757841 2.30569907 0.0013853 ENSBTAG00000004036 629.9321521 919.8888331 339.9754711 0.369583214 0.0014061 ENSBTAG00000004881 1994.531782 1139.450682 2849.612883 2.500865487 0.0014408 ENSBTAG00000006893 635.5916054 917.9787543 353.2044564 0.384763215 0.0014494 ENSBTAG00000019890 34.03699491 9.733691794 58.34029803 5.993645501 0.0015082 ENSBTAG00000019289 74.49035554 118.939656 30.04105504 0.252573919 0.001542 ENSBTAG00000014469 4478.903242 2625.19942 6332.607064 2.412238482 0.0015531 525579 412.2914087 203.816127 620.7666903 3.045719195 0.0015616 531336 957.8282588 499.0073375 1416.64918 2.838934568 0.0016132 ENSBTAG00000018914 169.0783686 66.73183366 271.4249035 4.067397652 0.0017241 ENSBTAG00000043949 1097.470828 567.0127615 1627.928894 2.871062178 0.0017656 ENSBTAG00000006748 850.8917359 452.8788377 1248.904634 2.757701465 0.0018463 ENSBTAG00000007079 47.49142353 14.96957974 80.01326732 5.345057691 0.0018463 ENSBTAG00000038334 94.3289491 40.73915131 147.9187469 3.63087453 0.0018844 ENSBTAG00000009076 185.5323663 275.3282019 95.73653059 0.347717851 0.0018954 ENSBTAG00000000501 285.5328048 428.6740119 142.3915978 0.332167553 0.0019182 540873 181.2143228 80.22932622 282.1993193 3.517408567 0.0020096 789216 136.7503427 204.5135098 68.98717548 0.337323317 0.0020955

PAGE 6

ENSBTAG00000015330 323.5241792 146.2368574 500.8115009 3.424659896 0.0020955 ENSBTAG00000019421 156.3390619 64.19635361 248.4817702 3.870652401 0.0020955 ENSBTAG00000032821 1180.045717 621.6232386 1738.468196 2.796658954 0.0021288 ENSBTAG00000014788 2101.596697 2947.932127 1255.261267 0.425810776 0.0021308 ENSBTAG00000005622 836.0349203 438.9675993 1233.102241 2.80909626 0.0021821 ENSBTAG00000007485 2143.745282 1170.108109 3117.382456 2.664183277 0.0022383 ENSBTAG00000017694 5.520295116 10.41486039 0.625729845 0.060080483 0.0022742 281062 406.7790284 596.8711919 216.6868648 0.363037901 0.0023085 ENSBTAG00000008956 30.96251676 51.26958888 10.65544463 0.207831677 0.0023116 100335953 70.58023081 108.7446431 32.41581849 0.298091175 0.0023116 ENSBTAG00000015131 2201.651204 2984.019968 1419.282439 0.475627662 0.0023116 ENSBTAG00000000644 154.970976 63.26220112 246.6797509 3.899322921 0.0023116 ENSBTAG00000001492 490.8690547 259.0618208 722.6762886 2.789590093 0.0023382 ENSBTAG00000015368 157.8632099 234.0090418 81.71737812 0.349206071 0.0023483 ENSBTAG00000013541 25.75410726 40.51708743 10.99112709 0.271271402 0.0023515 282479 6865.063353 4052.117019 9678.009687 2.388383564 0.0023773 ENSBTAG00000025246 60.87756478 96.14303875 25.61209081 0.266395686 0.0024312 ENSBTAG00000022937 20.08156155 33.94416702 6.218956075 0.183211333 0.0025422 ENSBTAG00000000253 1107.849518 581.3349363 1634.364099 2.811398381 0.0025422 ENSBTAG00000014517 28.89306195 46.88707821 10.89904568 0.232453079 0.002558 ENSBTAG00000012804 4965.332384 3020.501595 6910.163173 2.287753526 0.002558 ENSBTAG00000002651 4356.178648 2580.964358 6131.392937 2.375620925 0.002558 ENSBTAG00000007743 959.9628431 1366.482595 553.4430908 0.405012909 0.0025908 ENSBTAG00000013736 58.39541589 22.69006279 94.10076898 4.147223824 0.0025932 ENSBTAG00000002668 41.12439619 66.2319599 16.01683248 0.24182936 0.0026336 ENSBTAG00000001877 159.9762525 232.1671982 87.78530676 0.378112444 0.0026883 ENSBTAG00000000804 326.9915098 151.2469479 502.7360717 3.323941928 0.0026883 ENSBTAG00000020676 15.58506009 26.37745767 4.792662509 0.181695392 0.0026901 ENSBTAG00000006817 152.5220924 72.1187194 232.9254654 3.229750436 0.0026901 100140110 700.0404521 367.4358898 1032.645014 2.810408681 0.002706 ENSBTAG00000019175 22.67272637 36.7548123 8.590640427 0.233728317 0.0027382 ENSBTAG00000005799 21.6138333 34.09911888 9.128547712 0.267706264 0.0027424 ENSBTAG00000009210 364.4682801 537.0675877 191.8689726 0.357252936 0.0027903 ENSBTAG00000002813 1701.043882 978.859462 2423.228302 2.475563036 0.0027903 ENSBTAG00000018604 88.45742106 127.1082252 49.80661687 0.391844169 0.0028312 508011 14.10742648 24.49881627 3.716036695 0.151682296 0.0028566 ENSBTAG00000031214 14.10826863 1.778876032 26.43766123 14.86200317 0.0028566 525275 15.00338374 24.91493552 5.091831959 0.204368659 0.0028601 615913 13.38148956 2.079214723 24.68376441 11.87167643 0.0028626 ENSBTAG00000008936 81.79935108 31.91140011 131.6873021 4.126653848 0.0029842 ENSBTAG00000002624 599.6160747 321.5095147 877.7226347 2.730005161 0.0029904 ENSBTAG00000013073 114.9269177 47.72071108 182.1331244 3.816647327 0.0029904 540481 187.3938064 273.9219217 100.8656911 0.368227889 0.0030354 ENSBTAG00000017196 38692.95312 22970.23486 54415.67137 2.368964518 0.0030957 ENSBTAG00000030674 1087.447935 1564.356908 610.5389625 0.390281118 0.0031 ENSBTAG00000011944 874.7965117 1221.307478 528.285545 0.432557365 0.0031 ENSBTAG00000007840 6258.297301 3735.97601 8780.618592 2.350287734 0.0031 ENSBTAG00000013918 126.0331775 59.09385485 192.9725002 3.265525675 0.0031 ENSBTAG00000008134 98.01271582 36.89811832 159.1273133 4.312613233 0.0031 ENSBTAG00000016315 12027.18414 6638.538053 17415.83023 2.623443609 0.003131 ENSBTAG00000020313 400.556268 581.7151088 219.3974271 0.377156144 0.0031856 515561 14.92941824 25.01567567 4.843160811 0.193605037 0.0032289

PAGE 7

782347 84.87188357 35.44641566 134.2973515 3.788742782 0.0032289 ENSBTAG00000016208 272.964404 400.7268967 145.2019112 0.362346307 0.0032466 ENSBTAG00000034193 2037.536178 1148.668815 2926.403541 2.547647767 0.0032579 ENSBTAG00000017448 17.4746622 28.09185768 6.857466712 0.244108695 0.0032933 ENSBTAG00000004905 1335.37273 664.4072223 2006.338238 3.019741764 0.0032933 ENSBTAG00000018002 235.8491717 352.5260357 119.1723077 0.3380525 0.0033578 ENSBTAG00000011139 75.70685011 113.2478589 38.16584133 0.337011593 0.0033682 ENSBTAG00000014354 277.7628305 400.9273851 154.5982759 0.385601687 0.0033682 ENSBTAG00000003068 3636.449249 2218.161347 5054.737151 2.278795976 0.0033823 ENSBTAG00000014915 13.77864463 23.65180853 3.905480724 0.165123979 0.0034007 ENSBTAG00000021287 1008.205446 557.1291101 1459.281782 2.619288339 0.0034007 ENSBTAG00000015309 95.84595934 144.3843556 47.30756309 0.327650201 0.00351 ENSBTAG00000006546 9.3303846 0.901016072 17.75975313 19.71080614 0.0035368 ENSBTAG00000021771 2513.763457 1467.831192 3559.695722 2.425139717 0.0035467 ENSBTAG00000010062 168.2314142 82.1585136 254.3043149 3.095288653 0.0035774 ENSBTAG00000009904 2142.256811 3061.771088 1222.742534 0.39935792 0.0036159 ENSBTAG00000019250 1092.979631 1529.942834 656.0164277 0.428784928 0.0036159 ENSBTAG00000008253 57.81175936 91.41866609 24.20485262 0.264769261 0.0036582 ENSBTAG00000002628 3467.902869 1954.359393 4981.446344 2.548889606 0.003668 ENSBTAG00000009842 41.58064855 67.12763186 16.03366525 0.238853432 0.0037599 ENSBTAG00000007662 77001.69683 43960.73387 110042.6598 2.50320343 0.0037599 ENSBTAG00000007173 839.7845485 1183.748173 495.8209243 0.41885676 0.0038035 ENSBTAG00000002920 1135.221096 627.452989 1642.989204 2.618505661 0.0038035 ENSBTAG00000019256 568.1342192 302.2616946 834.0067437 2.759220763 0.0039774 ENSBTAG00000015794 120.3147066 183.4323308 57.19708241 0.31181571 0.004062 ENSBTAG00000031178 200.4613407 295.0012824 105.921399 0.359054029 0.004062 ENSBTAG00000019704 1183.811292 1696.324853 671.2977314 0.395736542 0.0040729 ENSBTAG00000018446 562.374959 324.2549211 800.4949969 2.468721197 0.0040729 ENSBTAG00000011590 77.10745235 33.6053478 120.6095569 3.588998918 0.0041306 ENSBTAG00000017258 1568.583842 903.9265371 2233.241147 2.47060027 0.0042089 ENSBTAG00000000668 291.3357029 156.5305382 426.1408676 2.722413611 0.0042089 521961 32.01406396 11.46244145 52.56568648 4.585906653 0.0042089 ENSBTAG00000009231 2203.520823 1301.984141 3105.057506 2.384865843 0.004242 ENSBTAG00000010152 68.25197198 107.7283339 28.77561007 0.267112737 0.0042464 ENSBTAG00000037768 191.8990552 84.49271673 299.3053937 3.542380992 0.0042694 ENSBTAG00000007589 20.31531889 33.90845808 6.722179708 0.198244924 0.0043229 ENSBTAG00000002096 31.28428546 50.82656716 11.74200376 0.231020988 0.0044407 ENSBTAG00000002699 1002.045797 1433.507525 570.5840697 0.398033536 0.0044531 510489 2050.063526 1204.67936 2895.447693 2.403500707 0.0045633 ENSBTAG00000016595 418.5715804 207.4884858 629.6546751 3.034648755 0.0045633 ENSBTAG00000008611 646.4339799 908.7684236 384.0995361 0.422659421 0.0045938 ENSBTAG00000018245 2173.758969 3055.882744 1291.635193 0.422671713 0.0045938 ENSBTAG00000020584 371.8865957 537.8483054 205.924886 0.382867965 0.0047044 ENSBTAG00000018527 26.50428362 41.40590247 11.60266478 0.280217652 0.004719 ENSBTAG00000020657 1342.939115 800.2060802 1885.672151 2.356483158 0.004719 ENSBTAG00000019290 1492.790188 807.2687028 2178.311673 2.698372507 0.004719 ENSBTAG00000000868 86.80205332 39.43803118 134.1660755 3.401946585 0.004719 ENSBTAG00000000831 1030.909715 563.482806 1498.336624 2.659063609 0.0048182 ENSBTAG00000005475 1672.934069 941.1080806 2404.760058 2.555243237 0.0049106 ENSBTAG00000009289 726.963871 1023.055027 430.872715 0.421162795 0.0049213 ENSBTAG00000010236 83.36516236 124.3492998 42.38102494 0.340822385 0.0050252 ENSBTAG00000001862 100.285501 154.132397 46.43860494 0.301290357 0.0051008

PAGE 8

ENSBTAG00000021574 23.69551973 38.60690304 8.784136432 0.227527611 0.0051956 ENSBTAG00000023617 16.07704308 26.59737295 5.556713216 0.208919626 0.0052058 ENSBTAG00000004263 1307.281665 748.2112518 1866.352079 2.49441862 0.0052058 ENSBTAG00000012252 196.4980497 98.7339893 294.2621101 2.980352685 0.0052129 ENSBTAG00000016291 1053.231232 535.3356221 1571.126842 2.934844568 0.0052186 ENSBTAG00000013579 3738.042451 2261.410478 5214.674423 2.305938915 0.0053543 100337074 43.26971094 15.71682211 70.82259977 4.506165387 0.0053959 ENSBTAG00000011598 588.4521823 816.2150566 360.6893079 0.441904747 0.0054514 ENSBTAG00000006722 3.859692156 7.123268027 0.596116286 0.083685786 0.0056053 ENSBTAG00000016312 2087.241407 2866.801658 1307.681157 0.456146366 0.0056396 521004 19.45004532 32.13734595 6.762744698 0.210432582 0.0057634 ENSBTAG00000013873 436.3530666 224.7917263 647.9144069 2.882287607 0.0059398 786429 4.170236954 7.508467267 0.832006642 0.110809119 0.0060649 ENSBTAG00000003165 12.0566866 20.12595125 3.987421947 0.198123403 0.0060649 100139325 421.4591938 608.2694285 234.6489591 0.385764841 0.0060649 ENSBTAG00000016359 88.55665459 41.18363521 135.929674 3.300574932 0.0060738 ENSBTAG00000017469 235.3634048 345.5749292 125.1518805 0.362155556 0.0061124 ENSBTAG00000016779 3126.462418 1863.24196 4389.682876 2.355938182 0.0061124 ENSBTAG00000018986 295.5439019 151.7794664 439.3083375 2.894385834 0.0061124 ENSBTAG00000003864 215.8937877 97.71413707 334.0734383 3.418885417 0.0061124 ENSBTAG00000011553 34.64072577 13.69542987 55.58602166 4.058727778 0.0061565 ENSBTAG00000016625 220.0873575 317.2604567 122.9142582 0.38742382 0.0063476 ENSBTAG00000037756 1836.680521 1126.756681 2546.604362 2.260119159 0.0064332 ENSBTAG00000015195 1003.859096 549.9012921 1457.8169 2.651051963 0.0064513 ENSBTAG00000013363 8511.483842 5220.187389 11802.7803 2.260987856 0.0064915 ENSBTAG00000019549 2.102370835 4.204741669 0 0 0.006559 614673 272.3997249 126.6969627 418.1024871 3.300019812 0.0065895 ENSBTAG00000018160 249.4166597 115.0498276 383.7834917 3.335802407 0.0065895 ENSBTAG00000008293 4033.60097 5591.170778 2476.031161 0.442846634 0.0066115 100297981 71.68068462 112.208173 31.15319625 0.277637497 0.006723 ENSBTAG00000006362 39.45544232 15.49746202 63.41342262 4.091858561 0.0068542 ENSBTAG00000012904 1286.366147 743.5912344 1829.14106 2.459874425 0.0069028 100335221 60.7557102 91.66708159 29.8443388 0.325573131 0.0069466 ENSBTAG00000013825 4695.200405 2897.986624 6492.414186 2.240318893 0.0069466 ENSBTAG00000010923 472.5355167 265.5174984 679.553535 2.559354992 0.0069466 617150 159.354266 237.922162 80.78637012 0.33954958 0.0070109 527418 253.8984546 138.8583804 368.9385288 2.656941033 0.0070757 ENSBTAG00000002827 4153.633447 2589.025754 5718.24114 2.208645909 0.0070928 ENSBTAG00000020172 215.6216712 100.9296753 330.313667 3.272711082 0.0070928 ENSBTAG00000031772 10.58695228 17.59213674 3.581767808 0.203600498 0.0071074 ENSBTAG00000013854 206.0219271 92.63257801 319.4112762 3.448152724 0.0071074 ENSBTAG00000006738 176.7181719 257.5239816 95.91236209 0.372440506 0.0074439 ENSBTAG00000010812 471.7699698 228.0064297 715.5335098 3.138216368 0.0074971 100299139 336.6266019 483.9201459 189.3330578 0.391248555 0.0076281 ENSBTAG00000000066 3.100116947 5.964343539 0.235890356 0.039550095 0.0078491 ENSBTAG00000005120 4.219087265 7.966393819 0.471780712 0.059221364 0.0078491 ENSBTAG00000008346 29.28647223 46.76076216 11.81218231 0.252608849 0.0078491 ENSBTAG00000001928 1874.499907 1113.360547 2635.639267 2.367282794 0.0078491 ENSBTAG00000010992 293.815834 143.8301981 443.8014698 3.08559312 0.0078491 ENSBTAG00000013724 126.3237924 60.83571251 191.8118722 3.152948561 0.0078491 ENSBTAG00000002714 1542.506214 2139.50997 945.502459 0.441924774 0.0078856 ENSBTAG00000005551 71.35860488 27.64162724 115.0755825 4.163126199 0.0078856

PAGE 9

ENSBTAG00000001586 80.54083 35.17214025 125.9095198 3.579808304 0.0079066 ENSBTAG00000010030 391.8660035 553.5450485 230.1869585 0.415841419 0.0079382 ENSBTAG00000009760 109.9716945 164.471538 55.47185101 0.337273255 0.0079659 ENSBTAG00000001497 1528.589941 879.4628155 2177.717067 2.476190043 0.0079874 ENSBTAG00000016940 5.983485364 10.86946017 1.097510557 0.100971947 0.008079 ENSBTAG00000018704 133.5961707 200.1265749 67.06576648 0.335116746 0.008079 ENSBTAG00000031640 3.534595952 7.069191903 0 0 0.008104 ENSBTAG00000003619 62.52575212 26.0743474 98.97715684 3.795959122 0.008104 ENSBTAG00000016058 236.5271347 114.6524951 358.4017742 3.125983207 0.0081086 ENSBTAG00000026610 4.81179095 9.151801187 0.471780712 0.051550586 0.008135 ENSBTAG00000010867 2288.130729 1360.293938 3215.967521 2.364171029 0.008135 506090 3.533207596 6.56502092 0.501394271 0.076373598 0.0081442 ENSBTAG00000007395 709.2245808 986.5941539 431.8550078 0.437723056 0.0081993 404076 285.6769452 169.3381406 402.0157499 2.374041361 0.0082072 ENSBTAG00000006110 160.3724809 237.7237716 83.02119022 0.349233859 0.0082499 ENSBTAG00000019761 5728.678103 3632.278204 7825.078002 2.154316812 0.0083335 616855 26.40707752 9.079006082 43.73514896 4.81717366 0.0083454 ENSBTAG00000005359 7.791500173 0.858585797 14.72441455 17.14961346 0.0084193 ENSBTAG00000006734 195.9897725 88.39649673 303.5830482 3.43433348 0.0084764 540584 125.1952766 60.45730239 189.9332508 3.141609753 0.0085476 784170 5.491969306 10.38782233 0.596116286 0.057386069 0.0087226 ENSBTAG00000012995 44.10062381 66.59808836 21.60315925 0.324381071 0.0087226 ENSBTAG00000030575 4.584578772 8.543427699 0.625729845 0.073241077 0.008779 535166 4.766325342 8.824979616 0.707671068 0.080189541 0.008874 ENSBTAG00000040266 31.9758382 12.41691067 51.53476573 4.150369372 0.008874 785658 14.91601792 24.91098578 4.921050058 0.197545376 0.0089108 ENSBTAG00000005432 1715.978698 966.4456663 2465.511731 2.551112615 0.0089957 100301169 947.2219315 573.2738749 1321.169988 2.304605261 0.0092771 ENSBTAG00000011617 4.63213317 8.278310565 0.985955775 0.119101086 0.0093795 ENSBTAG00000003880 13.08214966 21.85802767 4.306271644 0.197010989 0.0093795 ENSBTAG00000006910 2124.629012 1282.457927 2966.800098 2.313370315 0.0093795 ENSBTAG00000009455 16.13421538 25.95475268 6.31367809 0.243257109 0.0095765 ENSBTAG00000002328 100.620313 147.4772436 53.7633824 0.364553751 0.0095765 ENSBTAG00000014006 509.9928528 296.8840941 723.1016115 2.435636081 0.0096102 100299991 6.384146775 11.10428027 1.664013284 0.149853322 0.0097002 536075 144.5879989 75.51979059 213.6562073 2.829141946 0.0097002 ENSBTAG00000011425 739.7712632 429.1130454 1050.429481 2.447908523 0.0097231 ENSBTAG00000039883 233.3346704 127.0754363 339.5939045 2.672380393 0.0097231 ENSBTAG00000021301 618.9684227 854.6265314 383.310314 0.448512069 0.0098982 100299975 67.36282734 33.05042746 101.6752272 3.076366481 0.0100712 ENSBTAG00000010023 24.17577658 39.48850936 8.863043797 0.224446148 0.0100938 ENSBTAG00000019526 4550.820989 6189.00642 2912.635558 0.470614403 0.0101607 538337 56.67820176 26.34758023 87.00882328 3.30234589 0.0101607 ENSBTAG00000032819 67.51297916 27.45263197 107.5733263 3.918506846 0.0103341 ENSBTAG00000010293 45.8163382 16.88732465 74.74535175 4.426121561 0.0103385 ENSBTAG00000009411 1461.349113 907.2335174 2015.464708 2.221550097 0.0103784 ENSBTAG00000015936 52.10368333 80.00351165 24.203855 0.302534908 0.0104476 518839 391.5931688 209.4272339 573.7591037 2.739658511 0.0104476 ENSBTAG00000015228 26.15801698 40.70829909 11.60773487 0.285144188 0.0105205 ENSBTAG00000024959 41.84317985 60.74266847 22.94369124 0.377719514 0.010647 ENSBTAG00000021875 226.3414377 109.768585 342.9142903 3.123974772 0.0107276 100196900 19.3292183 6.606896014 32.05154058 4.851225223 0.0107384

PAGE 10

ENSBTAG00000024426 45.6661101 17.17608529 74.15613492 4.317406073 0.0108952 ENSBTAG00000018653 1971.411791 2685.179513 1257.644068 0.468364987 0.0109217 ENSBTAG00000014710 11714.31524 7790.844447 15637.78603 2.007200392 0.0109217 ENSBTAG00000021896 619.1300007 339.2480003 899.0120011 2.65001415 0.0109217 526981 324.3825727 162.8330016 485.9321438 2.984236236 0.0109217 ENSBTAG00000014178 83.33169553 34.83429581 131.8290953 3.78446276 0.0109217 ENSBTAG00000021143 1875.414109 1082.740109 2668.088108 2.464199936 0.0109281 ENSBTAG00000002955 10.52208583 18.02302523 3.021146419 0.167627043 0.0109903 100337111 91.78882046 133.9436353 49.63400561 0.370558896 0.0109979 ENSBTAG00000006934 242.0851816 115.9250515 368.2453116 3.176580962 0.0110336 ENSBTAG00000007139 1133.290545 684.958777 1581.622314 2.309076643 0.0111586 ENSBTAG00000017043 30.50179373 47.50467776 13.49890969 0.284159589 0.0112999 785925 57.18382315 85.97131754 28.39632876 0.33030003 0.0112999 ENSBTAG00000000421 1368.719288 831.1508435 1906.287732 2.293552063 0.0112999 ENSBTAG00000003836 81.5139835 35.9931525 127.0348145 3.529416172 0.0112999 100335853 391.0836785 214.3476749 567.8196821 2.649059208 0.0114147 ENSBTAG00000009078 29.91803446 46.19821351 13.63785542 0.295203091 0.0114427 ENSBTAG00000039016 4.054611901 7.123268027 0.985955775 0.138413404 0.0116644 100295130 39.31872318 59.99924026 18.6382061 0.310640702 0.0116644 ENSBTAG00000014111 372.8765334 207.5588396 538.1942272 2.592971844 0.0116644 ENSBTAG00000009831 40.38052134 61.54862315 19.21241952 0.312150273 0.011846 ENSBTAG00000027513 20.71841812 33.39991776 8.036918492 0.240626895 0.0119749 ENSBTAG00000016918 2132.256781 1330.690195 2933.823367 2.204738096 0.0120105 ENSBTAG00000013824 418.284334 218.8176058 617.7510622 2.823132352 0.0120212 ENSBTAG00000009568 649.1992165 904.6191353 393.7792978 0.435298439 0.0120215 ENSBTAG00000004257 97.13223646 44.25170152 150.0127714 3.389988775 0.0120357 ENSBTAG00000014204 767.8576731 416.3382027 1119.377143 2.688624623 0.0121455 ENSBTAG00000034285 54.40861553 24.92305122 83.89417984 3.366127971 0.0121975 790126 3.232919209 6.229948061 0.235890356 0.037863936 0.0122488 538331 6.87469244 12.54031954 1.209065339 0.096414237 0.0122488 ENSBTAG00000004813 13.03316303 3.515321789 22.55100427 6.415061158 0.0122553 ENSBTAG00000001250 471.1648279 259.0054476 683.3242082 2.638261915 0.0130293 286805 7.648868145 13.27937841 2.018357877 0.151991894 0.0131392 ENSBTAG00000018463 76.08967191 113.0153908 39.16395303 0.346536456 0.0131392 ENSBTAG00000003499 1891.704399 1193.799224 2589.609574 2.169217002 0.0131392 ENSBTAG00000010956 2146.249229 1322.977408 2969.52105 2.244574271 0.0131392 ENSBTAG00000018841 213.5152186 109.4970983 317.5333388 2.899924688 0.0132856 ENSBTAG00000032289 404.0104469 583.4978119 224.523082 0.384788216 0.0134639 ENSBTAG00000019161 82.49690598 37.32519265 127.6686193 3.420441001 0.0135361 ENSBTAG00000027936 628.771394 362.0167531 895.526035 2.473714344 0.013565 ENSBTAG00000002724 41.22541281 63.33900944 19.11181617 0.301738476 0.013842 ENSBTAG00000008148 45.82799144 69.69340895 21.96257394 0.315131291 0.014438 ENSBTAG00000004322 593.5116405 842.8926787 344.1306024 0.408273332 0.0145248 615978 166.3594963 240.3191927 92.39979995 0.384487809 0.0145478 ENSBTAG00000016782 272.427101 394.5054453 150.3487566 0.381106924 0.0145519 ENSBTAG00000017721 662.9246319 376.8377549 949.0115089 2.518355703 0.0146264 ENSBTAG00000039445 7.53051499 13.02583934 2.035190644 0.156242572 0.0147323 ENSBTAG00000024042 807.6988352 1076.009998 539.387672 0.501285 0.0147717 ENSBTAG00000011779 742.1864495 464.0785268 1020.294372 2.198538207 0.0147879 ENSBTAG00000013631 4360.455988 5836.525383 2884.386593 0.494195845 0.014845 ENSBTAG00000019611 343.610924 183.9647223 503.2571257 2.735617565 0.0149157 ENSBTAG00000001748 21.97384681 32.56996777 11.37772585 0.349331812 0.0151745

PAGE 11

ENSBTAG00000027425 8278.842704 10507.1076 6050.577807 0.5758557 0.0151905 ENSBTAG00000030852 15.88843662 26.52014071 5.256732522 0.198216615 0.0152005 ENSBTAG00000019946 58.55196281 87.37317783 29.73074779 0.340273165 0.0152452 ENSBTAG00000031696 33.41337397 11.22768914 55.59905881 4.951959224 0.0153017 100335865 1008.151041 1318.035227 698.2668559 0.529778599 0.0155251 ENSBTAG00000007578 196.6202956 107.2957164 285.9448749 2.66501669 0.015528 100297914 1570.96263 1016.274363 2125.650898 2.091611256 0.0155596 ENSBTAG00000005352 86.6588708 130.0467079 43.27103371 0.332734557 0.0156085 ENSBTAG00000030529 4172.431852 5649.184872 2695.678832 0.477180141 0.0159212 ENSBTAG00000008752 7.787070772 13.04850806 2.525633485 0.193557261 0.015934 615930 152.615668 74.90538654 230.3259494 3.074891674 0.0161534 ENSBTAG00000002781 30.01698051 12.72882741 47.3051336 3.716377956 0.0162159 ENSBTAG00000007356 853.7493954 514.709047 1192.789744 2.317405825 0.0163076 ENSBTAG00000004895 219.1383374 115.5833208 322.6933541 2.791867822 0.0163076 ENSBTAG00000020338 172.3435199 254.455288 90.23175179 0.354607493 0.0165951 616981 4650.301482 3040.788355 6259.814609 2.058615687 0.0165951 783399 66.83697529 30.13245629 103.5414943 3.43621155 0.0165951 ENSBTAG00000015527 4043.969823 2560.571157 5527.368488 2.158646704 0.0166768 ENSBTAG00000031383 2.296633839 4.593267678 0 0 0.0169059 ENSBTAG00000008291 45.64661661 18.35040199 72.94283123 3.974999092 0.0169059 ENSBTAG00000003746 10443.62125 6715.686937 14171.55555 2.110216823 0.0169082 ENSBTAG00000012413 109.2210104 160.2220312 58.21998969 0.363370688 0.0169684 ENSBTAG00000031797 1466.018924 910.2389303 2021.798917 2.221173859 0.0169691 ENSBTAG00000021652 99.71334913 137.5320234 61.89467489 0.450038277 0.0169864 282301 151.5844529 220.8215799 82.34732582 0.372913399 0.0170118 508028 24.74205563 9.976140205 39.50797106 3.960246172 0.0170196 ENSBTAG00000021413 19.66372086 31.35259782 7.974843894 0.254359908 0.0171176 ENSBTAG00000014611 91.65551354 130.8132965 52.49773055 0.401318 0.0171176 ENSBTAG00000002471 41.99812969 18.8435501 65.15270929 3.457560224 0.0171176 ENSBTAG00000020127 125.4804623 186.3457293 64.61519526 0.346749 0.0172459 ENSBTAG00000002719 13180.24339 17986.45562 8374.031149 0.465574281 0.0172459 ENSBTAG00000006589 81.18812702 122.1482696 40.22798443 0.329337326 0.0172719 ENSBTAG00000012223 18.58965049 30.44616984 6.733131138 0.221148708 0.0173517 ENSBTAG00000005353 27.82000419 42.83091887 12.80908951 0.299061749 0.0173517 ENSBTAG00000004269 2512.378268 1655.620258 3369.136278 2.034969228 0.0173915 ENSBTAG00000010278 70.60450317 32.51582386 108.6931825 3.342778057 0.0173915 ENSBTAG00000000306 23.23603467 36.8048031 9.667266241 0.26266317 0.0177184 ENSBTAG00000019003 41.84312972 63.4292819 20.25697755 0.319363186 0.0177661 531878 31.2931967 45.44972951 17.13666389 0.377046554 0.0177694 ENSBTAG00000013981 660.6373636 901.8588867 419.4158405 0.465057058 0.0177694 519918 120.5712687 61.28496818 179.8575692 2.93477462 0.0180172 ENSBTAG00000006492 598.2323927 375.4739134 820.990872 2.186545703 0.0180257 ENSBTAG00000015513 194.7797379 104.6240078 284.935468 2.723423371 0.0180257 ENSBTAG00000015590 883.770596 1216.880236 550.660956 0.452518613 0.018133 ENSBTAG00000020173 322.6929389 164.0227783 481.3630994 2.934733238 0.018133 ENSBTAG00000017243 670.123615 363.5850799 976.6621501 2.686199749 0.0182623 617353 5.754421687 0.589099325 10.91974405 18.53633773 0.0182623 100313101 5.503207789 9.814183006 1.192232572 0.121480573 0.0185371 ENSBTAG00000030600 24904.86849 33887.65095 15922.08602 0.46984921 0.0186385 781648 1575.859663 991.857848 2159.861478 2.177591761 0.0186385 ENSBTAG00000003440 130.8971101 69.3241571 192.4700631 2.776377978 0.0186385 100335755 30.27602219 11.81290652 48.73913787 4.125922591 0.0186711

PAGE 12

ENSBTAG00000006161 2707.728913 1772.747945 3642.709881 2.054838022 0.018904 ENSBTAG00000014529 963.4281068 569.3682766 1357.487937 2.384200161 0.0190212 ENSBTAG00000004249 131.4073419 188.6791104 74.13557346 0.39291882 0.0191034 ENSBTAG00000012038 1.651862799 3.303725597 0 0 0.0191778 ENSBTAG00000011412 685.480276 410.3215034 960.6390485 2.341186217 0.0192125 ENSBTAG00000003762 80.30369179 118.047866 42.55951754 0.360527631 0.0192464 ENSBTAG00000009223 11956.99412 7415.053137 16498.93511 2.225059592 0.0192464 ENSBTAG00000019928 103.8495204 52.48647144 155.2125694 2.957191923 0.0192464 ENSBTAG00000003600 95.953952 139.7555824 52.15232165 0.373168075 0.0193407 ENSBTAG00000014741 171.9400265 247.214985 96.66506811 0.391016217 0.0194667 ENSBTAG00000024826 14.81963294 22.65158226 6.987683623 0.308485453 0.0198192 ENSBTAG00000016874 924.9786949 1266.90531 583.0520802 0.460217568 0.0200522 ENSBTAG00000031941 1175.904612 690.0258423 1661.783382 2.408291515 0.0200522 ENSBTAG00000021445 11.39808645 19.53913612 3.257036775 0.166692977 0.0200702 ENSBTAG00000020046 420.1708844 246.1566693 594.1850995 2.413849282 0.0200702 ENSBTAG00000027173 14256.56282 19393.61117 9119.514462 0.470232923 0.0207704 100336090 253.1155045 342.8896466 163.3413624 0.476367146 0.0207704 ENSBTAG00000006733 9.227655158 14.60032789 3.854982423 0.264033962 0.0207804 ENSBTAG00000012976 117.363075 58.77535235 175.9507977 2.993615362 0.0212026 ENSBTAG00000017404 8.764426146 14.86205047 2.666801826 0.179437005 0.0212085 782451 75.11055647 31.15362226 119.0674907 3.821946922 0.0214392 ENSBTAG00000018382 5073.013253 6932.317333 3213.709173 0.463583679 0.0215145 ENSBTAG00000005062 99.14490075 50.14650892 148.1432926 2.95420949 0.0215145 ENSBTAG00000003276 44.23479009 20.80705205 67.66252812 3.251903632 0.0215145 510299 4.351788919 7.700789296 1.002788542 0.13021893 0.0216048 ENSBTAG00000013454 1503.036971 944.2015108 2061.872432 2.183720751 0.0216048 515570 26.58669451 9.933777723 43.23961129 4.352786271 0.0216048 ENSBTAG00000001083 230.1117889 136.8957855 323.3277923 2.361853516 0.021938 ENSBTAG00000006907 165.0230044 232.1677534 97.87825541 0.421584195 0.0219794 ENSBTAG00000031569 46.59041408 71.0916713 22.08915687 0.310713709 0.022051 ENSBTAG00000019416 44.5103198 64.83079038 24.18984922 0.373122849 0.022051 ENSBTAG00000004777 346.8192361 494.1278429 199.5106293 0.40376318 0.022051 ENSBTAG00000016147 490.8511625 680.9597399 300.742585 0.441645177 0.022051 ENSBTAG00000015128 4.277987704 8.054581136 0.501394271 0.062249577 0.0221395 ENSBTAG00000012460 17.14711268 5.348206152 28.94601921 5.412285613 0.0222138 ENSBTAG00000022663 7.683217165 12.4213478 2.945086533 0.23709879 0.0226549 ENSBTAG00000007494 916.201898 1248.304599 584.0991969 0.467913999 0.0226649 ENSBTAG00000020990 14873.22777 18589.27913 11157.1764 0.60019414 0.0226649 ENSBTAG00000030282 52.57778432 77.9508476 27.20472105 0.348998399 0.0227937 ENSBTAG00000001124 47.82099091 20.53763337 75.10434845 3.656913486 0.0227937 ENSBTAG00000007946 47.56946345 68.98527009 26.15365682 0.379119438 0.0228124 ENSBTAG00000016972 37.99183315 15.36684442 60.61682188 3.944649936 0.0228428 100301259 10.32290054 16.86465593 3.78114515 0.224205295 0.0229084 ENSBTAG00000018941 7.429265337 0.889438016 13.96909266 15.70552687 0.0229084 ENSBTAG00000015114 12157.53085 7721.909681 16593.15202 2.148840469 0.0229354 ENSBTAG00000026181 2933.654838 1846.695378 4020.614298 2.177194108 0.0229359 ENSBTAG00000020591 315.6636832 182.8280598 448.4993066 2.453120747 0.023047 ENSBTAG00000020745 8.654728479 14.02280662 3.286650334 0.234378924 0.0230914 ENSBTAG00000009725 589.0554038 358.5442134 819.5665942 2.285817379 0.0230914 ENSBTAG00000009851 74.92974623 111.0316399 38.82785258 0.349700794 0.0231664 ENSBTAG00000001822 490.9755711 313.2666376 668.6845046 2.134553841 0.0234291 100336395 16.13346189 24.81517014 7.451753636 0.30029025 0.0234378

PAGE 13

ENSBTAG00000002940 23.18302359 37.49996953 8.866077654 0.23642893 0.0236209 ENSBTAG00000020481 195.2834388 103.5048776 287.0619999 2.773415193 0.0236209 514739 31.59719381 48.84379104 14.35059658 0.293805953 0.0238865 ENSBTAG00000000141 264.0334601 151.1319216 376.9349987 2.494079309 0.0238865 ENSBTAG00000013533 15427.67216 9942.639385 20912.70493 2.103335354 0.0239234 ENSBTAG00000016800 4.635379855 8.297584728 0.973174983 0.117284127 0.0240475 ENSBTAG00000013557 271.7534252 157.4741879 386.0326626 2.451402784 0.0240603 504524 57.77927636 25.28134798 90.27720474 3.570901551 0.0240603 ENSBTAG00000009302 26.38569175 9.560156539 43.21122696 4.519928809 0.0241256 ENSBTAG00000017077 37578.7689 24027.9813 51129.55651 2.127917276 0.0241817 ENSBTAG00000005108 17.27376557 28.0107435 6.536787654 0.23336716 0.0242164 ENSBTAG00000022227 547.1900794 326.046066 768.3340928 2.356520053 0.0242164 ENSBTAG00000040215 341.4509993 472.5639793 210.3380193 0.44509956 0.0243168 784877 2.290844811 4.581689622 0 0 0.024338 ENSBTAG00000021829 121.5660801 58.23700238 184.8951579 3.174874226 0.0244368 ENSBTAG00000012737 21319.80238 27056.16347 15583.44128 0.575966408 0.0246466 ENSBTAG00000014501 987.2512707 617.0037462 1357.498795 2.200146763 0.0246466 ENSBTAG00000033056 5.929568876 0.600677381 11.25846037 18.74294042 0.0246466 ENSBTAG00000014541 242.4602724 125.1522838 359.768261 2.874643994 0.0247941 ENSBTAG00000012708 9.582418847 1.790454088 17.37438361 9.703897868 0.0248283 ENSBTAG00000014140 15422.23692 10370.63129 20473.84254 1.974213717 0.0248836 ENSBTAG00000018349 28.54516577 11.30866774 45.78166379 4.048369343 0.0249276 ENSBTAG00000017143 985.059543 572.0846664 1398.03442 2.443754398 0.0249587 ENSBTAG00000019848 2033.491726 2706.708964 1360.274488 0.502556612 0.0249768 ENSBTAG00000017594 2.690561561 5.020897192 0.36022593 0.071745331 0.0255503 ENSBTAG00000005012 15607.5166 21282.01952 9933.013678 0.466732665 0.0255503 ENSBTAG00000013182 591.2066931 356.5447185 825.8686677 2.316311601 0.0255503 ENSBTAG00000000060 84.54759067 122.6147864 46.48039492 0.379076588 0.025601 ENSBTAG00000005008 1578.086281 1013.026837 2143.145726 2.115586328 0.0257233 ENSBTAG00000016726 983.7684543 1332.128484 635.4084248 0.476987342 0.0257784 ENSBTAG00000012065 5254.949936 3541.079564 6968.820308 1.967993145 0.0258357 ENSBTAG00000001017 2665.528174 1735.686877 3595.369471 2.071438989 0.0258357 ENSBTAG00000020199 494.0719423 678.1397038 310.0041808 0.45713911 0.0258626 784776 16.65570087 6.460818416 26.85058333 4.155910537 0.0260899 ENSBTAG00000005805 11.49355157 19.29378054 3.69332259 0.191425552 0.0262288 ENSBTAG00000002214 361.6548637 204.9729029 518.3368245 2.528806575 0.0262288 ENSBTAG00000017743 34.92170275 52.30960942 17.53379608 0.33519264 0.0263906 ENSBTAG00000012442 1999.632433 1226.195156 2773.069709 2.261523946 0.0263906 ENSBTAG00000018709 11.4005556 18.91246325 3.888647957 0.205612982 0.0265063 ENSBTAG00000005501 623.2172224 375.8859345 870.5485103 2.315991184 0.0266748 532050 110.4903061 157.3862674 63.59434471 0.404065398 0.0267154 100297935 23.77861468 36.81984351 10.73738585 0.291619541 0.0268321 ENSBTAG00000018508 50.51990184 70.29145033 30.74835336 0.437440872 0.0268321 ENSBTAG00000020097 9391.444335 6313.590164 12469.29851 1.974993337 0.0269028 ENSBTAG00000032093 2.514246346 4.762988776 0.265503915 0.055743133 0.0269859 532280 3.542555408 6.253104173 0.832006642 0.133054979 0.027248 ENSBTAG00000005412 125.5449947 58.05237646 193.0376129 3.32523188 0.0276261 ENSBTAG00000008338 104.473181 152.1630129 56.78334906 0.373174453 0.027627 ENSBTAG00000006692 2.432653145 4.50508036 0.36022593 0.079959934 0.0277888 ENSBTAG00000016010 2902.966369 1944.14555 3861.787189 1.986367322 0.0277888 282002 427.11887 237.2175112 617.0202288 2.601073696 0.0277888 ENSBTAG00000040378 124.0851285 167.355271 80.81498606 0.482894776 0.0278973

PAGE 14

ENSBTAG00000040088 31.18425097 12.42516195 49.94333999 4.019532314 0.0278973 ENSBTAG00000008612 42.1098287 60.68109961 23.53855779 0.38790592 0.0279191 ENSBTAG00000016708 2711.777294 1803.673557 3619.88103 2.006949105 0.0284096 ENSBTAG00000014699 50.27140518 20.93441067 79.60839969 3.802753321 0.0284096 ENSBTAG00000039495 4.739119622 8.286006672 1.192232572 0.143885061 0.0286627 615496 8.789401622 15.06595055 2.512852693 0.166790186 0.0286627 ENSBTAG00000004131 1368.77557 923.3272497 1814.223889 1.964876364 0.0286627 ENSBTAG00000037327 143.4361707 194.6274387 92.24490268 0.47395631 0.0289127 ENSBTAG00000037331 244.1959154 331.0666242 157.3252066 0.475207088 0.0289127 ENSBTAG00000031575 21.31735179 8.578649256 34.05605431 3.969862072 0.0289127 617373 12.96511451 4.385485643 21.54474338 4.912738323 0.0289127 ENSBTAG00000009876 9.047284253 14.21180189 3.88276662 0.273207201 0.0290487 100336946 6.57373442 11.90878994 1.238678898 0.104013834 0.0293125 ENSBTAG00000009366 1419.775526 1827.594884 1011.956168 0.553709236 0.0298438 100295939 4.781800541 8.767089336 0.796511746 0.090852473 0.0299041 ENSBTAG00000016412 38.34285893 58.65457948 18.03113838 0.307412286 0.0299041 ENSBTAG00000003964 512.660051 670.4901213 354.8299807 0.529209856 0.0299041 ENSBTAG00000010388 1711.572242 1146.307027 2276.837457 1.986237023 0.0299041 ENSBTAG00000011382 7648.860068 4732.0997 10565.62044 2.232755247 0.0303013 ENSBTAG00000010620 551.4675966 329.8779622 773.0572311 2.34346431 0.0303013 ENSBTAG00000018165 210.8794813 106.8859032 314.8730594 2.94588014 0.0303013 ENSBTAG00000018731 9.971673051 16.66359522 3.279750879 0.196821324 0.0303976 ENSBTAG00000003151 10808.41276 7331.626103 14285.19942 1.948435343 0.0303976 768063 154.3305573 81.69260693 226.9685077 2.778323721 0.0304831 518469 1089.340467 1490.798589 687.8823446 0.461418699 0.0306863 ENSBTAG00000013614 118.1752867 65.35084097 170.9997324 2.616641651 0.030905 ENSBTAG00000002953 3116.210198 1964.784051 4267.636344 2.172063816 0.0312275 ENSBTAG00000001146 311.2263698 181.6759922 440.7767473 2.426169479 0.0312275 ENSBTAG00000017863 23.3660372 35.74196541 10.99010898 0.307484741 0.0315635 ENSBTAG00000034937 7.714745967 13.1752437 2.254248233 0.17109727 0.0317442 ENSBTAG00000007976 3653.152649 2482.771913 4823.533385 1.942801657 0.0317442 ENSBTAG00000005714 175.849266 98.55331312 253.1452189 2.568611961 0.0317442 ENSBTAG00000003291 12296.45229 8098.913005 16493.99157 2.036568557 0.0319194 512486 2.650946964 5.301893928 0 0 0.0323641 ENSBTAG00000014420 37.32267816 53.87744444 20.76791188 0.385465794 0.0329429 535342 101.4977464 58.70477366 144.2907191 2.45790436 0.0332425 ENSBTAG00000001116 301.5802364 166.4580013 436.7024715 2.623499429 0.0333119 ENSBTAG00000019309 376.5114002 514.310769 238.7120315 0.464139672 0.0334755 282638 136.0111413 68.1789636 203.843319 2.989827187 0.0337096 ENSBTAG00000039028 7.374317651 12.6483362 2.100299099 0.16605339 0.0337665 614497 795.6434369 1063.309731 527.9771426 0.49654125 0.0337956 ENSBTAG00000019225 1903.463614 1269.708765 2537.218463 1.998268054 0.033968 ENSBTAG00000020391 8.844541722 14.99266806 2.696415385 0.179848935 0.0339714 618218 101.2458259 143.6276881 58.86396367 0.409837159 0.0339846 ENSBTAG00000020758 58.60673879 82.98152604 34.23195154 0.41252497 0.0342993 ENSBTAG00000027900 29.22952217 44.90090753 13.55813681 0.301956855 0.0346956 ENSBTAG00000005493 334.2481027 210.3224141 458.1737913 2.178435395 0.034753 ENSBTAG00000016145 3.664444518 6.857108323 0.471780712 0.0688017 0.0347731 ENSBTAG00000010532 779.9781318 493.2052137 1066.75105 2.162894918 0.0347731 ENSBTAG00000013125 40.12514075 59.80587566 20.44440584 0.341846108 0.0350429 ENSBTAG00000020829 747.2330325 470.1978222 1024.268243 2.178377258 0.0350429 ENSBTAG00000033658 223.4868546 129.9968698 316.9768394 2.438342091 0.0350429

PAGE 15

ENSBTAG00000007415 88.48266208 121.9930381 54.9722861 0.450618224 0.0352593 ENSBTAG00000010069 371.7155422 524.0837375 219.3473468 0.418534923 0.0356251 ENSBTAG00000004554 3943.709003 2612.472394 5274.945613 2.019139274 0.0356251 510907 1339.461546 828.441032 1850.48206 2.233691945 0.0356251 ENSBTAG00000027074 92.12367092 133.1671513 51.08019054 0.383579509 0.0356825 533330 19.6890299 31.13891649 8.239143314 0.264593128 0.0356965 ENSBTAG00000008466 139.9989592 202.9004008 77.0975175 0.379977157 0.0356965 ENSBTAG00000012073 103.1447885 52.13420956 154.1553675 2.956894691 0.0357489 ENSBTAG00000010987 168.9515706 239.8427634 98.06037774 0.408852768 0.0360709 786143 748.2270049 437.9813031 1058.472707 2.416707515 0.0361849 789713 196.9252073 279.2898679 114.5605467 0.410185116 0.0362337 ENSBTAG00000003345 5.368414249 9.279092011 1.457736487 0.157099044 0.0364626 ENSBTAG00000003941 3116.161356 4214.736758 2017.585954 0.478697976 0.0364664 ENSBTAG00000000586 44.58067669 65.09583973 24.06551365 0.369693574 0.0364941 ENSBTAG00000038617 211.9353539 110.3337062 313.5370017 2.841715488 0.0365411 539821 42.4323875 59.53805473 25.32672027 0.425387097 0.0366729 ENSBTAG00000002554 1429.806565 1861.218311 998.3948199 0.53642005 0.0368595 ENSBTAG00000010866 269.9850921 374.9704117 164.9997724 0.440034113 0.0370445 ENSBTAG00000003791 16.62616093 4.99774108 28.25458078 5.653470304 0.0370445 ENSBTAG00000005718 1361.364205 1800.268573 922.4598368 0.512401233 0.0370677 ENSBTAG00000012432 3866.745833 2528.500135 5204.99153 2.058529267 0.037172 ENSBTAG00000016959 965.59183 1293.091654 638.0920056 0.493462318 0.0373379 ENSBTAG00000010221 887.6729657 576.2466302 1199.099301 2.080878635 0.0373643 ENSBTAG00000003063 1077.911579 698.6205659 1457.202592 2.085828363 0.0378317 100137953 4058.340957 5086.411878 3030.270036 0.595757896 0.0379029 ENSBTAG00000002313 573.5348004 371.7415029 775.3280979 2.085664613 0.037931 ENSBTAG00000038715 222.2757307 312.859155 131.6923064 0.420931606 0.0385933 ENSBTAG00000010177 21.03537621 8.439780376 33.63097204 3.984816019 0.0388239 100034674 47.06332785 26.88987994 67.23677575 2.500449087 0.0393693 ENSBTAG00000012342 255.1730389 146.6914529 363.6546249 2.479044401 0.0394381 ENSBTAG00000037367 140.8318321 189.1177628 92.54590149 0.489355945 0.039445 ENSBTAG00000040602 1506.495604 951.4641437 2061.527064 2.166689179 0.039445 ENSBTAG00000003920 58.38498398 29.89763619 86.87233178 2.90565887 0.039445 ENSBTAG00000026428 1024.252559 610.8633078 1437.64181 2.353459099 0.0394685 ENSBTAG00000019353 149.8763655 87.14370185 212.6090292 2.439752095 0.0394685 615641 3677.256936 4888.555813 2465.958059 0.504434879 0.0395241 ENSBTAG00000019203 43.90371867 19.99096432 67.81647301 3.392356263 0.0395241 ENSBTAG00000017628 3.225138902 5.948883533 0.501394271 0.08428376 0.0395264 ENSBTAG00000014863 7.716195979 13.01426128 2.418130678 0.185806219 0.0395264 ENSBTAG00000008428 8.791998123 14.32695947 3.257036775 0.227336218 0.0395264 ENSBTAG00000013721 3624.216241 2460.552393 4787.880089 1.945855777 0.0395264 ENSBTAG00000006661 1144.250315 764.3719897 1524.12864 1.993961919 0.0395264 ENSBTAG00000014027 35.0361882 52.94342322 17.12895319 0.323533163 0.0396577 ENSBTAG00000020471 48.7211252 72.28733014 25.15492025 0.347985189 0.0399073 787843 1.624858633 3.249717267 0 0 0.0399515 ENSBTAG00000032393 1.609432524 3.218865048 0 0 0.0399515 ENSBTAG00000018252 6.852568704 12.13584614 1.569291269 0.129310412 0.0399515 516259 198.7489432 113.4258313 284.0720552 2.504474086 0.0399515 ENSBTAG00000004711 178.9048177 92.07772546 265.7319099 2.885952152 0.0399515 ENSBTAG00000006850 3.095615668 5.925727421 0.265503915 0.044805287 0.0400202 ENSBTAG00000010799 8215.594375 5335.166536 11096.02221 2.079789288 0.0400226 ENSBTAG00000019426 1.495904425 2.991808851 0 0 0.0401721

PAGE 16

ENSBTAG00000006287 18.48763216 7.115504128 29.8597602 4.196436354 0.0401721 ENSBTAG00000003997 73.03011254 36.64298149 109.4172436 2.986035501 0.0408179 ENSBTAG00000002736 1013.881985 1354.824607 672.9393635 0.49669851 0.041225 618399 9500.627306 12043.92875 6957.325859 0.577662489 0.0413893 518274 1205.470991 811.0180353 1599.923946 1.972735348 0.0414507 100299615 16.16979707 23.84184636 8.497747774 0.356421548 0.0414778 ENSBTAG00000005997 335.4305329 203.0322009 467.8288649 2.304210183 0.0414778 100335505 758.9949231 505.8373819 1012.152464 2.000944376 0.0417438 ENSBTAG00000005482 445.4110073 286.3191386 604.5028761 2.111290496 0.0417684 ENSBTAG00000014824 229.1105006 301.7519762 156.469025 0.518535212 0.0417687 ENSBTAG00000005144 63.2612643 33.15844412 93.36408448 2.815695578 0.0417687 ENSBTAG00000033563 133.7882992 188.5130507 79.06354771 0.419406229 0.0418215 ENSBTAG00000022379 5.618987608 9.999296317 1.238678898 0.123876607 0.0418564 507706 31.46987662 44.85668044 18.08307279 0.403129982 0.0421291 ENSBTAG00000018520 14.92071916 5.274923659 24.56651466 4.657226579 0.0421409 540190 43.80932954 65.70982418 21.90883491 0.333417951 0.0421703 100337478 44.47452074 61.02386858 27.92517291 0.457610662 0.0421703 505787 126.3208174 63.8628785 188.7787563 2.956001369 0.0421811 ENSBTAG00000006717 5.580086477 9.217874962 1.942297991 0.210709952 0.0422665 ENSBTAG00000018161 2.890150243 5.544410131 0.235890356 0.042545618 0.0423056 ENSBTAG00000013677 1481.784644 991.4478056 1972.121482 1.989132934 0.0423056 ENSBTAG00000017452 1063.374742 669.615432 1457.134052 2.176075972 0.0423056 ENSBTAG00000009923 473.6859434 640.0371074 307.3347794 0.480182752 0.0423997 ENSBTAG00000014486 36.14118727 15.66330116 56.61907337 3.614759926 0.0425275 ENSBTAG00000022952 251.063975 137.8919179 364.2360321 2.641460338 0.042664 ENSBTAG00000037757 4.358916 7.950933813 0.766898186 0.096453851 0.0427123 100335822 7.971732412 13.87277928 2.07068554 0.149262487 0.0427123 ENSBTAG00000012945 32.13464602 45.45361146 18.81568058 0.413953479 0.0427123 ENSBTAG00000032597 270.5277911 363.8007656 177.2548167 0.487230466 0.0427123 613450 7.512188663 12.94091099 2.083466332 0.160998428 0.0427509 ENSBTAG00000010389 58.09259519 82.09887714 34.08631324 0.415186108 0.0427509 ENSBTAG00000021487 14.79382699 4.720558501 24.86709548 5.267829109 0.0427509 ENSBTAG00000001657 17705.40165 12327.32985 23083.47346 1.87254448 0.0428165 ENSBTAG00000016399 70.57305714 36.48199906 104.6641152 2.868924892 0.0430617 614589 4.313876331 7.920081594 0.707671068 0.089351487 0.0430744 ENSBTAG00000011770 2075.905307 1373.260014 2778.5506 2.023324477 0.0431519 ENSBTAG00000006160 960.0040738 1263.576179 656.4319687 0.519503279 0.043208 ENSBTAG00000012325 4.26127736 7.63132096 0.89123376 0.116786303 0.0436595 100335837 74001.6254 50809.46105 97193.78975 1.912907316 0.0436595 ENSBTAG00000016650 460.5109591 280.5089077 640.5130104 2.28339633 0.0436595 ENSBTAG00000031707 226.5589851 132.7433231 320.374647 2.41348973 0.0436595 617763 8.326996621 13.43752146 3.216471785 0.23936496 0.0436906 ENSBTAG00000012966 179.7227498 254.452398 104.9931016 0.412623746 0.0436906 281276 151.2459267 86.6206763 215.871177 2.49214375 0.0436906 ENSBTAG00000001288 1589.764067 2044.408632 1135.119503 0.555231222 0.0441318 ENSBTAG00000016836 79.22622377 41.88365837 116.5687892 2.783156814 0.0442644 ENSBTAG00000037261 14.21711012 22.62010707 5.814113181 0.257032965 0.0443124 782598 28.40339688 43.38514844 13.42164531 0.309360364 0.0443124 100140937 4823.876272 6105.348394 3542.404151 0.580213269 0.04439 ENSBTAG00000017162 108.2794214 148.738082 67.82076085 0.455974421 0.0445994 ENSBTAG00000001961 240.0148969 335.4032757 144.626518 0.431201865 0.0447603 ENSBTAG00000001507 159.4333353 92.85692609 226.0097445 2.433956776 0.0448049

PAGE 17

ENSBTAG00000023860 249.2438397 152.8764153 345.6112641 2.260723235 0.0450321 782825 11.3424853 2.660617941 20.02435267 7.526203727 0.045174 ENSBTAG00000021103 999.9319256 683.8397866 1316.024065 1.924462558 0.045399 ENSBTAG00000010029 229.9874402 319.1454633 140.8294171 0.441270308 0.0455972 ENSBTAG00000017222 2.70978542 4.793840995 0.625729845 0.130527868 0.0457162 ENSBTAG00000021395 1553.217809 2033.300613 1073.135004 0.527779807 0.0457162 ENSBTAG00000043530 78.28578624 110.3978261 46.17374639 0.418248692 0.0460476 ENSBTAG00000004075 1044.980259 719.4378736 1370.522645 1.904990959 0.04621 ENSBTAG00000006489 445.480361 283.3128445 607.6478774 2.144794665 0.0462724 ENSBTAG00000000936 24.8258795 8.313044733 41.33871427 4.972752535 0.0462724 ENSBTAG00000004720 7.505404876 12.49795706 2.512852693 0.201061076 0.0463156 ENSBTAG00000007867 331.8847276 451.0319511 212.7375041 0.471668368 0.0464367 ENSBTAG00000011088 10.72796023 2.906948301 18.54897217 6.380908858 0.0464669 ENSBTAG00000005738 50.38802491 22.50938661 78.26666321 3.477067792 0.0469338 ENSBTAG00000016666 413.9809125 259.4663448 568.4954802 2.191018186 0.0470939 ENSBTAG00000039346 163.413449 83.2306323 243.5962657 2.926762167 0.0471638 ENSBTAG00000021791 115.4806333 65.42419125 165.5370753 2.530212023 0.0472292 ENSBTAG00000005343 8.809552181 14.59207661 3.027027756 0.207443247 0.0473487 ENSBTAG00000012066 1528.564255 1001.504565 2055.623946 2.052535773 0.0474601 ENSBTAG00000000584 4.94212569 8.586345362 1.297906017 0.151159307 0.0474782 518974 466.9505559 289.2938262 644.6072855 2.228209617 0.0475968 100270756 19.68177325 30.36623381 8.997312683 0.296293335 0.047689 ENSBTAG00000011603 24.12358143 35.86481911 12.38234376 0.345250417 0.047689 ENSBTAG00000008793 261.6119848 149.8820382 373.3419314 2.490905087 0.047689 505427 137.8338135 187.8099891 87.85763795 0.467800666 0.0478345 ENSBTAG00000036130 2.550598323 4.50508036 0.596116286 0.1323209 0.0478676 ENSBTAG00000013923 13.28571977 20.88754326 5.68389627 0.272118947 0.0480363 ENSBTAG00000034323 57.6195957 27.47627547 87.76291593 3.194134373 0.0480363 522828 17684.80132 22155.10468 13214.49795 0.596453871 0.0487254 ENSBTAG00000009453 353.9075613 214.6052315 493.2098911 2.298219328 0.0487254 ENSBTAG00000011987 184.8553222 106.3042288 263.4064155 2.477854536 0.0488538 338037 439.3759694 259.4158709 619.3360679 2.38742551 0.0489051 ENSBTAG00000005989 336.0999921 201.0255144 471.1744697 2.343854068 0.049301 ENSBTAG00000011349 3.285980315 6.0409528 0.53100783 0.087901337 0.0494078 538561 477.3893112 649.9832302 304.7953922 0.468928086 0.0494078 ENSBTAG00000038891 3.539176831 0 7.078353663 NA 0.0494078 790982 3.78247741 6.703334619 0.861620201 0.128536057 0.0496311 ENSBTAG00000023918 11.03396683 2.618187667 19.44974599 7.428705831 0.049738 100141067 827.4245628 1052.874656 601.9744694 0.571743717 0.049939 ENSBTAG00000011091 20.69032514 32.77317709 8.607473194 0.262637741 0.0500797 100337381 48.81143836 22.27796108 75.34491565 3.382038212 0.0500797 ENSBTAG00000011532 5.973169137 9.656595144 2.289743129 0.237117027 0.0503027 ENSBTAG00000014405 79.12376143 115.4454224 42.80210048 0.370756151 0.0505897 ENSBTAG00000007836 3339.353878 2442.691371 4236.016384 1.734159474 0.0506649 100300634 3.6991822 6.50713064 0.89123376 0.136962635 0.0508752 506520 3.690076734 6.6724824 0.707671068 0.106058139 0.0509492 ENSBTAG00000034430 79.52661954 114.6915943 44.36164481 0.386790724 0.0509492 ENSBTAG00000023192 7.86302971 13.09475249 2.63130693 0.200943617 0.0509635 537521 58.73380792 84.19383588 33.27377997 0.395204466 0.0512329 ENSBTAG00000003585 48.11211144 72.00577822 24.21844466 0.336340295 0.0513668 516947 224.1711329 297.7698664 150.5723994 0.505667015 0.0513668 506996 237.8523354 152.062544 323.6421267 2.128348759 0.0513668

PAGE 18

ENSBTAG00000020644 9.875372464 16.58254883 3.168196097 0.191056039 0.0515513 ENSBTAG00000019989 2054.477904 1388.162003 2720.793806 1.95999732 0.051776 ENSBTAG00000008300 22638.31314 29408.64276 15867.98352 0.539568713 0.0517984 ENSBTAG00000021587 112.5442834 62.0360925 163.0524743 2.628348559 0.0520367 ENSBTAG00000014001 6.073618725 10.40716428 1.740073169 0.167199549 0.0524503 ENSBTAG00000031267 24.84938143 12.73652352 36.96223934 2.902066587 0.0524503 ENSBTAG00000015182 10.83434504 3.784808261 17.88388183 4.725175119 0.0525091 ENSBTAG00000032415 30.15763775 12.91400852 47.40126698 3.670530875 0.0526007 506370 1255.193856 818.4616663 1691.926045 2.067202552 0.0526489 ENSBTAG00000012962 3160.62439 2046.801204 4274.447576 2.088355023 0.0526893 ENSBTAG00000001137 6163.654771 4157.15604 8170.153503 1.965322789 0.0532212 100336770 20.55043461 7.615928747 33.48494048 4.396698235 0.0534179 ENSBTAG00000001219 15.62185202 5.394518376 25.84918566 4.791750414 0.0534179 ENSBTAG00000012671 258.4334195 156.0014143 360.8654248 2.313218931 0.0536551 100337166 36.44834631 53.7297013 19.16699131 0.356729906 0.0540273 ENSBTAG00000011608 439.4752353 585.943549 293.0069217 0.500059984 0.0542259 ENSBTAG00000018474 646.9897794 858.8936597 435.0858991 0.506565503 0.0542259 ENSBTAG00000007239 11.81239283 18.95828809 4.666497573 0.246145514 0.0544589 ENSBTAG00000012185 17.36063197 5.918031315 28.80323263 4.867029439 0.0545411 ENSBTAG00000002788 25.63226645 38.30656435 12.95796855 0.338270183 0.0546416 ENSBTAG00000005344 823.7057104 547.8148557 1099.596565 2.00724123 0.0546416 ENSBTAG00000001112 10.83642393 16.61062946 5.0622184 0.30475777 0.0548505 ENSBTAG00000035883 4.288712533 7.338746168 1.238678898 0.168786175 0.0549469 523799 290.54266 397.5435201 183.5417999 0.461689829 0.0549469 ENSBTAG00000021019 25.88819218 10.90419434 40.87219003 3.748299852 0.0553032 ENSBTAG00000037691 2.895737717 5.071023573 0.72045186 0.142072276 0.0553606 ENSBTAG00000002703 13206.80366 9281.676142 17131.93117 1.845779891 0.0553606 100300759 86.7306235 125.3825269 48.07872012 0.383456302 0.0556178 ENSBTAG00000023434 9.890116047 15.63196156 4.148270535 0.265371081 0.0558968 ENSBTAG00000038648 1.748023813 3.496047627 0 0 0.0559307 ENSBTAG00000007275 19.42428052 28.28417971 10.56438134 0.373508493 0.0561625 787309 154.11193 212.908169 95.31569091 0.447684518 0.0561625 ENSBTAG00000027630 227.3245314 142.9363187 311.7127442 2.180780554 0.0561625 ENSBTAG00000011986 290.3753526 196.9660875 383.7846178 1.948480689 0.0562757 540011 4.361522348 0.300338691 8.422706006 28.04402585 0.0562757 ENSBTAG00000026078 1.201354763 2.402709525 0 0 0.0564428 ENSBTAG00000039925 1.201354763 2.402709525 0 0 0.0564428 615599 10229.29186 12953.65685 7504.926869 0.579367429 0.0564771 ENSBTAG00000016740 9078.336675 6325.794597 11830.87875 1.870259708 0.0566573 ENSBTAG00000020707 920.877957 625.6072085 1216.148705 1.943949317 0.0566573 ENSBTAG00000016590 107.0846896 147.9037627 66.2656165 0.448031986 0.0570375 540666 2300.288424 3013.407699 1587.169148 0.526702427 0.0570375 ENSBTAG00000032914 2761.394762 1901.188392 3621.601131 1.904914393 0.0570375 ENSBTAG00000016519 52.2719003 27.93364685 76.61015375 2.742576155 0.0570375 ENSBTAG00000015214 10.36601226 16.9253178 3.806706734 0.22491198 0.0570656 ENSBTAG00000037558 15.52697684 24.714714 6.339239674 0.256496582 0.0571458 ENSBTAG00000040342 1.34573508 2.69147016 0 0 0.0574296 ENSBTAG00000029822 6.078586868 9.902925504 2.254248233 0.227634574 0.0574766 ENSBTAG00000010671 10.69014314 17.29124287 4.089043417 0.236480596 0.0574766 ENSBTAG00000021809 46.5065259 66.39412048 26.61893133 0.400923021 0.0574766 ENSBTAG00000017529 106.9640476 68.2238265 145.7042687 2.135680101 0.0574766 ENSBTAG00000018260 84.55894275 46.68082613 122.4370594 2.622855453 0.0574766

PAGE 19

ENSBTAG00000000053 133.8236935 72.11206587 195.5353211 2.711547904 0.0574766 ENSBTAG00000004293 9.034397444 14.90059879 3.168196097 0.212622066 0.0575352 ENSBTAG00000000472 415.6077927 536.2422825 294.973303 0.550074682 0.0576269 ENSBTAG00000037758 10.87266516 17.10661695 4.638713376 0.271164859 0.0578824 ENSBTAG00000021853 274.0975652 373.9917438 174.2033866 0.465794739 0.0578824 ENSBTAG00000015978 3114.915089 2245.251593 3984.578585 1.774669082 0.0579069 ENSBTAG00000004564 307.7439591 426.4956376 188.9922805 0.443128285 0.0581913 ENSBTAG00000039358 11.39140161 16.70318612 6.079617096 0.363979486 0.0582215 ENSBTAG00000020413 8.625349102 13.12615989 4.124538313 0.314222769 0.0584622 ENSBTAG00000022741 16.24138416 25.02330398 7.459464335 0.298100696 0.0586091 404053 2185.434326 2915.183075 1455.685576 0.499346195 0.0594249 ENSBTAG00000016165 232.6322389 319.4114411 145.8530367 0.456630596 0.0595717 ENSBTAG00000019017 21.64985389 31.11451875 12.18518903 0.391623895 0.0598769 ENSBTAG00000019350 75.11554159 38.19528871 112.0357945 2.933235963 0.0602312 613789 7.504621402 11.562762 3.446480804 0.298067261 0.060312 ENSBTAG00000020141 54.98502175 30.21343488 79.75660862 2.639772966 0.0607147 ENSBTAG00000003450 1141.996864 790.1030344 1493.890693 1.890754279 0.060788 100336104 5.785826929 9.098348038 2.473305821 0.271841197 0.0612878 ENSBTAG00000026977 63.30930359 91.91915851 34.69944867 0.377499634 0.0612878 ENSBTAG00000003109 6990.112713 5035.023058 8945.202368 1.776596108 0.061459 100335333 744.2804387 489.2047574 999.35612 2.042817665 0.061459 504698 613.5846043 812.9943355 414.1748731 0.509443738 0.0616341 ENSBTAG00000004024 1742.582301 1207.670587 2277.494015 1.885856987 0.06189 ENSBTAG00000021045 20.46576943 31.19106022 9.740478647 0.312284308 0.0619478 ENSBTAG00000000281 474.0026233 649.3383721 298.6668746 0.459955683 0.0619478 ENSBTAG00000032124 100.0771269 142.9160019 57.23825177 0.40050275 0.0619663 ENSBTAG00000008158 335.3405766 202.7613372 467.919816 2.307736881 0.06197 100313463 9.589772287 15.67383665 3.505707923 0.223666228 0.0619708 ENSBTAG00000001442 179.0410942 107.0875148 250.9946736 2.343827608 0.0619708 ENSBTAG00000017483 55.08417 75.42404275 34.74429725 0.46065281 0.061992 281585 810.8488081 530.7896919 1090.907924 2.05525454 0.0620978 100138326 10.28217106 16.36374392 4.200598199 0.256701536 0.0622443 524692 48.68097644 69.12323198 28.2387209 0.408527207 0.0622443 ENSBTAG00000008939 173.1927641 93.94520841 252.4403199 2.687101601 0.0623825 534227 140.2085715 79.39015017 201.0269928 2.532140226 0.0624506 ENSBTAG00000022175 37.99590124 17.06474186 58.92706063 3.453146911 0.0626577 100336637 6.444091268 11.16494213 1.723240402 0.154343872 0.0626787 ENSBTAG00000016584 1990.747995 2651.167666 1330.328324 0.501789586 0.0628383 ENSBTAG00000002963 3.792114491 6.722608781 0.861620201 0.128167536 0.0630215 ENSBTAG00000012461 16.95551901 25.71611842 8.194919601 0.318668606 0.0630215 ENSBTAG00000039088 4.74634765 8.489906757 1.002788542 0.118115378 0.0631815 100137784 22.4338284 32.24252323 12.62513357 0.39156779 0.0632987 ENSBTAG00000012820 221.202542 136.1226154 306.2824685 2.250048367 0.0633493 ENSBTAG00000015547 51.62704843 75.84168764 27.41240922 0.3614425 0.0634148 ENSBTAG00000016751 264.56741 158.9170841 370.2177359 2.329628297 0.0634538 ENSBTAG00000002779 164.7115016 98.29901548 231.1239878 2.351234004 0.0636744 ENSBTAG00000018699 4491.859738 5944.481252 3039.238223 0.511270554 0.0640601 ENSBTAG00000002245 2.953502917 0 5.907005834 NA 0.0645153 ENSBTAG00000017147 3474.832161 4533.253884 2416.410439 0.533041056 0.0645533 ENSBTAG00000003638 1991.61037 2654.238724 1328.982015 0.500701765 0.0653129 ENSBTAG00000021675 2037.051251 1421.503607 2652.598896 1.866051471 0.0653453 ENSBTAG00000003458 1380.154859 1812.855887 947.4538307 0.522630529 0.0653718

PAGE 20

ENSBTAG00000037377 868.9122119 585.5080543 1152.31637 1.968062371 0.0653718 ENSBTAG00000009037 212.2043607 136.6500103 287.7587111 2.105808192 0.0653718 ENSBTAG00000018186 1789.365992 1133.269042 2445.462942 2.157883832 0.0653718 280905 10.3368916 3.742377987 16.93140521 4.524237068 0.0653718 100337259 13.27144555 4.11988112 22.42300997 5.442635192 0.0653718 ENSBTAG00000016085 18.6202157 26.53671108 10.70372032 0.403355197 0.065601 ENSBTAG00000006515 2.255479634 4.150733339 0.36022593 0.086786093 0.0656168 ENSBTAG00000008285 952.0667263 633.9793217 1270.154131 2.003463027 0.0658195 ENSBTAG00000010206 1280.952334 888.1469809 1673.757687 1.884550331 0.0658938 ENSBTAG00000014409 3.214643526 5.833170765 0.596116286 0.102194211 0.0659221 ENSBTAG00000013734 11.22185749 15.83309006 6.610624926 0.417519568 0.0659221 ENSBTAG00000012940 712.9499637 904.9650362 520.9348912 0.575640904 0.0659221 618261 5.594135908 9.075191926 2.113079891 0.232841345 0.0662358 100335159 66.74179409 37.19734664 96.28624154 2.588524458 0.0662358 ENSBTAG00000007103 64.20483005 31.3767965 97.0328636 3.092503838 0.0662358 ENSBTAG00000011866 50.23624907 26.32449191 74.14800623 2.816692777 0.0668241 ENSBTAG00000022294 133.9048423 72.42558036 195.3841042 2.697722313 0.0668333 ENSBTAG00000007431 87.18241032 41.92726679 132.4375538 3.158745227 0.0669508 100335236 10.62734786 16.51030891 4.744386821 0.287359058 0.0671981 ENSBTAG00000014294 497.6515355 328.9236705 666.3794004 2.025939329 0.0671981 ENSBTAG00000002101 3423.984017 2294.50104 4553.466995 1.984512936 0.067264 ENSBTAG00000012496 816.658583 530.7713925 1102.545773 2.077251692 0.067475 ENSBTAG00000005699 80.98156762 113.1552344 48.8079008 0.431335775 0.0678028 ENSBTAG00000038283 491.9090719 663.8164529 320.0016909 0.482063512 0.0678028 516599 32.63413291 48.89343003 16.3748358 0.334908714 0.0682719 ENSBTAG00000018247 832.7030332 536.8902049 1128.515861 2.10194906 0.0682719 ENSBTAG00000002900 378.3550611 234.5027322 522.20739 2.22687124 0.0682719 ENSBTAG00000044077 35.11556008 51.22680681 19.00431336 0.370983759 0.0683518 512287 105.1578469 144.0924716 66.22322215 0.459588356 0.0683518 ENSBTAG00000004066 46.80020327 69.43875951 24.16164703 0.347956202 0.0684047 ENSBTAG00000017378 2.04893153 3.861972704 0.235890356 0.061080275 0.0685652 574093 412.626161 246.1559872 579.0963348 2.352558397 0.0686881 ENSBTAG00000012521 5.932416828 9.829643011 2.035190644 0.207046242 0.0689024 100337464 108.0546939 56.12201092 159.9873768 2.850706419 0.0689951 ENSBTAG00000019977 18.05583937 26.99408245 9.117596282 0.337762778 0.0696337 ENSBTAG00000006795 2381.787662 1682.87711 3080.698215 1.830613891 0.0696337 ENSBTAG00000008083 146.0636275 80.43724384 211.6900112 2.631741232 0.0696337 614351 7.64428422 12.75198353 2.536584915 0.198916891 0.0698328 ENSBTAG00000003506 63.52622737 90.33504145 36.71741329 0.406458144 0.0700543 ENSBTAG00000040323 5794.804314 7090.650679 4498.95795 0.634491551 0.0700543 ENSBTAG00000016760 776.3617457 529.8400751 1022.883416 1.930551244 0.0700543 ENSBTAG00000013472 196.2579625 116.4808745 276.0350504 2.369788616 0.0700543 ENSBTAG00000014809 3497.719965 2310.620962 4684.818969 2.027515133 0.070457 ENSBTAG00000016562 2208.349893 1528.705702 2887.994083 1.889175973 0.0705488 ENSBTAG00000012161 210.3488957 131.0029954 289.694796 2.211360092 0.0708714 ENSBTAG00000019226 15.43020989 5.686605779 25.173814 4.426861114 0.0708714 281080 4073.497815 2901.785037 5245.210593 1.807580688 0.07101 ENSBTAG00000012350 3852.890792 4963.92145 2741.860134 0.55235768 0.0714214 ENSBTAG00000023744 1580.935676 1102.374811 2059.496542 1.868236213 0.0714214 ENSBTAG00000011817 9.04330952 15.00036417 3.086254874 0.20574533 0.0717131 ENSBTAG00000000576 41.86079705 19.05909603 64.66249806 3.392736883 0.0717865 ENSBTAG00000014227 1008.51243 619.4071294 1397.617731 2.256379794 0.0719755

PAGE 21

100337339 903.6485656 1139.197536 668.0995949 0.586465098 0.0719928 ENSBTAG00000008023 94.42725703 62.95132263 125.9031914 2.000008676 0.0722681 100335269 607.061804 788.3181707 425.8054373 0.540144136 0.072308 ENSBTAG00000004019 28.39689284 42.20222865 14.59155703 0.345753234 0.0726281 509109 96.00058179 131.4859427 60.5152209 0.460240994 0.0727305 534448 318.8285988 436.2612749 201.3959228 0.461640614 0.0727305 ENSBTAG00000005825 444.048517 590.9838181 297.1132158 0.502743403 0.0727305 ENSBTAG00000021841 202.5342346 120.5612325 284.5072366 2.359856735 0.0727305 ENSBTAG00000011126 1549.749098 1995.498872 1103.999324 0.553244775 0.0728061 ENSBTAG00000005378 36.86140393 16.27943855 57.44336931 3.528584179 0.0728169 ENSBTAG00000008444 7.306484613 11.91655384 2.696415385 0.226274762 0.0728702 ENSBTAG00000003726 337.1569 222.0182985 452.2955016 2.037199207 0.0728702 282011 34.49091657 50.50750948 18.47432365 0.3657738 0.07323 ENSBTAG00000011187 170.8466138 240.2746095 101.418618 0.422094612 0.07323 ENSBTAG00000011767 1013.977992 685.501831 1342.454153 1.958352396 0.07323 ENSBTAG00000007895 1756.038534 2298.268017 1213.809051 0.528140775 0.0735834 ENSBTAG00000007545 419.0485322 267.4922944 570.6047699 2.133163391 0.0735834 789153 18.60707973 26.32504709 10.88911237 0.413640756 0.0737168 ENSBTAG00000020589 85.19969608 48.19070308 122.2086891 2.535939119 0.0737168 ENSBTAG00000018688 84.21762835 113.0920044 55.34325234 0.489364855 0.0738127 ENSBTAG00000021692 5.074978254 9.117554407 1.032402102 0.113232349 0.0739314 ENSBTAG00000039163 6134.678929 7657.292603 4612.065255 0.602310176 0.0740504 ENSBTAG00000013336 52.49788248 74.97110419 30.02466076 0.400483107 0.0741157 ENSBTAG00000021786 140.372271 185.2329051 95.5116369 0.515629968 0.0741157 516526 42.96470588 62.63565952 23.29375224 0.371892823 0.0743933 ENSBTAG00000018746 260.9493622 359.5810341 162.3176903 0.451407819 0.0744071 ENSBTAG00000013676 68.68879956 37.40124673 99.97635239 2.673075395 0.0753164 317725 7.454281975 12.5595937 2.348970247 0.187025974 0.0755414 781667 35.36429331 48.74957316 21.97901346 0.450855506 0.0755414 ENSBTAG00000001629 10.43899941 17.102735 3.775263813 0.220740356 0.0755618 ENSBTAG00000003358 150.1454084 88.07951988 212.2112968 2.409314868 0.075915 ENSBTAG00000008648 334.2513602 213.2153011 455.2874192 2.135341211 0.0761274 509626 138.2906605 80.20193635 196.3793847 2.448561639 0.0762301 ENSBTAG00000003089 601.1519554 394.0548383 808.2490726 2.051108105 0.0762916 ENSBTAG00000009680 1045.031852 722.6311671 1367.432537 1.892296651 0.0763318 ENSBTAG00000014169 4.795415735 7.785649845 1.805181625 0.231860109 0.0763407 ENSBTAG00000022501 22.70445576 31.03458272 14.3743288 0.463171325 0.0763407 ENSBTAG00000037353 74.80645042 101.4552691 48.15763173 0.474668612 0.0763407 ENSBTAG00000020570 8843.81427 10977.0817 6710.546843 0.611323394 0.0769205 ENSBTAG00000016819 1146.443328 1478.030887 814.8557678 0.551311732 0.0770689 ENSBTAG00000034818 6.891988696 11.76561952 2.018357877 0.171547097 0.0771889 ENSBTAG00000019338 53.41125725 77.78647062 29.03604389 0.373278845 0.0772639 100335661 156.6047788 82.73686122 230.4726963 2.785610826 0.0772639 789939 13.92168319 21.61162952 6.231736867 0.288351087 0.0779247 ENSBTAG00000038939 149.2352343 196.5538545 101.9166141 0.518517505 0.0779266 ENSBTAG00000009218 1964.342261 1367.354527 2561.329996 1.873201094 0.0779309 ENSBTAG00000011394 1365.198091 1719.41299 1010.983191 0.587981594 0.0786517 ENSBTAG00000001535 22.98702611 11.4585595 34.51549272 3.012201729 0.0786517 ENSBTAG00000001537 199.9493783 259.9920656 139.9066909 0.538119079 0.0789981 ENSBTAG00000014538 4.596178304 8.189568066 1.002788542 0.122447061 0.0792709 ENSBTAG00000027916 54.18920175 26.12065962 82.25774388 3.149144971 0.0792709 514332 5.293897825 9.005723589 1.582072061 0.175674064 0.0792924

PAGE 22

ENSBTAG00000021204 523.105919 350.4930397 695.7187984 1.984971796 0.0792924 ENSBTAG00000020809 10.43311643 2.703048216 18.16318465 6.719519299 0.0792924 ENSBTAG00000016455 234.0852166 319.5428808 148.6275525 0.465125532 0.0793426 ENSBTAG00000010801 32.35155996 16.78749148 47.91562843 2.854245881 0.0796689 ENSBTAG00000001662 6317.475924 7883.627444 4751.324403 0.602682513 0.0798748 ENSBTAG00000021116 1685.84949 1177.289351 2194.409629 1.863950971 0.0798748 ENSBTAG00000000738 554.9738603 343.1607352 766.7869855 2.234483456 0.0798748 505542 6.160197691 10.78071767 1.53967771 0.142817738 0.0799872 ENSBTAG00000015810 10.31401882 2.991808851 17.6362288 5.894838099 0.0799916 ENSBTAG00000039120 2.061847638 4.123695277 0 0 0.0800224 ENSBTAG00000006039 25.93426717 39.20751263 12.66102171 0.32292336 0.0800747 ENSBTAG00000037488 82.17072765 47.25404585 117.0874095 2.477828244 0.0800747 ENSBTAG00000038800 2.046421529 4.092843058 0 0 0.0801194 ENSBTAG00000010786 15.47894978 24.27994356 6.677955995 0.275040013 0.0803066 ENSBTAG00000004772 1193.05045 800.890978 1585.209922 1.979308003 0.0803066 ENSBTAG00000016979 995.1762372 692.3267227 1298.025752 1.874874549 0.080325 ENSBTAG00000032007 8.485732387 13.60287322 3.368591557 0.247638238 0.0803334 ENSBTAG00000019134 6.507140041 11.23871202 1.775568066 0.157986793 0.0806971 ENSBTAG00000014831 26.93152686 38.20644717 15.65660655 0.409789648 0.0809703 ENSBTAG00000004518 32.60362886 13.89988514 51.30737258 3.691208385 0.0809985 ENSBTAG00000011375 1.969290983 3.938581966 0 0 0.081038 ENSBTAG00000020793 3736.014204 4655.880435 2816.147972 0.60485831 0.081038 617881 18.37881781 27.64876816 9.108867465 0.329449305 0.0811297 ENSBTAG00000005234 229.610017 306.8228427 152.3971913 0.496694412 0.0811297 ENSBTAG00000006050 5260.467046 6450.543451 4070.390642 0.63101515 0.0811297 ENSBTAG00000000403 61.72941155 31.06487976 92.39394335 2.974225044 0.0811297 ENSBTAG00000021657 2.625425593 0 5.250851185 NA 0.0811297 281152 1325.926356 859.1962663 1792.656446 2.086434167 0.0813254 ENSBTAG00000021082 84.67552758 45.66902181 123.6820334 2.708226024 0.0813254 282191 195.3072765 260.0339536 130.5805994 0.502167496 0.0821442 ENSBTAG00000037539 18.82845939 27.70326388 9.953654899 0.359295386 0.0823355 ENSBTAG00000023172 251.6437056 168.741951 334.5454603 1.982586181 0.082416 616999 1.855762884 3.711525768 0 0 0.0824481 ENSBTAG00000005616 1.855762884 3.711525768 0 0 0.0824481 532276 8.736022176 1.802032144 15.67001221 8.695745112 0.0826229 530550 16.74860204 6.80746933 26.68973474 3.920654423 0.0829605 618635 886.4448828 1070.470985 702.4187809 0.656177319 0.0830784 ENSBTAG00000004414 1.051185417 2.102370835 0 0 0.0831991 ENSBTAG00000005433 1.051185417 2.102370835 0 0 0.0831991 ENSBTAG00000011254 1.051185417 2.102370835 0 0 0.0831991 ENSBTAG00000040090 1.051185417 2.102370835 0 0 0.0831991 ENSBTAG00000044253 1.051185417 2.102370835 0 0 0.0831991 ENSBTAG00000011862 3.306493137 6.141205562 0.471780712 0.076822166 0.0831991 512960 160.0803863 219.6087955 100.5519772 0.457868625 0.0831991 ENSBTAG00000038439 3310.568329 4087.759458 2533.377199 0.619747132 0.0831991 ENSBTAG00000015460 7.541577048 2.367975357 12.71517874 5.369641496 0.0831991 ENSBTAG00000011666 7.786321667 12.42128 3.15136333 0.25370681 0.0832343 ENSBTAG00000020667 7.331547803 11.96668022 2.696415385 0.225326936 0.0833244 ENSBTAG00000017280 334.1943893 427.1908977 241.197881 0.564613812 0.0833516 ENSBTAG00000021066 1.742234785 3.484469571 0 0 0.0834621 ENSBTAG00000010345 168.3878712 95.03091819 241.7448242 2.54385445 0.0834621 407110 638.8952178 867.2958878 410.4945478 0.473303925 0.083613

PAGE 23

ENSBTAG00000037549 240.9626529 155.1557837 326.769522 2.106073742 0.0836354 ENSBTAG00000017263 549.3016351 733.5471806 365.0560897 0.497658636 0.0843105 534524 1212.715662 836.388058 1589.043267 1.89988756 0.0843105 ENSBTAG00000017664 15.09974248 23.70914363 6.490341327 0.27374845 0.0845159 ENSBTAG00000004976 81.00373542 111.9071479 50.10032298 0.447695468 0.0845159 ENSBTAG00000017864 345.4818209 202.722861 488.2407807 2.408415007 0.0845224 100298818 74.61933302 104.738055 44.50061104 0.424875286 0.084524 ENSBTAG00000018774 200.1279823 119.1715055 281.0844591 2.358654931 0.0845395 ENSBTAG00000016276 50.87276065 70.06272859 31.68279271 0.452206092 0.0849689 ENSBTAG00000008862 7303.915612 5208.083741 9399.747483 1.804838008 0.0849689 ENSBTAG00000001081 217.8836388 121.283238 314.4840397 2.592971996 0.0849689 ENSBTAG00000003774 38.55123847 53.8653112 23.23716573 0.431393882 0.0849878 534069 87.95552976 52.31723773 123.5938218 2.36239196 0.0849878 515372 415.0210258 272.9944227 557.0476288 2.040509192 0.0851973 787830 1.180139625 2.360279251 0 0 0.0855923 540672 4319.43092 5369.059598 3269.802243 0.609008372 0.0855923 ENSBTAG00000002880 384.8822971 236.2032022 533.5613921 2.258908377 0.0855923 ENSBTAG00000019529 3.16211282 5.852444928 0.471780712 0.080612585 0.0856634 ENSBTAG00000034743 7.092445471 11.67791959 2.506971356 0.214676196 0.0857179 ENSBTAG00000031682 34.954924 51.07733465 18.83251335 0.368705875 0.0857179 ENSBTAG00000016137 42.19763342 62.09619918 22.29906765 0.359105194 0.0857406 ENSBTAG00000043950 45.80469505 23.77140324 67.83798687 2.853764507 0.0857503 ENSBTAG00000005230 1.453474151 2.906948301 0 0 0.085871 ENSBTAG00000032262 2.300431588 4.335359262 0.265503915 0.061241503 0.085871 ENSBTAG00000013555 1.339946052 2.679892104 0 0 0.0859726 ENSBTAG00000037676 1.339946052 2.679892104 0 0 0.0859726 ENSBTAG00000018311 9.105344358 14.24598087 3.964707843 0.278303606 0.0859726 ENSBTAG00000043582 1424.712208 1718.194574 1131.229841 0.658382851 0.0859726 ENSBTAG00000004259 341.2912958 201.562894 481.0196977 2.38644965 0.0859726 ENSBTAG00000014567 71.05604268 36.66281083 105.4492745 2.876191763 0.0859726 ENSBTAG00000013801 10.17654062 16.63704455 3.716036695 0.223359184 0.086035 ENSBTAG00000039756 3.384656059 5.937305477 0.832006642 0.140132025 0.086156 524255 34.33119467 16.77209927 51.89029008 3.093845871 0.0863269 ENSBTAG00000006821 88.0301107 122.3943838 53.66583765 0.438466505 0.0866487 ENSBTAG00000015874 993.8393611 1298.97847 688.7002526 0.530186041 0.0866582 790874 216.6970144 292.3378929 141.0561359 0.482510613 0.0872929 ENSBTAG00000025430 241.5503955 152.1297281 330.9710629 2.175584398 0.0872929 514634 35.19590621 16.02534429 54.36646812 3.392530427 0.0872929 ENSBTAG00000007649 8656.707124 6633.977524 10679.43672 1.609809 0.0874553 ENSBTAG00000018403 14.43940731 22.27691851 6.601896109 0.296355894 0.0877305 538275 27660.51423 34703.55885 20617.4696 0.594102458 0.0877305 ENSBTAG00000044174 2.17209671 4.108303064 0.235890356 0.057417954 0.0881519 ENSBTAG00000005354 795.7658145 529.5257601 1062.005869 2.005579235 0.088394 ENSBTAG00000005397 4610.179154 3364.162457 5856.19585 1.740758933 0.0892243 ENSBTAG00000001712 480.3447389 612.5835556 348.1059222 0.568258679 0.0894179 ENSBTAG00000010913 8.763961211 2.533327118 14.9945953 5.918933722 0.0894866 100336046 24.44391112 35.49944921 13.38837303 0.37714312 0.0898686 ENSBTAG00000040575 70.31618881 96.57066827 44.06170936 0.456263896 0.0901058 ENSBTAG00000011554 131.1296946 176.4967486 85.76264056 0.485916263 0.0901058 ENSBTAG00000032739 42.91008977 55.06043203 30.75974752 0.558654307 0.0901058 100138186 9029.114561 11033.74241 7024.486707 0.636636822 0.0901058 ENSBTAG00000015354 3274.737147 2322.758237 4226.716057 1.819696941 0.0901058

PAGE 24

ENSBTAG00000017660 26.48146151 12.98722322 39.9756998 3.078079057 0.0901058 537776 3162.421377 3888.05426 2436.788494 0.626737265 0.0902054 ENSBTAG00000008467 58.95542833 82.16439574 35.74646092 0.43506023 0.0902186 ENSBTAG00000004995 1766.314318 1294.659749 2237.968888 1.728615483 0.0902186 ENSBTAG00000005371 727.3359994 484.7351191 969.9368798 2.000962673 0.0902186 517113 10.71853422 4.269772875 17.16729557 4.020657789 0.0902186 ENSBTAG00000006987 460.9869895 291.0357517 630.9382273 2.167906258 0.0908076 100336745 55.91056793 30.72925172 81.09188413 2.638915027 0.0908465 539465 16.87724874 7.55034236 26.20415512 3.470591646 0.0912182 ENSBTAG00000001013 706.311532 470.2647052 942.3583589 2.003889189 0.0912635 786591 291.2869198 397.7436695 184.8301701 0.464696699 0.0917846 ENSBTAG00000008683 843.4508567 589.8060262 1097.095687 1.860095758 0.0920276 ENSBTAG00000016250 152.4140678 93.47299569 211.35514 2.261135833 0.0920276 ENSBTAG00000012863 135.7221684 73.38060477 198.0637321 2.699129187 0.0921223 ENSBTAG00000020133 1246.861265 908.763923 1584.958608 1.744081788 0.0923759 530549 17.36157281 26.6170667 8.106078923 0.304544412 0.0924308 ENSBTAG00000009844 789.4614256 569.5000981 1009.422753 1.772471605 0.0924366 ENSBTAG00000021964 144.7766537 197.3196125 92.23369489 0.467432982 0.0925127 ENSBTAG00000000758 322.6188779 423.8414485 221.3963074 0.522356433 0.0925127 ENSBTAG00000027924 8960.091685 6651.923938 11268.25943 1.693985009 0.0925127 ENSBTAG00000008078 87.41026427 123.6249424 51.19558618 0.414120203 0.0926348 ENSBTAG00000008734 431.8380609 276.5257469 587.1503749 2.123311777 0.0929152 ENSBTAG00000039818 4.718724155 8.405046208 1.032402102 0.122831223 0.0933009 ENSBTAG00000011105 6826.861354 8906.718088 4747.00462 0.532968999 0.0939176 ENSBTAG00000039201 1.831975764 3.303725597 0.36022593 0.109036274 0.0940643 ENSBTAG00000009521 142.1231159 194.8022834 89.44394836 0.459152464 0.0948782 ENSBTAG00000030222 189.545671 242.2787536 136.8125884 0.564690822 0.0949489 ENSBTAG00000017437 219.0334751 291.7540527 146.3128974 0.501493967 0.0953461 789476 128.7853528 165.4402299 92.13047567 0.556880728 0.0956725 ENSBTAG00000017564 73.09985666 37.76821438 108.4314989 2.870972344 0.0958515 ENSBTAG00000011580 574.1923792 345.6246704 802.7600879 2.322635381 0.0961553 ENSBTAG00000009812 64.47301877 37.66685125 91.27918628 2.423329353 0.0961553 ENSBTAG00000003090 28.02876284 41.45117212 14.60635356 0.352374922 0.0961863 ENSBTAG00000012117 2623.966147 1759.452648 3488.479645 1.98270732 0.0963358 ENSBTAG00000010579 107.5195039 69.4391791 145.5998287 2.096796514 0.0963358 ENSBTAG00000007101 112.3556641 69.22869327 155.4826349 2.245927629 0.0963358 ENSBTAG00000026232 68.1508062 35.82731335 100.4742991 2.804405066 0.0963358 ENSBTAG00000011154 133.4432021 83.43799042 183.4484138 2.198619752 0.0964583 ENSBTAG00000014923 637.5116943 818.5229425 456.500446 0.557712463 0.0965868 ENSBTAG00000030841 81.66361172 46.69289157 116.6343319 2.497903384 0.0966287 ENSBTAG00000007863 388.0492664 526.100261 249.9982718 0.475191309 0.0968476 ENSBTAG00000038981 8.930318105 14.31538142 3.545254794 0.247653534 0.0971612 ENSBTAG00000005936 4.972444945 8.316371502 1.628518387 0.195820784 0.0972257 ENSBTAG00000004879 594.0871753 781.0287237 407.1456269 0.52129405 0.0972257 100337507 43.71243918 23.88323406 63.54164429 2.660512564 0.0972257 ENSBTAG00000023007 14.00691911 4.50508036 23.50875785 5.218277139 0.0990007 537655 1007.051868 736.9710063 1277.132729 1.732948404 0.0990108 ENSBTAG00000033308 216.0795578 139.4388938 292.7202217 2.099272403 0.0990108 ENSBTAG00000006777 297.4005677 184.1839468 410.6171886 2.229386413 0.0994761 506406 523.1374743 364.6836857 681.591263 1.86899302 0.0996991 ENSBTAG00000008913 70.72426822 100.5487733 40.89976311 0.406765411 0.0998979 ENSBTAG00000004735 222.9396619 302.5196622 143.3596617 0.473885435 0.0998979

PAGE 25

534295 221.059389 146.733612 295.385166 2.013070911 0.0998979 ENSBTAG00000005016 4902.801348 3564.21992 6241.382777 1.751121681 0.0999071 ENSBTAG00000000054 2.33071374 0 4.66142748 NA 0.100112 ENSBTAG00000003444 160.5924917 101.5458762 219.6391071 2.162954473 0.1002964 511594 56.39574653 30.12524757 82.6662455 2.744085183 0.1006765 100336206 15.45548678 23.28255668 7.628416874 0.327645154 0.1008315 ENSBTAG00000004401 11.20670173 17.93046858 4.482934881 0.25001772 0.1010631 ENSBTAG00000034626 6582.425364 7925.73181 5239.118919 0.66102652 0.1020106 ENSBTAG00000018000 1308.677419 878.4731076 1738.88173 1.979436496 0.1020778 ENSBTAG00000039621 8.36076425 13.46449173 3.257036775 0.241898234 0.1022929 100296618 8.343504195 13.02147 3.665538393 0.281499584 0.102329 ENSBTAG00000003282 49928.98632 61106.41516 38751.55748 0.634165126 0.102329 ENSBTAG00000021923 1697.72465 1184.405961 2211.043339 1.86679518 0.102329 ENSBTAG00000017970 1378.592099 881.9546957 1875.229502 2.126219761 0.1023368 614540 334.5506973 448.2404908 220.8609038 0.492728587 0.1026237 ENSBTAG00000002349 1028.52418 1307.096005 749.9523552 0.573754607 0.1026237 ENSBTAG00000021908 3.039466362 5.105757741 0.973174983 0.190603439 0.1026632 ENSBTAG00000013185 50.73575039 25.87807562 75.59342516 2.92113781 0.1027762 ENSBTAG00000007808 32.65961659 47.41932982 17.89990335 0.377481154 0.1028835 ENSBTAG00000015119 39.93420523 21.26892834 58.59948212 2.755168534 0.1032193 ENSBTAG00000016845 311.9167692 199.4219705 424.411568 2.128208677 0.1033459 ENSBTAG00000006735 16.37290948 24.7147818 8.031037155 0.324948738 0.1034768 541268 34.30634878 17.26475999 51.34793756 2.974147199 0.1036294 ENSBTAG00000001212 1784.658262 1257.895918 2311.420606 1.8375293 0.1041193 ENSBTAG00000006762 72.54255749 38.45375231 106.6313627 2.772976791 0.1041193 ENSBTAG00000017831 1390.989802 961.421764 1820.55784 1.893609972 0.1041787 ENSBTAG00000018972 3818.996753 2733.558653 4904.434854 1.794157535 0.1042863 783970 51.12861559 28.8274542 73.42977699 2.547216847 0.1042863 ENSBTAG00000014713 83.00009821 117.1442268 48.85596961 0.417058279 0.1046221 ENSBTAG00000012444 338.728995 434.7126505 242.7453394 0.55840413 0.1049069 ENSBTAG00000005968 15.87759305 6.660904344 25.09428176 3.767398609 0.10557 ENSBTAG00000013391 223.7153159 143.4976257 303.933006 2.118035086 0.1056455 ENSBTAG00000016758 200.9332116 120.458276 281.4081472 2.336146229 0.1058899 ENSBTAG00000000120 14.42436608 6.0409528 22.80777937 3.775526828 0.1058899 618091 7.102662729 10.45784584 3.747479616 0.358341447 0.1059569 ENSBTAG00000007893 1023.7435 676.9969474 1370.490053 2.024366665 0.1059569 ENSBTAG00000009502 1653.841301 1127.374641 2180.307962 1.933969315 0.1061134 521962 4.196110303 6.822929336 1.569291269 0.230002568 0.1063066 ENSBTAG00000030434 1112.596348 813.8784637 1411.314233 1.734060177 0.1063066 ENSBTAG00000009995 297.7990135 191.1720923 404.4259347 2.115507184 0.1063066 525199 4.623411923 7.412028661 1.834795184 0.247542915 0.1066112 100298625 11.05517737 3.904402979 18.20595176 4.662928458 0.1066112 ENSBTAG00000002033 50.46479949 71.55319579 29.37640319 0.410553335 0.1068879 ENSBTAG00000011459 40.29820222 56.9760918 23.62031264 0.414565336 0.1068879 ENSBTAG00000018013 32.45068659 45.03361026 19.86776293 0.441176331 0.1068879 ENSBTAG00000013667 38.51902287 53.24917382 23.78887192 0.44674631 0.1068879 ENSBTAG00000017505 407.7814708 517.9641419 297.5987997 0.57455483 0.1068879 100300175 2.196490267 3.861972704 0.53100783 0.137496526 0.1075561 ENSBTAG00000021617 25.65164981 37.37032672 13.9329729 0.372835191 0.1077337 ENSBTAG00000004557 72.18025138 39.55097236 104.8095304 2.649986186 0.1078682 532829 11.65858865 4.354633424 18.96254388 4.3545672 0.107873 ENSBTAG00000006779 40.6182298 58.80877278 22.42768681 0.381366346 0.1082996

PAGE 26

ENSBTAG00000011658 1322.637008 1706.389943 938.8840727 0.5502166 0.1082996 ENSBTAG00000014289 577.055681 751.688885 402.422477 0.535357759 0.1085641 ENSBTAG00000005116 262.8541185 158.8994755 366.8087615 2.308432803 0.1085641 786100 9.12096101 15.11510216 3.126819864 0.206867266 0.1086554 ENSBTAG00000016681 13.68992423 20.91506871 6.464779743 0.309096749 0.1086554 ENSBTAG00000008063 17.20399531 22.68687161 11.72111901 0.516647655 0.1086554 ENSBTAG00000006933 541.0919121 688.3993327 393.7844916 0.572029159 0.1086554 504664 188.343961 116.0291819 260.6587401 2.246492958 0.1086554 ENSBTAG00000009506 309.410616 183.5794596 435.2417723 2.37086313 0.1086554 ENSBTAG00000007624 72.5687012 45.16797421 99.96942819 2.2132812 0.1091792 ENSBTAG00000017690 51.66564053 23.51072324 79.82055782 3.395070284 0.1097307 ENSBTAG00000011782 15.05576801 22.01235656 8.099179468 0.367937865 0.1097483 537203 166.902138 216.8107074 116.9935687 0.539611581 0.1097483 537487 35.9019307 50.45787049 21.3459909 0.423045814 0.1097798 ENSBTAG00000004167 7.686687021 11.89727968 3.476094364 0.292175561 0.1098325 ENSBTAG00000031582 3.379330381 5.802318547 0.956342216 0.164820702 0.1098913 ENSBTAG00000012550 457.0565598 295.0701999 619.0429198 2.097951335 0.1101848 ENSBTAG00000020106 1799.731534 1232.907645 2366.555422 1.919491238 0.1102602 ENSBTAG00000019790 19.28780955 28.82641163 9.749207464 0.338203991 0.1104871 100300010 9.678195821 4.104421114 15.25197053 3.715985788 0.1110656 ENSBTAG00000001007 3.729164356 0.589099325 6.869229386 11.66056231 0.1111697 ENSBTAG00000023182 96.48272163 131.2430069 61.72243639 0.47029124 0.1126621 532645 1083.7006 1396.399048 771.0021514 0.552135976 0.1126621 ENSBTAG00000002720 4721.782546 6040.809567 3402.755525 0.563294619 0.1126621 ENSBTAG00000017759 14.67493127 5.837052715 23.51280983 4.028198986 0.1126621 ENSBTAG00000011178 24.79133554 33.48693124 16.09573984 0.480657356 0.1128545 ENSBTAG00000003835 3193.355684 3930.480354 2456.231014 0.624918787 0.1128545 281572 677.1785853 470.1821082 884.1750624 1.880494913 0.1129637 ENSBTAG00000003567 577.3741841 760.3198864 394.4284819 0.518766494 0.1129671 ENSBTAG00000019498 15.42525836 5.609996517 25.2405202 4.499204254 0.1129671 ENSBTAG00000020940 1452.397754 1006.980493 1897.815015 1.884659164 0.1133488 785834 11.0465063 17.68025627 4.412756332 0.249586673 0.1138935 100336486 338.653217 215.8942184 461.4122155 2.137214321 0.1141984 ENSBTAG00000007740 77.53766386 106.860323 48.21500475 0.45119651 0.11428 ENSBTAG00000008294 92.8421472 126.8154428 58.86885163 0.464208856 0.11428 ENSBTAG00000000081 7473.060886 5519.839146 9426.282626 1.707709659 0.11428 ENSBTAG00000018588 6281.010361 4575.267008 7986.753715 1.745636637 0.11428 ENSBTAG00000019726 2.342003568 4.323781206 0.36022593 0.08331271 0.1143871 ENSBTAG00000017455 694.861017 473.8830007 915.8390333 1.932626897 0.1147276 ENSBTAG00000014072 3.078573916 5.655753561 0.501394271 0.088652072 0.114795 ENSBTAG00000013749 39.71304314 19.57491286 59.85117342 3.05754482 0.114795 ENSBTAG00000001950 101.3248013 54.0823871 148.5672156 2.747053589 0.1150324 528332 9.831625613 15.88210607 3.78114515 0.238075803 0.1152493 ENSBTAG00000008619 142.6110194 85.63832982 199.583709 2.33054182 0.1155337 ENSBTAG00000009703 50.73390011 25.17770066 76.29009956 3.030066192 0.1155337 ENSBTAG00000007438 11677.52663 8765.72669 14589.32656 1.664360192 0.1157123 ENSBTAG00000030951 230.0106495 142.8917398 317.1295593 2.219369431 0.1159591 ENSBTAG00000015825 45.96186833 64.11377726 27.8099594 0.433759491 0.1164716 ENSBTAG00000006928 9607.24003 7252.993839 11961.48622 1.649179151 0.1164716 ENSBTAG00000003056 5.019911628 8.205028072 1.834795184 0.223618392 0.1166565 511907 13.36466853 21.12617751 5.603159542 0.265223538 0.1169511 ENSBTAG00000034139 35.42018581 51.41864145 19.42173018 0.377717684 0.1169511

PAGE 27

ENSBTAG00000018658 18.7160551 26.17466795 11.25744225 0.43008921 0.1169695 536666 1060.883852 1320.5775 801.1902043 0.606696846 0.1169695 ENSBTAG00000006758 121.4415172 71.86240874 171.0206256 2.379834306 0.1169695 ENSBTAG00000019876 58.09293597 33.35125354 82.83461841 2.483703298 0.1169695 ENSBTAG00000015820 543.8677101 380.4083394 707.3270808 1.859388997 0.1171513 ENSBTAG00000032534 42.08226189 56.76123663 27.40328715 0.482781715 0.1171584 ENSBTAG00000013680 289.811307 383.0944655 196.5281485 0.513001795 0.1175617 ENSBTAG00000004679 159.1981444 97.97426189 220.4220268 2.249795228 0.1175919 ENSBTAG00000004173 193.4653022 124.3705741 262.5600304 2.111110544 0.117861 100335206 0.901016072 1.802032144 0 0 0.1182567 534570 0.901016072 1.802032144 0 0 0.1182567 790460 0.901016072 1.802032144 0 0 0.1182567 ENSBTAG00000010005 0.901016072 1.802032144 0 0 0.1182567 ENSBTAG00000034845 0.901016072 1.802032144 0 0 0.1182567 ENSBTAG00000017183 122.4869996 170.3444652 74.62953388 0.438109532 0.118458 ENSBTAG00000015205 3956.243733 4901.029361 3011.458105 0.614454206 0.118458 ENSBTAG00000018481 15.43994642 6.433848147 24.44604469 3.799599265 0.118458 ENSBTAG00000018007 82.63120175 115.1852126 50.07719088 0.434753644 0.1188062 507139 119.7240602 81.06364554 158.3844749 1.953828672 0.1188062 ENSBTAG00000010007 103.425212 56.95508862 149.8953353 2.631816382 0.1191898 ENSBTAG00000035419 446.415271 563.4757878 329.3547542 0.584505601 0.1193251 ENSBTAG00000010242 970.7223513 648.2900584 1293.154644 1.994716142 0.1195331 ENSBTAG00000009423 61.76079503 34.76864163 88.75294843 2.552672301 0.1196727 ENSBTAG00000019115 128.5819393 173.6236953 83.54018326 0.481156579 0.1201469 280794 109825.5165 143136.7944 76514.23865 0.53455325 0.1201469 ENSBTAG00000012916 4124.30369 3135.920496 5112.686884 1.630362406 0.1201469 ENSBTAG00000011985 16.15459575 6.253104173 26.05608732 4.166904405 0.1201469 ENSBTAG00000009846 2570.397952 1821.268334 3319.52757 1.82264607 0.1205826 ENSBTAG00000005400 1051.831601 754.4956998 1349.167503 1.788171229 0.1206194 ENSBTAG00000017819 39.60089589 21.26941573 57.93237604 2.723740829 0.1206194 ENSBTAG00000010693 95.34823813 56.43767403 134.2588022 2.37888617 0.1210099 ENSBTAG00000016401 5709.087392 4124.126441 7294.048342 1.768628689 0.1213679 281786 12.72006697 19.23984 6.200293946 0.32226328 0.12146 ENSBTAG00000005410 21.25601011 29.85139176 12.66062846 0.424121882 0.12146 ENSBTAG00000008716 14060.49505 18049.85268 10071.13741 0.557962305 0.12146 ENSBTAG00000009167 431.4297867 283.5456516 579.3139218 2.043106352 0.12146 ENSBTAG00000030671 164.2341223 105.2887416 223.1795029 2.119690098 0.12146 ENSBTAG00000014054 22.41921038 11.45086339 33.38755736 2.915724014 0.12146 ENSBTAG00000014721 5.631857602 1.189776707 10.0739385 8.467083312 0.12146 ENSBTAG00000006988 2.212768562 0 4.425537124 NA 0.12146 ENSBTAG00000001191 2.206887225 0 4.41377445 NA 0.12146 522049 1.736445757 3.472891515 0 0 0.1217407 ENSBTAG00000031757 37.62158915 50.01990887 25.22326944 0.504264602 0.1217407 ENSBTAG00000013538 81.02319844 102.8469329 59.199464 0.575607481 0.1217407 ENSBTAG00000020023 5889.192768 7150.255476 4628.130061 0.64726779 0.1217407 ENSBTAG00000019912 6.29612334 10.55705604 2.035190644 0.192780131 0.1221859 ENSBTAG00000013369 5.013603878 8.693806843 1.333400913 0.153373653 0.1223727 ENSBTAG00000018761 793.3842953 528.9526459 1057.815945 1.999831086 0.1223727 526482 1.67474132 3.34948264 0 0 0.1227341 ENSBTAG00000010009 1123.317601 804.4911938 1442.144008 1.792616277 0.122875 ENSBTAG00000011024 214.9153573 145.9478213 283.8828934 1.945098535 0.122875 ENSBTAG00000015541 354.6142254 228.8802 480.3482508 2.098688531 0.122875

PAGE 28

528338 3.843842274 6.229948061 1.457736487 0.233988546 0.1229982 ENSBTAG00000010254 1.892973157 3.550055957 0.235890356 0.06644694 0.1233621 ENSBTAG00000024846 2.707137401 4.912880531 0.501394271 0.102057086 0.1233621 ENSBTAG00000039348 7.765500601 11.66689671 3.864104491 0.331202426 0.1233621 ENSBTAG00000019314 338.9296621 227.9101987 449.9491255 1.974238661 0.1239992 516940 1.02997028 2.05994056 0 0 0.1240303 ENSBTAG00000005838 4.915501888 8.497602864 1.333400913 0.156914948 0.1241347 ENSBTAG00000003026 1141.054564 774.0318061 1508.077322 1.948340249 0.124236 790453 1.045396389 2.090792779 0 0 0.1244813 ENSBTAG00000043997 1.545787112 3.091574224 0 0 0.1246144 509942 5.59148789 9.194231462 1.988744317 0.216303486 0.1251411 ENSBTAG00000037505 1.778825728 3.292147541 0.265503915 0.080647636 0.1253688 ENSBTAG00000038992 4.093301965 6.522590645 1.664013284 0.255115394 0.1253688 ENSBTAG00000025441 89.9256726 124.3403406 55.51100463 0.446444045 0.1253688 ENSBTAG00000017769 57.50426511 78.5878569 36.42067333 0.463438943 0.1253688 ENSBTAG00000011849 6211.646929 8056.446709 4366.847148 0.542031407 0.1253688 789240 593.2619252 418.0916212 768.4322292 1.837951756 0.1253688 ENSBTAG00000039977 1.447685123 2.895370245 0 0 0.1258193 ENSBTAG00000027728 15.01720556 6.703334619 23.3310765 3.480517955 0.1259209 616071 21.31830546 29.06671143 13.56989949 0.466853621 0.1260752 ENSBTAG00000037322 107.0706764 139.1106101 75.03074279 0.539360317 0.1261493 ENSBTAG00000018959 2793.812163 2084.932915 3502.69141 1.680001973 0.1262268 ENSBTAG00000031718 53.54182553 70.75645001 36.32720105 0.513411866 0.1265079 100313139 1.174350597 2.348701195 0 0 0.1265653 100126827 34.01151965 49.35725588 18.66578342 0.37817709 0.1265653 ENSBTAG00000015249 569.2130555 372.7714796 765.6546313 2.053951746 0.12667 ENSBTAG00000011133 1530.919753 2000.421924 1061.417582 0.530596855 0.1267619 ENSBTAG00000021553 115.3388914 68.21598197 162.4618009 2.381579744 0.1267619 ENSBTAG00000003994 244.1876922 321.5996301 166.7757542 0.518581922 0.1273083 ENSBTAG00000015654 73.26939314 43.49669525 103.042091 2.368963675 0.1275691 ENSBTAG00000009780 6576.865691 4874.537622 8279.193761 1.698457249 0.1281114 516896 38.15534773 55.02840165 21.28229382 0.386751081 0.128757 511031 469.5691017 608.9228091 330.2153942 0.542294342 0.1291493 ENSBTAG00000021339 36.44881603 50.71924126 22.1783908 0.437277653 0.1295633 ENSBTAG00000024803 420.2421668 261.6490799 578.8352537 2.212257937 0.1296133 508251 167.8270311 111.809332 223.8447302 2.002021889 0.1300951 520925 29.94764104 15.57844062 44.31684147 2.844754656 0.1310181 ENSBTAG00000039719 38.31008045 18.62813975 57.99202115 3.113140761 0.1310181 ENSBTAG00000043572 1828.605532 2211.487113 1445.72395 0.653733834 0.1310726 ENSBTAG00000016750 219.4003899 140.7116493 298.0891304 2.118439602 0.1310726 100295148 3.758857948 6.780431269 0.737284627 0.108737129 0.1311116 ENSBTAG00000015698 42.88560226 23.49803482 62.2731697 2.650143732 0.1311116 ENSBTAG00000002976 7450.214523 9059.855569 5840.573476 0.644665186 0.1313978 524212 5.74273175 8.651931749 2.833531751 0.327502786 0.1318231 ENSBTAG00000018657 16.95346151 6.788195168 27.11872785 3.994983524 0.1318231 ENSBTAG00000025449 4.531243929 7.734968283 1.327519576 0.17162573 0.1326072 ENSBTAG00000002633 92.29095804 124.2563913 60.32552476 0.485492329 0.1326175 ENSBTAG00000015053 664.1450162 497.4152402 830.8747923 1.670384671 0.1326175 ENSBTAG00000012088 80.51711904 110.0631728 50.97106525 0.463107359 0.1326231 ENSBTAG00000038167 88.06765906 114.2420546 61.89326352 0.541773025 0.1326231 ENSBTAG00000022007 2870.925616 3736.287116 2005.564116 0.536779978 0.132727 ENSBTAG00000011383 11342.1495 8477.277184 14207.02181 1.675894453 0.1327996

PAGE 29

ENSBTAG00000020384 607.9029126 446.9074295 768.8983958 1.72048694 0.1327996 ENSBTAG00000020316 4165.049446 3003.284037 5326.814854 1.773663359 0.1327996 ENSBTAG00000018152 2758.516128 1853.358198 3663.674059 1.976776029 0.1327996 ENSBTAG00000010628 669.8623483 843.3752922 496.3494043 0.588527325 0.1328056 538904 135.1654404 186.2345214 84.09635942 0.451561605 0.1328533 ENSBTAG00000012838 28.80644966 15.29737609 42.31552324 2.766194869 0.1330491 ENSBTAG00000016369 487.1256947 626.1816527 348.0697367 0.555860644 0.1331047 ENSBTAG00000013298 451.7046289 322.1818897 581.227368 1.804034884 0.1333645 ENSBTAG00000000495 49.4705218 29.54717112 69.39387248 2.348579233 0.1333645 ENSBTAG00000008013 169.4142422 94.13489443 244.6935899 2.599393045 0.1334638 ENSBTAG00000014269 1355.699333 1668.916745 1042.481921 0.624645852 0.1341303 ENSBTAG00000006626 7.98592056 2.575757392 13.39608373 5.200832877 0.1341355 ENSBTAG00000005210 357.6305539 467.0538966 248.2072112 0.531431625 0.1341951 ENSBTAG00000000163 2168.956705 2770.749218 1567.164192 0.565610262 0.1341951 407151 35423.13756 43981.82781 26864.4473 0.610807887 0.1341951 ENSBTAG00000024561 2135.857864 2697.685199 1574.03053 0.583474503 0.1345379 ENSBTAG00000000672 1340.189449 1719.724555 960.6543431 0.558609424 0.134729 ENSBTAG00000011515 912.802066 1132.608397 692.9957345 0.611858199 0.134729 ENSBTAG00000004440 207.8100311 141.5218549 274.0982073 1.936790664 0.134729 ENSBTAG00000018784 358.3389699 222.4668042 494.2111356 2.22150508 0.134729 ENSBTAG00000044150 14.40817824 21.83050222 6.985854262 0.320004285 0.1347783 ENSBTAG00000040005 4927.010045 5969.734305 3884.285785 0.650663093 0.1347783 ENSBTAG00000020378 500.0013024 355.7400689 644.2625359 1.81104855 0.1347783 ENSBTAG00000004300 91.38239784 56.67963506 126.0851606 2.224523155 0.1347783 536993 88.9842668 48.44923447 129.5192991 2.673299187 0.1352054 ENSBTAG00000014138 35.31784763 18.93950131 51.69619395 2.729543566 0.1357458 100299238 6.730439414 11.11190858 2.348970247 0.21139215 0.1363409 ENSBTAG00000018833 14.26150063 21.25298095 7.270020306 0.342070617 0.1363409 ENSBTAG00000021801 280.8616636 181.9074856 379.8158417 2.087961584 0.1363409 522972 10.59358747 15.27428777 5.912887171 0.387113773 0.1363852 ENSBTAG00000002089 33.61270024 46.99558226 20.22981822 0.430462125 0.1363852 ENSBTAG00000021949 251.9634002 334.0844963 169.8423041 0.508381281 0.1363852 ENSBTAG00000019455 58.29064236 34.04018603 82.54109868 2.424813384 0.1363852 ENSBTAG00000012626 69.95646682 37.06007551 102.8528581 2.775300824 0.1363852 ENSBTAG00000017718 89.11386941 50.44795798 127.7797808 2.532902935 0.136754 ENSBTAG00000001567 12.73581881 4.720558501 20.75107911 4.395894915 0.1368636 ENSBTAG00000020665 19467.55743 24050.8438 14884.27106 0.618866896 0.1378403 ENSBTAG00000007502 8151.818265 5721.581867 10582.05466 1.849498078 0.1378413 ENSBTAG00000009109 106.7464828 67.86822069 145.6247449 2.145698582 0.1378413 ENSBTAG00000020515 177.5504117 226.9792923 128.121531 0.564463523 0.1379489 513329 11.58303782 4.354633424 18.81144222 4.319868148 0.139196 ENSBTAG00000004575 235.3496401 148.1478767 322.5514035 2.177225963 0.1392489 518291 10.32288787 13.84975876 6.79601698 0.490695694 0.1393765 ENSBTAG00000020755 62.92882829 86.872821 38.98483557 0.448757564 0.1396323 ENSBTAG00000006045 1048.286211 728.3733705 1368.199051 1.878430907 0.1396323 ENSBTAG00000012371 300.869536 205.3343865 396.4046855 1.930532398 0.1396323 ENSBTAG00000001079 8.356258801 2.876096083 13.83642152 4.810834242 0.1397298 ENSBTAG00000003128 171.3315002 115.4851489 227.1778516 1.967160746 0.1399748 ENSBTAG00000010037 13.45676197 20.78340855 6.130115398 0.29495236 0.1400986 ENSBTAG00000006551 1715.530106 2196.366167 1234.694044 0.562153097 0.1400986 ENSBTAG00000020731 116.0811655 72.35839623 159.8039347 2.208505758 0.1400986 ENSBTAG00000019435 4.162748083 6.992095253 1.333400913 0.190701194 0.1402596

PAGE 30

ENSBTAG00000001093 29.89524483 42.27169699 17.51879268 0.414433153 0.1402596 100138100 82.61208739 109.9220875 55.30208723 0.503102593 0.1402596 ENSBTAG00000013764 1168.747288 1455.784686 881.7098896 0.605659544 0.1402596 ENSBTAG00000009287 995.4844499 687.3668007 1303.602099 1.896515947 0.1402596 ENSBTAG00000009580 1622.895376 1101.725436 2144.065316 1.946097681 0.1402596 ENSBTAG00000034952 53.04462545 28.68865311 77.40059778 2.697951607 0.1402596 ENSBTAG00000000145 2.032133472 3.592486232 0.471780712 0.131324292 0.140886 ENSBTAG00000001246 27497.33435 19200.64143 35794.02726 1.864209974 0.140886 ENSBTAG00000014903 16.7855048 7.130964133 26.44004548 3.707779899 0.140886 ENSBTAG00000039787 70.01047637 97.61271899 42.40823376 0.434453975 0.1409265 ENSBTAG00000034406 5.941401897 10.17234418 1.71045961 0.168148028 0.141083 ENSBTAG00000033245 9.798819526 15.13153694 4.466102114 0.295151916 0.141083 ENSBTAG00000015107 9763.839234 7238.888141 12288.79033 1.697607435 0.14114 510304 86.86749175 115.1202664 58.61471714 0.509160715 0.1413379 540369 5490.923504 6874.778098 4107.06891 0.597411124 0.1413709 ENSBTAG00000015022 15208.96058 19176.46281 11241.45835 0.586211256 0.1422432 ENSBTAG00000013245 105.0808854 57.54813769 152.613633 2.651930005 0.1422432 ENSBTAG00000004112 15.45854306 21.81227063 9.10481549 0.417417134 0.1424125 506096 273.5513226 342.8390372 204.263608 0.59580032 0.1424125 784441 17.11266657 7.119386077 27.10594706 3.807343325 0.1434509 ENSBTAG00000010774 1758.280857 2219.872652 1296.689062 0.58412768 0.1438161 ENSBTAG00000005710 1560.826954 1919.05141 1202.602498 0.626665076 0.1438355 ENSBTAG00000012829 469.3551347 580.7700905 357.9401789 0.616319925 0.1439388 ENSBTAG00000007013 736.6773726 517.5177385 955.8370068 1.846964724 0.1439388 ENSBTAG00000020764 354.9044972 228.4140222 481.3949723 2.107554377 0.1439388 615429 23.56659223 33.79815722 13.33502725 0.394548944 0.1442275 ENSBTAG00000013048 14.3935799 5.652426792 23.13473301 4.092885032 0.1442275 ENSBTAG00000009348 16.98664943 25.4349861 8.538312763 0.335691662 0.1444301 ENSBTAG00000031299 124.836013 69.97995318 179.6920727 2.567764975 0.1444301 ENSBTAG00000040356 10.61435752 3.592486232 17.6362288 4.909198716 0.1444301 ENSBTAG00000011215 1939.523047 1307.37488 2571.671215 1.967049585 0.1454158 ENSBTAG00000000067 279.637025 166.9727756 392.3012744 2.349492443 0.1459482 ENSBTAG00000015441 73.42227044 100.3748863 46.46965461 0.462960969 0.1462273 100337119 176.8082763 239.3353334 114.2812192 0.47749414 0.1462322 ENSBTAG00000034531 1039.177525 790.0948551 1288.260195 1.630513332 0.1462322 ENSBTAG00000000582 257.8094075 159.3327159 356.286099 2.236113888 0.1462322 ENSBTAG00000006000 56.52411918 34.62540341 78.42283495 2.264893033 0.1462322 ENSBTAG00000006862 5.224032914 1.478537341 8.969528486 6.066487626 0.1462322 ENSBTAG00000000277 233.7154871 160.3630359 307.0679383 1.914829915 0.1465299 ENSBTAG00000005227 298.869753 204.3263285 393.4131774 1.925415976 0.1469413 ENSBTAG00000005287 2.686679611 5.013133293 0.36022593 0.071856444 0.1472357 781658 5.936063326 9.352374504 2.519752148 0.269423786 0.1472357 ENSBTAG00000011001 20.49062068 28.92728737 12.053954 0.416698387 0.147286 ENSBTAG00000019948 29.47496717 42.37146236 16.57847199 0.391265042 0.1481368 ENSBTAG00000023806 2.343494532 0 4.686989064 NA 0.1481445 100337494 2.340553864 0 4.681107727 NA 0.1481445 ENSBTAG00000003217 116.2637052 65.10617615 167.4212343 2.571510787 0.1483397 100138355 14.99314497 22.60471486 7.381575088 0.326550241 0.1489311 ENSBTAG00000013173 40.46727038 55.23583188 25.69870887 0.46525431 0.1489311 ENSBTAG00000008577 2115.139087 2700.10939 1530.168783 0.566706219 0.1489311 353351 44.57644711 24.23813626 64.91475796 2.678207485 0.1489311 ENSBTAG00000004291 18.56102261 9.082888032 28.03915718 3.087031028 0.1489311

PAGE 31

ENSBTAG00000032738 2.20141151 0 4.40282302 NA 0.1489311 ENSBTAG00000015919 89.52305061 58.39188213 120.6542191 2.066284125 0.1493512 ENSBTAG00000040431 9.124392788 14.32647208 3.922313491 0.273780835 0.1494092 ENSBTAG00000007423 16.59329209 24.47566016 8.710924025 0.355901494 0.1494092 ENSBTAG00000008765 42.95169454 23.16739909 62.73598998 2.707942731 0.1494092 100335590 11.81865022 17.17657267 6.460727768 0.376136025 0.1494677 781850 55.75281218 74.43324161 37.07238275 0.498062182 0.1494677 ENSBTAG00000012619 681.3842936 440.3914925 922.3770947 2.094448032 0.1494928 ENSBTAG00000000977 691.08979 483.5594252 898.6201549 1.858344824 0.1495671 ENSBTAG00000018546 2410.108788 1724.501524 3095.716051 1.795136744 0.1496822 ENSBTAG00000037496 1.949799694 0 3.899599387 NA 0.1497284 785909 1.937933583 0 3.875867165 NA 0.1497284 ENSBTAG00000017029 7.21279376 11.20404564 3.221541878 0.287533805 0.1497734 530157 19.79470089 9.74526985 29.84413193 3.062422323 0.1498574 ENSBTAG00000003149 7.103220264 11.80514262 2.401297911 0.203411173 0.1500205 ENSBTAG00000002232 114.4504075 154.251017 74.649798 0.483950119 0.1501413 100298588 8.155578582 12.51723122 3.793925942 0.303096258 0.1502307 ENSBTAG00000021962 279.0801242 195.1599572 363.0002911 1.860014197 0.1503526 ENSBTAG00000012278 88.10203228 51.49837842 124.7056861 2.421545881 0.1503526 ENSBTAG00000007636 18.75045345 28.16791176 9.332995147 0.331334294 0.1507426 ENSBTAG00000009515 22.17602382 32.52303257 11.82901507 0.363711934 0.1509002 ENSBTAG00000002367 9.167518573 3.465195408 14.86984174 4.291198616 0.1509002 539145 1369.014516 986.8223806 1751.206651 1.774591543 0.1510701 ENSBTAG00000006079 3.753811259 0.589099325 6.918523193 11.74423887 0.1512119 ENSBTAG00000025313 1719.512617 2145.474391 1293.550843 0.602920664 0.1516271 ENSBTAG00000010397 335.6053082 231.5074567 439.7031596 1.899304523 0.1516271 ENSBTAG00000008942 49.05120365 28.83854487 69.26386244 2.401780768 0.1516271 ENSBTAG00000014821 1672.098738 2095.708237 1248.489238 0.595736189 0.1518919 510825 3792.000756 4734.306749 2849.694762 0.601924403 0.1520704 ENSBTAG00000011841 13.31954649 19.74796073 6.891132247 0.348954119 0.1522611 ENSBTAG00000010368 54.29876444 76.14258151 32.45494737 0.426239126 0.1522611 ENSBTAG00000012361 23.18146623 11.58536293 34.77756953 3.001854127 0.1524132 ENSBTAG00000010215 37.1360698 52.98294632 21.28919327 0.401812182 0.1527648 ENSBTAG00000016002 347.3031332 235.9712849 458.6349814 1.943605051 0.1527648 ENSBTAG00000038649 5.312364336 8.635984355 1.988744317 0.230285771 0.1527763 ENSBTAG00000022155 164.5030187 219.9869894 109.019048 0.495570435 0.1527763 ENSBTAG00000001801 116.52858 70.7096504 162.3475096 2.295973869 0.1528001 ENSBTAG00000003162 4566.344923 3377.588439 5755.101408 1.703908428 0.1530225 ENSBTAG00000010645 16.00016914 24.24860396 7.75173433 0.319677551 0.1530241 ENSBTAG00000003788 338.4349576 431.5822989 245.2876162 0.568344941 0.1530241 ENSBTAG00000020892 30.63986615 15.8633193 45.41641301 2.86298297 0.1530241 ENSBTAG00000021815 3.617609574 0.589099325 6.646119822 11.28183235 0.1531064 503575 2245.008957 1685.917876 2804.100038 1.663248298 0.1532047 ENSBTAG00000009183 155.0965449 200.6310891 109.5620007 0.546086856 0.1532112 ENSBTAG00000019904 563.4115558 734.3463676 392.476744 0.534457255 0.1540192 615240 1907.731569 2400.611169 1414.851969 0.589371568 0.1540812 ENSBTAG00000005339 71.43775572 37.67953967 105.1959718 2.791859261 0.1540812 ENSBTAG00000006729 18.31053562 8.235880291 28.38519095 3.446527869 0.1540812 515598 5.761505492 8.655813699 2.867197286 0.331245263 0.1543766 ENSBTAG00000006643 540.2669035 368.1270387 712.4067684 1.935219893 0.1543766 ENSBTAG00000021359 7.836103747 11.98983633 3.68237116 0.307124389 0.154681 511371 19.97318563 28.51935161 11.42701966 0.400675998 0.1546927

PAGE 32

ENSBTAG00000011600 191.9757818 255.8156293 128.1359343 0.500891735 0.1549248 ENSBTAG00000000820 26.64687032 38.82570795 14.4680327 0.372640538 0.1549573 ENSBTAG00000001182 12183.42717 9193.62065 15173.23368 1.650408937 0.1555305 ENSBTAG00000008122 483.0840053 345.6265898 620.5414208 1.795409957 0.1556414 ENSBTAG00000019849 16.2289254 23.32159239 9.136258411 0.391751054 0.1562153 100335579 16.28695504 8.139441685 24.43446839 3.001983347 0.1567172 ENSBTAG00000011609 708.6001458 522.3136431 894.8866485 1.713312796 0.1567262 786985 2.877663588 5.159210891 0.596116286 0.115544082 0.1574212 ENSBTAG00000007659 1717.338534 2161.07567 1273.601398 0.58933679 0.157833 528098 13.22844779 4.966888861 21.49000673 4.326653429 0.1578974 ENSBTAG00000010649 1395.879482 1777.233644 1014.52532 0.570845214 0.1585785 ENSBTAG00000013657 31.87660768 46.38756057 17.36565479 0.374360164 0.1588276 100336039 16.19543159 22.43943089 9.951432286 0.443479709 0.1588727 ENSBTAG00000000941 1508.346037 1101.36546 1915.326613 1.739047285 0.1588727 ENSBTAG00000007540 11532.19 8492.39681 14571.98318 1.71588581 0.1595801 ENSBTAG00000003144 34.80652895 20.35245227 49.26060564 2.420376915 0.1595801 ENSBTAG00000004742 4.645960384 7.758124395 1.533796373 0.197701957 0.1599058 ENSBTAG00000016841 6.453031103 10.59948631 2.306575896 0.217612045 0.1599058 ENSBTAG00000025276 109.7588003 140.8673726 78.65022811 0.558328211 0.1599058 523461 47.49688487 63.2418166 31.75195314 0.502072123 0.1599477 ENSBTAG00000009263 2752.989175 2094.343341 3411.63501 1.628975986 0.1599477 513640 517.6914089 358.3931435 676.9896744 1.88895822 0.1600414 509283 1175.330047 1442.846537 907.8135559 0.629182337 0.1608528 ENSBTAG00000021393 2.175944763 4.115999171 0.235890356 0.057310594 0.1612191 281312 104.8658726 64.58869378 145.1430514 2.247189762 0.1622159 ENSBTAG00000021678 22572.84141 16415.77247 28729.91035 1.750140629 0.1622171 ENSBTAG00000043964 120.7468912 79.35423784 162.1395446 2.043237374 0.1629177 ENSBTAG00000039684 2.114240326 3.992590296 0.235890356 0.059082034 0.1635176 ENSBTAG00000037268 203.0202311 256.4286433 149.6118188 0.583444255 0.1635618 786362 1625.51784 1986.067567 1264.968114 0.636920986 0.1635618 ENSBTAG00000023891 4.382932573 7.527186248 1.238678898 0.164560681 0.163858 100335763 7.871123676 2.968652739 12.77359461 4.30282547 0.163858 ENSBTAG00000004018 1479.899056 1825.065017 1134.733094 0.621749408 0.163875 ENSBTAG00000033220 7.535860935 11.985467 3.086254874 0.25749976 0.1646663 ENSBTAG00000016939 52.37465222 31.95660197 72.79270246 2.277861161 0.1646663 ENSBTAG00000033090 1211.692841 1536.105974 887.279708 0.577616208 0.1648745 ENSBTAG00000000686 125.5333329 166.9597482 84.1069176 0.503755657 0.1651045 ENSBTAG00000013066 8256.096494 10061.17768 6451.015307 0.641178947 0.1651045 535487 12.21894797 5.821592709 18.61630324 3.197802417 0.1652475 ENSBTAG00000006355 18.77205384 8.547797037 28.99631064 3.392255398 0.1652475 ENSBTAG00000037657 3.02731928 5.317353933 0.737284627 0.138656301 0.1654017 ENSBTAG00000022303 5.254179575 1.158924488 9.349434663 8.067337224 0.1654017 ENSBTAG00000044610 6.439788448 10.21865641 2.660920489 0.260398274 0.1655128 ENSBTAG00000042931 26.76623688 38.39814623 15.13432754 0.39414214 0.1655128 ENSBTAG00000014960 50.09126436 67.28397809 32.89855063 0.488950736 0.1655128 ENSBTAG00000014588 2502.300658 3059.035791 1945.565525 0.636006133 0.1655128 ENSBTAG00000010235 808.6282795 985.9751009 631.2814581 0.640261055 0.1655128 ENSBTAG00000016541 2750.155125 3344.773268 2155.536982 0.644449357 0.1655128 ENSBTAG00000036111 73.71282247 43.93978477 103.4858602 2.35517449 0.1655128 ENSBTAG00000013880 84.01763488 48.54123594 119.4940338 2.46170151 0.1655128 ENSBTAG00000012349 18.17578974 9.317640336 27.03393915 2.901371825 0.1655128 ENSBTAG00000004034 42.78835281 26.23526202 59.34144359 2.261896357 0.1658862

PAGE 33

ENSBTAG00000009891 6.094104073 9.567852646 2.6203555 0.273870804 0.1664332 ENSBTAG00000035030 2532.547264 1950.929749 3114.16478 1.596246498 0.1664743 ENSBTAG00000040182 2.588902954 4.581689622 0.596116286 0.130108396 0.1665538 ENSBTAG00000014947 2893.490863 2154.756865 3632.224861 1.685677358 0.1665538 ENSBTAG00000004092 15.5613495 6.437730096 24.6849689 3.834421222 0.1665538 ENSBTAG00000003867 4.248740401 6.980517197 1.516963605 0.217313927 0.1666305 ENSBTAG00000018071 22.01662749 29.77048095 14.26277402 0.479091152 0.1668247 ENSBTAG00000033174 1274.923223 1565.472712 984.3737344 0.62880287 0.1669179 ENSBTAG00000013971 170.5118064 105.5946278 235.4289849 2.22955457 0.1670344 ENSBTAG00000007958 9906.882889 11942.91092 7870.85486 0.659039904 0.1676102 ENSBTAG00000019819 3040.913122 2307.714285 3774.111959 1.635432941 0.1676102 ENSBTAG00000044139 350.7221702 244.6013872 456.8429533 1.867703853 0.1676102 ENSBTAG00000002570 464.8630625 324.3275 605.3986251 1.866627483 0.1677881 ENSBTAG00000009219 1.918499697 3.476773464 0.36022593 0.103609261 0.1679631 ENSBTAG00000011131 21.55431638 31.2175431 11.89108967 0.380910491 0.1685782 ENSBTAG00000007826 1.886564799 3.507625683 0.265503915 0.075693343 0.1690225 100141141 795.5724865 995.5502179 595.5947552 0.598256868 0.1691717 ENSBTAG00000020410 1608.741374 1235.742255 1981.740493 1.603684332 0.1692654 ENSBTAG00000033486 69.99959051 95.26573397 44.73344704 0.469564923 0.1693222 100336978 2.785919653 4.739832664 0.832006642 0.175535024 0.1697801 ENSBTAG00000010535 9.641683948 14.01892467 5.264443221 0.375524039 0.1697801 ENSBTAG00000001408 64.06333889 88.19744905 39.92922873 0.452725438 0.169824 ENSBTAG00000037260 489.6559107 611.0993695 368.2124519 0.602541044 0.169824 ENSBTAG00000020799 2591.514477 1830.27966 3352.749294 1.831823501 0.169824 ENSBTAG00000015798 2.95779149 0.558247107 5.357335874 9.596710506 0.169824 ENSBTAG00000032719 1204.42016 1545.316085 863.5242345 0.558801039 0.1700318 ENSBTAG00000007115 69.28509825 43.22672139 95.34347511 2.205660574 0.1705905 ENSBTAG00000006087 2.895623703 0.558247107 5.2330003 9.373985529 0.1705905 ENSBTAG00000012382 2300.244067 1697.942373 2902.545761 1.709448922 0.1705951 ENSBTAG00000014270 89.5526395 54.40137698 124.703902 2.292293117 0.1705951 ENSBTAG00000002194 71.33596926 41.28735032 101.3845882 2.455584759 0.1705951 784034 39.91621943 53.31531538 26.51712348 0.497364093 0.1711603 ENSBTAG00000022348 2.412587738 4.323781206 0.501394271 0.11596199 0.1725279 ENSBTAG00000025642 19.15766462 28.34484158 9.970487666 0.351756691 0.1730529 100336103 70.46050009 92.7185446 48.20245557 0.519879338 0.173097 ENSBTAG00000000616 15.68250835 22.32753228 9.037484421 0.40476862 0.1734247 ENSBTAG00000000679 956.5629452 705.3663222 1207.759568 1.712244447 0.1739182 ENSBTAG00000015751 417.0393495 524.0071884 310.0715107 0.591731407 0.174352 786701 7.688753054 2.895370245 12.48213586 4.311067258 0.1744627 ENSBTAG00000004135 126.9470382 79.96323431 173.9308421 2.175135156 0.1747235 ENSBTAG00000014777 59.88328996 33.20198476 86.56459515 2.60721146 0.1747235 ENSBTAG00000013023 29.33705174 41.07519895 17.59890454 0.428455735 0.174784 ENSBTAG00000008641 5.670687916 8.5670712 2.774304633 0.323833498 0.1764034 ENSBTAG00000009124 66.30039903 90.15283531 42.44796276 0.470844457 0.1764034 100335813 106.2693154 142.0020306 70.53660012 0.496729517 0.1764034 ENSBTAG00000001344 778.879687 968.1466912 589.6126828 0.609011721 0.1764034 ENSBTAG00000021681 411.3231222 287.1902601 535.4559844 1.86446429 0.1764034 ENSBTAG00000008070 757.0552533 525.9076679 988.2028386 1.879042461 0.1764034 ENSBTAG00000008213 174.7240723 115.7471426 233.701002 2.019064978 0.1764034 790396 2.299678969 4.127577227 0.471780712 0.114299669 0.1764281 615842 2.29844031 4.065872789 0.53100783 0.130601191 0.1764281 520994 312.4256424 394.4177669 230.433518 0.584237165 0.1764369

PAGE 34

ENSBTAG00000016236 339.54113 224.7931713 454.2890886 2.020920324 0.1765489 ENSBTAG00000001403 2677.688618 3421.65161 1933.725626 0.565143927 0.1772217 ENSBTAG00000040442 125.2282354 165.191611 85.26485977 0.516157323 0.1775979 767865 50.00861488 67.05255256 32.9646772 0.491624494 0.1776019 783387 5.442493667 8.582463413 2.302523921 0.268282404 0.1785233 ENSBTAG00000001324 34.15022204 20.50283141 47.79761268 2.331268873 0.1785233 510342 164.3540886 222.6508663 106.0573109 0.476339089 0.1787848 ENSBTAG00000016748 101.2861104 56.87854715 145.6936737 2.561487257 0.1787848 ENSBTAG00000009637 1333.818539 1734.478898 933.1581807 0.53800492 0.1788136 ENSBTAG00000005453 237.5875674 150.4006944 324.7744404 2.159394553 0.1788323 ENSBTAG00000015802 765.7643855 541.4487297 990.0800412 1.828575795 0.1790232 ENSBTAG00000001512 211.6003628 267.580329 155.6203967 0.581583845 0.1792127 ENSBTAG00000008359 66.03195469 36.92508858 95.1388208 2.576536021 0.1792127 ENSBTAG00000004337 49.30886274 68.14158911 30.47613636 0.447247221 0.1799986 ENSBTAG00000000164 8.724680445 3.195708936 14.25365195 4.460247238 0.1804316 ENSBTAG00000000251 298.3252358 189.562789 407.0876827 2.147508405 0.1806327 ENSBTAG00000004208 2.154059993 3.777112155 0.53100783 0.140585667 0.1813885 100139150 3.036286728 5.040171355 1.032402102 0.204834723 0.1813885 ENSBTAG00000011463 65.00772883 38.7226836 91.29277407 2.357604525 0.1813885 ENSBTAG00000000483 31.68499711 15.92897348 47.44102073 2.978284871 0.1813885 100301375 7.918035306 12.49019316 3.345877452 0.267880361 0.1816778 ENSBTAG00000038962 3.756409742 5.694857067 1.817962417 0.319228805 0.1816778 ENSBTAG00000021842 389.2768664 500.9387661 277.6149668 0.554189425 0.1816778 ENSBTAG00000017251 16.88683626 23.82589896 9.947773562 0.417519338 0.1819952 ENSBTAG00000015428 1042.843857 1324.865588 760.8221246 0.574263632 0.1819952 ENSBTAG00000003419 6368.588273 7952.562046 4784.6145 0.60164441 0.1819952 521542 2.178188347 0 4.356376694 NA 0.1819952 ENSBTAG00000021779 351.9745871 249.0827562 454.8664179 1.826165829 0.1822134 ENSBTAG00000021876 17.897523 9.360070611 26.43497538 2.824228201 0.1823665 789513 0.750846727 1.501693453 0 0 0.1827477 ENSBTAG00000018316 0.750846727 1.501693453 0 0 0.1827477 ENSBTAG00000038214 0.750846727 1.501693453 0 0 0.1827477 539194 4.347512024 7.473177917 1.221846131 0.16349753 0.1827477 ENSBTAG00000043685 11.56143311 16.95623781 6.166628412 0.363679047 0.1827477 ENSBTAG00000008140 25.35923553 35.88027911 14.83819194 0.413547283 0.1827477 ENSBTAG00000000286 66.45995198 90.87740895 42.042495 0.462628672 0.1827477 ENSBTAG00000000391 152.073209 204.2848859 99.86153213 0.488834657 0.1827477 786369 665.1973475 825.1345175 505.2601774 0.612336736 0.1827477 504415 104.2852031 67.0882615 141.4821446 2.108895676 0.1827477 509018 24.95468065 13.61056932 36.29879198 2.666956181 0.1827477 ENSBTAG00000004799 1.695652831 0 3.391305661 NA 0.1827477 ENSBTAG00000040168 1.89990364 0 3.799807279 NA 0.1827533 ENSBTAG00000035323 5842.52852 7016.265703 4668.791338 0.665423964 0.1830989 ENSBTAG00000005094 4.316659806 7.41147348 1.221846131 0.164858733 0.1831468 ENSBTAG00000014602 3406.303422 4132.693326 2679.913517 0.648466582 0.1831468 507285 125.0632645 79.6793304 170.4471987 2.139164547 0.1831468 ENSBTAG00000007879 5.153282915 8.235880291 2.07068554 0.251422491 0.1837008 ENSBTAG00000033384 15.78603783 23.37025661 8.201819055 0.350951177 0.1837008 534169 657.6389085 481.1488118 834.1290051 1.733619588 0.1837008 ENSBTAG00000020705 111.5893166 149.7975252 73.38110805 0.489868627 0.1838643 ENSBTAG00000006189 25538.22672 19486.22687 31590.22658 1.621156666 0.1838755 ENSBTAG00000015016 427.6745338 520.7130828 334.6359849 0.642649467 0.1838803

PAGE 35

783009 185.3140046 117.3761947 253.2518145 2.157607982 0.18397 ENSBTAG00000027204 6.911160304 1.802032144 12.02028846 6.670407353 0.1844834 ENSBTAG00000019679 2.010299005 3.519203739 0.501394271 0.142473783 0.1845105 511783 122.9348331 83.19693639 162.6727298 1.955273077 0.1845903 ENSBTAG00000013215 5.090495799 8.205028072 1.975963525 0.240823494 0.1847363 530325 2.876480301 4.720558501 1.032402102 0.21870338 0.1849054 ENSBTAG00000027337 986.9514285 646.8050117 1327.097845 2.051774215 0.1851294 ENSBTAG00000012277 16.15695698 24.01433904 8.299574928 0.345609134 0.1854426 100139476 3.354021376 0.558247107 6.149795644 11.01626067 0.1854426 ENSBTAG00000040221 51.62852147 67.40689958 35.85014337 0.531846793 0.1856918 ENSBTAG00000016024 15415.5799 11597.58788 19233.57192 1.658411398 0.1856918 ENSBTAG00000017706 19.37011528 26.06276934 12.67746123 0.486420344 0.1857802 ENSBTAG00000006001 82.77024539 47.07483184 118.4656589 2.516539185 0.1857802 513641 43.90740113 60.18435357 27.63044869 0.459096876 0.1859055 ENSBTAG00000025659 1.944131914 3.292147541 0.596116286 0.181072166 0.1861656 ENSBTAG00000015841 1034.628811 1324.910553 744.3470702 0.5618093 0.1862797 ENSBTAG00000020194 1764.866537 2084.598058 1445.135016 0.693243961 0.186316 ENSBTAG00000013768 23.34704878 11.97777089 34.71632667 2.898396287 0.186316 540701 44.43857268 62.90077665 25.97636872 0.412973736 0.1864908 ENSBTAG00000002412 200.4577612 127.4069662 273.5085562 2.146731567 0.186553 516661 4.135262606 7.019065522 1.25145969 0.178294345 0.1865705 ENSBTAG00000013275 252.5578269 165.217543 339.8981108 2.05727615 0.1865705 ENSBTAG00000001135 10.23495058 15.33162287 5.138278285 0.335142491 0.1866246 ENSBTAG00000007865 1539.269436 1106.88193 1971.656941 1.781271234 0.1869669 ENSBTAG00000017733 11.24003613 17.39919174 5.080880529 0.292018193 0.1870539 ENSBTAG00000011949 1.881964127 3.292147541 0.471780712 0.143304851 0.1875503 ENSBTAG00000016516 421.4824728 274.5736239 568.3913218 2.070087118 0.1875503 ENSBTAG00000013439 138.0052066 88.31052582 187.6998873 2.125453173 0.18803 ENSBTAG00000022731 5813.105173 4396.368829 7229.841517 1.644502952 0.1881591 786399 27.11118167 14.86593242 39.35643092 2.647424313 0.1881591 ENSBTAG00000012104 153.6178372 204.8047031 102.4309713 0.500139742 0.1882494 ENSBTAG00000016271 504.8075766 633.003959 376.6111941 0.594958671 0.1882494 ENSBTAG00000002817 143.4084663 90.07831118 196.7386215 2.184084258 0.1882494 ENSBTAG00000011195 4.87932906 7.658359021 2.100299099 0.274249235 0.1887544 ENSBTAG00000034985 38.89395086 52.61369447 25.17420725 0.478472525 0.1887544 ENSBTAG00000008747 1044.20074 775.358019 1313.043461 1.693467313 0.1887544 ENSBTAG00000004247 80.9668732 106.1483022 55.78544424 0.525542501 0.1888981 ENSBTAG00000015624 29.43315922 15.80605199 43.06026645 2.724289814 0.1890841 781928 7.396191695 11.73574207 3.056641315 0.260455734 0.1893481 ENSBTAG00000014314 37.4753518 48.89176881 26.0589348 0.532992269 0.1900171 617203 3.981157493 6.86480443 1.097510557 0.159874993 0.1902128 515333 62.3733893 86.24226618 38.50451242 0.446469163 0.1902128 ENSBTAG00000017204 1.737583809 3.003386907 0.471780712 0.157082896 0.1904264 528828 3.448162239 5.598418461 1.297906017 0.231834406 0.1904264 100301295 159.5981802 216.1644548 103.0319056 0.476636669 0.1904264 613546 143.7530394 193.5858882 93.92019066 0.485160316 0.1904264 ENSBTAG00000020084 103.6743001 71.30637804 136.0422221 1.907854892 0.1904264 ENSBTAG00000016331 136.9696764 80.62630689 193.3130459 2.397642325 0.1908336 ENSBTAG00000002566 47.25346541 27.82181603 66.68511479 2.396864199 0.1912511 ENSBTAG00000008411 123.6662242 82.53504196 164.7974064 1.996696222 0.1914539 ENSBTAG00000013916 1776.273762 1260.826014 2291.721511 1.817635016 0.1919985 ENSBTAG00000004964 1256.080753 978.0161198 1534.145386 1.568629959 0.1922326

PAGE 36

523503 3.898481613 6.699452669 1.097510557 0.163820929 0.192269 ENSBTAG00000016081 1293.104684 1555.749097 1030.46027 0.662356335 0.1923122 ENSBTAG00000033136 1698.407054 1204.066803 2192.747304 1.821117648 0.1923122 ENSBTAG00000033313 199.5702832 135.2134158 263.9271505 1.951930205 0.1923122 ENSBTAG00000005182 4.476521605 7.354138381 1.598904828 0.217415657 0.1925177 ENSBTAG00000045124 31.65201222 41.74485728 21.55916716 0.516450853 0.1925177 ENSBTAG00000037791 33787.29243 41245.8638 26328.72105 0.638336032 0.1925322 ENSBTAG00000002691 94.92869217 131.4398467 58.41753767 0.444443136 0.1929963 617437 374.7625997 471.6982826 277.8269169 0.588992852 0.1929963 ENSBTAG00000021867 273.5921168 174.4667576 372.717476 2.136323739 0.1929963 ENSBTAG00000002236 138.7603808 88.78439977 188.7363619 2.125782935 0.1932762 ENSBTAG00000015789 65.38074206 85.95399293 44.80749119 0.521296215 0.1940331 497225 21013.46971 25680.35607 16346.58336 0.63654037 0.1942252 ENSBTAG00000012732 23.09085512 12.08627494 34.0954353 2.821004443 0.1943055 504733 22.66590854 11.56657616 33.76524093 2.919207937 0.1943055 ENSBTAG00000002979 77.19248389 106.6088647 47.77610307 0.448143812 0.1943983 ENSBTAG00000004004 655.229479 801.5082892 508.9506688 0.634991148 0.1945069 ENSBTAG00000006335 0.879800935 1.759601869 0 0 0.194698 ENSBTAG00000045029 4.483268321 7.639017066 1.327519576 0.173781465 0.194698 ENSBTAG00000007414 1649.417493 2057.450074 1241.384912 0.603360892 0.194698 ENSBTAG00000000522 7.125479796 11.24259397 3.008365627 0.267586434 0.1951661 ENSBTAG00000024947 57.69806216 77.74508291 37.6510414 0.484288395 0.1952589 523762 0.895227044 1.790454088 0 0 0.195636 ENSBTAG00000029904 0.895227044 1.790454088 0 0 0.195636 ENSBTAG00000042261 0.895227044 1.790454088 0 0 0.195636 ENSBTAG00000003948 1340.547112 971.3681752 1709.726048 1.760121539 0.1964695 ENSBTAG00000014750 1616.585572 1242.433529 1990.737614 1.60228903 0.1966119 ENSBTAG00000010275 408.2534848 294.1182311 522.3887385 1.776118184 0.1966119 ENSBTAG00000003474 1742.89576 1228.29932 2257.492201 1.837900717 0.1966119 ENSBTAG00000019376 356.9522212 246.1104927 467.7939496 1.900747686 0.1966119 ENSBTAG00000004398 12.33815734 5.059445517 19.61686917 3.877276492 0.1966119 ENSBTAG00000003863 3.702399156 0.600677381 6.804120931 11.32741325 0.1966119 ENSBTAG00000035072 3.326180346 5.790740491 0.861620201 0.14879275 0.1968162 ENSBTAG00000035975 3.684008335 0.889438016 6.478578653 7.283901224 0.1968162 ENSBTAG00000039820 137.6759247 90.69091842 184.660931 2.036156809 0.1970839 ENSBTAG00000006811 4.372061561 7.38110865 1.363014472 0.184662567 0.1976531 ENSBTAG00000016896 281.8500922 204.0095551 359.6906293 1.763106778 0.1976879 ENSBTAG00000018277 1.472748313 2.945496626 0 0 0.1977078 ENSBTAG00000016609 255.1091698 173.4130567 336.8052828 1.942214094 0.1977078 ENSBTAG00000027401 1.457322204 2.914644408 0 0 0.1977978 ENSBTAG00000004129 662.9863901 789.2599807 536.7127995 0.680020288 0.1977978 ENSBTAG00000036310 99.9037674 62.96407884 136.843456 2.173357548 0.1977978 ENSBTAG00000015240 546.5101452 362.8302092 730.1900813 2.01248425 0.1980561 ENSBTAG00000018381 211.6309843 140.6331755 282.6287931 2.009687915 0.1980977 521982 266.9528783 354.9229515 178.9828051 0.504286365 0.198221 ENSBTAG00000024021 199.0984662 262.529919 135.6670133 0.516767818 0.1985081 ENSBTAG00000000569 238.6876227 306.9667167 170.4085288 0.555136826 0.1986497 ENSBTAG00000021938 3.609720978 6.1219314 1.097510557 0.179275213 0.1992665 ENSBTAG00000012265 9.506558861 14.28841115 4.724706574 0.330667037 0.1992665 ENSBTAG00000005278 3772.452195 4879.241094 2665.663295 0.54632744 0.1992665 ENSBTAG00000017801 6813.703029 5378.222862 8249.183195 1.53381208 0.1992665 ENSBTAG00000012779 143.8431574 97.65167407 190.0346407 1.946045907 0.1992665

PAGE 37

ENSBTAG00000009800 19.37844381 26.86783419 11.88905343 0.44250137 0.1993848 ENSBTAG00000017725 1.008755143 2.017510285 0 0 0.1994949 ENSBTAG00000030334 1.008755143 2.017510285 0 0 0.1994949 ENSBTAG00000010541 2414.354112 2923.233539 1905.474685 0.651837993 0.1994949 ENSBTAG00000011504 77.04385944 51.51321545 102.5745034 1.991226961 0.1994949 ENSBTAG00000032026 79.62202362 44.56805539 114.6759919 2.573053521 0.1994949 ENSBTAG00000020931 25.39511421 13.84199486 36.94823355 2.669285311 0.1994949 ENSBTAG00000014800 1.328367996 2.656735992 0 0 0.1995509 100313150 1.312941887 2.625883773 0 0 0.1996389 ENSBTAG00000044420 1.312941887 2.625883773 0 0 0.1996389 100337079 1.039607361 2.079214723 0 0 0.1996389 ENSBTAG00000031017 1.039607361 2.079214723 0 0 0.1996389 ENSBTAG00000038472 1.266663559 2.533327118 0 0 0.1996389 ENSBTAG00000043048 1.266663559 2.533327118 0 0 0.1996389 ENSBTAG00000037753 4.126212513 6.80746933 1.444955695 0.212260331 0.1996389 ENSBTAG00000012826 60.39971173 85.50202915 35.29739431 0.412825224 0.1996389 ENSBTAG00000004423 64.51980235 88.53882365 40.50078106 0.457435274 0.1996389 ENSBTAG00000009299 572.558935 418.7659878 726.3518822 1.734505436 0.1996389 ENSBTAG00000033908 56.00160878 32.94733532 79.05588225 2.399462096 0.1996389 ENSBTAG00000012048 38.23993147 19.93362922 56.54623372 2.83672547 0.1996389 ENSBTAG00000030227 735.3619465 932.9788182 537.7450748 0.576374366 0.2002252 618617 1.137709351 2.275418702 0 0 0.2003254 537506 1.15313546 2.30627092 0 0 0.2003254 ENSBTAG00000013362 1888.23706 1326.802023 2449.672097 1.846298132 0.2008589 ENSBTAG00000017436 29.72275343 42.26725985 17.178247 0.406419698 0.2018161 ENSBTAG00000006364 276.4166199 187.6123907 365.2208491 1.946677656 0.2023321 ENSBTAG00000044126 9.534034893 4.724372658 14.34369713 3.036106202 0.2023321 ENSBTAG00000007921 893.9578154 624.4412873 1163.474343 1.863224561 0.2023531 ENSBTAG00000018146 21.8411852 31.98357224 11.69879816 0.36577522 0.2024523 ENSBTAG00000016013 35.06014619 49.2753025 20.84498988 0.423031191 0.2024523 ENSBTAG00000031789 2816.285391 3398.870985 2233.699797 0.657188757 0.2029747 ENSBTAG00000023976 2958.657346 3570.67328 2346.641412 0.657198581 0.2029747 ENSBTAG00000019563 4697.730441 5677.151984 3718.308897 0.654960253 0.2034853 ENSBTAG00000022989 44.54426381 22.85166819 66.23685942 2.898556853 0.203557 ENSBTAG00000042645 2.955207181 4.924458587 0.985955775 0.200216076 0.2036603 ENSBTAG00000018808 33.06388542 44.49803188 21.62973896 0.486083048 0.2036603 ENSBTAG00000005385 695.7265388 881.7875719 509.6655058 0.577991256 0.2037095 788287 5.650788002 9.437167261 1.864408743 0.19756021 0.2038882 100335202 81.30364603 108.0668013 54.54049075 0.504692376 0.2038882 786885 161.5281545 111.0042672 212.0520417 1.910305316 0.2038882 ENSBTAG00000022067 38.86519409 53.78654901 23.94383917 0.445164072 0.2044084 ENSBTAG00000018778 7.013754314 11.48504238 2.542466252 0.221371952 0.2044278 ENSBTAG00000039105 23.79131376 12.41746585 35.16516166 2.831911285 0.2049352 ENSBTAG00000031886 419.823895 530.3033115 309.3444784 0.583334993 0.2056259 505738 26.57148748 15.47042395 37.67255101 2.435133719 0.2056259 ENSBTAG00000019636 117.8183313 68.05562252 167.58104 2.462412859 0.2056259 781214 91.69718423 58.9020202 124.4923483 2.113549719 0.2064676 781004 5.35244059 9.105976351 1.598904828 0.175588511 0.2072188 ENSBTAG00000015369 334.806249 427.889958 241.7225401 0.564917534 0.2072188 ENSBTAG00000007177 28.04303648 37.51702729 18.56904567 0.494949814 0.2075371 ENSBTAG00000026672 2269.052922 2790.931448 1747.174397 0.626018385 0.2075371 508335 99.23805966 62.48639073 135.9897286 2.176309545 0.2075371

PAGE 38

ENSBTAG00000032544 61.1814917 36.38167851 85.98130489 2.363313305 0.2075371 ENSBTAG00000039462 108.6565194 147.6778126 69.63522618 0.471534789 0.2077792 ENSBTAG00000022759 22.20310744 10.56530732 33.84090756 3.203021599 0.2081826 ENSBTAG00000009635 103.1579708 66.97933786 139.3366037 2.080292343 0.2084607 ENSBTAG00000003568 131.6562046 176.6326254 86.67978392 0.490734844 0.208638 ENSBTAG00000011702 198.7319569 251.4189046 146.0450092 0.580883166 0.2088546 520030 162.24889 112.0392276 212.4585524 1.896287192 0.2088546 ENSBTAG00000006060 2.756644452 4.982281074 0.53100783 0.10657926 0.2092592 100336626 330.7850857 411.8132629 249.7569084 0.606480973 0.2094623 100137734 2.329962162 4.424033968 0.235890356 0.053320195 0.2096113 ENSBTAG00000000943 1864.636153 2350.078762 1379.193545 0.586871201 0.2097774 ENSBTAG00000032951 2862.388581 3562.001734 2162.775428 0.60717978 0.2097774 ENSBTAG00000022733 115.6092568 74.30650597 156.9120076 2.11168599 0.2097774 ENSBTAG00000008165 20.57022537 11.97437633 29.16607442 2.435707182 0.2097774 100335783 2.727030893 4.982281074 0.471780712 0.094691709 0.2101568 ENSBTAG00000044188 3.197707449 5.451853475 0.943561424 0.173071677 0.2104529 ENSBTAG00000038149 3.91023375 6.268008998 1.552458502 0.247679686 0.2104529 616090 1361.664234 1731.61633 991.7121376 0.572708931 0.2104529 ENSBTAG00000012938 445.1308477 561.2332892 329.0284061 0.586259604 0.2104529 ENSBTAG00000019633 108.661898 70.26039473 147.0634013 2.093119486 0.2104529 ENSBTAG00000013333 2.650557087 4.439493973 0.861620201 0.194080723 0.2107021 ENSBTAG00000019885 3.891403622 6.360565654 1.422241591 0.223603005 0.2107021 ENSBTAG00000003079 5.117724348 8.070041142 2.165407555 0.268326706 0.2107021 ENSBTAG00000020806 481.3046303 621.3960587 341.2132018 0.549107445 0.2107021 ENSBTAG00000022520 6116.649629 7769.701913 4463.597345 0.574487592 0.2107021 ENSBTAG00000039007 3.171961393 4.99774108 1.346181705 0.269358033 0.2110199 ENSBTAG00000012955 29.61601703 40.29322241 18.93881166 0.470024747 0.2111069 ENSBTAG00000007843 7.537543629 12.17827641 2.896810845 0.237867063 0.211818 ENSBTAG00000018016 50.26600478 26.44464181 74.08736774 2.80160224 0.2120435 ENSBTAG00000016913 28.82132128 39.74273921 17.89990335 0.450394304 0.2125283 ENSBTAG00000002037 70.83805803 96.478599 45.19751705 0.468471946 0.2125283 ENSBTAG00000020143 133.960704 167.0644252 100.8569827 0.603701133 0.2125283 ENSBTAG00000031795 147.1902552 101.3314406 193.0490698 1.905125088 0.2125283 ENSBTAG00000010922 47.93359748 31.01752496 64.84967 2.090742897 0.2125283 ENSBTAG00000016615 142.9619682 89.8326038 196.0913326 2.182852598 0.2125283 ENSBTAG00000039297 3.840389077 0.889438016 6.791340139 7.635540664 0.2125283 ENSBTAG00000010026 45.11321713 61.81852922 28.40790505 0.459537058 0.2125986 ENSBTAG00000008084 81.16283584 109.2739876 53.0516841 0.485492342 0.2125986 ENSBTAG00000000210 8.150101653 12.1628842 4.137319105 0.340159376 0.2126539 ENSBTAG00000040346 3.078478037 5.059445517 1.097510557 0.21692309 0.2135919 ENSBTAG00000022502 4.050670135 5.952765483 2.148574788 0.360937247 0.2135919 ENSBTAG00000020914 48.766024 65.60382487 31.92822313 0.486682342 0.2135919 ENSBTAG00000002072 50.94406141 67.21076339 34.67735943 0.515949495 0.2135919 ENSBTAG00000009773 20.28599121 11.18907302 29.3829094 2.626036074 0.2135919 ENSBTAG00000002029 11.21914474 4.193163613 18.24512588 4.351160021 0.2135919 781819 5.041250588 1.767297976 8.315203199 4.705037471 0.2135919 790684 5.042952597 1.705593539 8.380311655 4.913428355 0.2135919 100335326 2.170155735 4.104421114 0.235890356 0.05747226 0.2137566 ENSBTAG00000019596 54.93729844 76.97787561 32.89672127 0.427352938 0.2137566 ENSBTAG00000001752 10.19740244 4.354633424 16.04017145 3.683472267 0.2137566 507670 3.777875523 6.133509456 1.422241591 0.231880557 0.2138151 ENSBTAG00000009962 960.5390876 711.8613917 1209.216784 1.698668867 0.2138151

PAGE 39

ENSBTAG00000017425 16.42794418 23.14805714 9.707831231 0.419379958 0.2139819 ENSBTAG00000015307 30.99903375 43.60366934 18.39439817 0.421854363 0.2139819 ENSBTAG00000013606 455.7259731 297.6228055 613.8291407 2.062439872 0.2139819 ENSBTAG00000019036 86.12015671 50.29369689 121.9466165 2.424689853 0.2140039 ENSBTAG00000009987 19.04557344 27.19798253 10.89316435 0.40051369 0.2141104 523362 25.54068344 35.47241115 15.60895573 0.440030864 0.2147292 ENSBTAG00000009268 2.123258078 3.98101224 0.265503915 0.066692564 0.214813 ENSBTAG00000033815 6.765419783 10.03791243 3.492927131 0.347973461 0.214813 ENSBTAG00000008098 14.33986032 20.57181236 8.107908285 0.394127078 0.214813 ENSBTAG00000005979 1181.446001 1503.956508 858.9354935 0.571117242 0.214813 ENSBTAG00000001599 586.5906605 721.6243508 451.5569703 0.625750738 0.214813 ENSBTAG00000008114 63.06346867 38.2372316 87.88970574 2.29853737 0.214813 ENSBTAG00000020465 24.38192821 11.35497997 37.40887646 3.29449075 0.214813 100101128 2.103369314 3.846512698 0.36022593 0.093650004 0.2153387 ENSBTAG00000016142 7.24370101 11.4662556 3.021146419 0.263481517 0.2153387 532586 10.45587905 16.10916227 4.802595822 0.298128217 0.2153387 523153 114.7688964 76.60445781 152.933335 1.996402551 0.2153387 ENSBTAG00000038131 850.1629374 596.2417476 1104.084127 1.85173905 0.2154602 ENSBTAG00000009888 640.789043 480.3013167 801.2767694 1.668279352 0.2160187 ENSBTAG00000043956 2900.229052 2236.699689 3563.758416 1.593311089 0.216287 ENSBTAG00000011397 95.29648663 61.58870143 129.0042718 2.094609382 0.216287 ENSBTAG00000018011 92.86337672 53.18185841 132.544895 2.492295286 0.216287 ENSBTAG00000038168 5.010942966 8.127863629 1.894022303 0.233028307 0.2172638 100140166 2.315054775 3.892824923 0.737284627 0.189395784 0.2174511 ENSBTAG00000037742 3.64662402 5.586840405 1.706407635 0.305433395 0.2182955 ENSBTAG00000018130 3.635353195 5.937305477 1.333400913 0.224580143 0.2185858 ENSBTAG00000037465 70.35572056 96.34347648 44.36796464 0.460518618 0.2185858 ENSBTAG00000011613 280.110834 373.3887273 186.8329407 0.500371133 0.2185858 493734 194.9076864 247.1835269 142.6318459 0.57702812 0.2185858 ENSBTAG00000010841 386.4574657 475.789854 297.1250775 0.624488049 0.2185858 ENSBTAG00000016481 2992.27722 2313.917139 3670.6373 1.586330486 0.2185858 ENSBTAG00000000640 958.2275992 719.0004209 1197.454778 1.665443778 0.2185858 ENSBTAG00000016094 18.92021948 9.891347448 27.94909151 2.825610126 0.2185858 ENSBTAG00000035124 1.99430387 3.723103824 0.265503915 0.07131252 0.2188894 ENSBTAG00000006323 178.7450259 116.6492012 240.8408506 2.064659235 0.2188894 ENSBTAG00000003502 59.32543335 82.18395391 36.46691278 0.443723027 0.2193808 ENSBTAG00000010756 76.4001597 49.05219605 103.7481234 2.115055629 0.2193808 509257 3.587836208 5.783044384 1.392628031 0.240812268 0.2196707 ENSBTAG00000018465 65.22718994 89.89437171 40.56000817 0.451196303 0.2196707 ENSBTAG00000004540 575.774235 410.6807072 740.8677629 1.803999433 0.2196707 ENSBTAG00000003556 121.0837408 80.50602141 161.6614603 2.008066694 0.2196707 ENSBTAG00000006583 30.348931 18.61600651 42.08185549 2.260520025 0.2196707 ENSBTAG00000010148 28.17140855 16.29434338 40.04847372 2.457814518 0.2196707 515756 2.185481237 3.604064288 0.766898186 0.212787044 0.2197869 100294994 1.888546588 0 3.777093175 NA 0.2198046 790609 1.746463565 0 3.492927131 NA 0.2198835 534542 1.943562888 3.526899845 0.36022593 0.102136705 0.2201427 ENSBTAG00000015582 889.9955227 603.4852247 1176.505821 1.949518849 0.2202785 ENSBTAG00000017021 1264.769142 1605.081239 924.4570446 0.575956545 0.2210519 100335864 10.02428426 14.81962019 5.228948325 0.352839564 0.2214364 540003 70.17572347 94.57791184 45.7735351 0.483977011 0.2214364 783049 2.340012289 4.054294733 0.625729845 0.154337532 0.2227234

PAGE 40

ENSBTAG00000013303 57.80819888 75.66649116 39.9499066 0.527973559 0.2230373 ENSBTAG00000003113 4.789588082 7.839102995 1.740073169 0.221973505 0.2237533 ENSBTAG00000021469 22.24971676 12.3166579 32.18277561 2.612947105 0.2240409 ENSBTAG00000006528 59.23762606 82.10630208 36.36895004 0.442949556 0.2244985 ENSBTAG00000005629 187.4547655 119.4613087 255.4482223 2.13833437 0.2244985 ENSBTAG00000004005 176.9792679 119.0971126 234.8614231 1.972016096 0.2247476 ENSBTAG00000035081 95.6353736 57.36246919 133.908278 2.334423184 0.2247476 507299 126.7070949 78.76250252 174.6516872 2.217447156 0.2254605 ENSBTAG00000007644 255.4237911 320.4281022 190.4194801 0.594265855 0.2259514 ENSBTAG00000008232 3.604498721 0.889438016 6.319559427 7.105115043 0.2265495 781715 19.13359222 26.40165635 11.86552809 0.449423624 0.2266488 ENSBTAG00000000406 2437.285089 3004.279511 1870.290667 0.622542164 0.2267479 ENSBTAG00000000368 2.242992979 3.765534099 0.72045186 0.191327934 0.2269127 100336799 1.751821563 3.238139211 0.265503915 0.081992743 0.2270809 ENSBTAG00000012991 476.0167822 345.9611075 606.072457 1.751851419 0.2274757 ENSBTAG00000019197 247.7771577 164.9724543 330.581861 2.003860962 0.2281026 ENSBTAG00000025964 67.38062923 88.66764443 46.09361403 0.519847057 0.2283293 ENSBTAG00000021013 66.54225331 90.36048176 42.72402485 0.472817586 0.2283844 ENSBTAG00000010382 117.9904952 159.6201079 76.36088248 0.478391372 0.2283844 ENSBTAG00000037470 162.5276391 112.928869 212.1264092 1.878407276 0.2283844 ENSBTAG00000038488 162.5276391 112.928869 212.1264092 1.878407276 0.2283844 ENSBTAG00000004884 61.52651328 36.76687775 86.28614881 2.346844608 0.2283844 ENSBTAG00000020050 4320.059269 5249.703682 3390.414856 0.645829758 0.2284396 ENSBTAG00000019521 2.179742513 3.858090754 0.501394271 0.12995917 0.2288711 531208 2.180825192 3.765534099 0.596116286 0.158308561 0.2288711 ENSBTAG00000043761 2.180825192 3.765534099 0.596116286 0.158308561 0.2288711 ENSBTAG00000037861 4.626865031 7.199877288 2.053852773 0.285262191 0.2288711 ENSBTAG00000018342 252.9392961 162.5353667 343.3432255 2.112421637 0.2288711 ENSBTAG00000001957 278.8236102 199.6936056 357.9536148 1.792514156 0.2290339 ENSBTAG00000034195 4.594930133 7.230729507 1.959130758 0.270945104 0.2297716 789800 12.91230751 19.20891999 6.615695019 0.344407443 0.2297716 ENSBTAG00000039969 50.82874649 68.69200453 32.96548845 0.479902846 0.2297716 ENSBTAG00000033080 18048.79633 22536.63938 13560.95328 0.601729169 0.2297716 538457 2560.301667 3082.182679 2038.420656 0.66135621 0.2297716 ENSBTAG00000042758 4.263565143 7.022947472 1.504182813 0.214181128 0.2300637 ENSBTAG00000002507 28201.55394 21699.27504 34703.83285 1.5993084 0.2306462 ENSBTAG00000032915 38.66679276 20.79221502 56.5413705 2.719352914 0.2309222 ENSBTAG00000010615 3.989555915 6.822374155 1.156737675 0.169550606 0.2310601 ENSBTAG00000007450 37.83536561 51.77396324 23.89676798 0.461559566 0.2310694 ENSBTAG00000012971 1.33410672 2.402709525 0.265503915 0.110501878 0.2315198 ENSBTAG00000008409 175.3458591 127.3408375 223.3508807 1.753961142 0.2315221 ENSBTAG00000020543 23.69473497 13.32950479 34.05996515 2.555231096 0.2315221 100337120 2310.113996 2706.839227 1913.388766 0.706871966 0.2320279 ENSBTAG00000019859 125.1989438 158.0459454 92.35194225 0.584336042 0.232142 100140016 1189.561779 1434.909886 944.2136727 0.658029944 0.232142 ENSBTAG00000017783 544.756375 407.3169169 682.1958332 1.674852688 0.232142 ENSBTAG00000015255 586.8479382 403.5988312 770.0970452 1.908075509 0.232142 ENSBTAG00000001956 96.92833733 58.30584775 135.5508269 2.324823875 0.232142 ENSBTAG00000000218 23.60034883 13.52570877 33.67498888 2.489702347 0.232142 ENSBTAG00000016267 40.3728552 20.51891439 60.22679601 2.935184331 0.232142 ENSBTAG00000014034 5.812208045 1.759601869 9.864814221 5.606276279 0.232142 ENSBTAG00000043713 2.878790936 0.558247107 5.199334766 9.313679736 0.232142

PAGE 41

ENSBTAG00000000581 14.70896942 21.70758073 7.710358097 0.355191958 0.2333002 523454 100.7405172 60.47817431 141.0028601 2.331466875 0.2333002 ENSBTAG00000009804 1813.990102 1404.564181 2223.416022 1.582993538 0.2333713 ENSBTAG00000019219 2.019936086 3.538477901 0.501394271 0.141697726 0.2345552 100301263 20.57199105 12.07851104 29.06547107 2.406378648 0.2345552 ENSBTAG00000025148 1129.169524 1407.965006 850.374042 0.603973848 0.2358601 ENSBTAG00000012363 145.5770893 90.41109984 200.7430788 2.220336653 0.2361737 511676 5.381865827 8.728541011 2.035190644 0.233165043 0.2370304 787564 88.68326631 116.9707593 60.39577329 0.516332232 0.2370304 ENSBTAG00000014764 19283.88639 23968.13451 14599.63827 0.609127017 0.2370304 ENSBTAG00000021943 247.7047527 168.043445 327.3660605 1.948103722 0.2379306 ENSBTAG00000002939 100.4724027 59.81191054 141.1328948 2.359611883 0.2379581 ENSBTAG00000025345 289.3758652 192.8920398 385.8596906 2.000391986 0.2382225 ENSBTAG00000037834 8.713802943 12.62906204 4.798543846 0.37996043 0.23936 ENSBTAG00000017031 7.480285384 10.86564601 4.094924754 0.376868964 0.2402069 ENSBTAG00000017567 1126.333309 851.261267 1401.405351 1.646269372 0.2407196 ENSBTAG00000002108 8176.901161 6332.641291 10021.16103 1.582461499 0.24111 ENSBTAG00000001880 28.97603148 39.09581739 18.85624557 0.482308513 0.241219 ENSBTAG00000012074 289.3279465 374.1164793 204.5394138 0.546726555 0.2419567 ENSBTAG00000002425 93.59882899 121.8569408 65.34071721 0.536208416 0.2423302 ENSBTAG00000015910 5475.742812 4165.95287 6785.532754 1.628806894 0.2423302 617074 1748.494247 1322.66444 2174.324054 1.643896962 0.2423302 ENSBTAG00000008596 455.1480422 584.5363874 325.7596971 0.55729584 0.242366 ENSBTAG00000014337 2708.060958 2089.709668 3326.412247 1.591805932 0.2425306 ENSBTAG00000023551 391.1449086 492.2417852 290.048032 0.589238949 0.2426307 ENSBTAG00000007844 1911.379631 1494.58753 2328.171732 1.557735286 0.2426307 100335911 16.79907372 9.679683464 23.91846397 2.470996501 0.2427978 ENSBTAG00000009177 210.207385 138.2434212 282.1713488 2.041119543 0.2429536 ENSBTAG00000018562 59.51991614 40.54336693 78.49646535 1.936111164 0.2439477 ENSBTAG00000031890 413.8713059 289.3184951 538.4241168 1.861008286 0.2441225 ENSBTAG00000003581 64.15987716 39.99295152 88.3268028 2.208559245 0.2441225 ENSBTAG00000005999 16.52459158 22.61684809 10.43233507 0.461263878 0.2441401 100335650 10.97851906 14.68518844 7.271849668 0.495182591 0.2441401 ENSBTAG00000019495 127.9848878 77.80082458 178.168951 2.290065072 0.2441401 ENSBTAG00000016742 1.746601561 2.991808851 0.501394271 0.167589006 0.2442258 ENSBTAG00000045097 1.731175452 2.960956632 0.501394271 0.16933523 0.2443845 ENSBTAG00000010145 3.826424886 5.929609371 1.723240402 0.290616176 0.2443845 ENSBTAG00000016260 115.4905022 153.2224939 77.75851062 0.507487567 0.2443845 ENSBTAG00000005444 861.4059342 648.6215246 1074.190344 1.656112699 0.2443845 ENSBTAG00000000782 105.0646279 140.4282963 69.7009595 0.496345547 0.2449155 ENSBTAG00000001326 8.095519428 13.00600999 3.185028864 0.244889006 0.244933 ENSBTAG00000014648 4335.134908 3333.635856 5336.63396 1.600844901 0.2450561 615304 1537.519614 1183.502038 1891.537191 1.598254274 0.2451237 ENSBTAG00000017028 8837.461061 6852.788613 10822.13351 1.579230605 0.2457462 ENSBTAG00000031898 3.52233875 5.852444928 1.192232572 0.2037153 0.2459006 ENSBTAG00000012478 1.649582251 2.703048216 0.596116286 0.220534833 0.2459006 ENSBTAG00000033846 1.649582251 2.703048216 0.596116286 0.220534833 0.2459006 ENSBTAG00000005980 20.93222322 10.31897696 31.54546947 3.057034586 0.2459006 618803 4.236698995 7.080769959 1.392628031 0.196677486 0.2459746 514704 5.623654653 2.079214723 9.168094584 4.409402494 0.2459746 ENSBTAG00000012262 73.63031189 94.15902101 53.10160277 0.563956615 0.2460136 ENSBTAG00000011851 101.7852779 136.2169689 67.353587 0.494458125 0.2479366

PAGE 42

ENSBTAG00000005235 16.62768885 23.82583117 9.429546524 0.395769888 0.2480026 ENSBTAG00000014646 7.250283449 11.05408609 3.446480804 0.311783423 0.2488431 ENSBTAG00000019686 5.906935807 9.206296906 2.607574708 0.283238172 0.2491726 ENSBTAG00000038107 256.3826923 164.8367131 347.9286715 2.110747448 0.2495566 ENSBTAG00000034393 72.01821555 97.67995376 46.35647734 0.474575136 0.2507775 ENSBTAG00000001114 67.56783561 93.81749367 41.31817754 0.440410162 0.2511663 ENSBTAG00000013210 6573.702898 7868.326204 5279.079593 0.670927902 0.2511663 ENSBTAG00000021025 3748.67223 4484.184317 3013.160144 0.671952786 0.2516504 ENSBTAG00000042309 2.950037483 4.943732749 0.956342216 0.193445371 0.251673 ENSBTAG00000042732 2.950037483 4.943732749 0.956342216 0.193445371 0.251673 ENSBTAG00000042967 2.950037483 4.943732749 0.956342216 0.193445371 0.251673 ENSBTAG00000018404 507.2142978 374.5217155 639.90688 1.708597535 0.251673 783538 10.45141574 5.036289405 15.86654207 3.150442874 0.251673 ENSBTAG00000037340 683.9848666 844.5677727 523.4019604 0.619727602 0.2517195 ENSBTAG00000009443 2231.506745 2624.781131 1838.232359 0.700337387 0.2518911 ENSBTAG00000038503 17.20079676 24.41832506 9.983268458 0.408843294 0.2522272 ENSBTAG00000033260 1151.407376 1388.51143 914.3033225 0.658477347 0.2522372 ENSBTAG00000021956 1349.74853 1029.792363 1669.704698 1.621399379 0.2522372 ENSBTAG00000000284 490.1953272 352.3384469 628.0522074 1.782525333 0.2538051 ENSBTAG00000020456 71.45437299 47.70136912 95.20737686 1.995904491 0.2538085 ENSBTAG00000020880 174.7265777 219.4902983 129.9628572 0.59211208 0.2539209 100138312 3427.364959 2495.799879 4358.930039 1.74650623 0.2539209 ENSBTAG00000002182 24.81763762 13.27605165 36.3592236 2.738707604 0.2539209 506902 34.95028005 49.13934079 20.7612193 0.422496903 0.2546359 ENSBTAG00000012529 2.839270029 4.882028312 0.796511746 0.163151808 0.2548338 ENSBTAG00000014267 4.590767809 0.901016072 8.280519547 9.190201822 0.2548338 616111 3.263191674 5.274923659 1.25145969 0.237246977 0.2551144 ENSBTAG00000020283 6.362418936 9.998808929 2.726028944 0.272635367 0.2551144 ENSBTAG00000001979 13.82011752 18.97860482 8.661630219 0.456389197 0.2551144 ENSBTAG00000019568 144.205019 191.133387 97.27665103 0.50894641 0.2551144 ENSBTAG00000007562 4341.697004 3364.126371 5319.267637 1.58117355 0.2551144 ENSBTAG00000035206 799.4850578 601.4621206 997.5079951 1.658471849 0.2551144 ENSBTAG00000033228 114.8881873 80.57535416 149.2010204 1.851695496 0.2551144 ENSBTAG00000017073 14.50447384 20.87547782 8.133469869 0.389618381 0.2554315 100336235 18.57170113 24.79250142 12.35090083 0.498170823 0.2554315 ENSBTAG00000005891 49.84907699 66.89045977 32.80769421 0.49046896 0.2556564 ENSBTAG00000037272 59.60781991 75.9393044 43.27633542 0.569880588 0.2560402 ENSBTAG00000012194 198.5070239 258.3182227 138.6958252 0.536918471 0.2566332 ENSBTAG00000017375 129.0150492 168.1027931 89.92730537 0.534954261 0.2568649 ENSBTAG00000035698 4.976605097 7.981298643 1.97191155 0.247066504 0.2573017 ENSBTAG00000014011 65.26291949 88.03895421 42.48688477 0.482591884 0.2578018 ENSBTAG00000039992 9458.204928 6600.754775 12315.65508 1.865794973 0.2578018 ENSBTAG00000037776 9.962766335 4.951428856 14.97410381 3.024198519 0.2581965 ENSBTAG00000015061 590.6871192 415.1174845 766.2567538 1.845879257 0.2587008 ENSBTAG00000020831 1955.178436 1505.983902 2404.37297 1.596546263 0.2592558 ENSBTAG00000019459 34.99994445 23.09737558 46.90251332 2.030642536 0.2592558 ENSBTAG00000020934 5.503252434 8.18575391 2.820750959 0.34459269 0.2594215 539238 20.52638089 27.89946786 13.15329392 0.471453219 0.2599743 ENSBTAG00000036140 124.1490092 161.2861655 87.01185289 0.539487393 0.2600186 538070 14.10474628 21.30740888 6.902083677 0.323928814 0.2614216 ENSBTAG00000001071 94.82727748 120.6422111 69.01234381 0.572041437 0.2617068 ENSBTAG00000013577 12146.09129 14606.7224 9685.460188 0.663082376 0.2617068

PAGE 43

100300765 9.877756544 14.75840314 4.997109944 0.338594216 0.2618497 786836 128.0396867 83.29351058 172.7858629 2.074421665 0.261917 535632 609.1593498 761.6366614 456.6820382 0.599606166 0.2619924 100336022 9.343159754 14.2922253 4.394094203 0.307446469 0.26252 ENSBTAG00000016420 8374.443519 6532.333262 10216.55378 1.563997636 0.2638974 ENSBTAG00000001918 60.96455928 81.08596246 40.8431561 0.503701934 0.2640847 ENSBTAG00000011762 4.924180067 7.889229376 1.959130758 0.248329801 0.2641324 ENSBTAG00000007447 8305.876012 10380.46224 6231.289785 0.600290203 0.2641324 ENSBTAG00000003718 309.9095663 224.9387572 394.8803755 1.755501721 0.2641324 ENSBTAG00000014393 453.7267101 327.2996151 580.153805 1.772546554 0.2645336 ENSBTAG00000015390 86.97792 55.06001243 118.8958276 2.159386137 0.2645336 ENSBTAG00000044053 120.7143344 75.9866592 165.4420095 2.177250734 0.2648169 532479 4.429991418 6.511012589 2.348970247 0.360768807 0.2648687 532189 803.9449354 618.8857907 989.0040801 1.598039727 0.2648687 508805 4.87681906 7.889229376 1.864408743 0.236323303 0.2656872 788986 9.553653836 4.065872789 15.04143488 3.699435684 0.2656872 282493 16.6336843 23.60598369 9.661384904 0.409276946 0.2658606 ENSBTAG00000009461 21.70870228 30.34017053 13.07723403 0.431020453 0.2659198 ENSBTAG00000014373 2921.233002 3573.152567 2269.313437 0.635101187 0.2659198 ENSBTAG00000040539 13.7568262 18.97756225 8.53609015 0.449799086 0.2663481 530345 0.600677381 1.201354763 0 0 0.2664354 539509 0.600677381 1.201354763 0 0 0.2664354 781426 0.600677381 1.201354763 0 0 0.2664354 ENSBTAG00000006198 0.600677381 1.201354763 0 0 0.2664354 ENSBTAG00000008389 0.600677381 1.201354763 0 0 0.2664354 ENSBTAG00000009039 0.600677381 1.201354763 0 0 0.2664354 ENSBTAG00000012625 0.600677381 1.201354763 0 0 0.2664354 ENSBTAG00000013511 0.600677381 1.201354763 0 0 0.2664354 ENSBTAG00000014600 0.600677381 1.201354763 0 0 0.2664354 ENSBTAG00000019587 0.600677381 1.201354763 0 0 0.2664354 ENSBTAG00000019807 0.600677381 1.201354763 0 0 0.2664354 ENSBTAG00000023023 0.600677381 1.201354763 0 0 0.2664354 ENSBTAG00000024231 0.600677381 1.201354763 0 0 0.2664354 ENSBTAG00000030286 0.600677381 1.201354763 0 0 0.2664354 ENSBTAG00000032798 0.600677381 1.201354763 0 0 0.2664354 ENSBTAG00000037525 0.600677381 1.201354763 0 0 0.2664354 ENSBTAG00000038868 0.600677381 1.201354763 0 0 0.2664354 ENSBTAG00000039099 0.600677381 1.201354763 0 0 0.2664354 ENSBTAG00000044350 0.600677381 1.201354763 0 0 0.2664354 ENSBTAG00000009788 4.77856109 7.538764304 2.018357877 0.267730598 0.2664354 ENSBTAG00000005871 7.078999914 10.6650727 3.492927131 0.32751086 0.2664354 ENSBTAG00000023464 7.592023759 11.30818035 3.875867165 0.34274897 0.2664354 ENSBTAG00000018732 78.1474343 105.3854642 50.90940439 0.483078049 0.2664354 ENSBTAG00000032517 21.03098254 28.04603284 14.01593224 0.499747409 0.2664354 ENSBTAG00000008129 40.95786961 53.40399009 28.51174913 0.533887994 0.2664354 ENSBTAG00000025853 145.6416511 183.76823 107.5150721 0.585057994 0.2664354 ENSBTAG00000043544 188.3123593 236.1774014 140.4473173 0.594668738 0.2664354 ENSBTAG00000003462 125.9695514 155.6672312 96.27187149 0.61844661 0.2664354 ENSBTAG00000005030 2785.587234 3295.418182 2275.756286 0.690581941 0.2664354 ENSBTAG00000020480 1677.337149 1292.663827 2062.010472 1.595163746 0.2664354 ENSBTAG00000020270 289.6709454 204.9016334 374.4402575 1.827414702 0.2664354 532067 536.0625462 376.2167058 695.9083866 1.84975408 0.2664354

PAGE 44

ENSBTAG00000005414 157.8128669 109.8643328 205.761401 1.87286807 0.2664354 615027 114.1829149 75.80431747 152.5615122 2.012570225 0.2664354 ENSBTAG00000014322 110.0562321 72.87913758 147.2333267 2.020239695 0.2664354 ENSBTAG00000008079 57.26409419 33.5557766 80.97241178 2.413069223 0.2664354 ENSBTAG00000010856 3.384584052 1.147346432 5.621821671 4.899846737 0.2664354 510331 3.408959647 0.858585797 5.959333497 6.940871274 0.2664354 ENSBTAG00000001491 3.433954572 0.600677381 6.267231763 10.43360705 0.2664354 ENSBTAG00000002065 5296.823959 4060.199418 6533.4485 1.609144731 0.266858 ENSBTAG00000016026 58.3841421 78.99594108 37.77234312 0.478155493 0.2670593 529746 1774.962205 1330.660228 2219.264182 1.667791774 0.2670593 785291 536.5314447 402.7717119 670.2911774 1.664196262 0.2676895 ENSBTAG00000015221 895.1916718 662.8274993 1127.555844 1.701130151 0.2676895 ENSBTAG00000012762 225.4737623 282.920216 168.0273086 0.593903508 0.2683175 510904 130.6213435 172.8355655 88.40712153 0.511510008 0.2683343 ENSBTAG00000008844 3.185283424 0.600677381 5.769889468 9.60563798 0.2691475 ENSBTAG00000021182 117.8100555 79.2352661 156.3848449 1.973677285 0.2692498 ENSBTAG00000019429 19.73295061 26.00876101 13.45714021 0.517407969 0.2693306 ENSBTAG00000018862 592.8378355 431.7827538 753.8929171 1.74600053 0.2693306 504346 42.79397653 26.45947884 59.12847421 2.234680228 0.2693306 ENSBTAG00000021041 2.227053217 3.592486232 0.861620201 0.239839528 0.2693948 ENSBTAG00000025220 1353.498929 1626.340014 1080.657844 0.664472272 0.2693948 ENSBTAG00000018877 215.3038995 147.6749775 282.9328215 1.915915792 0.2693948 ENSBTAG00000002959 63.783046 41.9217193 85.6443727 2.042959452 0.2693948 ENSBTAG00000011726 220.5013764 151.3888553 289.6138976 1.913046354 0.2695248 ENSBTAG00000038539 4.406213722 1.447685123 7.364742321 5.087254269 0.2697017 ENSBTAG00000000585 196.2655724 130.8146231 261.7165216 2.000667169 0.2702421 ENSBTAG00000003366 31.03965683 17.58437285 44.49494082 2.530368368 0.2705464 ENSBTAG00000000770 98.30956689 130.0762507 66.54288309 0.511568274 0.2706094 ENSBTAG00000000189 16.97478993 9.456509216 24.49307064 2.590075268 0.270617 ENSBTAG00000020693 4600.119088 3550.111452 5650.126723 1.591535026 0.270644 ENSBTAG00000032858 55.86297448 73.92075155 37.80519741 0.511428748 0.2708444 ENSBTAG00000018503 4.372386893 7.145868958 1.598904828 0.22375233 0.2708649 ENSBTAG00000006214 253.681186 157.5537086 349.8086633 2.220250265 0.2708649 ENSBTAG00000010163 4.339832665 7.145868958 1.533796373 0.214640988 0.2709506 ENSBTAG00000018861 2.753076156 4.408641755 1.097510557 0.24894528 0.2709506 ENSBTAG00000025576 8.122941508 11.95461478 4.291268238 0.358963322 0.2709506 ENSBTAG00000015849 7.858523987 11.51644978 4.200598199 0.364747668 0.2709506 540095 12.04904062 17.42234785 6.675733382 0.383170709 0.2709506 ENSBTAG00000001696 30.76599034 43.6310592 17.90092147 0.410279324 0.2709506 ENSBTAG00000016881 26.07640627 34.79567969 17.35713285 0.498830113 0.2709506 ENSBTAG00000021614 529.6013352 656.1892551 403.0134153 0.614172531 0.2709506 ENSBTAG00000021164 1041.328868 785.9384174 1296.719319 1.649899395 0.2709506 ENSBTAG00000016822 453.5742438 310.6254887 596.5229989 1.920392951 0.2709506 ENSBTAG00000001922 22.47165106 13.27937841 31.66392371 2.384443211 0.2709506 100336184 6.501562973 2.337123139 10.66600281 4.563731637 0.2709506 100336828 436.5024206 510.5679122 362.436929 0.709870167 0.2709813 784737 193.500435 253.9560415 133.0448284 0.523889204 0.2713651 ENSBTAG00000001562 231.5916243 282.2111745 180.9720742 0.641264735 0.2717647 ENSBTAG00000039561 18.30437243 25.68089687 10.927848 0.425524391 0.2720216 ENSBTAG00000019447 22.44511206 30.62948634 14.26073779 0.465588539 0.2720886 ENSBTAG00000004653 121.2204159 159.6827571 82.7580748 0.518265568 0.2721967 ENSBTAG00000031967 26.17755857 37.20497496 15.15014219 0.407207429 0.2727016

PAGE 45

ENSBTAG00000016277 1780.304709 1375.052909 2185.556508 1.589434481 0.2727016 ENSBTAG00000038536 207.5451888 266.1439508 148.9464269 0.559646111 0.2727966 783813 80.40213479 99.4712342 61.33303538 0.616590674 0.2727966 ENSBTAG00000015145 83.97082168 57.63077751 110.3108658 1.914096436 0.2727966 511094 230.375115 154.9207474 305.8294826 1.974102809 0.2727966 ENSBTAG00000021250 225.0908666 146.6891687 303.4925646 2.068950062 0.2727966 786432 2193.37303 2627.945628 1758.800432 0.669268197 0.2729005 ENSBTAG00000042910 27.39619041 38.43620716 16.35617367 0.425540782 0.2731971 ENSBTAG00000020257 120.6751241 75.65165413 165.698594 2.19028382 0.2734054 100336793 8.192319222 12.76737574 3.617262705 0.283320768 0.2734083 ENSBTAG00000024539 68.80927454 46.01504975 91.60349932 1.990729116 0.2734083 ENSBTAG00000032905 55.68169068 71.15322731 40.21015404 0.565120593 0.2745925 ENSBTAG00000026748 68.5508657 93.00619487 44.09553653 0.474113973 0.2748766 ENSBTAG00000005808 515.5679716 401.6281797 629.5077635 1.56738943 0.2750625 783115 77.06098775 104.3725495 49.74942599 0.476652398 0.275119 ENSBTAG00000026250 34.01518084 43.03932388 24.99103781 0.580655911 0.275119 ENSBTAG00000017582 3926.565749 4901.857549 2951.27395 0.602072565 0.275119 ENSBTAG00000007382 1105.515237 814.611462 1396.419012 1.714214785 0.275119 ENSBTAG00000011043 24.24252261 14.68512065 33.79992458 2.301644323 0.275119 ENSBTAG00000021811 504.7991055 618.0960503 391.5021607 0.633400198 0.2751397 533107 12.14484121 5.371362264 18.91832017 3.522071169 0.275642 ENSBTAG00000031829 32176.83153 38174.40772 26179.25534 0.685780262 0.2759762 ENSBTAG00000000700 265.0698983 186.7744735 343.3653232 1.838395348 0.2760154 ENSBTAG00000006466 58.90278049 80.55308787 37.2524731 0.46245866 0.2761368 ENSBTAG00000000696 1269.146097 970.0135083 1568.278686 1.616759635 0.2764081 ENSBTAG00000009836 49.50001448 64.04153734 34.95849162 0.545872149 0.2765735 100138522 1.829828528 0 3.659657056 NA 0.2766189 ENSBTAG00000008350 139.5174655 91.30233467 187.7325962 2.056164247 0.2766205 507283 1.782467521 0 3.564935041 NA 0.2766205 ENSBTAG00000002357 814.7675415 983.9147029 645.6203802 0.656175152 0.2768938 ENSBTAG00000044017 2.776915241 0.300338691 5.253491791 17.4918915 0.2768938 ENSBTAG00000014971 2780.857668 2165.987118 3395.728217 1.567750883 0.2769602 100336292 29.40396039 40.83600951 17.97191126 0.440099595 0.2773214 ENSBTAG00000011839 115.4566405 81.47637023 149.4369107 1.834113502 0.2773214 ENSBTAG00000005403 42.86343603 25.63902177 60.08785028 2.343609316 0.2773214 ENSBTAG00000009417 7332.316159 9166.926841 5497.705477 0.599732666 0.2774655 ENSBTAG00000037544 6.667743732 10.13767781 3.197809656 0.315438083 0.2775242 ENSBTAG00000011509 538.4794577 397.7474073 679.211508 1.707645343 0.2775242 ENSBTAG00000020123 191.1367578 128.3430682 253.9304474 1.978528727 0.2775242 ENSBTAG00000039316 67.95216449 90.0405171 45.86381189 0.509368597 0.2783713 ENSBTAG00000020321 159.2009459 204.4155584 113.9863333 0.557620634 0.2783713 541220 11.14415909 4.955310805 17.33300737 3.497864827 0.2783713 100296141 2.663802405 0.589099325 4.738505484 8.043644392 0.2784455 ENSBTAG00000001911 26.36977526 37.56750547 15.17204505 0.403860859 0.2784928 ENSBTAG00000019192 14.15335102 20.28256433 8.0241377 0.395617515 0.2788422 ENSBTAG00000008773 16.60219837 23.33268306 9.871713676 0.423085234 0.27917 ENSBTAG00000020778 591.7698046 424.1216275 759.4179817 1.790566508 0.2793341 ENSBTAG00000004553 63150.19699 48714.04075 77586.35323 1.592689747 0.2795603 ENSBTAG00000013147 20.06697724 28.19155526 11.94239922 0.42361619 0.2796434 ENSBTAG00000031433 86.57147385 112.4543043 60.68864341 0.539673815 0.2796434 ENSBTAG00000013493 139.8967175 181.8265704 97.96686447 0.538792896 0.2800268 514559 528.0358173 668.1734383 387.8981962 0.580535193 0.2801865

PAGE 46

ENSBTAG00000001654 57.92447764 40.70871869 75.1402366 1.845802055 0.2801865 ENSBTAG00000026822 14.64525544 7.765820502 21.52469038 2.771721336 0.2805659 ENSBTAG00000025644 139.3413278 92.77310811 185.9095475 2.003916342 0.2809686 ENSBTAG00000031721 3.907930373 6.341291491 1.474569254 0.232534533 0.2815235 ENSBTAG00000006342 8028.192556 5982.398036 10073.98708 1.683937948 0.2815235 ENSBTAG00000014299 240.2655387 165.7564482 314.7746292 1.899018908 0.2815235 ENSBTAG00000032324 38.48336432 51.46253389 25.50419475 0.495587621 0.2816263 513583 372.5048704 463.5237249 281.486016 0.607274236 0.2816263 ENSBTAG00000018747 12.83106669 5.609996517 20.05213686 3.574358166 0.2816263 ENSBTAG00000011421 48.92318997 64.69996941 33.14641054 0.512309524 0.2822874 ENSBTAG00000015260 38.66342247 23.05938243 54.26746251 2.353378833 0.2824932 ENSBTAG00000011381 73.63211565 41.8958594 105.3683719 2.515006815 0.2825617 ENSBTAG00000044326 3.869079545 5.825474659 1.912684432 0.328331088 0.2827788 100336886 0.729631589 1.459263179 0 0 0.2828368 510329 0.729631589 1.459263179 0 0 0.2828368 791066 0.729631589 1.459263179 0 0 0.2828368 ENSBTAG00000003493 0.729631589 1.459263179 0 0 0.2828368 ENSBTAG00000009371 0.729631589 1.459263179 0 0 0.2828368 ENSBTAG00000018524 0.729631589 1.459263179 0 0 0.2828368 ENSBTAG00000018838 0.729631589 1.459263179 0 0 0.2828368 ENSBTAG00000042771 0.729631589 1.459263179 0 0 0.2828368 100138767 3.840680602 6.206791949 1.474569254 0.237573495 0.2828368 ENSBTAG00000016206 28.02560511 38.75249325 17.29871697 0.446389781 0.2828368 783404 71.70218623 91.11854794 52.28582453 0.573821968 0.2828368 ENSBTAG00000003349 1188.825236 1471.971673 905.6787981 0.615282763 0.2828368 ENSBTAG00000033240 2.383220402 0.300338691 4.466102114 14.87021903 0.2828368 506315 6.639845209 10.55366147 2.726028944 0.258301723 0.2830668 ENSBTAG00000001154 35.46315948 46.81151151 24.11480745 0.515146952 0.2832061 ENSBTAG00000003536 450.7050314 326.1488741 575.2611888 1.763799401 0.2836587 ENSBTAG00000006078 0.745057699 1.490115397 0 0 0.2843823 ENSBTAG00000007309 0.745057699 1.490115397 0 0 0.2843823 ENSBTAG00000009105 0.745057699 1.490115397 0 0 0.2843823 ENSBTAG00000010020 0.745057699 1.490115397 0 0 0.2843823 ENSBTAG00000018095 0.745057699 1.490115397 0 0 0.2843823 538759 2.350787423 3.604064288 1.097510557 0.30452025 0.2843823 ENSBTAG00000017446 22.58336722 31.12505424 14.0416802 0.451137533 0.2843823 ENSBTAG00000025471 20.65649448 28.26435037 13.04863859 0.461664196 0.2843823 ENSBTAG00000000295 314.14519 232.1597904 396.1305897 1.706284232 0.2843823 ENSBTAG00000019052 463.7190656 358.236793 569.2013382 1.588896923 0.2844637 ENSBTAG00000021538 209.7947907 151.8596187 267.7299627 1.763009581 0.2844637 ENSBTAG00000006833 3081.071228 2396.426016 3765.716441 1.571388566 0.2855023 ENSBTAG00000020341 8.395853675 12.06700078 4.724706574 0.391539427 0.2861349 ENSBTAG00000017566 704.3899591 529.7817652 878.9981529 1.659170267 0.2861349 ENSBTAG00000020661 1089.45134 849.5204476 1329.382233 1.56486196 0.2862994 ENSBTAG00000009023 180.9469658 127.1473244 234.7466071 1.846256759 0.2866073 100139988 49.46283688 30.74471172 68.18096204 2.217648441 0.2870876 514474 55.44505456 32.24210363 78.6480055 2.439295103 0.2870876 ENSBTAG00000031468 5.620096971 8.235880291 3.004313652 0.36478355 0.2871375 ENSBTAG00000027569 2980.876133 3556.347919 2405.404347 0.676369242 0.2875218 ENSBTAG00000016663 216.3234854 154.1380801 278.5088906 1.806879198 0.2875218 ENSBTAG00000021787 264.7786623 187.9252401 341.6320844 1.817914848 0.2877615 516435 2.164366707 4.092843058 0.235890356 0.05763484 0.287855

PAGE 47

ENSBTAG00000004290 215.2217963 154.3540456 276.089547 1.788677102 0.2885037 ENSBTAG00000011037 189.2212959 240.183032 138.2595599 0.575642495 0.2892846 ENSBTAG00000012454 618.4650436 481.5936982 755.3363891 1.568410035 0.2892846 ENSBTAG00000008061 140.3938935 97.05334868 183.7344382 1.893128271 0.2892846 ENSBTAG00000014522 648.0163534 497.2603767 798.77233 1.606346227 0.2896935 616450 2.118088379 4.000286403 0.235890356 0.058968367 0.2898365 ENSBTAG00000044108 2.498492342 4.465976854 0.53100783 0.118900713 0.2898365 522188 21.42425412 30.47855202 12.36995622 0.405857739 0.2898365 ENSBTAG00000002549 1737.329793 2103.572775 1371.08681 0.651789578 0.2898365 ENSBTAG00000006033 918.9179969 695.167067 1142.668927 1.643732825 0.2898365 ENSBTAG00000015089 349.7848674 238.7414538 460.828281 1.930239904 0.2898365 506184 35.21820444 21.21880196 49.21760691 2.319528077 0.2898365 ENSBTAG00000031764 16.4604522 8.794127397 24.126777 2.743510062 0.2901232 100297155 7.633132388 11.42001117 3.846253606 0.336799461 0.2906983 ENSBTAG00000005481 6310.033083 4970.218152 7649.848014 1.539137273 0.2910388 ENSBTAG00000035755 2.082154177 3.804082424 0.36022593 0.094694565 0.2910627 ENSBTAG00000015579 3.598661645 5.598418461 1.598904828 0.285599378 0.2910627 ENSBTAG00000011451 56.01230989 76.27998823 35.74463156 0.468597759 0.2910627 528802 27.63991214 36.59334249 18.68648178 0.510652499 0.2910627 ENSBTAG00000003541 1062.117422 1341.671299 782.5635462 0.583275164 0.2910627 ENSBTAG00000013671 1538.29038 1203.315081 1873.265679 1.556754095 0.2910627 520186 72.41080189 91.40258743 53.41901636 0.584436588 0.2914721 ENSBTAG00000042512 67.40007239 89.4663226 45.33382218 0.506713821 0.2915445 ENSBTAG00000009953 4.797227074 6.541864808 3.05258934 0.466623727 0.2915976 ENSBTAG00000008053 523.0922163 406.5821089 639.6023238 1.573119696 0.2915976 539735 0.858585797 1.717171595 0 0 0.2923234 ENSBTAG00000013220 0.858585797 1.717171595 0 0 0.2923234 ENSBTAG00000035795 0.858585797 1.717171595 0 0 0.2923234 ENSBTAG00000042156 0.858585797 1.717171595 0 0 0.2923234 ENSBTAG00000044744 0.858585797 1.717171595 0 0 0.2923234 100300196 0.874011907 1.748023813 0 0 0.2923234 509074 0.874011907 1.748023813 0 0 0.2923234 526780 0.874011907 1.748023813 0 0 0.2923234 ENSBTAG00000003446 0.874011907 1.748023813 0 0 0.2923234 ENSBTAG00000028880 0.874011907 1.748023813 0 0 0.2923234 ENSBTAG00000042237 0.874011907 1.748023813 0 0 0.2923234 767889 3.459501329 5.555988187 1.363014472 0.245323501 0.2923234 ENSBTAG00000020048 105.2911966 135.2021896 75.38020367 0.557536856 0.2923234 788694 2039.558077 2401.801727 1677.314428 0.698356742 0.2923234 ENSBTAG00000009523 2147.935775 1657.623377 2638.248173 1.591584801 0.2923234 ENSBTAG00000005976 221.254408 159.8873651 282.6214509 1.767628422 0.2923234 790030 12.95984207 7.403777374 18.51590676 2.500872976 0.2923234 ENSBTAG00000007468 204.7638941 146.064157 263.4636312 1.803752793 0.2925041 100336859 0.889438016 1.778876032 0 0 0.2927593 281413 0.889438016 1.778876032 0 0 0.2927593 ENSBTAG00000010373 0.889438016 1.778876032 0 0 0.2927593 ENSBTAG00000015878 833.850659 1020.273153 647.4281649 0.634563561 0.292844 ENSBTAG00000011885 117.9720451 157.5464235 78.39766662 0.497616289 0.2928473 ENSBTAG00000032631 1.178198651 2.356397301 0 0 0.2929309 ENSBTAG00000001753 1.162772541 2.325545083 0 0 0.2929525 ENSBTAG00000015752 1.162772541 2.325545083 0 0 0.2929525 ENSBTAG00000001229 410.8283354 499.740285 321.9163857 0.644167371 0.2929525

PAGE 48

ENSBTAG00000020144 6.211667868 2.090792779 10.33254296 4.941925887 0.2929525 100141230 1.147346432 2.294692864 0 0 0.2932212 540297 1.131920323 2.263840645 0 0 0.2932513 ENSBTAG00000040571 1.131920323 2.263840645 0 0 0.2932513 ENSBTAG00000003492 1.116494213 2.232988427 0 0 0.2932513 ENSBTAG00000036044 1.116494213 2.232988427 0 0 0.2932513 100297122 1.002966115 2.005932229 0 0 0.2932513 100336008 1.002966115 2.005932229 0 0 0.2932513 789335 1.002966115 2.005932229 0 0 0.2932513 ENSBTAG00000004936 1.033818333 2.067636667 0 0 0.2932513 ENSBTAG00000006421 1.033818333 2.067636667 0 0 0.2932513 ENSBTAG00000015008 1.033818333 2.067636667 0 0 0.2932513 ENSBTAG00000032485 1.033818333 2.067636667 0 0 0.2932513 512266 1.018392224 2.036784448 0 0 0.2932513 ENSBTAG00000028898 1.018392224 2.036784448 0 0 0.2932513 ENSBTAG00000019488 244.7118688 173.5099321 315.9138056 1.820724623 0.2932513 ENSBTAG00000008697 152.3227241 106.6024146 198.0430337 1.857772495 0.2932513 ENSBTAG00000015512 295.7002936 212.0581734 379.3424138 1.78886014 0.2935234 ENSBTAG00000010597 1492.503661 1124.515518 1860.491805 1.654482998 0.2941297 ENSBTAG00000015716 1179.289316 922.4185203 1436.160112 1.556950647 0.2950859 ENSBTAG00000042538 1.905838961 3.546174008 0.265503915 0.074870527 0.2951193 784245 16.00963551 9.22508368 22.79418733 2.470892202 0.2951193 ENSBTAG00000001100 19.30883929 25.53537445 13.08230412 0.512320826 0.2953345 617717 71.50939071 94.48085026 48.53793116 0.513733005 0.2953345 ENSBTAG00000005205 3.604794073 0.858585797 6.351002348 7.397050321 0.2953345 ENSBTAG00000030725 1.891032182 3.546174008 0.235890356 0.066519679 0.2955377 ENSBTAG00000000070 13.4276594 17.27689323 9.578425564 0.554406712 0.2955739 ENSBTAG00000031806 155.7857423 191.9139906 119.657494 0.623495419 0.2955739 510879 12.92532284 6.703334619 19.14731107 2.856385986 0.2955739 ENSBTAG00000011952 12.92167913 5.352088101 20.49127016 3.828649635 0.2955739 534212 1696.179058 1280.397117 2111.961 1.649457791 0.2958959 100337398 2.272055474 4.042716677 0.501394271 0.124024093 0.2965567 ENSBTAG00000006125 75.82603507 99.92751237 51.72455777 0.517620789 0.2965567 100137751 8.880167764 12.85611824 4.904217291 0.381469523 0.2965853 ENSBTAG00000042195 2.257248695 4.042716677 0.471780712 0.11669893 0.2969811 100335622 15.58788931 22.3660806 8.809698015 0.393886536 0.2969811 ENSBTAG00000012856 11.88950314 16.96393391 6.815072361 0.401738912 0.2969811 ENSBTAG00000012873 973.7078984 755.3229289 1192.092868 1.578255899 0.2969811 ENSBTAG00000039681 6.45021894 9.814183006 3.086254874 0.314468853 0.2969998 540108 737.9053795 519.6719776 956.1387813 1.83988905 0.2969998 ENSBTAG00000042235 27.40086112 36.85069573 17.95102652 0.487128565 0.2977692 ENSBTAG00000003764 1443.444498 1781.490592 1105.398404 0.620490733 0.2977692 ENSBTAG00000008966 27.87892289 14.77004899 40.98779679 2.775061668 0.2982828 ENSBTAG00000018893 10535.07145 13124.93683 7945.206076 0.605351948 0.2985347 ENSBTAG00000004899 8.968894602 4.065872789 13.87191642 3.411793023 0.2985347 521780 1.793393542 3.226561155 0.36022593 0.111643918 0.2986526 ENSBTAG00000015925 531.6077959 643.6450536 419.5705382 0.651866329 0.2986526 ENSBTAG00000040333 393.519194 307.4682517 479.5701363 1.559738717 0.2986526 ENSBTAG00000005892 183.1653956 235.4469457 130.8838456 0.555895279 0.2988029 ENSBTAG00000006420 349.6115926 246.5381222 452.685063 1.836166589 0.2988356 ENSBTAG00000039634 1185.243442 843.3666215 1527.120263 1.810743067 0.2989383 ENSBTAG00000040336 116.6930834 151.5827707 81.80339606 0.53966157 0.2992787

PAGE 49

ENSBTAG00000001297 4174.572472 4909.342994 3439.80195 0.700664418 0.2994609 ENSBTAG00000004775 4.024205883 6.626170176 1.422241591 0.214640064 0.2999606 ENSBTAG00000037493 1915.266992 1428.865712 2401.668272 1.680821543 0.2999606 537989 29.8227016 40.91692032 18.72848288 0.457719758 0.2999916 ENSBTAG00000023997 289.2554261 207.5098408 371.0010114 1.787871891 0.300121 ENSBTAG00000027151 50.05066623 31.82258982 68.27874265 2.145606094 0.300121 529905 4.010637763 6.687874613 1.333400913 0.199375884 0.3002884 ENSBTAG00000000438 3.433717862 5.521254019 1.346181705 0.243818107 0.3005301 ENSBTAG00000044097 30.26207792 41.92165151 18.60250433 0.443744549 0.3008643 ENSBTAG00000012139 2.157908046 3.784808261 0.53100783 0.140299797 0.3009249 785144 1.715180316 3.164856717 0.265503915 0.083891291 0.3011239 100336081 3.169139293 5.5713804 0.766898186 0.137649583 0.3011239 ENSBTAG00000018585 1.700373537 3.164856717 0.235890356 0.074534292 0.3015732 518798 25.46784003 14.31926337 36.61641669 2.55714388 0.3015732 ENSBTAG00000005064 333.1557733 249.7576059 416.5539406 1.667832854 0.3015812 ENSBTAG00000037842 4.22289225 6.499434533 1.946349966 0.299464508 0.3016342 ENSBTAG00000033940 2.127055827 3.723103824 0.53100783 0.14262504 0.3019491 615226 4.898965625 7.619742904 2.178188347 0.285861134 0.3019491 ENSBTAG00000012865 13182.40315 16394.05041 9970.755885 0.60819356 0.3019491 614438 2.123675853 3.526899845 0.72045186 0.20427341 0.3020011 ENSBTAG00000015151 122.496541 83.83629768 161.1567843 1.922279356 0.3020011 787173 26.31521403 14.93921491 37.69121314 2.522971479 0.3020835 509657 39.20654327 25.82788145 52.58520509 2.035986002 0.3021994 ENSBTAG00000009178 224.9176068 153.2363098 296.5989039 1.93556543 0.3025574 ENSBTAG00000010413 153.3477695 192.5953582 114.1001807 0.592434738 0.3027821 ENSBTAG00000011056 8.681372627 3.550055957 13.8126893 3.890837064 0.3027821 ENSBTAG00000008529 1.169130595 2.102370835 0.235890356 0.112202068 0.3030864 ENSBTAG00000037793 1.169130595 2.102370835 0.235890356 0.112202068 0.3030864 ENSBTAG00000006036 1162.674253 1378.134571 947.2139343 0.687315995 0.3030864 ENSBTAG00000013990 8.116072636 3.526899845 12.70524543 3.602383392 0.3030864 ENSBTAG00000014375 178.6517081 115.530978 241.7724382 2.092706583 0.3032538 ENSBTAG00000016446 38.85855106 24.45687338 53.26022874 2.177720264 0.3032708 ENSBTAG00000016442 165.1355516 118.455734 211.8153691 1.788139434 0.3033412 ENSBTAG00000039986 1.602271547 2.968652739 0.235890356 0.079460407 0.3035192 781952 1.601652218 2.93780052 0.265503915 0.090375066 0.3035192 ENSBTAG00000031677 1.183937375 2.102370835 0.265503915 0.126287861 0.3035192 ENSBTAG00000016684 8.635175797 12.0245705 5.245781092 0.436255174 0.3035192 ENSBTAG00000025496 4373.743071 3275.498406 5471.987735 1.670581712 0.3039426 ENSBTAG00000030338 6.108395984 9.071309976 3.145481993 0.34675058 0.3042587 529230 279.2656758 355.095512 203.4358397 0.572904565 0.3042587 613988 64.07703005 39.38506542 88.76899469 2.253874502 0.3042587 ENSBTAG00000002440 1.555993219 2.876096083 0.235890356 0.082017551 0.3045279 ENSBTAG00000014466 1.231298382 2.102370835 0.36022593 0.171342717 0.3045279 785623 2.830720356 4.705098496 0.956342216 0.203256577 0.3045279 ENSBTAG00000021215 4.619580277 7.669869285 1.569291269 0.204604695 0.3045279 ENSBTAG00000042298 22.06090927 30.16226593 13.9595526 0.462815116 0.3045279 524854 741.8814155 900.3132253 583.4496057 0.648051799 0.3045279 ENSBTAG00000022238 2365.757892 1753.028949 2978.486835 1.69905171 0.3045279 ENSBTAG00000000829 225.2129091 149.5199273 300.9058909 2.012480184 0.3045279 ENSBTAG00000014599 38.95047103 25.43886805 52.46207402 2.062280205 0.3045279 ENSBTAG00000015909 38.26612611 24.55719394 51.97505828 2.116490118 0.3045279 ENSBTAG00000009539 45.50937024 28.5271833 62.49155719 2.190596826 0.3045279

PAGE 50

786992 4.12320011 1.158924488 7.087475731 6.11556301 0.3045279 505077 4.222998171 1.178198651 7.267797692 6.16856732 0.3045279 ENSBTAG00000003118 2.898025499 4.462650085 1.333400913 0.298791276 0.3045814 782689 18.14748514 24.71096764 11.58400265 0.468779807 0.3048171 ENSBTAG00000010270 37.56073465 23.9449385 51.1765308 2.137258812 0.3048171 ENSBTAG00000017166 11.99422756 6.718726832 17.26972828 2.570387026 0.3048171 ENSBTAG00000014309 1.45789123 2.679892104 0.235890356 0.088022333 0.3051896 523702 1.298084803 2.360279251 0.235890356 0.099941715 0.3051896 ENSBTAG00000021460 1.441845791 2.618187667 0.265503915 0.101407519 0.3051896 ENSBTAG00000009938 1.998720949 3.496047627 0.501394271 0.14341746 0.3051896 100337051 4.747777137 7.785094664 1.71045961 0.219709545 0.3051896 ENSBTAG00000039336 1.994721645 3.268991429 0.72045186 0.220389645 0.3051896 ENSBTAG00000008330 77.71164137 101.1235908 54.29969194 0.536963645 0.3051896 515105 265.345533 326.2795723 204.4114937 0.626491852 0.3051896 ENSBTAG00000044652 1.238678898 0 2.477357796 NA 0.3052097 ENSBTAG00000005903 1.3756787 2.391131469 0.36022593 0.150650826 0.3056137 ENSBTAG00000034184 360.6673098 456.8884393 264.4461803 0.578798143 0.3056794 ENSBTAG00000013740 129.3893823 163.138947 95.63981758 0.586247609 0.3059336 ENSBTAG00000002238 83.20981864 100.9793143 65.44032294 0.648056717 0.3059336 ENSBTAG00000020080 1.96848806 3.465195408 0.471780712 0.136148372 0.3060411 ENSBTAG00000022036 1.96848806 3.465195408 0.471780712 0.136148372 0.3060411 616320 60.19188278 40.12835804 80.25540753 1.999967391 0.3063726 518298 20.35894047 27.9534084 12.76447255 0.456633852 0.3067448 ENSBTAG00000021844 94.78766725 124.9641912 64.61114328 0.517037262 0.3067448 ENSBTAG00000017103 183.9185033 234.5368391 133.3001674 0.568354924 0.3067448 ENSBTAG00000014534 2620.110468 2081.239624 3158.981313 1.517836426 0.3067448 ENSBTAG00000021955 474.7952036 349.1486372 600.44177 1.7197311 0.3067448 ENSBTAG00000002289 34.51911121 47.39956827 21.63865415 0.456515849 0.3067881 ENSBTAG00000016656 138.3311551 180.3677946 96.29451562 0.533878655 0.3071435 100335727 218.7170955 149.4770096 287.9571813 1.926431242 0.3071435 ENSBTAG00000008673 2.658867795 4.550837403 0.766898186 0.168518037 0.3078015 ENSBTAG00000024477 4.645056514 7.330982269 1.959130758 0.267239871 0.3078015 100337278 15.12196973 7.05379969 23.19013977 3.287609627 0.3078015 519280 2386.078801 2812.163817 1959.993784 0.696969989 0.3080817 ENSBTAG00000009969 1846.438962 2185.178955 1507.698968 0.689965902 0.3081099 ENSBTAG00000005450 30.42186146 15.87496515 44.96875777 2.832683873 0.3081099 ENSBTAG00000010565 91.71089468 117.7798417 65.64194763 0.557327525 0.3081589 ENSBTAG00000009384 104.3265404 67.56947975 141.083601 2.087978205 0.3081589 788119 32.92815325 42.3339566 23.52234989 0.55563788 0.3083415 ENSBTAG00000016185 616.6409876 768.4662228 464.8157525 0.604861656 0.3083415 ENSBTAG00000004242 345.2395413 243.7784297 446.7006529 1.832404341 0.3083415 ENSBTAG00000002068 3323.855684 2324.24055 4323.470818 1.860164955 0.3083415 ENSBTAG00000016108 1.315653465 0 2.63130693 NA 0.3083415 404125 172.7995652 216.634803 128.9643275 0.595307521 0.3084408 508603 18.26368097 26.55099293 9.976369003 0.375743726 0.3089683 ENSBTAG00000038124 354.9502649 268.7787217 441.1218082 1.641208075 0.3089683 ENSBTAG00000015438 448.8494361 301.1076947 596.5911775 1.981321594 0.3089683 ENSBTAG00000005266 1.869766741 3.238139211 0.501394271 0.154840246 0.3089832 ENSBTAG00000024754 6.450324616 9.702839576 3.197809656 0.329574619 0.3090597 ENSBTAG00000016330 6.003491906 8.967175264 3.039808548 0.338992878 0.3090597 781224 62.21900054 82.18353432 42.25446676 0.514147598 0.3090597 528523 1.854340632 3.207286992 0.501394271 0.156329718 0.3093502

PAGE 51

ENSBTAG00000002775 1.850341327 2.980230795 0.72045186 0.241743647 0.3093502 100337133 35.76525149 48.16657219 23.36393079 0.485065258 0.3093502 ENSBTAG00000015730 2617.938311 3114.597843 2121.278779 0.681076301 0.3093502 ENSBTAG00000015105 1070.4768 836.1311029 1304.822498 1.560547734 0.3094373 785351 1.360073804 0 2.720147607 NA 0.3094373 ENSBTAG00000020620 1.363014472 0 2.726028944 NA 0.3094373 ENSBTAG00000039542 1.363014472 0 2.726028944 NA 0.3094373 ENSBTAG00000001671 307.3430254 373.5295707 241.1564801 0.645615499 0.3101382 100139916 2.531152246 4.354633424 0.707671068 0.162509906 0.3103015 ENSBTAG00000012682 6.250885971 9.044339707 3.457432234 0.382275804 0.3103015 ENSBTAG00000007385 5827.508086 4621.663958 7033.352215 1.521822503 0.3103015 ENSBTAG00000006222 2126.343393 1647.519924 2605.166861 1.581265769 0.3103015 ENSBTAG00000010878 114.2971726 74.92450796 153.6698373 2.050995616 0.3105464 ENSBTAG00000001941 45.50017201 27.35668076 63.64366326 2.32643952 0.3105464 ENSBTAG00000002850 1.3955687 0 2.7911374 NA 0.3105464 ENSBTAG00000032079 33.6212257 19.78318229 47.45926911 2.39897042 0.3106924 ENSBTAG00000004099 1.787554211 2.949378576 0.625729845 0.212156503 0.3108558 788943 13.60787355 20.17066572 7.04508138 0.349273617 0.3108558 ENSBTAG00000017458 12.0944678 17.8880383 6.300897298 0.352240821 0.3108558 ENSBTAG00000011262 161.1834334 211.8184923 110.5483744 0.521901432 0.3108558 ENSBTAG00000022199 484.277728 362.8962065 605.6592495 1.668959991 0.3108558 ENSBTAG00000000490 35.81249051 20.19105025 51.43393076 2.547362823 0.3108558 ENSBTAG00000044070 7.454033092 2.649039885 12.2590263 4.627724319 0.3108558 ENSBTAG00000018098 215.9347424 158.3167585 273.5527262 1.727882309 0.3114965 784848 2.417004818 4.096725008 0.737284627 0.179969274 0.3122525 782569 1.740193203 2.949378576 0.53100783 0.18004058 0.3122525 ENSBTAG00000032435 1.740193203 2.949378576 0.53100783 0.18004058 0.3122525 ENSBTAG00000038061 2.974343325 4.851176094 1.097510557 0.226235976 0.3122525 ENSBTAG00000020494 17.77886788 24.94183799 10.61589776 0.425626121 0.3122525 ENSBTAG00000002895 23.23240064 31.89919908 14.5656022 0.456613414 0.3122525 ENSBTAG00000014549 564.8674131 703.0107298 426.7240964 0.60699514 0.3122525 ENSBTAG00000002645 304.0060672 372.2455254 235.7666089 0.633363178 0.3122525 ENSBTAG00000023633 682.6959769 808.1618914 557.2300624 0.689503017 0.3122525 ENSBTAG00000006679 283.4300982 211.9696472 354.8905492 1.674251734 0.3122525 282454 38.84654442 27.14494898 50.54813985 1.862156377 0.3122525 ENSBTAG00000005732 214.6442494 148.0182339 281.2702649 1.90024065 0.3122525 497621 64.94014155 43.07773662 86.80254648 2.01502106 0.3122525 100313129 6.413798893 2.606609611 10.22098818 3.921181037 0.3122525 281309 1.457736487 0 2.915472974 NA 0.3122525 ENSBTAG00000040558 1.472543267 0 2.945086533 NA 0.3122525 ENSBTAG00000019437 5.168984098 2.005932229 8.332035966 4.15369764 0.312887 539501 804.6002111 632.3787655 976.8216566 1.544678142 0.3134212 ENSBTAG00000009984 2311.549031 1778.125494 2844.972569 1.599984129 0.313489 781863 27.44690188 14.78932315 40.1044806 2.711718459 0.313489 ENSBTAG00000009238 1.549517833 0 3.099035666 NA 0.3135103 ENSBTAG00000015630 766.1815852 593.7832243 938.579946 1.580677775 0.314325 ENSBTAG00000021205 12.06915883 16.72529966 7.413018009 0.443221835 0.3143598 ENSBTAG00000011757 632.3212415 504.7265793 759.9159036 1.50559914 0.3143598 ENSBTAG00000032424 12.76521857 7.288551994 18.24188514 2.502813338 0.3143598 506950 1.628367114 2.660617941 0.596116286 0.224051818 0.3145349 ENSBTAG00000017641 720.4919201 875.6488496 565.3349906 0.645618379 0.3145349 ENSBTAG00000008576 6.28254739 2.05994056 10.50515422 5.099736577 0.3145349

PAGE 52

537640 4.140160997 6.711030725 1.569291269 0.233837593 0.3148741 ENSBTAG00000024153 4.371721988 6.784313218 1.959130758 0.28877363 0.3148741 ENSBTAG00000005092 6.137519934 8.609501474 3.665538393 0.425755011 0.3148741 ENSBTAG00000025042 90.07580833 63.14045347 117.0111632 1.853188515 0.3148741 ENSBTAG00000020431 89.90189277 56.79978496 123.0040006 2.165571589 0.3148741 ENSBTAG00000002738 1069.672435 1280.326415 859.018454 0.67093707 0.3152668 ENSBTAG00000017565 169.1489618 124.6080302 213.6898933 1.714896648 0.3152668 100336608 4.344869074 6.949664979 1.740073169 0.25038231 0.3158734 ENSBTAG00000011824 39.21288038 52.71345985 25.71230091 0.487774868 0.3158734 ENSBTAG00000001422 640.7644973 807.7627148 473.7662797 0.586516648 0.3158734 ENSBTAG00000000175 794.2160726 616.1375235 972.2946217 1.578048057 0.3158734 100335913 163.1293434 109.8445035 216.4141834 1.970186732 0.3158734 ENSBTAG00000004303 2.693821586 0.589099325 4.798543846 8.145559909 0.3161746 100336604 9.480779247 13.25677748 5.704781012 0.430329393 0.3161817 ENSBTAG00000019595 14.05958461 19.44374009 8.675429129 0.446181089 0.3161817 ENSBTAG00000005031 513.3378185 618.0355918 408.6400453 0.661191767 0.3164673 ENSBTAG00000017161 254.7203674 190.5932573 318.8474775 1.672921078 0.3164673 ENSBTAG00000021046 487.6305248 592.0223936 383.238656 0.647338108 0.316547 ENSBTAG00000010252 379.3979971 468.1116656 290.6843285 0.620972195 0.3169009 ENSBTAG00000013678 163.2648433 113.6630712 212.8666155 1.872786063 0.3169009 ENSBTAG00000033886 91.24540646 115.5282699 66.96254301 0.579620409 0.3170091 ENSBTAG00000005054 10.60442163 13.3763722 7.832471057 0.585545239 0.3170833 ENSBTAG00000007203 16322.74929 12793.77096 19851.72762 1.551671332 0.3174197 ENSBTAG00000002595 4.979907154 7.623624853 2.336189455 0.306440768 0.3176892 ENSBTAG00000032763 543.0088986 671.6384725 414.3793248 0.616967821 0.3176951 ENSBTAG00000006507 53.62500276 72.61179972 34.63820581 0.47703274 0.3177959 ENSBTAG00000026769 33.29563859 18.28537078 48.3059064 2.641778883 0.3178734 787125 150.7074961 192.7532979 108.6616943 0.563734553 0.3180041 507318 214.4185424 141.4465594 287.3905254 2.031795801 0.3180788 ENSBTAG00000020594 301.7995387 387.0893185 216.5097588 0.55932765 0.3183928 ENSBTAG00000006941 8.755531041 12.12045393 5.390608157 0.444752993 0.3186792 ENSBTAG00000031238 55.2571995 76.02243162 34.49196737 0.453707763 0.3186792 ENSBTAG00000005862 3084.996308 3796.79406 2373.198555 0.625053273 0.3186792 ENSBTAG00000018659 7.616109067 3.176434774 12.05578336 3.795381999 0.3186792 ENSBTAG00000017642 2.519184336 0.589099325 4.449269347 7.552664136 0.3186792 784129 2.504377556 0.589099325 4.419655787 7.502394923 0.3188874 100138541 464.290687 556.4360709 372.1453031 0.668801544 0.3190581 ENSBTAG00000013050 740.7694221 601.35001 880.1888342 1.463688068 0.3190581 ENSBTAG00000005633 431.285537 319.0486438 543.5224302 1.703572295 0.3190581 529366 273.6823424 196.9656044 350.3990804 1.77898614 0.3190581 ENSBTAG00000038335 304.5150163 217.8455872 391.1844455 1.795695982 0.3190581 ENSBTAG00000039504 3.963226452 6.422270091 1.504182813 0.234213571 0.3199365 100300635 2.746667798 4.36621148 1.127124116 0.258146936 0.3199365 522566 2.091690651 3.292147541 0.89123376 0.270715012 0.3199365 ENSBTAG00000011814 16.93665406 23.40547817 10.46782996 0.447238458 0.3199365 ENSBTAG00000003418 17197.06375 13168.9905 21225.137 1.611751258 0.3199365 788186 15.07131483 7.68532929 22.45730037 2.922099955 0.3199365 ENSBTAG00000019741 68.44076909 87.13516655 49.74637163 0.570910387 0.3201857 616451 18.854774 10.54215121 27.16739679 2.577025908 0.3215119 ENSBTAG00000043983 2.70162813 4.335359262 1.067896998 0.246322608 0.3220525 ENSBTAG00000005333 15.83400407 21.61557926 10.05242889 0.4650548 0.3220525 ENSBTAG00000009363 422.8373845 519.2291463 326.4456227 0.628712053 0.3220525

PAGE 53

785911 735.5442408 575.3192582 895.7692234 1.556995026 0.3220525 ENSBTAG00000005285 645.2726724 500.9920373 789.5533076 1.575979754 0.3220525 ENSBTAG00000005932 2.327443011 0.300338691 4.354547332 14.49878909 0.3220525 ENSBTAG00000019053 7.040129637 10.61106437 3.469194909 0.326941275 0.3229354 ENSBTAG00000024857 2.265275224 0.300338691 4.230211758 14.08480455 0.3229354 ENSBTAG00000014560 166.7358002 209.6343886 123.8372117 0.590729472 0.3235872 ENSBTAG00000036117 18.37437995 10.19938225 26.54937765 2.603037812 0.3235872 ENSBTAG00000033802 53.24708803 35.80360206 70.690574 1.974398383 0.3239337 100335353 4.721980777 7.065377747 2.378583806 0.336653452 0.3240474 ENSBTAG00000006909 661.4902822 515.0667672 807.9137973 1.568561299 0.3248604 ENSBTAG00000003636 293.9264676 379.4728011 208.380134 0.549130619 0.3251162 ENSBTAG00000009055 294.3570975 230.5026749 358.2115201 1.55404496 0.3251162 ENSBTAG00000004281 780.967718 538.9213149 1023.014121 1.898262498 0.3251162 ENSBTAG00000001265 13.31533997 17.1419063 9.488773642 0.553542499 0.3251279 788054 20.24996646 26.88662097 13.61331195 0.506322902 0.3252125 ENSBTAG00000003545 4169.027583 5134.512198 3203.542968 0.623923529 0.3257577 512304 244.5423061 298.5012292 190.583383 0.638467666 0.3257577 ENSBTAG00000001120 186.3235669 226.197816 146.4493177 0.647439132 0.3257577 ENSBTAG00000008897 736.4844325 565.1528982 907.8159667 1.606319227 0.3257577 ENSBTAG00000008880 623.8610374 475.5674511 772.1546236 1.623649015 0.3257577 ENSBTAG00000001564 377.8170272 282.0425766 473.5914779 1.679148885 0.3257577 ENSBTAG00000037383 67.12149011 40.10873208 94.13424814 2.346976413 0.3257577 514360 38.54901293 20.01467561 57.08335025 2.852074715 0.3257577 ENSBTAG00000035012 1.389178304 0 2.778356608 NA 0.3257577 ENSBTAG00000039889 1.403985084 0 2.807970167 NA 0.3264533 521514 2.585778692 4.139155283 1.032402102 0.24942338 0.3268434 ENSBTAG00000006031 80.68181041 102.6089851 58.75463575 0.572607123 0.3268434 ENSBTAG00000019436 128.9776163 159.5907728 98.36445989 0.616354305 0.3268873 ENSBTAG00000031069 2324.480124 1845.691778 2803.268471 1.518817228 0.3276119 ENSBTAG00000000243 23.83287364 14.98157739 32.68416988 2.181624073 0.3284947 ENSBTAG00000012620 32.34115882 18.99739159 45.68492604 2.404799933 0.3289329 517950 4.568031643 7.065377747 2.07068554 0.293074994 0.3293624 ENSBTAG00000011173 1.510573209 0 3.021146419 NA 0.329713 ENSBTAG00000014922 1.513513878 0 3.027027756 NA 0.329713 ENSBTAG00000032379 1.513513878 0 3.027027756 NA 0.329713 528412 13.67593247 19.46301425 7.888850696 0.405325228 0.3298397 100138036 24.02593673 33.02727135 15.02460212 0.454915029 0.3298397 ENSBTAG00000013247 15.69437326 21.22698546 10.16176106 0.478718991 0.3298397 ENSBTAG00000010719 152.6849936 199.2564788 106.1135084 0.532547343 0.3298397 ENSBTAG00000030933 37.92148672 49.37229629 26.47067715 0.536144339 0.3298397 ENSBTAG00000008868 40.02961162 51.83671025 28.222513 0.544450311 0.3298397 ENSBTAG00000002345 21.64374449 28.02294453 15.26454445 0.544715936 0.3298397 ENSBTAG00000018772 27.43351658 35.1996657 19.66736747 0.558737337 0.3298397 535225 46.62449606 58.19394914 35.05504299 0.602382954 0.3298397 ENSBTAG00000009914 399.6562109 462.3034135 337.0090083 0.72897798 0.3298397 ENSBTAG00000005586 266.0654302 207.8198886 324.3109717 1.560538666 0.3298397 ENSBTAG00000031350 169.6465739 122.2310493 217.0620984 1.775834369 0.3298397 507060 127.8726639 86.69458176 169.0507461 1.949957455 0.3298397 100101133 14.90125214 6.838321549 22.96418273 3.358160707 0.3298397 ENSBTAG00000014857 1.809546033 0 3.619092067 NA 0.3298397 507022 1.634908783 0 3.269817567 NA 0.3298397 100336143 1.652656232 0 3.305312463 NA 0.3298397

PAGE 54

ENSBTAG00000015140 1.652656232 0 3.305312463 NA 0.3298397 789829 105.6047417 138.2324112 72.97707215 0.527930256 0.329975 ENSBTAG00000004977 359.9174019 438.635963 281.1988408 0.641075663 0.329975 ENSBTAG00000018309 15.51304834 8.462936488 22.56316019 2.666114797 0.3302615 ENSBTAG00000044167 85.55662861 109.0504615 62.06279569 0.569119973 0.3311041 ENSBTAG00000005217 8.277623078 3.507625683 13.04762047 3.719787016 0.3315423 ENSBTAG00000004240 2482.05824 3085.715926 1878.400553 0.608740596 0.3324259 ENSBTAG00000006670 850.7679017 1021.968559 679.5672446 0.664959053 0.3324259 ENSBTAG00000003537 17.0382012 22.7132867 11.3631157 0.500284959 0.3324796 534923 316.518474 373.8478235 259.1891245 0.693301146 0.3325841 ENSBTAG00000013881 1342.659988 1578.569685 1106.750291 0.701109556 0.3331594 ENSBTAG00000016363 837.2426551 638.3111379 1036.174172 1.6233058 0.3331594 ENSBTAG00000027770 163.3470578 118.5830248 208.1110909 1.754982142 0.3331594 ENSBTAG00000043694 3.536507197 1.147346432 5.925667963 5.164671975 0.3331594 529092 4.421949317 6.838321549 2.005577085 0.293284993 0.3331662 618227 4.871545285 2.036784448 7.706306121 3.783564888 0.3331662 100337310 3.579148517 5.49428375 1.664013284 0.30286264 0.3333639 ENSBTAG00000006561 89.68474456 114.9727266 64.39676253 0.560104683 0.3333639 ENSBTAG00000037273 57.20294239 72.67024518 41.73563959 0.574315382 0.3333639 ENSBTAG00000003721 1027.933346 1211.561548 844.3051435 0.696873506 0.3333639 617406 12364.87642 14543.17819 10186.57464 0.700436625 0.3333923 ENSBTAG00000021102 6650.218349 5161.935879 8138.500819 1.576637333 0.334148 ENSBTAG00000035855 1045.128898 829.1338669 1261.123928 1.521013649 0.3345051 525643 5.880821065 9.117554407 2.644087722 0.289999665 0.3345305 ENSBTAG00000001376 6.901588652 10.59948631 3.203690993 0.302249647 0.3345305 100336611 12.39206408 17.5072084 7.276919761 0.415652775 0.3348056 ENSBTAG00000019255 2254.661484 1779.097279 2730.225688 1.53461293 0.3348056 ENSBTAG00000009279 872.0659355 666.5151276 1077.616743 1.616792626 0.3348056 ENSBTAG00000014974 683.9071277 513.1504887 854.6637667 1.665522659 0.3348056 100336955 51.83022567 35.72311085 67.93734049 1.901775598 0.3348056 515966 5.413297008 7.19655052 3.630043497 0.50441437 0.3349011 100297753 15.0513241 7.142542189 22.96010601 3.214556583 0.3349011 ENSBTAG00000040206 22.26251536 31.00157757 13.52345316 0.436218226 0.3351321 ENSBTAG00000032706 8.225904472 12.70615869 3.745650254 0.294790136 0.3353856 617767 9.492095307 13.81446941 5.169721206 0.374225101 0.3354249 ENSBTAG00000004894 2511.71223 2959.65611 2063.76835 0.697300049 0.3357264 ENSBTAG00000009481 3.491234673 5.040171355 1.942297991 0.385363484 0.3363136 ENSBTAG00000008943 2130.813364 2544.475217 1717.151511 0.674854878 0.3363136 ENSBTAG00000001987 730.1590046 562.7323595 897.5856496 1.595048933 0.3363136 ENSBTAG00000021481 4.712358188 1.748023813 7.676692562 4.391640722 0.3363136 ENSBTAG00000016777 6.185438816 9.379344773 2.99153286 0.318949024 0.3364044 100337321 16.13203459 22.07350581 10.19056337 0.461664924 0.3364044 100336150 4.694303236 2.232988427 7.155618044 3.204502969 0.3365423 ENSBTAG00000042875 4.295779798 6.42615204 2.165407555 0.336967993 0.3370647 ENSBTAG00000008962 261.0595839 190.607039 331.5121289 1.739243895 0.3371847 783254 4.665640554 1.459263179 7.872017929 5.394515563 0.3373073 505053 565.0449756 699.1384043 430.9515469 0.616403768 0.3373393 ENSBTAG00000017547 1239.42233 909.2749553 1569.569705 1.72617721 0.3378448 ENSBTAG00000017188 8.104041627 12.24337541 3.964707843 0.323824739 0.3379682 ENSBTAG00000002392 39.70417056 53.71430909 25.69403203 0.478346133 0.3382637 ENSBTAG00000008341 307.5588688 226.2920382 388.8256993 1.718247369 0.3382637 ENSBTAG00000037562 4.131140991 1.736445757 6.525836224 3.758157257 0.3382637

PAGE 55

ENSBTAG00000015536 1017.741227 793.0587782 1242.423676 1.566622437 0.338838 ENSBTAG00000017223 189.4120577 149.3154171 229.5086983 1.537073015 0.33896 ENSBTAG00000003547 202.7544435 153.8915464 251.6173406 1.635030296 0.33896 ENSBTAG00000000171 3.229355741 0.858585797 5.600125685 6.522499792 0.3392937 ENSBTAG00000002854 542.6442124 383.9706008 701.3178239 1.826488337 0.3397974 100297058 15.13776349 9.317152948 20.95837403 2.249439732 0.3411815 ENSBTAG00000015426 48.98713299 27.43440038 70.5398656 2.571219513 0.3418498 788627 4.768690112 6.81135128 2.726028944 0.400218522 0.3424379 519845 9.192063848 13.58741321 4.796714485 0.35302632 0.3431689 516747 14.58151532 21.48045674 7.682573899 0.357654122 0.3432567 ENSBTAG00000040268 70.28117698 88.8069329 51.75542107 0.582785818 0.343507 530360 31.45283812 41.97184568 20.93383056 0.498758876 0.3435983 ENSBTAG00000017098 54.44105202 71.8188681 37.06323594 0.516065442 0.3436213 615884 6.273954028 9.821879112 2.726028944 0.277546579 0.3440629 ENSBTAG00000020125 40.37569926 52.05995229 28.69144623 0.551123176 0.3446354 ENSBTAG00000010813 102.5445464 128.9878371 76.10125565 0.589987842 0.3446354 ENSBTAG00000010463 52.05312064 35.68068057 68.42556071 1.917720167 0.3446354 ENSBTAG00000010659 82.28763499 55.3399666 109.2353034 1.973895362 0.3446354 ENSBTAG00000012022 11.24866335 5.555988187 16.94133852 3.049203482 0.3446354 ENSBTAG00000008871 434.0398329 340.0544509 528.0252149 1.552766663 0.3448404 531436 621.0259242 777.4609064 464.5909419 0.597574667 0.3453208 ENSBTAG00000030196 19.77917065 10.52287705 29.03546426 2.759270504 0.3453208 ENSBTAG00000004805 1721.657584 1367.422292 2075.892877 1.518106651 0.3454391 507159 113.2682874 141.1039217 85.43265305 0.605459097 0.3460859 ENSBTAG00000037980 23.6361826 32.44593592 14.82642927 0.456957978 0.3461298 ENSBTAG00000014904 657.7992644 491.3608525 824.2376762 1.677458984 0.3461298 ENSBTAG00000005260 51.3912282 37.89383966 64.88861674 1.712379039 0.3461298 781991 6.1598066 9.563970696 2.755642504 0.288127452 0.3466851 ENSBTAG00000001761 10.69600659 15.84016319 5.551849997 0.35049197 0.3466851 540462 6.281666265 2.637461829 9.925870702 3.763417765 0.3468354 ENSBTAG00000037476 130.5912141 96.59819372 164.5842344 1.703802402 0.3472249 ENSBTAG00000022796 737.2424112 588.5302786 885.9545437 1.505367822 0.3474689 ENSBTAG00000017560 227.597242 165.0031032 290.1913808 1.758702565 0.3475739 100335455 3.150764217 4.99774108 1.303787354 0.26087533 0.3476105 ENSBTAG00000037949 11.53277245 16.26730531 6.798239594 0.417908158 0.3476105 ENSBTAG00000014124 8.061884159 11.19683692 4.926931396 0.440028861 0.3476105 ENSBTAG00000010068 1050.389036 1244.78223 855.995842 0.687667145 0.3476105 ENSBTAG00000004427 1048.378166 826.3564259 1270.399906 1.537351035 0.3476105 ENSBTAG00000006346 352.7061799 254.0569894 451.3553703 1.776591037 0.3476105 ENSBTAG00000009556 24.93131211 15.08910666 34.77351755 2.304544485 0.3476105 512239 192.4549608 134.2788437 250.6310778 1.86649714 0.347975 ENSBTAG00000006065 2748.525576 3446.866231 2050.18492 0.594796776 0.3485007 ENSBTAG00000003130 44.3764697 56.94967671 31.80326269 0.558445008 0.3485985 ENSBTAG00000006655 5.45923872 8.736237117 2.182240322 0.249791792 0.3489593 ENSBTAG00000015554 440.0754521 340.0684487 540.0824556 1.588158083 0.3489593 ENSBTAG00000039215 5.449226142 8.035306974 2.86314531 0.356320589 0.3493735 ENSBTAG00000012781 73.16072302 50.05346488 96.26798116 1.92330304 0.3496764 ENSBTAG00000003595 1131.330151 1316.508113 946.1521878 0.718683142 0.3506248 ENSBTAG00000009828 16.98066136 23.79449156 10.16683115 0.427276671 0.3507134 ENSBTAG00000020573 23.2663038 12.90631241 33.6262952 2.605414632 0.3507134 281825 9.172464493 13.13281343 5.212115558 0.396877302 0.3509217 353110 46.80586623 60.6606473 32.95108517 0.543203652 0.3509217

PAGE 56

100300042 3.958575476 5.941187427 1.975963525 0.332587307 0.3509632 781002 37.25896767 25.14962003 49.36831532 1.96298454 0.3515022 ENSBTAG00000015314 78.63056495 49.42741498 107.8337149 2.181657992 0.3515022 ENSBTAG00000003508 5.553323443 8.662954624 2.443692262 0.282085312 0.3516136 ENSBTAG00000010977 24.94032497 34.9753133 14.90533663 0.426167351 0.3516513 ENSBTAG00000003616 31.72925903 17.85004516 45.6084729 2.555090057 0.3517955 ENSBTAG00000011350 13.99965479 7.673751234 20.32555835 2.648712179 0.3520077 ENSBTAG00000003186 219.6312053 270.4822344 168.7801763 0.623997272 0.3522892 ENSBTAG00000004318 106.3481338 132.287329 80.40893867 0.60783553 0.3523803 100313064 31.97227668 41.43675469 22.50779867 0.543184399 0.3525252 ENSBTAG00000001269 58.41437971 38.77953131 78.04922811 2.012639799 0.3527981 ENSBTAG00000002613 640.6477878 789.9227349 491.3728408 0.622051777 0.3531158 ENSBTAG00000031778 134.755095 163.7573051 105.752885 0.645790335 0.3531158 ENSBTAG00000016805 30.57829803 17.765672 43.39092406 2.442402632 0.3541502 ENSBTAG00000005454 35.08497577 46.83848178 23.33146975 0.498126089 0.3546118 505147 458.5015933 546.7748395 370.2283471 0.677112991 0.356648 ENSBTAG00000020030 348.2410618 427.7224242 268.7596994 0.628350735 0.357088 ENSBTAG00000033530 45.94614626 58.3201296 33.57216291 0.575653092 0.357529 ENSBTAG00000040357 5.764921189 8.863040553 2.666801826 0.300890175 0.3579907 ENSBTAG00000010548 171.8157376 205.6858813 137.9455939 0.670661462 0.3580966 785554 639.384216 471.3022381 807.4661939 1.713266198 0.3581624 ENSBTAG00000017158 374.5539522 451.0148428 298.0930617 0.660938474 0.3587273 ENSBTAG00000021963 864.3924551 690.7771321 1038.007778 1.502666678 0.3588538 ENSBTAG00000019242 75.71339162 95.3352701 56.09151314 0.588360562 0.359195 ENSBTAG00000006731 701.7592002 505.6210732 897.8973272 1.775830508 0.359195 ENSBTAG00000009407 446.5163556 561.3650764 331.6676348 0.590823421 0.3593235 ENSBTAG00000017580 3.851969388 5.898757152 1.805181625 0.306027453 0.3593343 100335908 1152.952175 1395.040301 910.8640493 0.652930277 0.3593343 100296502 70.56684608 48.18542675 92.94826541 1.928970472 0.3593343 782067 5.283988222 8.343341771 2.224634673 0.266635928 0.3599901 ENSBTAG00000010590 453.6624032 551.6070889 355.7177174 0.644875174 0.3599901 ENSBTAG00000020660 5.67992397 8.728541011 2.63130693 0.30146011 0.3600845 540987 280.3996938 356.4891716 204.310216 0.573117593 0.3600845 100140040 2092.541505 1684.84908 2500.233931 1.48395127 0.3600845 ENSBTAG00000031076 116.5545758 82.16579011 150.9433614 1.837058479 0.3601888 ENSBTAG00000017830 487.924806 380.8490727 595.0005394 1.562300087 0.360889 ENSBTAG00000014411 1858.972592 2254.54297 1463.402215 0.649090408 0.3610973 ENSBTAG00000013889 8.727589366 12.74040547 4.714773262 0.370064616 0.3612219 ENSBTAG00000012319 84.21327524 59.60197557 108.8245749 1.825855165 0.3612377 ENSBTAG00000033153 3.444437623 5.447971525 1.44090372 0.264484444 0.3616246 ENSBTAG00000014064 58.92887839 74.92645751 42.93129927 0.572979168 0.3616246 ENSBTAG00000009916 843.8741137 655.6892544 1032.058973 1.574006233 0.3616246 ENSBTAG00000001498 112.4309022 77.34123248 147.5205718 1.907398772 0.3616246 ENSBTAG00000022461 841.7372077 655.9688567 1027.505559 1.566393813 0.3620749 ENSBTAG00000013851 365.082338 271.5742459 458.5904301 1.688637406 0.3620749 ENSBTAG00000013266 3.428548163 5.540528181 1.316568146 0.237625025 0.3620764 782635 5.120957801 7.981786031 2.26012957 0.283160882 0.3620764 ENSBTAG00000038375 545.7461079 415.7104065 675.7818093 1.62560715 0.3626599 ENSBTAG00000001702 70.41592587 90.62240771 50.20944403 0.554051093 0.3636787 ENSBTAG00000040507 12.11459009 6.156665568 18.07251461 2.935438739 0.3638429 513234 67.18727448 87.83103659 46.54351238 0.529921019 0.3641642 ENSBTAG00000014215 81.5379124 104.8611121 58.21471272 0.555160169 0.3649602

PAGE 57

ENSBTAG00000014958 42.94818419 56.47087825 29.42549013 0.521073712 0.3650582 527992 188.0426043 230.9741797 145.1110288 0.628256496 0.3655686 ENSBTAG00000034258 11.03471137 15.77845875 6.290963986 0.398705861 0.3656671 ENSBTAG00000016146 2.663322285 3.904402979 1.422241591 0.364266086 0.3657984 ENSBTAG00000032808 669.4376217 793.4675703 545.407673 0.687372356 0.3667964 ENSBTAG00000008132 11.98792702 16.10971745 7.866136592 0.488285199 0.3668102 ENSBTAG00000010042 1890.26602 1537.831665 2242.700374 1.458352319 0.3668352 ENSBTAG00000033565 104.7130396 68.88605989 140.5400193 2.040180836 0.3671331 ENSBTAG00000006205 14.30305372 19.23984 9.36626743 0.486816285 0.3673617 ENSBTAG00000013051 3.30359326 5.509675963 1.097510557 0.199196934 0.3678285 ENSBTAG00000004059 21492.96477 17458.8435 25527.08604 1.462129266 0.3678285 525624 8.529464051 4.550837403 12.5080907 2.748525072 0.3678285 538956 5.386381683 1.790454088 8.982309278 5.016777218 0.3678285 ENSBTAG00000005990 175.2544442 225.4754416 125.0334468 0.55453244 0.367938 ENSBTAG00000025358 4137.842713 3322.62459 4953.060836 1.490707332 0.367938 ENSBTAG00000004906 568.0674893 426.0329814 710.1019971 1.666777053 0.367938 ENSBTAG00000024731 224.1188997 167.4560069 280.7817925 1.6767496 0.367938 616289 100.0617918 121.3701116 78.75347207 0.648870394 0.3679806 ENSBTAG00000021768 32.48493528 43.26041299 21.70945757 0.501831954 0.3680132 ENSBTAG00000016720 18408.829 14718.27062 22099.38739 1.501493481 0.368085 100336813 5072.654302 5593.579493 4551.729111 0.81374174 0.3680896 ENSBTAG00000021705 1995.536061 1592.868614 2398.203508 1.505587772 0.3680896 ENSBTAG00000010402 3509.291723 2638.914895 4379.668552 1.659647517 0.3680896 ENSBTAG00000011684 40.26294076 23.25614159 57.26973993 2.462564123 0.3680896 ENSBTAG00000033292 284.9653452 348.2253677 221.7053227 0.636671947 0.3682875 538517 4.913634387 7.507912086 2.319356688 0.308921663 0.3682894 507217 107.0060117 145.4686332 68.54339008 0.47119017 0.3682894 ENSBTAG00000020250 108.7898112 136.6195777 80.96004474 0.592594752 0.369065 100299449 4.225070636 6.792009325 1.658131947 0.24412981 0.369157 536808 38.57377521 49.79943841 27.348112 0.549165068 0.369157 ENSBTAG00000005909 973.3763912 746.622435 1200.130347 1.607412651 0.3693723 ENSBTAG00000020041 221.2187058 280.8962512 161.5411604 0.575091906 0.3694585 100295263 5.355229133 7.954815762 2.755642504 0.346411857 0.3695042 ENSBTAG00000010322 260.2768793 178.8364314 341.7173272 1.910781402 0.3699685 521363 5.28395588 8.120167523 2.447744237 0.301440116 0.370487 ENSBTAG00000005321 20.6420559 28.95370245 12.33040934 0.425866411 0.3713429 ENSBTAG00000026495 79.98514587 101.8770671 58.09322463 0.570228671 0.3714258 ENSBTAG00000003794 96.04141266 119.7472934 72.3355319 0.604068199 0.3714258 ENSBTAG00000030482 83.97521521 104.0611751 63.88925531 0.613958618 0.3714258 790189 217.0980792 259.6644983 174.53166 0.672142943 0.3714258 100298791 158.6523308 110.757585 206.5470766 1.86485717 0.3714258 507041 33.77014011 43.5579123 23.98236793 0.550585799 0.371842 ENSBTAG00000026266 89.85681744 65.63135032 114.0822846 1.738228514 0.3719891 507330 52.44471302 30.84503228 74.04439376 2.400528977 0.3719891 ENSBTAG00000033076 105.721891 135.7855252 75.65825676 0.557189411 0.3720299 ENSBTAG00000019427 60.07544049 39.84638653 80.30449446 2.015351992 0.3720299 ENSBTAG00000036127 19.13610877 10.56142537 27.71079216 2.623773893 0.3720299 ENSBTAG00000038795 659.3714521 817.8538813 500.8890228 0.612443169 0.3721336 511647 422.661333 516.4986911 328.8239749 0.636640481 0.3721704 ENSBTAG00000016694 129.9348486 92.31081222 167.5588851 1.815159904 0.3724446 ENSBTAG00000011115 17.34991915 24.82224328 9.877595013 0.397933213 0.3727113 ENSBTAG00000019552 1153.191493 916.2011757 1390.181809 1.517332488 0.3727113

PAGE 58

784584 2.952183527 5.013133293 0.89123376 0.177779785 0.373249 535297 1.165154059 0 2.330308118 NA 0.3734207 ENSBTAG00000005218 40.73439886 54.48415239 26.98464534 0.495275124 0.3735084 ENSBTAG00000007341 2.665360459 0.300338691 5.030382227 16.74903162 0.3735084 ENSBTAG00000002454 435.5735498 330.8523242 540.2947753 1.633039081 0.3736173 ENSBTAG00000013485 57.93269146 37.46301896 78.40236396 2.092793537 0.3736173 504348 30.17353422 39.81504692 20.53202153 0.515684976 0.3737557 ENSBTAG00000037552 5.154382342 7.831406888 2.477357796 0.316336238 0.3741978 ENSBTAG00000002798 195.5682727 238.3529913 152.7835542 0.640997008 0.3741978 ENSBTAG00000032623 7.036587601 10.62264242 3.45053278 0.324828102 0.3742251 ENSBTAG00000011812 438.0879024 547.5116562 328.6641487 0.600287035 0.3746799 ENSBTAG00000004814 63.49792484 42.80006665 84.19578302 1.967188129 0.3746799 ENSBTAG00000012951 76.34839357 48.75289993 103.9438872 2.132055475 0.3746799 ENSBTAG00000008797 2.891717749 4.951428856 0.832006642 0.168033646 0.3748137 768048 307.3617479 217.0996585 397.6238373 1.831526774 0.3749589 ENSBTAG00000032340 1986.427987 1582.018063 2390.83791 1.511258288 0.3759508 ENSBTAG00000039371 2.859163521 4.951428856 0.766898186 0.154884218 0.3761667 ENSBTAG00000019327 82.38354612 104.4581686 60.30892361 0.57735 0.3761667 ENSBTAG00000033135 6.475813746 10.04893531 2.902692182 0.288855694 0.3764715 ENSBTAG00000001740 11.72837507 16.67129133 6.785458802 0.40701459 0.3764715 ENSBTAG00000015824 134.2094328 98.96672425 169.4521413 1.712213298 0.3764715 ENSBTAG00000030368 131.5354846 91.82689018 171.244079 1.864857654 0.3764715 ENSBTAG00000008336 38.94573322 23.08690788 54.80455856 2.373837104 0.3764715 ENSBTAG00000044401 1.215455735 0 2.43091147 NA 0.3764715 ENSBTAG00000003551 10.45543779 14.41951613 6.491359445 0.450178729 0.3765957 ENSBTAG00000004073 2336.690008 2866.898999 1806.481017 0.630116728 0.3765957 ENSBTAG00000016295 301.312359 385.8822644 216.7424537 0.561680268 0.3766071 ENSBTAG00000017402 359.4321596 247.7394135 471.1249057 1.90169541 0.3766071 ENSBTAG00000014913 127.1460252 82.76715826 171.5248921 2.072378655 0.3766071 ENSBTAG00000039687 25.66036901 15.80931097 35.51142705 2.246234963 0.3766071 ENSBTAG00000008749 4.611744938 7.188299232 2.035190644 0.283125476 0.3773259 100297485 9.440133628 13.59899127 5.281275988 0.388357922 0.3773259 506828 19.0005707 27.35847757 10.64266384 0.389007898 0.3773259 530661 232.7538031 172.6229139 292.8846923 1.69667332 0.3773259 ENSBTAG00000018199 196.7252287 147.3106459 246.1398116 1.670889501 0.3773939 ENSBTAG00000017140 1016.151873 1256.133099 776.1706465 0.61790478 0.3775315 ENSBTAG00000038832 10.52328063 13.99965051 7.046910742 0.503363333 0.3775664 782315 1737.225684 1371.123269 2103.328098 1.534018235 0.3775664 ENSBTAG00000025317 2.758144907 4.435612024 1.08067779 0.243636681 0.3776232 ENSBTAG00000019546 17.93454379 25.96958971 9.899497874 0.381195775 0.3776232 ENSBTAG00000016847 70.67079126 91.10432956 50.23725296 0.551425527 0.3776232 ENSBTAG00000022801 462.4536587 587.5517548 337.3555626 0.574171653 0.3776232 ENSBTAG00000006801 392.6306298 463.670023 321.5912367 0.693577805 0.3776232 ENSBTAG00000019995 540.2162716 428.338426 652.0941173 1.522380617 0.3776232 ENSBTAG00000015734 1022.335824 806.6827902 1237.988859 1.534666258 0.3776232 ENSBTAG00000019847 101.8340983 67.85005689 135.8181397 2.001739511 0.3776232 ENSBTAG00000033223 21.73630175 12.30944919 31.1631543 2.531644904 0.3776232 ENSBTAG00000005083 10.66270166 4.720558501 16.60484481 3.517559376 0.3776232 100298705 1.259876074 0 2.519752148 NA 0.3776232 ENSBTAG00000015834 1.259876074 0 2.519752148 NA 0.3776232 ENSBTAG00000007884 1.262816742 0 2.525633485 NA 0.3776642 ENSBTAG00000044165 9.334760117 13.98030856 4.689211678 0.335415464 0.3780121

PAGE 59

ENSBTAG00000020612 450.9873464 564.3375433 337.6371495 0.598289363 0.3780121 ENSBTAG00000018010 60.83597224 75.67363209 45.99831239 0.607851257 0.3780121 ENSBTAG00000010527 140.7823924 96.00798835 185.5567964 1.93272247 0.3780121 506063 2.318383254 0.589099325 4.047667183 6.870941808 0.3780121 ENSBTAG00000019588 36.01221174 45.14890343 26.87552005 0.595264071 0.3781155 100124498 5017.920858 6112.523461 3923.318255 0.641849194 0.3781155 ENSBTAG00000003990 75.62753198 96.92758782 54.32747614 0.560495493 0.3793129 100335210 227.5081222 174.2642476 280.7519968 1.611070548 0.3794794 ENSBTAG00000014238 5038.874897 3839.618963 6238.130832 1.624674451 0.3796025 781718 114.9186856 86.35347402 143.4838971 1.66158801 0.3798299 ENSBTAG00000024878 28.24970731 17.5149723 38.98444232 2.225778131 0.3798299 100299475 1.307237081 0 2.614474162 NA 0.3798299 782758 2.679931681 4.373907587 0.985955775 0.225417606 0.3798718 ENSBTAG00000011973 63.50936462 82.86414773 44.15458151 0.532855073 0.3804637 ENSBTAG00000001640 9.991838493 4.728254608 15.25542238 3.226438431 0.3804637 531847 444.3650042 530.8302533 357.8997551 0.674226371 0.380466 ENSBTAG00000012437 2.162136826 0.300338691 4.023934961 13.39799062 0.380466 ENSBTAG00000031873 140.7198405 171.4545642 109.9851167 0.641482583 0.3805305 ENSBTAG00000021024 2586.018659 1999.886024 3172.151294 1.586166039 0.3805305 ENSBTAG00000011966 585.1520343 441.8859008 728.4181677 1.648430435 0.3805305 ENSBTAG00000030328 60.52688457 79.83962205 41.21414708 0.516211701 0.380765 ENSBTAG00000018577 2.102909707 0.300338691 3.905480724 13.00358843 0.3812561 ENSBTAG00000040026 3.59087793 1.178198651 6.00355721 5.095539031 0.3813561 100126816 20.02854606 28.70390974 11.35318239 0.395527386 0.3814372 100337493 13.06778857 17.20742489 8.928152252 0.51885464 0.3814372 100299291 36.73600101 22.86317845 50.60882358 2.213551527 0.3814372 ENSBTAG00000001558 2.869832978 4.61254184 1.127124116 0.244360735 0.3818804 ENSBTAG00000042400 2.869213649 4.581689622 1.156737675 0.252469672 0.3818804 ENSBTAG00000003802 20.02367963 26.32837386 13.7189854 0.521072265 0.3818804 ENSBTAG00000010111 12.02438468 15.74046561 8.308303744 0.527830876 0.3818804 ENSBTAG00000007121 50.84992476 66.78639285 34.91345666 0.522763024 0.3819207 ENSBTAG00000021147 3.540576254 1.178198651 5.902953858 5.010151603 0.3820843 ENSBTAG00000017139 4127.779633 3354.150218 4901.409048 1.46129682 0.3821058 788473 1.384211648 0 2.768423296 NA 0.3821437 ENSBTAG00000038908 1.387152316 0 2.774304633 NA 0.3821896 525823 3.763398804 5.833170765 1.693626843 0.290344122 0.3822528 ENSBTAG00000001510 41.14624783 55.58574177 26.70675389 0.480460511 0.3822528 ENSBTAG00000012409 7.755206864 10.35752529 5.152888439 0.497501893 0.3822528 ENSBTAG00000007962 386.9796328 477.9453896 296.0138759 0.61934665 0.3822528 ENSBTAG00000006209 690.8016329 836.1853146 545.4179513 0.65226923 0.3822528 ENSBTAG00000007394 6779.480064 8084.972047 5473.988081 0.677057144 0.3822528 ENSBTAG00000021392 88.43761215 60.03785637 116.8373679 1.946061618 0.3822528 ENSBTAG00000038627 1.401959096 0 2.803918192 NA 0.3822528 ENSBTAG00000016588 9.004125341 12.39819169 5.610058997 0.4524901 0.3824665 100138050 303.6648157 382.2464787 225.0831527 0.588842973 0.3826714 ENSBTAG00000019158 2.122968808 3.649821331 0.596116286 0.163327525 0.3828264 518599 2.540169998 4.343055368 0.737284627 0.169761738 0.3828264 ENSBTAG00000031792 29.88887005 39.92680995 19.85093016 0.497182975 0.3828264 ENSBTAG00000003062 424.1810863 328.4380195 519.9241531 1.583020607 0.3828264 ENSBTAG00000018889 1738.339758 1254.175196 2222.504321 1.772084416 0.3828264 281638 47.43785054 28.28854905 66.58715204 2.353855333 0.3828264 788304 2.535551364 4.085146952 0.985955775 0.241351361 0.3828321

PAGE 60

ENSBTAG00000003807 1277.092818 1543.303386 1010.88225 0.655012008 0.3828321 ENSBTAG00000021958 1675.96976 1995.539056 1356.400465 0.67971632 0.3838761 784997 175.7467688 125.7054708 225.7880668 1.796167385 0.3840664 ENSBTAG00000001810 1753.44621 2116.139625 1390.752796 0.657212208 0.3842344 ENSBTAG00000034332 2.087034606 3.453617352 0.72045186 0.208607899 0.3843833 ENSBTAG00000030385 2.489892365 4.023442515 0.956342216 0.237692526 0.3843833 516077 76.45152236 100.1284203 52.77462438 0.52706938 0.3843833 ENSBTAG00000013227 368.8763 447.3168274 290.4357726 0.649284254 0.3843833 507327 13.10008981 6.272378336 19.92780129 3.177072591 0.3843833 536121 1.496681111 0 2.993362221 NA 0.3843833 ENSBTAG00000027879 1274.152549 1016.714283 1531.590815 1.506412215 0.3843939 ENSBTAG00000021410 614.8795218 466.6807714 763.0782721 1.635118305 0.3846657 ENSBTAG00000009862 2.070525817 3.515321789 0.625729845 0.17800073 0.3849996 100336970 2.457338138 4.023442515 0.89123376 0.221510251 0.3852825 513508 3.665140835 5.482705694 1.847575976 0.336982519 0.3852825 ENSBTAG00000007417 56.6647905 67.21422575 46.11535526 0.686095164 0.3852825 ENSBTAG00000019853 148.9396707 105.6980717 192.1812697 1.818209799 0.3854898 ENSBTAG00000001332 518.7129619 363.7197828 673.7061411 1.852266973 0.3854898 100300295 78.33691358 55.4131813 101.2606459 1.827374706 0.3857155 100300493 2.040292928 3.484469571 0.596116286 0.171078058 0.386328 ENSBTAG00000037316 100.4656039 125.0337951 75.89741259 0.607015187 0.386328 ENSBTAG00000038065 3.798851695 6.110353344 1.487350046 0.243414736 0.3867572 100300626 2.721453357 4.096725008 1.346181705 0.328599479 0.3867639 ENSBTAG00000031333 4.253437237 6.187517787 2.319356688 0.374844448 0.3867639 ENSBTAG00000015550 4.227822983 6.414573984 2.041071981 0.318192913 0.3882742 ENSBTAG00000012595 747.2844314 589.255628 905.3132349 1.536367566 0.3884427 ENSBTAG00000016427 507.562331 381.6817857 633.4428764 1.659609916 0.3901844 ENSBTAG00000025219 21.50583274 30.48187879 12.52978669 0.411056903 0.3906487 ENSBTAG00000039580 139.8127371 169.0121282 110.613346 0.654469872 0.3923131 ENSBTAG00000000675 129.3026691 99.52767516 159.077663 1.598325921 0.3923523 ENSBTAG00000024180 33.55780259 40.79482519 26.32078 0.64519899 0.3924905 784289 2.282261582 3.827238536 0.737284627 0.19264141 0.3928573 ENSBTAG00000007253 69.65200459 49.58826182 89.71574736 1.809213392 0.3935382 ENSBTAG00000005477 33.12760357 43.3230922 22.93211494 0.529327751 0.3940209 ENSBTAG00000022005 22.11382243 30.47418268 13.75346218 0.451315211 0.3942397 ENSBTAG00000020679 22.46113799 30.87186696 14.05040901 0.455120159 0.3942397 ENSBTAG00000031686 262.9851707 336.32232 189.6480214 0.563887706 0.3942397 ENSBTAG00000006582 136.1575724 167.3550633 104.9600814 0.627170038 0.3942397 ENSBTAG00000009871 1352.643113 1093.694756 1611.591469 1.473529484 0.3942397 ENSBTAG00000000897 2107.974147 1652.29169 2563.656605 1.551576287 0.3942397 ENSBTAG00000039746 7.221666538 3.453617352 10.98971572 3.182088403 0.3942397 ENSBTAG00000009266 12.44219033 17.81475581 7.069624846 0.396840963 0.3944691 532996 390.2109413 478.5645826 301.8572999 0.63075562 0.3944691 ENSBTAG00000022306 253.8542817 186.4423756 321.2661878 1.723139317 0.3944691 ENSBTAG00000033545 3.576258152 5.759888272 1.392628031 0.24178039 0.3945555 ENSBTAG00000003225 2264.868724 2643.828419 1885.909028 0.713325046 0.3947531 509038 3.458129381 5.317353933 1.598904828 0.300695581 0.3948713 ENSBTAG00000014396 204.859827 262.7260381 146.993616 0.559493901 0.3948713 ENSBTAG00000016676 377.4533118 472.7174312 282.1891923 0.596951104 0.3948713 539718 264.5041919 324.704393 204.3039909 0.629199959 0.3948713 785246 57.38696397 71.27712357 43.49680438 0.610249154 0.3949344 ENSBTAG00000032233 8.552724301 11.67022348 5.435225122 0.465734451 0.3950494

PAGE 61

ENSBTAG00000004840 188.7514317 244.2016984 133.301165 0.54586502 0.3950494 ENSBTAG00000043566 113.5413644 141.7884171 85.2943117 0.601560504 0.3950494 ENSBTAG00000006951 457.0579186 565.924873 348.1909642 0.615260047 0.3950494 ENSBTAG00000007559 3387.497605 4164.21424 2610.780969 0.626956448 0.3950494 319097 28.44709734 34.78028747 22.11390721 0.635817264 0.3950494 ENSBTAG00000017279 1404.005458 1127.2746 1680.736315 1.490973287 0.3950494 ENSBTAG00000008109 520.9387939 404.4009168 637.4766711 1.576348234 0.3950494 ENSBTAG00000006881 617.263356 469.3120499 765.214662 1.630502908 0.3950494 ENSBTAG00000038082 21.55147829 14.33077363 28.77218296 2.007720148 0.3950494 ENSBTAG00000027625 95.08228693 67.24536198 122.9192119 1.827921038 0.3951719 ENSBTAG00000016430 34.17514464 22.07350581 46.27678347 2.096485437 0.3954159 513565 14.98066531 8.705384899 21.25594573 2.441700853 0.395496 787062 31.75943257 42.24854087 21.27032427 0.503457015 0.3959017 ENSBTAG00000039630 397.1278365 310.9824803 483.2731927 1.554020639 0.3959017 ENSBTAG00000032642 31.87455777 22.14290635 41.60620918 1.878985916 0.3959208 100335909 2.936773313 0.858585797 5.014960829 5.840954794 0.3959208 ENSBTAG00000003148 166.237769 120.9096803 211.5658578 1.749784279 0.3964389 ENSBTAG00000020979 3.469050696 5.729036054 1.209065339 0.21104167 0.3967303 100337059 3.579411487 1.158924488 5.999898486 5.177126334 0.3967303 ENSBTAG00000015646 26.63569758 34.4871575 18.78423766 0.544673409 0.3971407 100139405 4.659674971 6.953546928 2.365803014 0.340229675 0.3971962 786530 20.64936748 26.33558258 14.96315238 0.568172446 0.3982551 ENSBTAG00000037293 101.3337786 127.1283343 75.53922289 0.594196591 0.3982551 ENSBTAG00000015187 601.7165034 709.4405355 493.9924713 0.696312723 0.3982551 ENSBTAG00000020066 1678.662138 1328.260528 2029.063747 1.527609761 0.3982551 ENSBTAG00000004171 121.6253181 84.42879157 158.8218446 1.881133694 0.3982551 ENSBTAG00000016328 3017.521473 3583.195065 2451.847881 0.684263021 0.398258 100297269 16.00597649 21.76540322 10.24654976 0.470772338 0.3983633 ENSBTAG00000005355 501.5647199 368.9713426 634.1580972 1.718719109 0.3984319 ENSBTAG00000009632 1967.954604 2380.089788 1555.81942 0.653680978 0.3988513 100140640 10.8496402 14.9237549 6.77552549 0.454009432 0.3991079 ENSBTAG00000001575 4623.293877 3681.863324 5564.724429 1.511388104 0.3991079 280907 3.330257852 4.966888861 1.693626843 0.340983439 0.3995407 ENSBTAG00000021970 3.327317184 4.966888861 1.687745506 0.33979933 0.3996269 615652 7.643658892 11.40455116 3.88276662 0.340457644 0.3997257 ENSBTAG00000037309 28.12804324 35.84270556 20.41338091 0.569526786 0.3997257 ENSBTAG00000004580 53.20549446 67.06752517 39.34346375 0.586624654 0.3997257 512737 2253.176839 1760.099684 2746.253993 1.560283214 0.3997257 ENSBTAG00000016704 20.90503915 29.13444643 12.67563187 0.435073716 0.399933 ENSBTAG00000001294 292.774163 356.7318449 228.8164812 0.64142432 0.399933 407129 46484.19855 36929.61668 56038.78042 1.517448202 0.399933 790350 479.0203909 376.4213601 581.6194216 1.545128633 0.399933 100335670 98.77643368 61.00126765 136.5515997 2.238504296 0.399933 ENSBTAG00000025442 5.795066364 9.047666476 2.542466252 0.281007955 0.4010519 785799 10.71219985 14.86205047 6.562349238 0.44155073 0.4010519 ENSBTAG00000012929 52.24594439 68.14970482 36.34218396 0.533269866 0.4010519 ENSBTAG00000004172 23.05270371 28.83528589 17.27012153 0.598923194 0.4010519 ENSBTAG00000002175 429.6636983 525.1167913 334.2106053 0.636450045 0.4010519 ENSBTAG00000001518 591.4119676 721.9259183 460.8980168 0.638428411 0.4010519 ENSBTAG00000011238 4367.341366 3530.948539 5203.734194 1.473749656 0.4010519 ENSBTAG00000019565 11208.67569 8949.176795 13468.17459 1.5049624 0.4010519 ENSBTAG00000001274 119.3435285 88.27898283 150.4080742 1.703781233 0.4010519

PAGE 62

ENSBTAG00000017170 11.58681247 5.62927068 17.54435426 3.116630068 0.4015606 ENSBTAG00000021857 507.8830282 384.6744338 631.0916227 1.640586344 0.4019934 ENSBTAG00000020885 1.896481637 2.960956632 0.832006642 0.280992512 0.4019936 ENSBTAG00000043981 197.8763013 143.5930217 252.1595809 1.756071276 0.4022273 ENSBTAG00000003494 111.5518096 140.3408675 82.76275164 0.589726664 0.4022292 ENSBTAG00000000015 12.4818593 6.765039056 18.19867955 2.690107093 0.4022292 ENSBTAG00000009889 212.7661414 269.3890275 156.1432553 0.579619952 0.4022655 ENSBTAG00000021879 445.5468786 342.9844068 548.1093503 1.598059094 0.4026026 ENSBTAG00000009646 10992.81814 8700.735353 13284.90092 1.52687105 0.4028384 788709 1.916558722 3.472891515 0.36022593 0.103725074 0.4028546 ENSBTAG00000012063 161.2315823 193.2885288 129.1746357 0.668299544 0.4030474 ENSBTAG00000031544 597.2259629 449.2289992 745.2229266 1.658893188 0.4030474 ENSBTAG00000018909 1.829695216 2.703048216 0.956342216 0.35380139 0.4031438 785243 32.35689912 43.2343497 21.47944855 0.496814424 0.403724 ENSBTAG00000024851 4.419514004 6.437730096 2.401297911 0.373003819 0.4038232 ENSBTAG00000030424 46.50484352 26.95657669 66.05311035 2.450352324 0.4038232 100335841 26.94611004 16.52958307 37.36263701 2.260349632 0.4038684 ENSBTAG00000012499 143.521855 179.0282618 108.0154483 0.603342998 0.4041586 ENSBTAG00000025136 49.91711852 62.31278769 37.52144936 0.602146859 0.4041752 ENSBTAG00000026199 126845.5469 98054.50156 155636.5922 1.587245763 0.40423 ENSBTAG00000003164 5.766347296 8.370379833 3.16231476 0.377798239 0.4046228 ENSBTAG00000001823 1.869197715 3.472891515 0.265503915 0.076450391 0.4049576 527664 15.96854647 8.174175854 23.76291709 2.907071919 0.4049576 ENSBTAG00000020512 47.98030569 62.27854091 33.68207047 0.540829473 0.405005 ENSBTAG00000008068 315.1819774 243.8206523 386.5433026 1.585359153 0.405005 ENSBTAG00000026716 405.7671795 327.0401218 484.4942372 1.481451984 0.4051375 537176 2.27642225 3.550055957 1.002788542 0.282471193 0.4052044 ENSBTAG00000040153 1.854854285 3.34948264 0.36022593 0.107546737 0.4052992 100336655 7.333307351 10.96152944 3.705085265 0.338008057 0.4055479 ENSBTAG00000005206 480.5649576 591.2058185 369.9240967 0.625711191 0.4055479 ENSBTAG00000007616 384.6028227 481.3856956 287.8199497 0.597898841 0.4057475 ENSBTAG00000010998 24.08048128 15.2968887 32.86407385 2.14841557 0.4063979 ENSBTAG00000031167 7.067329745 3.496047627 10.63861186 3.04303974 0.4064541 519058 18.23756993 10.56142537 25.91371449 2.45361905 0.406557 537380 166.2460198 125.2073304 207.2847092 1.655531737 0.4067657 ENSBTAG00000018846 564.8203754 426.1669936 703.4737572 1.650699767 0.4068147 ENSBTAG00000015955 277.3963375 200.6941879 354.098487 1.764368418 0.4068147 ENSBTAG00000034501 80.36415031 48.35230847 112.3759921 2.324108108 0.4069488 ENSBTAG00000002924 484.876187 575.738772 394.013602 0.684361765 0.4069924 ENSBTAG00000030662 7.019992781 3.176434774 10.86355079 3.420045291 0.4069924 ENSBTAG00000042844 1.807493278 3.34948264 0.265503915 0.079267142 0.4071018 ENSBTAG00000010889 3.097614182 4.986163024 1.209065339 0.242484117 0.4071018 ENSBTAG00000026016 3.092995547 4.728254608 1.457736487 0.308303297 0.4071018 541023 5.661924664 7.977971875 3.345877452 0.419389477 0.4071018 533088 19.01831485 26.33600218 11.70062752 0.4442826 0.4071018 618400 7.351898987 10.01863827 4.685159703 0.467644362 0.4071018 ENSBTAG00000019264 281.8968686 216.810758 346.9829792 1.600395582 0.4071018 ENSBTAG00000015520 1174.794694 1378.009764 971.5796235 0.705060043 0.40782 ENSBTAG00000012705 2200.194508 1809.619948 2590.769067 1.431664737 0.4079313 520988 20.50090209 27.73695548 13.2648487 0.478237372 0.4082783 504436 50.4683617 64.16494621 36.77177719 0.573082023 0.4082783 ENSBTAG00000005727 5.160533773 7.765820502 2.555247044 0.329037613 0.4083645

PAGE 63

ENSBTAG00000011699 537.5836905 618.8339139 456.3334671 0.737408627 0.4083645 ENSBTAG00000032104 72.36869561 50.50418271 94.2332085 1.865849588 0.4083645 516135 6.917399638 2.402709525 11.43208975 4.757999096 0.4083645 ENSBTAG00000012981 195.1001381 132.79962 257.4006562 1.9382635 0.4083902 ENSBTAG00000009565 6016.221519 4949.693673 7082.749365 1.430947011 0.4084951 ENSBTAG00000003904 1148.408586 1381.889946 914.9272253 0.662084002 0.4084977 614345 1891.301948 1537.62554 2244.978357 1.460029311 0.4084977 ENSBTAG00000012518 401.9506011 295.368674 508.5325281 1.721687413 0.4084977 538233 1.755669616 3.245835317 0.265503915 0.081798332 0.4085521 ENSBTAG00000000728 5.130300884 7.734968283 2.525633485 0.326521505 0.4090924 407163 1.740243507 3.214983099 0.265503915 0.0825833 0.4094262 ENSBTAG00000003253 24.23219421 33.2817852 15.18260322 0.456183559 0.4094562 ENSBTAG00000016495 37.80895061 50.21493469 25.40296653 0.505884687 0.4097398 527734 1.724817398 3.18413088 0.265503915 0.083383481 0.4099768 ENSBTAG00000032705 2277.510436 1807.859278 2747.161593 1.519566056 0.4099768 ENSBTAG00000013240 162.1954463 112.9487661 211.4421266 1.872018029 0.4099768 ENSBTAG00000010344 1.709391288 3.153278661 0.265503915 0.084199319 0.4108912 ENSBTAG00000040447 5.082476527 7.858377157 2.306575896 0.293518095 0.4110687 ENSBTAG00000010599 550.2555234 665.1445005 435.3665464 0.654544307 0.4111236 ENSBTAG00000016512 1591.650304 1275.874203 1907.426406 1.494995668 0.4111943 100295626 87.47079609 56.5925581 118.3490341 2.091247295 0.4112775 782071 1.694584509 3.153278661 0.235890356 0.074807964 0.4113061 ENSBTAG00000038347 53.72664094 70.55858049 36.8947014 0.52289461 0.4113061 ENSBTAG00000012497 602.5113233 465.1690084 739.8536381 1.59050501 0.4113061 100297716 47.48144888 33.60922975 61.35366802 1.825500569 0.4113061 ENSBTAG00000011121 11.68227717 7.195995339 16.168559 2.246882917 0.4115648 ENSBTAG00000014996 5.511998878 7.885415219 3.138582538 0.39802375 0.4116205 786285 19.28306228 10.91965434 27.64647021 2.531808182 0.4116205 ENSBTAG00000024958 182.2642776 137.9882166 226.5403386 1.641736839 0.4116446 ENSBTAG00000037910 39.14254626 50.57309587 27.71199666 0.547959269 0.4118773 ENSBTAG00000019665 266.4517377 195.5802467 337.3232288 1.724730562 0.4118773 ENSBTAG00000040347 8.111211187 11.43158923 4.790833147 0.419087237 0.4126555 ENSBTAG00000007681 3532.717729 4257.018836 2808.416622 0.659714399 0.4126555 ENSBTAG00000002902 933.8970636 736.3243634 1131.469764 1.536645832 0.4126555 ENSBTAG00000037485 1.03376803 1.802032144 0.265503915 0.147335838 0.4128412 ENSBTAG00000001886 1546.031428 1910.86749 1181.195365 0.618146141 0.4130328 ENSBTAG00000038662 692.967311 802.9705102 582.9641118 0.726009367 0.4130328 ENSBTAG00000004556 32609.93485 25795.28121 39424.58849 1.528364361 0.4130328 ENSBTAG00000033290 292.8973698 230.590845 355.2038946 1.540407619 0.4130328 100335613 23.27732883 30.79865226 15.75600541 0.511581003 0.4131777 515230 2.881828809 4.181585557 1.582072061 0.378342626 0.4133166 ENSBTAG00000007767 708.9670896 853.7227951 564.211384 0.660883588 0.4133166 ENSBTAG00000018578 1.896632911 0.300338691 3.492927131 11.62996057 0.4133166 ENSBTAG00000043295 1.933805773 0.558247107 3.309364438 5.928135405 0.4134154 100295750 1.993652221 0.589099325 3.398205116 5.768475655 0.4135346 ENSBTAG00000040352 2.006161705 0.300338691 3.711984719 12.3593291 0.4135346 ENSBTAG00000023765 6.599625052 3.176434774 10.02281533 3.155366329 0.4137026 ENSBTAG00000029897 5.288354998 7.850681051 2.726028944 0.347234708 0.4138929 ENSBTAG00000003737 13.24712089 18.52344985 7.970791919 0.430308176 0.4138929 ENSBTAG00000000077 1160.830134 866.5461323 1455.114135 1.679211389 0.4139764 100335154 1.59586319 2.926222464 0.265503915 0.090732649 0.4142848 ENSBTAG00000022603 1.437245119 2.402709525 0.471780712 0.19635362 0.4147205

PAGE 64

ENSBTAG00000000746 158.5979585 199.8452263 117.3506908 0.587207875 0.4147205 ENSBTAG00000021170 5959.028575 4833.637119 7084.420031 1.465649956 0.4147205 100337399 4.714452329 7.534882354 1.894022303 0.251367203 0.4147982 100336118 1.452051898 2.402709525 0.501394271 0.208678688 0.4148136 516156 229.0128954 174.0893857 283.9364051 1.630980567 0.4148136 ENSBTAG00000021699 1.565630301 2.895370245 0.235890356 0.081471569 0.4152739 ENSBTAG00000020390 26.85547742 15.84023098 37.87072386 2.390793663 0.4155694 ENSBTAG00000013799 50.73965894 34.95326755 66.52605032 1.903285586 0.415729 ENSBTAG00000032183 57.52114795 74.8723136 40.16998231 0.53651317 0.4159391 ENSBTAG00000004519 156.3419241 100.1068663 212.5769819 2.123500512 0.4159391 ENSBTAG00000000387 623.1207376 462.2389126 784.0025626 1.696098146 0.4160556 ENSBTAG00000003401 22630.101 18470.71253 26789.48947 1.450376613 0.4160699 785870 16.62902082 23.98244425 9.27559739 0.38676614 0.4161133 ENSBTAG00000007927 3.540291607 5.340510045 1.740073169 0.325825278 0.4162274 ENSBTAG00000012317 624.1864781 488.7356895 759.6372667 1.554290556 0.4162274 ENSBTAG00000039173 1.629433068 0 3.258866137 NA 0.416467 ENSBTAG00000037350 62.15450968 78.56505259 45.74396678 0.582243189 0.4166074 790348 5.332303688 7.431302824 3.233304553 0.435092558 0.4169742 ENSBTAG00000003667 459.7746513 351.7278527 567.8214499 1.614377268 0.4169742 ENSBTAG00000024275 120.6830569 89.08411548 152.2819983 1.709418087 0.4169742 ENSBTAG00000017150 12.06069993 5.555988187 18.56541168 3.341513887 0.4169742 541272 3.839457649 1.201354763 6.477560535 5.391879848 0.4175739 509503 603.1669826 711.5189574 494.8150078 0.695434749 0.4182887 ENSBTAG00000000648 1.467991661 2.575757392 0.36022593 0.13985243 0.4183147 ENSBTAG00000016573 1897.19276 2229.036901 1565.348619 0.702253345 0.4186064 ENSBTAG00000003775 1.451482872 2.637461829 0.265503915 0.100666448 0.4186725 ENSBTAG00000031758 15.34751079 19.11365954 11.58136204 0.605920704 0.4186725 ENSBTAG00000020895 70.10758891 44.47598613 95.73919169 2.152604136 0.4186725 ENSBTAG00000001084 1.436676093 2.637461829 0.235890356 0.089438396 0.4189581 504715 42.31914568 54.1655821 30.47270925 0.562584358 0.4189581 ENSBTAG00000038419 5.120549962 7.076955803 3.164144122 0.447105254 0.4190455 ENSBTAG00000006517 58.28351797 69.3219407 47.24509524 0.68153163 0.4190455 ENSBTAG00000021322 12.95672957 7.477059867 18.43639927 2.465728454 0.4190455 ENSBTAG00000038031 1.405823874 2.575757392 0.235890356 0.091580968 0.4194628 ENSBTAG00000040146 92.03017143 64.51159713 119.5487457 1.853135731 0.4194628 ENSBTAG00000011244 24.2640643 14.84665825 33.68147034 2.268622997 0.4194628 100335573 1543.396287 1895.39354 1191.399035 0.628576077 0.4196038 100301421 11.79030687 14.85102759 8.729586155 0.587810244 0.4198603 ENSBTAG00000018162 1.307721885 2.379553413 0.235890356 0.099132196 0.4203693 520781 1.292295775 2.348701195 0.235890356 0.100434383 0.4203693 533653 1.292295775 2.348701195 0.235890356 0.100434383 0.4203693 ENSBTAG00000037891 1.276869666 2.317848976 0.235890356 0.101771236 0.4203693 ENSBTAG00000004262 58.17848341 72.03829599 44.31867083 0.615209872 0.4203693 ENSBTAG00000011912 72.04840368 87.86799148 56.22881589 0.639923764 0.4203693 ENSBTAG00000003650 645.6356625 771.1579813 520.1133438 0.674457577 0.4203693 ENSBTAG00000034234 1068.285174 1241.556195 895.0141525 0.720880904 0.4203693 ENSBTAG00000006138 23.10412294 15.10068472 31.10756117 2.060009976 0.4203693 ENSBTAG00000024269 81.58124265 52.88484649 110.2776388 2.085240785 0.4203693 539274 11.39756587 16.12122772 6.67390402 0.413982368 0.4204301 ENSBTAG00000014698 32.31462187 41.25982487 23.36941887 0.566396463 0.4204301 508040 32.43139655 20.66825096 44.19454213 2.138281668 0.4204301 ENSBTAG00000021708 445.5032585 335.1039161 555.9026008 1.658896163 0.4205152

PAGE 65

505941 1192.109837 844.6306641 1539.58901 1.822795543 0.4205152 ENSBTAG00000005765 49.689889 34.52563803 64.85413996 1.87843422 0.4205152 ENSBTAG00000011315 8.91755063 12.74428742 5.090813841 0.399458493 0.4212551 ENSBTAG00000038619 267.4057722 325.6612014 209.1503429 0.642232916 0.4212551 ENSBTAG00000020451 3753.171068 4550.229809 2956.112327 0.649662204 0.4212912 ENSBTAG00000038455 448.7424879 361.0890465 536.3959292 1.485494878 0.4212912 100125320 41.25247202 26.51688173 55.98806231 2.111412001 0.4213177 ENSBTAG00000014143 57.39956824 74.55165817 40.2474783 0.53986027 0.4225764 614959 35.55893364 23.51398222 47.60388506 2.024492688 0.4225764 ENSBTAG00000018638 8.859689652 12.486379 5.2330003 0.419096705 0.4226287 783910 116.9742395 144.411597 89.53688201 0.620011715 0.4230965 ENSBTAG00000007300 36.58269632 24.32625579 48.83913685 2.007671763 0.4230965 ENSBTAG00000025755 92.0018073 117.0037473 66.99986727 0.572630098 0.4232257 ENSBTAG00000020789 383.7139836 459.88716 307.5408072 0.668731015 0.4234201 ENSBTAG00000001826 61.26287067 75.87718037 46.64856096 0.614790385 0.4234701 ENSBTAG00000021653 2792.788169 2260.691884 3324.884454 1.470737555 0.4235722 615936 13.65318333 19.38973176 7.916634893 0.408290068 0.4240397 ENSBTAG00000004272 6.384408169 9.872005493 2.896810845 0.293436916 0.4243659 ENSBTAG00000003313 16.89699733 24.17095213 9.623042528 0.398124264 0.4243659 ENSBTAG00000020247 216.2266527 257.1827426 175.2705629 0.681502037 0.4243659 ENSBTAG00000014387 52.62516486 33.90624167 71.34408804 2.104157952 0.4243659 100301324 4.412105612 6.976635248 1.847575976 0.264823358 0.4245661 ENSBTAG00000013031 362.9182225 279.2054991 446.630946 1.599649532 0.4245661 ENSBTAG00000022647 378.0537982 290.4531531 465.6544432 1.603199821 0.4245661 100299286 23.57495441 14.89290269 32.25700614 2.165931439 0.4261319 ENSBTAG00000001489 1735.115959 2071.978539 1398.253379 0.674839702 0.4261339 ENSBTAG00000004746 1100.976661 861.8270274 1340.126295 1.554982905 0.4261339 ENSBTAG00000030461 5.330427738 7.296315894 3.364539582 0.461128552 0.4289527 ENSBTAG00000017665 834.9502022 977.3346081 692.5657963 0.708627107 0.4289527 ENSBTAG00000034580 19.47524129 12.29017502 26.66030756 2.16923742 0.4290954 ENSBTAG00000003552 1683.247031 2022.921474 1343.572588 0.664174366 0.4292399 ENSBTAG00000020611 19.06947955 25.92334528 12.21561383 0.471220581 0.4295154 ENSBTAG00000004974 18.91349936 10.5344551 27.29254361 2.590788355 0.4301407 515435 17.15540307 23.32880111 10.98200503 0.470748796 0.4305762 100300061 16.25687568 10.43413455 22.07961681 2.116094699 0.4305762 ENSBTAG00000015341 27.34915125 36.3584546 18.33984789 0.504417696 0.4311246 ENSBTAG00000045249 6.239474956 2.618187667 9.860762246 3.766254945 0.4311246 517537 4.123877039 1.447685123 6.800068956 4.697201656 0.4311246 538822 2.563003307 0.600677381 4.525329232 7.533710063 0.4311246 505464 22.35012076 31.17171826 13.52852325 0.433999921 0.4311657 ENSBTAG00000014159 88.35059225 112.8114907 63.8896938 0.566340303 0.4311657 514492 911.084228 737.7460659 1084.42239 1.469912806 0.4311657 539889 186.317395 141.4629899 231.1718002 1.634150391 0.4311657 ENSBTAG00000009813 270.426634 197.1413604 343.7119076 1.743479435 0.4311657 ENSBTAG00000007970 102.413465 73.851351 130.975579 1.773502816 0.4311657 ENSBTAG00000012249 26.42462768 15.62475284 37.22450252 2.382405847 0.4311657 ENSBTAG00000039329 9.968225302 5.263345603 14.673105 2.787790525 0.4311657 ENSBTAG00000016254 4.553976269 6.91881276 2.189139777 0.316403963 0.4317083 ENSBTAG00000001949 100.5263773 127.8327268 73.22002784 0.572779989 0.4319523 ENSBTAG00000018908 581.0746818 683.4199759 478.7293877 0.700490774 0.4320626 522059 6.370633765 9.513844315 3.227423216 0.339234395 0.43373 ENSBTAG00000018942 1615.642815 1961.097011 1270.188618 0.647692904 0.43373

PAGE 66

ENSBTAG00000003076 116.568495 85.5683741 147.5686159 1.724569591 0.43373 ENSBTAG00000002725 2951.434358 2381.080404 3521.788313 1.479071562 0.4338975 ENSBTAG00000017007 219.3994236 267.1781698 171.6206775 0.642345434 0.4346851 ENSBTAG00000000517 8.973634507 4.74752877 13.19974024 2.780339179 0.4346851 524279 318.4552427 242.8124459 394.0980396 1.623055351 0.4348586 ENSBTAG00000003161 8.956969738 4.654972115 13.25896736 2.848345175 0.4348586 785216 3.981174687 1.416832904 6.545516471 4.619822459 0.4348586 ENSBTAG00000039588 12.81620181 17.16832139 8.464082239 0.493005813 0.435443 ENSBTAG00000003222 4679.465886 3856.752903 5502.178868 1.426635049 0.435443 ENSBTAG00000006715 339.8099703 264.4163115 415.2036292 1.57026481 0.435443 ENSBTAG00000012046 108.3707428 137.5744665 79.16701904 0.57544849 0.435801 ENSBTAG00000030941 132.7773912 99.5134611 166.0413213 1.668531267 0.4362826 617727 5.096124063 7.100111915 3.092136211 0.435505278 0.4362856 ENSBTAG00000019132 5440.83916 6262.145061 4619.533259 0.737691831 0.4362856 ENSBTAG00000013419 1204.086952 943.7152668 1464.458637 1.551801363 0.4362856 ENSBTAG00000000111 4019.924537 3343.322006 4696.527068 1.404748648 0.4367483 782841 18.10055879 23.73764385 12.46347373 0.525051004 0.4370969 ENSBTAG00000014832 21.01353532 26.37856804 15.6485026 0.593227903 0.4370969 ENSBTAG00000011095 392.0662804 489.4555334 294.6770274 0.602050661 0.4379054 100336127 41.81434208 51.07130408 32.55738008 0.637488716 0.4379054 ENSBTAG00000003359 3713.452288 3023.713043 4403.191532 1.456220041 0.4379054 ENSBTAG00000018442 7.819886393 11.81623329 3.823539501 0.323583617 0.4388304 ENSBTAG00000030966 191.4688371 227.5695827 155.3680915 0.682727848 0.4388304 ENSBTAG00000021759 461.7616168 363.3673089 560.1559246 1.541569401 0.439313 ENSBTAG00000019645 183.0899939 140.7838215 225.3961663 1.601009008 0.439313 ENSBTAG00000015424 1322.956546 1604.366845 1041.546248 0.649194572 0.4395732 ENSBTAG00000019750 313.9093882 255.9847274 371.8340489 1.452563411 0.4395732 ENSBTAG00000005356 65.44350132 82.31096072 48.57604192 0.590152775 0.439658 539595 21.09201938 27.51378123 14.67025752 0.533196706 0.4400131 ENSBTAG00000019325 4.9836546 7.100111915 2.867197286 0.403824238 0.44039 ENSBTAG00000044063 103.7746291 72.59030915 134.958949 1.859186861 0.4406278 ENSBTAG00000000395 5.917654353 8.778667392 3.056641315 0.348189671 0.4411371 ENSBTAG00000039852 1129.173471 1386.942306 871.4046355 0.628291914 0.4411371 ENSBTAG00000034978 7842.096343 9074.062722 6610.129964 0.728464213 0.4411371 ENSBTAG00000012519 147.8591006 181.6089437 114.1092575 0.628323998 0.4412403 ENSBTAG00000019766 59.43308842 72.0536882 46.81248864 0.649689 0.4412403 ENSBTAG00000015526 3.763379802 1.158924488 6.367835115 5.494607441 0.4413496 ENSBTAG00000032055 81.39740827 56.62569452 106.169122 1.874928386 0.4414028 100138139 5827.956688 6954.325728 4701.587647 0.676066643 0.4417368 ENSBTAG00000003928 49.13150659 57.62530213 40.63771104 0.705206039 0.4418992 615146 5.884480796 8.747815173 3.021146419 0.345360111 0.441908 ENSBTAG00000006662 5.478434337 2.079214723 8.877653951 4.269714837 0.441908 614824 2.519479687 0.558247107 4.480712268 8.026395862 0.441908 ENSBTAG00000017824 107.5677491 142.5864216 72.54907666 0.508807752 0.4421459 ENSBTAG00000014927 395.8215018 298.5391417 493.1038619 1.651722649 0.4422744 783832 3.947493112 6.017796688 1.877189535 0.311939674 0.4426778 ENSBTAG00000024188 4.899120731 6.842203499 2.956037963 0.432030115 0.4429221 534929 16.90202768 20.53818855 13.26586682 0.645912213 0.4429221 ENSBTAG00000038994 241.6484843 186.3447588 296.9522099 1.59356352 0.4432109 517059 141.5916265 169.5901369 113.5931162 0.669809685 0.4435464 613428 18.10727126 26.11566731 10.09887522 0.386697958 0.4445617 ENSBTAG00000014834 3.657826268 1.705593539 5.610058997 3.289212154 0.4448023

PAGE 67

ENSBTAG00000001882 24.08691853 32.73851071 15.43532635 0.471473076 0.4458458 ENSBTAG00000009237 2125.233283 1717.234315 2533.232251 1.475181476 0.4458458 ENSBTAG00000014884 1479.529654 1185.526774 1773.532535 1.495986909 0.4458458 616216 0.987981763 0 1.975963525 NA 0.445895 ENSBTAG00000009432 193.7635485 226.9968375 160.5302594 0.707191612 0.4459569 ENSBTAG00000015163 332.3692254 261.001124 403.7373268 1.546879648 0.4459827 ENSBTAG00000010423 12.16968054 16.7870041 7.552356988 0.449893081 0.4464845 ENSBTAG00000018576 152.6015571 192.1539977 113.0491165 0.588325602 0.4466468 ENSBTAG00000018303 9.624807772 13.12172276 6.127892784 0.467003678 0.4467579 ENSBTAG00000008629 2946.871907 3542.713644 2351.030169 0.663624104 0.4469365 100336700 956.0646673 1108.969809 803.1595254 0.724239306 0.4470716 ENSBTAG00000039657 87.32301574 104.9217783 69.72425323 0.664535565 0.4471655 ENSBTAG00000032982 4029.039367 4815.967363 3242.111372 0.673200445 0.4471655 ENSBTAG00000009148 11.10916453 6.668600451 15.54972861 2.331782917 0.4474365 100298036 4.71667306 6.972821091 2.460525029 0.352873679 0.4476383 ENSBTAG00000021855 36.01578131 47.92689536 24.10466727 0.502946562 0.4476646 ENSBTAG00000018345 37.87971462 46.92334233 28.83608692 0.614536081 0.4477528 ENSBTAG00000013099 24.62359209 32.24154845 17.00563573 0.527444758 0.4479719 ENSBTAG00000020017 94.85682346 70.1613836 119.5522633 1.703961028 0.4479719 100335825 37.68846511 51.227646 24.14928423 0.471411164 0.4483927 ENSBTAG00000008544 14.78544365 19.99429109 9.576596202 0.478966529 0.4483927 513095 60.8002093 80.17372014 41.42669847 0.516711691 0.4483927 540850 105.4414264 127.3492921 83.53356066 0.655940518 0.4483927 614147 487.6637445 577.8851202 397.4423688 0.687753249 0.4483927 533308 356.7779706 260.5056111 453.0503301 1.739119277 0.4483927 ENSBTAG00000005745 42.21906907 29.6700926 54.76804554 1.845900728 0.4483927 100300488 3.153915185 0.889438016 5.418392354 6.091928001 0.4483927 ENSBTAG00000015150 2.18627467 0.300338691 4.072210649 13.55872812 0.4483927 ENSBTAG00000020218 795.6317691 654.627116 936.6364223 1.430793805 0.4493122 ENSBTAG00000004824 66.69102005 81.14247553 52.23956458 0.643800479 0.4500586 ENSBTAG00000014731 38.41801932 26.05888739 50.77715125 1.948554076 0.4500586 ENSBTAG00000008340 18.11281287 10.88492018 25.34070556 2.328056168 0.4502304 ENSBTAG00000008103 200.2484875 259.9554033 140.5415718 0.54063724 0.4505122 ENSBTAG00000014422 36.04080575 22.37821384 49.70339765 2.221061878 0.4505122 ENSBTAG00000038929 68.52555738 45.08331704 91.96779772 2.039951888 0.4505201 ENSBTAG00000012031 7.806970754 3.538477901 12.07546361 3.412615238 0.4505201 ENSBTAG00000004258 9738.011045 7767.739983 11708.28211 1.507295833 0.4507006 100336857 12.68543054 7.827524939 17.54333615 2.241236698 0.4507683 ENSBTAG00000013168 3862.91807 4637.165644 3088.670495 0.666068614 0.4511903 ENSBTAG00000013640 4.068416369 5.598418461 2.538414277 0.453416316 0.4512534 282536 8.165136671 10.97698944 5.353283899 0.48768234 0.4512534 ENSBTAG00000001557 2.002711978 0.300338691 3.705085265 12.33635685 0.4512534 ENSBTAG00000007340 1.03534277 0 2.07068554 NA 0.4512534 ENSBTAG00000033881 1.03534277 0 2.07068554 NA 0.4512534 533834 17.91125265 24.05676932 11.76573598 0.48908213 0.4516278 ENSBTAG00000007837 1893.943493 1578.949934 2208.937051 1.398991192 0.4516278 ENSBTAG00000039510 23.88728233 30.12087823 17.65368643 0.586094678 0.4518097 ENSBTAG00000020420 412.7303572 512.708077 312.7526374 0.610001386 0.4520341 ENSBTAG00000010838 14.836407 9.329218392 20.34359561 2.18063237 0.4522258 ENSBTAG00000037812 3.04435847 5.085928398 1.002788542 0.197169221 0.4523145 ENSBTAG00000039199 3.040515145 5.013133293 1.067896998 0.213019869 0.4523145 ENSBTAG00000043574 171.9123152 209.0106907 134.8139398 0.645009781 0.4523145

PAGE 68

ENSBTAG00000007993 3321.837043 2606.254596 4037.419491 1.549127049 0.4523145 ENSBTAG00000005379 6.536907688 2.949378576 10.1244368 3.432735588 0.4523145 ENSBTAG00000040319 1.047208881 0 2.094417762 NA 0.4523145 613397 1.05014955 0 2.100299099 NA 0.4523145 ENSBTAG00000044726 1.05014955 0 2.100299099 NA 0.4523145 ENSBTAG00000003817 176.5604338 216.7500283 136.3708393 0.629161806 0.452756 ENSBTAG00000043776 3.024933056 4.828019982 1.221846131 0.253073959 0.4531804 ENSBTAG00000003921 3.013506251 5.024223961 1.002788542 0.199590733 0.4538848 ENSBTAG00000040316 72.07851345 47.87503997 96.28198694 2.01111032 0.4550687 ENSBTAG00000016688 104.0245928 72.50933055 135.539855 1.869274671 0.4551046 ENSBTAG00000038564 2.989618183 4.662668221 1.316568146 0.282363677 0.4551164 ENSBTAG00000020801 2900.139367 3494.587193 2305.691542 0.659789387 0.4551164 ENSBTAG00000026247 19.90355424 27.11749132 12.68961716 0.467949524 0.4552385 ENSBTAG00000035370 826.8993675 1015.674753 638.1239818 0.628275912 0.4553323 ENSBTAG00000005376 343.5380711 280.0346905 407.0414517 1.453539385 0.4553323 ENSBTAG00000017698 13.1687473 8.127863629 18.20963098 2.240395731 0.4553323 100337174 15.55234962 9.090584138 22.0141151 2.421639222 0.4553323 ENSBTAG00000010179 2.894436562 1.116494213 4.672378911 4.184866213 0.4553323 ENSBTAG00000010909 410.8448177 317.1279067 504.5617286 1.591035408 0.4554212 100335438 4.303609193 6.61847407 1.988744317 0.300483812 0.4555205 ENSBTAG00000035254 13.04605763 7.304012 18.78810325 2.572299067 0.4563714 781935 15.22857119 20.11769996 10.33944241 0.51394754 0.4564805 ENSBTAG00000044186 7.903411056 11.18088953 4.625932584 0.413735649 0.4570433 ENSBTAG00000019814 17.14304647 21.93519211 12.35090083 0.563063263 0.4570433 508834 26.82715716 15.51236684 38.14194747 2.458809018 0.4570433 ENSBTAG00000006823 21.36771425 29.95108934 12.78433917 0.426840541 0.4571072 ENSBTAG00000039693 82.69392312 62.54068307 102.8471632 1.644484168 0.4571757 ENSBTAG00000020082 1.094569888 0 2.189139777 NA 0.4571757 ENSBTAG00000042963 88.30432199 108.9574853 67.6511587 0.620895008 0.4574729 ENSBTAG00000019102 54.93189077 70.84789631 39.01588524 0.550699277 0.457799 ENSBTAG00000017755 5699.697735 6567.554998 4831.840472 0.735713743 0.4582831 281754 33.44059438 39.91641005 26.96477872 0.675531158 0.4585838 100138743 4.188998415 6.483974528 1.894022303 0.292108227 0.4587498 ENSBTAG00000009128 11.2668218 16.28609209 6.247551517 0.383612685 0.4587498 785034 5.50682918 7.904689381 3.108968979 0.393306913 0.4587498 ENSBTAG00000023309 9.00960207 12.67870103 5.340503107 0.421218474 0.4587498 515245 4.148275219 5.694857067 2.60169337 0.456849635 0.4587498 100126045 19.57814878 26.60500126 12.55129629 0.471764544 0.4587498 511837 38.79623959 48.11748838 29.47499081 0.612562954 0.4587498 ENSBTAG00000024027 1601.093854 1951.069029 1251.118679 0.641247778 0.4587498 ENSBTAG00000004817 138.8612801 103.5335768 174.1889834 1.68243954 0.4587498 617133 2.885171373 4.797167763 0.973174983 0.202864488 0.4589718 ENSBTAG00000004362 57.606507 72.12308874 43.08992525 0.597449804 0.4592145 ENSBTAG00000019589 22.09916645 27.94966203 16.24867086 0.581354824 0.4592277 616546 4.065745521 6.391417872 1.740073169 0.27225151 0.4593012 ENSBTAG00000013957 386.9657561 290.3399451 483.5915671 1.665604665 0.4597507 ENSBTAG00000000228 2.8635806 4.724372658 1.002788542 0.212258561 0.4598924 514741 1562.542521 1308.581196 1816.503846 1.388147599 0.4598924 788463 2.771161963 4.651090165 0.89123376 0.19161825 0.4604648 532986 1797.247088 2099.175044 1495.319132 0.712336561 0.4605165 100337475 8.921224876 12.34799751 5.49445224 0.444967067 0.4606112 ENSBTAG00000014596 189.0381604 138.4848442 239.5914766 1.730091679 0.4606269

PAGE 69

ENSBTAG00000026637 8.188180685 12.0741417 4.302219668 0.356316811 0.4607139 ENSBTAG00000005014 97.54818803 123.8160056 71.28037046 0.57569593 0.4607139 ENSBTAG00000019525 376.1790494 472.9313579 279.4267409 0.590839952 0.4607139 ENSBTAG00000019265 386.2017912 475.2434818 297.1601007 0.625279698 0.4607139 ENSBTAG00000011742 295.9699369 360.6820049 231.2578688 0.641168303 0.4607139 ENSBTAG00000015346 56370.1307 67916.46233 44823.79907 0.659984303 0.4607139 ENSBTAG00000021065 141.9365475 163.1743084 120.6987866 0.739692343 0.4607139 ENSBTAG00000013860 491.552843 386.5098185 596.5958675 1.543546474 0.4607139 ENSBTAG00000002137 784.9355847 611.2866229 958.5845465 1.568142522 0.4607139 614655 2.654275594 0.600677381 4.707873807 7.837607929 0.4607139 ENSBTAG00000002639 2.654275594 0.600677381 4.707873807 7.837607929 0.4607139 519902 1.141930896 0 2.283861792 NA 0.4607139 ENSBTAG00000032257 1.144871564 0 2.289743129 NA 0.4607139 ENSBTAG00000014156 658.5993766 805.1470275 512.0517256 0.635972944 0.4611773 508266 636.3016203 761.2763302 511.3269105 0.671670575 0.4611773 ENSBTAG00000005694 7926.827567 6430.757813 9422.897321 1.465285678 0.4611773 614768 153.4719744 112.2587911 194.6851577 1.734253111 0.4611773 517400 119.0588189 86.67475242 151.4428853 1.747254894 0.4611773 100137858 2.636528146 0.600677381 4.672378911 7.778516481 0.4611773 ENSBTAG00000032521 1.159678344 0 2.319356688 NA 0.4611773 ENSBTAG00000013999 13206.44652 15052.7191 11360.17394 0.754692482 0.4616405 ENSBTAG00000042757 9.237338033 4.912880531 13.56179554 2.760457017 0.4616405 100313956 3.419786125 5.305775877 1.533796373 0.289080506 0.4619828 ENSBTAG00000006494 1551.074851 1799.385281 1302.764421 0.724005267 0.4619828 ENSBTAG00000011102 2.592107807 0.600677381 4.583538233 7.63061566 0.4619828 ENSBTAG00000033937 3.4168695 4.986163024 1.847575976 0.370540628 0.4620196 ENSBTAG00000009903 14.71288616 19.76723489 9.658537425 0.48861348 0.4620196 ENSBTAG00000035485 3.488412573 5.613810674 1.363014472 0.242796658 0.4628901 ENSBTAG00000018667 1377.145008 1649.771305 1104.51871 0.669498073 0.4630272 ENSBTAG00000042339 25.53704607 35.03271619 16.04137595 0.457897009 0.4631413 786899 17.8622999 24.14932597 11.57527383 0.479320783 0.4631413 ENSBTAG00000017599 494.9629579 586.9306337 402.9952822 0.686614838 0.4631413 100125284 6657.158205 7546.295587 5768.020823 0.764351298 0.4631413 ENSBTAG00000040092 145.8857063 103.8927806 187.878632 1.808389678 0.4631413 ENSBTAG00000011582 73.84263014 49.36182859 98.32343168 1.991892004 0.4631413 515758 1.192232572 0 2.384465144 NA 0.4631413 100335205 3.458179684 5.582958456 1.333400913 0.23883411 0.463248 ENSBTAG00000020132 1140.369455 899.4503595 1381.28855 1.535702928 0.463248 ENSBTAG00000007403 40.57378682 51.05861566 30.08895798 0.589302267 0.4636433 ENSBTAG00000002826 1357.749058 1628.94544 1086.552676 0.66702828 0.4636433 ENSBTAG00000004042 2.617676179 4.527681291 0.707671068 0.156298781 0.4637099 ENSBTAG00000015210 5.268428823 8.135559736 2.401297911 0.29516075 0.4637099 783966 236.8172012 287.8167296 185.8176729 0.645611092 0.4637099 ENSBTAG00000031687 56.175827 72.35347171 39.99818229 0.552816352 0.4642491 ENSBTAG00000013126 39.2363143 49.78016425 28.69246435 0.576383481 0.4642491 615111 14.27894377 17.92332765 10.63455989 0.593336243 0.4646201 ENSBTAG00000043388 1.221846131 0 2.443692262 NA 0.4646201 ENSBTAG00000019506 13.9343272 18.97416769 8.894486718 0.468768215 0.464836 ENSBTAG00000042357 2.705476183 4.343055368 1.067896998 0.245886112 0.4648711 ENSBTAG00000014211 5.329307647 7.808250776 2.850364518 0.365045207 0.4648711 ENSBTAG00000038290 11.69287364 14.01947986 9.36626743 0.66808951 0.4648711 ENSBTAG00000017157 3.395392568 5.552106237 1.238678898 0.22310072 0.4649033

PAGE 70

ENSBTAG00000042475 3.322766815 5.017015243 1.628518387 0.324599051 0.4653011 ENSBTAG00000002599 3.323849495 4.924458587 1.723240402 0.349934997 0.4653011 ENSBTAG00000037729 9.788776773 13.64093415 5.936619393 0.43520622 0.4653011 ENSBTAG00000007439 5.911609725 3.534595952 8.288623497 2.344998866 0.4653011 ENSBTAG00000012141 5.262488884 7.327168112 3.197809656 0.436431867 0.4654825 ENSBTAG00000015439 9.766283344 13.49534394 6.037222745 0.447355975 0.4658165 ENSBTAG00000040202 321.8260045 386.2247193 257.4272896 0.666522045 0.4667487 ENSBTAG00000001119 9.118208354 4.11988112 14.11653559 3.426442457 0.4667487 ENSBTAG00000007140 1.269207138 0 2.538414277 NA 0.4671555 100139149 3.328606147 5.294197821 1.363014472 0.25745439 0.4673693 ENSBTAG00000033449 5.839736864 2.348701195 9.330772534 3.972737168 0.4676736 ENSBTAG00000011831 530.0286791 415.607365 644.4499932 1.550622168 0.4680971 ENSBTAG00000004406 2.488721971 4.269772875 0.707671068 0.165739745 0.4682292 ENSBTAG00000020696 58.68350982 76.20621835 41.1608013 0.540123919 0.4682292 ENSBTAG00000001406 125.1272434 156.2387176 94.01576916 0.601744373 0.4682292 100335240 7.152830086 3.515321789 10.79033838 3.069516542 0.4682292 784717 7.85093368 3.777112155 11.92475521 3.157109113 0.4682292 ENSBTAG00000003326 12.8361851 18.1960731 7.476297103 0.410874207 0.4687445 616487 113.4735825 138.0751623 88.87200279 0.643649454 0.4687445 ENSBTAG00000011442 34.36483815 41.57950552 27.15017077 0.652970025 0.4687445 ENSBTAG00000031083 2.468213878 4.104421114 0.832006642 0.202709863 0.4687838 537376 55.42755468 64.04750443 46.80760493 0.730826366 0.4687838 ENSBTAG00000011266 686.5129874 806.1297516 566.8962231 0.703231982 0.4688726 ENSBTAG00000038721 3.591450364 5.082601629 2.100299099 0.413233075 0.4692871 ENSBTAG00000004939 12.46526731 16.95284325 7.977691374 0.470581321 0.4692871 ENSBTAG00000004512 15.74622259 19.37926406 12.11318112 0.625058881 0.4692871 ENSBTAG00000007723 72.39036432 52.96810929 91.81261935 1.733356553 0.4692871 100140410 9.830083712 6.091079181 13.56908824 2.227698547 0.4692871 510681 9.712036857 4.728254608 14.69581911 3.108085398 0.4692871 ENSBTAG00000004788 9.813598967 5.833170765 13.79402717 2.364756275 0.4693578 ENSBTAG00000012794 45.31293537 56.16597116 34.45989959 0.613536967 0.4693661 538584 25.63199118 18.17679894 33.08718342 1.820297596 0.469477 ENSBTAG00000004930 12.5461355 17.29124287 7.801028136 0.451154853 0.4695583 ENSBTAG00000034147 335.8455304 400.1906276 271.5004333 0.678427766 0.4697951 ENSBTAG00000032279 2.575283316 4.023442515 1.127124116 0.280139237 0.4700733 ENSBTAG00000006026 12.29157127 8.527967694 16.05517486 1.882649587 0.4702756 ENSBTAG00000031762 21.13839642 26.92523709 15.35155576 0.570154896 0.4703416 ENSBTAG00000015894 20.92976947 26.04349518 15.81604377 0.60729344 0.4703416 ENSBTAG00000021859 412.8751996 484.5561213 341.1942779 0.704137793 0.4712898 ENSBTAG00000005445 569.0209352 457.216409 680.8254614 1.489066114 0.4712898 ENSBTAG00000033622 3.185308509 4.912880531 1.457736487 0.296717268 0.4715148 ENSBTAG00000030174 894.1209848 704.8374016 1083.404568 1.537098578 0.4715148 ENSBTAG00000030499 3.16941905 5.005437186 1.333400913 0.2663905 0.4718435 ENSBTAG00000034869 10.53970865 14.93145101 6.147966283 0.411746071 0.4718435 ENSBTAG00000006434 134.8599289 166.0968609 103.622997 0.623870894 0.4718435 ENSBTAG00000019181 229.1692378 166.6293158 291.7091599 1.750647288 0.4718435 ENSBTAG00000018122 15.36181446 10.03784464 20.68578428 2.060779482 0.4718435 100337030 177.5541817 206.7958704 148.312493 0.717192721 0.4720177 ENSBTAG00000000105 1399.000204 1150.653688 1647.346719 1.431661617 0.4720177 ENSBTAG00000001714 3.597289696 5.359784208 1.834795184 0.342326316 0.4722663 615768 95.99706822 68.6771675 123.3169689 1.795603596 0.4722663 614223 3.148772938 4.728254608 1.569291269 0.331896524 0.4724752

PAGE 71

ENSBTAG00000013184 1413.115733 1712.695933 1113.535534 0.65016534 0.4724752 ENSBTAG00000004552 38114.56518 44424.84138 31804.28897 0.715912268 0.4724752 100337041 55.39874283 72.48887823 38.30860742 0.528475655 0.4726203 ENSBTAG00000012647 5.061510291 6.522590645 3.600429937 0.551993852 0.472675 ENSBTAG00000002027 10.35010642 13.87235969 6.827853153 0.492191185 0.4727973 786695 5.438322788 7.666055128 3.210590448 0.418806074 0.4731718 ENSBTAG00000037378 5.431514617 8.120167523 2.742861712 0.337783882 0.473199 ENSBTAG00000025752 3.126406856 4.470346192 1.782467521 0.398731428 0.473199 ENSBTAG00000015082 14.81156547 20.27147367 9.351657276 0.461321038 0.473199 100299799 426.6881395 525.8775064 327.4987726 0.622766269 0.473199 786474 5.586447082 2.090792779 9.082101386 4.343855344 0.4733149 613886 506.9876167 394.9520187 619.0232148 1.567337766 0.4737982 ENSBTAG00000002266 4146.678556 3461.009087 4832.348024 1.396225177 0.4740014 ENSBTAG00000016114 20.90121677 27.1753816 14.62705193 0.538246422 0.4741222 ENSBTAG00000014088 62.75081304 43.76618172 81.73544437 1.867547982 0.4741417 ENSBTAG00000031340 295.8745736 354.2658203 237.4833269 0.670353484 0.4746635 ENSBTAG00000005192 8.437355157 3.881246867 12.99346345 3.34775496 0.4746635 ENSBTAG00000039467 3.5196958 5.328931989 1.71045961 0.320976063 0.4747137 ENSBTAG00000031086 4.31701894 2.067636667 6.566401213 3.175800333 0.4747137 ENSBTAG00000001833 2.246239665 3.784808261 0.707671068 0.186976729 0.4752118 ENSBTAG00000043693 3.081367188 4.439493973 1.723240402 0.388161446 0.4752118 ENSBTAG00000017695 21.2171684 28.68858532 13.74575148 0.479136609 0.4752118 ENSBTAG00000006846 22.4369859 30.03983184 14.83413997 0.493815679 0.4752118 100336172 4751.223849 3934.155942 5568.291757 1.415371388 0.4752118 ENSBTAG00000016858 908.9496889 711.2155339 1106.683844 1.556045659 0.4752118 ENSBTAG00000027279 52.77451083 34.29476768 71.25425399 2.077700443 0.4752118 ENSBTAG00000017108 27.41461604 17.2879161 37.54131598 2.171535063 0.4752118 ENSBTAG00000006525 15.30575759 8.824979616 21.78653557 2.468734945 0.4752118 100138553 13.91212819 8.513062869 19.31119351 2.268418994 0.4754724 ENSBTAG00000025372 52.89842402 68.24905059 37.54779745 0.550158531 0.4755018 ENSBTAG00000043104 16.92280869 22.88917395 10.95644344 0.478673606 0.4755745 ENSBTAG00000015337 80.61946606 60.89630658 100.3426255 1.647762092 0.4755745 100137855 33.87889799 43.88515346 23.87264251 0.543979925 0.4756498 ENSBTAG00000013958 3.051134299 4.408641755 1.693626843 0.384160686 0.4759973 ENSBTAG00000032552 169.1261745 128.5998663 209.6524827 1.630269835 0.4759973 ENSBTAG00000010612 38.26276104 25.70454037 50.82098171 1.977120811 0.4759973 ENSBTAG00000008523 1196.881759 949.2354439 1444.528075 1.521780591 0.4761131 ENSBTAG00000008494 15.35348222 9.102162195 21.60480224 2.373590118 0.4762505 ENSBTAG00000038714 2.178214584 3.465195408 0.89123376 0.257195816 0.4764021 100336263 2.991865175 4.685824333 1.297906017 0.276985632 0.4764021 ENSBTAG00000030464 2.396670805 3.476773464 1.316568146 0.378675274 0.4764021 ENSBTAG00000013205 35.00834036 47.73159837 22.28508236 0.46688322 0.4764021 ENSBTAG00000010843 2086.754269 1611.531035 2561.977504 1.58977857 0.4764021 ENSBTAG00000039972 10.05685464 4.739832664 15.37387662 3.243548392 0.4764021 100335998 4.369989097 1.767297976 6.972680218 3.945390259 0.4764021 ENSBTAG00000027875 6.614778974 2.906948301 10.32260965 3.551012462 0.4767094 ENSBTAG00000012164 6.476670827 9.791026894 3.16231476 0.322980908 0.476914 ENSBTAG00000001999 1755.412174 2091.591145 1419.233204 0.678542366 0.476914 ENSBTAG00000014377 82.34361285 57.87329371 106.813932 1.845651511 0.4771608 522586 2.368735211 3.73468188 1.002788542 0.268507084 0.4773294 ENSBTAG00000011584 2.147981695 3.43434319 0.861620201 0.250883547 0.4773579 ENSBTAG00000034154 5.235154659 7.573498472 2.896810845 0.382493092 0.4775765

PAGE 72

ENSBTAG00000014318 1044.490728 849.5060807 1239.475375 1.459054152 0.4776032 ENSBTAG00000007000 199.0049156 150.7749343 247.2348969 1.639761265 0.478729 ENSBTAG00000035314 2.112666822 3.268991429 0.956342216 0.292549625 0.4788384 789732 30.91690722 38.59157862 23.24223582 0.602261857 0.4789405 100335786 2.101240018 3.465195408 0.737284627 0.212768557 0.4790058 781493 2.085813908 3.43434319 0.737284627 0.214679951 0.4790058 100335251 2.897167204 4.36621148 1.428122928 0.327085148 0.4790058 614838 2.971838393 4.439493973 1.504182813 0.338818528 0.4790058 100299814 12.80054402 17.33416054 8.266927511 0.476915366 0.4790058 ENSBTAG00000017367 47.98082733 62.08080697 33.88084768 0.545753983 0.4790058 ENSBTAG00000008204 107.9619729 137.8025481 78.12139765 0.566908223 0.4790058 ENSBTAG00000004722 11.61825276 14.21180189 9.024703629 0.635014736 0.4790058 ENSBTAG00000012702 124.452528 94.21344893 154.691607 1.641927016 0.4790058 ENSBTAG00000021518 82.46664386 58.84087095 106.0924168 1.803039538 0.4790058 100337204 21.92989025 13.1179086 30.74187189 2.343504047 0.4790058 ENSBTAG00000018430 1.672099607 0.300338691 3.043860523 10.13475992 0.4793094 ENSBTAG00000021011 382.8349838 291.7740348 473.8959328 1.62418816 0.479458 618576 4.851789811 2.079214723 7.624364899 3.666944455 0.4794752 ENSBTAG00000030468 1.701713166 0.300338691 3.103087642 10.33196101 0.4796543 790312 8.548713846 12.44776289 4.649664806 0.373534172 0.4797101 ENSBTAG00000022137 7.259241384 9.879769392 4.638713376 0.469516361 0.4800917 ENSBTAG00000021438 41.94154954 56.09281993 27.79027916 0.495433804 0.4800917 ENSBTAG00000019041 19.93563709 25.8395273 14.03174689 0.543034194 0.4800917 ENSBTAG00000007372 24.39423604 31.61529517 17.1731769 0.543192047 0.4800917 ENSBTAG00000014081 194.5497807 239.608973 149.4905883 0.623893949 0.4800917 ENSBTAG00000025280 157.0649625 108.9726784 205.1572465 1.882648472 0.4800917 509118 1.749074174 0.300338691 3.197809656 10.647345 0.4800917 509089 1.786247035 0.558247107 3.014246964 5.399485152 0.4800966 ENSBTAG00000025035 2.017325478 3.238139211 0.796511746 0.245978228 0.4806817 536380 7.339082272 9.933777723 4.744386821 0.477601468 0.4807066 ENSBTAG00000025023 11.72104994 15.51673618 7.92536371 0.51076229 0.4807066 ENSBTAG00000018613 295.9712384 361.3039523 230.6385245 0.638350406 0.4807066 ENSBTAG00000010904 480.6046574 580.2766841 380.9326308 0.656467236 0.4807066 100336258 168.851716 132.5039981 205.199434 1.548628245 0.4807066 100300211 1.984616507 0.558247107 3.410985908 6.110172121 0.4807066 ENSBTAG00000038528 1.855662299 0.300338691 3.410985908 11.35713118 0.4807066 ENSBTAG00000006853 2.139828344 0.300338691 3.979317996 13.24943512 0.4807066 ENSBTAG00000042372 2.154635123 0.300338691 4.008931556 13.34803567 0.4807066 789938 2.21680291 0.300338691 4.13326713 13.76202021 0.4807066 ENSBTAG00000036107 1.983093285 2.980230795 0.985955775 0.33083202 0.481043 ENSBTAG00000042669 1.972905139 3.238139211 0.707671068 0.218542509 0.4811903 ENSBTAG00000014349 17.37919699 23.22854835 11.52984562 0.496365311 0.4811903 ENSBTAG00000014117 105.049169 123.6414321 86.45690597 0.699255132 0.4811903 ENSBTAG00000016093 473.1477948 378.1130236 568.182566 1.502679174 0.4811903 100125581 138.8299007 102.0549717 175.6048297 1.720688632 0.4811903 ENSBTAG00000006901 122.3657291 85.87689628 158.8545619 1.849793936 0.4811903 ENSBTAG00000038966 30.33820791 20.84899494 39.82742088 1.910280136 0.4811903 100336230 12.60589123 6.253104173 18.95867828 3.031882687 0.4811903 ENSBTAG00000014804 33712.45323 40582.13982 26842.76663 0.66144286 0.4812237 ENSBTAG00000007942 435.6511962 529.0912856 342.2111067 0.646790291 0.4822093 ENSBTAG00000042618 834.4334289 942.0362317 726.8306261 0.77155273 0.4822093 ENSBTAG00000027015 116.9616232 86.51182044 147.411426 1.703945487 0.4822622

PAGE 73

ENSBTAG00000000245 48.89981393 30.99547921 66.80414865 2.155286847 0.4822622 518043 1.905499389 2.949378576 0.861620201 0.292136184 0.4822704 ENSBTAG00000042753 1.905499389 2.949378576 0.861620201 0.292136184 0.4822704 100137826 2.859392974 4.11988112 1.598904828 0.388094894 0.4822704 ENSBTAG00000019752 13.33231028 18.03848524 8.626135323 0.4782073 0.4822704 100337148 16.87661464 21.82766284 11.92556645 0.546351047 0.4822704 ENSBTAG00000015498 445.4490712 549.2698422 341.6283001 0.621968064 0.4822704 ENSBTAG00000020031 339.826862 418.6677481 260.985976 0.623372536 0.4822704 ENSBTAG00000010788 60.80784208 79.00182322 42.61386095 0.539403513 0.4823329 ENSBTAG00000003383 408.9568246 315.5851774 502.3284718 1.591736583 0.4823329 ENSBTAG00000021325 1393.371392 1089.372687 1697.370097 1.558116995 0.4828294 ENSBTAG00000015549 24.41324382 31.67602483 17.1504628 0.541433557 0.4833263 537991 50.29991368 65.66650408 34.93332328 0.53198086 0.4834411 ENSBTAG00000013081 635.4406113 538.9600244 731.9211983 1.358025021 0.4834411 ENSBTAG00000037335 16.39040157 21.50368065 11.2771225 0.524427547 0.4838414 100138533 1.843950931 2.980230795 0.707671068 0.237455122 0.4839676 ENSBTAG00000022767 1.828524822 2.949378576 0.707671068 0.239939041 0.4843588 407102 497.3466624 381.2383615 613.4549632 1.60911132 0.4843588 ENSBTAG00000008709 53.88214027 72.09063877 35.67364177 0.494844301 0.4844363 ENSBTAG00000016105 537.5713548 420.4874609 654.6552487 1.556896006 0.4844533 ENSBTAG00000042716 779.7466398 884.3304384 675.1628413 0.763473485 0.484494 100335280 1.775925851 2.660617941 0.89123376 0.334972469 0.4853042 ENSBTAG00000009277 22.95281624 30.32040898 15.58522351 0.514017589 0.4853042 ENSBTAG00000020544 552.1700488 633.2704329 471.0696648 0.743868086 0.4853042 ENSBTAG00000020212 406.9506684 324.2767678 489.624569 1.509897154 0.4853042 789418 30.79713572 20.79165984 40.80261161 1.962450902 0.4853042 100336623 6.085213612 8.439780376 3.730646849 0.442031271 0.4853612 ENSBTAG00000018938 122.8675806 82.12127902 163.6138822 1.992344544 0.4855679 ENSBTAG00000015636 21.71532355 27.80302925 15.62761786 0.562083279 0.4857699 ENSBTAG00000025903 34.2112396 23.65617786 44.76630133 1.892372537 0.4857699 536818 14.85249558 19.29821767 10.40677348 0.539260861 0.4860448 ENSBTAG00000026326 86.88171145 108.6656819 65.09774102 0.599064395 0.4861293 ENSBTAG00000004888 26.02220957 16.2441492 35.80026993 2.203887042 0.4866269 ENSBTAG00000014612 2.760671655 3.892824923 1.628518387 0.418338461 0.4866972 786149 10.44764918 13.5956645 7.299633865 0.536908944 0.4870453 785753 12.19000504 16.50982152 7.870188567 0.476697374 0.4874562 ENSBTAG00000005111 62.68429891 78.91170351 46.45689432 0.588719952 0.4874562 781500 1.569997076 2.402709525 0.737284627 0.306855498 0.4878414 ENSBTAG00000016366 9.206904608 11.90885773 6.504951481 0.546227995 0.4880341 ENSBTAG00000017422 12.7454774 16.4216342 9.069320594 0.55227881 0.4881625 ENSBTAG00000003498 11.12266277 14.41570197 7.829623578 0.543131621 0.4884245 ENSBTAG00000021573 398.3851541 456.2298374 340.5404708 0.746423059 0.4884245 ENSBTAG00000019458 1055.885305 1265.058288 846.7123209 0.669306963 0.4890991 538060 10.38751791 14.77330797 6.001727848 0.406254839 0.489727 ENSBTAG00000013901 703.713362 841.0234505 566.4032735 0.673469061 0.489727 ENSBTAG00000016600 2.691719763 1.147346432 4.236093095 3.692078501 0.489727 521914 2.684160461 0.889438016 4.478882906 5.035632417 0.489727 ENSBTAG00000015352 860.5463575 680.3150946 1040.77762 1.529846432 0.4898049 ENSBTAG00000015916 29.68629227 35.08007098 24.29251355 0.692487582 0.4898453 ENSBTAG00000014737 21.80776015 27.91874202 15.69677829 0.562230858 0.4904855 100299582 33.31866661 43.62003633 23.01729689 0.52767716 0.4907484 ENSBTAG00000003417 104.6905183 80.52037105 128.8606655 1.60034863 0.4907484

PAGE 74

ENSBTAG00000021805 622.4664051 479.8261926 765.1066175 1.594549504 0.4908332 ENSBTAG00000014069 47.43070152 61.05680162 33.80460142 0.553658242 0.4909508 ENSBTAG00000042741 14.29963547 17.78501395 10.81425698 0.608054456 0.4909508 ENSBTAG00000018646 2876.646597 2389.283906 3364.009287 1.40795712 0.4909508 ENSBTAG00000020150 3.724087156 1.416832904 6.031341408 4.25691794 0.4909508 ENSBTAG00000011437 2.587141151 0.600677381 4.573604921 7.614078809 0.4909508 ENSBTAG00000011709 1044.596801 826.9167118 1262.27689 1.526486129 0.4911343 ENSBTAG00000022027 356.4254206 243.956542 468.8942992 1.922040276 0.4911343 534655 50.12963741 64.40732683 35.85194799 0.556643937 0.4917299 615488 147.5509426 180.4204258 114.6814594 0.635634568 0.4917299 ENSBTAG00000020662 1143.467139 926.8776652 1360.056613 1.467352882 0.4917299 ENSBTAG00000012961 195.6515942 155.0422874 236.2609011 1.523848139 0.4917299 ENSBTAG00000002971 122.0487799 91.00913691 153.0884229 1.682121467 0.4917299 ENSBTAG00000014191 47.57901554 32.10420953 63.05382156 1.964035947 0.4917299 ENSBTAG00000002044 3.680905476 1.478537341 5.883273611 3.979117366 0.4917299 100139352 2.49703777 0.858585797 4.135489743 4.816629573 0.4917299 100138804 3.683973625 1.158924488 6.209022763 5.357573187 0.4917299 ENSBTAG00000001260 2.495359805 0.600677381 4.390042228 7.308485994 0.4917299 ENSBTAG00000012119 20.90158706 28.70688471 13.09628941 0.456207267 0.4920057 100336392 20.96858302 26.77139559 15.16577046 0.56649159 0.4920057 ENSBTAG00000006812 76.91883459 93.9560957 59.88157349 0.637335694 0.4920057 ENSBTAG00000013662 580.5342242 673.5830564 487.4853919 0.723719796 0.4920057 ENSBTAG00000011317 46.01366045 30.44825498 61.57906593 2.022416916 0.4920057 ENSBTAG00000018258 18603.10333 22292.59254 14913.61412 0.668994155 0.4921305 ENSBTAG00000004105 7.931777792 10.36910334 5.49445224 0.529886921 0.4921318 ENSBTAG00000002952 25.32835546 30.45650627 20.20020466 0.663247599 0.4921318 100300864 10.0217324 13.93018218 6.11328263 0.438851592 0.4924255 506660 7.98788056 4.373907587 11.60185353 2.652514554 0.4924255 ENSBTAG00000010850 7.985403241 4.250498712 11.72030777 2.757395911 0.4924255 ENSBTAG00000009885 20.925075 26.34383387 15.50631614 0.588612736 0.4927547 ENSBTAG00000020062 52.12186879 65.39659801 38.84713957 0.59402386 0.493037 786672 4.389156123 6.772735162 2.005577085 0.296125131 0.4938892 ENSBTAG00000044128 26.31273277 17.4913288 35.13413673 2.008660242 0.4938892 ENSBTAG00000019779 116.5002982 145.5283075 87.47228892 0.601067177 0.4939206 ENSBTAG00000005787 120.2110398 150.6288567 89.79322286 0.596122316 0.4941544 523756 134.8542286 160.6721132 109.036344 0.678626439 0.4941544 ENSBTAG00000002457 488.5144709 379.6890928 597.339849 1.573234155 0.4941544 ENSBTAG00000000078 1157.70848 924.1853902 1391.231569 1.505359838 0.4959962 100298655 4.338259162 6.422270091 2.254248233 0.351004894 0.4964949 786421 409.7476559 501.7968945 317.6984173 0.633121529 0.4965781 497020 3.537559751 1.736445757 5.338673745 3.074483451 0.4965781 ENSBTAG00000007184 3136.097032 3562.897839 2709.296225 0.760419284 0.4968802 ENSBTAG00000017462 4922.29866 4013.452178 5831.145142 1.452900118 0.4968802 617416 5.485368228 2.668314048 8.302422407 3.111486226 0.4971187 ENSBTAG00000013706 5.477501421 2.895370245 8.059632596 2.783627624 0.4972885 ENSBTAG00000006152 32.25019575 23.08198336 41.41840814 1.794404211 0.4987699 ENSBTAG00000011125 27.8790043 17.78445877 37.97354982 2.135209753 0.4987699 ENSBTAG00000021813 24.0040039 14.1462155 33.8617923 2.393699736 0.4987699 ENSBTAG00000037560 11.36006471 6.649326288 16.07080313 2.416906981 0.4987699 ENSBTAG00000001847 10.75862822 14.81962019 6.697636242 0.451943852 0.499388 ENSBTAG00000018347 61.363623 41.7106105 81.01663549 1.942350748 0.499388 ENSBTAG00000009091 94.25196958 118.3800995 70.12383966 0.592361722 0.4996832

PAGE 75

ENSBTAG00000006870 24.822831 16.39459614 33.25106586 2.028172306 0.4996832 ENSBTAG00000030416 14.70055246 9.05973192 20.341373 2.245251094 0.4996832 511754 8.674605247 11.52414588 5.825064611 0.50546606 0.4997406 534587 229.4215112 282.9203816 175.9226408 0.621809711 0.4997406 508215 133.9960063 161.2888736 106.703139 0.661565405 0.4997406 ENSBTAG00000030930 2945.284611 3399.012091 2491.557132 0.73302391 0.4997406 ENSBTAG00000003989 66.06454113 51.79316961 80.33591264 1.551090872 0.4997406 ENSBTAG00000006644 233.4004037 176.6961309 290.1046765 1.64182812 0.4997406 ENSBTAG00000017949 3.436565181 0.901016072 5.972114289 6.628199512 0.4997406 ENSBTAG00000020973 48.4084523 32.58099065 64.23591394 1.971576452 0.5001349 ENSBTAG00000009733 12.00876173 7.754242446 16.26328101 2.097339763 0.5006342 ENSBTAG00000009151 69.10245942 85.95683231 52.24808652 0.607840995 0.5009172 ENSBTAG00000001318 4.594415265 6.734186837 2.454643692 0.364504839 0.501175 ENSBTAG00000008931 200.3343495 162.2111091 238.4575899 1.470044754 0.501175 ENSBTAG00000006305 10.36085528 5.87560104 14.84610952 2.526738867 0.5012316 ENSBTAG00000015149 441.0113067 356.1796961 525.8429173 1.476341642 0.5013614 ENSBTAG00000014883 362.191817 279.7860125 444.5976215 1.589063076 0.5015162 ENSBTAG00000012355 493.909009 579.498212 408.3198059 0.704609259 0.5015395 782527 24.36869984 31.74493799 16.99246169 0.535280985 0.5019187 526505 907.8225718 729.4264183 1086.218725 1.489140917 0.5019187 ENSBTAG00000019026 171.0237489 215.4727508 126.574747 0.587428093 0.502093 ENSBTAG00000020261 19.06371427 11.43547118 26.69195736 2.334137085 0.502093 ENSBTAG00000011207 14.89066799 20.50573858 9.27559739 0.452341541 0.5021469 ENSBTAG00000023270 19.81058481 26.46280561 13.15836401 0.497239945 0.5021469 ENSBTAG00000013010 436.6756427 543.0111949 330.3400905 0.608348582 0.5021469 ENSBTAG00000005666 39.07974532 47.89812829 30.26136236 0.631785906 0.5021469 ENSBTAG00000011344 379.0551111 459.9525936 298.1576285 0.648235563 0.5021469 ENSBTAG00000008989 24.36521481 29.47783837 19.25259126 0.653120864 0.5021469 ENSBTAG00000019423 81.94435776 98.96437226 64.92434325 0.656037539 0.5021469 ENSBTAG00000013974 572.776903 676.2754292 469.2783768 0.693916053 0.5021469 100336229 626.9134159 730.8608641 522.9659677 0.715547915 0.5021469 ENSBTAG00000007933 79.54660905 56.97664698 102.1165711 1.792253081 0.5021469 531539 12.9273836 7.635202909 18.21956429 2.386258035 0.5021469 ENSBTAG00000004586 24.63791946 32.7886371 16.48720182 0.502832788 0.5022127 ENSBTAG00000005638 171.2176373 212.0106153 130.4246593 0.615179854 0.5022127 ENSBTAG00000001113 291.4370366 356.2555511 226.6185221 0.636112255 0.5022127 ENSBTAG00000002631 431.390118 510.3481454 352.4320906 0.690571904 0.5022127 534495 513.0620918 410.965446 615.1587375 1.496862434 0.5022127 100138498 297.0289808 233.9965567 360.061405 1.538746595 0.5022127 ENSBTAG00000011150 130.0390064 101.369366 158.7086468 1.56564703 0.5022127 ENSBTAG00000044189 43.50971046 31.47982085 55.53960007 1.764292126 0.5022127 ENSBTAG00000004415 54.87059877 37.74887242 71.99232512 1.907138426 0.5022127 540674 6.006221469 3.503743733 8.508699204 2.428459343 0.5022127 ENSBTAG00000024899 24.05448093 31.54873401 16.56022785 0.524909426 0.5026348 ENSBTAG00000019787 34.87789777 42.78474223 26.97105331 0.630389524 0.5026348 ENSBTAG00000014154 12.04527522 16.98320808 7.107342356 0.418492332 0.5027895 100335201 6.961513302 9.579430702 4.343595902 0.45342944 0.5027895 ENSBTAG00000018040 33.22404211 42.31461465 24.13346958 0.570334145 0.5027895 782389 454.3604587 556.520202 352.2007155 0.632862409 0.5027895 ENSBTAG00000008133 876.186799 1066.221209 686.1523888 0.643536616 0.5027895 ENSBTAG00000002575 594.0916653 463.5007893 724.6825412 1.563497966 0.5027895 ENSBTAG00000004587 138.1488142 102.5326598 173.7649687 1.694727992 0.5027895

PAGE 76

ENSBTAG00000011857 19.5989807 11.9281319 27.26982951 2.28617773 0.5028951 ENSBTAG00000011489 1.287075773 2.102370835 0.471780712 0.224404137 0.503031 ENSBTAG00000019246 1742.90055 1479.636504 2006.164596 1.355849623 0.503031 ENSBTAG00000021503 687.9140151 562.815135 813.0128953 1.444546965 0.503031 ENSBTAG00000044047 9.456077245 12.77513964 6.137014852 0.480387301 0.5031237 ENSBTAG00000006247 135.6961869 98.5793764 172.8129975 1.753033989 0.5031237 ENSBTAG00000019469 15.94088227 22.4234157 9.458348839 0.421806783 0.5032009 ENSBTAG00000004635 271.0065006 309.619914 232.3930872 0.750575388 0.5032009 ENSBTAG00000025494 188.5459649 232.3414242 144.7505056 0.62300774 0.50379 ENSBTAG00000012560 23.67998214 14.65815038 32.7018139 2.230964552 0.50379 ENSBTAG00000017265 4034.724708 3367.131656 4702.31776 1.396535164 0.5040117 ENSBTAG00000002922 4.13870178 1.490115397 6.787288164 4.55487419 0.5041343 ENSBTAG00000000188 44.18306189 56.65980571 31.70631806 0.559591013 0.504312 ENSBTAG00000020281 1304.749481 1559.552917 1049.946046 0.673235281 0.504312 ENSBTAG00000039793 525.7716473 618.3807805 433.1625141 0.700478617 0.504312 ENSBTAG00000018240 3014.25832 2358.460636 3670.056003 1.556123493 0.504312 ENSBTAG00000012178 10.82787089 6.360565654 15.29517612 2.404688035 0.504312 ENSBTAG00000007147 71.96628712 86.49691562 57.43565861 0.664019731 0.5047454 ENSBTAG00000017357 18.13274212 23.19818352 13.06730072 0.563289824 0.504764 100336712 907.5049701 993.4879041 821.5220361 0.826906933 0.504764 100336207 7738.443623 6946.46163 8530.425617 1.228024579 0.5052611 ENSBTAG00000002563 441.1968288 338.7772497 543.6164079 1.604642603 0.5052733 ENSBTAG00000014096 57.32461939 74.49002153 40.15921725 0.539122106 0.5053767 ENSBTAG00000024485 660.9787031 526.3729645 795.5844416 1.511446247 0.5053767 ENSBTAG00000017512 48.2956447 28.14642119 68.4448682 2.431743195 0.5053767 ENSBTAG00000007495 87.40821104 60.95967657 113.8567455 1.867738675 0.5053879 ENSBTAG00000015036 157.580945 192.0506388 123.1112513 0.641035365 0.5054344 ENSBTAG00000005222 1.847932274 3.164856717 0.53100783 0.167782582 0.5056412 617765 1.833125494 3.164856717 0.501394271 0.158425583 0.5057599 ENSBTAG00000029847 1.832506165 3.134004499 0.53100783 0.169434291 0.5057599 ENSBTAG00000019953 149.741165 109.5413932 189.9409368 1.733964953 0.5057599 100298420 9.303366771 12.83684407 5.769889468 0.449478815 0.5060464 532721 1.411411347 2.102370835 0.72045186 0.342685433 0.5064381 ENSBTAG00000016696 37.46166452 46.76187252 28.16145652 0.602231155 0.5065571 ENSBTAG00000012996 392.826645 309.2551121 476.3981779 1.540469855 0.5066583 ENSBTAG00000018811 1.750912964 2.876096083 0.625729845 0.217562219 0.5068667 ENSBTAG00000025400 10.58595612 6.145087512 15.02682473 2.445339419 0.5068667 ENSBTAG00000007058 3.981811979 1.490115397 6.47350856 4.344300161 0.5068667 ENSBTAG00000017475 5973.668608 4789.869763 7157.467453 1.494292707 0.5068855 790201 1.493004548 2.360279251 0.625729845 0.265108396 0.5075694 ENSBTAG00000037304 24.69712924 30.56396775 18.83029073 0.616094444 0.5075694 ENSBTAG00000001975 1.638004195 2.679892104 0.596116286 0.222440405 0.5076559 ENSBTAG00000034945 1.622578086 2.649039885 0.596116286 0.225031072 0.5076559 ENSBTAG00000005776 1.555791665 2.391131469 0.72045186 0.301301651 0.5076559 ENSBTAG00000040521 1544.900773 1784.929823 1304.871723 0.731049314 0.5076559 784305 13.09019395 18.08424228 8.096145611 0.447690618 0.5078075 ENSBTAG00000005970 33.03289096 23.38232205 42.68345987 1.825458557 0.5078075 ENSBTAG00000008175 61.42147159 76.26273141 46.58021177 0.610786041 0.5078304 100140305 4.438796464 7.019065522 1.858527406 0.264782741 0.5080968 513301 3.956634501 5.937305477 1.975963525 0.33280476 0.5080968 ENSBTAG00000013417 16.46452778 21.49210259 11.43695297 0.53214677 0.5080968 ENSBTAG00000010484 55.90683536 70.23626384 41.57740687 0.591964956 0.5080968

PAGE 77

ENSBTAG00000013895 85.35886227 105.5100512 65.20767331 0.618023331 0.5080968 ENSBTAG00000016932 699.8943168 857.1796706 542.608963 0.633016603 0.5080968 ENSBTAG00000014105 464.192355 364.9173148 563.4673953 1.54409608 0.5080968 505171 219.5447256 171.8722769 267.2171742 1.554742737 0.5080968 404161 382.2613076 294.6346074 469.8880078 1.594816074 0.5080968 ENSBTAG00000015166 2.928762552 0.858585797 4.998939306 5.82229443 0.5080968 ENSBTAG00000043202 11.84945309 16.05182717 7.647079003 0.476399286 0.5084042 ENSBTAG00000010371 95.98166564 73.65785082 118.3054805 1.60614896 0.5084042 522873 866.6220424 1004.888179 728.3559055 0.72481289 0.5084283 ENSBTAG00000012980 347.7703688 434.3435806 261.197157 0.601360694 0.508766 ENSBTAG00000018969 306.9540068 365.056671 248.8513425 0.681678661 0.5088662 ENSBTAG00000010863 1606.194048 1950.465059 1261.923037 0.646985718 0.5090354 282101 38.90984811 48.19846698 29.62122924 0.614567871 0.5090437 ENSBTAG00000008072 7229.914567 8634.72 5825.109134 0.674614711 0.5090437 ENSBTAG00000006321 1018.899837 840.1731795 1197.626494 1.425451947 0.5090437 ENSBTAG00000016878 525.4420931 406.6001329 644.2840533 1.584564296 0.5090437 785549 337.8794744 261.6765967 414.082352 1.582420275 0.5095488 ENSBTAG00000004381 18.12705806 10.63470787 25.61940826 2.409037331 0.5095488 100336844 234.2354502 184.0708023 284.4000981 1.545058176 0.5103685 ENSBTAG00000020485 1222.603477 929.008859 1516.198094 1.632059888 0.5103685 519195 4.345800502 6.637748232 2.053852773 0.309420108 0.5106848 526910 177.1384146 220.7914313 133.4853978 0.604576894 0.5106848 ENSBTAG00000003516 144.8832458 109.5875021 180.1789895 1.644156369 0.5107218 788526 3.853302712 6.202422611 1.504182813 0.24251537 0.5107462 532085 34.61209788 44.99783352 24.22636223 0.538389525 0.5114718 ENSBTAG00000008958 7.048401237 3.692251606 10.40455087 2.817941998 0.5114718 781844 2.801486309 0.858585797 4.744386821 5.525815632 0.5114718 100337450 2.339986052 0.589099325 4.090872778 6.944283592 0.5114718 ENSBTAG00000016550 229.2219624 171.8995355 286.5443893 1.666929398 0.5115709 ENSBTAG00000030463 2.319941309 0.300338691 4.339543926 14.44883414 0.511919 ENSBTAG00000022293 19.82138933 24.19182404 15.45095462 0.638684979 0.5124858 ENSBTAG00000021723 248.0252122 297.3762674 198.6741569 0.668090156 0.5124858 531649 276.8917497 205.2407238 348.5427756 1.698214512 0.5124858 ENSBTAG00000012909 56.89805001 73.22939927 40.56670075 0.553967411 0.5125597 ENSBTAG00000020773 19.86548716 26.67828375 13.05269057 0.489262753 0.512589 ENSBTAG00000021977 70.05246997 46.073563 94.03137693 2.040896575 0.5130431 ENSBTAG00000022178 70.90800499 52.37852258 89.4374874 1.707522148 0.5137075 ENSBTAG00000012295 76.82576298 97.1174729 56.53405305 0.582120306 0.513709 787226 286.6940668 344.7740346 228.614099 0.663083864 0.513709 ENSBTAG00000044058 118.4635641 87.90500985 149.0221183 1.695263086 0.513709 100300284 4.236271708 6.637748232 1.834795184 0.276418315 0.5137846 ENSBTAG00000039740 5.465601641 7.79667272 3.134530563 0.40203439 0.5137846 ENSBTAG00000017751 87.58555063 106.4597315 68.71136974 0.645421219 0.5138593 ENSBTAG00000039887 102.2810025 74.90662817 129.6553769 1.730893247 0.5138593 ENSBTAG00000021807 2.21209048 0.558247107 3.865933853 6.925130119 0.5138593 ENSBTAG00000038773 3.751201418 5.779162435 1.723240402 0.298181687 0.5144394 ENSBTAG00000022329 7.595356944 10.81933379 4.371380099 0.404034129 0.5144394 513990 8.748363983 12.23228474 5.264443221 0.430372848 0.5144394 ENSBTAG00000033190 39.74646095 50.51527338 28.97764851 0.573641328 0.5144394 ENSBTAG00000016712 660.2942856 762.5213826 558.0671886 0.731870871 0.5144394 ENSBTAG00000012659 403.3311548 486.3733036 320.2890061 0.658525054 0.514624 ENSBTAG00000000885 123.3704372 94.48098585 152.2598886 1.611540007 0.514624

PAGE 78

100299281 902.0101922 673.4754723 1130.544912 1.678672734 0.514624 ENSBTAG00000024643 2.153482691 0.589099325 3.717866057 6.311102215 0.514624 ENSBTAG00000014434 83.91810976 103.8140862 64.02213332 0.616699869 0.5150753 ENSBTAG00000004600 290.6451767 216.676195 364.6141584 1.682760575 0.5150753 ENSBTAG00000013117 6.579665656 3.226561155 9.932770156 3.078438523 0.5150753 ENSBTAG00000039384 51.41623722 63.72531905 39.1071554 0.613683164 0.5154337 ENSBTAG00000005174 22.61530726 29.04300013 16.18761438 0.557367156 0.5155058 100337077 1181.903073 941.5867349 1422.219411 1.510449711 0.5155058 ENSBTAG00000004620 16.51091451 10.2919389 22.72989012 2.2085139 0.5155058 ENSBTAG00000016910 164.7762533 202.6187177 126.9337889 0.626466253 0.5156785 ENSBTAG00000009265 4.137550389 6.410692035 1.864408743 0.290828 0.5163069 ENSBTAG00000013426 21.7478665 29.0149195 14.48081349 0.499081636 0.5163069 ENSBTAG00000018143 3205.700258 3676.163582 2735.236935 0.744046578 0.5164623 ENSBTAG00000006587 5.61331163 8.016032811 3.210590448 0.400521121 0.516587 ENSBTAG00000004003 11.89836992 15.12821017 8.668529674 0.573004313 0.516587 ENSBTAG00000015946 4510.878941 5321.5041 3700.253782 0.695339835 0.516587 ENSBTAG00000039289 25.78733624 35.05968646 16.51498602 0.471053443 0.5168634 784652 2.003087724 3.003386907 1.002788542 0.333885901 0.516905 ENSBTAG00000018530 28.08893534 35.69614058 20.4817301 0.57377996 0.5176683 ENSBTAG00000043349 54.38917901 70.08477434 38.69358369 0.552096858 0.5181449 ENSBTAG00000004225 6527.074447 7675.793092 5378.355802 0.700690565 0.5183507 100337058 21.1585941 29.01582649 13.30136171 0.458417468 0.5185959 100336777 42.45851492 53.27663147 31.64039836 0.593888868 0.5185959 ENSBTAG00000017540 136.3383576 169.0795114 103.5972038 0.612712936 0.5185959 507668 2481.444758 2947.402214 2015.487301 0.683818208 0.5185959 ENSBTAG00000009886 70.46415601 53.11751366 87.81079837 1.653142106 0.5185959 ENSBTAG00000002571 50.18860628 36.81935612 63.55785644 1.726207711 0.5185959 ENSBTAG00000008721 19.11785452 12.76356158 25.47214746 1.995692762 0.5185959 ENSBTAG00000019285 16.05372714 9.402500885 22.7049534 2.414778119 0.5185959 ENSBTAG00000008111 15.72833714 9.156170525 22.30050376 2.435571039 0.5185959 ENSBTAG00000012789 6.440319235 3.711525768 9.169112701 2.470442959 0.5185959 ENSBTAG00000002025 44.8230178 56.83389615 32.81213944 0.57733398 0.5188426 513774 27.46384144 35.6223707 19.30531217 0.541943498 0.5194089 ENSBTAG00000004909 12.93505066 17.52162584 8.348475482 0.476466942 0.5195403 ENSBTAG00000020605 54.25279863 65.57124363 42.93435363 0.654774124 0.5195403 ENSBTAG00000034191 397.6576184 321.1926014 474.1226354 1.47613187 0.5195403 ENSBTAG00000015504 2452.857477 2043.068191 2862.646764 1.401150865 0.5200051 ENSBTAG00000003166 3.572588908 5.232493384 1.912684432 0.365539771 0.5219332 ENSBTAG00000011632 664.3776826 827.2765212 501.478844 0.606180438 0.5219332 100336372 17.23107708 20.99223315 13.469921 0.641662128 0.52197 ENSBTAG00000031661 228.8420815 173.9140537 283.7701094 1.631668651 0.5220244 ENSBTAG00000015728 461.4847741 554.6085598 368.3609884 0.664181939 0.5221796 100336999 15.16925857 21.1763039 9.162213247 0.432663476 0.5223238 522132 14.09405256 8.470632595 19.71747252 2.327744982 0.5223238 532401 8.348216565 11.56220682 5.13422631 0.444052454 0.522527 ENSBTAG00000010988 4416.30013 3683.797687 5148.802573 1.397688747 0.522527 ENSBTAG00000005631 9.290555125 12.10943105 6.471679198 0.53443297 0.5231748 ENSBTAG00000004926 9.293779994 13.08317443 5.504385552 0.420722477 0.5233248 100301320 4.285641188 1.459263179 7.112019197 4.873705649 0.5233669 ENSBTAG00000013792 6.07183294 7.947119656 4.196546223 0.528058769 0.5234824 100140931 48.58469537 61.03468808 36.13470266 0.59203551 0.5234824 ENSBTAG00000004806 296.6200139 236.3596076 356.8804203 1.509904437 0.5234824

PAGE 79

ENSBTAG00000038005 113.4350795 136.4065193 90.46363965 0.663191467 0.5246602 ENSBTAG00000012638 9.330715377 12.77125769 5.890173066 0.461205404 0.5247398 100526411 10.15565475 13.68385182 6.627457693 0.484326912 0.5247398 ENSBTAG00000033562 438.142167 524.3167488 351.9675852 0.671288083 0.5247398 ENSBTAG00000010661 696.7357622 539.5662957 853.9052288 1.582577036 0.5247398 ENSBTAG00000000828 9.171262226 5.139936728 13.20258772 2.568628452 0.5248527 100298738 3.496672977 5.459549582 1.533796373 0.280938262 0.5249173 ENSBTAG00000001385 210.9086986 259.1542075 162.6631897 0.627669492 0.5249173 ENSBTAG00000034787 676.4393291 599.7629101 753.115748 1.255689099 0.5249173 ENSBTAG00000013422 207.2105564 245.0703366 169.3507762 0.691029272 0.525224 ENSBTAG00000010386 10940.4332 9121.005095 12759.86131 1.398953424 0.525224 ENSBTAG00000016915 12.8928071 7.765820502 18.0197937 2.320397915 0.525224 ENSBTAG00000021557 4.221463888 2.005932229 6.436995546 3.208979572 0.525224 787968 3.84417112 5.575262349 2.113079891 0.379009948 0.5261724 ENSBTAG00000009449 11.63063117 6.499434533 16.76182781 2.578967096 0.5261724 506776 7.12628179 9.756847906 4.495715673 0.460775418 0.5262209 789390 4.1902758 1.748023813 6.632527786 3.79430059 0.5262209 ENSBTAG00000000660 308.7374266 242.9057739 374.5690792 1.542034482 0.5262974 ENSBTAG00000003682 26.58562366 34.83221067 18.33903665 0.52649649 0.526997 ENSBTAG00000031572 16.2321771 21.05296281 11.41139139 0.542032563 0.5270217 ENSBTAG00000007910 62.29460968 44.28636789 80.30285147 1.813263433 0.5273405 ENSBTAG00000010407 3.50744811 5.009319136 2.005577085 0.400369198 0.5279476 ENSBTAG00000013179 171.928509 208.7497902 135.1072279 0.647220904 0.5279476 ENSBTAG00000018025 253.127498 307.3382399 198.9167561 0.647224231 0.5279476 ENSBTAG00000011376 108.6033784 80.6451743 136.5615825 1.69336335 0.5279476 ENSBTAG00000000808 59.83532916 38.7382114 80.93244692 2.08921486 0.5287373 ENSBTAG00000037363 20.66353947 25.56234472 15.76473422 0.616717065 0.5287518 ENSBTAG00000008355 52.58796963 61.54405475 43.63188451 0.708953687 0.5288553 ENSBTAG00000021218 3.724753386 4.805419051 2.644087722 0.550230416 0.5288657 ENSBTAG00000030557 946.2097276 1118.596783 773.8226727 0.691779813 0.5296595 ENSBTAG00000000233 3.742664978 5.709761891 1.775568066 0.310970597 0.5297031 100298850 18.31868475 23.97572292 12.66164658 0.528102807 0.5297031 787451 74.24264132 95.73135663 52.75392602 0.551062138 0.5297031 ENSBTAG00000018379 53.28167983 63.95716418 42.60619548 0.666167677 0.5297031 100297344 2163.451238 1792.434302 2534.468175 1.413981071 0.5297031 ENSBTAG00000000742 36.55956622 22.40136995 50.71776249 2.26404736 0.5297031 ENSBTAG00000018905 10.40508595 5.525135968 15.28503594 2.76645426 0.5297031 ENSBTAG00000040017 3.732345031 5.286501715 2.178188347 0.412028306 0.5298073 100299981 9.860573477 12.91012657 6.811020386 0.52757193 0.5298073 ENSBTAG00000002497 8.904328489 5.501979856 12.30667712 2.236772479 0.5298073 504739 17.61748052 24.11361703 11.121344 0.461205965 0.5298875 ENSBTAG00000042916 3.719216217 5.544410131 1.894022303 0.341609343 0.5300505 ENSBTAG00000003975 82.27931016 61.95892805 102.5996923 1.655930719 0.5300505 ENSBTAG00000001912 37.95249574 24.86578391 51.03920756 2.052587915 0.5300505 ENSBTAG00000008726 3.352911989 5.201641165 1.504182813 0.28917466 0.5302104 ENSBTAG00000014911 10.01684603 13.99139922 6.042292838 0.431857653 0.5302104 783432 5.068500568 7.015251366 3.121749771 0.444994713 0.5302104 ENSBTAG00000004189 5.853394681 7.977971875 3.728817487 0.467389149 0.5302104 ENSBTAG00000020223 36.7697012 47.26506873 26.27433367 0.555893271 0.5302104 ENSBTAG00000038689 11.48588946 14.71985482 8.251924106 0.560598199 0.5302104 ENSBTAG00000024801 34.4236984 43.16938629 25.67801051 0.594819911 0.5302104 ENSBTAG00000001514 167.052501 131.0461799 203.058822 1.549521109 0.5302104

PAGE 80

ENSBTAG00000018291 398.1189294 308.9652283 487.2726306 1.577111552 0.5302104 ENSBTAG00000016810 8.854050857 5.182367003 12.52573471 2.416991059 0.5302104 ENSBTAG00000019791 9.64351223 5.305775877 13.98124858 2.63509973 0.5302104 ENSBTAG00000007793 25.07516157 13.27993359 36.87038954 2.776398638 0.5302104 ENSBTAG00000009125 8.82138887 4.181585557 13.46119218 3.219159814 0.5302104 ENSBTAG00000024525 0.868791905 1.501693453 0.235890356 0.157082896 0.5320764 ENSBTAG00000024759 0.868791905 1.501693453 0.235890356 0.157082896 0.5320764 ENSBTAG00000035763 3.638242346 5.317353933 1.959130758 0.368440917 0.5320764 286813 12.92818982 17.72656849 8.129811145 0.458622951 0.5320764 788199 3.989088122 5.406096432 2.572079811 0.475773942 0.5320764 784893 13.92165729 17.56898063 10.27433396 0.584799663 0.5320764 ENSBTAG00000003708 6771.86609 7600.014923 5943.717258 0.782066525 0.5320764 ENSBTAG00000017040 753.3761945 596.9474795 909.8049094 1.524095403 0.5320764 100138651 291.2505477 227.3736455 355.1274499 1.561867248 0.5320764 ENSBTAG00000002199 3.285828023 1.189776707 5.38187934 4.523436465 0.5320764 ENSBTAG00000033344 3.311881584 1.158924488 5.464838681 4.715439821 0.5320764 ENSBTAG00000015880 20.7615162 26.98299178 14.54004061 0.538859469 0.5321137 783057 1428.101479 1666.11908 1190.083879 0.714285007 0.5322356 ENSBTAG00000013402 4.420708402 1.790454088 7.050962717 3.938086301 0.5322914 ENSBTAG00000037750 6.391715613 9.379344773 3.404086453 0.362934356 0.5322962 616730 232.455327 286.9179977 177.9926562 0.620360722 0.5323904 510877 3.600417812 4.805419051 2.395416574 0.498482348 0.5324644 790042 187.4586859 132.2132922 242.7040796 1.835701052 0.5324644 ENSBTAG00000034373 24.58099964 14.75458899 34.40741029 2.331980262 0.5324644 ENSBTAG00000007357 26.54263538 33.88259817 19.20267259 0.566741443 0.5334079 ENSBTAG00000017666 219.0080817 161.9436271 276.0725363 1.704744677 0.5334448 513836 0.883598684 1.501693453 0.265503915 0.176803005 0.5339549 ENSBTAG00000022466 0.883598684 1.501693453 0.265503915 0.176803005 0.5339549 785548 6.827714861 8.898262109 4.757167613 0.534617609 0.5339549 541019 149.2415421 174.9651649 123.5179193 0.705957208 0.5339549 ENSBTAG00000005183 26.2959457 17.88471154 34.70717986 1.940606075 0.5339549 791061 12.79821762 18.00756523 7.588870002 0.421426767 0.5339807 ENSBTAG00000006536 126.10861 151.9092576 100.3079624 0.660315006 0.5339807 ENSBTAG00000006888 7.747142268 3.550055957 11.94422858 3.364518397 0.5339807 ENSBTAG00000006360 8.825681843 12.03947533 5.611888359 0.466123997 0.5341246 ENSBTAG00000000221 2487.305678 2971.008258 2003.603098 0.674384897 0.5341246 ENSBTAG00000017291 28.99881759 18.48927087 39.50836431 2.136826519 0.5341342 ENSBTAG00000019386 9.338350565 5.790740491 12.88596064 2.225269922 0.5341342 ENSBTAG00000017187 31.76302932 39.04229645 24.4837622 0.62710866 0.5352222 ENSBTAG00000017763 1078.670192 1280.97866 876.3617234 0.684134522 0.5353736 ENSBTAG00000033359 3.218719818 4.654972115 1.782467521 0.382916906 0.5354097 ENSBTAG00000006023 16.87561261 11.29272035 22.45850487 1.9887595 0.5354705 ENSBTAG00000017771 5.65991925 2.317848976 9.001989525 3.883768795 0.5354705 ENSBTAG00000006835 167.9218506 203.7515111 132.0921902 0.64830042 0.5360887 ENSBTAG00000002643 19.12372978 23.14091621 15.10654334 0.652806622 0.536278 615431 630.9598484 755.2774901 506.6422067 0.670802736 0.536278 ENSBTAG00000016943 22.56695256 15.15469305 29.97921206 1.978213083 0.5365481 ENSBTAG00000016807 1.652861278 2.945496626 0.36022593 0.12229718 0.5368674 ENSBTAG00000036124 160.1847911 188.2889188 132.0806634 0.701478686 0.5372745 541196 3373.198233 2824.06572 3922.330746 1.388894996 0.5376303 ENSBTAG00000015385 233.5708437 285.4680961 181.6735913 0.636405937 0.5381351 ENSBTAG00000021157 5.554365717 2.864518027 8.244213407 2.878045566 0.5381787

PAGE 81

ENSBTAG00000016341 3271.699103 3749.19106 2794.207145 0.745282676 0.5384832 ENSBTAG00000015655 101.396906 118.8282491 83.96556288 0.706612809 0.5385031 ENSBTAG00000011075 914.7522569 718.5244026 1110.980111 1.546196771 0.5386402 ENSBTAG00000004106 66.68797072 49.46048361 83.91545783 1.696616202 0.5386402 100271685 40.89647418 52.19382886 29.59911951 0.567099984 0.5387992 287007 5.088618891 1.759601869 8.417635913 4.783829831 0.5387992 ENSBTAG00000037603 1.605500271 2.945496626 0.265503915 0.09013893 0.5393038 ENSBTAG00000021905 1.60658295 2.852939971 0.36022593 0.126264812 0.5393038 504789 1.590693491 2.945496626 0.235890356 0.080085088 0.5401887 ENSBTAG00000004217 1.590693491 2.945496626 0.235890356 0.080085088 0.5401887 ENSBTAG00000010255 618.7904467 730.725237 506.8556563 0.693633709 0.5401887 527553 3787.517346 4263.554876 3311.479816 0.776694545 0.5402981 535235 616.8284248 699.1959257 534.4609239 0.764393647 0.5404537 ENSBTAG00000017312 1.575267382 2.914644408 0.235890356 0.080932808 0.5404972 ENSBTAG00000001416 1.575730732 2.791235534 0.36022593 0.129056085 0.5404972 ENSBTAG00000039983 0.930959692 1.501693453 0.36022593 0.239879803 0.5404972 100336294 6.08690954 8.740119067 3.433700012 0.392866503 0.5404972 ENSBTAG00000007828 724.976309 837.882958 612.0696599 0.730495416 0.5404972 786875 5.427732848 2.575757392 8.279708303 3.214475217 0.5404972 ENSBTAG00000019039 2.886895221 0.901016072 4.87277437 5.408088181 0.5404972 ENSBTAG00000010125 61.39007129 74.54950956 48.23063302 0.646961104 0.5407243 ENSBTAG00000021073 582.6890035 475.8993963 689.4786107 1.448790682 0.5407243 ENSBTAG00000021743 13.44475584 17.70680694 9.182704737 0.518597439 0.5408183 ENSBTAG00000007191 1.559841273 2.883792189 0.235890356 0.081798667 0.5409064 ENSBTAG00000021769 2677.85344 2237.960293 3117.746588 1.393119707 0.5409064 ENSBTAG00000018286 140.019129 106.4877444 173.5505137 1.629769836 0.5409601 ENSBTAG00000008935 1523.56134 1715.793771 1331.328908 0.775925948 0.5410646 784344 6.035549228 8.513062869 3.558035586 0.417950113 0.5411093 ENSBTAG00000015171 194.5867491 239.1396846 150.0338135 0.627389861 0.5411093 ENSBTAG00000043077 1.544415163 2.852939971 0.235890356 0.082683252 0.5414192 ENSBTAG00000034522 118.9110609 148.2984549 89.52366697 0.603672284 0.5417677 ENSBTAG00000009490 110.1260757 79.0160416 141.2361098 1.787435905 0.5417677 100336087 10.80361401 13.97698179 7.630246236 0.545915159 0.5419178 ENSBTAG00000003511 23.05158144 15.45114979 30.6520131 1.983801433 0.5428095 ENSBTAG00000006861 3.354752017 5.251767546 1.457736487 0.277570642 0.5430135 100336947 17.1260289 21.13831075 13.11374705 0.620378194 0.5430468 ENSBTAG00000022632 62.78068872 43.77055106 81.79082639 1.868626837 0.5430786 ENSBTAG00000010265 309.2975194 369.7885364 248.8065024 0.672834547 0.5434865 784299 4.58048961 6.156665568 3.004313652 0.487977399 0.5439032 ENSBTAG00000007043 7.358893119 9.514399496 5.203386741 0.54689597 0.5444125 100336153 15.08227286 10.79229573 19.37224999 1.795007335 0.5450247 ENSBTAG00000002277 3.014493052 4.335359262 1.693626843 0.390654324 0.5451812 788567 189.0214576 225.4721192 152.570796 0.676672559 0.5451812 ENSBTAG00000001631 203.2721151 238.0206222 168.5236081 0.708021038 0.5451812 ENSBTAG00000035184 1.462202633 2.564179336 0.36022593 0.140483906 0.5456769 ENSBTAG00000001209 93.94976386 118.3434158 69.55611194 0.587748051 0.5459134 ENSBTAG00000023125 1.446313174 2.656735992 0.235890356 0.088789536 0.5460478 ENSBTAG00000033601 1.415460955 2.595031555 0.235890356 0.090900766 0.5460478 ENSBTAG00000044011 1.415460955 2.595031555 0.235890356 0.090900766 0.5460478 617754 1.445693844 2.625883773 0.265503915 0.101110307 0.5460478 ENSBTAG00000038904 1.445693844 2.625883773 0.265503915 0.101110307 0.5460478 ENSBTAG00000013015 1.399415516 2.533327118 0.265503915 0.104804434 0.5460478

PAGE 82

100313169 1.013172222 1.790454088 0.235890356 0.1317489 0.5460478 ENSBTAG00000015396 1.013172222 1.790454088 0.235890356 0.1317489 0.5460478 ENSBTAG00000022205 1.013172222 1.790454088 0.235890356 0.1317489 0.5460478 ENSBTAG00000030920 1.013172222 1.790454088 0.235890356 0.1317489 0.5460478 ENSBTAG00000005736 1.012552892 1.759601869 0.265503915 0.15088863 0.5460478 ENSBTAG00000026220 1.012552892 1.759601869 0.265503915 0.15088863 0.5460478 ENSBTAG00000033187 1.012552892 1.759601869 0.265503915 0.15088863 0.5460478 540532 5.811147999 8.335645664 3.286650334 0.394288633 0.5460478 ENSBTAG00000038888 5.861555351 8.224302235 3.498808468 0.425423138 0.5460478 100138267 5.80423207 7.788976614 3.819487526 0.490370907 0.5460478 ENSBTAG00000000591 44.47252585 56.9837879 31.9612638 0.560883454 0.5460478 ENSBTAG00000042898 55.01751947 70.38511303 39.64992591 0.563328298 0.5460478 100301104 12.66373295 15.94436569 9.383100197 0.588490027 0.5460478 100336707 224.6555125 280.2161252 169.0948998 0.603444572 0.5460478 ENSBTAG00000017844 217.7369764 269.8904269 165.5835259 0.613521301 0.5460478 100336332 23.50335916 28.99280596 18.01391236 0.621323524 0.5460478 ENSBTAG00000001908 4306.390037 3707.66299 4905.117084 1.322967351 0.5460478 ENSBTAG00000009665 1162.383155 947.0705594 1377.695751 1.454691773 0.5460478 ENSBTAG00000011444 928.421832 739.9778548 1116.865809 1.509323289 0.5460478 100337062 335.5122877 263.2290395 407.7955359 1.549204209 0.5460478 ENSBTAG00000015666 180.7382213 131.988588 229.4878546 1.738694671 0.5460478 ENSBTAG00000016192 14.98664373 9.926013824 20.04727364 2.019670131 0.5460478 ENSBTAG00000020202 13.26240239 7.358020331 19.16678444 2.604883322 0.5460478 618226 17.36974228 23.2974615 11.44202306 0.491127459 0.5461208 538960 1.384608737 2.533327118 0.235890356 0.093114843 0.5466322 509061 1.027979002 1.790454088 0.265503915 0.148288592 0.5467742 ENSBTAG00000015127 110.9811037 79.29371156 142.6684958 1.799240987 0.5467742 ENSBTAG00000027696 112.9653809 138.8318976 87.09886421 0.627369255 0.5470748 ENSBTAG00000032674 72.85493848 88.27523647 57.43464049 0.650631398 0.5470748 ENSBTAG00000013607 6800.703226 5377.795764 8223.610688 1.529178691 0.5470748 519016 1.348674534 2.337123139 0.36022593 0.1541322 0.5473481 ENSBTAG00000013044 1.333248425 2.30627092 0.36022593 0.156194108 0.5473481 100296560 1.0599139 1.759601869 0.36022593 0.204720134 0.5473481 ENSBTAG00000019031 1.0599139 1.759601869 0.36022593 0.204720134 0.5473481 100138505 3.162391362 4.932154693 1.392628031 0.282356925 0.5473481 ENSBTAG00000006499 10.22447223 13.29920776 7.149736707 0.537606212 0.5473481 ENSBTAG00000010778 161.7447659 197.8062255 125.6833064 0.635386 0.5473481 512796 240.6818909 286.271716 195.0920658 0.681492634 0.5473481 ENSBTAG00000011761 345.8631584 262.8484808 428.877836 1.631654232 0.5473481 ENSBTAG00000018749 177.1656775 131.5242919 222.8070631 1.694037351 0.5473481 ENSBTAG00000016513 26.68868434 19.1434014 34.23396728 1.788290731 0.5473481 ENSBTAG00000031462 36.11149758 25.80381835 46.41917681 1.798926662 0.5473481 511220 66.77874849 47.49753683 86.05996015 1.811882592 0.5473481 537256 1.301932857 2.367975357 0.235890356 0.099616896 0.5473501 787120 1.286506747 2.337123139 0.235890356 0.100931933 0.5473501 ENSBTAG00000038544 1.271080638 2.30627092 0.235890356 0.102282153 0.5473501 100336226 1.301313527 2.337123139 0.265503915 0.113602878 0.5473501 ENSBTAG00000040318 1.270461308 2.275418702 0.265503915 0.116683543 0.5473501 ENSBTAG00000017045 1.126700321 2.017510285 0.235890356 0.116921513 0.5473501 ENSBTAG00000020800 1.126700321 2.017510285 0.235890356 0.116921513 0.5473501 ENSBTAG00000023369 1.126700321 2.017510285 0.235890356 0.116921513 0.5473501 ENSBTAG00000024137 1.126700321 2.017510285 0.235890356 0.116921513 0.5473501

PAGE 83

ENSBTAG00000027328 1.172359319 2.079214723 0.265503915 0.127694322 0.5473501 ENSBTAG00000039935 1.188868108 2.017510285 0.36022593 0.178549737 0.5473501 616198 2.842209483 4.527681291 1.156737675 0.25548125 0.5473501 100313418 3.132777803 4.932154693 1.333400913 0.270348559 0.5473501 521180 3.132158474 4.901302475 1.363014472 0.278092299 0.5473501 ENSBTAG00000013763 4.864282101 7.238425613 2.490138588 0.344016603 0.5473501 ENSBTAG00000027118 5.664007037 7.881533269 3.446480804 0.437285575 0.5473501 ENSBTAG00000011111 11.78813408 15.25113166 8.325136512 0.545870084 0.5473501 ENSBTAG00000040425 16.4679919 20.92664677 12.00933703 0.573877753 0.5473501 784438 6.942951051 8.701570742 5.18433136 0.595792589 0.5473501 785630 1004.863107 1194.942539 814.7836744 0.681860129 0.5473501 ENSBTAG00000019782 1586.971929 1875.852609 1298.091248 0.692000663 0.5473501 ENSBTAG00000001638 135.3348068 158.442939 112.2266746 0.708309726 0.5473501 ENSBTAG00000005565 954.8487461 1092.088246 817.6092464 0.748665916 0.5473501 ENSBTAG00000016278 2434.399552 2056.401849 2812.397255 1.367630192 0.5473501 ENSBTAG00000005524 2379.551788 1976.500642 2782.602934 1.407843173 0.5473501 ENSBTAG00000001895 123.0252146 97.34980542 148.7006237 1.527487632 0.5473501 ENSBTAG00000005102 272.4796121 206.6438935 338.3153307 1.637190071 0.5473501 ENSBTAG00000006043 33.66814095 21.84644961 45.48983229 2.082252864 0.5473501 100298021 18.76408992 10.7041762 26.82400363 2.505938161 0.5473501 ENSBTAG00000015139 2.855619291 1.178198651 4.533039931 3.847432629 0.5473501 517883 2.879994886 0.889438016 4.870551757 5.475987837 0.5473501 535868 0.840423025 0 1.680846051 NA 0.5473501 ENSBTAG00000043098 0.840423025 0 1.680846051 NA 0.5473501 353348 4.376238801 6.156665568 2.595812033 0.421626285 0.5477311 ENSBTAG00000007172 1882.927327 1500.695277 2265.159376 1.509406613 0.5478154 514809 13.3639158 8.231998341 18.49583326 2.246821791 0.5478154 ENSBTAG00000010932 36.53646401 44.82485345 28.24807458 0.630187773 0.5479967 ENSBTAG00000032050 5.59554265 7.365716437 3.825368863 0.519347832 0.5483276 ENSBTAG00000004011 65.8588936 50.63910185 81.07868535 1.601108282 0.5483276 511168 12.48484289 8.716962955 16.25272284 1.864493737 0.5483276 ENSBTAG00000039861 3.034056484 4.705098496 1.363014472 0.289688829 0.5489184 616864 5.574986336 8.04688503 3.103087642 0.385625945 0.5489184 504647 30.24463125 37.79081531 22.6984472 0.600633964 0.5489184 ENSBTAG00000004038 82.42114783 102.0326548 62.80964087 0.615583717 0.5489184 ENSBTAG00000020563 78.68082634 89.51354613 67.84810656 0.757964682 0.5489184 ENSBTAG00000014936 1033.305943 849.8694333 1216.742453 1.431681627 0.5489184 530874 17.43517077 10.9234685 23.94687303 2.192240773 0.5489184 ENSBTAG00000008684 2.635942372 1.147346432 4.124538313 3.594849993 0.5489184 100337149 2.657996629 0.889438016 4.426555242 4.97680014 0.5489184 ENSBTAG00000023146 21.72651911 15.26215453 28.1908837 1.847110357 0.5490657 100139151 3.018630375 4.674246277 1.363014472 0.291600911 0.5493328 ENSBTAG00000014058 979.2942796 1113.883908 844.704651 0.758341731 0.5493328 ENSBTAG00000018045 23.03462518 14.39254586 31.6767045 2.200910444 0.5493328 ENSBTAG00000024534 507.680945 592.5880572 422.7738328 0.713436303 0.5494464 ENSBTAG00000015800 5.545372776 8.04688503 3.043860523 0.378265691 0.5495045 528533 2.568536622 0.858585797 4.278487446 4.983179851 0.549575 ENSBTAG00000006277 0.855229805 0 1.71045961 NA 0.5500138 ENSBTAG00000008892 2.988397486 4.643394059 1.333400913 0.287160835 0.5504834 ENSBTAG00000038155 2.987778156 4.61254184 1.363014472 0.295501812 0.5504834 ENSBTAG00000002733 14.47471525 19.16655751 9.782872999 0.510413672 0.5504834 ENSBTAG00000000372 1737.023584 2078.088816 1395.958353 0.671751054 0.5504834

PAGE 84

100336691 30.04992239 20.66388163 39.43596315 1.908448948 0.5505839 ENSBTAG00000030669 4.216497232 2.005932229 6.427062234 3.204027603 0.5507746 ENSBTAG00000003957 31.39607931 19.84439933 42.94775929 2.164225712 0.5508458 531254 34.511126 44.13973511 24.88251688 0.563721482 0.5510281 533199 929.5346823 789.4836929 1069.585672 1.354791342 0.5510281 507661 840.2110483 1011.187769 669.2343277 0.661829927 0.5510725 ENSBTAG00000018269 82.47612564 100.8193702 64.13288111 0.636116661 0.551074 ENSBTAG00000013810 4.56030164 7.049917741 2.07068554 0.293717688 0.5512115 508115 15.59452532 18.68603003 12.50302061 0.669110592 0.5512115 ENSBTAG00000014492 85.62523981 62.99444367 108.256036 1.718501342 0.5512115 ENSBTAG00000012959 382.6476067 453.8075739 311.4876394 0.686387044 0.5513509 ENSBTAG00000000470 23.71929964 29.01984402 18.41875526 0.634695185 0.5513543 525040 15.99240628 20.54096014 11.44385242 0.55712354 0.5513551 ENSBTAG00000019793 28.10902047 36.41925206 19.79878887 0.543635241 0.551568 ENSBTAG00000008634 45.58219186 31.45340577 59.71097796 1.898394673 0.551568 ENSBTAG00000015811 47.42846644 56.71929374 38.13763914 0.672392701 0.5520304 788103 26.91857709 33.17876085 20.65839333 0.622639086 0.5520472 ENSBTAG00000019539 2.330053619 0.600677381 4.059429857 6.758086759 0.5523432 ENSBTAG00000005461 5.445568778 7.912385488 2.978752068 0.376467005 0.5525143 ENSBTAG00000034437 0.870036585 0 1.740073169 NA 0.5525143 ENSBTAG00000018421 34.37194453 21.55436221 47.18952684 2.189326058 0.5525802 ENSBTAG00000000415 719.7280971 591.7836744 847.6725198 1.432402678 0.5527882 528380 81.50886773 62.36617304 100.6515624 1.613880691 0.553283 ENSBTAG00000035174 718.1530764 824.2212447 612.0849081 0.742622096 0.5536939 ENSBTAG00000011321 10.42647103 7.238425613 13.61451645 1.88086708 0.5536939 539842 2.648170863 3.950160022 1.346181705 0.340791689 0.5541083 ENSBTAG00000039997 8.589634153 12.18215836 4.997109944 0.410199063 0.5541083 ENSBTAG00000009457 5.555616294 7.412028661 3.699203927 0.499081169 0.5541083 ENSBTAG00000020898 28.66596551 36.89361339 20.43831763 0.553979829 0.5541083 100313446 231.5527852 277.3055661 185.8000042 0.670019022 0.5541083 ENSBTAG00000009129 445.78329 533.3891391 358.1774409 0.671512437 0.5541083 ENSBTAG00000037393 4630.172604 5220.384318 4039.96089 0.773881891 0.5541083 ENSBTAG00000020630 5671.80104 4695.360281 6648.2418 1.415917289 0.5541083 ENSBTAG00000003745 459.7281127 378.7081535 540.7480718 1.427875441 0.5541083 ENSBTAG00000021421 1343.533988 1083.059345 1604.008632 1.480997916 0.5541083 ENSBTAG00000040173 152.4523455 118.3112542 186.5934368 1.577140215 0.5541083 ENSBTAG00000039513 184.0365414 138.6401307 229.4329521 1.654881245 0.5541083 ENSBTAG00000003692 251.9937313 180.4838679 323.5035948 1.79242388 0.5541083 ENSBTAG00000001711 60.56619256 40.97452659 80.15785853 1.956285165 0.5541083 525618 4.00530645 1.778876032 6.231736867 3.503187831 0.5541083 790739 1.462373083 0.300338691 2.624407475 8.738159805 0.5541083 ENSBTAG00000006676 33.46102953 42.40280197 24.51925709 0.578246153 0.5546396 100336575 92.45238436 108.5935775 76.31119117 0.702722876 0.5546396 ENSBTAG00000019445 228.6199138 172.6629921 284.5768355 1.648163466 0.5546396 100336976 48.66941952 33.89029428 63.44854476 1.872174501 0.5546396 ENSBTAG00000039782 194.8124755 152.3571189 237.2678321 1.557313723 0.5547337 529148 1340.941143 1109.322069 1572.560218 1.417586707 0.5547451 ENSBTAG00000008840 113.5080228 80.86050401 146.1555416 1.807502234 0.5549708 786299 0.887784033 0 1.775568066 NA 0.5549708 ENSBTAG00000009396 131.1958167 165.258439 97.13319435 0.587765411 0.5550126 518833 32.33122115 23.65901724 41.00342506 1.733099251 0.5550126 ENSBTAG00000013670 16.80933524 11.03481193 22.58385856 2.046601129 0.5550487

PAGE 85

782561 3.940841367 1.490115397 6.391567337 4.289310311 0.5550751 ENSBTAG00000014119 1452.895266 1201.984906 1703.805627 1.417493363 0.5552148 ENSBTAG00000021611 1190.312184 1426.628876 953.9954924 0.668706142 0.5555893 ENSBTAG00000010948 2379.483826 2750.580789 2008.386862 0.730168287 0.5555893 532834 135.9653477 99.0334888 172.8972065 1.745845861 0.5555893 521976 11.20502074 7.195995339 15.21404614 2.11423791 0.5555893 ENSBTAG00000006855 213.7927741 268.9258925 158.6596558 0.589975381 0.5556389 ENSBTAG00000007797 120.7012955 95.90544707 145.4971439 1.51708947 0.5556389 ENSBTAG00000001805 204.2561896 158.1884251 250.323954 1.58244166 0.5563945 ENSBTAG00000012261 803.2188398 906.6662476 699.771432 0.771807083 0.5563991 ENSBTAG00000042484 4.445328599 6.341291491 2.549365707 0.402026261 0.5564944 ENSBTAG00000020371 21.21501978 13.00656517 29.42347439 2.262201742 0.5564944 ENSBTAG00000008539 1.583767988 0.300338691 2.867197286 9.546546531 0.5564944 ENSBTAG00000017655 24.3102826 32.31185598 16.30870922 0.504728334 0.5567013 ENSBTAG00000003036 4.365024361 6.410692035 2.319356688 0.361795057 0.5567284 ENSBTAG00000019757 4404.800727 3584.289951 5225.311504 1.457837278 0.5567284 ENSBTAG00000003037 43.62682542 31.15688123 56.09676961 1.800461644 0.5567284 ENSBTAG00000033892 6.67804132 3.218865048 10.13721759 3.149314258 0.5567284 ENSBTAG00000031852 1.616322216 0.300338691 2.932305741 9.763329975 0.5567284 ENSBTAG00000024582 0.902590812 0 1.805181625 NA 0.5567284 ENSBTAG00000038785 8.271259276 4.435612024 12.10690653 2.729478246 0.557141 ENSBTAG00000003675 6.349184731 8.763275179 3.935094283 0.449043788 0.5574092 ENSBTAG00000020499 118.3742444 136.4345999 100.313889 0.735252561 0.5574496 ENSBTAG00000007386 731.1331666 891.622347 570.6439862 0.640006375 0.5575172 ENSBTAG00000015856 308.0220531 359.9218579 256.1222483 0.711605152 0.5575172 ENSBTAG00000012015 6.423580758 9.544696534 3.302464983 0.345999998 0.5575851 ENSBTAG00000003865 54.45351061 70.29679012 38.6102311 0.549246004 0.5575851 ENSBTAG00000025812 13.86973154 17.43836304 10.30110004 0.590714852 0.5575851 ENSBTAG00000019220 1008.433201 1157.307486 859.5589168 0.742723025 0.5575851 ENSBTAG00000031851 982.8293806 1123.74367 841.9150914 0.749205636 0.5575851 ENSBTAG00000027201 477.7496676 382.0540932 573.4452421 1.500953013 0.5575851 509483 39.08049986 27.82902475 50.33197498 1.808614403 0.5575851 100335619 1.724588307 0.558247107 2.890929508 5.178583951 0.5575851 782654 30.01443922 39.71084442 20.31803403 0.511649509 0.5576803 ENSBTAG00000019604 940.2812156 749.5333245 1131.029107 1.508977746 0.5576803 100336177 1.777830652 0.558247107 2.997414197 5.369332255 0.5576803 ENSBTAG00000010273 1.789696763 0.558247107 3.021146419 5.411844293 0.5576803 ENSBTAG00000018642 1.789696763 0.558247107 3.021146419 5.411844293 0.5576803 508045 89.54458911 111.4712671 67.61791116 0.606594981 0.5578546 529961 6.293205785 8.278310565 4.308101005 0.520408237 0.5580908 ENSBTAG00000016593 1.993947572 0.558247107 3.429648037 6.143601992 0.5581189 ENSBTAG00000011820 0.917397592 0 1.834795184 NA 0.5583235 ENSBTAG00000044212 0.917397592 0 1.834795184 NA 0.5583235 615653 3.196101604 4.50508036 1.887122848 0.418887722 0.5583454 ENSBTAG00000019868 115.9743051 138.2549315 93.69367873 0.677687788 0.5584959 ENSBTAG00000002335 255.5343338 302.3981351 208.6705325 0.690052313 0.5584974 100335605 187.5165156 221.7680861 153.264945 0.691104602 0.5589129 515823 10.67299892 5.340510045 16.0054878 2.996996104 0.5590677 ENSBTAG00000021944 8765.489835 7524.933255 10006.04642 1.329718959 0.5590881 ENSBTAG00000015961 758.8547386 873.5695929 644.1398843 0.737365276 0.5593086 ENSBTAG00000011787 54.92461661 38.58000056 71.26923265 1.847310306 0.5593086 613439 82.37591739 105.0398387 59.71199608 0.56846999 0.559841

PAGE 86

ENSBTAG00000007689 8.397943132 12.15900225 4.636884014 0.381353989 0.5603486 ENSBTAG00000001444 49.18290237 62.77834255 35.58746219 0.566874829 0.5603486 ENSBTAG00000033351 77.03405187 95.2864703 58.78163344 0.616893807 0.5603486 ENSBTAG00000006040 524.367917 645.4477172 403.2881167 0.624819185 0.5603486 ENSBTAG00000005835 338.4527813 399.630969 277.2745936 0.693826593 0.5603486 ENSBTAG00000010601 382.1415498 286.3178163 477.9652833 1.669352223 0.5603486 ENSBTAG00000000713 0.932204372 0 1.864408743 NA 0.5603486 ENSBTAG00000004952 0.932204372 0 1.864408743 NA 0.5603486 ENSBTAG00000042717 0.932204372 0 1.864408743 NA 0.5603486 ENSBTAG00000020500 49.01434328 66.11083523 31.91785133 0.482793043 0.5603855 506790 131.1169677 162.4314439 99.80249139 0.614428395 0.5611149 ENSBTAG00000011981 613.5524377 513.7698421 713.3350333 1.388433059 0.5614208 ENSBTAG00000019044 56.14496229 38.38046981 73.90945477 1.925704796 0.5614208 ENSBTAG00000018246 27.29665783 17.73045044 36.86286522 2.079070994 0.5614208 ENSBTAG00000033137 7.129810845 3.507625683 10.75199601 3.065320242 0.5614708 ENSBTAG00000042607 10.99760334 14.56940788 7.425798801 0.509684324 0.5621292 ENSBTAG00000009488 437.8595653 519.1638268 356.5553038 0.686787648 0.5621367 ENSBTAG00000042902 2.570063314 3.777112155 1.363014472 0.36086153 0.5622234 ENSBTAG00000007321 683.8874659 796.2223718 571.55256 0.71783032 0.5622993 ENSBTAG00000011110 5.765651063 8.066159192 3.465142933 0.429590199 0.5623558 ENSBTAG00000002402 1555.88047 1761.372813 1350.388127 0.766667975 0.5624634 540056 0.947011151 0 1.894022303 NA 0.5625273 ENSBTAG00000042409 0.947011151 0 1.894022303 NA 0.5625273 ENSBTAG00000009427 125.7890057 153.6819504 97.89606105 0.637004286 0.5625622 ENSBTAG00000002304 1618.225662 1361.711953 1874.739371 1.376751791 0.5628817 282146 292.6551814 229.7355225 355.5748403 1.547757336 0.5628817 ENSBTAG00000005115 122.0141518 91.72220029 152.3061033 1.660515151 0.5628817 ENSBTAG00000014619 6.220864345 3.238139211 9.20358948 2.842246389 0.5628817 ENSBTAG00000011185 40.94438994 55.36964066 26.51913922 0.478947288 0.5629343 782047 21.0449862 26.57858617 15.51138623 0.583604641 0.5629343 ENSBTAG00000002008 17.86100442 10.88492018 24.83708867 2.281788775 0.5629343 786046 19.60359146 25.68859297 13.51858994 0.52624875 0.5629797 514354 34.85271268 44.49310736 25.21231801 0.566656714 0.5629797 ENSBTAG00000000156 177.5980473 133.158955 222.0371396 1.667459313 0.5629797 ENSBTAG00000008886 7.210466423 9.918317717 4.502615128 0.45396964 0.5635561 ENSBTAG00000000125 239.2913373 285.8229984 192.7596762 0.674402261 0.5635561 ENSBTAG00000007932 17.79403798 10.79236352 24.79571244 2.297523836 0.5635561 ENSBTAG00000037250 14.26797998 18.57357623 9.962383716 0.536374018 0.5636754 506181 0.961817931 0 1.923635862 NA 0.5642777 ENSBTAG00000019461 281.0872352 328.5295507 233.6449197 0.711183877 0.5643978 ENSBTAG00000030631 2.488470113 3.519203739 1.457736487 0.414223386 0.5645486 ENSBTAG00000031934 17.03843726 22.85492717 11.22194736 0.491007793 0.5645486 ENSBTAG00000017737 48.38493664 62.47709688 34.29277641 0.548885562 0.5645486 ENSBTAG00000005150 29.82199425 36.72444747 22.91954102 0.624094918 0.5645486 ENSBTAG00000002623 53.79761464 63.46984757 44.1253817 0.695218019 0.5645486 ENSBTAG00000016637 1817.35142 1476.857953 2157.844886 1.461105235 0.5645486 ENSBTAG00000021997 1299.328952 1029.825067 1568.832837 1.523397407 0.5645486 ENSBTAG00000000172 16.83765464 11.08112416 22.59418512 2.038979512 0.5645486 617720 144.8057608 110.0069481 179.6045735 1.632665723 0.5651559 ENSBTAG00000016894 369.0835157 293.6106655 444.5563659 1.514101557 0.56544 ENSBTAG00000015731 1373.829011 1149.961149 1597.696873 1.389348566 0.565465 784799 22.56961199 29.47388862 15.66533537 0.531498764 0.5656087

PAGE 87

ENSBTAG00000015155 623.4975496 755.5167087 491.4783905 0.650519552 0.5656087 ENSBTAG00000004989 1898.473188 2185.672998 1611.273379 0.737197825 0.5656087 ENSBTAG00000012667 436.7604723 353.6786834 519.8422613 1.469815077 0.5656087 ENSBTAG00000039839 89.27922726 65.97183508 112.5866194 1.706586141 0.5656087 ENSBTAG00000018655 253.5259493 184.5048734 322.5470252 1.748176182 0.5656087 ENSBTAG00000006974 22.80588257 14.5352289 31.07653624 2.13801492 0.5656087 507205 0.979565379 0 1.959130758 NA 0.5656087 ENSBTAG00000001397 0.979565379 0 1.959130758 NA 0.5656087 ENSBTAG00000039451 0.979565379 0 1.959130758 NA 0.5656087 ENSBTAG00000044904 0.979565379 0 1.959130758 NA 0.5656087 ENSBTAG00000016485 9.881200139 13.64911765 6.11328263 0.447888485 0.565678 789347 3.965652253 5.925727421 2.005577085 0.33845247 0.5656782 ENSBTAG00000000320 1054.867029 1238.015013 871.7190454 0.704126393 0.5656782 ENSBTAG00000043140 23.54199926 27.54907058 19.53492794 0.709095717 0.5656782 ENSBTAG00000020015 67.24048871 74.08499726 60.39598016 0.815225517 0.5664557 ENSBTAG00000001764 4.608727366 6.914930811 2.302523921 0.332978591 0.5669144 ENSBTAG00000013569 2769.571006 3248.669082 2290.47293 0.705049629 0.5669144 790309 5.461490579 8.04300308 2.879978078 0.358072482 0.5679738 ENSBTAG00000000875 5.931469889 7.927845494 3.935094283 0.496363645 0.5679738 ENSBTAG00000008636 48.57960107 62.40374659 34.75545555 0.556945014 0.5679738 ENSBTAG00000018253 4237.786561 4752.260422 3723.312701 0.783482463 0.5685447 100336612 2517.548341 3015.852952 2019.243729 0.669543165 0.5689025 ENSBTAG00000030367 11.28116194 14.94302907 7.619294806 0.509889579 0.5696345 407134 2.399637733 4.06199084 0.737284627 0.181508195 0.5703363 ENSBTAG00000004077 7884.175291 9332.044892 6436.305689 0.689699392 0.5703363 518288 1211.856323 1009.171056 1414.541591 1.401686644 0.5703363 ENSBTAG00000032518 87.90221814 67.10988766 108.6945486 1.619650284 0.5703363 ENSBTAG00000008537 1.012119607 0 2.024239214 NA 0.5703363 ENSBTAG00000044060 1.012119607 0 2.024239214 NA 0.5703363 ENSBTAG00000016864 16.5294286 21.36918111 11.68967609 0.54703435 0.5703993 ENSBTAG00000016242 17.33071753 21.83875351 12.82268155 0.587152629 0.5712426 ENSBTAG00000003133 353.3223231 424.994889 281.6497573 0.662713281 0.5712426 ENSBTAG00000019927 105.9324744 81.30616174 130.5587871 1.605767438 0.5712426 100300091 5.407938648 7.415842818 3.400034478 0.458482544 0.5714908 ENSBTAG00000044563 2.363084201 3.834934642 0.89123376 0.232398683 0.5715024 ENSBTAG00000010609 17.97721684 23.65180853 12.30262515 0.52015579 0.5718037 ENSBTAG00000002626 2.347658092 3.804082424 0.89123376 0.234283504 0.5722748 504861 78.90196183 56.26420657 101.5397171 1.80469473 0.5722938 539296 4.438576814 6.698965281 2.178188347 0.325152954 0.5723451 ENSBTAG00000039720 84.66585913 101.4904907 67.8412276 0.668449104 0.5723451 540141 642.6280272 534.7364702 750.5195842 1.403531694 0.5726339 ENSBTAG00000038900 24.07751442 31.4682428 16.68678604 0.530273843 0.5729745 ENSBTAG00000016126 644.0399899 753.3497521 534.7302277 0.709803416 0.5737706 ENSBTAG00000009065 26.4457979 18.15419801 34.73739779 1.913463639 0.5737706 787361 3.90745751 5.567566243 2.247348778 0.403650119 0.5739258 ENSBTAG00000009132 24.18816181 31.46054669 16.91577694 0.537682231 0.5739258 ENSBTAG00000012391 370.8909879 286.0263476 455.7556282 1.593404356 0.5739258 100336687 16.26084464 21.55429442 10.96739487 0.508826439 0.5740646 ENSBTAG00000016082 2.215754917 3.003386907 1.428122928 0.475504147 0.5743358 ENSBTAG00000009704 5.878921221 7.904689381 3.853153061 0.487451546 0.5744452 ENSBTAG00000001578 151.1049958 108.810166 193.3998256 1.77740585 0.5744452 ENSBTAG00000017788 743.0881226 888.8535468 597.3226983 0.672014755 0.5747153

PAGE 88

ENSBTAG00000033731 215.2856319 164.9083979 265.6628659 1.610972329 0.5747153 509875 12.4901987 8.170293904 16.81010349 2.057466193 0.5749307 ENSBTAG00000008933 580.3397118 427.8983072 732.7811163 1.712512305 0.5750011 ENSBTAG00000016824 109.2268805 130.5281467 87.92561438 0.67361421 0.5751075 ENSBTAG00000014395 7.54303773 9.964629942 5.121445518 0.51396244 0.5751999 ENSBTAG00000001004 15.2539824 19.90991793 10.59804687 0.532299877 0.5751999 510497 143.6680822 165.3068407 122.0293238 0.738198874 0.5752313 ENSBTAG00000017957 18.14180458 21.83930869 14.44430048 0.661390005 0.5754316 ENSBTAG00000023601 684.8118053 779.7700125 589.853598 0.756445604 0.5754316 ENSBTAG00000030783 687.710768 572.6158753 802.8056608 1.401996863 0.5754316 ENSBTAG00000035926 442.5562829 365.4472779 519.665288 1.421997972 0.5754316 504970 12.42588514 7.242307563 17.60946272 2.431471263 0.5754316 ENSBTAG00000008260 739.7794784 885.3394203 594.2195365 0.671177091 0.5754718 511514 2.239211977 3.711525768 0.766898186 0.206626125 0.5757587 ENSBTAG00000016496 4.293733147 6.53361352 2.053852773 0.314351739 0.5763932 ENSBTAG00000016186 1.074287394 0 2.148574788 NA 0.5764377 ENSBTAG00000015453 4.277224358 6.595317957 1.959130758 0.29704872 0.5764433 ENSBTAG00000004187 5.218338639 7.261581726 3.175095552 0.437245723 0.5764433 ENSBTAG00000011715 4.079079744 5.621574573 2.536584915 0.451223208 0.5764433 ENSBTAG00000019585 95.24775474 117.8748182 72.62069132 0.616083167 0.5764433 ENSBTAG00000007489 1476.877515 1758.590917 1195.164113 0.679614629 0.5764433 ENSBTAG00000003501 2264.220971 1934.025947 2594.415995 1.341458732 0.5764433 ENSBTAG00000003693 2199.976144 1745.028382 2654.923905 1.521421619 0.5764433 ENSBTAG00000007200 4.476757101 2.079214723 6.87429948 3.306199886 0.5764433 ENSBTAG00000020602 506.9570005 570.7422768 443.1717242 0.776483086 0.5765142 526028 2.189553675 3.422765134 0.956342216 0.279406322 0.5773412 ENSBTAG00000003958 12.63544975 6.972821091 18.29807841 2.624200186 0.5773412 ENSBTAG00000031701 50.47162312 61.82775528 39.11549097 0.632652614 0.5781665 ENSBTAG00000004832 613.1764014 491.4779725 734.8748303 1.49523452 0.578195 ENSBTAG00000007620 13.9724845 18.11564968 9.829319325 0.542587183 0.5783305 ENSBTAG00000015353 9.453564015 11.82067042 7.086457613 0.599497098 0.5788472 ENSBTAG00000027863 276.589909 224.4527672 328.7270508 1.464571165 0.5788472 ENSBTAG00000009598 87.55421437 67.3331297 107.7752991 1.600628094 0.5788472 ENSBTAG00000039870 1.103900953 0 2.207801906 NA 0.5788472 ENSBTAG00000008461 1274.575954 1473.975427 1075.176481 0.729439895 0.5792313 ENSBTAG00000024639 12.13447162 7.500215979 16.76872726 2.235765918 0.5794662 536988 84.85051928 95.09220304 74.60883551 0.784594668 0.5795026 536628 2.723654662 1.116494213 4.33081511 3.878940936 0.5801107 ENSBTAG00000007755 15.92135727 21.16860779 10.67410676 0.504242266 0.5802796 ENSBTAG00000000939 35.20927778 23.64848176 46.7700738 1.977719935 0.5803195 100335689 68.95365307 82.53462236 55.37268377 0.670902491 0.5807407 522338 4771.353575 4016.496393 5526.210757 1.375878432 0.5807407 ENSBTAG00000008802 108.5039513 127.6472617 89.36064101 0.700059209 0.5809529 100336352 125.2268655 90.15194548 160.3017855 1.778128965 0.5809954 ENSBTAG00000016558 25.81906232 30.75296301 20.88516162 0.679126809 0.5810947 ENSBTAG00000034776 42.14421485 51.16718751 33.1212422 0.647314105 0.5811574 ENSBTAG00000038644 1.136455181 0 2.272910362 NA 0.5811574 ENSBTAG00000015043 3.625994656 4.99774108 2.254248233 0.451053425 0.5812256 ENSBTAG00000003754 8.136815929 10.30739891 5.966232952 0.578830121 0.5812256 ENSBTAG00000019370 18.47066215 12.49407511 24.44724918 1.956707397 0.5812256 ENSBTAG00000039031 2.08064421 3.453617352 0.707671068 0.204907202 0.5812384 ENSBTAG00000015644 51.50889565 63.7686563 39.24913499 0.615492583 0.5812384

PAGE 89

ENSBTAG00000010785 444.5930737 519.5501536 369.6359939 0.711453921 0.5819561 ENSBTAG00000022167 673.460295 563.9844593 782.9361307 1.388222881 0.5819561 ENSBTAG00000017989 24.57272827 16.73348315 32.41197339 1.936953179 0.5819561 540907 1.15126196 0 2.302523921 NA 0.5819561 538749 1962.395563 2324.618569 1600.172557 0.688359191 0.5820346 509171 7.413928416 10.48426093 4.343595902 0.414296814 0.582367 540601 48.06033379 59.21684412 36.90382346 0.623198078 0.582367 ENSBTAG00000002430 151.1031185 186.1455799 116.0606571 0.623494026 0.582367 ENSBTAG00000007035 121.2741662 139.9317579 102.6165745 0.733332991 0.582367 ENSBTAG00000027387 5642.881116 6286.468914 4999.293318 0.795246646 0.582367 ENSBTAG00000018085 898.0578636 773.4438171 1022.67191 1.32223167 0.582367 ENSBTAG00000012450 563.4020125 449.0861128 677.7179123 1.509104586 0.582367 ENSBTAG00000001140 72.25807593 52.64856423 91.86758762 1.744921043 0.582367 504422 5.398832414 2.090792779 8.70687205 4.164387853 0.582367 ENSBTAG00000020989 101.0252556 78.09894254 123.9515687 1.587109437 0.5825542 ENSBTAG00000000365 1105.584885 1342.957972 868.2117977 0.646492158 0.5829156 ENSBTAG00000009994 47.3802004 59.74756578 35.01283502 0.586012745 0.583192 ENSBTAG00000014102 2247.356886 2698.901536 1795.812236 0.665386348 0.583192 ENSBTAG00000038897 72.06085194 57.98020001 86.14150388 1.485705532 0.583192 ENSBTAG00000003687 36.91904641 23.52174612 50.31634671 2.139141646 0.5840595 538046 1.981303561 3.195708936 0.766898186 0.239977483 0.5844543 ENSBTAG00000004176 1.198622968 0 2.397245936 NA 0.5844543 ENSBTAG00000016059 1.966496782 3.195708936 0.737284627 0.230710819 0.5848491 ENSBTAG00000008827 1796.296635 2057.487708 1535.105563 0.746106796 0.5848491 533078 4722.315618 4049.938165 5394.693072 1.332043318 0.5848491 ENSBTAG00000032021 306.1366503 237.0367629 375.2365376 1.583030973 0.5848491 ENSBTAG00000033340 56.86043252 70.43198043 43.2888846 0.614619727 0.5856695 ENSBTAG00000017330 66.76374734 51.09612142 82.43137326 1.613260869 0.5859968 ENSBTAG00000007785 18.54257813 24.33346451 12.75169175 0.524039302 0.586053 100337173 1.931025929 2.876096083 0.985955775 0.342810444 0.5863911 100137722 308.6673857 365.1867463 252.1480251 0.690463243 0.5865553 100336606 5.056218131 2.883792189 7.228644072 2.506645277 0.5865997 100139549 1.91451714 2.93780052 0.89123376 0.303367691 0.5869526 ENSBTAG00000007704 372.9797959 440.4778023 305.4817896 0.693523687 0.5871119 ENSBTAG00000022292 2706.370491 3194.551405 2218.189576 0.694366531 0.5871119 510173 22.84251179 14.68130649 31.00371708 2.111781884 0.5871119 510640 1.899710361 2.93780052 0.861620201 0.293287511 0.5871494 ENSBTAG00000009413 1.899710361 2.93780052 0.861620201 0.293287511 0.5871494 ENSBTAG00000015327 117.1686902 83.21454932 151.1228311 1.816062604 0.5871894 407127 69.98612174 49.55262067 90.41962281 1.82471929 0.5871894 100298830 590.5153671 675.4217045 505.6090297 0.748582739 0.5873174 100336231 1680.967897 1869.882823 1492.052971 0.79793929 0.5873174 100337468 1.884903581 2.93780052 0.832006642 0.28320733 0.5873331 ENSBTAG00000011531 2671.282687 2267.179194 3075.38618 1.3564813 0.5873331 ENSBTAG00000020884 19.54271872 25.65385881 13.43157862 0.523569523 0.5874558 ENSBTAG00000002015 76.94699677 97.02242867 56.87156488 0.586169256 0.5874558 783333 1876.460472 1620.676322 2132.244621 1.315651122 0.5874558 788252 51.44336226 63.7531963 39.13352823 0.61382849 0.5875329 ENSBTAG00000040422 2885.642352 3297.832152 2473.452553 0.750023785 0.5875329 ENSBTAG00000019071 772.1896031 622.7482208 921.6309854 1.479941579 0.5875329 ENSBTAG00000043579 252.3881128 288.7413934 216.0348321 0.74819488 0.5876633 531645 16.0067123 21.08374724 10.92967736 0.518393492 0.5877153

PAGE 90

ENSBTAG00000006995 43.41895091 54.13916701 32.6987348 0.60397558 0.5877215 505686 12.7139049 16.37532198 9.052487826 0.552812814 0.5878139 100300832 66.31137449 83.96615671 48.65659227 0.579478616 0.5878139 517040 514.1117528 592.076118 436.1473877 0.736640737 0.5878139 ENSBTAG00000011027 8184.227747 6469.193087 9899.262406 1.530215944 0.5878139 100124405 168.1183775 193.580345 142.6564099 0.736936438 0.5878717 ENSBTAG00000005043 242.9553006 182.9171413 302.9934598 1.656451975 0.5878717 788456 3.227109964 1.189776707 5.264443221 4.42473213 0.5878717 ENSBTAG00000021919 1.822116464 2.906948301 0.737284627 0.253628393 0.5882295 ENSBTAG00000002376 1237.778781 1468.745658 1006.811903 0.685490982 0.5882295 ENSBTAG00000027444 41.63873423 28.6891405 54.58832795 1.902752296 0.5883627 538655 105.8345453 124.5113926 87.15769808 0.699997778 0.5888625 ENSBTAG00000012024 113.5243993 82.10477644 144.9440221 1.765354323 0.5888625 100336924 3.184367591 1.447685123 4.921050058 3.399254424 0.5888625 ENSBTAG00000012861 333.3186501 264.1176383 402.5196618 1.524016587 0.5889267 ENSBTAG00000031711 18.12148331 23.30183084 12.94113578 0.555369914 0.5890861 ENSBTAG00000014250 5.943392385 7.831406888 4.055377882 0.517835166 0.5891347 ENSBTAG00000014418 14.51680278 9.575548752 19.45805681 2.032056576 0.5892357 781090 1.770756152 2.679892104 0.861620201 0.321513019 0.5893296 788005 1.770136823 2.649039885 0.89123376 0.33643652 0.5893296 ENSBTAG00000040185 1.770136823 2.649039885 0.89123376 0.33643652 0.5893296 ENSBTAG00000026751 3.812304488 5.914149365 1.71045961 0.289214814 0.5896374 ENSBTAG00000032130 5.961189369 2.606609611 9.315769128 3.573902701 0.5896374 507482 520.3597018 637.8531984 402.8662052 0.631597061 0.5897279 ENSBTAG00000039944 2.225593553 3.507625683 0.943561424 0.269002884 0.5897898 ENSBTAG00000019018 1.693781586 2.679892104 0.707671068 0.264067 0.5901438 539768 1.707349706 2.618187667 0.796511746 0.304222557 0.5901438 618101 2.174233242 3.280569485 1.067896998 0.325521835 0.5901438 ENSBTAG00000034582 2.188420691 3.249717267 1.127124116 0.346837593 0.5901438 505647 4.760253065 6.91881276 2.60169337 0.376031764 0.5901438 ENSBTAG00000010543 4.729506523 6.745764893 2.713248152 0.402215048 0.5901438 510361 6.162429512 8.012706043 4.312152981 0.53816438 0.5901438 ENSBTAG00000032227 40.92681983 52.30177773 29.55186193 0.565025955 0.5901438 ENSBTAG00000012511 15.32418176 18.4049655 12.24339803 0.665222547 0.5901438 ENSBTAG00000008527 7094.591295 8444.777833 5744.404758 0.680231603 0.5901438 ENSBTAG00000000223 10079.52644 11912.93983 8246.113059 0.692197995 0.5901438 ENSBTAG00000034182 1127.83701 1330.694025 924.9799938 0.695110954 0.5901438 100125927 747.14932 618.7441331 875.5545069 1.415051004 0.5901438 ENSBTAG00000008395 56.76966115 41.57943772 71.95988457 1.730660358 0.5901438 ENSBTAG00000019304 8.707716672 4.204741669 13.21069167 3.141855722 0.5901438 ENSBTAG00000012922 3.060032017 1.447685123 4.672378911 3.227482853 0.5901438 100336704 3.085026942 1.189776707 4.980277177 4.185892318 0.5901438 100137875 0.450508036 0.901016072 0 0 0.5901476 100300014 0.450508036 0.901016072 0 0 0.5901476 100313037 0.450508036 0.901016072 0 0 0.5901476 100313302 0.450508036 0.901016072 0 0 0.5901476 100313363 0.450508036 0.901016072 0 0 0.5901476 100336053 0.450508036 0.901016072 0 0 0.5901476 100336576 0.450508036 0.901016072 0 0 0.5901476 515666 0.450508036 0.901016072 0 0 0.5901476 781232 0.450508036 0.901016072 0 0 0.5901476 784096 0.450508036 0.901016072 0 0 0.5901476

PAGE 91

785933 0.450508036 0.901016072 0 0 0.5901476 787429 0.450508036 0.901016072 0 0 0.5901476 ENSBTAG00000001571 0.450508036 0.901016072 0 0 0.5901476 ENSBTAG00000002913 0.450508036 0.901016072 0 0 0.5901476 ENSBTAG00000004771 0.450508036 0.901016072 0 0 0.5901476 ENSBTAG00000007592 0.450508036 0.901016072 0 0 0.5901476 ENSBTAG00000009752 0.450508036 0.901016072 0 0 0.5901476 ENSBTAG00000012722 0.450508036 0.901016072 0 0 0.5901476 ENSBTAG00000017000 0.450508036 0.901016072 0 0 0.5901476 ENSBTAG00000017568 0.450508036 0.901016072 0 0 0.5901476 ENSBTAG00000018068 0.450508036 0.901016072 0 0 0.5901476 ENSBTAG00000020155 0.450508036 0.901016072 0 0 0.5901476 ENSBTAG00000025337 0.450508036 0.901016072 0 0 0.5901476 ENSBTAG00000025720 0.450508036 0.901016072 0 0 0.5901476 ENSBTAG00000037723 0.450508036 0.901016072 0 0 0.5901476 ENSBTAG00000037839 0.450508036 0.901016072 0 0 0.5901476 ENSBTAG00000038231 0.450508036 0.901016072 0 0 0.5901476 ENSBTAG00000040251 0.450508036 0.901016072 0 0 0.5901476 ENSBTAG00000043122 0.450508036 0.901016072 0 0 0.5901476 ENSBTAG00000044779 0.450508036 0.901016072 0 0 0.5901476 ENSBTAG00000045440 0.450508036 0.901016072 0 0 0.5901476 781755 1.533975159 2.360279251 0.707671068 0.299825145 0.5901476 782215 2.126252904 3.249717267 1.002788542 0.308577165 0.5901476 ENSBTAG00000018635 1.611569056 2.391131469 0.832006642 0.347955206 0.5901476 ENSBTAG00000000772 1.43463451 2.102370835 0.766898186 0.36477779 0.5901476 ENSBTAG00000011525 1.885472607 2.703048216 1.067896998 0.395071383 0.5901476 ENSBTAG00000037959 1.467188738 2.102370835 0.832006642 0.395746853 0.5901476 ENSBTAG00000004949 1.900279387 2.703048216 1.097510557 0.406027 0.5901476 282535 4.723699533 6.691756563 2.755642504 0.411796586 0.5901476 ENSBTAG00000006096 5.972592898 8.220420285 3.724765511 0.453111323 0.5901476 ENSBTAG00000020817 4.70427412 6.433848147 2.974700092 0.462351617 0.5901476 613539 1.544163305 2.102370835 0.985955775 0.468973294 0.5901476 100335561 11.67172987 15.6777186 7.665741132 0.488957694 0.5901476 ENSBTAG00000038895 17.20485639 21.87341988 12.53629289 0.573129074 0.5901476 785705 11.31907331 14.36938975 8.268756873 0.575442452 0.5901476 789637 48.20289764 61.11080995 35.29498532 0.577557152 0.5901476 ENSBTAG00000044190 65.49117612 82.18644149 48.79591076 0.59372215 0.5901476 534095 35.05233892 43.64374762 26.46093022 0.606293723 0.5901476 ENSBTAG00000009527 166.1558515 203.3409393 128.9707637 0.634258719 0.5901476 ENSBTAG00000003644 18.31595828 22.03163072 14.60028585 0.662696558 0.5901476 ENSBTAG00000037978 297.5004235 354.8577547 240.1430923 0.676730575 0.5901476 ENSBTAG00000020318 134.7322429 160.171553 109.2929328 0.682349211 0.5901476 539603 1867.851227 2216.993158 1518.709295 0.685031115 0.5901476 ENSBTAG00000033181 89.51321727 106.1521841 72.87425043 0.686507311 0.5901476 ENSBTAG00000014093 187.0602404 219.8018804 154.3186003 0.702080437 0.5901476 ENSBTAG00000037354 126.4496195 147.0495463 105.8496927 0.719823321 0.5901476 ENSBTAG00000019341 8370.865714 9610.710223 7131.021205 0.741986912 0.5901476 ENSBTAG00000014493 2216.641638 1875.268182 2558.015093 1.364079612 0.5901476 ENSBTAG00000002717 938.5553412 787.1900426 1089.92064 1.384571172 0.5901476 ENSBTAG00000014482 1657.736591 1386.923672 1928.54951 1.390523177 0.5901476 ENSBTAG00000018046 5213.746007 4329.376417 6098.115597 1.408543635 0.5901476 ENSBTAG00000012067 209.1615624 157.2471995 261.0759253 1.660289825 0.5901476

PAGE 92

100337065 39.27273346 29.06560106 49.47986585 1.702351372 0.5901476 ENSBTAG00000013030 239.2446915 175.956873 302.5325099 1.719356026 0.5901476 ENSBTAG00000003952 113.6255565 83.34308178 143.9080312 1.726694384 0.5901476 100336816 9.924787492 6.907234704 12.94234028 1.873736862 0.5901476 ENSBTAG00000034492 8.787535743 5.213219222 12.36185226 2.371251187 0.5901476 781851 7.667260589 4.127577227 11.20694395 2.715138527 0.5901476 ENSBTAG00000007075 5.090238984 2.618187667 7.562290301 2.888368315 0.5901476 ENSBTAG00000018767 3.035368639 0.901016072 5.169721206 5.737657038 0.5901476 ENSBTAG00000010810 54.29498886 64.58487962 44.0050981 0.681352948 0.5901938 ENSBTAG00000006259 1732.305788 2112.717623 1351.893952 0.639883881 0.5905231 ENSBTAG00000009863 1164.388651 1338.377681 990.3996214 0.740000103 0.5908479 ENSBTAG00000045316 10.10009567 13.85689968 6.343291649 0.457771348 0.5917334 ENSBTAG00000002783 234.4087483 296.1499511 172.6675455 0.583040939 0.5917334 ENSBTAG00000015595 150.9717054 179.3080169 122.6353939 0.683937037 0.5917334 ENSBTAG00000009227 357.1811448 423.7103564 290.6519332 0.685968442 0.5917334 783320 416.8400404 474.8276843 358.8523964 0.755752894 0.5917334 ENSBTAG00000002908 4415.282556 4952.699747 3877.865365 0.782980104 0.5917334 ENSBTAG00000004148 55.50074189 43.49372028 67.5077635 1.552126676 0.5917334 618694 7.504928901 3.846512698 11.1633451 2.902198947 0.5917334 ENSBTAG00000006886 70.10215324 87.83596111 52.36834538 0.596206209 0.5921615 ENSBTAG00000030246 11.9889255 15.75148848 8.226362522 0.522259374 0.5925558 100140452 1895.791369 2268.851565 1522.731173 0.671146229 0.5928056 ENSBTAG00000016499 6.673791854 9.690774131 3.656809576 0.377349583 0.5930368 ENSBTAG00000006471 606.7162649 483.8596111 729.5729186 1.507819421 0.5930368 ENSBTAG00000020873 7347.007535 8662.757752 6031.257317 0.696228325 0.5934813 ENSBTAG00000001323 1998.510132 2400.250936 1596.769328 0.665250997 0.5936217 ENSBTAG00000015935 50.52079273 34.24790027 66.79368519 1.950300154 0.5936217 ENSBTAG00000019794 8417.086916 7234.769093 9599.404739 1.326843278 0.5936544 ENSBTAG00000040512 210.5077464 256.7531257 164.2623671 0.639767741 0.5937285 100336430 1150.963183 1298.228727 1003.697639 0.773128508 0.5937285 ENSBTAG00000016524 846.9365144 951.4017863 742.4712425 0.78039715 0.5937285 537068 105.7451615 82.35769254 129.1326304 1.56794862 0.5937285 516046 48.53972821 37.67454736 59.40490906 1.57679158 0.5937285 100298252 32.6515305 24.01385165 41.28920935 1.719391372 0.5937285 509706 7.31651576 3.992590296 10.64044122 2.665047108 0.5937285 ENSBTAG00000014426 437.7741969 521.2331419 354.315252 0.679763475 0.594085 ENSBTAG00000008954 15.50484173 11.16931147 19.84037198 1.776329009 0.5942104 532798 19.2790526 25.06912882 13.48897638 0.538071206 0.5944279 ENSBTAG00000017747 19.66917843 12.32490919 27.01344766 2.191776608 0.5946875 ENSBTAG00000011273 31.11270983 39.7036357 22.52178396 0.567247396 0.5950086 529061 20.54080083 27.22834736 13.85325429 0.508780577 0.5955483 ENSBTAG00000020286 27.60347727 16.8261076 38.38084695 2.281029449 0.5955483 100298890 3.409910078 5.220915328 1.598904828 0.306249906 0.5957637 ENSBTAG00000020530 352.2212075 269.1488042 435.2936108 1.617297213 0.5957637 ENSBTAG00000039988 9.182241959 12.77125769 5.59322623 0.437954222 0.5957699 ENSBTAG00000016530 7.909980647 4.323781206 11.49618009 2.658825584 0.5964436 506809 6.404544878 2.402709525 10.40638023 4.331102083 0.5964436 535127 7.205904286 4.085146952 10.32666162 2.527855605 0.5964524 ENSBTAG00000038655 3.388782655 5.024711349 1.752853961 0.348846698 0.5965059 ENSBTAG00000012186 16.61251617 21.4424636 11.78256875 0.549496969 0.5965059 ENSBTAG00000015584 766.3616509 925.340394 607.3829079 0.656388624 0.5965059 100138887 1018.206538 1205.328929 831.084147 0.689508172 0.5965059

PAGE 93

ENSBTAG00000010120 522.9205478 428.3429309 617.4981647 1.441597655 0.5965059 ENSBTAG00000033498 3.825293363 0.901016072 6.749570654 7.491065769 0.5965059 ENSBTAG00000009272 38.28065008 43.67085348 32.89044668 0.753144124 0.5967055 100138335 3047.927271 3398.35424 2697.500302 0.793766662 0.597035 ENSBTAG00000006832 580.4423788 455.3305675 705.5541901 1.549542773 0.597035 ENSBTAG00000006241 93.56878995 72.28941528 114.8481646 1.58872726 0.597035 ENSBTAG00000034442 25.38397455 16.8834427 33.88450641 2.006966648 0.597035 ENSBTAG00000007498 11.15930281 14.13463744 8.18396817 0.579000926 0.59824 ENSBTAG00000017064 27.38735318 34.6177073 20.15699906 0.582274236 0.59824 ENSBTAG00000004063 36.66127346 45.4028621 27.91968482 0.614932265 0.59824 ENSBTAG00000008343 56.72111792 68.76535481 44.67688102 0.649700436 0.59824 ENSBTAG00000008269 36.89557305 26.1393786 47.65176749 1.82298777 0.59824 ENSBTAG00000001844 7.049913571 3.550055957 10.54977118 2.971719689 0.59824 ENSBTAG00000038384 344.8450929 263.7155384 425.9746474 1.615280806 0.5984203 ENSBTAG00000018727 108.8515305 76.22431867 141.4787422 1.856084052 0.5988738 100140337 3537.108524 2993.144154 4081.072893 1.363473553 0.5991104 ENSBTAG00000038951 59.36251169 44.77417188 73.9508515 1.651640854 0.5993647 ENSBTAG00000008916 18.54172763 12.41309651 24.67035875 1.987445979 0.5993647 507256 1.151713208 1.802032144 0.501394271 0.278238251 0.599495 514896 1.151713208 1.802032144 0.501394271 0.278238251 0.599495 ENSBTAG00000011619 8.649710055 11.38146285 5.917957264 0.519964555 0.599495 ENSBTAG00000013926 18.73436888 23.95602917 13.5127086 0.564062955 0.599495 100335586 5.571386844 7.323286163 3.819487526 0.521553773 0.5996371 ENSBTAG00000020663 407.1329885 315.762514 498.503463 1.578729079 0.5996371 751574 1.166519987 1.802032144 0.53100783 0.294671675 0.599912 ENSBTAG00000027651 1.166519987 1.802032144 0.53100783 0.294671675 0.599912 539315 3.29576265 4.963006912 1.628518387 0.328131396 0.599912 ENSBTAG00000031573 9.650469969 12.73270936 6.568230575 0.515854905 0.599912 100140850 10.3046899 13.45679562 7.152584187 0.531522094 0.599912 100336918 7.113438814 9.086769982 5.140107647 0.565669392 0.599912 ENSBTAG00000018262 66.08053795 79.81562675 52.34544914 0.655829582 0.599912 ENSBTAG00000005489 929.4028798 1106.859578 751.9461812 0.679351018 0.599912 ENSBTAG00000008696 2612.19708 3082.447642 2141.946518 0.694884964 0.599912 ENSBTAG00000025426 1265.19656 1484.932863 1045.460258 0.704045472 0.599912 ENSBTAG00000003300 1369.360268 1067.572088 1671.148448 1.56537293 0.599912 ENSBTAG00000021007 74.42396945 53.4349101 95.41302879 1.785593512 0.599912 100336811 3.6907456 1.478537341 5.902953858 3.992427985 0.599912 ENSBTAG00000016709 233.1016811 271.8514285 194.3519337 0.714919671 0.6000699 ENSBTAG00000007721 1087.749322 913.3877923 1262.110852 1.381790804 0.6000699 ENSBTAG00000001204 30.10822886 39.25382485 20.96263288 0.534027778 0.6005393 ENSBTAG00000013955 54.22341222 40.28940826 68.15741619 1.691695638 0.6005393 ENSBTAG00000044087 12.77397472 8.705384899 16.84256453 1.934729449 0.6005393 ENSBTAG00000015180 90.93272867 71.145883 110.7195743 1.556233048 0.6006683 ENSBTAG00000033487 6.537947977 9.47141404 3.604481913 0.380564285 0.6008615 ENSBTAG00000016761 7.849407795 10.43032039 5.268495196 0.505113458 0.6009247 100336480 27.66539393 34.72960591 20.60118196 0.593187899 0.6009247 ENSBTAG00000011473 2183.526679 2387.081638 1979.97172 0.829452872 0.6009247 ENSBTAG00000031558 13.77766341 9.001909432 18.55341739 2.06105355 0.6009247 ENSBTAG00000000827 474.1333619 398.92881 549.3379137 1.377032443 0.6009517 615827 911.9961259 767.2368639 1056.755388 1.377352207 0.6009517 ENSBTAG00000033326 41.39797129 26.39451543 56.40142715 2.136861626 0.6009517 ENSBTAG00000031759 1.199074215 1.802032144 0.596116286 0.330802249 0.6010903

PAGE 94

ENSBTAG00000013674 50.88751799 63.02141394 38.75362205 0.614927842 0.6010903 516214 65.6400652 49.74591747 81.53421292 1.639013151 0.6013308 ENSBTAG00000038042 1.987762223 3.503743733 0.471780712 0.134650462 0.6015696 ENSBTAG00000016828 77.62290559 98.5742485 56.67156267 0.57491245 0.6016695 ENSBTAG00000038312 6.488909004 9.213505624 3.764312383 0.408564616 0.6017899 ENSBTAG00000013726 75.3889538 93.78138229 56.99652532 0.607759493 0.6017899 ENSBTAG00000001889 568.627675 687.5169085 449.7384414 0.654148917 0.6018309 ENSBTAG00000043576 159.6227981 188.9225335 130.3230626 0.689822755 0.6018309 ENSBTAG00000019352 1.956910004 3.442039296 0.471780712 0.137064302 0.60192 ENSBTAG00000031716 3.214788779 4.735950714 1.693626843 0.357610741 0.60192 ENSBTAG00000004961 2018.51513 1679.938712 2357.091548 1.40308187 0.60192 ENSBTAG00000010739 191.5788401 152.0510337 231.1066465 1.519928151 0.60192 ENSBTAG00000002472 15.00865201 10.40328233 19.61402169 1.885368585 0.60192 ENSBTAG00000020909 5.43900444 7.715694121 3.16231476 0.409854863 0.6026003 ENSBTAG00000042131 8.312726263 11.70440247 4.921050058 0.420444365 0.6026003 538508 703.1067515 828.2636138 577.9498892 0.697784956 0.6026003 ENSBTAG00000001475 41.94999528 32.19953777 51.7004528 1.605627173 0.603004 506199 3.214738475 4.470346192 1.959130758 0.438250344 0.6036367 ENSBTAG00000016296 20.86560311 25.78170481 15.94950141 0.618636414 0.6036367 ENSBTAG00000006918 645.2220791 513.7446945 776.6994637 1.511839387 0.6036367 ENSBTAG00000016307 2248.41489 2641.152714 1855.677065 0.7026012 0.6038932 ENSBTAG00000000546 67.88196179 86.44166134 49.32226224 0.570584386 0.6040247 505359 5877.595353 7041.650226 4713.540481 0.669380093 0.6042477 781590 3.164511146 4.416337861 1.912684432 0.433092868 0.6043352 ENSBTAG00000037964 87.10814309 104.0186093 70.19767693 0.674856907 0.6043352 100140621 1.280667416 2.05994056 0.501394271 0.2434023 0.6045711 ENSBTAG00000045019 4.182837472 5.652426792 2.713248152 0.480014736 0.6045711 ENSBTAG00000013174 11.1132211 14.96230323 7.264138969 0.48549604 0.6045711 526730 1.811910357 3.122426443 0.501394271 0.160578409 0.6046299 ENSBTAG00000000431 1.296093525 2.090792779 0.501394271 0.2398106 0.6046299 ENSBTAG00000027312 1.296093525 2.090792779 0.501394271 0.2398106 0.6046299 ENSBTAG00000038591 1.296093525 2.090792779 0.501394271 0.2398106 0.6046299 538185 1.295474195 2.05994056 0.53100783 0.257778229 0.6046299 ENSBTAG00000039772 5.193091855 6.768921005 3.617262705 0.534392808 0.6046299 786234 99.27872433 121.5718587 76.98558996 0.633251731 0.6046299 ENSBTAG00000019769 1.777058834 2.833665808 0.72045186 0.254247293 0.6049707 ENSBTAG00000010157 3444.62487 2867.935582 4021.314158 1.402163348 0.6049707 ENSBTAG00000031986 1.683575479 2.895370245 0.471780712 0.162943137 0.6051835 ENSBTAG00000026230 1.65272326 2.833665808 0.471780712 0.166491303 0.6051835 ENSBTAG00000002855 1.682956149 2.864518027 0.501394271 0.175036172 0.6051835 ENSBTAG00000039994 1.554621271 2.637461829 0.471780712 0.178876792 0.6051835 504623 1.584854159 2.668314048 0.501394271 0.187906769 0.6051835 516730 1.58423483 2.637461829 0.53100783 0.201332897 0.6051835 ENSBTAG00000037918 1.394814844 2.317848976 0.471780712 0.203542473 0.6051835 ENSBTAG00000000997 1.568808721 2.606609611 0.53100783 0.203715903 0.6051835 ENSBTAG00000037786 1.568808721 2.606609611 0.53100783 0.203715903 0.6051835 ENSBTAG00000011587 1.440473842 2.379553413 0.501394271 0.2107094 0.6051835 100337124 1.600743619 2.575757392 0.625729845 0.242930428 0.6051835 ENSBTAG00000042349 1.48783485 2.379553413 0.596116286 0.250516035 0.6051835 539904 1.456982631 2.317848976 0.596116286 0.257185128 0.6051835 ENSBTAG00000042565 1.678956845 2.637461829 0.72045186 0.273161057 0.6051835 ENSBTAG00000034287 1.342835203 2.05994056 0.625729845 0.303761117 0.6051835

PAGE 95

539126 1.534576527 2.348701195 0.72045186 0.306744792 0.6051835 790429 4.760391083 7.030643578 2.490138588 0.354183591 0.6051835 ENSBTAG00000037968 5.281211982 7.642899016 2.919524949 0.381991826 0.6051835 ENSBTAG00000000434 14.56386269 20.32492682 8.802798561 0.43310358 0.6051835 787244 5.252988607 7.065377747 3.440599467 0.486966103 0.6051835 100301416 3.102293056 4.150733339 2.053852773 0.494816844 0.6051835 617538 3.117099835 4.150733339 2.083466332 0.501951381 0.6051835 ENSBTAG00000035166 23.61221283 30.674756 16.54966967 0.539520825 0.6051835 ENSBTAG00000009614 28.32366253 35.65364251 20.99368255 0.588822938 0.6051835 ENSBTAG00000007402 127.6160796 155.8371514 99.39500789 0.637813301 0.6051835 ENSBTAG00000005068 926.9273024 1094.278829 759.575776 0.694133667 0.6051835 ENSBTAG00000004428 14658.17798 17049.3436 12267.01237 0.719500566 0.6051835 ENSBTAG00000001361 4117.77594 4774.009587 3461.542292 0.725080716 0.6051835 ENSBTAG00000001134 1400.519461 1591.401952 1209.63697 0.760107758 0.6051835 525161 1766.786949 1984.889308 1548.68459 0.780237257 0.6051835 ENSBTAG00000021111 2133.82253 2394.113036 1873.532024 0.782557881 0.6051835 ENSBTAG00000010204 536.1768377 446.5326173 625.8210581 1.40151253 0.6051835 505842 181.0759777 140.4205367 221.7314187 1.579052636 0.6051835 ENSBTAG00000025526 209.0070522 161.1589424 256.8551619 1.593800245 0.6051835 ENSBTAG00000010367 36.03306443 26.72459598 45.34153287 1.696621828 0.6051835 ENSBTAG00000000291 80.72195521 59.14072225 102.3031882 1.729826493 0.6051835 ENSBTAG00000017169 22.76108631 15.18942722 30.33274541 1.9969644 0.6051835 ENSBTAG00000013842 582.7816544 702.6620743 462.9012344 0.658782153 0.6053279 790639 5258.932796 4814.318743 5703.54685 1.184704868 0.6053279 100140633 11.36406744 8.135559736 14.59257515 1.793678078 0.6054764 100313477 0.579462244 1.158924488 0 0 0.6063207 509632 0.579462244 1.158924488 0 0 0.6063207 536164 0.579462244 1.158924488 0 0 0.6063207 788059 0.579462244 1.158924488 0 0 0.6063207 ENSBTAG00000000856 0.579462244 1.158924488 0 0 0.6063207 ENSBTAG00000001502 0.579462244 1.158924488 0 0 0.6063207 ENSBTAG00000006775 0.579462244 1.158924488 0 0 0.6063207 ENSBTAG00000007242 0.579462244 1.158924488 0 0 0.6063207 ENSBTAG00000011223 0.579462244 1.158924488 0 0 0.6063207 ENSBTAG00000014412 0.579462244 1.158924488 0 0 0.6063207 ENSBTAG00000016322 0.579462244 1.158924488 0 0 0.6063207 ENSBTAG00000017214 0.579462244 1.158924488 0 0 0.6063207 ENSBTAG00000030100 0.579462244 1.158924488 0 0 0.6063207 ENSBTAG00000032373 0.579462244 1.158924488 0 0 0.6063207 ENSBTAG00000032390 0.579462244 1.158924488 0 0 0.6063207 ENSBTAG00000038779 0.579462244 1.158924488 0 0 0.6063207 ENSBTAG00000039243 0.579462244 1.158924488 0 0 0.6063207 ENSBTAG00000039369 0.579462244 1.158924488 0 0 0.6063207 ENSBTAG00000042294 0.579462244 1.158924488 0 0 0.6063207 ENSBTAG00000043971 0.579462244 1.158924488 0 0 0.6063207 ENSBTAG00000044490 0.579462244 1.158924488 0 0 0.6063207 100313210 4.637138189 6.938086923 2.336189455 0.336719543 0.6063207 505942 4.724970534 6.976635248 2.473305821 0.354512703 0.6063207 ENSBTAG00000004007 4.597668032 6.391417872 2.803918192 0.438700496 0.6063207 ENSBTAG00000007449 8.810080438 12.10887587 5.511285007 0.455144232 0.6063207 ENSBTAG00000016323 6.827645108 9.094466088 4.560824129 0.501494435 0.6063207 100336988 8.421489545 10.81163768 6.031341408 0.557856412 0.6063207

PAGE 96

ENSBTAG00000002848 20.64373902 26.44643862 14.84103942 0.561173458 0.6063207 ENSBTAG00000012849 19.67636875 24.83825846 14.51447903 0.584359771 0.6063207 ENSBTAG00000017478 42.24780154 52.93816405 31.55743902 0.596118879 0.6063207 ENSBTAG00000000283 7.684901235 9.437235053 5.932567418 0.628634063 0.6063207 ENSBTAG00000006770 171.0414069 209.0134623 133.0693514 0.636654453 0.6063207 ENSBTAG00000038738 124.9743136 152.241758 97.70686914 0.641787578 0.6063207 ENSBTAG00000005026 31.94476726 38.91451824 24.97501628 0.641791738 0.6063207 540933 134.6986359 163.870526 105.5267458 0.643964161 0.6063207 ENSBTAG00000019331 50.05380727 60.60677455 39.50083999 0.651756182 0.6063207 ENSBTAG00000007708 179.4941023 216.780745 142.2074597 0.655996729 0.6063207 ENSBTAG00000019908 12.82242449 15.4820698 10.16277918 0.656422514 0.6063207 ENSBTAG00000003960 562.7610931 678.3185617 447.2036244 0.659282599 0.6063207 ENSBTAG00000021673 436.1910872 524.642714 347.7394603 0.66281195 0.6063207 ENSBTAG00000015414 116.4183814 139.814867 93.02189581 0.66532192 0.6063207 ENSBTAG00000008219 1515.21931 1797.183352 1233.255268 0.686215609 0.6063207 ENSBTAG00000040065 98.79332847 117.0882732 80.49838371 0.687501673 0.6063207 ENSBTAG00000012100 173.3046045 204.1483562 142.4608529 0.697830027 0.6063207 ENSBTAG00000025848 2834.888982 3278.654206 2391.123759 0.72930038 0.6063207 ENSBTAG00000032994 167.2320725 192.1018755 142.3622695 0.741076937 0.6063207 513260 1790.846867 2040.271434 1541.422301 0.755498643 0.6063207 ENSBTAG00000015858 2370.237782 2676.623219 2063.852345 0.771065696 0.6063207 ENSBTAG00000038156 1362.104301 1169.079186 1555.129416 1.330217349 0.6063207 ENSBTAG00000014302 3452.7321 2935.249078 3970.215122 1.352599053 0.6063207 ENSBTAG00000014921 246.6666955 204.3980304 288.9353606 1.413591706 0.6063207 ENSBTAG00000015413 205.6183381 169.9769974 241.2596788 1.419366635 0.6063207 ENSBTAG00000014551 520.5204034 424.1096212 616.9311855 1.454650295 0.6063207 ENSBTAG00000004709 312.2006645 248.1293802 376.2719488 1.516434485 0.6063207 100137838 268.8127415 211.6175037 326.0079792 1.540552996 0.6063207 ENSBTAG00000019251 68.71972094 52.59158093 84.84786095 1.613335432 0.6063207 ENSBTAG00000002321 202.459747 154.389958 250.529536 1.622706161 0.6063207 ENSBTAG00000007931 39.29790533 29.66621065 48.92960001 1.649337712 0.6063207 ENSBTAG00000011051 68.58641705 51.49296651 85.67986759 1.663913995 0.6063207 514313 47.29665947 34.68759523 59.9057237 1.727007113 0.6063207 ENSBTAG00000032299 42.68548143 28.95432543 56.41663743 1.948470102 0.6063207 ENSBTAG00000009451 10.64420016 6.218370005 15.07003032 2.423469545 0.6063207 506557 3.703179249 1.748023813 5.658334686 3.236989475 0.6063207 ENSBTAG00000034289 3.717986029 1.748023813 5.687948245 3.253930639 0.6063207 ENSBTAG00000038676 2.875577807 1.116494213 4.634661401 4.151084121 0.6063207 100335398 0.594888353 1.189776707 0 0 0.6067335 100336488 0.594888353 1.189776707 0 0 0.6067335 520525 0.594888353 1.189776707 0 0 0.6067335 524369 0.594888353 1.189776707 0 0 0.6067335 614598 0.594888353 1.189776707 0 0 0.6067335 783329 0.594888353 1.189776707 0 0 0.6067335 789329 0.594888353 1.189776707 0 0 0.6067335 ENSBTAG00000001879 0.594888353 1.189776707 0 0 0.6067335 ENSBTAG00000002375 0.594888353 1.189776707 0 0 0.6067335 ENSBTAG00000004579 0.594888353 1.189776707 0 0 0.6067335 ENSBTAG00000006278 0.594888353 1.189776707 0 0 0.6067335 ENSBTAG00000008047 0.594888353 1.189776707 0 0 0.6067335 ENSBTAG00000014365 0.594888353 1.189776707 0 0 0.6067335 ENSBTAG00000014439 0.594888353 1.189776707 0 0 0.6067335

PAGE 97

ENSBTAG00000016723 0.594888353 1.189776707 0 0 0.6067335 ENSBTAG00000023920 0.594888353 1.189776707 0 0 0.6067335 ENSBTAG00000027768 0.594888353 1.189776707 0 0 0.6067335 ENSBTAG00000035312 0.594888353 1.189776707 0 0 0.6067335 ENSBTAG00000035523 0.594888353 1.189776707 0 0 0.6067335 ENSBTAG00000037773 0.594888353 1.189776707 0 0 0.6067335 ENSBTAG00000037869 0.594888353 1.189776707 0 0 0.6067335 ENSBTAG00000038182 0.594888353 1.189776707 0 0 0.6067335 ENSBTAG00000039993 0.594888353 1.189776707 0 0 0.6067335 ENSBTAG00000042938 0.594888353 1.189776707 0 0 0.6067335 ENSBTAG00000044306 0.594888353 1.189776707 0 0 0.6067335 ENSBTAG00000002051 4.955847512 6.572717027 3.338977998 0.508005743 0.6067335 ENSBTAG00000026880 32.01014997 41.51717811 22.50312183 0.542019541 0.6067335 ENSBTAG00000042610 43.77990877 55.94681013 31.61300741 0.565054689 0.6067335 ENSBTAG00000017233 57.97434907 73.45796827 42.49072987 0.578435953 0.6067335 ENSBTAG00000039913 64.90694134 82.17146887 47.64241381 0.579792651 0.6067335 ENSBTAG00000043552 32.73449224 40.4002643 25.06872018 0.620508816 0.6067335 504352 157.7045149 190.247564 125.1614658 0.65788735 0.6067335 ENSBTAG00000002306 3320.292388 2816.320971 3824.263805 1.357893452 0.6067335 537688 343.7538116 288.0153705 399.4922528 1.387051851 0.6067335 ENSBTAG00000014167 466.1855381 369.3650772 563.0059991 1.524253466 0.6067335 ENSBTAG00000021902 39.23349678 27.23327188 51.23372168 1.881291455 0.6067335 ENSBTAG00000044152 9.770977864 6.514826746 13.02712898 1.999612498 0.6067335 ENSBTAG00000038112 10.09683122 6.637748232 13.5559142 2.042245913 0.6067335 ENSBTAG00000009260 22.61257252 14.48510251 30.74004253 2.122183291 0.6067335 540479 14.36563477 8.81340156 19.91786798 2.259952396 0.6067335 ENSBTAG00000001247 2.452888739 1.147346432 3.758431046 3.275759562 0.6067335 534164 76.4658192 91.49070696 61.44093144 0.671553795 0.6067456 539034 685.5626311 594.0471083 777.0781539 1.308108638 0.6067456 ENSBTAG00000001919 30.35358568 21.361485 39.34568636 1.841898462 0.6067456 780995 4.852882003 2.883792189 6.821971816 2.365625318 0.6067456 ENSBTAG00000020959 15583.82737 18187.87587 12979.77887 0.713650069 0.6070752 784704 850.1255902 982.71509 717.5360905 0.730156785 0.6071985 ENSBTAG00000015788 20.94614671 27.49443927 14.39785415 0.523664222 0.6080514 ENSBTAG00000018317 610.7102467 707.9797038 513.4407896 0.725219645 0.6080514 ENSBTAG00000021667 437.1507116 494.1252156 380.1762076 0.769392445 0.6080514 ENSBTAG00000020996 408.2946883 335.6225724 480.9668043 1.433058572 0.6080514 100137883 22.23472338 16.03255301 28.43689374 1.77369716 0.6080514 ENSBTAG00000020554 91.28542717 63.57356269 118.9972916 1.871804672 0.6080514 ENSBTAG00000016004 5056.204258 4276.743919 5835.664598 1.364511111 0.608124 ENSBTAG00000040301 3.105159377 4.204741669 2.005577085 0.476979858 0.6083571 ENSBTAG00000013007 1369.997262 1152.080057 1587.914467 1.378302192 0.6090184 ENSBTAG00000000380 179.7526921 210.1524262 149.352958 0.710688717 0.609516 ENSBTAG00000042748 4.468144798 6.36826176 2.568027836 0.403254127 0.6096443 ENSBTAG00000025893 20.7780539 25.88528434 15.67082345 0.605395067 0.6099514 ENSBTAG00000008637 690.9160799 550.2102588 831.6219011 1.511462005 0.6100028 ENSBTAG00000012140 27.14694852 34.10140308 20.19249396 0.592130884 0.6100999 ENSBTAG00000035467 302.8421797 251.5827264 354.101633 1.407495809 0.6100999 ENSBTAG00000009112 9.823830605 4.793840995 14.85382021 3.098521672 0.6100999 512788 2.102579647 0.600677381 3.604481913 6.000695256 0.6100999 100295084 11.5108829 14.96618518 8.055580621 0.538252101 0.6103427 ENSBTAG00000011786 11.87909813 14.59700113 9.161195129 0.627608031 0.6103427

PAGE 98

ENSBTAG00000011551 48.50254666 59.340253 37.66484031 0.634726655 0.6103427 ENSBTAG00000015943 2164.392101 1846.386025 2482.398177 1.344463262 0.6103427 537161 419.2028727 342.8121304 495.593615 1.445671174 0.6103427 ENSBTAG00000020142 237.9780624 185.066443 290.8896819 1.571812141 0.6103427 ENSBTAG00000002066 2.05521864 0.600677381 3.509759898 5.843003261 0.6103427 ENSBTAG00000000597 13.06125996 17.0217564 9.100763515 0.534654785 0.6108722 508365 63.21461396 77.75624137 48.67298655 0.62596887 0.6112272 ENSBTAG00000007331 312.7810671 376.1912568 249.3708773 0.662883235 0.6112382 ENSBTAG00000008471 20.57278008 27.61784815 13.52771201 0.489817742 0.6113469 786347 54.76262899 67.33548169 42.18977629 0.626560845 0.6113469 539643 23.86808947 29.94783036 17.78834857 0.593977873 0.6113512 ENSBTAG00000004020 9.627136731 5.544410131 13.70986333 2.472736145 0.6118549 ENSBTAG00000032360 1132.772797 955.1355911 1310.410004 1.37196228 0.612087 ENSBTAG00000012989 100.027211 116.1454499 83.90897213 0.722447347 0.6121327 ENSBTAG00000011420 5.542506455 7.992876699 3.092136211 0.386861493 0.613191 ENSBTAG00000030710 164.2235744 194.9108552 133.5362936 0.685114708 0.613191 100336679 17.66013508 10.57688538 24.74338478 2.339382899 0.613191 ENSBTAG00000019554 34.96767927 22.8020292 47.13332934 2.067067318 0.613832 ENSBTAG00000019121 41.55217484 53.51761772 29.58673197 0.552840975 0.6142755 ENSBTAG00000017068 93.2301484 69.9793302 116.4809666 1.664505308 0.614751 ENSBTAG00000014674 4.328846465 6.214000667 2.443692262 0.393255874 0.6151128 ENSBTAG00000011917 929.6329529 775.2259092 1084.039997 1.398353672 0.6151128 786165 263.1979781 207.8238212 318.572135 1.532895186 0.6151128 ENSBTAG00000031669 77.82511313 96.16335548 59.48687078 0.618602278 0.6152279 100140518 335.3587366 392.9788711 277.7386021 0.706751997 0.6152821 ENSBTAG00000009059 93.44962047 116.8445617 70.05467923 0.59955447 0.615435 ENSBTAG00000012047 109.0345942 134.9731838 83.09600461 0.615648251 0.615435 100299402 316.6755331 238.0272123 395.3238538 1.6608347 0.6154387 521298 5.453485888 7.950933813 2.956037963 0.371785004 0.6159016 ENSBTAG00000040593 81.52425588 99.00181023 64.04670153 0.64692455 0.6159016 100126055 688.2955381 564.6611145 811.9299617 1.437906633 0.6159016 ENSBTAG00000002881 81.86977529 98.19355419 65.54599638 0.667518321 0.6159158 ENSBTAG00000015892 300.3470686 237.9506665 362.7434708 1.524448223 0.6159158 529294 4.199997933 5.844748821 2.555247044 0.437186802 0.6161029 ENSBTAG00000020961 99.12398986 126.1124953 72.13548446 0.571993158 0.6162775 ENSBTAG00000013014 29.2665903 36.46937844 22.06380216 0.604995289 0.6162775 ENSBTAG00000020546 686.2667773 822.3330768 550.2004778 0.669072537 0.6162775 ENSBTAG00000008664 490.463571 563.8027492 417.1243929 0.739841005 0.6162775 ENSBTAG00000005635 52.71525517 39.10302611 66.32748423 1.696223818 0.6162775 280867 4.273642828 5.914149365 2.633136292 0.445226546 0.616446 ENSBTAG00000007744 12.70878537 16.86749531 8.550075437 0.506896565 0.616446 100299027 6700.035232 7415.515949 5984.554514 0.80703144 0.616446 ENSBTAG00000006034 481.0512006 383.4026402 578.699761 1.509378654 0.6165708 ENSBTAG00000012448 616.0111396 523.895959 708.1263201 1.35165448 0.6165733 ENSBTAG00000019660 52.93320383 61.2244419 44.64196576 0.729152678 0.6173892 ENSBTAG00000008463 0.708416452 1.416832904 0 0 0.6174748 ENSBTAG00000012546 0.708416452 1.416832904 0 0 0.6174748 ENSBTAG00000042395 0.708416452 1.416832904 0 0 0.6174748 ENSBTAG00000043554 0.708416452 1.416832904 0 0 0.6174748 ENSBTAG00000043622 0.708416452 1.416832904 0 0 0.6174748 ENSBTAG00000008193 0.723842561 1.447685123 0 0 0.6174748 ENSBTAG00000013444 0.723842561 1.447685123 0 0 0.6174748

PAGE 99

ENSBTAG00000017679 0.723842561 1.447685123 0 0 0.6174748 ENSBTAG00000021419 0.723842561 1.447685123 0 0 0.6174748 ENSBTAG00000031441 0.723842561 1.447685123 0 0 0.6174748 ENSBTAG00000031905 0.723842561 1.447685123 0 0 0.6174748 ENSBTAG00000036552 0.723842561 1.447685123 0 0 0.6174748 ENSBTAG00000036995 0.723842561 1.447685123 0 0 0.6174748 ENSBTAG00000044000 0.723842561 1.447685123 0 0 0.6174748 ENSBTAG00000044096 0.723842561 1.447685123 0 0 0.6174748 ENSBTAG00000044202 0.723842561 1.447685123 0 0 0.6174748 100313280 0.739268671 1.478537341 0 0 0.6174748 100313321 0.739268671 1.478537341 0 0 0.6174748 100336357 0.739268671 1.478537341 0 0 0.6174748 616747 0.739268671 1.478537341 0 0 0.6174748 785790 0.739268671 1.478537341 0 0 0.6174748 790978 0.739268671 1.478537341 0 0 0.6174748 ENSBTAG00000018268 0.739268671 1.478537341 0 0 0.6174748 ENSBTAG00000039240 0.739268671 1.478537341 0 0 0.6174748 ENSBTAG00000042689 0.739268671 1.478537341 0 0 0.6174748 ENSBTAG00000044227 0.739268671 1.478537341 0 0 0.6174748 509128 0.883648988 1.767297976 0 0 0.6174748 ENSBTAG00000005930 0.883648988 1.767297976 0 0 0.6174748 ENSBTAG00000015065 0.883648988 1.767297976 0 0 0.6174748 ENSBTAG00000015647 0.883648988 1.767297976 0 0 0.6174748 ENSBTAG00000020095 0.883648988 1.767297976 0 0 0.6174748 ENSBTAG00000039025 0.883648988 1.767297976 0 0 0.6174748 ENSBTAG00000045177 0.883648988 1.767297976 0 0 0.6174748 ENSBTAG00000045282 0.883648988 1.767297976 0 0 0.6174748 ENSBTAG00000045313 0.883648988 1.767297976 0 0 0.6174748 527410 0.868222879 1.736445757 0 0 0.6174748 539762 0.868222879 1.736445757 0 0 0.6174748 790124 0.868222879 1.736445757 0 0 0.6174748 ENSBTAG00000004324 0.868222879 1.736445757 0 0 0.6174748 ENSBTAG00000010868 0.868222879 1.736445757 0 0 0.6174748 ENSBTAG00000016052 0.868222879 1.736445757 0 0 0.6174748 100335565 0.852796769 1.705593539 0 0 0.6174748 100337226 0.852796769 1.705593539 0 0 0.6174748 510311 0.852796769 1.705593539 0 0 0.6174748 786808 0.852796769 1.705593539 0 0 0.6174748 ENSBTAG00000013262 0.852796769 1.705593539 0 0 0.6174748 ENSBTAG00000036644 0.852796769 1.705593539 0 0 0.6174748 ENSBTAG00000044984 0.852796769 1.705593539 0 0 0.6174748 ENSBTAG00000000625 0.83737066 1.67474132 0 0 0.6174748 ENSBTAG00000001021 0.83737066 1.67474132 0 0 0.6174748 ENSBTAG00000010472 0.83737066 1.67474132 0 0 0.6174748 ENSBTAG00000012389 0.83737066 1.67474132 0 0 0.6174748 ENSBTAG00000016793 0.83737066 1.67474132 0 0 0.6174748 ENSBTAG00000018845 0.83737066 1.67474132 0 0 0.6174748 ENSBTAG00000026004 0.83737066 1.67474132 0 0 0.6174748 ENSBTAG00000031453 0.83737066 1.67474132 0 0 0.6174748 ENSBTAG00000034565 0.83737066 1.67474132 0 0 0.6174748 ENSBTAG00000036997 0.83737066 1.67474132 0 0 0.6174748 ENSBTAG00000042525 0.83737066 1.67474132 0 0 0.6174748

PAGE 100

ENSBTAG00000043023 0.83737066 1.67474132 0 0 0.6174748 ENSBTAG00000043181 0.83737066 1.67474132 0 0 0.6174748 ENSBTAG00000044291 0.83737066 1.67474132 0 0 0.6174748 ENSBTAG00000045431 0.83737066 1.67474132 0 0 0.6174748 ENSBTAG00000034251 2.868461029 4.373907587 1.363014472 0.311623976 0.6174748 ENSBTAG00000011984 2.999117247 4.570111566 1.428122928 0.312491918 0.6174748 539495 4.119513672 6.079501125 2.159526218 0.355214379 0.6174748 521387 5.286895334 7.765820502 2.807970167 0.361580617 0.6174748 ENSBTAG00000021336 4.057809234 5.956092251 2.159526218 0.36257434 0.6174748 ENSBTAG00000039975 4.167494009 6.110353344 2.224634673 0.364076273 0.6174748 781497 2.833609506 4.085146952 1.582072061 0.387274211 0.6174748 ENSBTAG00000017670 5.232594354 7.538764304 2.926424404 0.388183565 0.6174748 ENSBTAG00000016735 5.265148582 7.538764304 2.99153286 0.396820054 0.6174748 100138045 4.117216376 5.790740491 2.443692262 0.421999961 0.6174748 ENSBTAG00000010065 3.944850162 5.49428375 2.395416574 0.435983412 0.6174748 ENSBTAG00000011373 14.68146815 20.37942254 8.983513773 0.44081297 0.6174748 782530 4.054998286 5.525135968 2.584860603 0.46783656 0.6174748 ENSBTAG00000011434 15.03335474 20.00149981 10.06520968 0.503222747 0.6174748 ENSBTAG00000000301 18.50951484 24.33346451 12.68556518 0.521321786 0.6174748 ENSBTAG00000004896 18.4607592 24.11749898 12.80401942 0.530901626 0.6174748 100337023 18.09982279 23.42523972 12.77440586 0.54532658 0.6174748 ENSBTAG00000012673 18.41036164 23.52119093 13.29953235 0.565427677 0.6174748 ENSBTAG00000017002 18.42426577 23.44839583 13.4001357 0.571473452 0.6174748 ENSBTAG00000016194 60.0288695 75.02165017 45.03608884 0.600307894 0.6174748 100138461 50.78155021 63.3327755 38.23032492 0.603642026 0.6174748 507543 6.183956748 7.712367352 4.655546143 0.603646835 0.6174748 ENSBTAG00000013069 311.2839814 384.421793 238.1461699 0.619491856 0.6174748 ENSBTAG00000006166 37.05068445 45.5257158 28.57565309 0.627681577 0.6174748 785746 47.12723529 57.3569217 36.89754887 0.64329723 0.6174748 ENSBTAG00000017490 93.42321015 113.1326841 73.71373616 0.651568879 0.6174748 ENSBTAG00000017123 242.389784 292.7443793 192.0351887 0.655982496 0.6174748 615638 226.066473 271.9831521 180.1497939 0.662356446 0.6174748 ENSBTAG00000019014 247.2977583 295.9769076 198.618609 0.671061167 0.6174748 ENSBTAG00000023999 1840.84705 2166.041079 1515.653021 0.6997342 0.6174748 ENSBTAG00000000385 729.9651146 858.7890332 601.141196 0.699987043 0.6174748 ENSBTAG00000001673 2744.460859 3220.510272 2268.411445 0.704363984 0.6174748 100299071 51.88920194 60.47713174 43.30127214 0.715994143 0.6174748 ENSBTAG00000039980 220.0908151 256.182313 183.9993173 0.718235834 0.6174748 ENSBTAG00000007397 829.273789 963.1433898 695.4041882 0.722015222 0.6174748 ENSBTAG00000003625 88.25152278 101.6410732 74.86197238 0.736532683 0.6174748 ENSBTAG00000000267 170.8971445 193.9156891 147.8785999 0.762592241 0.6174748 ENSBTAG00000008059 3140.668968 3559.468776 2721.86916 0.764684095 0.6174748 ENSBTAG00000006743 3767.594362 3236.830545 4298.35818 1.327952798 0.6174748 ENSBTAG00000013461 5960.387316 5094.670624 6826.104008 1.339851879 0.6174748 ENSBTAG00000016977 1104.010166 928.0987309 1279.921602 1.379079142 0.6174748 ENSBTAG00000021398 3951.04313 3282.87562 4619.21064 1.407062336 0.6174748 ENSBTAG00000009351 3369.198701 2781.179551 3957.21785 1.422855942 0.6174748 ENSBTAG00000011636 230.9179521 188.5285956 273.3073085 1.449686227 0.6174748 ENSBTAG00000020968 170.9691241 138.4091926 203.5290557 1.470487992 0.6174748 ENSBTAG00000009343 250.9855231 201.502359 300.4686871 1.49114228 0.6174748 ENSBTAG00000030230 47.18694266 37.0550832 57.31880212 1.546853958 0.6174748 ENSBTAG00000034659 123.5076348 96.57621576 150.4390539 1.557723636 0.6174748

PAGE 101

ENSBTAG00000039172 230.6039578 178.6248987 282.5830169 1.581991194 0.6174748 ENSBTAG00000018744 140.5560859 107.7152302 173.3969416 1.609771815 0.6174748 ENSBTAG00000033109 62.48033128 47.74670657 77.21395599 1.617157738 0.6174748 ENSBTAG00000007080 211.1412402 159.829746 262.4527344 1.642076904 0.6174748 ENSBTAG00000013244 287.3056481 215.4192385 359.1920578 1.667409375 0.6174748 521217 119.5801403 85.20792872 153.9523519 1.806784348 0.6174748 ENSBTAG00000008711 111.6733772 78.35144337 144.9953111 1.850576133 0.6174748 ENSBTAG00000043996 26.43412057 18.49308502 34.37515612 1.858811338 0.6174748 ENSBTAG00000016658 48.71388308 33.96745872 63.46030744 1.868267743 0.6174748 508887 158.4057509 108.3852446 208.4262571 1.923013209 0.6174748 ENSBTAG00000013728 12.44499103 8.231998341 16.65798372 2.023565 0.6174748 ENSBTAG00000021798 16.48365719 10.81163768 22.15567669 2.049243356 0.6174748 535329 26.08544759 17.08401602 35.08687916 2.053784024 0.6174748 512673 12.23668838 7.850681051 16.6226957 2.117357156 0.6174748 ENSBTAG00000014765 4.217372274 1.790454088 6.644290461 3.710952716 0.6174748 ENSBTAG00000034560 4.261173283 1.759601869 6.762744698 3.843337982 0.6174748 ENSBTAG00000012600 8.650992118 5.10908451 12.19289973 2.386513612 0.6177335 535030 6.702536699 3.858090754 9.546982643 2.474535528 0.6177335 ENSBTAG00000016679 409.8845763 486.1029445 333.6662081 0.686410588 0.6177552 100140375 2.791949813 4.250498712 1.333400913 0.31370458 0.6180395 790276 5.069407953 7.022947472 3.115868434 0.44366962 0.6180395 ENSBTAG00000010935 177.577194 215.0983753 140.0560127 0.651125386 0.6180395 ENSBTAG00000001936 62.16232744 74.35656456 49.96809033 0.672006441 0.6180395 100298923 38.06185029 44.53664799 31.58705258 0.709237314 0.6180395 100297240 1250.777573 1057.479039 1444.076108 1.36558367 0.6180395 ENSBTAG00000011544 1220.015951 1008.847874 1431.184027 1.418632148 0.6180395 ENSBTAG00000010871 921.8132233 755.3802683 1088.246178 1.440660054 0.6180395 ENSBTAG00000009545 5.962190132 3.43434319 8.490037075 2.472099207 0.6180395 ENSBTAG00000007096 51.89706648 64.33404434 39.46008863 0.613362474 0.6180475 511273 2.774202365 4.250498712 1.297906017 0.30535382 0.6185921 ENSBTAG00000005372 9.415399283 12.89417917 5.936619393 0.460410803 0.6187989 ENSBTAG00000004108 13.48392856 17.17220334 9.795653791 0.570436629 0.6189836 ENSBTAG00000015074 10.52921491 12.91400852 8.144421299 0.630665629 0.6189836 ENSBTAG00000005937 5.914880916 3.195708936 8.634052896 2.701764481 0.6190476 100335899 2.754932931 4.146851389 1.363014472 0.328686597 0.6192519 ENSBTAG00000033612 16.2916887 20.4219206 12.16145681 0.595509945 0.6192929 ENSBTAG00000032369 2.741208831 4.054294733 1.428122928 0.35224941 0.6197815 ENSBTAG00000032841 1.403655023 0.300338691 2.506971356 8.347147516 0.6197815 ENSBTAG00000020102 1.406595692 0.300338691 2.512852693 8.366729865 0.6197815 ENSBTAG00000017890 3.961409254 5.698183835 2.224634673 0.39041118 0.6197878 ENSBTAG00000010244 6.066713545 8.231998341 3.901428749 0.473934589 0.6197878 100462699 21145.78444 23961.20091 18330.36798 0.765002057 0.6197878 ENSBTAG00000014601 9810.342234 11003.80937 8616.8751 0.783081096 0.6197878 100336649 13.57747378 7.154120245 20.00082732 2.795707457 0.6197878 ENSBTAG00000021018 8.49843177 10.58846343 6.408400105 0.605224747 0.6200231 ENSBTAG00000001519 13.64116179 16.77209927 10.51022431 0.626649303 0.6205217 ENSBTAG00000005793 574.6892483 664.1858147 485.1926818 0.730507444 0.6205217 ENSBTAG00000019216 304.2996137 347.1722478 261.4269797 0.753018081 0.6205217 ENSBTAG00000008686 14.33121647 9.082888032 19.57954491 2.155651907 0.6205217 ENSBTAG00000000646 77.08459665 58.10811381 96.06107949 1.653143996 0.6211673 ENSBTAG00000002164 19.46046269 26.14651953 12.77440586 0.488570031 0.6212821 ENSBTAG00000015467 55.64407013 38.46096102 72.82717924 1.893535089 0.6212821

PAGE 102

ENSBTAG00000001086 50.41071555 34.73064848 66.09078263 1.902952738 0.6212821 ENSBTAG00000023509 6.974818413 9.771752731 4.177884094 0.427547054 0.6213457 512656 36.13491016 25.99669556 46.27312475 1.779961789 0.621497 100300546 5.25563007 8.093129461 2.418130678 0.298788088 0.6216882 ENSBTAG00000003820 3.801708504 5.267227552 2.336189455 0.443533041 0.6216882 ENSBTAG00000006345 8275.866866 9232.596281 7319.137452 0.792749648 0.6216882 100335249 1.48062959 0.300338691 2.660920489 8.859732601 0.6216882 ENSBTAG00000008243 188.2366979 229.1108455 147.3625502 0.643193254 0.6217835 ENSBTAG00000003747 8950.763975 10391.74753 7509.780425 0.722667714 0.6218623 ENSBTAG00000014652 2.657913621 3.858090754 1.457736487 0.377838827 0.6222684 ENSBTAG00000000650 1.502995672 0.558247107 2.447744237 4.384696683 0.6222684 100313437 2.647725475 4.115999171 1.17945178 0.286552968 0.6226064 ENSBTAG00000009918 2.642487511 3.827238536 1.457736487 0.38088467 0.6226064 ENSBTAG00000017939 38.96426438 46.34249429 31.58603446 0.681578213 0.6226064 ENSBTAG00000005213 1966.713144 2285.653275 1647.773012 0.720919936 0.6226064 ENSBTAG00000022580 14286.22985 16320.68003 12251.77967 0.750690513 0.6226064 ENSBTAG00000031256 4.91017781 2.379553413 7.440802206 3.126974232 0.6226064 ENSBTAG00000042780 1.530931266 0.300338691 2.761523841 9.19469894 0.6226064 504687 549.8211238 466.7408738 632.9013738 1.356001605 0.6229913 ENSBTAG00000001721 560.0223359 463.8220806 656.2225912 1.414815333 0.6229913 517232 1.560544825 0.300338691 2.820750959 9.391900034 0.6233373 ENSBTAG00000020814 34.47716017 44.43182251 24.52249783 0.551912941 0.6235708 ENSBTAG00000038696 1080.394843 870.6107592 1290.178926 1.48192394 0.6235708 ENSBTAG00000044164 2.607635988 3.538477901 1.676794076 0.473874395 0.6239024 ENSBTAG00000012632 106.4594614 126.5013774 86.41754547 0.683135214 0.6239024 781231 8.424438512 11.35442478 5.49445224 0.483904059 0.6239038 511836 3.842179842 5.305775877 2.378583806 0.448300845 0.6241593 ENSBTAG00000003572 51.25301587 61.63161909 40.87441264 0.663205239 0.6241593 ENSBTAG00000007787 882.7973128 1043.330247 722.2643785 0.692268225 0.6241593 533634 3.832611026 5.594536512 2.07068554 0.370126379 0.6244847 100301420 4.844673094 6.537982858 3.15136333 0.482008503 0.6244847 ENSBTAG00000014692 3.717174635 5.009319136 2.425030133 0.484103741 0.6244847 ENSBTAG00000002121 19.14901427 11.32412775 26.97390079 2.381984855 0.6244847 614924 6.567709217 9.082888032 4.052530403 0.446172009 0.6246303 539899 10.20603685 13.53777422 6.87429948 0.507786536 0.6246303 ENSBTAG00000012969 23.96527292 31.14093384 16.789612 0.539149278 0.6246303 100141010 1.687177694 0.589099325 2.785256063 4.727990584 0.6246303 787862 1.684880399 0.300338691 3.069422107 10.21986911 0.6246303 528021 46.77906069 56.16770017 37.3904212 0.665692579 0.6246404 ENSBTAG00000021992 298.1145304 356.9516202 239.2774407 0.670335774 0.6246404 ENSBTAG00000040390 187.0170124 220.3429342 153.6910906 0.697508596 0.6256793 504288 28.39852542 19.41676982 37.38028102 1.92515446 0.6256793 511854 3.673373625 5.040171355 2.306575896 0.457638388 0.62618 783256 185.8244241 226.8340496 144.8147985 0.638417375 0.62618 ENSBTAG00000007142 6200.831672 6954.086407 5447.576937 0.783363424 0.62618 ENSBTAG00000007722 9502.114357 10543.39587 8460.832847 0.802477015 0.62618 782003 13.90639203 16.97599936 10.83678471 0.638359161 0.6262231 ENSBTAG00000009446 4151.104619 4946.783232 3355.426006 0.678304637 0.6262231 512290 81.76438451 64.34999173 99.17877729 1.541239938 0.6262231 ENSBTAG00000040046 54.34734325 41.77127237 66.92341414 1.602139709 0.6268059 ENSBTAG00000033346 5.822505051 8.335645664 3.309364438 0.397013569 0.6269407 ENSBTAG00000005471 18.65432732 24.34885672 12.95979791 0.532254884 0.6269407

PAGE 103

100336729 16.57021562 20.92664677 12.21378447 0.583647471 0.6269407 ENSBTAG00000020865 460.414598 566.8799059 353.9492901 0.624381437 0.6269407 ENSBTAG00000038431 3.648090918 4.462650085 2.833531751 0.634943744 0.6269407 ENSBTAG00000007305 4261.806207 3570.762021 4952.850393 1.387056982 0.6269407 616868 35.25621718 45.30822031 25.20421406 0.556283471 0.6278141 ENSBTAG00000018915 656.4897218 522.7737776 790.2056661 1.511563319 0.627879 ENSBTAG00000006650 238.2630842 286.0888869 190.4372815 0.665657739 0.6281085 512787 8.642848011 10.96208462 6.323611402 0.576862123 0.6283034 ENSBTAG00000007739 159.6133901 171.7313315 147.4954487 0.858873261 0.6284261 ENSBTAG00000015181 870.1449229 978.7232119 761.5666338 0.778122583 0.628646 100140780 6.651362235 9.05973192 4.24299255 0.468335331 0.628647 ENSBTAG00000016794 6.412828929 8.536218981 4.289438876 0.502498692 0.628647 ENSBTAG00000031600 14.51894693 19.36657565 9.671318217 0.499381945 0.6287676 ENSBTAG00000006354 21.58487613 26.88273902 16.28701324 0.605853936 0.6287676 100271756 73.22616716 62.32900193 84.12333238 1.349665962 0.6287676 784795 11.16354256 6.691756563 15.63532856 2.33650588 0.6287676 ENSBTAG00000039162 800.8400507 900.2779531 701.4021482 0.779095107 0.6296237 ENSBTAG00000043728 2.435320077 3.507625683 1.363014472 0.388586068 0.6297427 ENSBTAG00000027075 28.52507637 20.62582069 36.42433205 1.765957952 0.6297427 ENSBTAG00000017533 25.38070383 17.18378139 33.57762626 1.954030111 0.6297427 ENSBTAG00000043973 6.589374471 8.894380159 4.284368783 0.481693913 0.6301778 ENSBTAG00000016411 102.9607347 123.6434451 82.27802425 0.665445905 0.6301778 ENSBTAG00000008008 11259.05345 12604.84212 9913.26478 0.786464811 0.6301778 ENSBTAG00000037737 31.9311233 22.28947134 41.57277526 1.865130609 0.6301778 509574 4.878799611 6.907234704 2.850364518 0.412663626 0.6302386 ENSBTAG00000043071 9.349088092 12.91733529 5.780840898 0.447525807 0.6304006 ENSBTAG00000015670 7.051670841 8.590227312 5.513114369 0.641789113 0.6304006 ENSBTAG00000007602 8.094174163 11.09651637 5.091831959 0.458867611 0.6306342 ENSBTAG00000035643 1139.181203 967.1682773 1311.194128 1.355704233 0.6313686 100139208 10454.37283 11679.45093 9229.294728 0.790216491 0.6313962 ENSBTAG00000007703 228.9026077 174.450255 283.3549604 1.624273695 0.6314919 786683 4.837915227 7.257699776 2.418130678 0.333181415 0.6319936 ENSBTAG00000010238 12.89020067 17.09503889 8.685362442 0.508063333 0.6319936 ENSBTAG00000004676 10.34784383 13.31411258 7.381575088 0.554417355 0.6321936 ENSBTAG00000032657 122.6514228 90.00835546 155.2944901 1.725334157 0.6323084 787651 937.6271147 1105.765198 769.4890317 0.695888271 0.6329158 100337263 2.676669401 3.819542429 1.533796373 0.401565476 0.6330028 781546 7.317008839 9.794908843 4.839108836 0.494043274 0.6330373 ENSBTAG00000037413 57.19451279 42.54173864 71.84728693 1.688865788 0.6330373 ENSBTAG00000008188 6.488307636 9.22508368 3.751531591 0.406666402 0.6331064 100335723 2.657863317 3.592486232 1.723240402 0.479679055 0.6331604 618771 1050.004812 1195.045933 904.9636901 0.757262683 0.6331604 ENSBTAG00000004489 338.6283719 270.5387981 406.7179457 1.503362729 0.6331604 ENSBTAG00000038816 3.377261348 1.447685123 5.306837572 3.665740215 0.6331604 ENSBTAG00000010741 66.43884042 82.68242898 50.19525186 0.607084873 0.6334305 782307 7.281206439 10.27987346 4.282539421 0.416594566 0.6334728 616707 42.99676786 55.3735904 30.61994531 0.552970199 0.6334728 ENSBTAG00000016532 97.34463402 119.0468507 75.64241737 0.635400407 0.6334728 100125591 13.71848572 9.255935899 18.18103554 1.964256855 0.6334728 ENSBTAG00000019122 2.632249062 3.819542429 1.444955695 0.378305968 0.63358 ENSBTAG00000014761 7.273647136 10.02196504 4.525329232 0.451541111 0.63358 ENSBTAG00000008505 6.917766451 8.878987947 4.956544955 0.558233099 0.63358

PAGE 104

ENSBTAG00000017179 506.4845632 414.9796496 597.9894769 1.441009162 0.6337811 100299038 23.08384881 15.92460414 30.24309349 1.899142561 0.6337811 532564 9.745447697 12.486379 7.004516391 0.560972592 0.6338198 100140555 30.25494849 39.11016704 21.39972994 0.547165394 0.6339108 ENSBTAG00000008435 86.55455423 64.2642242 108.8448843 1.693708835 0.6339714 784999 124.2274621 155.6799153 92.77500879 0.595934348 0.6340349 506206 2.29155909 3.249717267 1.333400913 0.410312899 0.634073 783847 5.566166842 7.076955803 4.055377882 0.573039877 0.6343013 ENSBTAG00000011969 801.672027 890.2372692 713.1067849 0.801030028 0.634452 ENSBTAG00000038650 4.733955944 6.741882944 2.726028944 0.404342372 0.6351724 ENSBTAG00000008373 6.154944556 7.700789296 4.609099817 0.59852304 0.6351724 788696 1039.885482 1218.229601 861.5413641 0.707207708 0.6351724 ENSBTAG00000013201 2.244198082 3.249717267 1.238678898 0.381165128 0.6359113 100336783 100.6568211 120.2862664 81.0273758 0.673621173 0.6359113 ENSBTAG00000013600 3460.03248 3011.097869 3908.96709 1.298186661 0.6359113 519644 9.86874028 6.114235294 13.62324527 2.228119235 0.6359113 ENSBTAG00000014712 9.16171146 11.02378906 7.299633865 0.66217104 0.6361543 ENSBTAG00000014902 67.20400043 48.47904412 85.92895674 1.772496927 0.6362093 ENSBTAG00000021427 59.17499395 47.66226562 70.68772227 1.483096142 0.6362429 ENSBTAG00000021162 3483.751252 4037.832955 2929.669549 0.725554916 0.6364277 ENSBTAG00000017639 624.8897665 539.1013508 710.6781822 1.318264518 0.6364894 ENSBTAG00000009172 18.63624349 11.78593625 25.48655074 2.162454488 0.6364894 ENSBTAG00000003825 1291.023124 1536.850119 1045.196129 0.680089825 0.6368433 100135054 39.75765639 28.07202834 51.44328445 1.832546043 0.6368433 ENSBTAG00000018589 312.1820961 258.4033715 365.9608207 1.416238568 0.636932 ENSBTAG00000024765 91.58329633 69.47030249 113.6962902 1.636617174 0.636932 ENSBTAG00000009702 14.32160909 17.86931932 10.77389887 0.602927211 0.6370214 100336011 9.03014279 11.46244145 6.597844134 0.575605482 0.6370514 ENSBTAG00000040238 2.199158414 3.218865048 1.17945178 0.366418524 0.6370682 ENSBTAG00000021292 4.445764335 5.929609371 2.9619193 0.499513394 0.6378301 ENSBTAG00000001027 72.4024363 88.92209049 55.88278212 0.628446563 0.6378301 ENSBTAG00000039523 8912.130029 9959.52447 7864.735588 0.789669789 0.6378301 ENSBTAG00000013108 102.3369675 77.12089762 127.5530373 1.653936109 0.6378301 ENSBTAG00000000224 711.7205741 580.3511191 843.0900291 1.452724052 0.6379594 528177 6.276058218 8.770971285 3.78114515 0.431097655 0.6383103 ENSBTAG00000002522 15.20716294 18.73560123 11.67872466 0.623344003 0.6383103 ENSBTAG00000038806 38.62189552 49.57175924 27.67203179 0.558221702 0.6385299 ENSBTAG00000007483 4.627367818 6.741882944 2.512852693 0.372722682 0.6385545 ENSBTAG00000007876 152.1874662 186.7500542 117.6248783 0.629851909 0.6385545 ENSBTAG00000038893 168.031534 205.0988585 130.9642096 0.638541875 0.6385545 ENSBTAG00000011147 2052.577121 1763.335645 2341.818597 1.328061735 0.6385545 ENSBTAG00000005827 503.704033 422.4873754 584.9206906 1.384469039 0.6385545 ENSBTAG00000017840 544.9666168 417.2640147 672.669219 1.61209497 0.6385545 ENSBTAG00000016345 46.00929407 33.87102012 58.14756803 1.716735068 0.6385545 518089 4.172250661 6.480092578 1.864408743 0.287713288 0.6386159 ENSBTAG00000038413 591.3995842 500.9328162 681.8663523 1.361193218 0.6386159 ENSBTAG00000014899 41.88974139 50.496974 33.28250878 0.659099074 0.6388827 ENSBTAG00000038128 7.708394219 10.23023446 5.186553974 0.506982904 0.6390212 782117 0.722477847 0 1.444955695 NA 0.6390212 785311 5.398006216 7.427420874 3.368591557 0.453534492 0.6391408 ENSBTAG00000032277 19.30842283 14.55394788 24.06289778 1.653358799 0.6395384 ENSBTAG00000008762 75.18107079 56.10987769 94.25226388 1.679780241 0.6398952

PAGE 105

ENSBTAG00000014406 3.007195294 1.447685123 4.566705466 3.154488082 0.6404313 ENSBTAG00000009835 4.364610441 5.867904933 2.861315949 0.487621388 0.6409632 785701 7.648084421 10.32279112 4.973377722 0.481786143 0.6410211 ENSBTAG00000032998 152.8992934 176.9826709 128.8159159 0.727844796 0.6412085 617650 19.08198115 23.10569466 15.05826765 0.651712397 0.641477 ENSBTAG00000021145 77.07902444 56.91161577 97.24643311 1.708727327 0.641477 ENSBTAG00000021284 36.7105294 45.41679215 28.00426665 0.616606002 0.6415634 ENSBTAG00000013912 2660.571034 2269.118658 3052.02341 1.34502592 0.6415634 ENSBTAG00000036219 61.56246083 46.97298132 76.15194033 1.621186013 0.6415634 ENSBTAG00000019646 36.6610674 43.57330451 29.74883029 0.682730645 0.641746 ENSBTAG00000011198 3724.620439 4359.540394 3089.700485 0.70872161 0.641746 100140276 11.20628224 13.81502459 8.597539882 0.622332579 0.6419192 507169 25.03167751 30.03657286 20.02678215 0.666746577 0.6422417 ENSBTAG00000000258 2.926660729 1.416832904 4.436488555 3.131271543 0.6422429 ENSBTAG00000009471 491.8474984 404.8674121 578.8275847 1.429671955 0.6422432 ENSBTAG00000017504 8.797181077 11.53523655 6.059125605 0.525271032 0.6424634 ENSBTAG00000011186 151.1136072 177.841744 124.3854703 0.699416613 0.6425825 ENSBTAG00000001165 40.25164957 27.206789 53.29651014 1.958941577 0.6427614 ENSBTAG00000014609 7897.932053 6769.712185 9026.15192 1.333313983 0.643551 535458 54.74897302 42.50354212 66.99440393 1.576207549 0.643551 ENSBTAG00000031358 24.64366555 31.11826511 18.16906599 0.583871431 0.6435949 ENSBTAG00000027612 2224.750926 1853.786624 2595.715228 1.400223302 0.6435949 ENSBTAG00000033504 5061.018143 5853.540451 4268.495835 0.729216082 0.644201 ENSBTAG00000012967 28.45581723 20.56072169 36.35091277 1.767978446 0.644201 ENSBTAG00000018235 0.737284627 0 1.474569254 NA 0.644201 787709 34.13421417 42.15695899 26.11146934 0.619386928 0.6445184 ENSBTAG00000004636 1816.416569 1543.665345 2089.167794 1.353381289 0.6445184 ENSBTAG00000013800 19.54882762 13.76871237 25.32894288 1.839601425 0.6445184 ENSBTAG00000019002 14.85104585 17.8544145 11.8476772 0.663571309 0.6448971 100138421 8.025580057 11.01165582 5.039504295 0.457651817 0.6452925 504927 3.964463897 6.129627506 1.799300288 0.293541538 0.6458255 100299302 3.947823172 5.717457998 2.178188347 0.380971465 0.646557 ENSBTAG00000014981 20.74510593 26.28975774 15.20045411 0.578189204 0.646557 508459 31.06440532 39.23503808 22.89377256 0.583503259 0.6467855 ENSBTAG00000007666 17.63808742 22.09326736 13.18290748 0.59669343 0.6467855 533350 323.3393809 271.3430366 375.3357253 1.383251732 0.6471177 ENSBTAG00000020595 1474.824363 1740.575088 1209.073639 0.694640321 0.6472162 ENSBTAG00000038348 135.5304012 158.7576951 112.3031073 0.707386859 0.6478355 532242 2.713172652 0.901016072 4.525329232 5.022473375 0.6482952 100296970 18.48651606 24.14446925 12.82856288 0.531325114 0.6501751 ENSBTAG00000016905 0.752091407 0 1.504182813 NA 0.6501751 100335190 74.74770894 89.40330874 60.09210913 0.672146367 0.6510887 783829 6.346762445 8.840371829 3.853153061 0.43585871 0.6513337 ENSBTAG00000038937 15.1863932 18.5273318 11.84545459 0.63935027 0.6513337 ENSBTAG00000019714 30.7043661 37.09758127 24.31115094 0.655329811 0.6513337 ENSBTAG00000021069 674.7490329 805.911362 543.5867038 0.674499367 0.6513337 507677 128.9391276 148.7484185 109.1298368 0.733653762 0.6513337 ENSBTAG00000020262 1197.02965 1020.566016 1373.493283 1.345815225 0.6513337 ENSBTAG00000013650 116.5683456 91.37929573 141.7573954 1.551307594 0.6513337 ENSBTAG00000014335 2.621391306 0.901016072 4.34176654 4.818744831 0.6513337 ENSBTAG00000010572 78.01849234 93.48069179 62.55629289 0.669189452 0.6513583 ENSBTAG00000001832 9.144490944 5.513557912 12.77542398 2.317092552 0.6518107

PAGE 106

ENSBTAG00000020652 4.105561779 2.036784448 6.174339111 3.03141509 0.6518534 ENSBTAG00000030973 39.19623556 47.57414609 30.81832503 0.647795653 0.6519353 784454 88.60846261 69.87082615 107.3460991 1.536350792 0.6519353 511187 6.234780375 8.397350101 4.072210649 0.484939963 0.6523736 ENSBTAG00000004749 803.8772271 964.0318907 643.7225634 0.667739905 0.6528461 781892 6.218890916 8.489906757 3.947875075 0.465008061 0.6529218 ENSBTAG00000024578 591.7541651 502.3496491 681.1586812 1.355945371 0.6529218 ENSBTAG00000000562 4268.063848 3709.586261 4826.541434 1.301099663 0.6532062 ENSBTAG00000013848 58.93881982 46.6426974 71.23494225 1.527247484 0.6532062 538416 25.09300377 18.59673235 31.58927519 1.698646547 0.6532062 ENSBTAG00000037686 50.64475122 36.10456372 65.18493871 1.80544873 0.6532062 ENSBTAG00000022917 11.00135692 7.003673309 14.99904053 2.141596255 0.6532062 509520 4.838182091 6.006773813 3.669590368 0.610908698 0.6533109 ENSBTAG00000001043 1271.968952 1444.710389 1099.227516 0.760863578 0.6533466 520966 585.1301956 665.2601669 505.0002243 0.759101851 0.6535447 ENSBTAG00000004902 1813.059522 1546.905441 2079.213603 1.344111636 0.6540333 ENSBTAG00000039032 0.766898186 0 1.533796373 NA 0.6540333 ENSBTAG00000042209 0.766898186 0 1.533796373 NA 0.6540333 ENSBTAG00000018469 1126.340107 959.6017885 1293.078426 1.347515648 0.6551777 ENSBTAG00000001335 44.61183855 34.05606563 55.16761147 1.619905601 0.6555608 ENSBTAG00000001509 47.24166482 57.74642248 36.73690716 0.636176331 0.6555864 787041 64.50963152 76.35577546 52.66348759 0.689711908 0.6555864 618369 51.37549644 34.38787952 68.36311336 1.988000258 0.6558173 514947 9.988687351 13.11402665 6.863348049 0.523359318 0.6561622 ENSBTAG00000030393 5502.472128 6144.067423 4860.876833 0.791149657 0.6563476 ENSBTAG00000013343 62.23025411 78.54619802 45.91431019 0.584551657 0.6564515 ENSBTAG00000038755 219.1455585 263.6311395 174.6599776 0.662516491 0.6568428 ENSBTAG00000023675 49.49848575 37.94791578 61.04905572 1.608759123 0.6573848 100336296 4.017242018 5.321235883 2.713248152 0.509890599 0.6574391 789775 7.698515917 5.159210891 10.23782094 1.984377293 0.6574391 ENSBTAG00000014103 112.2901515 133.5248801 91.05542286 0.681936002 0.6576324 ENSBTAG00000020539 20.40978354 12.62136593 28.19820115 2.23416398 0.6576324 ENSBTAG00000018445 3.664300501 5.428697363 1.89990364 0.349974131 0.6576473 616433 677.9946899 826.5812699 529.4081099 0.640479199 0.6578788 ENSBTAG00000033197 91.53929785 107.0955627 75.98303303 0.709488154 0.6578788 ENSBTAG00000034973 179.1397346 144.3768629 213.9026063 1.481557378 0.6578788 ENSBTAG00000010647 7.705765761 4.408641755 11.00288977 2.495755015 0.6578788 ENSBTAG00000027384 0.781704966 0 1.563409932 NA 0.6585805 ENSBTAG00000015721 157.2375918 182.2382569 132.2369268 0.7256266 0.6589367 ENSBTAG00000017442 307.0503574 364.6155096 249.4852053 0.68424189 0.6594597 ENSBTAG00000000240 428.2061722 361.94923 494.4631144 1.366111801 0.6594597 ENSBTAG00000000946 0.784645634 0 1.569291269 NA 0.6594597 ENSBTAG00000012534 5.679111535 7.358020331 4.000202739 0.543652037 0.6596933 ENSBTAG00000005496 440.1185328 363.6510094 516.5860563 1.420554441 0.6596933 504790 17.42894113 12.03996271 22.81791955 1.895181912 0.6596933 ENSBTAG00000004343 7.941671712 4.943732749 10.93961067 2.21282404 0.6603709 ENSBTAG00000044763 1248.047959 999.2841706 1496.811747 1.497883976 0.660412 ENSBTAG00000014253 120.1325203 90.60133673 149.6637038 1.651892888 0.6604815 ENSBTAG00000018697 4237.3344 3688.982551 4785.68625 1.297291647 0.6608666 789937 55.53042143 63.24195218 47.81889067 0.7561261 0.6612571 ENSBTAG00000039748 1538.174007 1308.202218 1768.145797 1.351584466 0.6612571 ENSBTAG00000020363 11.18734109 15.52006295 6.854619233 0.441661819 0.6613336

PAGE 107

532108 16.35023504 21.13005946 11.57041061 0.547580599 0.6613336 ENSBTAG00000027516 43.77077639 52.88324874 34.65830405 0.655373958 0.6613336 100336714 135.6109577 115.326938 155.8949774 1.351765512 0.6613336 789743 10.7457263 13.91860412 7.572848479 0.544081031 0.6617757 505131 583.593511 693.5800804 473.6069415 0.682843921 0.6617757 ENSBTAG00000009431 3161.013087 3558.572375 2763.4538 0.776562483 0.6617757 ENSBTAG00000002112 45.21915533 32.01546703 58.42284362 1.82483184 0.6617757 ENSBTAG00000003610 40.64015454 26.27880266 55.00150641 2.092998951 0.6617757 ENSBTAG00000006894 22.43874772 15.58564933 29.29184611 1.87941134 0.6620594 ENSBTAG00000004987 100.6290114 123.4485506 77.80947215 0.630298791 0.6630299 ENSBTAG00000019060 52.22130325 63.178934 41.2636725 0.653123912 0.6630299 789333 0.799452414 0 1.598904828 NA 0.6630923 ENSBTAG00000033293 0.799452414 0 1.598904828 NA 0.6630923 ENSBTAG00000029764 3.51421887 4.974584968 2.053852773 0.412869171 0.6634454 532541 250.5665209 202.9398605 298.1931814 1.469367234 0.6638985 ENSBTAG00000024683 3.636594383 1.975080011 5.298108756 2.68247804 0.6644375 ENSBTAG00000006579 30.73172795 36.39332436 25.07013155 0.688866214 0.6645656 ENSBTAG00000003064 817.3105962 955.9110745 678.710118 0.710013866 0.6645656 ENSBTAG00000006984 765.307476 870.3127132 660.3022387 0.758695385 0.6645656 ENSBTAG00000015042 2548.196865 2877.538229 2218.855501 0.771095056 0.6645656 539307 307.0414412 344.2624387 269.8204437 0.783763819 0.6645656 ENSBTAG00000001477 37.97443132 27.37928169 48.56958096 1.773953806 0.6645656 ENSBTAG00000014533 6.484653219 3.742377987 9.22692845 2.465525525 0.6645656 ENSBTAG00000044155 7.730529017 4.077450846 11.38360719 2.791844125 0.6645656 ENSBTAG00000033781 3.471939847 5.10908451 1.834795184 0.359124062 0.6648991 508553 9.055870885 11.87412357 6.237618204 0.525311883 0.6648991 ENSBTAG00000011328 13.17164867 8.255154453 18.08814289 2.191133187 0.6648991 100335218 3.600660181 1.778876032 5.42244433 3.048241829 0.6648991 504511 3.434922965 5.005437186 1.864408743 0.372476704 0.6650298 100139737 4.771574194 6.833952211 2.709196177 0.396431829 0.6650298 ENSBTAG00000023963 46.24701678 55.64904396 36.8449896 0.662095644 0.6650298 ENSBTAG00000014515 463.4043766 547.0254834 379.7832697 0.694269794 0.6650298 ENSBTAG00000031871 516.039931 605.8262761 426.2535859 0.703590456 0.6650298 ENSBTAG00000010721 763.3923257 883.1465866 643.6380648 0.728800943 0.6650298 784433 4645.459822 4157.811893 5133.10775 1.2345695 0.6650298 ENSBTAG00000010191 2007.093532 1699.110906 2315.076159 1.3625221 0.6650298 ENSBTAG00000000744 1353.135183 1134.508474 1571.761892 1.38541221 0.6650298 ENSBTAG00000033032 769.543748 610.1631954 928.9243006 1.522419424 0.6650298 ENSBTAG00000038510 11.66615474 8.53954575 14.79276373 1.73226588 0.6650298 ENSBTAG00000019451 26.54846971 17.8384671 35.25847231 1.9765416 0.6650298 ENSBTAG00000011913 6.166179146 4.042716677 8.289641615 2.050512632 0.6650298 ENSBTAG00000034346 6.479190263 4.158429445 8.799951081 2.11617179 0.6650298 ENSBTAG00000000710 4.730342234 2.30627092 7.154413549 3.102156597 0.6650298 100336731 0.814259194 0 1.628518387 NA 0.6650298 100336746 0.814259194 0 1.628518387 NA 0.6650298 784128 0.814259194 0 1.628518387 NA 0.6650298 ENSBTAG00000015373 0.814259194 0 1.628518387 NA 0.6650298 ENSBTAG00000032873 0.814259194 0 1.628518387 NA 0.6650298 ENSBTAG00000021582 2645.948417 3122.470934 2169.4259 0.694778573 0.6652597 ENSBTAG00000005408 3323.116414 3920.480818 2725.752009 0.695259621 0.6657411 ENSBTAG00000009777 1006.124199 1154.115497 858.1329001 0.743541614 0.6657603 519208 2.565494983 3.784808261 1.346181705 0.355680291 0.66581

PAGE 108

100313419 3.404690076 4.974584968 1.834795184 0.368833822 0.66581 ENSBTAG00000015981 18.82068518 24.00615555 13.63521482 0.567988272 0.66581 ENSBTAG00000000140 31.61931952 39.06157061 24.17706843 0.618947678 0.66581 ENSBTAG00000023652 1908.855809 1668.101 2149.610618 1.288657352 0.66581 ENSBTAG00000002561 157.5317954 123.8484556 191.2151353 1.543944448 0.66581 ENSBTAG00000006771 31.36300095 22.7783179 39.94768399 1.753759174 0.66581 ENSBTAG00000004097 25.6439201 17.31488637 33.97295383 1.96206623 0.66581 615722 4.667115811 2.079214723 7.2550169 3.489306237 0.6660645 ENSBTAG00000034992 142.9221241 113.3867956 172.4574526 1.520965927 0.6660981 ENSBTAG00000011455 449.1489378 522.6008103 375.6970653 0.718898742 0.6661347 ENSBTAG00000018852 1317.098232 1121.676228 1512.520237 1.348446369 0.6665871 ENSBTAG00000008396 55.53378861 66.34448149 44.72309574 0.674104232 0.6667446 ENSBTAG00000043447 8.863046881 11.67791959 6.048174175 0.517915381 0.6667807 528100 608.169596 504.4166499 711.9225422 1.41137796 0.6667807 ENSBTAG00000007031 29.82098048 22.52373626 37.11822471 1.647960369 0.6667807 785664 4.628968029 2.914644408 6.343291649 2.176351816 0.6667807 ENSBTAG00000034772 4.633942254 2.048362504 7.219522004 3.524533372 0.6667807 ENSBTAG00000017320 2.507326501 4.011864459 1.002788542 0.249955738 0.6668293 100335683 4.640917977 6.637748232 2.644087722 0.398341068 0.6668293 100335829 8.376476137 11.36600284 5.386949433 0.473952849 0.6668293 ENSBTAG00000039393 15.7343067 20.44889087 11.01972253 0.538890965 0.6668293 ENSBTAG00000021714 9.264001076 11.82448457 6.703517579 0.566918375 0.6668293 ENSBTAG00000032092 94.63343114 115.3612526 73.90560967 0.640645 0.6668293 100300124 47.7614136 54.91005288 40.61277433 0.739623661 0.6668293 ENSBTAG00000018756 48.78609032 33.81756697 63.75461367 1.885251347 0.6668293 100336325 0.829065973 0 1.658131947 NA 0.6668293 782367 0.829065973 0 1.658131947 NA 0.6668293 ENSBTAG00000027684 45.09926917 55.37026363 34.8282747 0.629006843 0.6669592 ENSBTAG00000037559 9.9173326 12.86381434 6.970850856 0.541896102 0.6670687 ENSBTAG00000015844 13.54010577 16.67566067 10.40455087 0.623936351 0.6671164 ENSBTAG00000001697 6375.37732 7545.404385 5205.350254 0.689870282 0.6671854 ENSBTAG00000012860 1462.049051 1258.325687 1665.772414 1.323800691 0.6671854 ENSBTAG00000032850 0.832006642 0 1.664013284 NA 0.6671854 787898 2.45426418 3.846512698 1.062015661 0.276098311 0.6674176 ENSBTAG00000043003 290.4464154 324.473781 256.4190498 0.790261232 0.6674176 ENSBTAG00000017457 4.559884312 2.367975357 6.751793267 2.851293721 0.6674176 540979 159.979867 194.3283417 125.6313924 0.646490323 0.6674387 ENSBTAG00000028809 2.44054008 3.753956043 1.127124116 0.300249684 0.6675017 ENSBTAG00000019676 20.94238344 15.17778137 26.7069855 1.759610634 0.6675017 ENSBTAG00000021443 2.42511397 3.723103824 1.127124116 0.302737761 0.6680401 ENSBTAG00000043654 6.15547155 3.391912915 8.919030184 2.629498577 0.6680401 ENSBTAG00000003503 191.88775 223.4871901 160.2883099 0.717214753 0.6682806 100337044 2.404605877 3.557752064 1.25145969 0.351755734 0.6686073 ENSBTAG00000012216 3.289923318 4.685824333 1.894022303 0.404202584 0.6688306 326334 10.217244 13.02147 7.413018009 0.569291947 0.6688306 ENSBTAG00000004820 16.33870406 20.1871683 12.49023981 0.618721736 0.6689387 ENSBTAG00000008661 2.379610952 3.81566048 0.943561424 0.247286526 0.6691207 ENSBTAG00000034909 2.359566209 3.526899845 1.192232572 0.338039815 0.6691207 ENSBTAG00000020289 2.34352077 3.465195408 1.221846131 0.352605261 0.6691207 ENSBTAG00000021176 77.91400649 95.19009949 60.63791349 0.637019121 0.6691207 ENSBTAG00000013773 139.0080039 162.3305554 115.6854525 0.712653587 0.6691207 ENSBTAG00000027525 517.7380268 437.4560482 598.0200054 1.367040204 0.6691207

PAGE 109

ENSBTAG00000039888 133.1400181 104.5078076 161.7722285 1.54794395 0.6691207 ENSBTAG00000026413 208.293624 154.8032378 261.7840101 1.691075805 0.6691207 ENSBTAG00000000842 61.92984237 44.374623 79.48506173 1.791227877 0.6691207 ENSBTAG00000019845 19.43417871 12.64452205 26.22383537 2.073928558 0.6691207 ENSBTAG00000019920 0.843872753 0 1.687745506 NA 0.6691207 524684 0.846813421 0 1.693626843 NA 0.6691207 614531 0.846813421 0 1.693626843 NA 0.6691207 ENSBTAG00000015419 0.846813421 0 1.693626843 NA 0.6691207 ENSBTAG00000022556 0.846813421 0 1.693626843 NA 0.6691207 505540 83.27330547 98.1125078 68.43410315 0.697506411 0.6695948 ENSBTAG00000004028 444.9237565 365.2051812 524.6423317 1.436568698 0.6695948 ENSBTAG00000025413 239.4759084 188.548141 290.4036758 1.540209701 0.6695948 ENSBTAG00000009153 5.207929936 2.360279251 8.055580621 3.412977773 0.6696577 ENSBTAG00000009509 1445.125214 1197.693311 1692.557117 1.413180737 0.6697667 ENSBTAG00000011192 5.79185005 2.660617941 8.923082159 3.353763056 0.6698519 529670 3.22899419 4.74752877 1.71045961 0.360284201 0.6700042 ENSBTAG00000038706 2.292160458 3.238139211 1.346181705 0.41572694 0.6700042 ENSBTAG00000030555 27.9246159 33.53594726 22.31328455 0.665354236 0.6700042 100336854 82.54831941 95.48815398 69.60848484 0.728975082 0.6700042 ENSBTAG00000034209 412.7912116 366.0387214 459.5437017 1.255451063 0.6700042 ENSBTAG00000043487 2.230042974 3.503743733 0.956342216 0.272948677 0.6700913 ENSBTAG00000032832 3.223756227 4.458768136 1.988744317 0.446029992 0.6700913 ENSBTAG00000034493 968.4728603 812.3707775 1124.574943 1.384312403 0.6700913 ENSBTAG00000021933 10.5048019 13.62214738 7.387456425 0.542312179 0.6701189 504458 51.59556917 60.61884 42.57229834 0.702294837 0.6701189 528377 5.995641079 3.391912915 8.599369243 2.535256494 0.6701189 ENSBTAG00000008017 3.208330117 4.427915917 1.988744317 0.449137778 0.6703779 100140704 350.4413409 297.3039726 403.5787093 1.357461543 0.6703779 ENSBTAG00000006256 2.249418084 3.496047627 1.002788542 0.28683492 0.6704829 ENSBTAG00000004738 153.9201862 173.137205 134.7031673 0.778013987 0.6704829 ENSBTAG00000034457 4.377380256 2.595031555 6.159728957 2.37366245 0.6704829 ENSBTAG00000042684 3.196903312 4.624119896 1.769686729 0.382707795 0.6707144 782370 2.234611305 3.496047627 0.973174983 0.278364338 0.6707821 614402 0.861620201 0 1.723240402 NA 0.6707821 ENSBTAG00000010363 0.861620201 0 1.723240402 NA 0.6707821 100336622 2.183250993 3.268991429 1.097510557 0.335733691 0.6708379 ENSBTAG00000014546 2.198057773 3.268991429 1.127124116 0.344792619 0.6708379 540380 2.182012334 3.207286992 1.156737675 0.360659236 0.6708379 ENSBTAG00000038303 3.477715642 5.013133293 1.942297991 0.387441921 0.6708379 ENSBTAG00000037277 4.434989202 6.379839816 2.490138588 0.390313654 0.6708379 ENSBTAG00000033502 9.990627112 12.76356158 7.217692642 0.565492053 0.6708379 ENSBTAG00000015717 52.01797029 63.93247811 40.10346248 0.627278399 0.6708379 ENSBTAG00000014192 112.2992288 133.987375 90.61108258 0.676265824 0.6708379 ENSBTAG00000009618 232.0356983 275.6328422 188.4385543 0.683657843 0.6708379 ENSBTAG00000039341 64.8099499 76.04246434 53.57743546 0.704572582 0.6708379 ENSBTAG00000010292 1786.527681 1491.615017 2081.440346 1.395427321 0.6708379 ENSBTAG00000016883 315.2804419 253.5361168 377.024767 1.487065321 0.6708379 ENSBTAG00000002144 78.85061704 62.40478916 95.29644491 1.527069416 0.6708379 ENSBTAG00000015254 711.0258428 561.9696701 860.0820156 1.530477642 0.6708379 ENSBTAG00000005845 55.24265484 41.56016356 68.92514612 1.65844261 0.6708379 ENSBTAG00000013537 5.071084878 2.649039885 7.49312987 2.828621008 0.6708379 ENSBTAG00000006872 62.1645065 75.62641288 48.70260011 0.643989292 0.6709562

PAGE 110

ENSBTAG00000030881 396.8926057 338.130472 455.6547395 1.347570767 0.6709562 ENSBTAG00000008401 932.6374595 766.2617433 1099.013176 1.434252963 0.6712434 ENSBTAG00000018937 42.45513108 29.89437721 55.01588495 1.840342234 0.6712434 282608 8.547735494 12.28192374 4.813547252 0.391921278 0.6717027 ENSBTAG00000043565 282.1280485 327.7894493 236.4666478 0.721397984 0.6717027 ENSBTAG00000019273 17.84852307 23.08247075 12.61457539 0.546500222 0.6720001 ENSBTAG00000023445 4.373284765 6.256430942 2.490138588 0.398012639 0.6720485 ENSBTAG00000002947 20.7258687 26.61657932 14.83515809 0.557365314 0.6720485 ENSBTAG00000000020 17.79979147 22.54689237 13.05269057 0.578913065 0.6720485 ENSBTAG00000009121 1482.078862 1775.215676 1188.942048 0.669745127 0.6720485 ENSBTAG00000010630 1515.55463 1280.091294 1751.017965 1.367885223 0.6720485 507787 53.85216688 37.46683312 70.23750065 1.874658059 0.6720485 ENSBTAG00000012489 10.41568672 7.134290902 13.69708254 1.919894034 0.6720485 508574 6.438512764 4.238920656 8.638104871 2.037807633 0.6720485 517246 0.876426981 0 1.752853961 NA 0.6720485 100337139 2.1203582 3.34948264 0.89123376 0.266081021 0.6720502 507480 2.115895546 3.245835317 0.985955775 0.303760259 0.6722266 ENSBTAG00000004907 200.76846 153.6899348 247.8469852 1.61264292 0.672496 ENSBTAG00000011184 12653.84694 10698.04945 14609.64444 1.365636279 0.6727071 ENSBTAG00000011482 832.9191283 929.5857529 736.2525037 0.792022147 0.6730926 ENSBTAG00000025099 2059.700073 1804.191929 2315.208218 1.283238319 0.6731345 ENSBTAG00000026848 78.29793075 62.58560093 94.01026058 1.502106861 0.6731345 ENSBTAG00000007205 8.746625099 4.978466918 12.51478328 2.513782553 0.6734007 ENSBTAG00000017994 804.3660074 893.7299308 715.002084 0.800020296 0.6736832 ENSBTAG00000009290 64.51659905 49.82924806 79.20395004 1.58950723 0.6736832 522448 2.008637787 2.949378576 1.067896998 0.362075254 0.6737286 ENSBTAG00000023179 599.5481917 714.4133107 484.6830726 0.678435109 0.6737286 ENSBTAG00000013045 3364.913054 3873.671244 2856.154863 0.737325055 0.6737286 ENSBTAG00000015882 234.8380494 268.3128193 201.3632796 0.750479534 0.6737286 535053 5.752515399 3.195708936 8.309321862 2.600149772 0.6737286 513144 0.89123376 0 1.782467521 NA 0.6737286 614990 0.89123376 0 1.782467521 NA 0.6737286 784830 6.910664416 8.859713784 4.961615048 0.560019789 0.6738865 ENSBTAG00000020166 55.34539859 64.8620622 45.82873498 0.70655686 0.6738865 524608 39.20579155 29.80896148 48.60262162 1.630470141 0.6738865 ENSBTAG00000030839 53.68444819 64.63493821 42.73395817 0.6611588 0.673944 ENSBTAG00000040171 0.894174429 0 1.788348858 NA 0.673944 ENSBTAG00000040059 1.961896109 2.980230795 0.943561424 0.31660683 0.6739998 ENSBTAG00000004090 15.63401768 20.74097828 10.52705708 0.507548725 0.6739998 516393 2.03830165 3.214983099 0.861620201 0.268001471 0.6741978 ENSBTAG00000021386 42.88118406 54.31831324 31.44405488 0.578884965 0.6741978 ENSBTAG00000006253 88.80914119 103.2145192 74.40376321 0.72086528 0.6741978 ENSBTAG00000015100 1445.101111 1244.643365 1645.558857 1.322112746 0.6741978 ENSBTAG00000001708 280.5725029 212.7972366 348.3477693 1.636993858 0.6741978 ENSBTAG00000011134 117.0052297 88.61086451 145.3995949 1.640877737 0.6741978 ENSBTAG00000011103 18.63111729 11.02378906 26.23844552 2.380165784 0.6741978 ENSBTAG00000043490 32.6220446 21.93082277 43.31326643 1.97499505 0.6744035 505079 2.022875541 3.18413088 0.861620201 0.270598237 0.6746405 ENSBTAG00000022378 1.894490358 2.69147016 1.097510557 0.40777363 0.6747503 ENSBTAG00000034785 184.348939 151.0064448 217.6914332 1.441603592 0.6748945 525243 1.990940642 3.214983099 0.766898186 0.238538793 0.6749486 ENSBTAG00000025652 1.992023322 3.122426443 0.861620201 0.275945716 0.6749486

PAGE 111

ENSBTAG00000033590 1.992023322 3.122426443 0.861620201 0.275945716 0.6749486 ENSBTAG00000021361 7.668624856 10.71131713 4.625932584 0.431873366 0.6749486 785849 7.206259347 9.775634681 4.636884014 0.474330738 0.6749486 507061 15.48901803 20.42136542 10.55667064 0.516942448 0.6749486 515300 15.42070962 20.05980968 10.78160957 0.537473173 0.6749486 ENSBTAG00000007988 47.7960655 60.00589379 35.5862372 0.593045699 0.6749486 ENSBTAG00000044175 64.30835762 79.21778875 49.3989265 0.623583759 0.6749486 ENSBTAG00000015094 7.725871847 9.437235053 6.01450864 0.637316821 0.6749486 100125305 348.4737489 399.8814696 297.0660283 0.742885207 0.6749486 ENSBTAG00000018125 65.89161325 53.09914648 78.68408002 1.481833235 0.6749486 ENSBTAG00000025029 377.8271786 303.0750742 452.5792829 1.493291007 0.6749486 ENSBTAG00000012463 263.4111293 210.1441749 316.6780837 1.506956278 0.6749486 ENSBTAG00000031464 19.84936087 12.98729101 26.71143073 2.056736136 0.6749486 ENSBTAG00000035021 6.216718574 3.753956043 8.679481104 2.312089168 0.6749486 ENSBTAG00000012815 5.411571808 3.238139211 7.585004405 2.342396022 0.6749486 ENSBTAG00000019925 4.90178547 2.05994056 7.74363038 3.759152341 0.6749486 ENSBTAG00000006091 0.908981208 0 1.817962417 NA 0.6749486 ENSBTAG00000010114 62.02672368 49.34525823 74.70818913 1.513989222 0.6750694 ENSBTAG00000030915 12.2037064 15.59771478 8.809698015 0.56480697 0.675075 524776 5.842435954 7.985667981 3.699203927 0.463230369 0.6755051 518435 9.026308015 5.802318547 12.25029748 2.111276274 0.675775 ENSBTAG00000009206 4.1827821 6.029374744 2.336189455 0.387467947 0.6759678 100300738 849.7932472 958.1790606 741.4074338 0.773767101 0.6761348 ENSBTAG00000015963 88.45378654 71.86559992 105.0419732 1.461644699 0.6761348 ENSBTAG00000000620 1.945281644 3.153278661 0.737284627 0.233815246 0.6761449 ENSBTAG00000019097 8.679198489 11.95461478 5.403782201 0.452024787 0.6761872 528665 2.95212371 3.850394648 2.053852773 0.533413575 0.6761872 ENSBTAG00000004154 137.0787479 166.4683969 107.689099 0.646904163 0.6761872 ENSBTAG00000021870 406.2198435 468.1514556 344.2882315 0.735420615 0.6761872 ENSBTAG00000037986 561.4605196 640.8783051 482.0427341 0.752159545 0.6761872 ENSBTAG00000004783 0.923787988 0 1.847575976 NA 0.6761872 ENSBTAG00000042969 0.923787988 0 1.847575976 NA 0.6761872 ENSBTAG00000005357 327.7271465 258.2467628 397.2075303 1.53809297 0.6763203 ENSBTAG00000003758 1916.632374 2133.043609 1700.221139 0.79708691 0.6764311 ENSBTAG00000025110 1.908728112 2.926222464 0.89123376 0.304568013 0.676748 ENSBTAG00000009150 212.6913102 250.1707502 175.2118701 0.700369128 0.676748 ENSBTAG00000025274 1978.495872 1544.912643 2412.079101 1.561304526 0.676748 ENSBTAG00000020849 39.37237751 29.6778565 49.06689851 1.653316792 0.676748 512449 18.59671681 12.46322289 24.73021073 1.984254871 0.676748 ENSBTAG00000011368 2281.358039 2655.644466 1907.071613 0.718120079 0.6772856 ENSBTAG00000026148 1.894540662 2.957074682 0.832006642 0.28136139 0.6773715 538513 1.876793214 2.957074682 0.796511746 0.269358008 0.6778533 ENSBTAG00000042587 1.877875894 2.864518027 0.89123376 0.311128697 0.6778533 ENSBTAG00000014137 8.498737787 10.6077376 6.389737976 0.602365765 0.6778533 529231 2049.863214 2310.007489 1789.718939 0.774767592 0.6778533 ENSBTAG00000012383 3580.98055 3053.129872 4108.831229 1.345776761 0.6778533 ENSBTAG00000027213 116.2875611 93.48457374 139.0905484 1.487844923 0.6778533 ENSBTAG00000025391 5.495250356 2.391131469 8.599369243 3.596359863 0.6778656 537051 1.863688444 2.895370245 0.832006642 0.287357599 0.6781126 534604 1.863069114 2.864518027 0.861620201 0.300790637 0.6781126 ENSBTAG00000002098 7.003758769 8.867409891 5.140107647 0.5796628 0.6781126 787102 13.02298201 15.27428777 10.77167625 0.70521627 0.6781397

PAGE 112

ENSBTAG00000012907 770.3269392 650.5287975 890.1250809 1.368310034 0.6783248 ENSBTAG00000035959 104.9811387 84.27876422 125.6835132 1.491283295 0.6783577 ENSBTAG00000024934 1.846560325 2.926222464 0.766898186 0.262077882 0.6784414 ENSBTAG00000018158 9.547516847 5.513557912 13.58147578 2.463287046 0.6784414 ENSBTAG00000035649 9.522677902 5.925727421 13.11962838 2.214011454 0.6790292 ENSBTAG00000016159 1.831134216 2.895370245 0.766898186 0.264870508 0.679083 508957 326.0293947 368.3383509 283.7204386 0.770271241 0.679083 ENSBTAG00000005072 6.016324155 8.385772045 3.646876264 0.434888552 0.679168 ENSBTAG00000009484 8.027144048 10.83812056 5.216167533 0.481279711 0.679168 538789 60.84168646 73.46996592 48.213407 0.656232876 0.679168 ENSBTAG00000011100 156.4797309 185.8212459 127.1382159 0.684196338 0.679168 541118 2201.060726 2523.413184 1878.708269 0.744510761 0.679168 ENSBTAG00000021482 335.8805873 378.424453 293.3367216 0.775152661 0.679168 ENSBTAG00000005734 112.4954682 126.6248541 98.36608238 0.776830766 0.679168 788817 0.956342216 0 1.912684432 NA 0.679168 100138864 8.991799534 11.45086339 6.532735679 0.570501582 0.6793354 ENSBTAG00000013463 139.3529431 164.5909336 114.1149525 0.693324656 0.6793354 ENSBTAG00000013400 8.47731724 11.07724221 5.877392274 0.530582627 0.6800702 100298629 63.84293451 75.77450782 51.9113612 0.685076851 0.6804836 511442 381.070593 444.0564263 318.0847597 0.716316083 0.6809258 ENSBTAG00000031524 24.08324641 28.48856718 19.67792565 0.690730619 0.6810336 ENSBTAG00000000477 0.971148995 0 1.942297991 NA 0.6810493 ENSBTAG00000002496 0.971148995 0 1.942297991 NA 0.6810493 ENSBTAG00000011433 342.2588672 391.6238954 292.8938391 0.74789573 0.6810586 531059 4.000146241 5.575262349 2.425030133 0.434962515 0.6811051 509158 16.76249686 21.94282043 11.58217329 0.527834301 0.6811051 ENSBTAG00000024585 7825.008804 8679.946018 6970.07159 0.803008633 0.6811051 100298394 1.717606117 2.668314048 0.766898186 0.287409268 0.6811186 ENSBTAG00000002023 1.702180008 2.637461829 0.766898186 0.290771293 0.6811186 ENSBTAG00000005884 1.702180008 2.637461829 0.766898186 0.290771293 0.6811186 ENSBTAG00000017296 1.734114906 2.606609611 0.861620201 0.330552069 0.6811186 535359 1.733495576 2.575757392 0.89123376 0.346008426 0.6811186 767920 5.084746348 7.207573395 2.9619193 0.410945423 0.6811186 ENSBTAG00000023677 2.780427129 3.850394648 1.71045961 0.444229687 0.6811186 ENSBTAG00000039179 24.89093078 32.11418983 17.66767172 0.550151563 0.6811186 ENSBTAG00000007111 12.93028571 16.13287357 9.727697855 0.602973662 0.6811186 ENSBTAG00000030706 967.561921 1143.019943 792.103899 0.692992195 0.6811186 ENSBTAG00000037247 123.8997931 145.5179076 102.2816786 0.702880355 0.6811186 ENSBTAG00000007522 1829.24367 1590.492821 2067.99452 1.30022248 0.6811186 ENSBTAG00000040607 132.9255633 108.6927199 157.1584067 1.445896346 0.6811186 ENSBTAG00000012096 436.4357846 350.2683226 522.6032465 1.492008305 0.6811186 ENSBTAG00000008985 778.3329255 624.2113068 932.4545442 1.493812326 0.6811186 ENSBTAG00000039847 11.07167127 6.210673899 15.93266864 2.565368735 0.6811186 ENSBTAG00000008066 2.508961481 1.116494213 3.901428749 3.494356443 0.6811186 786925 2.55338182 1.116494213 3.990269427 3.573927548 0.6811186 ENSBTAG00000033169 0.985955775 0 1.97191155 NA 0.6811186 ENSBTAG00000011882 3.961427216 5.74061411 2.182240322 0.38014057 0.6812774 ENSBTAG00000021458 1.254851606 1.802032144 0.707671068 0.392707239 0.6812774 ENSBTAG00000003893 50.26881193 62.44624466 38.09137919 0.609986708 0.6816346 ENSBTAG00000030225 139.0699261 108.6349652 169.504887 1.560316116 0.6816346 ENSBTAG00000030608 8.25685946 4.408641755 12.10507717 2.74576113 0.6816346 782886 1.671947119 2.606609611 0.737284627 0.282851956 0.6817686

PAGE 113

ENSBTAG00000012416 1.269658386 1.802032144 0.737284627 0.409140664 0.6817823 ENSBTAG00000001618 2.427344237 1.178198651 3.676489823 3.120432893 0.6822452 783263 1.620586807 2.379553413 0.861620201 0.362093238 0.6827421 ENSBTAG00000000786 1.620586807 2.379553413 0.861620201 0.362093238 0.6827421 724061 1.605160698 2.348701195 0.861620201 0.366849646 0.6827421 530353 1.635393587 2.379553413 0.89123376 0.374538245 0.6827421 ENSBTAG00000020374 30.71871041 37.70879414 23.72862669 0.629259758 0.6827421 528201 95.78339196 111.1383471 80.42843678 0.72367854 0.6827421 ENSBTAG00000006656 552.5290897 626.5340082 478.5241712 0.763764081 0.6827421 ENSBTAG00000023015 5996.016499 6724.71594 5267.317058 0.783277257 0.6827421 ENSBTAG00000023550 162.3386485 132.4149716 192.2623255 1.451968181 0.6827421 ENSBTAG00000012125 1078.458502 856.6089644 1300.30804 1.517971553 0.6827421 ENSBTAG00000011007 100.5261182 78.4417793 122.6104571 1.56307593 0.6827421 ENSBTAG00000008609 147.9507972 115.2867285 180.6148658 1.566657916 0.6827421 ENSBTAG00000039254 2.382304568 1.147346432 3.617262705 3.152720577 0.6827421 ENSBTAG00000014597 1.528186131 2.348701195 0.707671068 0.30130315 0.6827525 ENSBTAG00000042447 1.542992911 2.348701195 0.737284627 0.313911633 0.6827525 ENSBTAG00000044172 1.542992911 2.348701195 0.737284627 0.313911633 0.6827525 ENSBTAG00000038952 1.527566802 2.317848976 0.737284627 0.31809002 0.6827525 100335447 1.5732258 2.379553413 0.766898186 0.322286603 0.6827525 504764 1.428226153 2.05994056 0.796511746 0.386667344 0.6827525 ENSBTAG00000027531 1.460780381 2.05994056 0.861620201 0.418274303 0.6827525 ENSBTAG00000044111 1.508141388 2.05994056 0.956342216 0.46425719 0.6827525 ENSBTAG00000002949 1.538374277 2.090792779 0.985955775 0.471570299 0.6827525 ENSBTAG00000004830 1.570309175 2.05994056 1.08067779 0.524616006 0.6827525 100335897 1.37918718 1.802032144 0.956342216 0.530702085 0.6827525 ENSBTAG00000010002 1.39399396 1.802032144 0.985955775 0.547135509 0.6827525 ENSBTAG00000006638 24.46132949 31.25276466 17.66989433 0.565386599 0.6827525 ENSBTAG00000016833 26.98469828 33.2085705 20.76082605 0.625164701 0.6827525 ENSBTAG00000033803 45.98730703 54.08564607 37.88896799 0.700536478 0.6827525 100140639 833.5624959 975.3201062 691.8048855 0.709310596 0.6827525 513673 1448.859268 1682.615353 1215.103183 0.722151489 0.6827525 ENSBTAG00000021483 210.3534877 241.2557015 179.4512739 0.743821899 0.6827525 ENSBTAG00000000184 863.8733254 716.2566586 1011.489992 1.412189304 0.6827525 ENSBTAG00000000694 309.9463421 247.5708663 372.3218179 1.503899968 0.6827525 ENSBTAG00000033651 139.0864385 106.1214675 172.0514095 1.621268661 0.6827525 ENSBTAG00000005722 11.50809246 7.673751234 15.34243369 1.999339466 0.6827525 ENSBTAG00000013819 13.61752336 8.374749171 18.86029754 2.252043274 0.6827525 ENSBTAG00000035150 2.315518147 0.889438016 3.741598279 4.2066993 0.6827525 ENSBTAG00000000507 24.80357988 31.78736826 17.81979149 0.560593483 0.6832169 ENSBTAG00000031483 481.3466772 400.6598482 562.0335062 1.402769728 0.683429 528054 170.9924938 202.8137478 139.1712399 0.6862022 0.6835786 ENSBTAG00000009006 336.1524873 391.5432514 280.7617233 0.717064391 0.6835786 ENSBTAG00000003375 197.6951083 165.95411 229.4361066 1.382527414 0.6835786 ENSBTAG00000004050 63.2752693 49.35302213 77.19751648 1.564190259 0.6835786 ENSBTAG00000011050 19.1150589 13.45630823 24.77380958 1.841055448 0.6835786 ENSBTAG00000018082 8.795436106 5.563684293 12.02718792 2.16173084 0.6835786 ENSBTAG00000037459 39.43807388 49.78391062 29.09223715 0.584370267 0.6837752 ENSBTAG00000040591 39.43807388 49.78391062 29.09223715 0.584370267 0.6837752 ENSBTAG00000012939 100.4280469 78.33425003 122.5218438 1.564090341 0.6837752 ENSBTAG00000016320 110.1576489 79.92191439 140.3933834 1.756631888 0.6837752 100336215 3.823855069 4.99774108 2.649969059 0.530233363 0.6839535

PAGE 114

ENSBTAG00000003322 3.82323574 4.966888861 2.679582618 0.539489144 0.6839535 ENSBTAG00000009152 34.08873802 43.73712631 24.44034973 0.558800996 0.6839535 ENSBTAG00000003189 315.0535073 250.2915909 379.8154237 1.517491748 0.6842264 ENSBTAG00000025842 102.1232627 79.05403474 125.1924908 1.583631894 0.6842264 100300829 2.076415815 0.600677381 3.552154249 5.913580833 0.6842264 ENSBTAG00000017094 75.81234634 91.9254774 59.69921529 0.649430571 0.6844171 ENSBTAG00000008416 68.8584377 52.19438404 85.52249135 1.638538186 0.6847591 513217 18.88598196 24.38359089 13.38837303 0.549073067 0.6848925 532742 8.490112524 5.779162435 11.20106261 1.938180963 0.6848925 ENSBTAG00000015533 5.330462447 7.026829422 3.634095472 0.517174284 0.6850115 ENSBTAG00000025764 107.6581039 84.34004907 130.9761586 1.552953313 0.6852004 ENSBTAG00000040165 12.137195 14.83896215 9.435427861 0.635854972 0.6852828 ENSBTAG00000042974 37.16547748 45.20949751 29.12145746 0.644144683 0.6852828 ENSBTAG00000016775 30.9028989 23.33268306 38.47311473 1.648893727 0.6856968 ENSBTAG00000003786 10.43473692 5.105757741 15.7637161 3.087439104 0.6856968 516032 16.00973117 20.03283941 11.98662293 0.598348675 0.6859493 ENSBTAG00000004438 1109.953397 937.9113839 1281.99541 1.366861978 0.6859493 ENSBTAG00000033555 1.08067779 0 2.16135558 NA 0.6859493 ENSBTAG00000037897 1.08067779 0 2.16135558 NA 0.6859493 ENSBTAG00000031849 16.37985894 10.55372927 22.20598862 2.10408928 0.686154 ENSBTAG00000002585 22.64030378 15.57074451 29.70986304 1.908056678 0.6861782 ENSBTAG00000011059 15.97039295 19.96004431 11.98074159 0.600236222 0.6862115 ENSBTAG00000001132 381.7578308 457.4938078 306.0218537 0.66890928 0.6862115 ENSBTAG00000040603 110.3983572 128.8100681 91.98664623 0.714126214 0.6862115 ENSBTAG00000000042 49.61703109 35.44981022 63.78425197 1.799283313 0.6862565 790548 4.127936137 5.717457998 2.538414277 0.443976025 0.6862596 ENSBTAG00000007421 5.600930651 7.519490142 3.68237116 0.489710219 0.6862935 ENSBTAG00000003569 26.62329795 34.92906887 18.31752704 0.524420708 0.6862935 ENSBTAG00000001607 628.2055466 529.8314042 726.5796891 1.371341305 0.6862935 ENSBTAG00000009714 2.569260391 3.303725597 1.834795184 0.555371543 0.6864595 ENSBTAG00000018999 58.6318395 43.58543775 73.67824126 1.690432518 0.6869699 ENSBTAG00000021988 2002.648036 2349.739829 1655.556243 0.704570022 0.6881964 ENSBTAG00000000609 56.23416595 42.79964705 69.66868484 1.627786434 0.6881964 ENSBTAG00000016471 155.954786 178.7542069 133.1553651 0.744907588 0.6882811 ENSBTAG00000008732 10.90561808 13.65688155 8.154354611 0.597087599 0.6883439 ENSBTAG00000016193 348.6049216 301.6852073 395.524636 1.311050812 0.6883439 ENSBTAG00000017249 76.24195112 58.91699282 93.56690942 1.588114141 0.6883439 ENSBTAG00000032353 5.53306155 7.354138381 3.711984719 0.504747739 0.6890385 ENSBTAG00000010470 63.32455851 67.68144616 58.96767086 0.871253116 0.6890446 ENSBTAG00000009281 635.8598229 527.808283 743.9113628 1.409434802 0.6893018 ENSBTAG00000005810 600.111234 479.391719 720.8307489 1.503636213 0.6893018 ENSBTAG00000010667 10.33987149 13.44521756 7.234525409 0.538074254 0.6894576 ENSBTAG00000001656 4725.943833 4141.131491 5310.756174 1.282440846 0.6895106 ENSBTAG00000010276 166.1519512 194.2027164 138.101186 0.711118714 0.6897492 ENSBTAG00000015553 69.83686801 84.45562625 55.21810977 0.653812093 0.689812 616720 776.9244786 915.3059825 638.5429746 0.697627883 0.689812 ENSBTAG00000020547 453.3283502 376.2572715 530.3994289 1.409672235 0.689812 100337015 35.73378665 28.45715978 43.01041351 1.511409214 0.689812 ENSBTAG00000011334 197.7742945 240.9675595 154.5810294 0.641501411 0.6899308 ENSBTAG00000019694 97.32261261 116.9896817 77.65554352 0.663781133 0.6899308 ENSBTAG00000020302 31.00026139 37.05896515 24.94155762 0.673023586 0.6899308 ENSBTAG00000017597 150.6011149 176.7330137 124.4692162 0.704278242 0.6899308

PAGE 115

790362 10.79394937 7.465481811 14.12241692 1.89169531 0.6899729 ENSBTAG00000012490 2017.438764 1732.80948 2302.068048 1.32851769 0.6902259 ENSBTAG00000003270 138.9868531 111.6624153 166.311291 1.48941155 0.6902259 ENSBTAG00000001168 4303.675397 4975.436126 3631.914668 0.729969107 0.6913194 ENSBTAG00000012988 255.6208096 207.5641837 303.6774354 1.463053162 0.6913194 ENSBTAG00000042702 4.66365153 6.175939731 3.15136333 0.510264586 0.6913567 ENSBTAG00000008541 171.0447056 137.4753241 204.614087 1.488369556 0.6913567 ENSBTAG00000023607 89.20793828 70.64011427 107.7757623 1.525701981 0.691468 ENSBTAG00000014091 18.3675968 13.76434303 22.97085057 1.668866471 0.6921816 ENSBTAG00000004118 341.6203787 280.084605 403.1561524 1.439408469 0.6922658 531727 23.69690234 31.66437898 15.7294257 0.496754593 0.6925297 ENSBTAG00000003695 633.2166017 728.5496515 537.8835519 0.738293609 0.6926196 ENSBTAG00000039950 30.93178522 22.7783179 39.08525254 1.715897228 0.6926196 ENSBTAG00000018559 13.61529061 16.89113881 10.33944241 0.612122281 0.6927519 ENSBTAG00000018272 26.13979094 31.74167901 20.53790286 0.647032656 0.6929113 100297795 38.03684536 45.87236671 30.201324 0.65837728 0.6929113 536969 34.98424984 25.30055435 44.66794533 1.765492752 0.6929113 ENSBTAG00000016952 1198.857761 1034.632291 1363.08323 1.317456687 0.692963 ENSBTAG00000013132 17.07418444 21.34941956 12.79894932 0.599498703 0.6930411 ENSBTAG00000003810 132.7521698 162.3253597 103.17898 0.635630688 0.6930411 ENSBTAG00000009854 5519.98179 6374.003808 4665.959771 0.732029649 0.6934338 536738 5.377873758 7.292433944 3.463313572 0.474918744 0.693748 527394 407.361036 460.3230451 354.3990268 0.769891993 0.693748 ENSBTAG00000001407 712.4566324 580.2910124 844.6222525 1.455514965 0.693748 ENSBTAG00000025856 19.65268918 25.35740206 13.9479763 0.550055414 0.693765 ENSBTAG00000020776 103.7959222 117.948105 89.64373945 0.760026958 0.6940882 ENSBTAG00000015351 7.885894321 4.943732749 10.82805589 2.190259151 0.6940882 444866 41.3824303 46.9658404 35.7990202 0.762235273 0.6943794 ENSBTAG00000012674 10.31800468 13.14876082 7.487248533 0.569426171 0.6945814 ENSBTAG00000003871 628.4473414 783.6787734 473.2159095 0.603839131 0.6949682 ENSBTAG00000015525 25.32855576 19.27450638 31.38260514 1.628192418 0.6951357 ENSBTAG00000036298 162.6644894 127.9626408 197.3663381 1.542374688 0.6952697 785362 7.558823987 4.932154693 10.18549328 2.065120401 0.6953345 ENSBTAG00000007977 6.070373277 7.862259107 4.278487446 0.544180418 0.6955326 ENSBTAG00000001785 44.34863959 54.88862579 33.80865339 0.615950079 0.6955326 ENSBTAG00000004200 50.88924533 61.88799755 39.8904931 0.644559441 0.6955326 ENSBTAG00000013103 27.83846538 32.75840785 22.9185229 0.699622613 0.6955326 100336891 162.9673781 175.6424009 150.2923553 0.855672403 0.6955326 ENSBTAG00000004358 221.7294917 263.2577388 180.2012446 0.684505023 0.6956718 ENSBTAG00000016937 4.523270517 6.114235294 2.932305741 0.47958667 0.6965081 785708 14.17719062 9.629557083 18.72482416 1.94451562 0.6965081 ENSBTAG00000009169 101.657713 123.3345033 79.98092268 0.648487816 0.696612 ENSBTAG00000001700 10362.23032 8933.091218 11791.36941 1.319965186 0.6967648 788989 0.718622559 1.201354763 0.235890356 0.19635362 0.6967767 ENSBTAG00000006284 0.718622559 1.201354763 0.235890356 0.19635362 0.6967767 ENSBTAG00000007045 0.718622559 1.201354763 0.235890356 0.19635362 0.6967767 ENSBTAG00000007647 0.718622559 1.201354763 0.235890356 0.19635362 0.6967767 ENSBTAG00000016034 0.718622559 1.201354763 0.235890356 0.19635362 0.6967767 ENSBTAG00000019942 0.718622559 1.201354763 0.235890356 0.19635362 0.6967767 ENSBTAG00000030386 0.718622559 1.201354763 0.235890356 0.19635362 0.6967767 ENSBTAG00000032564 0.718622559 1.201354763 0.235890356 0.19635362 0.6967767 ENSBTAG00000037399 0.718622559 1.201354763 0.235890356 0.19635362 0.6967767

PAGE 116

ENSBTAG00000005717 3.475843273 4.739832664 2.211853881 0.466652314 0.6967767 782069 10.94510262 14.38429457 7.505910662 0.521812914 0.6967767 540332 12.1026216 15.88598802 8.319255175 0.523685097 0.6967767 ENSBTAG00000000074 15.09776623 18.55818402 11.63734843 0.627073663 0.6967767 ENSBTAG00000038221 63.33859607 74.71042419 51.96676795 0.695575865 0.6967767 ENSBTAG00000007784 9519.558535 11195.39552 7843.721548 0.700620316 0.6967767 ENSBTAG00000024187 17.66376211 20.67268809 14.65483612 0.70889843 0.6967767 ENSBTAG00000000988 1213.440452 1414.152964 1012.72794 0.71613748 0.6967767 789271 63.32027765 73.62575697 53.01479833 0.720057769 0.6967767 ENSBTAG00000017418 89.36180956 102.3449105 76.37870862 0.746287317 0.6967767 768033 2443.791977 2088.721761 2798.862193 1.339988047 0.6967767 ENSBTAG00000018295 680.4883853 552.1360559 808.8407147 1.464930077 0.6967767 ENSBTAG00000013178 55.02532925 40.54787185 69.50278665 1.714092096 0.6967767 ENSBTAG00000011149 25.90653472 18.41210642 33.40096302 1.814076144 0.6967767 ENSBTAG00000032166 2486.858988 2899.666675 2074.051301 0.715272317 0.6972878 ENSBTAG00000010568 502.4367672 593.8127456 411.0607888 0.692239754 0.6976753 100313220 4.452484792 5.62927068 3.275698904 0.581904671 0.6979024 ENSBTAG00000039340 320.3101943 366.1568111 274.4635775 0.749579331 0.6979024 100336412 19.44015556 23.92954629 14.95076484 0.624782629 0.6980755 ENSBTAG00000015557 3.089833875 4.705098496 1.474569254 0.313398169 0.6982881 ENSBTAG00000032144 48.34711025 58.5231227 38.1710978 0.652239594 0.6985423 ENSBTAG00000016900 975.3165389 839.6075246 1111.025553 1.323267742 0.6985465 506237 3.066253177 4.065872789 2.066633565 0.508287807 0.6991292 786156 3.401399192 1.447685123 5.355113261 3.69908703 0.6996917 ENSBTAG00000015452 3.035556938 4.158429445 1.912684432 0.459953561 0.7001041 ENSBTAG00000014471 9.410590974 12.55577955 6.265402402 0.499005448 0.7001041 ENSBTAG00000033211 10.77451289 13.76483042 7.784195369 0.565513351 0.7001041 ENSBTAG00000022489 266.0366857 309.8021202 222.2712512 0.717462008 0.7001041 ENSBTAG00000013408 258.5845181 305.8459887 211.3230474 0.690945951 0.7003216 524456 385.8950898 442.3629488 329.4272307 0.744698966 0.7003216 ENSBTAG00000003124 1594.217553 1357.364372 1831.070735 1.348989831 0.7003216 ENSBTAG00000005469 75.63255754 86.34709166 64.91802343 0.751826404 0.7003855 ENSBTAG00000008555 11.79954171 14.65815038 8.940933044 0.60996325 0.7004047 ENSBTAG00000013938 136.1938192 157.156927 115.2307114 0.733220696 0.7004047 ENSBTAG00000004070 0.733429339 1.201354763 0.265503915 0.221003756 0.7004194 ENSBTAG00000040201 0.733429339 1.201354763 0.265503915 0.221003756 0.7004194 ENSBTAG00000040344 0.733429339 1.201354763 0.265503915 0.221003756 0.7004194 100336470 381.3189022 421.9483768 340.6894276 0.80741969 0.7004194 ENSBTAG00000034004 2.990956576 4.323781206 1.658131947 0.383491178 0.7004924 ENSBTAG00000011300 4.817650967 6.441544253 3.193757681 0.495806216 0.7004924 ENSBTAG00000016552 18.8072711 22.45870505 15.15583714 0.674831301 0.7004924 ENSBTAG00000005897 135.036007 153.7135783 116.3584357 0.756982154 0.7004924 ENSBTAG00000035802 169.3661517 191.73637 146.9959333 0.766656495 0.7004924 ENSBTAG00000014153 1317.844962 1478.162671 1157.527253 0.783085161 0.7004924 ENSBTAG00000004413 137.7846844 111.4796539 164.0897149 1.471925227 0.7004924 ENSBTAG00000014205 124.0548111 101.5352729 146.5743493 1.443580591 0.7009574 ENSBTAG00000009050 767.6585195 639.4293783 895.8876607 1.401073662 0.7011757 528877 5.61178843 7.558038467 3.665538393 0.484985411 0.7013032 538717 9.027715775 11.60463709 6.450794456 0.555880757 0.7013032 538905 1726.892659 1908.088554 1545.696765 0.810076011 0.7013032 ENSBTAG00000019834 1432.891248 1207.112374 1658.670123 1.374080955 0.7014202 527833 3.008290978 4.712794602 1.303787354 0.276648457 0.7014983

PAGE 117

ENSBTAG00000035226 45.03772979 52.36417293 37.71128664 0.720173442 0.7014983 518878 91.04131811 107.0233227 75.05931349 0.701336041 0.7017519 ENSBTAG00000022681 1781.23562 2021.582874 1540.888366 0.762218747 0.7017519 ENSBTAG00000014032 8173.004088 6987.571709 9358.436467 1.339297378 0.7017519 ENSBTAG00000020398 375.3067884 305.2883011 445.3252756 1.458704031 0.7021672 ENSBTAG00000008553 6.699274419 3.303725597 10.09482324 3.055587682 0.7023727 ENSBTAG00000006453 153.7073386 180.8291158 126.5855615 0.700028649 0.7027787 ENSBTAG00000009072 193.7104243 159.037433 228.3834156 1.4360356 0.7027787 ENSBTAG00000015212 36.28077192 45.51746451 27.04407934 0.594147315 0.7028313 ENSBTAG00000011333 315.0180436 264.1240885 365.9119986 1.385379125 0.7028313 503551 2.895175925 4.096725008 1.693626843 0.413409941 0.7032395 ENSBTAG00000013025 1047.470786 871.6243775 1223.317194 1.403491258 0.7032689 ENSBTAG00000006615 5.771424496 7.542646254 4.000202739 0.530344736 0.7033269 100300920 11.56508206 14.30768531 8.822478807 0.616625164 0.7033269 ENSBTAG00000001600 241.9589805 290.7416383 193.1763228 0.664426066 0.7033269 ENSBTAG00000004037 577.5519204 678.9041309 476.19971 0.701424087 0.7034232 ENSBTAG00000000563 186.4023932 147.831455 224.9733314 1.521823156 0.7034232 100336182 162.1584162 187.4324182 136.8844142 0.730313441 0.7035643 ENSBTAG00000033535 6712.993185 7546.716774 5879.269595 0.779049986 0.703676 536747 8.884550073 11.69719375 6.071906397 0.519090863 0.703803 780962 694.2909206 783.4681934 605.1136478 0.772352538 0.7046062 617808 224.4739436 190.2495814 258.6983059 1.359783838 0.7046062 614948 127.0097991 97.95117357 156.0684247 1.593328788 0.7047272 ENSBTAG00000012805 1245.707644 1089.966033 1401.449256 1.28577333 0.7050847 ENSBTAG00000030594 23.00868935 16.28276532 29.73461338 1.826140265 0.7053575 100138523 2.81649935 4.158429445 1.474569254 0.354597637 0.7055807 ENSBTAG00000008614 70.81110461 83.40423103 58.2179782 0.698021881 0.7056212 ENSBTAG00000033222 2765.375982 3141.731051 2389.020914 0.760415476 0.7057739 ENSBTAG00000008144 9.559424964 5.236375334 13.88247459 2.651161101 0.7058374 539572 50.69378741 63.29415938 38.09341543 0.601847245 0.7060219 ENSBTAG00000033738 2.877478781 4.362329531 1.392628031 0.319239531 0.7060903 509992 16.94355448 21.73843295 12.14867601 0.558857027 0.7060903 ENSBTAG00000026505 8.707639572 11.08882026 6.326458882 0.570525875 0.7061865 ENSBTAG00000003981 79.45122917 94.24769571 64.65476262 0.686008948 0.7061865 ENSBTAG00000013900 673.8713078 552.3684734 795.3741423 1.439933995 0.7061865 ENSBTAG00000020698 85.36143372 68.95435008 101.7685174 1.475882482 0.7061865 ENSBTAG00000020279 66.21443643 48.81848631 83.61038655 1.7126788 0.7061865 ENSBTAG00000032237 3.047198554 1.67474132 4.419655787 2.639008027 0.7061865 100300267 2.862672001 4.362329531 1.363014472 0.312451057 0.7062141 ENSBTAG00000017419 3792.036136 3326.399112 4257.67316 1.279964615 0.7063639 ENSBTAG00000006838 447.9134501 362.5939226 533.2329776 1.470606495 0.7063639 ENSBTAG00000002962 6.898650881 3.292147541 10.50515422 3.190973092 0.7063639 ENSBTAG00000039920 3.162240111 4.712794602 1.61168562 0.341980875 0.706391 528650 12.45126271 9.05584997 15.84667544 1.749882727 0.706391 ENSBTAG00000045306 8.679084648 11.31587646 6.042292838 0.53396596 0.7063972 ENSBTAG00000030340 3.01358569 1.447685123 4.579486258 3.163316515 0.70644 535652 5.595109281 7.284737838 3.905480724 0.536118226 0.7065318 ENSBTAG00000020717 9.00938492 11.65864542 6.360124416 0.545528591 0.7065318 ENSBTAG00000011399 4929.10866 5454.390495 4403.826825 0.807391189 0.7065318 ENSBTAG00000007204 74.37763853 61.13494084 87.62033622 1.433228445 0.7065318 ENSBTAG00000045478 2.998159581 1.416832904 4.579486258 3.232199255 0.7065318 ENSBTAG00000018560 11.1678198 14.66584649 7.669793107 0.522969684 0.7066398

PAGE 118

ENSBTAG00000006201 107.3423208 131.2007928 83.48384886 0.636305979 0.7067424 616379 721.1716907 828.8646816 613.4786997 0.740143371 0.7067424 529829 21.43989702 16.82167047 26.05812356 1.54908061 0.7068345 525419 0.780790346 1.201354763 0.36022593 0.299849754 0.7068549 ENSBTAG00000008274 0.780790346 1.201354763 0.36022593 0.299849754 0.7068549 ENSBTAG00000014720 0.780790346 1.201354763 0.36022593 0.299849754 0.7068549 ENSBTAG00000019591 0.780790346 1.201354763 0.36022593 0.299849754 0.7068549 ENSBTAG00000023556 0.780790346 1.201354763 0.36022593 0.299849754 0.7068549 ENSBTAG00000024891 0.780790346 1.201354763 0.36022593 0.299849754 0.7068549 ENSBTAG00000037424 0.780790346 1.201354763 0.36022593 0.299849754 0.7068549 ENSBTAG00000039170 0.780790346 1.201354763 0.36022593 0.299849754 0.7068549 510761 2.801586894 4.269772875 1.333400913 0.312288487 0.7068549 ENSBTAG00000014995 12.26576243 16.07110134 8.460423516 0.526437071 0.7068549 ENSBTAG00000005284 15.19322971 19.77056166 10.61589776 0.536954789 0.7068549 ENSBTAG00000040437 9.704220158 12.37836234 7.030077975 0.567932799 0.7068549 100335258 7.662483362 9.417960891 5.907005834 0.627206452 0.7068549 ENSBTAG00000025593 244.2633711 292.3790094 196.1477327 0.670868039 0.7068549 ENSBTAG00000013078 286.0511641 338.6816966 233.4206315 0.689203562 0.7068549 524925 2429.047017 2861.944336 1996.149697 0.697480266 0.7068549 ENSBTAG00000016851 3829.088926 3323.518206 4334.659647 1.304238274 0.7068549 515222 45.5347677 32.72034691 58.34918848 1.783269249 0.7068549 523485 6.054446853 3.238139211 8.870754496 2.739460511 0.7068549 100335531 2.669202408 3.550055957 1.788348858 0.503752301 0.7072476 ENSBTAG00000038759 36.2528065 44.58226945 27.92334355 0.626332932 0.7072476 ENSBTAG00000010336 719.6675487 562.252667 877.0824304 1.559943566 0.7072476 ENSBTAG00000009915 152.6730745 112.8876169 192.458532 1.704868411 0.7072476 ENSBTAG00000004598 1050.251277 908.6123992 1191.890154 1.311769634 0.7072652 ENSBTAG00000013221 72.32638767 85.04867532 59.60410002 0.700823379 0.7076278 533883 2.886309448 1.447685123 4.324933773 2.987482364 0.7076853 ENSBTAG00000015769 8.885668676 11.68949764 6.081839709 0.520282385 0.7078949 ENSBTAG00000007071 44.27937095 53.18019287 35.37854903 0.665258005 0.7080813 ENSBTAG00000017814 56.8196626 68.46938546 45.16993973 0.659710021 0.7080888 ENSBTAG00000036087 25.12187586 17.38435471 32.85939701 1.890170648 0.7080888 ENSBTAG00000023563 6.357602575 3.907729747 8.807475402 2.253859906 0.7080888 ENSBTAG00000004023 2.861314522 1.705593539 4.017035506 2.355212666 0.7080888 ENSBTAG00000003947 26.51994255 33.43174475 19.60814035 0.586512624 0.7081937 ENSBTAG00000012077 3282.046385 3779.151586 2784.941184 0.736922328 0.7081937 ENSBTAG00000013068 840.8314255 734.2845319 947.3783191 1.290206014 0.7081937 ENSBTAG00000024839 79.51836609 62.43570917 96.60102301 1.547207909 0.7081937 ENSBTAG00000002675 2.843898622 0.901016072 4.786781172 5.312647933 0.7081937 359712 152.7231479 118.0429458 187.40335 1.587586185 0.708399 ENSBTAG00000012449 2.604093952 3.550055957 1.658131947 0.467072059 0.7085664 ENSBTAG00000044834 334.5021205 257.496397 411.5078439 1.598111075 0.7085664 ENSBTAG00000009785 5.447233823 3.134004499 7.760463147 2.476213148 0.7085664 ENSBTAG00000019428 12.88202589 15.80937876 9.954673017 0.629668829 0.7085841 ENSBTAG00000007537 1422.405751 1197.515157 1647.296344 1.375595402 0.7085841 ENSBTAG00000018348 409.1059528 477.3450812 340.8668243 0.714088901 0.7088158 782293 48.74282841 37.80183818 59.68381863 1.578860222 0.7088158 ENSBTAG00000007998 2.802418952 0.901016072 4.703821832 5.220574835 0.7088981 ENSBTAG00000004994 2.702865575 4.042716677 1.363014472 0.337153103 0.7091204 785088 8.070060363 10.77690351 5.363217211 0.49765846 0.709379 785659 7.749328907 10.14537391 5.353283899 0.527657624 0.709379

PAGE 119

ENSBTAG00000013001 23.9853224 30.92059897 17.05004582 0.551413827 0.709379 ENSBTAG00000020070 18.63716449 23.72897297 13.54535602 0.570836169 0.709379 ENSBTAG00000002191 20.56975585 24.8999629 16.23954879 0.652191686 0.709379 ENSBTAG00000012537 802.2769641 944.795369 659.7585592 0.698308418 0.709379 ENSBTAG00000003866 3058.196432 3504.915313 2611.477551 0.745090057 0.709379 ENSBTAG00000003849 2423.737803 2725.363795 2122.111811 0.778652676 0.709379 ENSBTAG00000013591 420.8811898 363.0687798 478.6935997 1.318465333 0.709379 ENSBTAG00000008730 640.26278 530.2001559 750.3254041 1.415173866 0.709379 ENSBTAG00000018857 541.9382515 440.1499425 643.7265605 1.462516516 0.709379 ENSBTAG00000030581 34.6416295 25.26540059 44.0178584 1.742218899 0.709379 ENSBTAG00000022835 17.80771359 12.76404897 22.85137821 1.790292271 0.709379 ENSBTAG00000024125 5.882726228 3.557752064 8.207700393 2.306990551 0.709379 ENSBTAG00000014696 6.743460721 3.723103824 9.763817618 2.622494048 0.709379 ENSBTAG00000027692 1.249865501 2.263840645 0.235890356 0.104199188 0.7111925 ENSBTAG00000031420 1.234439391 2.232988427 0.235890356 0.105638862 0.7111925 ENSBTAG00000044937 1.234439391 2.232988427 0.235890356 0.105638862 0.7111925 ENSBTAG00000003088 1.310950608 2.356397301 0.265503915 0.112673663 0.7111925 ENSBTAG00000034187 1.310950608 2.356397301 0.265503915 0.112673663 0.7111925 526835 1.151763511 2.067636667 0.235890356 0.114086948 0.7111925 ENSBTAG00000024070 1.151763511 2.067636667 0.235890356 0.114086948 0.7111925 ENSBTAG00000031100 1.151763511 2.067636667 0.235890356 0.114086948 0.7111925 ENSBTAG00000039730 1.151763511 2.067636667 0.235890356 0.114086948 0.7111925 504208 1.28009839 2.294692864 0.265503915 0.115703465 0.7111925 505220 1.28009839 2.294692864 0.265503915 0.115703465 0.7111925 ENSBTAG00000012414 1.28009839 2.294692864 0.265503915 0.115703465 0.7111925 ENSBTAG00000021272 1.28009839 2.294692864 0.265503915 0.115703465 0.7111925 527790 1.136337402 2.036784448 0.235890356 0.115815081 0.7111925 ENSBTAG00000040445 1.136337402 2.036784448 0.235890356 0.115815081 0.7111925 100138844 1.26467228 2.263840645 0.265503915 0.117280302 0.7111925 ENSBTAG00000001864 1.26467228 2.263840645 0.265503915 0.117280302 0.7111925 ENSBTAG00000043233 1.120911293 2.005932229 0.235890356 0.117596374 0.7111925 ENSBTAG00000044209 1.249246171 2.232988427 0.265503915 0.118900713 0.7111925 ENSBTAG00000006139 1.105485183 1.975080011 0.235890356 0.119433316 0.7111925 ENSBTAG00000021568 1.105485183 1.975080011 0.235890356 0.119433316 0.7111925 ENSBTAG00000012205 1.135718072 2.005932229 0.265503915 0.132359365 0.7111925 ENSBTAG00000031761 1.007383194 1.778876032 0.235890356 0.132606405 0.7111925 ENSBTAG00000038590 1.007383194 1.778876032 0.235890356 0.132606405 0.7111925 100336098 0.991957085 1.748023813 0.235890356 0.134946878 0.7111925 ENSBTAG00000031198 0.991957085 1.748023813 0.235890356 0.134946878 0.7111925 ENSBTAG00000004751 0.976530975 1.717171595 0.235890356 0.137371452 0.7111925 100337038 1.022189974 1.778876032 0.265503915 0.149253748 0.7111925 786060 1.022189974 1.778876032 0.265503915 0.149253748 0.7111925 ENSBTAG00000017390 1.022189974 1.778876032 0.265503915 0.149253748 0.7111925 ENSBTAG00000018981 1.022189974 1.778876032 0.265503915 0.149253748 0.7111925 ENSBTAG00000033774 1.022189974 1.778876032 0.265503915 0.149253748 0.7111925 ENSBTAG00000007265 1.358311616 2.356397301 0.36022593 0.152871475 0.7111925 537652 0.991337755 1.717171595 0.265503915 0.154616997 0.7111925 ENSBTAG00000038757 0.991337755 1.717171595 0.265503915 0.154616997 0.7111925 ENSBTAG00000040609 0.991337755 1.717171595 0.265503915 0.154616997 0.7111925 ENSBTAG00000042270 0.991337755 1.717171595 0.265503915 0.154616997 0.7111925 ENSBTAG00000042981 0.991337755 1.717171595 0.265503915 0.154616997 0.7111925 ENSBTAG00000015895 1.327459397 2.294692864 0.36022593 0.156982198 0.7111925

PAGE 120

ENSBTAG00000009538 0.863002877 1.490115397 0.235890356 0.158303415 0.7111925 ENSBTAG00000020078 0.863002877 1.490115397 0.235890356 0.158303415 0.7111925 ENSBTAG00000038273 0.863002877 1.490115397 0.235890356 0.158303415 0.7111925 ENSBTAG00000013384 1.312033288 2.263840645 0.36022593 0.159121593 0.7111925 ENSBTAG00000044257 1.296607178 2.232988427 0.36022593 0.161320106 0.7111925 524985 0.847576767 1.459263179 0.235890356 0.161650317 0.7111925 ENSBTAG00000002705 0.847576767 1.459263179 0.235890356 0.161650317 0.7111925 ENSBTAG00000014508 0.847576767 1.459263179 0.235890356 0.161650317 0.7111925 ENSBTAG00000017871 0.847576767 1.459263179 0.235890356 0.161650317 0.7111925 ENSBTAG00000035259 0.847576767 1.459263179 0.235890356 0.161650317 0.7111925 ENSBTAG00000039228 0.847576767 1.459263179 0.235890356 0.161650317 0.7111925 ENSBTAG00000044465 0.847576767 1.459263179 0.235890356 0.161650317 0.7111925 ENSBTAG00000005568 1.213931298 2.067636667 0.36022593 0.174221098 0.7111925 ENSBTAG00000006877 1.213931298 2.067636667 0.36022593 0.174221098 0.7111925 100335861 1.198505189 2.036784448 0.36022593 0.176860114 0.7111925 ENSBTAG00000042785 1.198505189 2.036784448 0.36022593 0.176860114 0.7111925 505861 0.877809656 1.490115397 0.265503915 0.178176748 0.7111925 540677 0.877809656 1.490115397 0.265503915 0.178176748 0.7111925 100139141 0.862383547 1.459263179 0.265503915 0.181943819 0.7111925 100140982 0.862383547 1.459263179 0.265503915 0.181943819 0.7111925 100335169 0.862383547 1.459263179 0.265503915 0.181943819 0.7111925 790995 0.862383547 1.459263179 0.265503915 0.181943819 0.7111925 ENSBTAG00000032878 0.862383547 1.459263179 0.265503915 0.181943819 0.7111925 ENSBTAG00000045455 0.862383547 1.459263179 0.265503915 0.181943819 0.7111925 100313295 1.069550981 1.778876032 0.36022593 0.202501986 0.7111925 ENSBTAG00000037561 1.069550981 1.778876032 0.36022593 0.202501986 0.7111925 ENSBTAG00000042254 1.069550981 1.778876032 0.36022593 0.202501986 0.7111925 ENSBTAG00000045344 1.069550981 1.778876032 0.36022593 0.202501986 0.7111925 ENSBTAG00000044847 1.054124872 1.748023813 0.36022593 0.2060761 0.7111925 507012 1.038698762 1.717171595 0.36022593 0.209778645 0.7111925 533492 1.038698762 1.717171595 0.36022593 0.209778645 0.7111925 100335694 0.925170664 1.490115397 0.36022593 0.241743647 0.7111925 530330 0.925170664 1.490115397 0.36022593 0.241743647 0.7111925 617470 0.925170664 1.490115397 0.36022593 0.241743647 0.7111925 ENSBTAG00000008125 0.925170664 1.490115397 0.36022593 0.241743647 0.7111925 100300779 0.909744554 1.459263179 0.36022593 0.24685467 0.7111925 504454 0.909744554 1.459263179 0.36022593 0.24685467 0.7111925 ENSBTAG00000011191 0.909744554 1.459263179 0.36022593 0.24685467 0.7111925 280969 2.512362909 3.81566048 1.209065339 0.316869214 0.7111925 100313296 2.559723917 3.81566048 1.303787354 0.341693754 0.7111925 784509 2.367982592 3.526899845 1.209065339 0.342812496 0.7111925 509005 2.352556483 3.496047627 1.209065339 0.345837777 0.7111925 ENSBTAG00000038215 2.605846265 3.753956043 1.457736487 0.388320074 0.7111925 ENSBTAG00000000726 2.569912062 3.557752064 1.582072061 0.444683056 0.7111925 518597 2.363363958 3.268991429 1.457736487 0.445928513 0.7111925 ENSBTAG00000000654 2.539059844 3.496047627 1.582072061 0.45253161 0.7111925 788169 3.798222853 5.182367003 2.414078703 0.4658255 0.7111925 ENSBTAG00000029935 8.733555989 11.87793772 5.589174255 0.470550897 0.7111925 ENSBTAG00000010269 11.32981784 15.38556341 7.274072281 0.472785565 0.7111925 785776 7.669569651 10.29963501 5.039504295 0.4892896 0.7111925 528184 8.429369245 11.26956423 5.589174255 0.495953006 0.7111925 ENSBTAG00000026097 7.65863024 10.05281726 5.264443221 0.523678396 0.7111925

PAGE 121

615688 7.999713944 10.48814288 5.511285007 0.525477682 0.7111925 ENSBTAG00000008908 8.20908266 10.70750297 5.710662349 0.533332782 0.7111925 ENSBTAG00000037890 11.58623574 15.08910666 8.083364819 0.535708641 0.7111925 539742 19.84326025 25.68519841 14.00132208 0.545112475 0.7111925 ENSBTAG00000003332 20.0724818 25.9541975 14.19076611 0.546761891 0.7111925 100336002 22.11870901 28.35302507 15.88439295 0.560236268 0.7111925 ENSBTAG00000006720 8.324156922 10.51129899 6.137014852 0.583849328 0.7111925 ENSBTAG00000001465 31.73500209 39.9957231 23.47428107 0.586919782 0.7111925 ENSBTAG00000018773 45.04376855 56.55899777 33.52853933 0.592806461 0.7111925 781113 63.64246373 78.890412 48.39451547 0.613439761 0.7111925 ENSBTAG00000043960 10.29629993 12.64452205 7.948077814 0.628578746 0.7111925 ENSBTAG00000000706 131.5795557 158.5000535 104.6590579 0.66030929 0.7111925 ENSBTAG00000003017 34.13686929 41.03616324 27.23757534 0.663745662 0.7111925 520376 108.7265364 130.2150518 87.23802106 0.669953434 0.7111925 ENSBTAG00000013159 149.1671167 178.0269251 120.3073084 0.675781533 0.7111925 511200 295.9268764 352.4471628 239.40659 0.679269449 0.7111925 ENSBTAG00000000603 46.69377522 55.53852257 37.84902787 0.681491443 0.7111925 ENSBTAG00000010350 651.428845 774.248555 528.609135 0.682738291 0.7111925 ENSBTAG00000007566 418.8423722 497.4503425 340.2344019 0.683956514 0.7111925 ENSBTAG00000040058 279.3873488 329.9148406 228.8598569 0.693693732 0.7111925 ENSBTAG00000020272 29.96166702 35.36453007 24.55880397 0.694447344 0.7111925 ENSBTAG00000006945 854.6288555 1007.449476 701.8082347 0.69661879 0.7111925 ENSBTAG00000009746 982.8880176 1158.131065 807.6449699 0.697369231 0.7111925 ENSBTAG00000017218 1512.497397 1778.839082 1246.155712 0.700544374 0.7111925 ENSBTAG00000021671 1246.45912 1464.932477 1027.985762 0.701729109 0.7111925 ENSBTAG00000014766 38964.05184 45781.11996 32146.98372 0.70218867 0.7111925 ENSBTAG00000037555 450.6025257 528.4438558 372.7611955 0.705394133 0.7111925 ENSBTAG00000009226 6.612139493 7.723945408 5.500333577 0.712114507 0.7111925 507211 171.3994663 198.4830247 144.315908 0.727094461 0.7111925 ENSBTAG00000033510 7087.989772 8193.2066 5982.772944 0.73021141 0.7111925 ENSBTAG00000011498 435.0697319 502.6611462 367.4783175 0.73106569 0.7111925 ENSBTAG00000007665 31.66185974 36.52831129 26.79540819 0.733551792 0.7111925 ENSBTAG00000019509 597.7596744 688.7805822 506.7387666 0.735704199 0.7111925 ENSBTAG00000004715 2908.66943 3338.293746 2479.045114 0.742608441 0.7111925 ENSBTAG00000010001 1808.165495 2073.378264 1542.952726 0.744173291 0.7111925 ENSBTAG00000001728 54.94138051 62.97233012 46.91043089 0.744937194 0.7111925 100140757 31.68056636 36.29737314 27.06375958 0.745612072 0.7111925 ENSBTAG00000034033 790.649257 902.7210756 678.5774383 0.751702222 0.7111925 ENSBTAG00000017177 4627.31876 5267.854084 3986.783436 0.756813566 0.7111925 ENSBTAG00000014297 899.7807603 1005.45091 794.1106106 0.789805452 0.7111925 ENSBTAG00000002701 5816.647932 6465.152562 5168.143302 0.799384586 0.7111925 ENSBTAG00000018112 103.0373621 114.1192687 91.95545542 0.805783778 0.7111925 ENSBTAG00000011883 3992.947237 3521.63561 4464.258864 1.267666323 0.7111925 100336381 450.9637054 397.4038927 504.5235181 1.269548506 0.7111925 ENSBTAG00000033186 1461.893225 1257.711423 1666.075028 1.324687839 0.7111925 ENSBTAG00000006107 799.2796554 683.434389 915.1249218 1.339009181 0.7111925 ENSBTAG00000003902 1362.083064 1164.156787 1560.009341 1.340033712 0.7111925 ENSBTAG00000027738 440.3775076 376.0971746 504.6578407 1.341828322 0.7111925 ENSBTAG00000008361 102.5407717 87.29255103 117.7889923 1.349359034 0.7111925 ENSBTAG00000002512 795.2472367 676.2629991 914.2314743 1.351887469 0.7111925 ENSBTAG00000017753 1873.984147 1562.035865 2185.93243 1.399412445 0.7111925 ENSBTAG00000022902 253.9428236 211.3551582 296.530489 1.402996225 0.7111925

PAGE 122

784403 98.05818107 80.69051175 115.4258504 1.430476123 0.7111925 615465 999.0929571 813.6671808 1184.518733 1.455777941 0.7111925 510014 60.87614621 49.51393676 72.23835566 1.458949952 0.7111925 ENSBTAG00000016465 332.6452572 265.3866646 399.9038497 1.506872436 0.7111925 ENSBTAG00000017710 60.52753925 48.04802004 73.00705847 1.51946029 0.7111925 616109 251.4755741 198.372173 304.5789753 1.535391636 0.7111925 ENSBTAG00000023259 166.5607121 131.0676748 202.0537494 1.541598641 0.7111925 ENSBTAG00000014667 23.78283446 18.66225094 28.90341799 1.548763763 0.7111925 ENSBTAG00000040296 49.25665189 37.18188664 61.33141714 1.64949718 0.7111925 ENSBTAG00000044613 100.5305369 75.02296391 126.0381099 1.679993743 0.7111925 ENSBTAG00000006013 59.46941822 44.04724625 74.89159019 1.700255897 0.7111925 519552 12.97331632 9.440561822 16.50607082 1.748420394 0.7111925 ENSBTAG00000004344 21.78920535 15.6203835 27.9580272 1.78984256 0.7111925 515838 19.46303701 13.78798653 25.13808748 1.823187703 0.7111925 ENSBTAG00000015829 19.69565293 13.68773377 25.70357209 1.877854474 0.7111925 ENSBTAG00000019054 5.698520162 3.846512698 7.550527626 1.962954036 0.7111925 100301381 8.475070361 5.575262349 11.37487837 2.040240918 0.7111925 ENSBTAG00000005832 22.72910023 14.94309686 30.51510361 2.042086985 0.7111925 100336899 5.975953871 3.742377987 8.209529754 2.193666643 0.7111925 ENSBTAG00000031354 4.63006867 2.864518027 6.395619313 2.232703461 0.7111925 ENSBTAG00000022471 3.857967229 2.30627092 5.409663538 2.345632289 0.7111925 ENSBTAG00000005351 5.848701672 3.422765134 8.27463821 2.417530239 0.7111925 ENSBTAG00000009111 8.726833701 4.936036643 12.51763076 2.535967957 0.7111925 537248 4.565603588 2.575757392 6.555449783 2.545057156 0.7111925 ENSBTAG00000023068 3.836220476 2.079214723 5.59322623 2.690066672 0.7111925 ENSBTAG00000005846 5.453584581 2.918526357 7.988642804 2.737217974 0.7111925 ENSBTAG00000012985 4.970887148 2.649039885 7.29273441 2.752972672 0.7111925 ENSBTAG00000036099 4.664632411 2.317848976 7.011415845 3.024966647 0.7111925 ENSBTAG00000040304 4.617659064 2.275418702 6.959899426 3.058733507 0.7111925 ENSBTAG00000001349 4.556366319 2.05994056 7.052792079 3.423784266 0.7111925 ENSBTAG00000003512 3.714282076 1.490115397 5.938448755 3.98522743 0.7111925 ENSBTAG00000007776 25.10659178 31.10238551 19.11079805 0.614447983 0.7126775 ENSBTAG00000002422 105.4849245 122.5000484 88.4698005 0.722202168 0.7126775 ENSBTAG00000043307 3.667566636 4.986163024 2.348970247 0.471097763 0.7131153 ENSBTAG00000004388 9.037468196 11.012211 7.062725391 0.641353983 0.7131153 ENSBTAG00000016721 74.41783752 90.10312852 58.73254651 0.651836928 0.713174 ENSBTAG00000013476 16.28455103 18.7130003 13.85610177 0.740453244 0.713174 784095 16.30167915 18.68214808 13.92121022 0.745161111 0.713174 ENSBTAG00000016109 19.04722943 13.77640847 24.31805039 1.765195221 0.713174 ENSBTAG00000000805 10.80318166 14.17651254 7.429850776 0.524095807 0.7132234 ENSBTAG00000020459 35.97146019 43.58106841 28.36185198 0.650783769 0.7132234 ENSBTAG00000025859 2889.837591 2517.762189 3261.912993 1.295560402 0.7132234 ENSBTAG00000019173 10.14039833 5.898757152 14.3820395 2.438147415 0.7132234 100140708 3.579139027 1.717171595 5.441106459 3.168644575 0.7132234 527517 2.268641943 3.268991429 1.268292457 0.387976685 0.7134952 ENSBTAG00000037444 62.89421349 72.4740412 53.31438577 0.735634234 0.7135993 ENSBTAG00000012012 842.3001522 717.2408147 967.3594897 1.348723427 0.7135993 ENSBTAG00000035378 2.255537173 3.207286992 1.303787354 0.406507854 0.7139482 ENSBTAG00000006709 2.250299209 2.918526357 1.582072061 0.542079073 0.7141505 100299346 2.237789725 3.207286992 1.268292457 0.395440901 0.7143366 ENSBTAG00000019698 16.73281651 20.95652421 12.50910882 0.596907612 0.7143366 ENSBTAG00000009937 41.61710277 49.64178276 33.59242279 0.676696543 0.7143366

PAGE 123

ENSBTAG00000012405 434.1437802 494.8413174 373.446243 0.754678783 0.7143366 ENSBTAG00000044185 7.958887545 4.759106826 11.15866826 2.344698001 0.7143366 100336377 10.98423112 13.22204331 8.746418922 0.661502819 0.7144754 ENSBTAG00000011890 4.553485445 6.102657237 3.004313652 0.492295984 0.7147316 782669 3296.524229 2942.27714 3650.771318 1.240797907 0.7148205 ENSBTAG00000003608 95.34124929 115.6947955 74.98770308 0.648151049 0.7152489 ENSBTAG00000031834 456.4459645 504.7544524 408.1374767 0.808586184 0.7152489 ENSBTAG00000037672 765.4921432 653.3427696 877.6415167 1.34330945 0.7152489 ENSBTAG00000002190 17.31941249 10.64247177 23.99635321 2.254772551 0.7152489 784501 5.962041136 8.201146123 3.72293615 0.453953154 0.7153902 ENSBTAG00000012403 832.1711246 949.6178123 714.7244369 0.752644303 0.7157472 ENSBTAG00000040244 6130.036546 6825.819015 5434.254076 0.796132166 0.7157472 535541 7519.002305 8249.874074 6788.130536 0.822816261 0.7157472 ENSBTAG00000019011 553.8052099 448.5269801 659.0834396 1.469439897 0.7157472 504509 253.9001821 293.752306 214.0480583 0.728668521 0.7160565 100190915 4.497018971 6.268008998 2.726028944 0.43491146 0.7161237 ENSBTAG00000007256 7.845822796 4.408641755 11.28300384 2.559292513 0.7161237 ENSBTAG00000010792 10197.94252 11447.34869 8948.536345 0.781712568 0.7162889 ENSBTAG00000002763 31.39621003 38.12914714 24.66327292 0.646835158 0.7162901 ENSBTAG00000039343 20.4665897 24.8189843 16.1141951 0.649268919 0.716433 524676 7.642171755 10.38012622 4.904217291 0.472462202 0.7164636 ENSBTAG00000032366 3.512998173 4.955310805 2.07068554 0.41787198 0.7167985 ENSBTAG00000037321 13.57465006 16.59080012 10.5585 0.63640692 0.7167985 ENSBTAG00000038295 12.53593455 15.18554527 9.88632383 0.651035156 0.7167985 531339 395.3080077 362.7219933 427.894022 1.179674875 0.7167985 ENSBTAG00000012234 3.434734666 1.748023813 5.121445518 2.929848826 0.7167985 ENSBTAG00000021858 3360.025954 3703.565953 3016.485955 0.814481501 0.7168191 ENSBTAG00000034769 3.507760209 4.666550171 2.348970247 0.503363333 0.7168689 ENSBTAG00000043268 4.451515953 6.360565654 2.542466252 0.399723294 0.7168731 527379 21.44214704 27.05141755 15.83287654 0.585288239 0.7168731 ENSBTAG00000012441 4.213336773 2.337123139 6.089550408 2.605575336 0.7168731 ENSBTAG00000043353 827.3854067 878.3503389 776.4204745 0.883953065 0.7169156 ENSBTAG00000014313 6.418378991 8.482210651 4.354547332 0.513374109 0.7173261 ENSBTAG00000011902 103.3153215 75.5976458 131.0329973 1.73329468 0.7173261 ENSBTAG00000018424 204.8821616 254.1076288 155.6566943 0.612562067 0.7173729 ENSBTAG00000007777 9.807632617 5.837052715 13.77821252 2.360474231 0.7173729 ENSBTAG00000012352 78.9356005 63.13275737 94.73844363 1.500622618 0.7176933 ENSBTAG00000008921 52.10356691 65.788383 38.41875083 0.583974694 0.7178395 ENSBTAG00000007315 795.3112169 918.6814015 671.9410322 0.731419 0.7178681 ENSBTAG00000037405 0.986737083 1.501693453 0.471780712 0.314165791 0.7180386 ENSBTAG00000044328 3905.414713 3263.040977 4547.788449 1.393727042 0.7180415 ENSBTAG00000006712 536.1240402 447.0927334 625.1553471 1.398267743 0.7180415 ENSBTAG00000026278 331.1663111 248.9974169 413.3352052 1.659997964 0.7180415 ENSBTAG00000003014 6.369340018 8.224302235 4.514377802 0.548907089 0.7180505 ENSBTAG00000015930 69.28490251 82.6300184 55.93978662 0.676991095 0.7180505 ENSBTAG00000011284 954.0093357 1073.35851 834.6601619 0.777615451 0.7180505 ENSBTAG00000011258 2418.942342 2145.373994 2692.510691 1.255030917 0.7180505 ENSBTAG00000015311 3.445592422 4.666550171 2.224634673 0.476719331 0.7181577 ENSBTAG00000016525 3.730404056 5.282619765 2.178188347 0.412331086 0.7183159 ENSBTAG00000020774 13.88436168 17.39156343 10.37715992 0.596677807 0.7186498 ENSBTAG00000016484 184.8134446 153.7286144 215.8982749 1.404411766 0.7186498 ENSBTAG00000020018 3.338334685 1.490115397 5.186553974 3.480639139 0.7186498

PAGE 124

ENSBTAG00000021739 1.303457293 0.300338691 2.306575896 7.679915934 0.7188557 512431 5.769704525 7.561920416 3.977488635 0.525989222 0.7189076 ENSBTAG00000007469 40.04080348 47.04675121 33.03485575 0.702170817 0.7189076 100336012 141.3759118 165.4493839 117.3024398 0.708992908 0.7189076 ENSBTAG00000013841 21.01999643 24.51531884 17.52467402 0.714845853 0.7189076 ENSBTAG00000002742 5115.398458 5923.026159 4307.770758 0.727292205 0.7189076 616776 1.001543862 1.501693453 0.501394271 0.333885901 0.7189172 ENSBTAG00000023986 1.001543862 1.501693453 0.501394271 0.333885901 0.7189172 ENSBTAG00000003072 123.2247578 95.05247656 151.3970391 1.59277322 0.7189761 ENSBTAG00000040078 3.305780458 1.490115397 5.121445518 3.436945573 0.7191476 100316905 11.30078093 7.604350691 14.99721117 1.972188262 0.7192764 ENSBTAG00000007943 14397.75288 16712.43845 12083.06731 0.722998463 0.7196071 ENSBTAG00000015761 1310.493599 1107.596434 1513.390764 1.366373814 0.7196071 ENSBTAG00000017338 7.800024314 10.01087437 5.589174255 0.558310298 0.7197798 ENSBTAG00000004193 2018.753332 2341.194608 1696.312056 0.724549788 0.7197798 529621 121.997436 101.8928789 142.1019931 1.394621436 0.7197798 ENSBTAG00000006071 654.0968126 514.2635121 793.9301131 1.543819646 0.7197798 ENSBTAG00000044136 125.0217892 96.26596456 153.7776139 1.597424538 0.7197798 533876 279.6815781 214.3109277 345.0522285 1.610054289 0.7197798 613570 4.712079645 2.668314048 6.755845243 2.531877853 0.7197798 ENSBTAG00000036993 1.340630155 0.558247107 2.123013204 3.802999027 0.7197798 531699 1.016350642 1.501693453 0.53100783 0.35360601 0.7200426 ENSBTAG00000039026 1.016350642 1.501693453 0.53100783 0.35360601 0.7200426 ENSBTAG00000014811 7.407688057 10.349274 4.466102114 0.431537721 0.7200426 ENSBTAG00000026882 179.2179365 145.7511977 212.6846753 1.459231064 0.7201251 ENSBTAG00000038562 1.964455199 2.660617941 1.268292457 0.476690936 0.7205059 ENSBTAG00000001634 44.86151518 52.63747356 37.08555679 0.704546672 0.7205059 ENSBTAG00000007639 2247.915223 2597.215298 1898.615147 0.731019545 0.7205059 ENSBTAG00000011466 3.238374707 1.201354763 5.275394651 4.391204676 0.7206031 ENSBTAG00000002999 213.3793536 167.4875498 259.2711574 1.548002569 0.7207402 ENSBTAG00000020107 36.33682436 26.10519961 46.5684491 1.783876384 0.7208457 784183 22.31590588 27.6945252 16.93728655 0.611575263 0.7209508 ENSBTAG00000037884 3.223567927 1.201354763 5.245781092 4.366554539 0.7209508 509704 3.609448457 5.478823744 1.740073169 0.317599772 0.7211815 ENSBTAG00000005078 36.44930298 46.49120789 26.40739806 0.568008431 0.7211815 ENSBTAG00000011847 80.55979586 100.9242591 60.19533259 0.596440669 0.7211815 ENSBTAG00000004048 44.80685368 53.69989165 35.91381571 0.668787489 0.7211815 ENSBTAG00000000462 186.4383536 226.1747406 146.7019666 0.648622239 0.7211933 505492 1.39523864 0.300338691 2.490138588 8.291101566 0.7211933 784511 13.1143129 16.08267939 10.14594641 0.630861697 0.7212142 ENSBTAG00000012824 76.47258294 92.94351566 60.00165021 0.645571128 0.7212142 ENSBTAG00000005162 54.42305535 64.79356864 44.05254205 0.679890659 0.7212142 ENSBTAG00000016804 1703.537354 1464.57018 1942.504527 1.326330792 0.7212142 100336107 1.410045419 0.300338691 2.519752148 8.389702113 0.7214293 ENSBTAG00000001181 137.382849 163.310482 111.455216 0.682474356 0.7216409 ENSBTAG00000012372 10.21154767 6.660904344 13.762191 2.066114492 0.7216409 784326 10.11551226 12.99061778 7.240406747 0.557356615 0.7219312 ENSBTAG00000005870 165.3632102 198.5012563 132.2251641 0.666117518 0.7219312 ENSBTAG00000003445 32.42293729 38.35287657 26.49299801 0.690769517 0.7219312 ENSBTAG00000013302 593.202303 689.6906329 496.713973 0.72019823 0.7219312 100298353 98.68451645 75.70732369 121.6617092 1.607000529 0.7219312 ENSBTAG00000014146 723.0848511 618.2918175 827.8778846 1.338975968 0.721994

PAGE 125

100337344 3.269277207 4.408641755 2.129912659 0.48312219 0.7220986 ENSBTAG00000007786 2243.549658 2511.785196 1975.314119 0.78641841 0.7225667 ENSBTAG00000034676 31.89115067 24.94571994 38.83658139 1.556843478 0.7225667 ENSBTAG00000037517 1.46264439 0.589099325 2.336189455 3.965697048 0.7226119 ENSBTAG00000004664 11.96341558 15.72014888 8.206682275 0.522048636 0.72279 ENSBTAG00000021090 109.9833788 87.20512227 132.7616353 1.522406389 0.72279 ENSBTAG00000003239 582.0193259 686.191225 477.8474268 0.696376475 0.7231719 ENSBTAG00000001350 17.91209376 11.1659847 24.65820282 2.208332133 0.7231719 511564 1.063711649 1.501693453 0.625729845 0.416682808 0.7237296 ENSBTAG00000015571 262.2533478 202.9167087 321.5899869 1.58483739 0.7239452 100335178 1.524812177 0.589099325 2.460525029 4.176757507 0.7240605 ENSBTAG00000008452 14.86950729 18.12722774 11.61178685 0.640571576 0.7241802 528108 6.201813101 8.786363498 3.617262705 0.411690537 0.7246121 100336919 1.554425736 0.589099325 2.519752148 4.277295932 0.7246121 ENSBTAG00000009717 18.10421239 22.25861912 13.94980566 0.626714783 0.7246485 100336961 73.39507143 88.37056471 58.41957815 0.66107508 0.7246485 ENSBTAG00000007513 15.04562438 11.00784166 19.08340711 1.733619332 0.7246485 ENSBTAG00000019913 7.286000887 3.892824923 10.67917685 2.743297493 0.7246485 ENSBTAG00000002856 1.584039296 0.589099325 2.578979266 4.377834357 0.7246485 ENSBTAG00000013356 1.571553855 0.558247107 2.584860603 4.630316166 0.7246485 784650 1.615974194 0.558247107 2.673701281 4.789458375 0.7249162 ENSBTAG00000019719 1.614296228 0.300338691 2.928253766 9.749838622 0.7249162 ENSBTAG00000044162 62.09780104 76.46170698 47.7338951 0.624284978 0.7250829 100313126 41.25338823 47.7829707 34.72380575 0.726698346 0.7250829 ENSBTAG00000013321 1.915566347 0.589099325 3.242033369 5.503373082 0.7251963 ENSBTAG00000027290 1.696508759 0.589099325 2.803918192 4.759669671 0.7253619 100138276 1.726122318 0.589099325 2.86314531 4.860208097 0.7253619 100336060 1.729062986 0.589099325 2.869026647 4.870191705 0.7253619 ENSBTAG00000001903 302.5603658 340.0714408 265.0492908 0.779392972 0.7255552 ENSBTAG00000013256 3.158070447 4.150733339 2.165407555 0.521692766 0.7255834 ENSBTAG00000004282 70.35846039 81.35704668 59.3598741 0.729621791 0.7256075 100301462 33.56831894 26.95165217 40.18498571 1.491002683 0.7256075 ENSBTAG00000038723 36.79244538 27.39085974 46.19403101 1.686476125 0.7256075 ENSBTAG00000014141 5.395010175 7.804368827 2.985651523 0.382561561 0.725701 ENSBTAG00000007270 394.026277 457.9539379 330.0986162 0.72081183 0.7257425 ENSBTAG00000009345 695.6817708 576.2480752 815.1154665 1.414521803 0.7257425 ENSBTAG00000009656 7.485781227 10.34157789 4.629984559 0.447705815 0.7257689 ENSBTAG00000009477 5.441761516 7.273159782 3.61036325 0.496395426 0.7257689 ENSBTAG00000043194 1.111072657 1.501693453 0.72045186 0.479759606 0.726096 ENSBTAG00000039895 3.127837558 4.11988112 2.135793996 0.518411559 0.726096 ENSBTAG00000042440 4.043989256 5.267227552 2.820750959 0.535528593 0.726096 ENSBTAG00000032375 22.88537265 16.67566067 29.09508463 1.744763534 0.726096 100335843 1.69259323 2.883792189 0.501394271 0.173866298 0.7269211 ENSBTAG00000021959 1.517360694 2.533327118 0.501394271 0.197919277 0.7269211 100337456 1.404451925 2.337123139 0.471780712 0.201863866 0.7269211 616970 1.578445802 2.625883773 0.53100783 0.202220615 0.7269211 ENSBTAG00000039185 1.770806456 2.945496626 0.596116286 0.202382267 0.7269211 782187 1.389025816 2.30627092 0.471780712 0.204564307 0.7269211 ENSBTAG00000014869 1.389025816 2.30627092 0.471780712 0.204564307 0.7269211 ENSBTAG00000021517 1.563019693 2.595031555 0.53100783 0.204624807 0.7269211 523598 1.724528128 2.852939971 0.596116286 0.208948065 0.7269211 ENSBTAG00000017934 1.724528128 2.852939971 0.596116286 0.208948065 0.7269211

PAGE 126

ENSBTAG00000043196 1.69367591 2.791235534 0.596116286 0.213567174 0.7269211 617696 1.419258705 2.337123139 0.501394271 0.214534811 0.7269211 ENSBTAG00000027867 1.419258705 2.337123139 0.501394271 0.214534811 0.7269211 790039 1.403832596 2.30627092 0.501394271 0.217404758 0.7269211 ENSBTAG00000006194 1.739334908 2.852939971 0.625729845 0.21932808 0.7269211 ENSBTAG00000016820 1.739334908 2.852939971 0.625729845 0.21932808 0.7269211 ENSBTAG00000032017 1.388406486 2.275418702 0.501394271 0.220352532 0.7269211 ENSBTAG00000005449 1.626426139 2.656735992 0.596116286 0.224379196 0.7269211 100313106 1.275497717 2.079214723 0.471780712 0.226903314 0.7269211 523644 1.61100003 2.625883773 0.596116286 0.227015488 0.7269211 100137759 1.434065484 2.337123139 0.53100783 0.227205756 0.7269211 ENSBTAG00000032178 1.418639375 2.30627092 0.53100783 0.230245209 0.7269211 617854 1.260071608 2.048362504 0.471780712 0.230320908 0.7269211 782990 1.260071608 2.048362504 0.471780712 0.230320908 0.7269211 ENSBTAG00000020213 1.260071608 2.048362504 0.471780712 0.230320908 0.7269211 ENSBTAG00000024548 1.594954591 2.564179336 0.625729845 0.244027333 0.7269211 521615 1.274878388 2.048362504 0.501394271 0.244778095 0.7269211 ENSBTAG00000000815 1.274878388 2.048362504 0.501394271 0.244778095 0.7269211 ENSBTAG00000011750 1.259452278 2.017510285 0.501394271 0.248521296 0.7269211 ENSBTAG00000043123 1.466619712 2.337123139 0.596116286 0.255064132 0.7269211 ENSBTAG00000043848 1.305111276 2.079214723 0.53100783 0.255388645 0.7269211 ENSBTAG00000043910 1.305111276 2.079214723 0.53100783 0.255388645 0.7269211 ENSBTAG00000038171 1.451193603 2.30627092 0.596116286 0.258476262 0.7269211 ENSBTAG00000016388 1.289685167 2.048362504 0.53100783 0.259235282 0.7269211 534113 1.435767494 2.275418702 0.596116286 0.26198092 0.7269211 100313445 1.688593926 2.656735992 0.72045186 0.27117932 0.7269211 ENSBTAG00000042989 1.450574273 2.275418702 0.625729845 0.274995474 0.7269211 ENSBTAG00000016197 1.13049807 1.759601869 0.501394271 0.284947567 0.7269211 615162 1.337665504 2.079214723 0.596116286 0.286702609 0.7269211 ENSBTAG00000018790 1.322239395 2.048362504 0.596116286 0.291020893 0.7269211 ENSBTAG00000034324 1.306813286 2.017510285 0.596116286 0.29547125 0.7269211 ENSBTAG00000042222 1.306813286 2.017510285 0.596116286 0.29547125 0.7269211 616273 1.160730959 1.790454088 0.53100783 0.296577183 0.7269211 ENSBTAG00000030257 1.160730959 1.790454088 0.53100783 0.296577183 0.7269211 ENSBTAG00000045039 1.14530485 1.759601869 0.53100783 0.30177726 0.7269211 619142 1.544213609 2.367975357 0.72045186 0.304248039 0.7269211 785123 1.544213609 2.367975357 0.72045186 0.304248039 0.7269211 ENSBTAG00000002007 1.337046175 2.048362504 0.625729845 0.30547808 0.7269211 ENSBTAG00000002792 1.321620065 2.017510285 0.625729845 0.310149519 0.7269211 ENSBTAG00000000389 1.192665857 1.759601869 0.625729845 0.355608764 0.7269211 ENSBTAG00000032292 1.192665857 1.759601869 0.625729845 0.355608764 0.7269211 ENSBTAG00000003661 4.479941156 6.564465739 2.395416574 0.364906554 0.7269211 ENSBTAG00000001127 3.254520731 4.674246277 1.834795184 0.392532844 0.7269211 ENSBTAG00000037311 3.300643079 4.61254184 1.988744317 0.431160169 0.7269211 ENSBTAG00000011891 5.960876824 8.085433355 3.836320293 0.474473059 0.7269211 789674 3.249282767 4.385485643 2.113079891 0.481834867 0.7269211 ENSBTAG00000000638 4.801549142 6.476278421 3.126819864 0.482811217 0.7269211 522372 3.062729102 4.11988112 2.005577085 0.486804601 0.7269211 ENSBTAG00000043970 6.01055917 8.054581136 3.966537205 0.492457291 0.7269211 ENSBTAG00000016373 14.03260415 18.72734994 9.337858366 0.498621449 0.7269211 ENSBTAG00000003234 3.89558559 5.071023573 2.720147607 0.536409971 0.7269211 ENSBTAG00000042677 20.17981391 26.19664591 14.16298191 0.540641041 0.7269211

PAGE 127

ENSBTAG00000011343 5.923689582 7.646780965 4.200598199 0.549328955 0.7269211 ENSBTAG00000021764 32.16758247 39.9720796 24.36308535 0.609502573 0.7269211 ENSBTAG00000001298 37.21536104 46.24106338 28.18965871 0.609623928 0.7269211 526825 8.351491148 10.26496863 6.438013664 0.627182985 0.7269211 ENSBTAG00000019593 50.86932496 62.19319297 39.54545696 0.635848637 0.7269211 ENSBTAG00000002620 134.8852725 163.7880852 105.9824597 0.647070632 0.7269211 ENSBTAG00000010676 54.50199221 66.12012909 42.88385533 0.648574888 0.7269211 ENSBTAG00000012253 52.5677593 62.80114686 42.33437174 0.674101889 0.7269211 ENSBTAG00000008485 129.563581 153.7643233 105.3628386 0.68522292 0.7269211 ENSBTAG00000000845 27.41006413 32.49994425 22.32018401 0.68677607 0.7269211 ENSBTAG00000013483 244.8987657 290.2070218 199.5905095 0.687752172 0.7269211 ENSBTAG00000018406 64.80532498 76.07276138 53.53788859 0.70377212 0.7269211 ENSBTAG00000009941 608.1179513 712.6550054 503.5808971 0.706626479 0.7269211 ENSBTAG00000015172 6794.120477 7943.859928 5644.381026 0.710533806 0.7269211 ENSBTAG00000003323 295.1984272 342.2683685 248.1284859 0.724953016 0.7269211 ENSBTAG00000005627 2437.641272 2824.539872 2050.742671 0.726044865 0.7269211 100337483 43.33156721 50.1079606 36.55517383 0.72952827 0.7269211 100139758 769.3192541 884.2858722 654.3526359 0.739978616 0.7269211 ENSBTAG00000009548 297.035688 340.5358218 253.5355541 0.744519483 0.7269211 ENSBTAG00000001736 234.1325545 267.0914147 201.1736944 0.753201651 0.7269211 ENSBTAG00000001793 53.52853374 60.53932356 46.51774392 0.768388895 0.7269211 ENSBTAG00000011623 4477.042621 3963.141631 4990.943611 1.259340209 0.7269211 ENSBTAG00000000605 10210.67563 8899.584951 11521.7663 1.294640859 0.7269211 ENSBTAG00000002750 444.3641094 386.5349877 502.1932312 1.299218046 0.7269211 ENSBTAG00000019723 942.592094 812.4701361 1072.714052 1.320311977 0.7269211 ENSBTAG00000002871 1731.465474 1457.42179 2005.509159 1.376066402 0.7269211 785042 150.5831726 125.6497969 175.5165482 1.396870926 0.7269211 ENSBTAG00000033787 100.8654134 83.60085461 118.1299722 1.413023501 0.7269211 ENSBTAG00000009508 542.0332887 448.2764967 635.7900806 1.418298941 0.7269211 ENSBTAG00000008893 109.805113 90.48548838 129.1247376 1.427021502 0.7269211 ENSBTAG00000038432 132.8032161 108.122827 157.4836052 1.456525042 0.7269211 ENSBTAG00000034926 142.1468627 115.3387195 168.9550059 1.464859387 0.7269211 ENSBTAG00000002935 244.8334639 198.1357552 291.5311727 1.471370841 0.7269211 ENSBTAG00000011994 92.44704445 74.42499032 110.4690986 1.484301148 0.7269211 100301161 62.40714593 50.02212527 74.79216659 1.495181706 0.7269211 ENSBTAG00000030704 101.8766987 81.24944962 122.5039477 1.507751108 0.7269211 ENSBTAG00000014814 68.60289254 54.43513637 82.77064871 1.520537179 0.7269211 ENSBTAG00000004436 242.6163547 185.1550542 300.0776551 1.620683034 0.7269211 ENSBTAG00000037931 30.99921474 23.60605148 38.39237801 1.626378644 0.7269211 100336285 59.40038154 43.86698966 74.93377342 1.708204142 0.7269211 ENSBTAG00000001252 17.0998147 12.44006678 21.75956262 1.749151592 0.7269211 ENSBTAG00000018554 7.736657618 4.685824333 10.7874909 2.302154356 0.7269211 ENSBTAG00000032749 7.736657618 4.685824333 10.7874909 2.302154356 0.7269211 ENSBTAG00000038532 6.468366313 3.838816592 9.097916035 2.369979346 0.7271163 100101436 7369.717737 8153.58397 6585.851505 0.807724742 0.7271636 ENSBTAG00000007634 876.2343613 752.4809774 999.9877451 1.328920963 0.7271636 ENSBTAG00000014490 2256.551811 2525.632908 1987.470714 0.786919868 0.7272413 782426 3227.793392 3591.500276 2864.086508 0.797462422 0.7275732 ENSBTAG00000008403 2574.267402 2235.051676 2913.483129 1.303541731 0.7275732 ENSBTAG00000011291 222.1066609 178.8723395 265.3409823 1.483409806 0.7276102 ENSBTAG00000013367 3319.415395 2848.729536 3790.101255 1.330453175 0.7276379 100337039 4.352225608 6.36826176 2.336189455 0.366848842 0.7278516

PAGE 128

ENSBTAG00000008392 25.57544384 31.77579021 19.37509747 0.609744002 0.7279316 785341 64.01639459 78.760214 49.27257518 0.625602353 0.7279596 790100 3.20192176 4.385485643 2.018357877 0.460235887 0.7280795 ENSBTAG00000015248 56.95162687 69.85474317 44.04851057 0.630572937 0.7281252 ENSBTAG00000014653 76.50725367 55.2721638 97.74234354 1.768382795 0.7281252 615593 3.191733614 4.643394059 1.740073169 0.374741654 0.7283239 100301114 6570.381398 7616.965152 5523.797645 0.725196654 0.7283239 ENSBTAG00000016473 4612.093151 5127.203491 4096.982811 0.799067722 0.7284319 ENSBTAG00000019569 74.11961091 53.73136684 94.50785498 1.758895419 0.7286798 100298428 16.23386243 19.89452571 12.57319915 0.631992908 0.7297594 ENSBTAG00000019287 11.11281177 14.56171178 7.66391177 0.52630569 0.7298595 ENSBTAG00000009282 337.9739724 281.4451582 394.5027866 1.401703938 0.7298595 533455 6.226068641 8.42820232 4.023934961 0.477436921 0.7298745 ENSBTAG00000016947 7524.646885 8336.086201 6713.20757 0.805318876 0.7299418 ENSBTAG00000019213 6.699071264 8.801823504 4.596319025 0.522200772 0.7312575 ENSBTAG00000017189 3437.835888 3110.287694 3765.384082 1.210622442 0.7312771 ENSBTAG00000000213 1728.748667 1520.463126 1937.034208 1.273976445 0.7315951 100335859 5.996347677 8.405046208 3.587649146 0.426844666 0.7317079 ENSBTAG00000035606 8.946810169 11.68561569 6.208004645 0.531251823 0.7317079 ENSBTAG00000032660 85.50445487 104.7670255 66.24188428 0.63227799 0.7317079 ENSBTAG00000039425 75.96219413 91.92922376 59.9951645 0.652623421 0.7317079 ENSBTAG00000005762 9.086783344 10.8424899 7.331076786 0.676143289 0.7317079 ENSBTAG00000005470 45.43583136 34.53291455 56.33874818 1.631450717 0.7317079 100336446 22.13904502 16.38253069 27.89555935 1.702762526 0.7317079 ENSBTAG00000000838 46.86658176 56.00948934 37.72367418 0.673522909 0.7317555 ENSBTAG00000020837 19.76137639 12.71780454 26.80494825 2.107671034 0.7319753 ENSBTAG00000038610 6.597872627 8.451358432 4.744386821 0.561375649 0.7319814 ENSBTAG00000004971 1175.982843 1360.426577 991.5391095 0.728844266 0.7320022 100299808 18.45958864 19.74518914 17.17398815 0.869780888 0.7320022 ENSBTAG00000001038 25.73279629 18.73560123 32.72999134 1.746941075 0.7320022 ENSBTAG00000006150 143.3551578 164.7318877 121.978428 0.740466401 0.7323127 100336453 505.6729385 534.2188309 477.1270461 0.89313034 0.7324961 790072 4.935196332 6.938086923 2.932305741 0.422638946 0.7326829 ENSBTAG00000003907 1766.096608 1998.409979 1533.783237 0.767501791 0.7327177 ENSBTAG00000037962 263.7844716 217.1095839 310.4593592 1.429966166 0.7334203 100139799 4.91283025 6.680178507 3.145481993 0.470867955 0.7335829 ENSBTAG00000032546 10.77123763 6.972821091 14.56965417 2.089492041 0.7335829 ENSBTAG00000017354 421.0699522 352.4711625 489.668742 1.389244835 0.7336573 ENSBTAG00000007052 3.058160772 4.127577227 1.988744317 0.481818803 0.7337916 ENSBTAG00000005961 2399.710466 2065.556258 2733.864675 1.323548881 0.7337916 ENSBTAG00000040350 116.9349852 142.5742078 91.29576269 0.640338559 0.7338463 ENSBTAG00000000676 121.2587266 98.20464486 144.3128084 1.469511026 0.7340046 ENSBTAG00000004307 3351.187859 3812.963682 2889.412035 0.757786403 0.7347947 523736 17.14234173 21.28432056 13.0003629 0.610795297 0.7348467 ENSBTAG00000004138 14.83436265 18.50417569 11.1645496 0.603352983 0.735379 ENSBTAG00000001244 34.02148793 40.65145138 27.39152447 0.673814182 0.7354901 ENSBTAG00000000905 56.06047888 70.24375657 41.87720119 0.596169727 0.7357809 ENSBTAG00000033053 3.989143293 4.955310805 3.022975781 0.610047664 0.7357809 ENSBTAG00000044569 4830.666599 4005.064257 5656.268942 1.412279199 0.7357809 ENSBTAG00000033887 98.81245328 78.83128009 118.7936265 1.506935145 0.7357809 ENSBTAG00000010390 1270.049185 1507.239193 1032.859178 0.685265606 0.735929 ENSBTAG00000039771 119.5822475 137.4507058 101.7137892 0.740001942 0.735929

PAGE 129

100298754 8.540130616 11.6933118 5.386949433 0.460686376 0.7359566 786656 149.3012753 174.555428 124.0471225 0.710646033 0.7359566 ENSBTAG00000027715 23.75228011 16.67954262 30.82501761 1.848073315 0.7359566 100336267 8.613881054 11.85866356 5.369098548 0.452757473 0.7360147 539504 3.971064297 5.759888272 2.182240322 0.378868516 0.7360585 ENSBTAG00000013782 721.6824678 792.4260963 650.9388393 0.821450533 0.7360585 ENSBTAG00000017063 4.101588712 5.274923659 2.928253766 0.555127231 0.7364144 ENSBTAG00000008938 39.06000727 47.83635606 30.28365848 0.633067837 0.7364323 782960 35.90834046 43.52317813 28.29350279 0.65007897 0.7364323 ENSBTAG00000013423 71.81487958 85.34852662 58.28123255 0.682861613 0.7364323 ENSBTAG00000020848 21.34570669 25.16896199 17.5224514 0.696192851 0.7364323 100125309 352.2420297 404.5986464 299.8854131 0.741192329 0.7364323 782180 605.5854748 677.3447085 533.826241 0.788116057 0.7364323 ENSBTAG00000024980 6.614500431 3.827238536 9.401762326 2.456539418 0.7364323 ENSBTAG00000032374 1405.33512 1209.21772 1601.45252 1.324370702 0.7364659 100337018 1170.459195 1245.687594 1095.230796 0.879217872 0.7368578 ENSBTAG00000023785 436.499163 373.487306 499.51102 1.337424357 0.7369173 781724 21.2623634 25.61198371 16.91274308 0.66034491 0.7369546 ENSBTAG00000022339 5.484374169 7.446207648 3.52254069 0.473065063 0.7370458 ENSBTAG00000014494 3.532791058 4.493502304 2.572079811 0.572399798 0.7372595 ENSBTAG00000021426 17.96258292 22.84286172 13.08230412 0.572708634 0.737438 ENSBTAG00000006487 155.4992693 172.2101935 138.7883451 0.805924099 0.737438 ENSBTAG00000008376 34.4620089 43.08008861 25.84392919 0.599904272 0.7379568 ENSBTAG00000018192 1826.315712 1581.730575 2070.90085 1.309262704 0.7380251 ENSBTAG00000040300 28.86651303 21.28820251 36.44482354 1.711972795 0.7385069 ENSBTAG00000013153 63.31556998 45.56544228 81.06569768 1.779104814 0.7385069 ENSBTAG00000010169 381.0129343 324.7613763 437.2644922 1.346417783 0.7389054 ENSBTAG00000043350 2.919018418 4.127577227 1.71045961 0.414397967 0.7389651 ENSBTAG00000039928 61.50731511 46.89353268 76.12109754 1.623274963 0.7389651 ENSBTAG00000017211 12.69641269 16.91373974 8.479085645 0.501313475 0.7391447 100335203 5.903075813 7.592772635 4.213378991 0.554919684 0.7391447 ENSBTAG00000027764 228.504488 198.1820631 258.826913 1.306005746 0.7391447 ENSBTAG00000002427 20.51016905 13.79575043 27.22458767 1.973403898 0.7391447 511224 8.026774607 4.966888861 11.08666035 2.232113635 0.7391447 789032 4.71879163 6.102657237 3.334926022 0.546471134 0.7392672 ENSBTAG00000036262 163.677982 134.6662594 192.6897046 1.43086847 0.7394493 517970 18.62984201 13.99188661 23.2677974 1.662949254 0.7395813 ENSBTAG00000019798 23.34142087 28.23447292 18.44836882 0.653398732 0.7397746 493726 19.1928201 24.66077347 13.72486674 0.556546483 0.7399997 ENSBTAG00000015464 5.663710645 3.280569485 8.046851804 2.452882599 0.7399997 539967 27.47591405 33.71232189 21.23950622 0.630022052 0.7404963 ENSBTAG00000008744 5.846765319 7.912385488 3.78114515 0.477876761 0.740519 ENSBTAG00000018438 11.48476194 15.44678045 7.522743429 0.487010445 0.740519 788363 2.863502822 3.519203739 2.207801906 0.627358366 0.740519 ENSBTAG00000013698 57.95992044 68.96641552 46.95342537 0.6808158 0.740519 100139242 49.81856077 57.84348406 41.79363747 0.72252974 0.740519 ENSBTAG00000007718 151.9925679 171.1031922 132.8819436 0.776618729 0.740519 ENSBTAG00000012081 1551.228318 1355.662016 1746.79462 1.288517787 0.740519 ENSBTAG00000000948 3190.671212 2772.05683 3609.285593 1.302024386 0.740519 ENSBTAG00000021372 4576.736235 3930.811001 5222.661469 1.328647312 0.740519 ENSBTAG00000044145 17.01131359 13.03686221 20.98576497 1.60972515 0.740519 100299927 5.352659316 7.022947472 3.68237116 0.524334145 0.7408647

PAGE 130

ENSBTAG00000008143 434.8114056 389.1076851 480.5151261 1.234915537 0.7413267 ENSBTAG00000024261 4.642436393 6.133509456 3.15136333 0.513794485 0.7413426 ENSBTAG00000043081 3.802020602 4.924458587 2.679582618 0.544137507 0.7413426 ENSBTAG00000000797 877.0777101 783.1321371 971.0232831 1.239922661 0.7413426 ENSBTAG00000007779 310.4303817 255.8145739 365.0461896 1.42699528 0.7413426 ENSBTAG00000020900 18.34631934 13.70312598 22.9895127 1.677683817 0.7413426 ENSBTAG00000017680 24.12486089 17.12977306 31.11994871 1.816716929 0.7413426 ENSBTAG00000030503 73.54123555 56.44543793 90.63703317 1.605745947 0.7415299 ENSBTAG00000016582 132.6415161 162.5141515 102.7688807 0.63236881 0.7415966 786101 16.00807264 11.43158923 20.58455606 1.800673175 0.7416177 ENSBTAG00000030341 3.787833152 4.955310805 2.6203555 0.528797406 0.741651 ENSBTAG00000017355 17.44155589 20.85724622 14.02586555 0.672469673 0.741651 ENSBTAG00000001133 101.5413471 84.68600921 118.3966849 1.398066646 0.741651 533633 15.86937331 11.7584108 19.98033583 1.699237777 0.741651 ENSBTAG00000012458 34.48838836 40.52464795 28.45212876 0.702094409 0.7417347 ENSBTAG00000002716 2355.329005 2723.699012 1986.958999 0.729507552 0.7417347 ENSBTAG00000011766 155.8132886 179.3116954 132.3148818 0.737904359 0.7417347 522335 119.4411718 132.8778904 106.0044531 0.797758398 0.7417347 ENSBTAG00000005093 13.87263613 10.59948631 17.14578596 1.617605368 0.7417347 ENSBTAG00000035993 23.5525652 27.1990251 19.9061053 0.731868338 0.7417596 ENSBTAG00000012758 1925.217313 1707.395658 2143.038967 1.255150766 0.7417596 100141213 2.641299156 4.031138621 1.25145969 0.31044819 0.7417724 ENSBTAG00000043036 5.199329513 7.05379969 3.344859335 0.47419256 0.7417724 785371 5.774097561 7.654477072 3.89371805 0.50868505 0.7417724 100337251 17.72625712 21.64975825 13.80275598 0.637547811 0.7417724 ENSBTAG00000019069 24.70564766 29.38958326 20.02171206 0.681251989 0.7417724 535254 3469.020806 3966.666074 2971.375538 0.749086382 0.7417724 512060 1981.285133 1688.174994 2274.395272 1.347250895 0.7417724 ENSBTAG00000014161 71.04232673 55.75553067 86.32912279 1.548350841 0.7417724 616048 11.77719736 7.893111325 15.66128339 1.984171101 0.7417724 ENSBTAG00000007049 1665.20558 1853.217986 1477.193174 0.797096286 0.7419583 783987 2.788206221 3.777112155 1.799300288 0.476369304 0.7421133 534463 2.784826247 3.580908176 1.988744317 0.555374285 0.742242 664641 2.594557478 4.06199084 1.127124116 0.277480713 0.7425715 ENSBTAG00000040226 4.563140487 6.164361675 2.9619193 0.480490837 0.7425715 ENSBTAG00000009549 5.161537321 6.765039056 3.558035586 0.525944574 0.7425715 100336027 369.9209953 437.4709993 302.3709912 0.691179511 0.7425715 ENSBTAG00000013389 163.7539321 192.9554012 134.5524631 0.69732416 0.7425715 ENSBTAG00000013793 65.16087 53.73309586 76.58864414 1.425353275 0.7425715 ENSBTAG00000030490 84.04567624 68.18401939 99.9073331 1.465260247 0.7425715 ENSBTAG00000017682 46.09831321 36.53877898 55.65784744 1.52325417 0.7425715 539328 8.410055701 5.059445517 11.76066589 2.324496992 0.7425715 ENSBTAG00000017405 3.721046731 4.697402389 2.744691074 0.584299757 0.7426393 ENSBTAG00000010131 61.45861173 73.56314555 49.35407792 0.670907661 0.7427938 ENSBTAG00000019972 48.87456652 58.82776293 38.9213701 0.661615675 0.742914 ENSBTAG00000015591 848.4654443 725.6129107 971.3179779 1.338617276 0.7434365 ENSBTAG00000011836 3522.159527 3913.979596 3130.339457 0.799784306 0.7436379 ENSBTAG00000010144 2.549981159 3.907729747 1.192232572 0.305095963 0.7437649 506240 1383.787414 1614.943616 1152.631212 0.713728455 0.7437788 ENSBTAG00000016349 254.9054223 283.8941671 225.9166775 0.795777806 0.7437788 ENSBTAG00000027426 460.3629287 399.4468476 521.2790098 1.305002187 0.7437788 784937 19.26449702 14.85047241 23.67852164 1.594462518 0.7437788

PAGE 131

ENSBTAG00000001142 51.80845329 39.22255304 64.39435354 1.641768538 0.7437788 ENSBTAG00000006784 10.05449581 6.868686379 13.24030523 1.927632811 0.7440893 ENSBTAG00000007782 40.82011309 49.78058385 31.85964233 0.640001379 0.7441036 ENSBTAG00000032955 24.84616121 31.27155143 18.420771 0.58905843 0.7443014 ENSBTAG00000007731 4070.13921 3628.342207 4511.936212 1.243525543 0.7443014 ENSBTAG00000026119 8.207161134 10.24181252 6.172509749 0.602677479 0.7443945 ENSBTAG00000010641 4.497436746 5.813896603 3.180976889 0.547133378 0.744576 ENSBTAG00000017661 24.77088433 30.20906555 19.33270312 0.639963626 0.7448827 ENSBTAG00000020756 110.0088735 125.3237339 94.69401305 0.75559521 0.7449183 ENSBTAG00000008688 23.5546852 16.47176058 30.63760982 1.860008204 0.7450694 100335194 17.38103102 21.96209459 12.79996744 0.582820887 0.745106 ENSBTAG00000007752 6.111920171 3.538477901 8.685362442 2.4545476 0.745106 ENSBTAG00000011038 518.9956074 583.6868707 454.3043441 0.778335726 0.7453324 ENSBTAG00000006242 2071.977753 1827.471323 2316.484183 1.267589895 0.7453324 ENSBTAG00000017905 49.34596351 40.06567883 58.6262482 1.463253585 0.7453661 ENSBTAG00000014319 38.78385273 48.70547734 28.86222813 0.592586906 0.7454008 ENSBTAG00000002923 33.39579975 40.95172228 25.83987722 0.630983895 0.7454008 517124 136.3419551 111.9583168 160.7255933 1.435584223 0.7454008 ENSBTAG00000001151 55.35825498 41.98342374 68.73308622 1.637148191 0.7454008 ENSBTAG00000015980 46.68169011 33.99498417 59.36839605 1.74638693 0.7454008 ENSBTAG00000018571 3.63218201 5.017015243 2.247348778 0.447945376 0.7454498 ENSBTAG00000006083 22.73962805 28.71458081 16.76467528 0.583838413 0.7455967 ENSBTAG00000005742 3199.080507 3542.337241 2855.823773 0.806197597 0.7460209 ENSBTAG00000006308 2.418242263 3.804082424 1.032402102 0.2713932 0.7460629 517383 7.700358199 10.1955003 5.205216103 0.510540528 0.7460629 510349 10.98037191 14.21894281 7.741801018 0.54447093 0.7460629 784747 60.13675545 72.5081524 47.76535851 0.658758456 0.7460629 614074 2364.783207 2012.735399 2716.831015 1.349820258 0.7460629 ENSBTAG00000042206 36.16446351 29.30756209 43.02136494 1.467927111 0.7460629 ENSBTAG00000025009 2.592945773 1.147346432 4.038545115 3.519900356 0.7467673 530039 5.044295634 2.980230795 7.108360474 2.385171137 0.7469794 ENSBTAG00000030539 20.63461303 26.51195722 14.75726884 0.556626911 0.7473525 ENSBTAG00000021318 2.373821924 3.804082424 0.943561424 0.248039164 0.7474287 ENSBTAG00000024653 2.358395815 3.773230205 0.943561424 0.250067283 0.7478815 ENSBTAG00000018579 79.18525294 59.5963646 98.77414127 1.657385344 0.7478815 ENSBTAG00000002370 7.624442269 10.42255649 4.826328044 0.463065664 0.7479746 786823 263.4468118 309.0983463 217.7952773 0.704614825 0.7481746 510185 221.302655 180.656424 261.9488859 1.449983787 0.748189 ENSBTAG00000033747 96.31789205 75.86595412 116.76983 1.539159842 0.748189 ENSBTAG00000038749 7.771511396 9.960747992 5.5822748 0.56042727 0.7485436 ENSBTAG00000038604 9.101128856 12.07802365 6.12423406 0.507055975 0.7485872 ENSBTAG00000010328 9.103450195 12.04717143 6.159728957 0.511300847 0.7485872 785055 4.971034656 6.537982858 3.404086453 0.520663105 0.7485872 ENSBTAG00000022373 14.77051898 19.35839215 10.1826458 0.526006794 0.7485872 788773 7.751905959 9.868191336 5.635620581 0.571089513 0.7485872 ENSBTAG00000007316 24.15614657 30.2288271 18.08346604 0.598219242 0.7485872 514939 944.1835261 1052.429168 835.9378846 0.794293726 0.7485872 326597 437.3851863 382.6199814 492.1503912 1.286264218 0.7489304 ENSBTAG00000016217 1620.959238 1793.153286 1448.76519 0.807942746 0.7493146 ENSBTAG00000015885 2.260757175 3.453617352 1.067896998 0.309211151 0.7494367 ENSBTAG00000011446 3.515093913 4.759106826 2.271081 0.477207401 0.7494367 100313436 32.56919427 40.93189294 24.20649561 0.591384709 0.7494367

PAGE 132

ENSBTAG00000016551 33.45925562 40.34723074 26.57128051 0.658565161 0.7494367 ENSBTAG00000012742 30.07308121 36.11551881 24.03064362 0.665382761 0.7494367 ENSBTAG00000013863 1098.951097 1300.824283 897.07791 0.689622666 0.7494367 ENSBTAG00000020761 2710.819323 3164.250669 2257.387977 0.71340365 0.7494367 ENSBTAG00000005289 167.5722914 193.1170066 142.0275762 0.73544831 0.7494367 ENSBTAG00000020658 215.122357 183.6844927 246.5602213 1.342302868 0.7494367 ENSBTAG00000017525 374.558495 309.3401083 439.7768817 1.421661369 0.7494367 ENSBTAG00000007308 209.8993463 168.7857628 251.0129297 1.487168856 0.7494367 618654 5.59122648 3.465195408 7.717257552 2.227077161 0.7494367 782366 2.372210219 0.889438016 3.854982423 4.334177709 0.7494367 617709 2.37159089 0.858585797 3.884595982 4.524412113 0.7494367 ENSBTAG00000032429 2.239629752 3.257413373 1.221846131 0.375097045 0.7494794 786151 2.548045253 3.261295323 1.834795184 0.562597067 0.7494794 ENSBTAG00000003100 42.68306951 51.63558175 33.73055727 0.653242515 0.7494794 ENSBTAG00000009543 450.8332738 510.076506 391.5900417 0.767708446 0.7494794 ENSBTAG00000011931 5876.259559 5086.847863 6665.671255 1.310373621 0.7494794 ENSBTAG00000031071 52.65387641 62.79387035 42.51388246 0.677038734 0.7494859 ENSBTAG00000009605 2.341333957 1.147346432 3.535321482 3.081302546 0.7494859 ENSBTAG00000039006 3.49504917 4.470346192 2.519752148 0.563659287 0.7496569 ENSBTAG00000001290 303.4369905 255.8005761 351.073405 1.372449626 0.7496659 790277 2.212776838 3.422765134 1.002788542 0.292976147 0.7496806 510961 16.19438335 20.98730864 11.40145807 0.543254891 0.7496806 615734 8.754784644 10.42311167 7.086457613 0.679879275 0.7496806 ENSBTAG00000007544 38.11295718 44.23624151 31.98967286 0.723155308 0.7496806 ENSBTAG00000012656 396.8685676 332.9160111 460.821124 1.38419634 0.7496806 ENSBTAG00000002125 66.93288446 80.53964521 53.3261237 0.662110239 0.7497327 787171 119.5776935 102.9630609 136.1923262 1.322729967 0.7497327 618295 2.193351424 3.164856717 1.221846131 0.386066808 0.7497545 788093 2.193351424 3.164856717 1.221846131 0.386066808 0.7497545 ENSBTAG00000001023 17.15731874 21.82662027 12.4880172 0.57214617 0.7499172 ENSBTAG00000009654 141.0621127 111.6977046 170.4265208 1.525783555 0.7500348 ENSBTAG00000043162 2.257443461 0.600677381 3.914209541 6.516325839 0.7501271 ENSBTAG00000033608 2.146609747 3.195708936 1.097510557 0.343432578 0.7503578 788928 353.2319422 416.4382855 290.025599 0.696443168 0.7503578 ENSBTAG00000005312 126.9660658 145.1589072 108.7732244 0.749338959 0.7503578 786254 1116.845074 1249.541964 984.1481838 0.787607149 0.7503578 ENSBTAG00000019883 2173.934524 1901.548879 2446.320169 1.286488186 0.7503578 ENSBTAG00000002988 428.7701288 348.1977788 509.3424788 1.462796462 0.7503578 100335880 2.235365161 1.178198651 3.292531671 2.794547142 0.7503578 ENSBTAG00000014768 2.216379053 1.116494213 3.316263893 2.970247273 0.7503578 100036592 2.234126502 1.116494213 3.35175879 3.002038657 0.7503578 ENSBTAG00000027225 2.127184333 2.93780052 1.316568146 0.448147564 0.750624 ENSBTAG00000043347 27.05956359 33.98180836 20.13731882 0.592591148 0.750624 ENSBTAG00000035241 3.444771538 4.150733339 2.738809736 0.659837555 0.750624 507035 614.8913932 516.926893 712.8558934 1.379026518 0.750624 787248 2.172578044 1.147346432 3.197809656 2.787135225 0.750624 617386 2.165018742 0.889438016 3.440599467 3.868284698 0.750624 ENSBTAG00000002408 2.162721446 0.600677381 3.724765511 6.200941849 0.750624 ENSBTAG00000007189 1288.972095 1150.977517 1426.966672 1.239786747 0.7507207 ENSBTAG00000035084 55.5148148 67.21360277 43.81602683 0.651892251 0.7508649 ENSBTAG00000012780 14.98753188 10.19938225 19.77568152 1.938909734 0.7508649 100336528 10.56654862 12.60978788 8.523309358 0.675928052 0.7508783

PAGE 133

ENSBTAG00000030910 8.615260958 4.893606368 12.33691555 2.521027361 0.7508783 ENSBTAG00000018314 36.00170317 23.61048861 48.39291772 2.049636435 0.7511026 ENSBTAG00000014315 22.30849377 28.27683541 16.34015214 0.577863538 0.7512898 526536 77.03636168 91.48966439 62.58305896 0.684045126 0.7512898 510855 33.37888248 26.08537027 40.6723947 1.559203273 0.7512898 ENSBTAG00000039813 2.088044175 0.889438016 3.286650334 3.69519885 0.7512898 ENSBTAG00000044099 2.090365514 0.858585797 3.32214523 3.869322368 0.7512898 ENSBTAG00000002083 2.054209071 3.164856717 0.943561424 0.29813717 0.751328 ENSBTAG00000020788 2.064397216 2.906948301 1.221846131 0.420319182 0.751328 ENSBTAG00000016867 10.51671029 12.486379 8.54704158 0.684509222 0.751328 616222 46.23512207 40.35339689 52.11684725 1.291510784 0.751328 529707 2.046564505 0.889438016 3.203690993 3.601927212 0.751328 ENSBTAG00000005498 6407.283232 5666.768017 7147.798448 1.261353637 0.75134 ENSBTAG00000015965 1173.255791 1344.874992 1001.63659 0.744780441 0.7513777 ENSBTAG00000010232 661.6239527 539.2669189 783.9809866 1.453790246 0.7513777 ENSBTAG00000044194 7.722927436 4.955310805 10.49054407 2.117030491 0.7513777 ENSBTAG00000034987 2.013390947 0.858585797 3.168196097 3.690016894 0.7513777 ENSBTAG00000040426 2.032462318 2.93780052 1.127124116 0.383662576 0.7514658 ENSBTAG00000015839 6092.551409 5293.523186 6891.579632 1.301889005 0.7514733 ENSBTAG00000037390 1.98083672 0.858585797 3.103087642 3.614184687 0.7514733 ENSBTAG00000027577 10.4776839 12.92940073 8.025967062 0.620753214 0.7515502 ENSBTAG00000015294 328.524882 364.4453226 292.6044413 0.802876106 0.7515502 ENSBTAG00000015538 1.931797747 0.600677381 3.262918112 5.432064222 0.7518068 100337502 14.50992188 19.38584981 9.633993958 0.496960105 0.7519085 100296348 12.9980442 16.84482658 9.151261816 0.54326839 0.7519085 ENSBTAG00000037726 16.67604518 20.42961671 12.92247365 0.632536275 0.7519085 ENSBTAG00000039135 1.863748623 0.600677381 3.126819864 5.205489604 0.7519085 100335334 1.86962996 0.600677381 3.138582538 5.225071953 0.7519085 281594 5963.589572 6699.297271 5227.881873 0.780362725 0.7521633 ENSBTAG00000035099 1.970294531 2.93780052 1.002788542 0.341339902 0.7522242 281985 508.9150066 599.7068966 418.1231167 0.697212453 0.7522242 615745 938.6028479 812.1707044 1065.034991 1.311343767 0.7522242 767938 2820.3036 3283.409892 2357.197309 0.717911374 0.7524225 ENSBTAG00000006044 36.94832777 29.38854069 44.50811486 1.514471758 0.7524225 ENSBTAG00000001398 2989.746358 2587.753793 3391.738924 1.310688418 0.7524555 ENSBTAG00000005674 289.1638548 236.9344928 341.3932168 1.440875968 0.7524555 531419 66.13197226 53.5991515 78.66479303 1.467649969 0.7530453 ENSBTAG00000008180 7013.253276 8173.858301 5852.648251 0.716020273 0.7533842 ENSBTAG00000021349 31.92680145 37.54011561 26.31348729 0.700943161 0.7534931 ENSBTAG00000008006 16.49511133 19.91379988 13.07642279 0.656651311 0.7539354 ENSBTAG00000031752 147.5600018 117.2613889 177.8586147 1.516770494 0.7540786 ENSBTAG00000002749 1.856147103 2.679892104 1.032402102 0.385240174 0.7541692 408020 1.857849112 2.618187667 1.097510557 0.419187124 0.7541692 ENSBTAG00000003236 9.257391164 11.29708968 7.217692642 0.63889841 0.7541692 ENSBTAG00000009982 46.57033465 35.2415408 57.8991285 1.642922732 0.7541692 ENSBTAG00000023593 1.811726764 2.679892104 0.943561424 0.352089333 0.7542734 534114 1.826533543 2.679892104 0.973174983 0.363139614 0.7542734 ENSBTAG00000023597 1.811107434 2.649039885 0.973174983 0.367368943 0.7542734 100335912 1.841340323 2.679892104 1.002788542 0.374189894 0.7542734 ENSBTAG00000015238 4.110574122 5.040171355 3.180976889 0.631124751 0.7542734 ENSBTAG00000000767 145.2406347 168.6186099 121.8626596 0.722711803 0.7542734 ENSBTAG00000016744 46585.64454 53760.95522 39410.33387 0.733066102 0.7542734

PAGE 134

ENSBTAG00000019116 1312.915415 1168.220071 1457.61076 1.247719326 0.7542734 ENSBTAG00000019023 536.4761957 439.5779009 633.3744904 1.440869728 0.7542734 ENSBTAG00000001706 1.80586947 2.360279251 1.25145969 0.530216791 0.7542835 ENSBTAG00000005950 1.795681325 2.618187667 0.973174983 0.371697948 0.754376 ENSBTAG00000003279 209.9736998 235.6412722 184.3061274 0.782147057 0.754376 510716 4.952258575 3.226561155 6.677955995 2.06968214 0.754376 100335784 17.10747402 10.69259815 23.52234989 2.199872245 0.754376 ENSBTAG00000021273 1.773934572 2.391131469 1.156737675 0.483761638 0.7544108 ENSBTAG00000012522 61.18100382 49.5829177 72.77908993 1.467825882 0.7544395 ENSBTAG00000009507 74.36701898 59.57888725 89.15515071 1.496421884 0.7544395 ENSBTAG00000009239 7.313195495 9.517726265 5.108664726 0.536752643 0.7544419 ENSBTAG00000013238 957.810501 1092.737833 822.8831694 0.753047204 0.7544419 ENSBTAG00000023531 4.934866718 2.102370835 7.767362602 3.694573038 0.7544676 ENSBTAG00000009658 1.696960006 2.391131469 1.002788542 0.419378255 0.7545025 ENSBTAG00000031719 1.714088124 2.360279251 1.067896998 0.452445192 0.7545025 ENSBTAG00000011292 1.552579688 2.102370835 1.002788542 0.476979858 0.7545025 ENSBTAG00000010542 30.49397197 36.88591729 24.10202666 0.653420829 0.7545025 ENSBTAG00000001729 54.16467864 65.1386218 43.19073547 0.663058786 0.7545025 ENSBTAG00000000518 1.599940696 2.102370835 1.097510557 0.522034714 0.7545768 ENSBTAG00000001997 1.614747475 2.102370835 1.127124116 0.536120506 0.7545768 282480 7493.572845 6303.612513 8683.533176 1.377548693 0.7545768 ENSBTAG00000008280 292.9561475 346.0916701 239.8206249 0.692939604 0.7546911 767895 39.42378281 46.51449959 32.33306602 0.695118002 0.754895 ENSBTAG00000009726 92.75214836 108.4535983 77.05069841 0.71044852 0.754895 ENSBTAG00000039731 39.44203578 32.26512416 46.6189474 1.444871161 0.7550369 ENSBTAG00000040522 39.44203578 32.26512416 46.6189474 1.444871161 0.7550369 784894 7.387678469 4.654972115 10.12038482 2.174102137 0.7555732 ENSBTAG00000005304 82.96642895 61.26735956 104.6654983 1.708340282 0.7557273 ENSBTAG00000019472 4.457846555 2.317848976 6.597844134 2.846537545 0.7557273 100125941 19.5748805 24.73405596 14.41570504 0.582828189 0.7558312 ENSBTAG00000015380 118.4314341 141.6307614 95.23210671 0.672397054 0.7558312 100137749 29.03584211 34.48320776 23.58847646 0.684056908 0.7558312 ENSBTAG00000021883 2253.911349 1984.745807 2523.076891 1.271234272 0.7558312 ENSBTAG00000031041 457.7135 399.2330307 516.1939694 1.292964083 0.7558312 286842 226.1587767 184.1854553 268.1320981 1.455772377 0.7558312 ENSBTAG00000019048 5.667945333 3.711525768 7.624364899 2.054240055 0.7558312 100336307 496.7113988 556.8568091 436.5659885 0.783982491 0.7569983 100299180 32.18249729 39.81207196 24.55292263 0.616720543 0.7570457 ENSBTAG00000000839 42.11106091 31.93448843 52.28763339 1.637340567 0.7571918 ENSBTAG00000015915 34.08307111 40.08113883 28.08500338 0.700703727 0.7575669 ENSBTAG00000012852 212.3782833 247.1172369 177.6393298 0.718846374 0.7578102 ENSBTAG00000019267 6.619757397 8.790245448 4.449269347 0.506159853 0.7585905 535750 34.33368888 41.32880582 27.33857194 0.66148952 0.7585905 ENSBTAG00000008306 743.5103527 852.4011583 634.6195471 0.744508077 0.7585905 ENSBTAG00000007435 3864.573275 4380.391567 3348.754984 0.764487588 0.7585905 ENSBTAG00000039938 5.915528911 7.400450605 4.430607218 0.598694249 0.7586057 615697 11.47529078 14.22282476 8.727756793 0.613644402 0.7586057 526903 254.9440927 306.7386179 203.1495675 0.662288853 0.7586057 ENSBTAG00000000425 254.5932405 212.0831942 297.1032868 1.400880857 0.7586057 ENSBTAG00000009990 855.9935953 691.7197051 1020.267486 1.474972417 0.7586057 ENSBTAG00000014643 33.27870955 26.15865276 40.39876633 1.544374884 0.7586057 ENSBTAG00000014650 48.61863131 37.87512067 59.36214195 1.567312286 0.7586057

PAGE 135

615800 3.927764071 2.367975357 5.487552785 2.317402826 0.7586057 ENSBTAG00000010830 4.741091836 2.679892104 6.802291569 2.538270686 0.7586057 618655 7.219254104 3.850394648 10.58811356 2.749877488 0.7586057 ENSBTAG00000009512 11.0549323 5.694857067 16.41500753 2.882426607 0.7586057 100336058 58.53470971 69.77868909 47.29073032 0.677724545 0.7587167 ENSBTAG00000040331 6.555755665 8.378075939 4.733435391 0.564978812 0.7592442 ENSBTAG00000012525 39.8685625 49.32445411 30.41267089 0.616584034 0.7592442 534360 143.3633135 174.5142394 112.2123877 0.642998463 0.7592442 ENSBTAG00000002492 966.7006698 1127.26812 806.1332199 0.715121102 0.7592442 ENSBTAG00000006991 44.49929704 50.88508041 38.11351367 0.749011564 0.7592442 ENSBTAG00000013651 91.86535693 75.15726007 108.5734538 1.444616976 0.7592442 ENSBTAG00000000942 14.45034973 9.737573744 19.16312572 1.967956928 0.7592442 100139041 3.104765668 1.459263179 4.750268158 3.255251162 0.7592442 ENSBTAG00000038284 4.257155744 2.348701195 6.165610294 2.625114811 0.7598751 510683 638.6090722 733.7340024 543.484142 0.74071004 0.7599466 ENSBTAG00000038652 3393.184052 3772.609982 3013.758122 0.79885229 0.7599466 516332 55.45152272 43.73096016 67.17208528 1.536030424 0.7599466 534148 3.85246747 2.625883773 5.079051167 1.934225429 0.7599466 ENSBTAG00000008522 497.5888218 574.9576175 420.2200261 0.730871308 0.7606673 ENSBTAG00000004725 16.39858906 11.72034986 21.07682827 1.798310504 0.7607539 ENSBTAG00000018310 103.9459042 80.62131458 127.2704937 1.578620919 0.7616312 ENSBTAG00000003539 5.443788991 6.768921005 4.118656976 0.608465806 0.7617615 ENSBTAG00000013688 6.129650699 8.127863629 4.131437768 0.508305498 0.7620297 ENSBTAG00000008554 38.95426106 45.43752848 32.47099363 0.714629398 0.7620297 ENSBTAG00000024182 5.786574703 7.142542189 4.430607218 0.620312362 0.7621915 ENSBTAG00000000998 193.1907473 225.3869703 160.9945243 0.714302713 0.7621915 100336303 8.746932218 10.83091185 6.66295259 0.615179284 0.7624258 ENSBTAG00000024957 59.47198233 69.86368523 49.08027943 0.702514894 0.7625015 ENSBTAG00000005702 22.98021659 28.06863378 17.8917994 0.637430362 0.7625801 100125948 57.86802005 69.17752432 46.55851579 0.673029517 0.7625801 ENSBTAG00000004793 6.423860788 8.120167523 4.727554054 0.582199079 0.7628034 615222 6.075661544 8.416624264 3.734698824 0.443728828 0.7629952 521541 62.08315197 70.72941195 53.43689198 0.755511611 0.7629952 515494 142.4487692 105.7891027 179.1084357 1.693070752 0.7629952 ENSBTAG00000018682 21.54777589 13.84975876 29.24579303 2.111646386 0.7629952 ENSBTAG00000012854 8.655590178 11.02711582 6.284064531 0.569873812 0.7636559 ENSBTAG00000033180 68.64097827 83.018964 54.26299255 0.653621654 0.7636559 ENSBTAG00000034593 21.73746176 25.78940092 17.6855226 0.685767097 0.7636559 ENSBTAG00000005969 13758.86619 12250.07132 15267.66107 1.246332422 0.7636559 790559 390.1160129 338.3049142 441.9271115 1.306298232 0.7636559 ENSBTAG00000015271 130.7068616 109.0094256 152.4042976 1.398083668 0.7636559 100336796 10.98605816 7.034525528 14.9375908 2.123468134 0.7636559 782875 3.685101741 2.048362504 5.321840978 2.598095292 0.7636559 ENSBTAG00000025458 9.476425105 5.009319136 13.94353107 2.783518218 0.7636559 100295820 8.650508194 10.89261628 6.408400105 0.58832515 0.7637208 532327 7.809505415 9.875887443 5.743123388 0.581529855 0.7640073 ENSBTAG00000012581 153.6587804 131.5740622 175.7434986 1.33570018 0.7640073 ENSBTAG00000007960 792.6473486 918.6282109 666.6664863 0.725719587 0.7643579 100336419 97.6419866 111.9120724 83.37190083 0.744976829 0.7643579 787577 35.78100505 27.93315946 43.62885065 1.56190175 0.7643579 ENSBTAG00000018024 67.61974117 77.24097972 57.99850261 0.750877356 0.7645155 ENSBTAG00000003111 880.869163 771.8802193 989.8581068 1.282398592 0.7648415

PAGE 136

100335754 421.1813054 336.3899324 505.9726785 1.50412551 0.7649141 ENSBTAG00000020552 325.7687757 262.4715328 389.0660187 1.482317013 0.7652027 ENSBTAG00000018765 19.95608294 24.13344637 15.77871951 0.653811282 0.7654283 787161 8031.168263 8810.632745 7251.70378 0.823062769 0.7654283 ENSBTAG00000003559 30.06880259 23.43681777 36.7007874 1.565945844 0.7655359 ENSBTAG00000014223 329.4880995 381.4630443 277.5131547 0.727496828 0.7659955 ENSBTAG00000015804 381.1653851 423.6186132 338.7121571 0.799568637 0.7661341 506539 3.39039695 5.116780616 1.664013284 0.32520708 0.766501 100140158 20.82908752 26.47050172 15.18767332 0.573758423 0.766501 100137803 6.264210342 7.954815762 4.573604921 0.574947938 0.7666703 281738 15.56159182 17.32265027 13.80053337 0.796675633 0.76694 ENSBTAG00000025257 24.62801055 29.01159273 20.24442837 0.69780479 0.767086 ENSBTAG00000023971 5.980320199 8.385772045 3.574868354 0.426301637 0.7671099 ENSBTAG00000017868 3632.501324 3219.36397 4045.638677 1.256657748 0.7671661 ENSBTAG00000018175 3.528855313 1.759601869 5.298108756 3.010970179 0.7672941 100336874 12.44454693 15.05104573 9.838048142 0.653645489 0.7673329 100300995 88.94327007 99.56574041 78.32079974 0.786623987 0.7673329 ENSBTAG00000001390 128.6870427 156.5891149 100.7849706 0.643626925 0.7675433 ENSBTAG00000019910 1215.286048 1042.66567 1387.906425 1.331113572 0.7678756 ENSBTAG00000019577 83.71056442 67.98393346 99.43719537 1.462657283 0.7678756 ENSBTAG00000017992 1875.169141 1605.959624 2144.378657 1.335263119 0.7680681 ENSBTAG00000008082 426.0618648 354.5351034 497.5886261 1.403496075 0.7680681 100300817 9.447919955 12.3166579 6.579182005 0.53416942 0.7684181 ENSBTAG00000030559 10.03826179 12.5596615 7.516862092 0.598492411 0.7684181 ENSBTAG00000019070 63.57974337 74.84589851 52.31358823 0.698950634 0.7684181 ENSBTAG00000013562 1868.946164 2158.219785 1579.672543 0.731933121 0.7684181 ENSBTAG00000007113 154.429799 168.4427098 140.4168882 0.833618079 0.7684181 540136 5535.764956 4999.97727 6071.552641 1.214316049 0.7684181 ENSBTAG00000021323 3496.73629 3041.871843 3951.600736 1.299068777 0.7684181 ENSBTAG00000012823 62.5652757 45.9771244 79.153427 1.72158281 0.7684181 ENSBTAG00000034337 4.335884111 2.048362504 6.623405718 3.233512479 0.7684181 ENSBTAG00000002709 1069.27417 860.856005 1277.692335 1.484211445 0.7684786 532446 3.275630192 4.828019982 1.723240402 0.35692487 0.7690488 ENSBTAG00000007462 22.18728457 25.85886925 18.51569988 0.716028984 0.7690488 510447 18.8388051 14.2112467 23.4663635 1.651252982 0.7690488 ENSBTAG00000019210 9.12142957 6.164361675 12.07849746 1.959407657 0.7690488 ENSBTAG00000005430 8.357592275 9.933777723 6.781406827 0.682661422 0.7691817 ENSBTAG00000007572 268.8451566 214.4583148 323.2319984 1.507201988 0.7691817 ENSBTAG00000030446 4.425036614 2.564179336 6.285893893 2.45142522 0.7691817 ENSBTAG00000014220 9.383147503 12.30556724 6.460727768 0.525024783 0.769248 ENSBTAG00000018287 6.136338813 7.604350691 4.668326935 0.61390211 0.769248 ENSBTAG00000034436 22.27953765 16.44811708 28.11095822 1.709068465 0.769248 510621 425.1953954 485.3958988 364.994892 0.751952979 0.7693241 539311 4.278930244 2.656735992 5.901124496 2.221193417 0.7693241 ENSBTAG00000013260 143.6631939 164.0559104 123.2704774 0.751393089 0.7695228 ENSBTAG00000010916 440.1762437 500.9645754 379.387912 0.757314849 0.7695228 ENSBTAG00000039117 257.9294259 215.8930403 299.9658115 1.389418626 0.7695228 100336473 25.3931721 18.86240466 31.92393954 1.692463931 0.7695228 522473 6.615577029 4.096725008 9.134429049 2.229690553 0.7695228 ENSBTAG00000009772 12770.2385 13987.04963 11553.42737 0.826008892 0.7698394 ENSBTAG00000006690 849.1460634 743.0292237 955.2629032 1.285633018 0.7698394 ENSBTAG00000003147 187.1269747 152.6677263 221.5862231 1.451428069 0.7698394

PAGE 137

ENSBTAG00000008642 233.2904454 183.3087907 283.2721 1.545327417 0.7698394 ENSBTAG00000017833 386.6923424 325.0359907 448.3486941 1.37938169 0.7700856 100298870 13.18675506 16.17523605 10.19827407 0.630486878 0.7703505 100295593 3.192954312 4.662668221 1.723240402 0.369582462 0.770766 ENSBTAG00000014130 717.0371055 795.6140027 638.4602082 0.802474826 0.7708746 ENSBTAG00000021051 2545.523172 2780.993662 2310.052682 0.830657298 0.7708746 539686 13.73159779 9.30994423 18.15325134 1.94987756 0.7708792 ENSBTAG00000002885 15.26489299 19.0701189 11.45966707 0.600922686 0.7709857 514842 43.13798066 50.61892071 35.65704061 0.704421195 0.7709857 510050 966.7469854 1068.778693 864.7152776 0.809068597 0.7709857 ENSBTAG00000001420 347.1182313 274.0754157 420.1610469 1.533012532 0.7709857 ENSBTAG00000011406 4.707043236 2.864518027 6.549568446 2.286446929 0.7709902 100337384 2.8726551 1.158924488 4.586385713 3.957449998 0.7709902 ENSBTAG00000015340 32.93170876 37.66401187 28.19940564 0.748709557 0.7712392 ENSBTAG00000038850 4.065305 5.840866872 2.289743129 0.392021112 0.7712682 ENSBTAG00000042275 5.309279651 7.207573395 3.410985908 0.47325025 0.7712682 ENSBTAG00000011727 2161.47523 2498.015013 1824.935447 0.730554235 0.7712682 ENSBTAG00000013612 197.2430052 227.8720528 166.6139575 0.731173285 0.7712682 ENSBTAG00000017200 1959.814658 2182.607881 1737.021434 0.795846771 0.7712682 ENSBTAG00000024162 6.494158079 4.416337861 8.571978298 1.940969773 0.7712682 ENSBTAG00000008279 2.84598221 1.158924488 4.533039931 3.911419577 0.7712682 ENSBTAG00000007668 1443.229777 1608.069386 1278.390169 0.794984458 0.7712951 ENSBTAG00000010555 52.17320596 63.55109302 40.7953189 0.641929461 0.7713832 ENSBTAG00000003176 1392.53833 1543.613197 1241.463464 0.804258131 0.7713832 ENSBTAG00000023974 3.604954836 1.975080011 5.234829662 2.65043929 0.7713832 ENSBTAG00000004766 4.050937527 6.037070851 2.064804203 0.342020866 0.7713857 ENSBTAG00000036016 37.24761992 46.2719156 28.22332424 0.609945015 0.771498 ENSBTAG00000002341 116.2738877 138.1010222 94.44675327 0.68389612 0.7716448 ENSBTAG00000003914 125.5224692 138.5739257 112.4710127 0.811631857 0.7719224 ENSBTAG00000020152 1122.880296 931.2513652 1314.509226 1.411551462 0.7720124 ENSBTAG00000019601 4103.61164 3568.836127 4638.387153 1.299691829 0.7723664 282410 21.05531453 25.86601018 16.24461888 0.628029556 0.7724886 ENSBTAG00000021092 25118.89084 22266.50286 27971.27883 1.256204398 0.7725705 ENSBTAG00000016203 2.77625512 0.901016072 4.651494168 5.162498553 0.772756 ENSBTAG00000020907 3.083888867 4.539259347 1.628518387 0.358763019 0.7727695 ENSBTAG00000012695 82.69069666 63.67332806 101.7080653 1.59734175 0.7727886 100139679 0.300338691 0.600677381 0 0 0.7730702 100313001 0.300338691 0.600677381 0 0 0.7730702 100313067 0.300338691 0.600677381 0 0 0.7730702 100313424 0.300338691 0.600677381 0 0 0.7730702 100335758 0.300338691 0.600677381 0 0 0.7730702 100337360 0.300338691 0.600677381 0 0 0.7730702 504599 0.300338691 0.600677381 0 0 0.7730702 509260 0.300338691 0.600677381 0 0 0.7730702 514973 0.300338691 0.600677381 0 0 0.7730702 516012 0.300338691 0.600677381 0 0 0.7730702 524380 0.300338691 0.600677381 0 0 0.7730702 526431 0.300338691 0.600677381 0 0 0.7730702 529657 0.300338691 0.600677381 0 0 0.7730702 531410 0.300338691 0.600677381 0 0 0.7730702 532927 0.300338691 0.600677381 0 0 0.7730702 534505 0.300338691 0.600677381 0 0 0.7730702

PAGE 138

536255 0.300338691 0.600677381 0 0 0.7730702 536316 0.300338691 0.600677381 0 0 0.7730702 536636 0.300338691 0.600677381 0 0 0.7730702 539432 0.300338691 0.600677381 0 0 0.7730702 539613 0.300338691 0.600677381 0 0 0.7730702 615525 0.300338691 0.600677381 0 0 0.7730702 617481 0.300338691 0.600677381 0 0 0.7730702 617648 0.300338691 0.600677381 0 0 0.7730702 781430 0.300338691 0.600677381 0 0 0.7730702 781681 0.300338691 0.600677381 0 0 0.7730702 783205 0.300338691 0.600677381 0 0 0.7730702 783265 0.300338691 0.600677381 0 0 0.7730702 784922 0.300338691 0.600677381 0 0 0.7730702 786163 0.300338691 0.600677381 0 0 0.7730702 789024 0.300338691 0.600677381 0 0 0.7730702 789199 0.300338691 0.600677381 0 0 0.7730702 789530 0.300338691 0.600677381 0 0 0.7730702 790216 0.300338691 0.600677381 0 0 0.7730702 791003 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000001336 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000001451 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000001952 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000002087 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000003491 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000004637 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000004647 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000005624 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000006380 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000007556 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000007898 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000008869 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000009587 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000010155 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000010475 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000010512 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000010523 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000010622 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000010849 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000015091 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000015292 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000016219 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000016698 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000020619 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000020798 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000024757 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000027033 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000027653 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000027852 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000030109 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000030423 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000031766 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000031833 0.300338691 0.600677381 0 0 0.7730702

PAGE 139

ENSBTAG00000034849 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000036003 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000037395 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000037471 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000037631 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000037820 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000038122 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000038499 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000038683 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000038973 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000038980 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000039089 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000039579 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000040133 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000040324 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000040362 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000040595 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000042089 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000042164 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000042176 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000042350 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000042862 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000042919 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000042990 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000043206 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000043236 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000043818 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000043975 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000043991 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000044082 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000044425 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000044969 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000044979 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000045069 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000045070 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000045126 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000045131 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000045295 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000045357 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000045448 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000045469 0.300338691 0.600677381 0 0 0.7730702 ENSBTAG00000019024 1.811157738 2.914644408 0.707671068 0.242798424 0.7730702 785380 1.825964517 2.914644408 0.737284627 0.252958689 0.7730702 507746 1.795112299 2.852939971 0.737284627 0.258429772 0.7730702 ENSBTAG00000042406 1.651351311 2.595031555 0.707671068 0.272702298 0.7730702 ENSBTAG00000038916 1.635305872 2.533327118 0.737284627 0.29103412 0.7730702 ENSBTAG00000030266 1.888132304 2.914644408 0.861620201 0.295617606 0.7730702 ENSBTAG00000002113 1.650112652 2.533327118 0.766898186 0.302723711 0.7730702 ENSBTAG00000002401 1.650112652 2.533327118 0.766898186 0.302723711 0.7730702 528099 1.506970994 2.30627092 0.707671068 0.30684646 0.7730702 536847 1.680345541 2.564179336 0.796511746 0.31063028 0.7730702 ENSBTAG00000014774 1.491544885 2.275418702 0.707671068 0.311006966 0.7730702

PAGE 140

ENSBTAG00000043785 1.728945208 2.625883773 0.832006642 0.316848236 0.7730702 ENSBTAG00000029921 1.713519098 2.595031555 0.832006642 0.320615231 0.7730702 618661 1.567436772 2.367975357 0.766898186 0.323862402 0.7730702 ENSBTAG00000004716 1.759178096 2.656735992 0.861620201 0.324315327 0.7730702 519501 1.743751987 2.625883773 0.861620201 0.328125795 0.7730702 100337123 1.552010662 2.337123139 0.766898186 0.328137689 0.7730702 100296151 1.920067203 2.883792189 0.956342216 0.331626606 0.7730702 ENSBTAG00000042833 1.728325878 2.595031555 0.861620201 0.332026869 0.7730702 ENSBTAG00000038938 3.87818231 5.810014653 1.946349966 0.334999149 0.7730702 100337407 1.712899769 2.564179336 0.861620201 0.336021818 0.7730702 ENSBTAG00000001325 1.582243551 2.367975357 0.796511746 0.336368258 0.7730702 ENSBTAG00000010085 1.521158444 2.275418702 0.766898186 0.337036074 0.7730702 524654 1.697473659 2.533327118 0.861620201 0.340114072 0.7730702 ENSBTAG00000044117 1.566817442 2.337123139 0.796511746 0.340808635 0.7730702 100126817 1.873788875 2.791235534 0.956342216 0.342623259 0.7730702 ENSBTAG00000039803 1.743132657 2.595031555 0.89123376 0.343438506 0.7730702 782302 1.551391333 2.30627092 0.796511746 0.345367814 0.7730702 ENSBTAG00000011654 1.378016786 2.048362504 0.707671068 0.345481362 0.7730702 ENSBTAG00000010979 1.919447873 2.852939971 0.985955775 0.345592892 0.7730702 ENSBTAG00000035357 1.904021764 2.822087752 0.985955775 0.349371055 0.7730702 ENSBTAG00000040534 1.362590677 2.017510285 0.707671068 0.35076454 0.7730702 ENSBTAG00000012886 1.599991 2.367975357 0.832006642 0.351357813 0.7730702 539779 3.05071531 4.508407128 1.593023491 0.353345083 0.7730702 616302 1.408249675 2.079214723 0.737284627 0.354597637 0.7730702 787074 1.408249675 2.079214723 0.737284627 0.354597637 0.7730702 ENSBTAG00000039437 1.408249675 2.079214723 0.737284627 0.354597637 0.7730702 100313440 1.392823566 2.048362504 0.737284627 0.359938549 0.7730702 ENSBTAG00000007333 2.956173319 4.343055368 1.569291269 0.361333471 0.7730702 787963 1.791112995 2.625883773 0.956342216 0.364198227 0.7730702 ENSBTAG00000035836 1.423056454 2.079214723 0.766898186 0.368840302 0.7730702 528006 3.016639096 4.404759805 1.628518387 0.369717864 0.7730702 525750 1.407630345 2.048362504 0.766898186 0.374395736 0.7730702 ENSBTAG00000005214 2.809471662 4.085146952 1.533796373 0.375456842 0.7730702 790233 4.780609907 6.86480443 2.696415385 0.392788376 0.7730702 ENSBTAG00000021755 1.249062578 1.790454088 0.707671068 0.395246699 0.7730702 100298603 3.858137566 5.521254019 2.195021114 0.397558436 0.7730702 ENSBTAG00000043016 2.85683267 4.085146952 1.628518387 0.398643771 0.7730702 512524 1.455610682 2.079214723 0.832006642 0.400154266 0.7730702 281068 1.440184573 2.048362504 0.832006642 0.406181347 0.7730702 ENSBTAG00000004662 1.440184573 2.048362504 0.832006642 0.406181347 0.7730702 ENSBTAG00000002343 3.017102446 4.281350931 1.752853961 0.409416091 0.7730702 100337497 1.263869358 1.790454088 0.737284627 0.411786391 0.7730702 ENSBTAG00000042888 1.424758464 2.017510285 0.832006642 0.412392763 0.7730702 100336040 3.535120695 5.005437186 2.064804203 0.412512259 0.7730702 ENSBTAG00000017497 1.470417462 2.079214723 0.861620201 0.414396932 0.7730702 539561 1.676965566 2.367975357 0.985955775 0.416370792 0.7730702 ENSBTAG00000012692 1.248443248 1.759601869 0.737284627 0.419006504 0.7730702 ENSBTAG00000038445 2.491097468 3.507625683 1.474569254 0.42038957 0.7730702 781474 4.714442816 6.637748232 2.7911374 0.420494617 0.7730702 512455 1.454991353 2.048362504 0.861620201 0.420638534 0.7730702 ENSBTAG00000044200 4.760101814 6.699452669 2.820750959 0.421042001 0.7730702 ENSBTAG00000018331 2.904193677 4.085146952 1.723240402 0.421830701 0.7730702

PAGE 141

ENSBTAG00000002206 1.439565243 2.017510285 0.861620201 0.427071033 0.7730702 ENSBTAG00000033327 1.439565243 2.017510285 0.861620201 0.427071033 0.7730702 ENSBTAG00000044536 1.439565243 2.017510285 0.861620201 0.427071033 0.7730702 ENSBTAG00000030350 1.278676137 1.790454088 0.766898186 0.428326083 0.7730702 ENSBTAG00000032493 1.278676137 1.790454088 0.766898186 0.428326083 0.7730702 ENSBTAG00000023726 2.742685241 3.827238536 1.658131947 0.433244997 0.7730702 540408 1.630687238 2.275418702 0.985955775 0.433307406 0.7730702 ENSBTAG00000012208 1.630687238 2.275418702 0.985955775 0.433307406 0.7730702 ENSBTAG00000027695 5.188504076 7.238425613 3.138582538 0.433600165 0.7730702 ENSBTAG00000045293 1.263250028 1.759601869 0.766898186 0.435836197 0.7730702 782359 3.761118256 5.232493384 2.289743129 0.437600769 0.7730702 511206 4.423980172 6.1219314 2.726028944 0.445289038 0.7730702 ENSBTAG00000017882 4.405613394 6.091079181 2.720147607 0.446578927 0.7730702 100299645 1.517778469 2.079214723 0.956342216 0.459953561 0.7730702 ENSBTAG00000004347 4.885555991 6.691756563 3.079355419 0.460171465 0.7730702 ENSBTAG00000006505 1.295804256 1.759601869 0.832006642 0.472838007 0.7730702 512176 1.326037145 1.790454088 0.861620201 0.481229989 0.7730702 532056 1.51715914 2.048362504 0.985955775 0.481338519 0.7730702 100170926 4.357193751 5.864022984 2.850364518 0.486076628 0.7730702 ENSBTAG00000043438 4.07475376 5.482705694 2.666801826 0.486402513 0.7730702 616826 1.310611035 1.759601869 0.861620201 0.4896677 0.7730702 ENSBTAG00000006593 1.310611035 1.759601869 0.861620201 0.4896677 0.7730702 ENSBTAG00000044038 1.310611035 1.759601869 0.861620201 0.4896677 0.7730702 786128 1.11948904 1.501693453 0.737284627 0.490968796 0.7730702 ENSBTAG00000038456 1.11948904 1.501693453 0.737284627 0.490968796 0.7730702 ENSBTAG00000034766 2.615433042 3.507625683 1.723240402 0.491284007 0.7730702 ENSBTAG00000037971 1.340843924 1.790454088 0.89123376 0.497769681 0.7730702 533897 2.869961484 3.827238536 1.912684432 0.499755741 0.7730702 100337277 4.340528983 5.771466328 2.909591637 0.504133867 0.7730702 ENSBTAG00000037625 1.13429582 1.501693453 0.766898186 0.510688906 0.7730702 ENSBTAG00000039629 1.13429582 1.501693453 0.766898186 0.510688906 0.7730702 520157 4.817530911 6.37214371 3.262918112 0.512059718 0.7730702 ENSBTAG00000002092 13.04993613 17.2565087 8.84336355 0.512465395 0.7730702 ENSBTAG00000030428 4.905288909 6.464700365 3.345877452 0.517561103 0.7730702 ENSBTAG00000009607 1.579946256 2.079214723 1.08067779 0.519752856 0.7730702 100337076 4.622848918 6.083383075 3.16231476 0.519828313 0.7730702 100532750 5.23791052 6.776617112 3.699203927 0.545877665 0.7730702 ENSBTAG00000001198 16.35552088 21.14975322 11.56128854 0.546639406 0.7730702 512926 4.067813787 5.255649496 2.879978078 0.547977577 0.7730702 ENSBTAG00000020375 3.451230199 4.458768136 2.443692262 0.54806444 0.7730702 530104 5.604109071 7.230729507 3.977488635 0.550081237 0.7730702 505010 3.199023096 4.108303064 2.289743129 0.557345233 0.7730702 100298838 9.860914203 12.65991426 7.061914147 0.557816902 0.7730702 ENSBTAG00000020053 13.51578641 17.3452512 9.686321622 0.55844228 0.7730702 100299636 5.282330859 6.776617112 3.788044605 0.558987551 0.7730702 ENSBTAG00000013451 14.56666811 18.65455483 10.47878139 0.561727765 0.7730702 526230 4.826017047 6.175939731 3.476094364 0.562844606 0.7730702 ENSBTAG00000007643 3.259488874 4.170007501 2.348970247 0.563301204 0.7730702 ENSBTAG00000026185 1.181656827 1.501693453 0.861620201 0.573765704 0.7730702 ENSBTAG00000044417 7.980456529 10.13767781 5.823235249 0.574415104 0.7730702 ENSBTAG00000002253 6.657192054 8.439780376 4.874603732 0.577574713 0.7730702 ENSBTAG00000004109 5.298220318 6.684060456 3.912380179 0.585329861 0.7730702

PAGE 142

613929 5.552748759 7.003673309 4.101824209 0.585667553 0.7730702 ENSBTAG00000034028 11.14906416 14.05310366 8.245024651 0.586704891 0.7730702 ENSBTAG00000030408 4.697062839 5.918031315 3.476094364 0.587373432 0.7730702 ENSBTAG00000013556 2.611433738 3.280569485 1.942297991 0.592061226 0.7730702 ENSBTAG00000004612 1.196463607 1.501693453 0.89123376 0.593485813 0.7730702 ENSBTAG00000016384 8.654745249 10.83091185 6.478578653 0.598156346 0.7730702 784771 19.33295385 24.11410442 14.55180329 0.603456095 0.7730702 ENSBTAG00000033701 10.81988262 13.49534394 8.144421299 0.603498609 0.7730702 ENSBTAG00000043207 20.13648011 25.10718976 15.16577046 0.604040938 0.7730702 ENSBTAG00000017797 25.54797632 31.84519075 19.2507619 0.604510805 0.7730702 538151 31.67443658 39.41438768 23.93448549 0.607252501 0.7730702 ENSBTAG00000036321 6.63838597 8.212724179 5.064047762 0.616609989 0.7730702 508455 30.17806172 37.27777006 23.07835337 0.619091575 0.7730702 505831 13.47646036 16.54836984 10.40455087 0.628735698 0.7730702 ENSBTAG00000009972 5.310266452 6.518708696 4.101824209 0.629238765 0.7730702 ENSBTAG00000037844 14.54326744 17.84997737 11.23655751 0.629499818 0.7730702 ENSBTAG00000017649 7.635479197 9.36395256 5.907005834 0.630823981 0.7730702 ENSBTAG00000037371 29.19816994 35.76117178 22.6351681 0.632953759 0.7730702 ENSBTAG00000027477 1.229017835 1.501693453 0.956342216 0.636842502 0.7730702 ENSBTAG00000038808 1.229017835 1.501693453 0.956342216 0.636842502 0.7730702 ENSBTAG00000037341 14.09090263 17.21075166 10.9710536 0.637453483 0.7730702 ENSBTAG00000000369 16.08744749 19.64043146 12.53446353 0.638196954 0.7730702 782608 19.3043728 23.54864859 15.06009701 0.639531265 0.7730702 ENSBTAG00000040551 87.98894134 107.0115919 68.96629074 0.644474953 0.7730702 ENSBTAG00000002006 68.40511668 82.93645544 53.87377792 0.649578977 0.7730702 ENSBTAG00000016246 6.804820544 8.243576397 5.366064691 0.650938917 0.7730702 ENSBTAG00000003833 218.1967829 263.6837834 172.7097825 0.65498826 0.7730702 ENSBTAG00000011377 11.84254439 14.29610725 9.388981534 0.656750916 0.7730702 ENSBTAG00000033291 53.18317345 64.01775825 42.34858865 0.661513146 0.7730702 100335863 50.59678987 60.75362355 40.43995619 0.665638588 0.7730702 100300095 85.27771841 102.3132319 68.24220489 0.666992955 0.7730702 ENSBTAG00000017349 52.60534973 62.97510171 42.23559775 0.67067137 0.7730702 ENSBTAG00000004115 283.3050241 339.0649591 227.5450891 0.671095856 0.7730702 ENSBTAG00000008719 1245.215592 1487.100941 1003.330244 0.674688729 0.7730702 785923 63.61580579 75.86158478 51.3700268 0.677154675 0.7730702 ENSBTAG00000008682 14.15501018 16.86028659 11.44973376 0.679094848 0.7730702 533166 72.42690072 86.16121979 58.69258165 0.681194879 0.7730702 785986 33.83053988 40.14623783 27.51484193 0.68536539 0.7730702 784290 226.2402313 268.3124082 184.1680544 0.686394102 0.7730702 100301467 85.9593688 101.88962 70.02911764 0.687303748 0.7730702 ENSBTAG00000006691 166.6286856 197.1028078 136.1545634 0.690779421 0.7730702 ENSBTAG00000014438 130.8677796 154.7381345 106.9974247 0.69147418 0.7730702 ENSBTAG00000015056 59.0548418 69.69771049 48.4119731 0.694599188 0.7730702 ENSBTAG00000023073 69.29376754 81.71312272 56.87441236 0.696025442 0.7730702 100271839 31.27027948 36.86234158 25.67821738 0.696597565 0.7730702 ENSBTAG00000015539 140.2904983 165.1515327 115.4294639 0.698930624 0.7730702 ENSBTAG00000012060 33.96157558 39.81990365 28.10324752 0.705758803 0.7730702 ENSBTAG00000031901 852.3703841 997.2067525 707.5340157 0.709515869 0.7730702 790001 63.16523808 73.79678749 52.53368867 0.711869588 0.7730702 ENSBTAG00000018234 9.848784353 11.50487172 8.192696987 0.712106765 0.7730702 507801 123.7353671 144.3994638 103.0712703 0.713792611 0.7730702 100140938 60.8512397 70.97969205 50.72278735 0.714609854 0.7730702

PAGE 143

ENSBTAG00000007581 62.62971864 72.92433944 52.33509784 0.717662967 0.7730702 ENSBTAG00000013741 27.34120243 31.78071472 22.90169014 0.720615956 0.7730702 548614 81.26144944 94.41637424 68.10652464 0.721342301 0.7730702 ENSBTAG00000006609 1238.795012 1438.922204 1038.66782 0.721837371 0.7730702 100335777 7.432798595 8.621079531 6.244517659 0.72433129 0.7730702 ENSBTAG00000017531 30.8364159 35.75791281 25.91491898 0.724732428 0.7730702 ENSBTAG00000008902 163.572466 189.3076478 137.8372841 0.728112602 0.7730702 ENSBTAG00000015519 1278.215779 1479.271472 1077.160086 0.728169309 0.7730702 ENSBTAG00000003409 115.5730866 133.6245098 97.52166346 0.729818681 0.7730702 786614 135.430763 156.1390878 114.7224382 0.734745154 0.7730702 ENSBTAG00000006914 87.82765268 101.0243806 74.63092475 0.738741721 0.7730702 ENSBTAG00000012561 612.9949973 704.9781943 521.0118003 0.739046689 0.7730702 ENSBTAG00000038894 20.40577868 23.45664712 17.35491023 0.739871736 0.7730702 ENSBTAG00000016757 83.05124722 95.20950924 70.8929852 0.744599838 0.7730702 ENSBTAG00000040076 183.5731768 210.3940354 156.7523183 0.745041645 0.7730702 ENSBTAG00000021912 189.9664651 217.4611593 162.4717709 0.747130069 0.7730702 ENSBTAG00000010595 1560.523647 1784.586261 1336.461034 0.748891249 0.7730702 ENSBTAG00000012972 309.1357762 352.7883384 265.483214 0.752528316 0.7730702 ENSBTAG00000016838 1013.037595 1155.885897 870.1892921 0.752833211 0.7730702 ENSBTAG00000043547 81.55668112 92.98525949 70.12810275 0.754185159 0.7730702 537528 169.8005044 193.2308547 146.370154 0.757488519 0.7730702 ENSBTAG00000019803 947.5753767 1077.867217 817.2835363 0.75824139 0.7730702 ENSBTAG00000036209 171.1822503 194.3067833 148.0577174 0.761979149 0.7730702 100297854 480.0976563 543.609105 416.5862075 0.766334124 0.7730702 ENSBTAG00000019515 148.973264 168.0384526 129.9080753 0.773085405 0.7730702 510529 207.4708224 233.8024885 181.1391563 0.774752901 0.7730702 ENSBTAG00000006347 167.6130808 188.7530158 146.4731458 0.776004268 0.7730702 ENSBTAG00000008292 4341.213351 4887.210552 3795.216149 0.776560803 0.7730702 ENSBTAG00000023472 66.74872326 75.12716642 58.3702801 0.776953037 0.7730702 ENSBTAG00000012697 14576.51633 16405.83023 12747.20242 0.776992218 0.7730702 ENSBTAG00000015628 248.890401 279.5674787 218.2133232 0.780539011 0.7730702 ENSBTAG00000020685 376.8870765 420.7072235 333.0669295 0.791683411 0.7730702 ENSBTAG00000000653 1063.002883 1185.833415 940.1723512 0.792836784 0.7730702 789571 135.7048728 151.2987355 120.1110101 0.793866582 0.7730702 ENSBTAG00000009959 1531.020598 1703.504422 1358.536774 0.797495302 0.7730702 ENSBTAG00000038398 1046.47352 1163.776247 929.1707944 0.798410173 0.7730702 ENSBTAG00000016429 28.06379966 30.99215245 25.13544688 0.811026176 0.7730702 ENSBTAG00000023938 138.6398475 152.4756076 124.8040874 0.81851838 0.7730702 ENSBTAG00000016000 1999.362466 2195.759337 1802.965595 0.821112571 0.7730702 ENSBTAG00000020153 78.66857177 85.82794806 71.50919548 0.833169114 0.7730702 100337126 2941.237213 3146.090972 2736.383453 0.869772514 0.7730702 ENSBTAG00000014520 1226.399831 1120.833195 1331.966466 1.188371715 0.7730702 ENSBTAG00000000341 754.020237 678.2907866 829.7496874 1.223294941 0.7730702 ENSBTAG00000010422 2152.00851 1928.671198 2375.345821 1.231597083 0.7730702 ENSBTAG00000010492 2965.599661 2642.037609 3289.161712 1.244933721 0.7730702 ENSBTAG00000007374 1453.034755 1293.504931 1612.56458 1.246662878 0.7730702 ENSBTAG00000013784 9339.868772 8258.108839 10421.6287 1.261987328 0.7730702 ENSBTAG00000018691 773.5385413 682.8561435 864.220939 1.26559737 0.7730702 789867 2400.507592 2118.700822 2682.314361 1.266018464 0.7730702 530230 419.8748991 369.0344328 470.7153654 1.275532372 0.7730702 ENSBTAG00000018322 2719.842083 2389.952547 3049.731618 1.27606367 0.7730702 ENSBTAG00000005096 5010.149901 4381.609115 5638.690687 1.286899524 0.7730702

PAGE 144

ENSBTAG00000007272 1213.391905 1061.032859 1365.750951 1.287190062 0.7730702 ENSBTAG00000038186 4619.027818 4033.751614 5204.304023 1.290189511 0.7730702 534358 354.6513794 309.4289949 399.873764 1.292295714 0.7730702 100139910 229.0097018 199.3622791 258.6571245 1.29742259 0.7730702 ENSBTAG00000002795 621.3629642 539.9298258 702.7961026 1.301643416 0.7730702 ENSBTAG00000020739 1589.769756 1376.757151 1802.782362 1.309441074 0.7730702 ENSBTAG00000009462 2172.699838 1875.149418 2470.250258 1.317361824 0.7730702 530262 319.0099575 275.2509525 362.7689624 1.317957155 0.7730702 ENSBTAG00000005027 1258.257053 1081.539898 1434.974207 1.326788045 0.7730702 ENSBTAG00000012279 132.1175199 112.542072 151.6929678 1.347877866 0.7730702 ENSBTAG00000021569 7600.36292 6472.169771 8728.55607 1.348629035 0.7730702 ENSBTAG00000021961 323.0217375 271.2100542 374.8334208 1.382077895 0.7730702 ENSBTAG00000005526 89.65291188 75.08349019 104.2223336 1.388085893 0.7730702 ENSBTAG00000017815 336.3375629 281.16645 391.5086758 1.392444496 0.7730702 ENSBTAG00000013128 291.2696096 243.1875292 339.3516901 1.395432122 0.7730702 ENSBTAG00000033315 193.3442043 160.6869503 226.0014584 1.406470519 0.7730702 ENSBTAG00000002049 194.7956448 160.5579982 229.0332914 1.426483227 0.7730702 ENSBTAG00000037566 28.4044926 23.32061762 33.48836759 1.435998314 0.7730702 100125942 337.4338314 276.5554209 398.3122419 1.440261921 0.7730702 ENSBTAG00000004962 28.24424329 23.11713713 33.37134946 1.443576221 0.7730702 ENSBTAG00000006955 813.0874599 664.666622 961.5082978 1.446602351 0.7730702 ENSBTAG00000043768 235.9146886 192.7485982 279.080779 1.447900434 0.7730702 ENSBTAG00000013653 108.9187565 88.56836644 129.2691466 1.459540825 0.7730702 ENSBTAG00000040380 88.77702923 72.08065847 105.4734 1.463269097 0.7730702 ENSBTAG00000002059 109.7884524 89.02483083 130.552074 1.466468094 0.7730702 ENSBTAG00000032265 15.60794291 12.58274982 18.633136 1.48084769 0.7730702 ENSBTAG00000031731 33.55009748 27.02493467 40.07526029 1.482899433 0.7730702 ENSBTAG00000020043 98.01083156 78.66446616 117.357197 1.491870506 0.7730702 100335247 51.57277697 40.9821549 62.16339904 1.516840664 0.7730702 100336834 27.78954289 21.94670238 33.63238341 1.532457261 0.7730702 ENSBTAG00000044133 148.3617863 117.0218477 179.701725 1.535625429 0.7730702 ENSBTAG00000000204 51.39221654 40.51209512 62.27233796 1.537129536 0.7730702 ENSBTAG00000012112 38.79781953 30.55904323 47.03659583 1.539203812 0.7730702 514261 45.84217181 36.10012659 55.58421704 1.539723604 0.7730702 ENSBTAG00000014797 174.8604713 136.7283529 212.9925898 1.557779241 0.7730702 ENSBTAG00000030199 35.29843348 27.57936762 43.01749935 1.559771056 0.7730702 ENSBTAG00000003855 96.87189248 75.33813963 118.4056453 1.571656082 0.7730702 ENSBTAG00000008656 43.69942828 33.94860415 53.4502524 1.574446247 0.7730702 ENSBTAG00000003405 27.0937173 21.0379902 33.14944439 1.57569445 0.7730702 ENSBTAG00000021275 271.7774977 210.4924279 333.0625674 1.582301895 0.7730702 ENSBTAG00000015988 67.10031119 51.79379259 82.40682979 1.591056103 0.7730702 ENSBTAG00000005678 39.85944727 30.7138595 49.00503503 1.595534909 0.7730702 ENSBTAG00000012005 14.63483513 11.13894664 18.13072361 1.627687446 0.7730702 ENSBTAG00000040389 36.89079003 28.05324156 45.72833851 1.630055422 0.7730702 ENSBTAG00000002090 22.28200888 16.93356908 27.63044869 1.631696694 0.7730702 533304 30.6294651 23.14805714 38.11087306 1.646396189 0.7730702 ENSBTAG00000010740 142.8126041 107.6798096 177.9453987 1.652541914 0.7730702 ENSBTAG00000002508 27.66323787 20.45277282 34.87370291 1.705084353 0.7730702 ENSBTAG00000014961 15.80112251 11.65476347 19.94748154 1.711530361 0.7730702 529109 13.83555099 10.18780419 17.48329778 1.716100688 0.7730702 ENSBTAG00000021064 29.14977168 21.2805064 37.01903697 1.739575002 0.7730702 536833 8.493528422 6.060226963 10.92682988 1.803039713 0.7730702

PAGE 145

ENSBTAG00000012004 15.47705293 11.02711582 19.92699004 1.807089937 0.7730702 ENSBTAG00000010015 20.04617113 14.12305939 25.96928288 1.83878593 0.7730702 100336589 7.118682821 4.932154693 9.30521095 1.886642153 0.7730702 ENSBTAG00000013213 15.22188127 10.5189951 19.92476743 1.894170236 0.7730702 ENSBTAG00000014593 10.42494344 7.188299232 13.66158764 1.900531294 0.7730702 ENSBTAG00000004870 18.97228235 13.00219584 24.94236887 1.918319735 0.7730702 ENSBTAG00000010416 11.5491281 7.542646254 15.55560995 2.062354434 0.7730702 504900 13.49779947 8.713148798 18.28245013 2.098259832 0.7730702 ENSBTAG00000019294 6.782561179 4.354633424 9.210488935 2.115100868 0.7730702 ENSBTAG00000004296 4.088247555 2.595031555 5.581463556 2.150826854 0.7730702 ENSBTAG00000031802 10.64844215 6.641630182 14.65525412 2.206574849 0.7730702 ENSBTAG00000015775 3.39606135 2.036784448 4.755338251 2.33472828 0.7730702 ENSBTAG00000019268 8.190911886 4.708980445 11.67284333 2.478847271 0.7730702 ENSBTAG00000011226 9.465358202 5.352088101 13.5786283 2.537071148 0.7730702 539047 2.691389703 1.447685123 3.935094283 2.71819764 0.7730702 524642 2.718062594 1.447685123 3.988440065 2.755046662 0.7730702 100336017 5.387439166 2.864518027 7.910360305 2.761497826 0.7730702 100139840 2.755878829 1.416832904 4.094924754 2.890195973 0.7730702 ENSBTAG00000022228 2.547009386 1.158924488 3.935094283 3.395470821 0.7730702 617423 2.594370393 1.158924488 4.029816298 3.47720351 0.7730702 531775 3.421699648 1.490115397 5.353283899 3.592529752 0.7730702 ENSBTAG00000002942 2.666726326 0.901016072 4.432436579 4.91937571 0.7730702 ENSBTAG00000012462 64.64640959 77.31308406 51.97973512 0.672327792 0.7734654 ENSBTAG00000001102 90.43187937 106.4451785 74.41858024 0.699125891 0.7743774 ENSBTAG00000018206 8.564545962 6.141205562 10.98788636 1.789206736 0.7743774 ENSBTAG00000019672 27.88999395 35.26074716 20.51924073 0.581928699 0.7743833 ENSBTAG00000003472 3.921136174 4.678128227 3.164144122 0.676369686 0.7745077 790477 5.319054751 7.338678375 3.299431126 0.44959473 0.7745658 ENSBTAG00000000604 47.1951245 57.2681792 37.12206981 0.648214599 0.7746396 ENSBTAG00000007223 21.61885984 26.17792693 17.05979276 0.651686163 0.7746396 ENSBTAG00000019759 2715.343199 2459.363362 2971.323037 1.208167562 0.7746396 ENSBTAG00000036191 12.37712671 9.028879701 15.72537373 1.741674964 0.7746396 ENSBTAG00000014325 12227.35917 13444.37871 11010.33963 0.818954886 0.7748709 ENSBTAG00000002479 145.0659633 176.0009773 114.1309493 0.648467702 0.7750834 ENSBTAG00000011876 771.3278252 667.6004598 875.0551906 1.310746836 0.7754958 ENSBTAG00000004305 81.59091846 97.6843231 65.49751382 0.670501793 0.7757461 ENSBTAG00000016612 112.5085385 132.5681901 92.44888688 0.697368553 0.7758564 ENSBTAG00000007632 130.8368195 109.0239109 152.6497281 1.400149076 0.7758833 ENSBTAG00000017595 107.0635709 125.7839447 88.34319707 0.702340806 0.7760214 ENSBTAG00000021660 60.0821073 43.57392748 76.59028712 1.75770906 0.7762255 ENSBTAG00000008591 25.08637044 16.85695982 33.31578107 1.976381353 0.7762255 ENSBTAG00000017839 120.1401682 92.58085388 147.6994824 1.595356667 0.7762531 540197 538.682812 643.2806842 434.0849399 0.674798654 0.7767492 ENSBTAG00000006236 9.771845811 6.857108323 12.6865833 1.850136049 0.7767492 526949 79.35932259 65.83143624 92.88720893 1.410985606 0.7769091 ENSBTAG00000003098 8084.970149 7348.141648 8821.79865 1.200548257 0.7770842 ENSBTAG00000038415 14.979187 18.92404131 11.03433269 0.583085426 0.7773269 ENSBTAG00000000588 60.02728483 69.11249312 50.94207655 0.737089262 0.7775804 524913 73.55848871 60.9527347 86.16424272 1.413623903 0.7776208 ENSBTAG00000039635 132.7784719 151.4046671 114.1522767 0.753954808 0.7777017 ENSBTAG00000042504 29.29662353 36.30735345 22.2858936 0.61381212 0.7778152 ENSBTAG00000019651 176.8795505 203.3401001 150.4190009 0.73974096 0.7778152

PAGE 146

614367 7.784895923 9.456509216 6.11328263 0.646462927 0.777953 ENSBTAG00000013980 3.813904675 4.966888861 2.660920489 0.535731836 0.7779654 ENSBTAG00000014665 143.3614115 163.2086993 123.5141237 0.756786398 0.7783275 ENSBTAG00000019581 2802.142239 2478.630766 3125.653712 1.261040472 0.7783275 782609 113.909437 96.00237306 131.8165008 1.373054609 0.7783275 ENSBTAG00000011429 108.367503 89.31505363 127.4199524 1.426634674 0.7783275 ENSBTAG00000002050 16.55737351 21.0143467 12.10040032 0.575816155 0.7784402 ENSBTAG00000015587 5.460398387 7.238425613 3.68237116 0.508725427 0.7787719 528123 4.929315168 2.660617941 7.198012395 2.705391211 0.7791106 ENSBTAG00000020911 2090.122064 2363.833687 1816.410442 0.768417191 0.779597 100138087 0.429292899 0.858585797 0 0 0.7796993 100140553 0.429292899 0.858585797 0 0 0.7796993 100272170 0.429292899 0.858585797 0 0 0.7796993 100337405 0.429292899 0.858585797 0 0 0.7796993 100337466 0.429292899 0.858585797 0 0 0.7796993 493733 0.429292899 0.858585797 0 0 0.7796993 505232 0.429292899 0.858585797 0 0 0.7796993 509941 0.429292899 0.858585797 0 0 0.7796993 512336 0.429292899 0.858585797 0 0 0.7796993 514285 0.429292899 0.858585797 0 0 0.7796993 516576 0.429292899 0.858585797 0 0 0.7796993 541259 0.429292899 0.858585797 0 0 0.7796993 791001 0.429292899 0.858585797 0 0 0.7796993 791044 0.429292899 0.858585797 0 0 0.7796993 ENSBTAG00000001828 0.429292899 0.858585797 0 0 0.7796993 ENSBTAG00000002435 0.429292899 0.858585797 0 0 0.7796993 ENSBTAG00000003575 0.429292899 0.858585797 0 0 0.7796993 ENSBTAG00000004558 0.429292899 0.858585797 0 0 0.7796993 ENSBTAG00000010228 0.429292899 0.858585797 0 0 0.7796993 ENSBTAG00000010379 0.429292899 0.858585797 0 0 0.7796993 ENSBTAG00000010483 0.429292899 0.858585797 0 0 0.7796993 ENSBTAG00000014645 0.429292899 0.858585797 0 0 0.7796993 ENSBTAG00000014885 0.429292899 0.858585797 0 0 0.7796993 ENSBTAG00000017042 0.429292899 0.858585797 0 0 0.7796993 ENSBTAG00000022657 0.429292899 0.858585797 0 0 0.7796993 ENSBTAG00000022775 0.429292899 0.858585797 0 0 0.7796993 ENSBTAG00000025535 0.429292899 0.858585797 0 0 0.7796993 ENSBTAG00000028443 0.429292899 0.858585797 0 0 0.7796993 ENSBTAG00000030073 0.429292899 0.858585797 0 0 0.7796993 ENSBTAG00000031231 0.429292899 0.858585797 0 0 0.7796993 ENSBTAG00000032645 0.429292899 0.858585797 0 0 0.7796993 ENSBTAG00000033146 0.429292899 0.858585797 0 0 0.7796993 ENSBTAG00000033237 0.429292899 0.858585797 0 0 0.7796993 ENSBTAG00000033733 0.429292899 0.858585797 0 0 0.7796993 ENSBTAG00000035486 0.429292899 0.858585797 0 0 0.7796993 ENSBTAG00000037588 0.429292899 0.858585797 0 0 0.7796993 ENSBTAG00000037804 0.429292899 0.858585797 0 0 0.7796993 ENSBTAG00000038692 0.429292899 0.858585797 0 0 0.7796993 ENSBTAG00000040407 0.429292899 0.858585797 0 0 0.7796993 ENSBTAG00000040424 0.429292899 0.858585797 0 0 0.7796993 ENSBTAG00000042234 0.429292899 0.858585797 0 0 0.7796993 ENSBTAG00000042522 0.429292899 0.858585797 0 0 0.7796993

PAGE 147

ENSBTAG00000042570 0.429292899 0.858585797 0 0 0.7796993 ENSBTAG00000042883 0.429292899 0.858585797 0 0 0.7796993 ENSBTAG00000042960 0.429292899 0.858585797 0 0 0.7796993 ENSBTAG00000043145 0.429292899 0.858585797 0 0 0.7796993 ENSBTAG00000043211 0.429292899 0.858585797 0 0 0.7796993 ENSBTAG00000043346 0.429292899 0.858585797 0 0 0.7796993 ENSBTAG00000044109 0.429292899 0.858585797 0 0 0.7796993 ENSBTAG00000044329 0.429292899 0.858585797 0 0 0.7796993 ENSBTAG00000045372 0.429292899 0.858585797 0 0 0.7796993 ENSBTAG00000045458 0.429292899 0.858585797 0 0 0.7796993 100138964 0.444719008 0.889438016 0 0 0.7796993 100139250 0.444719008 0.889438016 0 0 0.7796993 100313039 0.444719008 0.889438016 0 0 0.7796993 100336680 0.444719008 0.889438016 0 0 0.7796993 100336789 0.444719008 0.889438016 0 0 0.7796993 100337462 0.444719008 0.889438016 0 0 0.7796993 507119 0.444719008 0.889438016 0 0 0.7796993 509633 0.444719008 0.889438016 0 0 0.7796993 510115 0.444719008 0.889438016 0 0 0.7796993 513936 0.444719008 0.889438016 0 0 0.7796993 515356 0.444719008 0.889438016 0 0 0.7796993 523680 0.444719008 0.889438016 0 0 0.7796993 529792 0.444719008 0.889438016 0 0 0.7796993 541094 0.444719008 0.889438016 0 0 0.7796993 615090 0.444719008 0.889438016 0 0 0.7796993 618322 0.444719008 0.889438016 0 0 0.7796993 782699 0.444719008 0.889438016 0 0 0.7796993 784887 0.444719008 0.889438016 0 0 0.7796993 786541 0.444719008 0.889438016 0 0 0.7796993 788382 0.444719008 0.889438016 0 0 0.7796993 790709 0.444719008 0.889438016 0 0 0.7796993 ENSBTAG00000000118 0.444719008 0.889438016 0 0 0.7796993 ENSBTAG00000001584 0.444719008 0.889438016 0 0 0.7796993 ENSBTAG00000002441 0.444719008 0.889438016 0 0 0.7796993 ENSBTAG00000003553 0.444719008 0.889438016 0 0 0.7796993 ENSBTAG00000004944 0.444719008 0.889438016 0 0 0.7796993 ENSBTAG00000008996 0.444719008 0.889438016 0 0 0.7796993 ENSBTAG00000020454 0.444719008 0.889438016 0 0 0.7796993 ENSBTAG00000021729 0.444719008 0.889438016 0 0 0.7796993 ENSBTAG00000022829 0.444719008 0.889438016 0 0 0.7796993 ENSBTAG00000029803 0.444719008 0.889438016 0 0 0.7796993 ENSBTAG00000034196 0.444719008 0.889438016 0 0 0.7796993 ENSBTAG00000034929 0.444719008 0.889438016 0 0 0.7796993 ENSBTAG00000035024 0.444719008 0.889438016 0 0 0.7796993 ENSBTAG00000035742 0.444719008 0.889438016 0 0 0.7796993 ENSBTAG00000036261 0.444719008 0.889438016 0 0 0.7796993 ENSBTAG00000038049 0.444719008 0.889438016 0 0 0.7796993 ENSBTAG00000038239 0.444719008 0.889438016 0 0 0.7796993 ENSBTAG00000042688 0.444719008 0.889438016 0 0 0.7796993 ENSBTAG00000042838 0.444719008 0.889438016 0 0 0.7796993 ENSBTAG00000042948 0.444719008 0.889438016 0 0 0.7796993 ENSBTAG00000043451 0.444719008 0.889438016 0 0 0.7796993

PAGE 148

ENSBTAG00000044025 0.444719008 0.889438016 0 0 0.7796993 ENSBTAG00000044835 0.444719008 0.889438016 0 0 0.7796993 ENSBTAG00000045104 0.444719008 0.889438016 0 0 0.7796993 ENSBTAG00000045318 0.444719008 0.889438016 0 0 0.7796993 ENSBTAG00000043452 2.681650438 4.000286403 1.363014472 0.340729222 0.7796993 280931 3.627571674 5.301893928 1.953249421 0.368405979 0.7796993 617983 3.629273683 5.24018949 2.018357877 0.385168872 0.7796993 616094 2.745520234 3.938581966 1.552458502 0.394166864 0.7796993 ENSBTAG00000020060 4.215005053 5.975366414 2.454643692 0.410793836 0.7796993 100336388 4.911659856 6.926508867 2.896810845 0.418220911 0.7796993 516333 3.59566082 5.013133293 2.178188347 0.434496396 0.7796993 618679 4.245261985 5.686605779 2.803918192 0.493074129 0.7796993 ENSBTAG00000008613 7.344699386 9.833457168 4.855941603 0.493818351 0.7796993 ENSBTAG00000011997 2.883565527 3.850394648 1.916736407 0.497802584 0.7796993 ENSBTAG00000016906 3.562936232 4.678128227 2.447744237 0.52323154 0.7796993 ENSBTAG00000040574 5.347952968 6.91881276 3.777093175 0.545916374 0.7796993 618416 4.712383272 6.060226963 3.364539582 0.555183758 0.7796993 ENSBTAG00000021814 7.237679378 9.248239792 5.227118963 0.565201496 0.7796993 100299192 3.733550134 4.770684883 2.696415385 0.565205091 0.7796993 533903 9.859130561 12.51334927 7.20491185 0.575778051 0.7796993 ENSBTAG00000018926 31.62156138 39.44614688 23.79697587 0.603277576 0.7796993 ENSBTAG00000024734 13.35589849 16.61007428 10.1017227 0.608168424 0.7796993 ENSBTAG00000038074 11.21559264 13.92248607 8.508699204 0.611147978 0.7796993 534849 18.30708504 22.58932264 14.02484743 0.620861796 0.7796993 532571 28.21726017 34.78347866 21.65104169 0.62245188 0.7796993 ENSBTAG00000006618 2.702012348 3.303725597 2.100299099 0.635736546 0.7796993 ENSBTAG00000009696 8.823543168 10.55372927 7.093357068 0.672118536 0.7796993 790576 623.9107 743.3402883 504.4811118 0.678667791 0.7796993 ENSBTAG00000015113 25.21554825 29.87066592 20.56043059 0.688315106 0.7796993 ENSBTAG00000012412 16.84743811 19.91768183 13.7771944 0.691706722 0.7796993 ENSBTAG00000001522 907.3473683 1064.923636 749.7711002 0.704060906 0.7796993 ENSBTAG00000033322 204.1112883 238.7894864 169.4330902 0.709550042 0.7796993 ENSBTAG00000005833 157.7400061 184.4014208 131.0785914 0.710832871 0.7796993 ENSBTAG00000008737 1357.972907 1580.838716 1135.107097 0.718041053 0.7796993 ENSBTAG00000012751 86.39387983 100.4727193 72.31504041 0.719748017 0.7796993 ENSBTAG00000001036 508.5993606 590.2795106 426.9192107 0.723249246 0.7796993 505851 44.28742547 51.36616307 37.20868787 0.724381298 0.7796993 ENSBTAG00000025434 527.9880085 611.6561501 444.3198669 0.726420991 0.7796993 524677 207.6290628 240.1713861 175.0867396 0.729007491 0.7796993 ENSBTAG00000022777 379.7243333 438.3009536 321.1477131 0.732710505 0.7796993 ENSBTAG00000016707 8742.827069 10088.73382 7396.920321 0.733186191 0.7796993 ENSBTAG00000031782 46.12957002 53.19516549 39.06397455 0.73435197 0.7796993 ENSBTAG00000021313 174.2504341 200.0408117 148.4600565 0.742148841 0.7796993 ENSBTAG00000026319 140.1860907 160.1258638 120.2463176 0.750948752 0.7796993 ENSBTAG00000010533 429.9647995 490.4575822 369.4720167 0.753321042 0.7796993 ENSBTAG00000019008 127.8345629 145.6760506 109.9930753 0.755052562 0.7796993 616790 91.99817205 104.4818799 79.51446417 0.761035925 0.7796993 ENSBTAG00000005474 577.8072896 653.172362 502.4422172 0.769233737 0.7796993 787634 324.9633975 366.6172424 283.3095527 0.77276658 0.7796993 ENSBTAG00000024366 166.6764888 187.6444168 145.7085607 0.776514235 0.7796993 ENSBTAG00000002219 243.1791041 273.767241 212.5909671 0.776539101 0.7796993 ENSBTAG00000004574 880.9915674 987.6994519 774.2836829 0.783926407 0.7796993

PAGE 149

ENSBTAG00000022372 963.8315572 1079.968643 847.6944714 0.784925078 0.7796993 ENSBTAG00000013627 7985.997542 8936.444952 7035.550131 0.787287357 0.7796993 505469 753.8475494 840.7758279 666.9192709 0.793218892 0.7796993 ENSBTAG00000026995 9565.017905 10649.98933 8480.046479 0.796249293 0.7796993 ENSBTAG00000000212 250.9772894 279.4178538 222.536725 0.79642987 0.7796993 516411 114.6538094 127.6449775 101.6626413 0.796448425 0.7796993 531757 1489.788634 1653.96716 1325.610108 0.801473052 0.7796993 ENSBTAG00000008448 590.1981134 654.4009882 525.9952385 0.803781241 0.7796993 ENSBTAG00000030897 708.0238809 779.9976538 636.050108 0.815451309 0.7796993 282018 1051.698507 1157.642292 945.7547231 0.816966286 0.7796993 ENSBTAG00000034136 2877.784828 3163.285152 2592.284505 0.81949125 0.7796993 ENSBTAG00000015348 768.1967524 690.7489494 845.6445554 1.224242985 0.7796993 ENSBTAG00000000473 282.4989172 252.5162053 312.4816291 1.237471586 0.7796993 ENSBTAG00000025310 670.9989131 597.5478643 744.4499619 1.245841557 0.7796993 ENSBTAG00000010012 2310.895989 2051.862119 2569.929859 1.252486624 0.7796993 ENSBTAG00000017811 750.6179008 666.4380052 834.7977964 1.252626336 0.7796993 ENSBTAG00000000750 250.2063423 219.1617434 281.2509411 1.283303084 0.7796993 ENSBTAG00000004643 1562.271347 1365.454433 1759.088261 1.288280458 0.7796993 ENSBTAG00000025001 589.5881588 514.8819379 664.2943797 1.290187771 0.7796993 614794 427.4107693 371.8724551 482.9490834 1.298695498 0.7796993 ENSBTAG00000013060 1252.327305 1086.160335 1418.494275 1.305971346 0.7796993 ENSBTAG00000010444 1714.764752 1479.686753 1949.842751 1.317740222 0.7796993 ENSBTAG00000003690 582.7936068 501.9934203 663.5937933 1.321917313 0.7796993 ENSBTAG00000016606 296.2112131 252.0200694 340.4023568 1.350695433 0.7796993 ENSBTAG00000006367 206.4139075 175.3600055 237.4678096 1.354173142 0.7796993 ENSBTAG00000021314 377.0152801 315.1554499 438.8751102 1.392567098 0.7796993 ENSBTAG00000015278 906.0794418 750.8417083 1061.317175 1.413503224 0.7796993 ENSBTAG00000021199 82.25103994 67.37653475 97.12554514 1.441533696 0.7796993 ENSBTAG00000002747 41.99088378 33.98957226 49.9921953 1.47080978 0.7796993 ENSBTAG00000024086 280.4014116 222.6267441 338.1760791 1.519027198 0.7796993 ENSBTAG00000027246 24.57054933 19.0783024 30.06279627 1.575758453 0.7796993 ENSBTAG00000019806 41.6244832 31.97303675 51.27592965 1.603724102 0.7796993 100335806 27.37949911 20.89579455 33.86320367 1.620575068 0.7796993 ENSBTAG00000026866 42.21803804 31.86508789 52.57098819 1.649798939 0.7796993 539162 11.67010969 8.790245448 14.54997392 1.655240916 0.7796993 ENSBTAG00000015242 10.83086786 7.942750318 13.7189854 1.727233622 0.7796993 ENSBTAG00000012936 41.17766995 29.8553415 52.4999984 1.758479246 0.7796993 ENSBTAG00000038995 25.6960341 18.58134013 32.81072807 1.765789111 0.7796993 ENSBTAG00000023845 8.758082948 6.329713435 11.18645246 1.767292086 0.7796993 ENSBTAG00000016041 25.69986331 18.53502791 32.86469872 1.773112988 0.7796993 ENSBTAG00000031070 9.685756126 6.776617112 12.59489514 1.858581492 0.7796993 ENSBTAG00000003038 7.462533252 5.170788947 9.754277557 1.886419588 0.7796993 100336550 8.958953782 6.133509456 11.78439811 1.921314085 0.7796993 616037 19.56901918 13.38739508 25.75064329 1.923499168 0.7796993 ENSBTAG00000006379 24.9805088 17.01842963 32.94258797 1.935700807 0.7796993 ENSBTAG00000009235 5.243873651 3.453617352 7.03412995 2.036742706 0.7796993 614522 5.520203003 3.268991429 7.771414577 2.377312619 0.7796993 539794 5.474544005 3.207286992 7.741801018 2.413816112 0.7796993 ENSBTAG00000015821 8.763087288 5.051749411 12.47442516 2.469327781 0.7796993 ENSBTAG00000020090 5.56864669 3.176434774 7.960858606 2.506224486 0.7796993 ENSBTAG00000034770 5.137617073 2.649039885 7.62619426 2.878852184 0.7796993 ENSBTAG00000015681 2.53788945 3.742377987 1.333400913 0.356297765 0.7797002

PAGE 150

100301250 49.92422043 34.36042186 65.488019 1.905914289 0.7797002 ENSBTAG00000033248 8.73990453 10.75762935 6.722179708 0.624875564 0.7800453 ENSBTAG00000015098 172.2533256 142.6717567 201.8348944 1.414680096 0.7800453 516736 5.064641811 2.876096083 7.253187539 2.52188638 0.7800453 ENSBTAG00000011389 79.98745473 92.11786722 67.85704225 0.736632798 0.7802301 100336471 2.501955247 3.546174008 1.457736487 0.411073028 0.7805277 ENSBTAG00000038545 4.135269841 5.810014653 2.460525029 0.423497216 0.7805277 614449 4.576157543 6.379839816 2.772475271 0.434568163 0.7805277 ENSBTAG00000034449 4.106738962 5.717457998 2.496019926 0.43656113 0.7805277 517126 4.131270537 5.582958456 2.679582618 0.47995747 0.7805277 ENSBTAG00000040119 3.354261193 4.435612024 2.272910362 0.512423167 0.7805277 615588 4.552576846 5.74061411 3.364539582 0.586094017 0.7805277 ENSBTAG00000010330 22.52863998 28.29950413 16.75777583 0.592157932 0.7805277 100140489 54.68797772 67.07606047 42.29989497 0.63062581 0.7805277 ENSBTAG00000004767 9.97711315 12.09397105 7.860255255 0.649931708 0.7805277 524700 29.83959721 36.08078464 23.59840977 0.654043697 0.7805277 ENSBTAG00000021248 20.21789938 24.42220701 16.01359175 0.655697978 0.7805277 ENSBTAG00000001050 33.67994574 39.62314449 27.736747 0.700013776 0.7805277 407190 1945.883399 2249.877097 1641.889702 0.729768619 0.7805277 ENSBTAG00000006998 29.99959629 34.55218871 25.44700387 0.736480229 0.7805277 ENSBTAG00000012698 34727.59765 39463.64674 29991.54855 0.759979146 0.7805277 ENSBTAG00000007939 2005.312302 2278.560745 1732.063859 0.760156982 0.7805277 ENSBTAG00000020094 691.3261116 591.8998618 790.7523614 1.33595632 0.7805277 ENSBTAG00000007120 348.9160504 295.8663227 401.9657782 1.358606057 0.7805277 ENSBTAG00000037480 68.44435998 57.00694402 79.88177594 1.401263957 0.7805277 ENSBTAG00000033284 82.10520478 68.06497985 96.14542971 1.412553562 0.7805277 ENSBTAG00000037434 103.1743474 85.19759229 121.1511024 1.422001481 0.7805277 ENSBTAG00000031149 34.68934659 28.62639349 40.75229968 1.423591822 0.7805277 ENSBTAG00000035726 49.90491334 40.05847011 59.75135658 1.491603559 0.7805277 ENSBTAG00000017175 70.81839378 55.46344326 86.17334429 1.553696259 0.7805277 ENSBTAG00000018297 24.20397915 16.02541209 32.38254621 2.020699751 0.7805277 ENSBTAG00000010394 5.159086436 2.949378576 7.368794296 2.49842267 0.7805277 535353 4.09747765 5.521254019 2.673701281 0.484256162 0.7807049 ENSBTAG00000003051 1009.424485 858.5719617 1160.277009 1.351403331 0.7807049 ENSBTAG00000012552 771.6605686 874.0956903 669.225447 0.765620348 0.7807115 ENSBTAG00000009789 1636.76193 1870.513004 1403.010857 0.750067417 0.7808151 538774 70.09979924 85.81734046 54.38225803 0.633697779 0.781365 ENSBTAG00000039231 278.7305218 321.4765731 235.9844705 0.734064284 0.781365 529211 2.438548801 3.484469571 1.392628031 0.399667153 0.7817947 ENSBTAG00000017498 125.342306 140.3323494 110.3522626 0.786363679 0.7817947 ENSBTAG00000004223 1100.388829 1280.444653 920.333004 0.718760472 0.7819267 ENSBTAG00000009086 2.423742021 3.484469571 1.363014472 0.391168425 0.782059 784547 2.423122692 3.453617352 1.392628031 0.403237501 0.782059 100300342 3.258919848 4.404759805 2.113079891 0.479726474 0.782059 783419 7.058915343 9.340796448 4.777034238 0.511416159 0.782059 ENSBTAG00000016344 6.975548286 8.974871371 4.976225202 0.554462008 0.782059 ENSBTAG00000019028 21.05802947 25.90795307 16.20810587 0.625603491 0.782059 525756 9.665866377 11.18914082 8.142591937 0.727722715 0.782059 ENSBTAG00000023333 60.27747409 47.22028646 73.33466172 1.55303297 0.782059 282518 3.244113069 4.404759805 2.083466332 0.473003393 0.7824655 ENSBTAG00000042471 3.245195748 4.31220315 2.178188347 0.505121923 0.7824655 781584 4.477460268 5.833170765 3.121749771 0.535172018 0.7824655

PAGE 151

ENSBTAG00000008295 23.03761436 27.79865992 18.2765688 0.657462225 0.7824655 ENSBTAG00000007329 193.8136518 226.1161295 161.5111741 0.71428418 0.7824655 ENSBTAG00000011916 13776.02796 12067.52363 15484.53229 1.283157404 0.7824655 ENSBTAG00000000147 81.60320496 67.99495633 95.21145358 1.400272295 0.7826607 ENSBTAG00000037826 3.231603584 4.69352044 1.769686729 0.377048902 0.782744 ENSBTAG00000029640 2.388271169 3.164856717 1.61168562 0.509244419 0.782744 ENSBTAG00000021645 553.2467627 635.0065139 471.4870116 0.742491614 0.782744 100124510 142.1514887 162.7557651 121.5472122 0.746807415 0.782744 ENSBTAG00000005503 33.07734333 37.6293455 28.52534117 0.75806105 0.782744 530146 4.009695608 5.748310216 2.271081 0.395086715 0.7829551 ENSBTAG00000012135 485.2854962 413.3047727 557.2662196 1.348317892 0.7831666 ENSBTAG00000039932 4.44490604 5.833170765 3.056641315 0.524010258 0.7833949 ENSBTAG00000026400 50.33664047 59.69078586 40.98249508 0.686579922 0.7834836 ENSBTAG00000015744 1621.021249 1857.346384 1384.696113 0.745523896 0.7835392 783604 4.825021971 3.442039296 6.208004645 1.803583315 0.7835392 787904 3.19953675 4.250498712 2.148574788 0.505487693 0.7837735 ENSBTAG00000040093 8.061975639 4.493502304 11.63044897 2.58828152 0.7837735 ENSBTAG00000014906 72.65983793 83.6641568 61.65551906 0.736940662 0.7838323 ENSBTAG00000034398 6.894243314 4.416337861 9.372148767 2.122153934 0.7838323 784000 4.419291785 6.060226963 2.778356608 0.458457517 0.7839375 ENSBTAG00000005574 138.9538442 166.3305706 111.5771178 0.670815458 0.7839375 ENSBTAG00000037916 270.3411728 310.5640597 230.118286 0.740968824 0.7839375 ENSBTAG00000009985 453.2800875 511.3774056 395.1827694 0.772781052 0.7839375 ENSBTAG00000008538 15.89034105 11.84375874 19.93692336 1.68332738 0.7839375 ENSBTAG00000040018 6.853798236 4.963006912 8.74458956 1.761953935 0.7843368 100335917 0.558247107 1.116494213 0 0 0.7843631 100336882 0.558247107 1.116494213 0 0 0.7843631 510079 0.558247107 1.116494213 0 0 0.7843631 515362 0.558247107 1.116494213 0 0 0.7843631 517368 0.558247107 1.116494213 0 0 0.7843631 528256 0.558247107 1.116494213 0 0 0.7843631 786338 0.558247107 1.116494213 0 0 0.7843631 790465 0.558247107 1.116494213 0 0 0.7843631 791063 0.558247107 1.116494213 0 0 0.7843631 ENSBTAG00000003011 0.558247107 1.116494213 0 0 0.7843631 ENSBTAG00000003665 0.558247107 1.116494213 0 0 0.7843631 ENSBTAG00000005855 0.558247107 1.116494213 0 0 0.7843631 ENSBTAG00000014224 0.558247107 1.116494213 0 0 0.7843631 ENSBTAG00000015574 0.558247107 1.116494213 0 0 0.7843631 ENSBTAG00000021862 0.558247107 1.116494213 0 0 0.7843631 ENSBTAG00000032359 0.558247107 1.116494213 0 0 0.7843631 ENSBTAG00000033952 0.558247107 1.116494213 0 0 0.7843631 ENSBTAG00000034295 0.558247107 1.116494213 0 0 0.7843631 ENSBTAG00000036019 0.558247107 1.116494213 0 0 0.7843631 ENSBTAG00000037973 0.558247107 1.116494213 0 0 0.7843631 ENSBTAG00000038234 0.558247107 1.116494213 0 0 0.7843631 ENSBTAG00000039837 0.558247107 1.116494213 0 0 0.7843631 ENSBTAG00000040211 0.558247107 1.116494213 0 0 0.7843631 ENSBTAG00000042183 0.558247107 1.116494213 0 0 0.7843631 ENSBTAG00000042257 0.558247107 1.116494213 0 0 0.7843631 ENSBTAG00000042385 0.558247107 1.116494213 0 0 0.7843631 ENSBTAG00000042391 0.558247107 1.116494213 0 0 0.7843631

PAGE 152

ENSBTAG00000042813 0.558247107 1.116494213 0 0 0.7843631 ENSBTAG00000043009 0.558247107 1.116494213 0 0 0.7843631 ENSBTAG00000043423 0.558247107 1.116494213 0 0 0.7843631 ENSBTAG00000043897 0.558247107 1.116494213 0 0 0.7843631 ENSBTAG00000044279 0.558247107 1.116494213 0 0 0.7843631 ENSBTAG00000044332 0.558247107 1.116494213 0 0 0.7843631 ENSBTAG00000044446 0.558247107 1.116494213 0 0 0.7843631 ENSBTAG00000045227 0.558247107 1.116494213 0 0 0.7843631 100140994 0.573673216 1.147346432 0 0 0.7843631 100298718 0.573673216 1.147346432 0 0 0.7843631 100299784 0.573673216 1.147346432 0 0 0.7843631 100302389 0.573673216 1.147346432 0 0 0.7843631 100313043 0.573673216 1.147346432 0 0 0.7843631 100313158 0.573673216 1.147346432 0 0 0.7843631 100313206 0.573673216 1.147346432 0 0 0.7843631 100313207 0.573673216 1.147346432 0 0 0.7843631 100336205 0.573673216 1.147346432 0 0 0.7843631 100336302 0.573673216 1.147346432 0 0 0.7843631 100336376 0.573673216 1.147346432 0 0 0.7843631 506306 0.573673216 1.147346432 0 0 0.7843631 508142 0.573673216 1.147346432 0 0 0.7843631 522718 0.573673216 1.147346432 0 0 0.7843631 528595 0.573673216 1.147346432 0 0 0.7843631 531109 0.573673216 1.147346432 0 0 0.7843631 617571 0.573673216 1.147346432 0 0 0.7843631 781828 0.573673216 1.147346432 0 0 0.7843631 790981 0.573673216 1.147346432 0 0 0.7843631 ENSBTAG00000005055 0.573673216 1.147346432 0 0 0.7843631 ENSBTAG00000006223 0.573673216 1.147346432 0 0 0.7843631 ENSBTAG00000009046 0.573673216 1.147346432 0 0 0.7843631 ENSBTAG00000009199 0.573673216 1.147346432 0 0 0.7843631 ENSBTAG00000034948 0.573673216 1.147346432 0 0 0.7843631 ENSBTAG00000036379 0.573673216 1.147346432 0 0 0.7843631 ENSBTAG00000038374 0.573673216 1.147346432 0 0 0.7843631 ENSBTAG00000038502 0.573673216 1.147346432 0 0 0.7843631 ENSBTAG00000038506 0.573673216 1.147346432 0 0 0.7843631 ENSBTAG00000039422 0.573673216 1.147346432 0 0 0.7843631 ENSBTAG00000040132 0.573673216 1.147346432 0 0 0.7843631 ENSBTAG00000043281 0.573673216 1.147346432 0 0 0.7843631 ENSBTAG00000043498 0.573673216 1.147346432 0 0 0.7843631 ENSBTAG00000043969 0.573673216 1.147346432 0 0 0.7843631 ENSBTAG00000044037 0.573673216 1.147346432 0 0 0.7843631 ENSBTAG00000044310 0.573673216 1.147346432 0 0 0.7843631 ENSBTAG00000044314 0.573673216 1.147346432 0 0 0.7843631 ENSBTAG00000045405 0.573673216 1.147346432 0 0 0.7843631 100295666 0.589099325 1.178198651 0 0 0.7843631 100299737 0.589099325 1.178198651 0 0 0.7843631 515227 0.589099325 1.178198651 0 0 0.7843631 518266 0.589099325 1.178198651 0 0 0.7843631 535410 0.589099325 1.178198651 0 0 0.7843631 616167 0.589099325 1.178198651 0 0 0.7843631 787544 0.589099325 1.178198651 0 0 0.7843631

PAGE 153

787624 0.589099325 1.178198651 0 0 0.7843631 790367 0.589099325 1.178198651 0 0 0.7843631 ENSBTAG00000001248 0.589099325 1.178198651 0 0 0.7843631 ENSBTAG00000005164 0.589099325 1.178198651 0 0 0.7843631 ENSBTAG00000005520 0.589099325 1.178198651 0 0 0.7843631 ENSBTAG00000005882 0.589099325 1.178198651 0 0 0.7843631 ENSBTAG00000007352 0.589099325 1.178198651 0 0 0.7843631 ENSBTAG00000009115 0.589099325 1.178198651 0 0 0.7843631 ENSBTAG00000009583 0.589099325 1.178198651 0 0 0.7843631 ENSBTAG00000011119 0.589099325 1.178198651 0 0 0.7843631 ENSBTAG00000012498 0.589099325 1.178198651 0 0 0.7843631 ENSBTAG00000013683 0.589099325 1.178198651 0 0 0.7843631 ENSBTAG00000020229 0.589099325 1.178198651 0 0 0.7843631 ENSBTAG00000024647 0.589099325 1.178198651 0 0 0.7843631 ENSBTAG00000024975 0.589099325 1.178198651 0 0 0.7843631 ENSBTAG00000026129 0.589099325 1.178198651 0 0 0.7843631 ENSBTAG00000029852 0.589099325 1.178198651 0 0 0.7843631 ENSBTAG00000030024 0.589099325 1.178198651 0 0 0.7843631 ENSBTAG00000031096 0.589099325 1.178198651 0 0 0.7843631 ENSBTAG00000033643 0.589099325 1.178198651 0 0 0.7843631 ENSBTAG00000035941 0.589099325 1.178198651 0 0 0.7843631 ENSBTAG00000037577 0.589099325 1.178198651 0 0 0.7843631 ENSBTAG00000038302 0.589099325 1.178198651 0 0 0.7843631 ENSBTAG00000038722 0.589099325 1.178198651 0 0 0.7843631 ENSBTAG00000040021 0.589099325 1.178198651 0 0 0.7843631 ENSBTAG00000040305 0.589099325 1.178198651 0 0 0.7843631 ENSBTAG00000040402 0.589099325 1.178198651 0 0 0.7843631 ENSBTAG00000042747 0.589099325 1.178198651 0 0 0.7843631 ENSBTAG00000043151 0.589099325 1.178198651 0 0 0.7843631 ENSBTAG00000043401 0.589099325 1.178198651 0 0 0.7843631 ENSBTAG00000043675 0.589099325 1.178198651 0 0 0.7843631 ENSBTAG00000045162 0.589099325 1.178198651 0 0 0.7843631 ENSBTAG00000045360 0.589099325 1.178198651 0 0 0.7843631 ENSBTAG00000007503 2.330102686 3.391912915 1.268292457 0.373916574 0.7843631 537297 3.836321061 5.4904018 2.182240322 0.397464594 0.7843631 286816 3.041564269 4.343055368 1.740073169 0.400656455 0.7843631 ENSBTAG00000017993 2.980479161 4.250498712 1.71045961 0.402413864 0.7843631 ENSBTAG00000024852 3.102030046 4.404759805 1.799300288 0.40848999 0.7843631 509029 2.231381367 3.164856717 1.297906017 0.410099456 0.7843631 ENSBTAG00000005301 2.279981034 3.226561155 1.333400913 0.413257598 0.7843631 ENSBTAG00000013933 6.623205637 9.294484224 3.951927051 0.425190571 0.7843631 ENSBTAG00000003919 2.279361704 3.195708936 1.363014472 0.42651396 0.7843631 616485 2.961209727 4.146851389 1.775568066 0.428172582 0.7843631 ENSBTAG00000019617 3.593838754 5.005437186 2.182240322 0.43597397 0.7843631 ENSBTAG00000037837 3.151093063 4.343055368 1.959130758 0.451095045 0.7843631 790683 1.944478721 2.679892104 1.209065339 0.451161947 0.7843631 100337250 1.929052612 2.649039885 1.209065339 0.456416434 0.7843631 100299152 2.165833605 2.968652739 1.363014472 0.459135706 0.7843631 ENSBTAG00000010680 1.959285501 2.679892104 1.238678898 0.462212227 0.7843631 100335979 2.150407496 2.93780052 1.363014472 0.463957462 0.7843631 ENSBTAG00000005791 3.004391407 4.085146952 1.923635862 0.470885352 0.7843631 ENSBTAG00000014784 2.182961724 2.93780052 1.428122928 0.486119775 0.7843631

PAGE 154

ENSBTAG00000002034 2.639275535 3.538477901 1.740073169 0.491757535 0.7843631 ENSBTAG00000036175 1.785291625 2.391131469 1.17945178 0.49326095 0.7843631 ENSBTAG00000011495 3.671896 4.912880531 2.43091147 0.494803701 0.7843631 100336261 2.197768503 2.93780052 1.457736487 0.496199955 0.7843631 ENSBTAG00000012693 3.656469891 4.882028312 2.43091147 0.497930638 0.7843631 ENSBTAG00000039553 2.182342394 2.906948301 1.457736487 0.501466258 0.7843631 781885 1.991220399 2.649039885 1.333400913 0.503352524 0.7843631 785529 2.212575283 2.93780052 1.487350046 0.506280136 0.7843631 ENSBTAG00000021360 2.908610756 3.858090754 1.959130758 0.507797997 0.7843631 615834 2.021453288 2.679892104 1.363014472 0.508607966 0.7843631 ENSBTAG00000001830 12.59590178 16.69486704 8.49693653 0.508955029 0.7843631 100313148 3.731742449 4.943732749 2.519752148 0.509686157 0.7843631 784148 5.920254235 7.827524939 4.012983531 0.512675918 0.7843631 ENSBTAG00000042464 2.006027179 2.649039885 1.363014472 0.514531502 0.7843631 789959 2.227382063 2.93780052 1.516963605 0.516360316 0.7843631 ENSBTAG00000020520 3.083687312 4.054294733 2.113079891 0.521195431 0.7843631 ENSBTAG00000010881 2.671210433 3.507625683 1.834795184 0.52308751 0.7843631 786617 2.020833958 2.649039885 1.392628031 0.525710481 0.7843631 789892 3.11686087 4.085146952 2.148574788 0.52594798 0.7843631 ENSBTAG00000013983 6.31424428 8.273941227 4.354547332 0.526296624 0.7843631 ENSBTAG00000043850 2.2753624 2.968652739 1.582072061 0.532925943 0.7843631 ENSBTAG00000032396 7.633258465 9.926013824 5.340503107 0.538030996 0.7843631 617485 2.876519878 3.73468188 2.018357877 0.540436359 0.7843631 ENSBTAG00000034768 4.301145053 5.575262349 3.027027756 0.54293907 0.7843631 617568 10.53863915 13.66020832 7.417069984 0.542969025 0.7843631 ENSBTAG00000039178 2.955352434 3.827238536 2.083466332 0.544378489 0.7843631 506708 6.264122627 8.108589467 4.419655787 0.545058522 0.7843631 281406 13.70914203 17.72608111 9.692202959 0.546776408 0.7843631 ENSBTAG00000004394 10.48681549 13.55656099 7.417069984 0.54712032 0.7843631 540409 4.270292834 5.513557912 3.027027756 0.549015319 0.7843631 ENSBTAG00000006732 4.37641761 5.636966786 3.115868434 0.552756217 0.7843631 533656 2.083621075 2.679892104 1.487350046 0.555003705 0.7843631 788642 2.068194966 2.649039885 1.487350046 0.561467592 0.7843631 ENSBTAG00000042461 3.489260142 4.458768136 2.519752148 0.565122938 0.7843631 ENSBTAG00000039991 6.496940239 8.286006672 4.707873807 0.568171617 0.7843631 ENSBTAG00000030688 11.69085055 14.86205047 8.519650634 0.573248668 0.7843631 514284 6.594386976 8.366497883 4.822276068 0.576379285 0.7843631 ENSBTAG00000038770 20.40331856 25.76520224 15.04143488 0.583788737 0.7843631 ENSBTAG00000004248 12.11929124 15.26215453 8.976427941 0.58814946 0.7843631 618198 8.878633838 11.14664275 6.610624926 0.593059729 0.7843631 ENSBTAG00000013544 55.50374038 69.60064891 41.40683184 0.594920198 0.7843631 ENSBTAG00000016924 13.03211684 16.34058781 9.72364588 0.595060961 0.7843631 100139510 6.284354818 7.842984944 4.725724692 0.602541599 0.7843631 ENSBTAG00000005946 6.129966379 7.646780965 4.613151792 0.603280232 0.7843631 509859 1.894201089 2.360279251 1.428122928 0.605065238 0.7843631 100297422 13.94196586 17.33416054 10.54977118 0.6086116 0.7843631 ENSBTAG00000014855 8.893727525 11.05027194 6.737183114 0.609684825 0.7843631 ENSBTAG00000004061 9.227088522 11.46244145 6.991735599 0.609969144 0.7843631 531515 28.48032626 35.35281643 21.6078361 0.611205507 0.7843631 784116 8.944648531 11.08112416 6.808172906 0.614393703 0.7843631 ENSBTAG00000001944 7.883135931 9.764544013 6.001727848 0.614644969 0.7843631 ENSBTAG00000025748 5.951913231 7.365716437 4.538110024 0.616112508 0.7843631

PAGE 155

ENSBTAG00000031447 16.79009166 20.73376956 12.84641377 0.619588914 0.7843631 ENSBTAG00000011939 9.92906306 12.25932281 7.598803315 0.619838749 0.7843631 ENSBTAG00000039533 2.667211129 3.280569485 2.053852773 0.626065926 0.7843631 ENSBTAG00000008509 12.31766429 15.12384083 9.511487746 0.628906893 0.7843631 ENSBTAG00000023372 1.923814648 2.360279251 1.487350046 0.630158506 0.7843631 ENSBTAG00000019402 22.31470193 27.36333429 17.26606956 0.630992896 0.7843631 ENSBTAG00000038195 94.88120545 116.1314477 73.63096319 0.634031218 0.7843631 505073 5.755195464 7.038407478 4.471983451 0.635368649 0.7843631 ENSBTAG00000015996 14.10886378 17.24160388 10.97612369 0.636606882 0.7843631 ENSBTAG00000036264 8.72099277 10.64191658 6.800068956 0.638989124 0.7843631 ENSBTAG00000015710 17.7317196 21.54222897 13.92121022 0.646228867 0.7843631 ENSBTAG00000033210 67.66890328 82.18734847 53.15045809 0.646698781 0.7843631 ENSBTAG00000005857 70.91722963 85.9914309 55.84302837 0.649402246 0.7843631 ENSBTAG00000038430 7.739838293 9.383226723 6.096449863 0.649717847 0.7843631 100335740 11.13001809 13.47995173 8.780084456 0.651343909 0.7843631 531271 31.53267662 38.16720808 24.89814515 0.652343894 0.7843631 100298918 9.030728563 10.91577239 7.145684732 0.654620166 0.7843631 ENSBTAG00000037553 17.77540055 21.44197621 14.10882489 0.658000212 0.7843631 ENSBTAG00000001088 1.986601765 2.391131469 1.582072061 0.661641604 0.7843631 616110 67.25762602 80.79706624 53.71818581 0.664853172 0.7843631 ENSBTAG00000035667 37.82299083 45.4365537 30.20942795 0.664870583 0.7843631 ENSBTAG00000027492 20.30013729 24.36438452 16.23589007 0.66637801 0.7843631 ENSBTAG00000013283 28.86539249 34.64370279 23.08708219 0.666414971 0.7843631 ENSBTAG00000006392 1.971175656 2.360279251 1.582072061 0.670290204 0.7843631 ENSBTAG00000011196 34.77485256 41.57118644 27.97851869 0.673026706 0.7843631 ENSBTAG00000007065 27.90326018 33.32428327 22.48223709 0.674650281 0.7843631 ENSBTAG00000000005 12.7255825 15.17784916 10.27331584 0.676862428 0.7843631 ENSBTAG00000025445 38.40447799 45.76386266 31.04509332 0.678375721 0.7843631 100336926 29.50536252 35.1109232 23.89980184 0.680694202 0.7843631 ENSBTAG00000022109 60.43057641 71.85692904 49.00422379 0.681969358 0.7843631 ENSBTAG00000010126 27.63721871 32.85040933 22.42402809 0.68261031 0.7843631 ENSBTAG00000037278 17.53656596 20.83409011 14.2390418 0.68344918 0.7843631 ENSBTAG00000021821 56.02571327 66.46629261 45.58513393 0.685838372 0.7843631 510927 32.67820734 38.75734997 26.5990647 0.686297302 0.7843631 ENSBTAG00000012777 21.47369456 25.45821001 17.48917912 0.686975994 0.7843631 ENSBTAG00000000521 72.88165751 86.31499349 59.44832153 0.688736906 0.7843631 ENSBTAG00000003557 423.303105 499.8157624 346.7904475 0.693836557 0.7843631 ENSBTAG00000021135 659.3021 775.3078668 543.2963332 0.700749156 0.7843631 ENSBTAG00000009694 121.8354707 142.7979372 100.8730043 0.706403792 0.7843631 ENSBTAG00000012034 16.4008491 19.1825049 13.61919329 0.70997992 0.7843631 ENSBTAG00000017627 32.18696395 37.52132883 26.85259907 0.715662262 0.7843631 407218 16.32867703 19.02436186 13.6329922 0.716607069 0.7843631 ENSBTAG00000015470 25.34008566 29.49704474 21.18312658 0.71814403 0.7843631 ENSBTAG00000015202 129.0502918 150.1780033 107.9225803 0.718631078 0.7843631 ENSBTAG00000001865 13.56452215 15.75537043 11.37367388 0.721891873 0.7843631 100300575 14.65120362 17.01073353 12.29167372 0.722583403 0.7843631 ENSBTAG00000005456 609.2315494 706.8155158 511.647583 0.723877124 0.7843631 ENSBTAG00000043551 231.8374286 268.8613486 194.8135085 0.724587262 0.7843631 ENSBTAG00000005300 304.7620266 352.6962691 256.8277842 0.728184012 0.7843631 782486 62.47805863 72.28899568 52.66712158 0.728563471 0.7843631 ENSBTAG00000003826 26.031206 30.11706407 21.94534792 0.728668235 0.7843631 ENSBTAG00000034203 127.2494904 146.9867315 107.5122494 0.731441868 0.7843631

PAGE 156

ENSBTAG00000013145 790.2788577 912.4209316 668.1367839 0.732268146 0.7843631 ENSBTAG00000014886 91.78498067 105.9444699 77.62549147 0.732699796 0.7843631 ENSBTAG00000016336 874.3720157 1007.684703 741.0593282 0.735407937 0.7843631 ENSBTAG00000017081 22.47073034 25.87426147 19.06719921 0.736917621 0.7843631 100299267 7992.553961 9162.21682 6822.891102 0.744676887 0.7843631 514642 41.43710299 47.46280266 35.41140332 0.74608749 0.7843631 ENSBTAG00000005443 7385.846325 8457.912852 6313.779797 0.746493835 0.7843631 ENSBTAG00000016124 56.8460503 64.98540328 48.70669732 0.749502117 0.7843631 ENSBTAG00000032087 305.6124654 349.2933162 261.9316147 0.749890143 0.7843631 787681 184.7234395 210.7922071 158.6546719 0.752659095 0.7843631 ENSBTAG00000032083 108.1828438 123.3196663 93.04602128 0.75451081 0.7843631 ENSBTAG00000026754 215.2183824 245.083025 185.3537398 0.756289587 0.7843631 ENSBTAG00000011800 66.83303471 76.02797911 57.63809031 0.758116827 0.7843631 ENSBTAG00000011287 39.9574854 45.30697868 34.60799212 0.76385566 0.7843631 ENSBTAG00000012213 4306.594769 4873.967269 3739.22227 0.767182474 0.7843631 ENSBTAG00000037781 43.85974587 49.5729374 38.14655434 0.769503611 0.7843631 ENSBTAG00000014038 601.9021032 679.2482351 524.5559712 0.772259601 0.7843631 ENSBTAG00000001435 837.8496252 944.8316502 730.8676002 0.773542673 0.7843631 ENSBTAG00000017091 936.59739 1055.478989 817.7157907 0.774734314 0.7843631 ENSBTAG00000000736 652.8443485 735.2342971 570.4543998 0.775881106 0.7843631 ENSBTAG00000038527 735.5364259 827.5474614 643.5253905 0.777629587 0.7843631 ENSBTAG00000002745 4554.85216 5120.170921 3989.5334 0.779179731 0.7843631 ENSBTAG00000009304 282.4175897 317.2735647 247.5616147 0.780278101 0.7843631 ENSBTAG00000020393 11.85766834 13.31078581 10.40455087 0.781663158 0.7843631 ENSBTAG00000005197 1087.712465 1220.259939 955.1649899 0.782755345 0.7843631 767870 146.2682619 164.0650687 128.4714551 0.783051847 0.7843631 ENSBTAG00000002095 144.2369651 161.1533315 127.3205988 0.790058745 0.7843631 ENSBTAG00000004496 921.6612922 1026.17764 817.1449447 0.796299698 0.7843631 ENSBTAG00000010467 257.3612024 286.2844594 228.4379454 0.797940433 0.7843631 ENSBTAG00000021918 654.5279375 727.9653961 581.090479 0.79823915 0.7843631 ENSBTAG00000014891 7878.582722 8758.666022 6998.499422 0.799037137 0.7843631 ENSBTAG00000001854 211.8229716 234.9103968 188.7355464 0.803436327 0.7843631 ENSBTAG00000011044 1577.854206 1745.360288 1410.348125 0.808055583 0.7843631 ENSBTAG00000014725 5320.686487 5852.614242 4788.758732 0.818225588 0.7843631 ENSBTAG00000039366 1920.30318 2111.570637 1729.035722 0.818838684 0.7843631 ENSBTAG00000026886 206.2057863 226.4487741 185.9627985 0.821213536 0.7843631 ENSBTAG00000010297 281.9895651 309.3606962 254.618434 0.823047133 0.7843631 ENSBTAG00000014326 1763.025185 1932.833437 1593.216934 0.824290859 0.7843631 ENSBTAG00000008241 697.7373419 761.0826945 634.3919893 0.833538844 0.7843631 ENSBTAG00000037799 2222.064766 2416.487177 2027.642356 0.839086744 0.7843631 ENSBTAG00000017622 17.10713073 18.59291819 15.62134327 0.840177056 0.7843631 ENSBTAG00000004695 843.4064423 915.4347734 771.3781112 0.842635798 0.7843631 100336141 3847.579023 4171.961221 3523.196824 0.844494145 0.7843631 100125833 8111.213009 8783.793533 7438.632485 0.846858758 0.7843631 100298336 11.84374269 12.73326454 10.95422083 0.86028377 0.7843631 ENSBTAG00000042596 806.8079145 859.635643 753.980186 0.877092745 0.7843631 ENSBTAG00000043482 1827.577384 1927.716013 1727.438755 0.896106451 0.7843631 ENSBTAG00000010526 233.9169764 211.3754877 256.4584652 1.213283848 0.7843631 ENSBTAG00000021521 2060.881334 1854.66036 2267.102308 1.222381389 0.7843631 614107 2036.060836 1829.772479 2242.349193 1.22547979 0.7843631 ENSBTAG00000004079 1832.865194 1629.704685 2036.025703 1.249321869 0.7843631 613338 622.7077438 553.3555701 692.0599174 1.250660434 0.7843631

PAGE 157

ENSBTAG00000014677 2985.272023 2646.71292 3323.831126 1.255833642 0.7843631 ENSBTAG00000014843 2902.938389 2565.209529 3240.66725 1.263314834 0.7843631 528150 6819.12956 6013.39627 7624.86285 1.267979443 0.7843631 ENSBTAG00000021979 16741.62221 14761.70967 18721.53475 1.26824976 0.7843631 ENSBTAG00000009245 1304.296312 1149.288046 1459.304579 1.269746592 0.7843631 ENSBTAG00000014029 1170.624189 1030.048 1311.200378 1.272950754 0.7843631 ENSBTAG00000008016 312.7562853 273.4686313 352.0439393 1.287328414 0.7843631 ENSBTAG00000008543 1743.697377 1518.880098 1968.514655 1.296030317 0.7843631 ENSBTAG00000001568 184.342358 160.4872839 208.1974321 1.297283043 0.7843631 ENSBTAG00000010355 570.7392582 491.5932657 649.8852508 1.321997871 0.7843631 ENSBTAG00000004165 126.4791537 108.8812278 144.0770797 1.323249954 0.7843631 ENSBTAG00000010395 410.5306663 349.3738923 471.6874403 1.350093555 0.7843631 ENSBTAG00000007398 347.4647138 295.5550289 399.3743987 1.35126917 0.7843631 ENSBTAG00000013495 972.8675252 826.9300738 1118.804977 1.352962012 0.7843631 ENSBTAG00000030587 4045.068139 3425.454779 4664.681499 1.361769984 0.7843631 ENSBTAG00000019323 91.49640272 77.43607334 105.5567321 1.363146755 0.7843631 ENSBTAG00000014044 146.1468757 123.4346883 168.8590632 1.368003318 0.7843631 ENSBTAG00000015104 595.4135831 502.7551394 688.0720268 1.368602672 0.7843631 ENSBTAG00000011819 295.9455466 248.8176219 343.0734712 1.378815007 0.7843631 505099 270.3455849 226.6385364 314.0526333 1.385698294 0.7843631 787930 41.95150489 35.08721191 48.81579788 1.391270358 0.7843631 ENSBTAG00000001329 214.5578673 177.6265542 251.4891804 1.415830992 0.7843631 ENSBTAG00000040091 496.3648397 410.9110095 581.8186698 1.41592378 0.7843631 ENSBTAG00000020632 90.34689167 74.60338231 106.090401 1.422058863 0.7843631 ENSBTAG00000007595 41.10964491 33.78948633 48.42980349 1.433280252 0.7843631 ENSBTAG00000012470 215.8585827 177.3869452 254.3302202 1.433759513 0.7843631 ENSBTAG00000031801 333.5041337 273.2738767 393.7343908 1.440805084 0.7843631 506566 87.74881166 71.59471908 103.9029042 1.45126492 0.7843631 ENSBTAG00000003843 388.9623605 317.3342309 460.5904901 1.451436515 0.7843631 ENSBTAG00000002678 163.7809658 133.2698788 194.2920528 1.457884216 0.7843631 100336754 47.25459724 38.37935945 56.12983502 1.462500569 0.7843631 ENSBTAG00000016528 330.663485 267.8417847 393.4851853 1.469095592 0.7843631 ENSBTAG00000022808 56.07906949 45.31363222 66.84450677 1.475152256 0.7843631 ENSBTAG00000009362 72.6225719 58.41177927 86.83336454 1.486572839 0.7843631 ENSBTAG00000015642 225.4375098 181.1298784 269.7451413 1.489236032 0.7843631 ENSBTAG00000004688 423.0635795 339.7037782 506.4233808 1.490779359 0.7843631 613274 41.21314261 33.06588747 49.36039774 1.492789141 0.7843631 ENSBTAG00000013618 55.72599292 44.57075919 66.88122666 1.500562877 0.7843631 ENSBTAG00000021160 609.0544818 486.7784979 731.3304657 1.502388599 0.7843631 281873 493.2280317 392.6865255 593.769538 1.51207006 0.7843631 ENSBTAG00000026937 34.36097184 27.27514698 41.44679671 1.519581058 0.7843631 520497 67.64061719 53.5577638 81.72347058 1.525894003 0.7843631 ENSBTAG00000038497 82.29355675 64.57288197 100.0142315 1.548858104 0.7843631 ENSBTAG00000039882 43.45324545 34.02091187 52.88557904 1.554502103 0.7843631 ENSBTAG00000000802 35.0137336 27.41013391 42.61733329 1.554802083 0.7843631 ENSBTAG00000008313 9.566500169 7.403777374 11.72922296 1.584221455 0.7843631 616441 174.3289034 133.7531822 214.9046246 1.606725321 0.7843631 100126815 29.30186492 22.47409726 36.12963257 1.607612183 0.7843631 ENSBTAG00000038809 36.44375165 27.94189813 44.94560517 1.608538008 0.7843631 ENSBTAG00000003403 11.96214611 9.17107535 14.75321686 1.608668155 0.7843631 ENSBTAG00000009841 161.7127038 123.1464194 200.2789883 1.62634845 0.7843631 ENSBTAG00000013664 55.21542042 41.86105743 68.56978341 1.638032759 0.7843631

PAGE 158

ENSBTAG00000008331 41.82959244 31.68815807 51.9710268 1.640077239 0.7843631 614452 10.68700714 8.085433355 13.28858092 1.643521174 0.7843631 ENSBTAG00000011500 20.3435616 15.32004481 25.36707839 1.655809673 0.7843631 100138915 25.35306823 19.02436186 31.68177459 1.665326534 0.7843631 ENSBTAG00000014291 33.98924384 25.29625281 42.68223487 1.687294762 0.7843631 ENSBTAG00000035447 19.77089448 14.41951613 25.12227284 1.742241044 0.7843631 ENSBTAG00000038327 6.019992358 4.281350931 7.758633785 1.812192906 0.7843631 ENSBTAG00000009340 8.784084863 6.060226963 11.50794276 1.898929336 0.7843631 ENSBTAG00000006343 5.966930037 4.115999171 7.817860903 1.899383498 0.7843631 ENSBTAG00000001842 8.584140862 5.802318547 11.36596318 1.958865768 0.7843631 ENSBTAG00000001166 6.963564782 4.674246277 9.252883286 1.979545522 0.7843631 533796 4.063108675 2.625883773 5.500333577 2.094659952 0.7843631 528224 13.32217333 8.289888621 18.35445804 2.214077762 0.7843631 ENSBTAG00000039738 3.695491441 2.275418702 5.115564181 2.248185873 0.7843631 ENSBTAG00000043472 3.527998232 2.017510285 5.038486178 2.497378186 0.7843631 ENSBTAG00000034282 1.297338205 0.589099325 2.005577085 3.404480363 0.7843631 ENSBTAG00000023623 1.315085653 0.589099325 2.041071981 3.464733184 0.7843631 100335820 1.359505992 0.589099325 2.129912659 3.615540822 0.7843631 ENSBTAG00000011164 1.296718875 0.558247107 2.035190644 3.645680594 0.7843631 ENSBTAG00000015565 1.37725344 0.589099325 2.165407555 3.675793643 0.7843631 ENSBTAG00000040477 1.361827331 0.558247107 2.165407555 3.878940936 0.7843631 ENSBTAG00000027181 1.439421227 0.589099325 2.289743129 3.886854102 0.7843631 ENSBTAG00000002413 1.37663411 0.558247107 2.195021114 3.931988339 0.7843631 524189 1.454228007 0.589099325 2.319356688 3.937123314 0.7843631 ENSBTAG00000037629 1.40624767 0.558247107 2.254248233 4.038083145 0.7843631 783311 1.438801897 0.558247107 2.319356688 4.154713316 0.7843631 ENSBTAG00000008650 1.531202573 0.589099325 2.473305821 4.198452986 0.7843631 521050 1.453608677 0.558247107 2.348970247 4.207760719 0.7843631 ENSBTAG00000017843 1.568631148 0.600677381 2.536584915 4.222874031 0.7843631 784256 1.615992156 0.600677381 2.63130693 4.380566027 0.7843631 ENSBTAG00000002687 1.618932824 0.600677381 2.637188267 4.390357201 0.7843631 ENSBTAG00000018540 1.548330692 0.558247107 2.538414277 4.547115867 0.7843631 ENSBTAG00000034908 1.71071417 0.600677381 2.820750959 4.695950017 0.7843631 ENSBTAG00000033879 1.152957888 0.300338691 2.005577085 6.677718013 0.7843631 ENSBTAG00000038727 1.170705336 0.300338691 2.041071981 6.795900909 0.7843631 ENSBTAG00000032896 1.185512115 0.300338691 2.07068554 6.894501456 0.7843631 ENSBTAG00000022783 1.200318895 0.300338691 2.100299099 6.993102003 0.7843631 ENSBTAG00000011305 1.229932454 0.300338691 2.159526218 7.190303097 0.7843631 ENSBTAG00000023776 1.229932454 0.300338691 2.159526218 7.190303097 0.7843631 786826 1.262486682 0.300338691 2.224634673 7.407086541 0.7843631 ENSBTAG00000020555 1.277293462 0.300338691 2.254248233 7.505687088 0.7843631 ENSBTAG00000026666 1.357208697 0.300338691 2.414078703 8.037854522 0.7843631 ENSBTAG00000037503 1.434183263 0.300338691 2.568027836 8.550439606 0.7843631 ENSBTAG00000008152 1.481544271 0.300338691 2.662749851 8.865823597 0.7843631 ENSBTAG00000007323 2669.293865 3008.160817 2330.426913 0.774701572 0.7849072 ENSBTAG00000038844 2.569572489 2.960956632 2.178188347 0.735636694 0.7849315 783681 6.40342096 8.26285056 4.543991361 0.549930236 0.7850243 506061 15.87584353 20.0096833 11.74200376 0.586816072 0.7850243 ENSBTAG00000006447 8.69692826 10.30739891 7.086457613 0.687511726 0.7850243 ENSBTAG00000004184 26.42758243 20.46428308 32.39088177 1.582800709 0.7850243 ENSBTAG00000012684 9.641065855 11.46244145 7.819690265 0.682201109 0.7851928 ENSBTAG00000009080 13.90997017 10.9080085 16.91193184 1.550414252 0.7851928

PAGE 159

523424 2.546661364 1.416832904 3.676489823 2.594864795 0.7851928 ENSBTAG00000011491 190.2852133 215.5791062 164.9913204 0.765340034 0.7852198 ENSBTAG00000001861 68.52566847 77.94863119 59.10270575 0.758226345 0.7854171 ENSBTAG00000006751 3633.168654 4099.550921 3166.786388 0.772471534 0.7854171 ENSBTAG00000005338 1257.689764 1128.132223 1387.247305 1.229685028 0.7854171 ENSBTAG00000030809 83.95451614 65.16282048 102.7462118 1.576761273 0.7854171 ENSBTAG00000017826 32.08892992 23.9527024 40.22515745 1.679357794 0.7854171 ENSBTAG00000024291 2.470925456 1.478537341 3.463313572 2.342391683 0.7854171 100337453 2.485112906 1.447685123 3.52254069 2.433222967 0.7854171 535689 2.469686797 1.416832904 3.52254069 2.486207569 0.7854171 100139581 2.483434941 1.189776707 3.777093175 3.174623569 0.7854171 ENSBTAG00000023377 3.453652508 1.501693453 5.405611562 3.599677118 0.7854171 ENSBTAG00000018897 2324.108219 2095.058943 2553.157494 1.218656641 0.785456 ENSBTAG00000019891 2.457820686 1.416832904 3.498808468 2.469457378 0.785456 617692 2.450880713 1.189776707 3.711984719 3.119900313 0.785456 100302388 5.691959378 7.311708107 4.072210649 0.556943821 0.7857137 ENSBTAG00000008251 876.3285228 988.3732505 764.2837951 0.773274464 0.7857137 ENSBTAG00000008484 418.8604211 355.4470068 482.2738355 1.356809387 0.7857137 100337303 2.415385817 1.189776707 3.640994927 3.060233829 0.7857137 ENSBTAG00000020315 52.14975872 60.46888045 43.83063698 0.72484618 0.7857753 ENSBTAG00000012541 8.439743351 10.96152944 5.917957264 0.539884265 0.7858718 783784 26.23228964 32.99253718 19.4720421 0.590195352 0.7858718 ENSBTAG00000018131 2021.665005 1851.768296 2191.561714 1.183496726 0.7859009 ENSBTAG00000002283 2.373286817 1.158924488 3.587649146 3.095671187 0.7859009 789847 7.378721726 9.06361387 5.693829582 0.628207431 0.7859272 ENSBTAG00000002941 3.22404079 1.975080011 4.473001569 2.264719173 0.7859272 ENSBTAG00000018924 1793.49454 2039.596033 1547.393046 0.758676238 0.7861517 ENSBTAG00000030670 25.17756587 17.88089738 32.47423436 1.816141197 0.7864761 ENSBTAG00000021581 17.49152569 11.03536711 23.94768427 2.170084967 0.7865199 ENSBTAG00000032209 8.589349752 11.1345773 6.044122199 0.542824576 0.7867095 100336494 6.871519251 8.655258518 5.087779984 0.587825306 0.7867095 505037 9.472285899 11.7820543 7.162517499 0.607917543 0.7867095 ENSBTAG00000003565 21.06703906 25.14629326 16.98778485 0.675558209 0.7867095 ENSBTAG00000030474 70.5874019 83.32941858 57.84538522 0.694177233 0.7867095 539858 2888.083206 3327.304493 2448.861919 0.735989725 0.7867095 ENSBTAG00000016156 506.4434005 433.2824471 579.604354 1.337705596 0.7867095 614835 48.16852718 39.63423516 56.70281921 1.43065254 0.7867095 782802 12.79253016 8.536218981 17.04884133 1.997235704 0.7867095 ENSBTAG00000010999 2.279184132 1.189776707 3.368591557 2.831280473 0.7867095 ENSBTAG00000038197 3.173323851 1.459263179 4.887384524 3.349213901 0.7867095 ENSBTAG00000025666 2.196971601 0.901016072 3.492927131 3.876653524 0.7867095 100299041 2.24139194 0.901016072 3.581767808 3.975254071 0.7867095 781152 2.25619872 0.901016072 3.611381368 4.00812092 0.7867095 614026 19.24764023 22.13139609 16.36388437 0.739396841 0.7868138 ENSBTAG00000002960 7056.064802 7837.165624 6274.96398 0.800667522 0.7868138 ENSBTAG00000016559 50.43486923 38.03333151 62.83640695 1.65214049 0.7868482 ENSBTAG00000038386 10.70961444 13.39509118 8.0241377 0.599035691 0.7870524 617924 28.87348146 33.76681761 23.98014531 0.710168947 0.7870524 ENSBTAG00000006680 210.943852 241.9527497 179.9349542 0.743678071 0.7870524 100294979 2681.829534 2383.86212 2979.796947 1.24998712 0.7870524 100336734 472.5193335 550.4264319 394.6122352 0.71692094 0.7871253 614347 225.0801207 256.5087149 193.6515264 0.754951061 0.787446

PAGE 160

ENSBTAG00000018598 129.1790854 146.3296938 112.028477 0.7655895 0.787446 ENSBTAG00000001447 641.8986015 708.9228369 574.8743662 0.810912466 0.787446 ENSBTAG00000019252 84.70176827 68.17778545 101.2257511 1.484732167 0.787446 512318 3063.973238 3496.33053 2631.615946 0.752679394 0.787641 ENSBTAG00000012925 1315.221047 1477.708813 1152.733281 0.780081482 0.787641 ENSBTAG00000040519 3.066092352 1.748023813 4.384160891 2.508067028 0.787641 613282 3.063795057 1.459263179 4.668326935 3.199098698 0.787641 100336512 1537.1956 1672.874808 1401.516393 0.837789167 0.787759 ENSBTAG00000018399 5.716990227 7.13866024 4.295320213 0.601698368 0.7880042 534759 35.01031076 41.84455486 28.17606667 0.673350852 0.7880042 ENSBTAG00000014075 45.46364602 52.53327106 38.39402099 0.73085152 0.7880042 ENSBTAG00000033373 4.309388732 2.852939971 5.765837492 2.021016058 0.7880042 787447 3.044369643 1.201354763 4.887384524 4.068227534 0.7880042 ENSBTAG00000009336 92.06237442 111.5044713 72.62027757 0.651276821 0.7883299 ENSBTAG00000022552 5.529236327 6.6724824 4.385990253 0.657325114 0.7883299 ENSBTAG00000031647 510.0379688 565.6713382 454.4045995 0.803301438 0.7884151 ENSBTAG00000018447 4508.949341 4101.040063 4916.85862 1.198929673 0.7884151 ENSBTAG00000038125 7.043134362 4.439493973 9.64677475 2.172944666 0.7884151 ENSBTAG00000038238 7.043134362 4.439493973 9.64677475 2.172944666 0.7884151 100299905 3.0022466 1.490115397 4.514377802 3.029549128 0.7884151 ENSBTAG00000039063 15.38300785 11.31587646 19.45013924 1.718836301 0.7889321 ENSBTAG00000038872 3.20498136 1.501693453 4.908269267 3.268489488 0.7892333 ENSBTAG00000012111 5.485411274 7.022947472 3.947875075 0.562139343 0.7892994 ENSBTAG00000033669 30.56501442 37.40506089 23.72496796 0.634271604 0.7892994 ENSBTAG00000017181 20.88023853 15.05492768 26.70554939 1.773874306 0.7892994 ENSBTAG00000043217 6.401415463 4.281350931 8.521479996 1.990371762 0.7892994 ENSBTAG00000024655 123.1929435 144.4220647 101.9638222 0.706012772 0.7897737 ENSBTAG00000009104 176.6423089 148.337071 204.9475469 1.381634041 0.7897737 ENSBTAG00000005280 41.16973695 31.33048428 51.00898963 1.628094516 0.7897737 ENSBTAG00000045237 3513.125636 2962.56735 4063.683922 1.371676469 0.7902909 ENSBTAG00000016297 88.2441566 104.4874909 72.00082232 0.689085571 0.7903778 ENSBTAG00000010321 2522.365588 2854.202334 2190.528843 0.767474968 0.7903778 ENSBTAG00000027923 16.15786385 12.40151845 19.91420925 1.605787979 0.7909846 ENSBTAG00000008048 33.14711659 39.83432108 26.4599121 0.664249104 0.7915895 ENSBTAG00000014676 42.35695808 34.08643046 50.6274857 1.485268038 0.7915895 782861 8.25354007 10.86557822 5.641501918 0.519208624 0.7916852 ENSBTAG00000011456 355.3212889 404.3760101 306.2665676 0.757380655 0.7916852 ENSBTAG00000039686 27014.89245 29794.47642 24235.30848 0.813416156 0.7916852 497226 752.4915311 826.528656 678.4544062 0.820848014 0.7916852 ENSBTAG00000025213 123.0000312 103.4818527 142.5182097 1.377229011 0.7916852 538777 1034.40822 854.5587501 1214.25769 1.420917742 0.7916852 ENSBTAG00000013956 34.8158116 28.53044228 41.10118093 1.440607914 0.7916852 613483 221.3276084 171.5192436 271.1359732 1.580790397 0.7916852 ENSBTAG00000032686 14.97791019 18.14261995 11.81320042 0.651129796 0.7918619 ENSBTAG00000024633 7.129395325 8.947901102 5.310889548 0.593534672 0.7918846 790191 16.02680628 19.88627443 12.16733814 0.611846034 0.7918846 ENSBTAG00000007880 11.52876479 14.29610725 8.761422327 0.612853707 0.7918846 ENSBTAG00000012892 30.03412707 35.21838468 24.84986947 0.705593675 0.7918846 ENSBTAG00000003143 97.13060816 79.16537817 115.0958382 1.453865829 0.7922115 512696 12.96537985 15.41648342 10.51427629 0.682015217 0.7922536 ENSBTAG00000013211 829.9349541 736.671125 923.1987833 1.253203434 0.79227 ENSBTAG00000000667 59.78137432 69.54781874 50.0149299 0.719144479 0.7928748

PAGE 161

ENSBTAG00000012609 8.371246622 10.22253836 6.519954887 0.637801949 0.7928797 ENSBTAG00000012385 710.0074971 610.9958449 809.0191493 1.324099265 0.7928797 ENSBTAG00000022847 413.8303622 354.1729247 473.4877997 1.336883106 0.7928797 506781 8.174707514 10.77302157 5.576393463 0.517625759 0.7929471 ENSBTAG00000013253 182.9406189 210.2091383 155.6720995 0.740558192 0.7930836 ENSBTAG00000021394 10.21943591 11.81678847 8.622083348 0.729646923 0.7933275 ENSBTAG00000004100 81.16708302 92.37196148 69.96220457 0.757396546 0.7933275 ENSBTAG00000019441 32.05310985 22.79045114 41.31576855 1.812854353 0.7933275 100337057 302.9264251 240.8078445 365.0450056 1.515918247 0.7935908 614300 52.02979489 60.98893103 43.07065875 0.70620452 0.7936555 ENSBTAG00000015509 215.8753853 189.6511882 242.0995825 1.276551889 0.7936555 ENSBTAG00000042697 5.310178738 6.6724824 3.947875075 0.591665116 0.7938991 519874 205.1148506 238.0172405 172.2124607 0.723529356 0.7938991 ENSBTAG00000015638 2.254265041 0.889438016 3.619092067 4.068964899 0.7941301 ENSBTAG00000009974 5.291991983 6.476278421 4.107705546 0.634269449 0.7942765 ENSBTAG00000023398 5.413886162 6.437730096 4.390042228 0.681923933 0.7942765 ENSBTAG00000011471 7.963752267 9.352374504 6.57513003 0.70304392 0.7942765 ENSBTAG00000012803 2057.700437 1831.172322 2284.228551 1.247413214 0.7942765 ENSBTAG00000038640 32.63301199 26.6821657 38.58385827 1.446054218 0.7942765 617027 27.85290276 21.60344602 34.1023595 1.578561099 0.7946153 ENSBTAG00000017738 7.883837032 9.352374504 6.41529956 0.685954092 0.7946824 ENSBTAG00000003338 367.6501931 421.1263305 314.1740557 0.7460328 0.7950063 ENSBTAG00000013638 2.17958777 1.178198651 3.180976889 2.699864652 0.7950063 ENSBTAG00000021880 827.2184341 931.6964513 722.7404169 0.775725201 0.7953348 ENSBTAG00000021584 20.72387561 16.22487504 25.22287619 1.554580613 0.7953348 ENSBTAG00000006424 27.19281351 20.15631608 34.22931094 1.698192805 0.7953348 ENSBTAG00000017507 2.609195134 1.201354763 4.017035506 3.343754594 0.7953348 ENSBTAG00000011899 1866.382015 1581.347414 2151.416616 1.360495864 0.795893 ENSBTAG00000008798 20.43242394 15.76306654 25.10178134 1.59244277 0.795893 ENSBTAG00000007351 8.886048272 6.164361675 11.60773487 1.883039232 0.795893 100169896 2.09737524 0.889438016 3.305312463 3.716180784 0.7959143 784074 2.09675591 0.858585797 3.334926022 3.884208232 0.7959143 ENSBTAG00000011808 14.38570902 17.83402997 10.93738806 0.613287523 0.7959233 ENSBTAG00000012457 31.19743748 25.20751031 37.18736464 1.475249407 0.7959233 ENSBTAG00000042276 2.08194913 0.858585797 3.305312463 3.849717143 0.7959233 ENSBTAG00000002223 2024.538629 2203.456651 1845.620608 0.837602413 0.7959293 ENSBTAG00000020430 7.380137129 4.439493973 10.32078028 2.324765017 0.7959293 ENSBTAG00000028811 2.062523717 0.600677381 3.524370052 5.867326058 0.7960131 ENSBTAG00000007430 12.66011043 14.90066658 10.41955427 0.699267661 0.7960256 520472 482.6313015 562.6163541 402.6462489 0.715667517 0.7960256 ENSBTAG00000007112 274.092243 307.7193075 240.4651785 0.781443259 0.7960256 ENSBTAG00000015691 13.48703533 9.55627459 17.41779608 1.822655462 0.7960256 100337286 15.4156342 10.62701176 20.20425663 1.901217115 0.7960256 511124 2.035207453 0.889438016 3.180976889 3.576389621 0.7960256 ENSBTAG00000017866 482.501021 570.8116181 394.1904238 0.690578838 0.796112 537894 116.7731605 134.6975312 98.84878978 0.733857472 0.7961316 ENSBTAG00000019297 12.09295569 15.22409359 8.961817787 0.588660187 0.7963761 787811 1.992465079 1.147346432 2.837583726 2.473170829 0.7963761 ENSBTAG00000010619 1251.715233 1120.800178 1382.630288 1.233609983 0.7964845 ENSBTAG00000001097 60.79493629 54.41517144 67.17470115 1.234484784 0.7964845 100137901 5.091860535 6.772735162 3.410985908 0.503634917 0.7967057 ENSBTAG00000007007 17.9869588 20.94931549 15.02460212 0.717188212 0.7967057

PAGE 162

505537 5094.14426 5766.665701 4421.622819 0.76675553 0.7967057 613898 1890.599935 2099.372103 1681.827768 0.801109897 0.7967057 ENSBTAG00000000080 168.0444142 182.2008189 153.8880095 0.844606574 0.7967057 ENSBTAG00000005310 25.57237977 20.14085607 31.00390346 1.539353806 0.7967057 ENSBTAG00000006093 1.860570203 0.889438016 2.831702389 3.183698401 0.7967057 783975 1.896065099 0.889438016 2.902692182 3.263512611 0.7967057 ENSBTAG00000007136 1.892505101 0.858585797 2.926424404 3.408423961 0.7967057 ENSBTAG00000010033 1.90731188 0.858585797 2.956037963 3.44291505 0.7967057 ENSBTAG00000004181 1.627349208 0.600677381 2.654021034 4.418380176 0.7967057 ENSBTAG00000037526 1.722071222 0.600677381 2.843465064 4.733764167 0.7967057 ENSBTAG00000044631 1.751684782 0.600677381 2.902692182 4.832364714 0.7967057 ENSBTAG00000020944 1.828659348 0.600677381 3.056641315 5.088657256 0.7967057 528008 1.890827135 0.600677381 3.180976889 5.295649525 0.7967057 ENSBTAG00000042583 1.905633915 0.600677381 3.210590448 5.344949799 0.7967057 ENSBTAG00000017360 42.66224602 50.17250442 35.15198762 0.700622543 0.7971515 ENSBTAG00000009436 1567.569152 1709.531009 1425.607295 0.83391719 0.797303 ENSBTAG00000042880 5.249485168 2.660617941 7.838352394 2.946064624 0.7975678 ENSBTAG00000004461 173.8616066 151.8411665 195.8820466 1.290045718 0.7978341 ENSBTAG00000018020 10.31822906 12.95976556 7.676692562 0.592348104 0.7979745 ENSBTAG00000022766 55.04156938 47.64631822 62.43682053 1.310422775 0.7979745 ENSBTAG00000038104 6248.664379 7071.127424 5426.201333 0.767374282 0.7980826 506546 17.77897243 21.87730183 13.68064302 0.625335022 0.7982396 ENSBTAG00000004196 8.95426765 11.05796804 6.850567257 0.619514112 0.7983043 ENSBTAG00000005236 68.82006003 82.26014358 55.37997648 0.673229757 0.7983043 ENSBTAG00000013162 87705.20388 77306.61841 98103.78935 1.269021869 0.7983043 ENSBTAG00000021544 2058.65664 2255.406124 1861.907155 0.82553077 0.7984152 ENSBTAG00000039067 4.988652384 6.968939141 3.008365627 0.431682006 0.7984314 ENSBTAG00000031347 11.27454459 14.63062493 7.918464255 0.541225292 0.7984314 ENSBTAG00000020859 11.83396446 15.00812806 8.659800858 0.577007394 0.7984314 540182 10.24527798 12.65991426 7.830641695 0.618538288 0.7984314 ENSBTAG00000000328 20.53713895 25.28460696 15.78967094 0.624477611 0.7984314 ENSBTAG00000000626 16.9205079 20.5838778 13.257138 0.644054445 0.7984314 ENSBTAG00000021837 13.95867648 16.89883491 11.01851804 0.652028267 0.7984314 786324 7.766585531 9.329218392 6.20395267 0.665002405 0.7984314 ENSBTAG00000004054 14429.30287 16491.31468 12367.29107 0.749927541 0.7984314 100271757 173497.205 193877.3647 153117.0454 0.789762361 0.7984314 ENSBTAG00000014118 29.68908533 33.13972514 26.23844552 0.791752056 0.7984314 ENSBTAG00000020981 428.5750321 377.8944856 479.2555787 1.268225912 0.7984314 ENSBTAG00000004256 19123.36903 16753.398 21493.34006 1.28292422 0.7984314 ENSBTAG00000032872 48.18874513 39.45681795 56.9206723 1.44260676 0.7984314 ENSBTAG00000039391 10.72321265 8.570397968 12.87602733 1.50238383 0.7984314 790476 19.07341852 13.81114264 24.3356944 1.762033384 0.7984314 100313263 3.44088731 2.036784448 4.844990173 2.378744681 0.7984314 ENSBTAG00000000355 20.58232806 15.41260147 25.75205466 1.670844128 0.7984785 540050 4.97092898 6.649326288 3.292531671 0.49516771 0.798816 ENSBTAG00000013329 23.74842204 27.86091953 19.63592455 0.704783793 0.7989243 ENSBTAG00000001727 20.05392976 14.23107605 25.87678348 1.818329366 0.7989408 510970 9.941123575 12.27471502 7.607532131 0.619772607 0.799007 ENSBTAG00000015444 12.83363724 15.65844444 10.00883004 0.639196957 0.799007 ENSBTAG00000003314 871.0638153 990.7733497 751.3542809 0.758351323 0.799007 ENSBTAG00000010178 3.382718828 2.263840645 4.50159701 1.988477864 0.7993294 508363 27.48696773 32.34180121 22.63213425 0.699779647 0.7993339

PAGE 163

ENSBTAG00000010504 131.8427015 143.5971071 120.088296 0.836286318 0.7993339 505914 130.3965081 157.4292486 103.3637677 0.656572833 0.7995149 ENSBTAG00000021932 635.3897522 536.5604718 734.2190326 1.368380772 0.7995149 100337095 2.999050218 1.736445757 4.261654679 2.454240025 0.7998603 524868 149.0212053 177.2403759 120.8020348 0.681571759 0.7999791 530437 24.56360793 28.53432423 20.59289163 0.721688429 0.7999791 100335268 2.9819221 1.767297976 4.196546223 2.374554988 0.8002272 ENSBTAG00000009850 732.6632647 816.6202002 648.7063292 0.794379479 0.800478 521413 4108.84604 4503.825845 3713.866236 0.824602541 0.800478 522529 5342.588107 4814.176914 5870.9993 1.219522964 0.800478 ENSBTAG00000031912 31.94581425 25.16944937 38.72217913 1.538459525 0.800478 ENSBTAG00000034662 31.94581425 25.16944937 38.72217913 1.538459525 0.800478 ENSBTAG00000002640 30.3293614 23.07096049 37.58776231 1.62922399 0.800478 ENSBTAG00000021474 3.331358516 2.036784448 4.625932584 2.271193984 0.800478 100313246 6.119173284 8.054581136 4.183765431 0.519426816 0.8004808 790031 2.951689211 1.736445757 4.166932664 2.399690659 0.8005269 504711 14.76676837 18.20813855 11.32539819 0.621996486 0.800604 ENSBTAG00000008147 66.21538256 75.17278787 57.25797726 0.761684898 0.800604 ENSBTAG00000002586 1450.818496 1634.359759 1267.277234 0.775396743 0.8006161 ENSBTAG00000002414 816.3303052 905.8407939 726.8198166 0.802370374 0.8006203 ENSBTAG00000008153 30.50610433 21.51581389 39.49639477 1.835691412 0.8006203 787413 7.282005025 4.654972115 9.909037934 2.128699741 0.8006203 ENSBTAG00000011864 6.089999031 8.250785115 3.929212946 0.476222916 0.8010574 781650 42.68749003 33.58225948 51.79272058 1.54226432 0.8010901 ENSBTAG00000006752 12.63199569 16.25572726 9.008264113 0.554159403 0.801387 787287 109.2125458 125.1861745 93.23891716 0.744802032 0.801387 ENSBTAG00000020760 10.65972224 12.39819169 8.921252797 0.719560806 0.8013899 518768 24.78282716 29.6623965 19.90325782 0.670992913 0.8014376 785408 320.5789316 375.5385713 265.6192918 0.707302291 0.8014376 ENSBTAG00000014002 545.1064461 471.2728394 618.9400528 1.313336991 0.8014376 537614 10.26671364 13.51024877 7.02317852 0.519840799 0.8015014 ENSBTAG00000043639 2140.960425 2252.01945 2029.9014 0.901369391 0.8015685 ENSBTAG00000016070 2.875333974 1.767297976 3.983369972 2.253932289 0.8018437 ENSBTAG00000011480 1619.768563 1402.526367 1837.010759 1.309786969 0.8019337 ENSBTAG00000008573 144.3008845 169.5566444 119.0451246 0.702096488 0.8020155 617255 115.8421278 133.6991018 97.98515384 0.732878176 0.8020155 ENSBTAG00000018220 3.660305051 4.204741669 3.115868434 0.741036829 0.8020155 100101129 1838.648937 2008.895706 1668.402168 0.830507111 0.8020155 ENSBTAG00000005654 11734.92077 12520.66012 10949.18141 0.874489149 0.8020155 ENSBTAG00000011793 1204.659023 1056.99997 1352.318075 1.279392729 0.8020155 ENSBTAG00000034376 176.3333198 151.5530289 201.1136108 1.32701809 0.8020155 615412 234.1875284 191.833919 276.5411378 1.441565388 0.8020155 ENSBTAG00000030923 29.24324868 23.35965333 35.12684403 1.503739954 0.8020155 ENSBTAG00000023407 4.898532703 2.402709525 7.39435588 3.077507207 0.8020155 ENSBTAG00000003743 11.50836251 13.36812091 9.648604112 0.721762181 0.8020219 ENSBTAG00000008690 31.32602404 23.23291769 39.41913038 1.696693068 0.8020219 538979 236.5166783 198.4157093 274.6176473 1.384051939 0.8026991 537696 4.515210454 6.399113979 2.63130693 0.411198634 0.8029322 ENSBTAG00000032038 9.428302611 6.992095253 11.86450997 1.696846158 0.8030602 ENSBTAG00000037439 9.428302611 6.992095253 11.86450997 1.696846158 0.8030602 ENSBTAG00000039957 3.191928381 1.201354763 5.182501998 4.313881427 0.8031761 ENSBTAG00000002831 44.64281237 52.87548484 36.41013989 0.688601532 0.8033623

PAGE 164

ENSBTAG00000002583 43.48456736 51.17377325 35.79536148 0.69948646 0.8033623 618456 3769.246684 4321.400096 3217.093272 0.744456241 0.8033623 ENSBTAG00000001807 1541.711792 1739.522464 1343.901119 0.772568994 0.8033623 ENSBTAG00000020314 1178.708082 1007.006811 1350.409354 1.341013128 0.8033623 ENSBTAG00000009138 40.59038802 32.25749584 48.92328019 1.516648423 0.8033623 781488 2.775373995 1.478537341 4.072210649 2.754215626 0.8033623 523049 4.479739601 6.079501125 2.879978078 0.473719474 0.8034514 617392 6.422456498 7.658359021 5.186553974 0.677240902 0.8037074 ENSBTAG00000026369 449.7788034 388.0618589 511.4957478 1.318077869 0.8037074 ENSBTAG00000030678 178.7658948 154.229039 203.3027506 1.318187236 0.8037074 100271834 83.96934911 70.95209881 96.98659941 1.366930662 0.8037074 ENSBTAG00000018575 7.912363016 5.810014653 10.01471138 1.723698128 0.8037074 100298118 18.94317887 20.68801251 17.19834524 0.831319356 0.8041228 ENSBTAG00000008809 281.2346636 314.3231436 248.1461837 0.789462019 0.8041828 ENSBTAG00000002293 2383.652827 2186.017618 2581.288037 1.180817582 0.8041828 ENSBTAG00000021680 2040.211869 1788.122959 2292.300779 1.281959256 0.8041828 ENSBTAG00000011957 499.1565353 430.1748405 568.1382302 1.320714688 0.8041828 100139484 247.1290825 210.4289858 283.8291791 1.34881218 0.8041828 ENSBTAG00000005592 79.52521948 65.94375445 93.10668451 1.411910579 0.8041828 ENSBTAG00000020312 93.72423515 74.01441857 113.4340517 1.532593972 0.8041828 100301415 2.720146181 1.705593539 3.734698824 2.18967693 0.8041828 ENSBTAG00000039111 4.769246947 2.949378576 6.589115317 2.234069024 0.8041828 ENSBTAG00000013152 823.8013517 715.0399116 932.5627918 1.304210823 0.8043447 100313172 0.836567737 1.201354763 0.471780712 0.392707239 0.805016 100336853 0.836567737 1.201354763 0.471780712 0.392707239 0.805016 282455 0.836567737 1.201354763 0.471780712 0.392707239 0.805016 ENSBTAG00000004351 0.836567737 1.201354763 0.471780712 0.392707239 0.805016 ENSBTAG00000025667 0.836567737 1.201354763 0.471780712 0.392707239 0.805016 614583 4.675228372 5.844748821 3.505707923 0.599804719 0.805016 ENSBTAG00000021378 55.8636637 65.57062066 46.15670675 0.703923591 0.805016 ENSBTAG00000010951 70.92824185 58.55397492 83.30250878 1.422661893 0.805016 ENSBTAG00000014841 248.5263704 194.9346386 302.1181022 1.549843088 0.805016 ENSBTAG00000019831 159.5538162 174.4508102 144.6568222 0.82921267 0.8054859 ENSBTAG00000020958 656.0461459 760.0065453 552.0857466 0.726422358 0.80579 ENSBTAG00000017685 191.7073477 146.3992342 237.0154612 1.618966537 0.8059213 786356 42.183861 50.51181103 33.85591097 0.670257318 0.8062418 ENSBTAG00000017852 736.6569033 819.204039 654.1097676 0.798469901 0.8062418 ENSBTAG00000014553 111.50519 87.68780269 135.3225773 1.543231477 0.8062418 ENSBTAG00000019687 22.66536123 16.05570912 29.27501334 1.823339792 0.8062418 ENSBTAG00000016711 2.620805532 1.447685123 3.793925942 2.620684486 0.8062418 514750 2.616186898 1.189776707 4.04259709 3.397777976 0.8062418 506188 14.00841271 16.99527352 11.0215519 0.648506885 0.8063436 524475 18.84486544 14.51158539 23.17814548 1.597216627 0.8063835 ENSBTAG00000009908 5969.955444 5477.124332 6462.786555 1.179959804 0.8063838 ENSBTAG00000016596 1293.038833 1134.698177 1451.379488 1.279088588 0.8064148 100336523 6.413471088 7.893111325 4.93383085 0.625080611 0.8066243 520784 57.93533297 69.40930166 46.46136428 0.669382391 0.8066243 ENSBTAG00000010559 13.96582186 16.61395623 11.31768749 0.68121568 0.8066243 ENSBTAG00000007922 228.5614449 256.0617435 201.0611463 0.785205722 0.8066243 ENSBTAG00000017508 62.69233003 77.47593108 47.90872897 0.618369193 0.8066984 ENSBTAG00000038520 8.670089726 10.65349464 6.686684812 0.627651774 0.8066984 538796 20.33307587 23.60168215 17.0644696 0.723019211 0.8066984

PAGE 165

ENSBTAG00000015972 348.380095 397.1185137 299.6416763 0.75453968 0.8066984 511427 163.2793313 184.563179 141.9954837 0.769359763 0.8066984 ENSBTAG00000020327 901.0749634 798.5423737 1003.607553 1.256799371 0.8066984 ENSBTAG00000015991 10951.27614 9541.044572 12361.50771 1.295613664 0.8066984 ENSBTAG00000000730 8.354536278 9.799278181 6.909794376 0.705132995 0.8067618 ENSBTAG00000016078 61.12802091 72.72993227 49.52610955 0.680959104 0.8070647 ENSBTAG00000001598 806.6506025 692.1271748 921.1740302 1.330931747 0.8070647 ENSBTAG00000035005 17.93311616 14.56122439 21.30500792 1.463133 0.8070647 618246 11.0041786 8.686110736 13.32224646 1.533741264 0.8070647 ENSBTAG00000025450 842.3681596 635.111501 1049.624818 1.652662275 0.8070647 ENSBTAG00000004168 20.82162838 15.57844062 26.06481614 1.673133838 0.8070647 ENSBTAG00000026156 2.548781148 0.901016072 4.196546223 4.657570884 0.8070647 614129 4.271513532 5.532832075 3.010194989 0.544060428 0.807187 ENSBTAG00000020710 270.4581627 316.1357241 224.7806014 0.711025627 0.807187 ENSBTAG00000012622 6010.253919 6838.802005 5181.705833 0.757692039 0.807187 613907 364.9915577 413.3060993 316.6770161 0.766204556 0.807187 ENSBTAG00000040580 730.5119464 815.2347875 645.7891053 0.792151065 0.807187 ENSBTAG00000007455 2406.168753 2101.388304 2710.949203 1.290075326 0.807187 ENSBTAG00000001315 1.414089007 2.356397301 0.471780712 0.20021272 0.8072705 ENSBTAG00000044782 1.398662897 2.325545083 0.471780712 0.202868874 0.8072705 ENSBTAG00000019523 1.382617458 2.263840645 0.501394271 0.22147949 0.8072705 785602 1.443702566 2.356397301 0.53100783 0.225347326 0.8072705 788764 1.269708689 2.067636667 0.471780712 0.228173895 0.8072705 ENSBTAG00000044118 1.25428258 2.036784448 0.471780712 0.231630162 0.8072705 100336887 1.238856471 2.005932229 0.471780712 0.235192747 0.8072705 ENSBTAG00000032255 1.223430361 1.975080011 0.471780712 0.238866633 0.8072705 511509 1.284515469 2.067636667 0.501394271 0.242496314 0.8072705 613365 1.26908936 2.036784448 0.501394271 0.24616953 0.8072705 ENSBTAG00000007094 1.26908936 2.036784448 0.501394271 0.24616953 0.8072705 ENSBTAG00000011651 1.476256794 2.356397301 0.596116286 0.252977834 0.8072705 ENSBTAG00000037984 1.238237141 1.975080011 0.501394271 0.253860233 0.8072705 100299686 1.445404575 2.294692864 0.596116286 0.259780424 0.8072705 782542 1.283896139 2.036784448 0.53100783 0.260708899 0.8072705 790217 1.283896139 2.036784448 0.53100783 0.260708899 0.8072705 100335479 1.429978466 2.263840645 0.596116286 0.263320781 0.8072705 ENSBTAG00000007612 1.429978466 2.263840645 0.596116286 0.263320781 0.8072705 784417 1.125328372 1.778876032 0.471780712 0.26521281 0.8072705 ENSBTAG00000010385 1.125328372 1.778876032 0.471780712 0.26521281 0.8072705 537184 1.491063573 2.356397301 0.625729845 0.265545137 0.8072705 786690 1.253043921 1.975080011 0.53100783 0.268853832 0.8072705 ENSBTAG00000006386 1.253043921 1.975080011 0.53100783 0.268853832 0.8072705 ENSBTAG00000014503 1.109902263 1.748023813 0.471780712 0.269893756 0.8072705 ENSBTAG00000038878 1.109902263 1.748023813 0.471780712 0.269893756 0.8072705 100140788 1.094476153 1.717171595 0.471780712 0.274742905 0.8072705 100336916 2.238459358 3.503743733 0.973174983 0.2777529 0.8072705 615170 1.140135152 1.778876032 0.501394271 0.281860153 0.8072705 100335351 1.124709042 1.748023813 0.501394271 0.28683492 0.8072705 ENSBTAG00000003715 1.124709042 1.748023813 0.501394271 0.28683492 0.8072705 ENSBTAG00000019454 1.124709042 1.748023813 0.501394271 0.28683492 0.8072705 ENSBTAG00000031943 1.331876476 2.067636667 0.596116286 0.288308045 0.8072705 ENSBTAG00000001658 1.109282933 1.717171595 0.501394271 0.291988449 0.8072705 ENSBTAG00000033600 1.109282933 1.717171595 0.501394271 0.291988449 0.8072705

PAGE 166

ENSBTAG00000042814 1.109282933 1.717171595 0.501394271 0.291988449 0.8072705 ENSBTAG00000042927 1.109282933 1.717171595 0.501394271 0.291988449 0.8072705 ENSBTAG00000043086 1.109282933 1.717171595 0.501394271 0.291988449 0.8072705 100335198 1.316450367 2.036784448 0.596116286 0.292675195 0.8072705 616818 1.316450367 2.036784448 0.596116286 0.292675195 0.8072705 ENSBTAG00000009053 1.316450367 2.036784448 0.596116286 0.292675195 0.8072705 ENSBTAG00000021253 1.316450367 2.036784448 0.596116286 0.292675195 0.8072705 ENSBTAG00000038228 1.301024258 2.005932229 0.596116286 0.297176683 0.8072705 515576 1.346683256 2.067636667 0.625729845 0.302630465 0.8072705 ENSBTAG00000039825 1.139515822 1.748023813 0.53100783 0.303776085 0.8072705 781895 1.331257147 2.036784448 0.625729845 0.307214563 0.8072705 100335386 1.124089713 1.717171595 0.53100783 0.309233994 0.8072705 100336724 1.124089713 1.717171595 0.53100783 0.309233994 0.8072705 786855 1.124089713 1.717171595 0.53100783 0.309233994 0.8072705 ENSBTAG00000005527 1.124089713 1.717171595 0.53100783 0.309233994 0.8072705 ENSBTAG00000014361 1.124089713 1.717171595 0.53100783 0.309233994 0.8072705 ENSBTAG00000000422 1.315831037 2.005932229 0.625729845 0.311939674 0.8072705 ENSBTAG00000001899 1.315831037 2.005932229 0.625729845 0.311939674 0.8072705 100299794 0.980948055 1.490115397 0.471780712 0.31660683 0.8072705 505692 0.980948055 1.490115397 0.471780712 0.31660683 0.8072705 ENSBTAG00000004014 0.980948055 1.490115397 0.471780712 0.31660683 0.8072705 ENSBTAG00000032224 0.980948055 1.490115397 0.471780712 0.31660683 0.8072705 100301203 1.300404928 1.975080011 0.625729845 0.316812403 0.8072705 786662 0.965521945 1.459263179 0.471780712 0.323300635 0.8072705 ENSBTAG00000005583 0.965521945 1.459263179 0.471780712 0.323300635 0.8072705 ENSBTAG00000021547 0.965521945 1.459263179 0.471780712 0.323300635 0.8072705 ENSBTAG00000026026 0.965521945 1.459263179 0.471780712 0.323300635 0.8072705 ENSBTAG00000042336 0.965521945 1.459263179 0.471780712 0.323300635 0.8072705 ENSBTAG00000042501 0.965521945 1.459263179 0.471780712 0.323300635 0.8072705 ENSBTAG00000043115 0.965521945 1.459263179 0.471780712 0.323300635 0.8072705 521706 1.187496159 1.778876032 0.596116286 0.335108392 0.8072705 ENSBTAG00000042563 1.187496159 1.778876032 0.596116286 0.335108392 0.8072705 ENSBTAG00000043416 1.187496159 1.778876032 0.596116286 0.335108392 0.8072705 514117 0.995754834 1.490115397 0.501394271 0.336480163 0.8072705 531240 0.995754834 1.490115397 0.501394271 0.336480163 0.8072705 100336224 1.17207005 1.748023813 0.596116286 0.341022978 0.8072705 100336837 1.17207005 1.748023813 0.596116286 0.341022978 0.8072705 ENSBTAG00000005021 1.17207005 1.748023813 0.596116286 0.341022978 0.8072705 ENSBTAG00000030333 1.17207005 1.748023813 0.596116286 0.341022978 0.8072705 ENSBTAG00000039047 1.17207005 1.748023813 0.596116286 0.341022978 0.8072705 100141103 0.980328725 1.459263179 0.501394271 0.343594136 0.8072705 ENSBTAG00000012328 1.15664394 1.717171595 0.596116286 0.347150097 0.8072705 ENSBTAG00000037464 1.15664394 1.717171595 0.596116286 0.347150097 0.8072705 ENSBTAG00000017932 2.729029407 4.042716677 1.415342136 0.350096791 0.8072705 ENSBTAG00000037887 1.202302939 1.778876032 0.625729845 0.351755734 0.8072705 100335181 1.010561614 1.490115397 0.53100783 0.356353495 0.8072705 ENSBTAG00000036098 1.010561614 1.490115397 0.53100783 0.356353495 0.8072705 516104 1.186876829 1.748023813 0.625729845 0.357964142 0.8072705 785970 1.186876829 1.748023813 0.625729845 0.357964142 0.8072705 ENSBTAG00000032984 1.363192045 2.005932229 0.72045186 0.359160618 0.8072705 ENSBTAG00000010536 0.995135505 1.459263179 0.53100783 0.363887637 0.8072705 ENSBTAG00000033657 3.8216523 5.602232618 2.041071981 0.364331887 0.8072705

PAGE 167

538844 1.17145072 1.717171595 0.625729845 0.364395642 0.8072705 ENSBTAG00000010583 1.17145072 1.717171595 0.625729845 0.364395642 0.8072705 100140050 2.96519107 4.331477312 1.598904828 0.369136143 0.8072705 ENSBTAG00000036304 2.773449745 4.042716677 1.504182813 0.37207228 0.8072705 282498 2.903486633 4.208068438 1.598904828 0.379961698 0.8072705 100335462 2.218414615 3.214983099 1.221846131 0.380047451 0.8072705 538589 2.775771084 4.011864459 1.53967771 0.383781089 0.8072705 784812 2.248647504 3.245835317 1.25145969 0.385558591 0.8072705 100298871 2.645114867 3.81566048 1.474569254 0.386451903 0.8072705 ENSBTAG00000042327 1.043115842 1.490115397 0.596116286 0.400047061 0.8072705 ENSBTAG00000024648 3.629754995 5.159210891 2.100299099 0.407096966 0.8072705 ENSBTAG00000037754 4.171685355 5.925240033 2.418130678 0.408106788 0.8072705 ENSBTAG00000043247 1.234237837 1.748023813 0.72045186 0.4121522 0.8072705 100297903 2.722708763 3.846512698 1.598904828 0.415676472 0.8072705 ENSBTAG00000020646 3.090145974 4.362329531 1.817962417 0.416741194 0.8072705 790430 2.234923404 3.153278661 1.316568146 0.417523564 0.8072705 ENSBTAG00000030498 1.218811727 1.717171595 0.72045186 0.419557289 0.8072705 100336251 2.913830758 4.104421114 1.723240402 0.419849804 0.8072705 ENSBTAG00000014945 1.057922621 1.490115397 0.625729845 0.419920394 0.8072705 ENSBTAG00000015296 3.358278459 4.705098496 2.011458422 0.427506124 0.8072705 520237 1.042496512 1.459263179 0.625729845 0.428798488 0.8072705 ENSBTAG00000038533 2.661004326 3.723103824 1.598904828 0.429454805 0.8072705 ENSBTAG00000018198 3.691922782 5.159210891 2.224634673 0.431196693 0.8072705 ENSBTAG00000013056 2.660384997 3.692251606 1.628518387 0.441063763 0.8072705 ENSBTAG00000000095 0.866181297 1.201354763 0.53100783 0.442007513 0.8072705 ENSBTAG00000038453 0.866181297 1.201354763 0.53100783 0.442007513 0.8072705 ENSBTAG00000019394 3.36890591 4.643394059 2.094417762 0.451053203 0.8072705 ENSBTAG00000038178 4.213964379 5.790740491 2.637188267 0.455414687 0.8072705 518355 3.562349244 4.870450256 2.254248233 0.462841855 0.8072705 784739 2.737978893 3.723103824 1.752853961 0.47080448 0.8072705 100313079 1.105283629 1.490115397 0.72045186 0.483487293 0.8072705 ENSBTAG00000037928 1.105283629 1.490115397 0.72045186 0.483487293 0.8072705 ENSBTAG00000039494 3.718775696 4.99385913 2.443692262 0.489339446 0.8072705 ENSBTAG00000011807 5.587530529 7.488637923 3.686423136 0.492268844 0.8072705 ENSBTAG00000009070 0.898735524 1.201354763 0.596116286 0.496203373 0.8072705 ENSBTAG00000021747 0.898735524 1.201354763 0.596116286 0.496203373 0.8072705 281063 5.170467358 6.907234704 3.433700012 0.497116452 0.8072705 ENSBTAG00000021906 2.879598565 3.846512698 1.912684432 0.497251558 0.8072705 ENSBTAG00000042432 2.80014668 3.723103824 1.877189535 0.504200158 0.8072705 ENSBTAG00000001010 3.982728853 5.274923659 2.690534048 0.51006123 0.8072705 787653 7.257936487 9.594822915 4.921050058 0.51288597 0.8072705 100336536 4.475156891 5.906453258 3.043860523 0.515344893 0.8072705 ENSBTAG00000032880 2.672431131 3.526899845 1.817962417 0.515456207 0.8072705 ENSBTAG00000033397 3.985050192 5.24407144 2.726028944 0.519830627 0.8072705 790004 0.913542304 1.201354763 0.625729845 0.52085351 0.8072705 529788 8.045771268 10.55754342 5.533999112 0.524174885 0.8072705 ENSBTAG00000033386 9.136610519 11.97049438 6.30272666 0.526521834 0.8072705 ENSBTAG00000012729 14.21134517 18.48871569 9.933974652 0.537299335 0.8072705 789538 3.603888882 4.635697952 2.572079811 0.554841976 0.8072705 100337400 8.98375149 11.48892433 6.478578653 0.563897757 0.8072705 789747 3.724820437 4.759106826 2.690534048 0.565344327 0.8072705 ENSBTAG00000039194 5.64049339 7.195995339 4.084991441 0.567675665 0.8072705

PAGE 168

ENSBTAG00000019385 3.918263771 4.986163024 2.850364518 0.571654899 0.8072705 ENSBTAG00000010837 9.759436833 12.40970195 7.109171718 0.572872076 0.8072705 ENSBTAG00000001001 7.836306538 9.949169936 5.723443141 0.575268407 0.8072705 509821 4.40713181 5.586840405 3.227423216 0.577683088 0.8072705 ENSBTAG00000006645 17.98856181 22.69727151 13.2798521 0.585085837 0.8072705 100335733 20.12447462 25.29230307 14.95664618 0.591351691 0.8072705 ENSBTAG00000002347 3.519974342 4.408641755 2.63130693 0.596852064 0.8072705 782397 0.960903311 1.201354763 0.72045186 0.599699508 0.8072705 790654 0.960903311 1.201354763 0.72045186 0.599699508 0.8072705 ENSBTAG00000011310 0.960903311 1.201354763 0.72045186 0.599699508 0.8072705 506812 13.14862538 16.40180486 9.895445898 0.603314451 0.8072705 781944 13.58680632 16.93356908 10.24004356 0.604718563 0.8072705 512045 25.80124443 31.9300513 19.67243756 0.616110428 0.8072705 535072 36.37361989 44.92836518 27.8188746 0.619182881 0.8072705 790721 10.13214348 12.50565317 7.758633785 0.62041012 0.8072705 ENSBTAG00000010860 9.989585224 12.22458864 7.75458181 0.634342966 0.8072705 ENSBTAG00000015864 6.46630781 7.893111325 5.039504295 0.638468671 0.8072705 511350 35.82481721 43.64312465 28.00650976 0.641716421 0.8072705 ENSBTAG00000024132 52.20523776 63.17463246 41.23584307 0.652727867 0.8072705 505732 5.619333625 6.776617112 4.462050139 0.658448023 0.8072705 ENSBTAG00000016354 23.96764019 28.90357607 19.03170431 0.658455004 0.8072705 613706 26.53550203 31.96090352 21.11010055 0.660497615 0.8072705 504819 27.79555939 33.44720476 22.14391402 0.662055744 0.8072705 ENSBTAG00000034867 63.27377337 76.07748252 50.47006423 0.663403448 0.8072705 541147 49.04718932 58.88946737 39.20491127 0.665737237 0.8072705 ENSBTAG00000013843 16.86312823 20.24499079 13.48126568 0.665906239 0.8072705 ENSBTAG00000018502 62.92231097 75.36399954 50.4806224 0.66982409 0.8072705 533064 39.13548728 46.756948 31.51402655 0.673996655 0.8072705 ENSBTAG00000039571 57.77208411 68.90797006 46.63619816 0.67678961 0.8072705 613326 71.89552178 85.54792178 58.24312179 0.680824508 0.8072705 ENSBTAG00000011057 20.73789715 24.62998904 16.84580526 0.683955045 0.8072705 ENSBTAG00000018868 342.557136 406.1573866 278.9568854 0.686819678 0.8072705 ENSBTAG00000013036 18.62550151 22.03107554 15.21992748 0.690839059 0.8072705 540719 71.16226653 84.06598988 58.25854318 0.693009661 0.8072705 ENSBTAG00000003622 36.03668257 42.54118346 29.53218169 0.694202166 0.8072705 ENSBTAG00000012484 88.05131989 103.6567823 72.44585745 0.698901276 0.8072705 ENSBTAG00000039712 35.69633839 41.99881595 29.39386083 0.69987356 0.8072705 781854 91.75458523 107.6523476 75.85682286 0.704646248 0.8072705 ENSBTAG00000009419 21.61420765 25.34249724 17.88591806 0.705767782 0.8072705 ENSBTAG00000000699 13.93625031 16.33677365 11.53572696 0.706120266 0.8072705 ENSBTAG00000002169 150.6303289 176.4040564 124.8566014 0.707787587 0.8072705 ENSBTAG00000019300 102.7740628 120.3434659 85.20465977 0.708012347 0.8072705 ENSBTAG00000026816 36.44271889 42.61495334 30.27048443 0.710325415 0.8072705 782484 66.40613201 77.53916548 55.27309854 0.712841029 0.8072705 ENSBTAG00000039711 25.36350667 29.5814179 21.14559544 0.714826974 0.8072705 512301 73.66788908 85.89991681 61.43586135 0.715202804 0.8072705 ENSBTAG00000006191 50.89330598 59.32139843 42.46521352 0.715849839 0.8072705 785244 5.145257985 5.995195757 4.295320213 0.716460377 0.8072705 ENSBTAG00000005252 27.45001216 31.97643132 22.923593 0.716890286 0.8072705 ENSBTAG00000019155 260.8612636 303.8697984 217.8527288 0.716927875 0.8072705 ENSBTAG00000004975 72.39944666 84.18225783 60.6166355 0.720064264 0.8072705 ENSBTAG00000009905 107.6399679 125.1486009 90.13133481 0.720194506 0.8072705

PAGE 169

613830 249.6435237 289.4663824 209.820665 0.724853309 0.8072705 784201 41.78852575 48.43703344 35.14001807 0.725478329 0.8072705 ENSBTAG00000006754 54.59158337 63.26823168 45.91493506 0.72571864 0.8072705 ENSBTAG00000017421 140.9214775 163.2515492 118.5914059 0.726433571 0.8072705 100336740 89.98511981 104.1109625 75.85927709 0.728638707 0.8072705 ENSBTAG00000018400 480.0283827 555.3505386 404.7062267 0.728740135 0.8072705 613757 146.2930432 168.3837898 124.2022966 0.737614332 0.8072705 615844 28.22204149 32.47734332 23.96673966 0.737952591 0.8072705 ENSBTAG00000019533 82.56588757 94.92879651 70.20297864 0.73953301 0.8072705 514951 134.6306537 154.7429235 114.518384 0.740055709 0.8072705 ENSBTAG00000017027 98.0277357 112.5166995 83.53877189 0.742456651 0.8072705 ENSBTAG00000014023 448.2700118 513.7231953 382.8168284 0.745181125 0.8072705 ENSBTAG00000015860 77.47087617 88.74529626 66.19645607 0.745915095 0.8072705 508697 1025.052382 1173.138558 876.9662054 0.747538472 0.8072705 504634 36.66828828 41.91118382 31.42539275 0.749809237 0.8072705 ENSBTAG00000003586 336.6609329 384.6448232 288.6770427 0.750502867 0.8072705 ENSBTAG00000013830 6858.103047 7825.046772 5891.159322 0.752859311 0.8072705 100337125 130.5370217 148.804995 112.2690485 0.754470967 0.8072705 ENSBTAG00000019767 43.74036979 49.8495648 37.63117478 0.75489475 0.8072705 ENSBTAG00000018189 344.931653 392.5785508 297.2847553 0.757261839 0.8072705 ENSBTAG00000007479 117.1336534 133.065288 101.2020189 0.760544094 0.8072705 784480 74.35301913 84.45083731 64.25520094 0.760859252 0.8072705 ENSBTAG00000015363 1234.164054 1398.412824 1069.915283 0.765092585 0.8072705 ENSBTAG00000033642 282.9608433 320.5846981 245.3369885 0.765279784 0.8072705 ENSBTAG00000000475 236.4789055 267.8983613 205.0594497 0.765437492 0.8072705 767993 89.06559407 100.8464082 77.2847799 0.766361254 0.8072705 ENSBTAG00000008835 223.0729989 252.3253326 193.8206653 0.768137956 0.8072705 ENSBTAG00000045235 46.93950745 53.04922347 40.82979143 0.769658607 0.8072705 782101 700.7551002 790.743917 610.7662833 0.772394539 0.8072705 ENSBTAG00000019157 341.7639961 385.3011701 298.2268221 0.774009646 0.8072705 ENSBTAG00000037811 194.7139588 219.4292975 169.9986201 0.774730731 0.8072705 ENSBTAG00000039123 241.5972682 272.088465 211.1060713 0.775872918 0.8072705 ENSBTAG00000017373 614.7299837 691.7620717 537.6978957 0.777287333 0.8072705 ENSBTAG00000031458 425.7558902 478.8994393 372.6123412 0.778059673 0.8072705 786531 186.2020065 209.2415611 163.1624518 0.779780322 0.8072705 ENSBTAG00000008100 285.0496802 320.0159327 250.0834278 0.781471803 0.8072705 538819 25.00920941 28.07307091 21.94534792 0.781722384 0.8072705 ENSBTAG00000000854 20.73987075 23.25225964 18.22748186 0.783901528 0.8072705 ENSBTAG00000018710 509.5825337 570.683967 448.4811004 0.785865954 0.8072705 ENSBTAG00000017799 7781.885337 8710.301324 6853.46935 0.786823451 0.8072705 617914 200.090784 223.8341929 176.3473751 0.787848241 0.8072705 ENSBTAG00000008548 1921.251468 2147.050405 1695.452531 0.789665919 0.8072705 ENSBTAG00000017459 25.95094762 28.91238254 22.9895127 0.79514418 0.8072705 ENSBTAG00000018823 258.4984591 287.9548442 229.0420739 0.795409692 0.8072705 ENSBTAG00000005497 1672.945081 1863.036592 1482.85357 0.795933679 0.8072705 ENSBTAG00000031488 160.0111814 178.1667688 141.8555941 0.796195581 0.8072705 ENSBTAG00000004029 125.7133253 139.9119964 111.5146542 0.797034258 0.8072705 ENSBTAG00000005757 5469.110766 6077.261502 4860.96003 0.799860271 0.8072705 ENSBTAG00000038836 197.8433992 219.7905014 175.8962969 0.800290712 0.8072705 ENSBTAG00000005362 108.7671536 120.0588584 97.47544875 0.811897182 0.8072705 ENSBTAG00000009418 24.27828649 26.77915949 21.7774135 0.813222443 0.8072705 512484 4823.26668 5293.685926 4352.847433 0.822271569 0.8072705

PAGE 170

ENSBTAG00000002296 946.9071456 1037.791342 856.0229488 0.824850732 0.8072705 ENSBTAG00000040392 1160.767373 1267.375846 1054.1589 0.831765023 0.8072705 509457 1224.852008 1333.580768 1116.123248 0.836937121 0.8072705 ENSBTAG00000030965 742.0475856 805.4486466 678.6465245 0.842569576 0.8072705 ENSBTAG00000005272 119.0069819 128.781301 109.2326628 0.848202821 0.8072705 ENSBTAG00000004009 150.3253358 162.2533952 138.3972764 0.852969987 0.8072705 100337420 1282.085407 1306.885935 1257.284878 0.962046376 0.8072705 768079 2461.40905 2269.184922 2653.633177 1.169421298 0.8072705 ENSBTAG00000018278 3658.617475 3364.48043 3952.75452 1.174848421 0.8072705 ENSBTAG00000035129 1580.93151 1448.216103 1713.646918 1.183281221 0.8072705 ENSBTAG00000006383 445.848837 407.0552115 484.6424624 1.19060621 0.8072705 ENSBTAG00000021226 833.1899147 754.8672487 911.5125807 1.207513748 0.8072705 536760 1055.360363 952.9924341 1157.728292 1.214834715 0.8072705 ENSBTAG00000008167 1294.066729 1154.689332 1433.444127 1.241411077 0.8072705 ENSBTAG00000006202 13770.48698 12275.98502 15264.98893 1.243483835 0.8072705 ENSBTAG00000005293 926.1573083 825.1324024 1027.182214 1.244869564 0.8072705 ENSBTAG00000006416 2026.506795 1799.055098 2253.958492 1.252856844 0.8072705 ENSBTAG00000039147 629.6550043 558.4436471 700.8663615 1.25503507 0.8072705 100300877 490.8842759 434.8963738 546.8721779 1.257476978 0.8072705 ENSBTAG00000033289 709.7818704 628.2759928 791.287748 1.259458832 0.8072705 ENSBTAG00000020787 1341.420049 1185.7193 1497.120799 1.26262666 0.8072705 ENSBTAG00000002186 852.946423 753.8077756 952.0850704 1.263034292 0.8072705 ENSBTAG00000013960 1143.55018 1010.474329 1276.62603 1.263392838 0.8072705 ENSBTAG00000001948 2927.812111 2582.242129 3273.382093 1.267651107 0.8072705 ENSBTAG00000000771 2962.834535 2611.095655 3314.573415 1.269418609 0.8072705 ENSBTAG00000005967 266.0481859 233.4805872 298.6157847 1.278974789 0.8072705 ENSBTAG00000011834 9610.273191 8416.322827 10804.22356 1.283722568 0.8072705 ENSBTAG00000016298 1382.927039 1211.059559 1554.794519 1.283829939 0.8072705 ENSBTAG00000020980 1160.488004 1015.863143 1305.112865 1.284732963 0.8072705 ENSBTAG00000005795 579.5465985 504.5771793 654.5160176 1.297157391 0.8072705 ENSBTAG00000004990 247.790113 215.3028984 280.2773276 1.301781489 0.8072705 ENSBTAG00000001109 619.0870676 537.4099628 700.7641724 1.303965726 0.8072705 ENSBTAG00000001589 2296.263395 1991.949261 2600.577529 1.305544062 0.8072705 ENSBTAG00000012544 652.6342126 565.6022895 739.6661356 1.307749543 0.8072705 ENSBTAG00000038025 799.1521352 691.8301114 906.4741591 1.310255429 0.8072705 ENSBTAG00000009233 9085.580541 7841.655158 10329.50592 1.317260925 0.8072705 ENSBTAG00000008001 6501.580231 5602.654781 7400.505681 1.320892679 0.8072705 100336818 98.42801752 84.60933216 112.2467029 1.326646837 0.8072705 ENSBTAG00000001478 496.5288325 425.6586695 567.3989955 1.332990577 0.8072705 ENSBTAG00000010692 5669.826159 4858.970521 6480.681798 1.333756146 0.8072705 ENSBTAG00000011843 1647.01193 1409.5968 1884.42706 1.336855376 0.8072705 ENSBTAG00000013225 140.5371308 119.8649386 161.2093231 1.344924754 0.8072705 615300 1327.811774 1132.304554 1523.318993 1.34532621 0.8072705 ENSBTAG00000015019 1350.393906 1150.43707 1550.350742 1.347618902 0.8072705 ENSBTAG00000018292 61.2732208 52.04005515 70.50638644 1.354848419 0.8072705 785117 17.90828092 15.10401149 20.71255036 1.371327768 0.8072705 ENSBTAG00000031698 51.68122906 43.40746536 59.95499277 1.38121386 0.8072705 ENSBTAG00000034496 55.10769756 46.11051358 64.10488154 1.390244362 0.8072705 507830 205.0890888 171.4737706 238.704407 1.392075337 0.8072705 541110 86.23000072 71.99628531 100.4637161 1.395401384 0.8072705 100300607 46.62847053 38.88359823 54.37334283 1.398361914 0.8072705 ENSBTAG00000015808 135.2375169 112.5845701 157.8904638 1.402416545 0.8072705

PAGE 171

ENSBTAG00000000497 98.31365367 81.78398543 114.8433219 1.404227506 0.8072705 521539 101.62779 84.20985107 119.045729 1.413679367 0.8072705 100337293 42.43772405 35.04915097 49.82629712 1.4216121 0.8072705 ENSBTAG00000000310 248.8048227 205.0843098 292.5253356 1.426366239 0.8072705 ENSBTAG00000001207 208.3016692 170.7613302 245.8420083 1.43968197 0.8072705 ENSBTAG00000015835 33.17049408 26.7790917 39.56189647 1.477342732 0.8072705 ENSBTAG00000005186 15.14951067 12.20094514 18.0980762 1.483333954 0.8072705 ENSBTAG00000014907 1028.167412 825.6780461 1230.656778 1.490480198 0.8072705 ENSBTAG00000030782 27.90695619 22.35068839 33.463224 1.497189859 0.8072705 ENSBTAG00000037179 15.54603589 12.44006678 18.65200501 1.499349267 0.8072705 ENSBTAG00000007369 22.29821299 17.74584266 26.85058333 1.513063305 0.8072705 ENSBTAG00000012744 40.2412343 31.69973613 48.78273247 1.53890027 0.8072705 ENSBTAG00000019194 22.62708582 17.68802017 27.56615148 1.558464498 0.8072705 ENSBTAG00000006067 90.60745725 70.29506111 110.9198534 1.577918159 0.8072705 100196902 44.27235765 34.20221102 54.34250428 1.588859394 0.8072705 ENSBTAG00000006398 38.73223112 29.86685176 47.59761047 1.593660117 0.8072705 ENSBTAG00000007541 24.24907375 18.6815929 29.81655461 1.596039201 0.8072705 ENSBTAG00000040151 31.30755739 23.80995157 38.80516321 1.629787574 0.8072705 ENSBTAG00000019045 22.98991196 17.34962054 28.63020337 1.650191905 0.8072705 100140923 12.22818522 9.217387574 15.23898286 1.653286546 0.8072705 100313262 11.84647062 8.901588878 14.79135237 1.661653056 0.8072705 ENSBTAG00000013755 58.28104369 43.24710591 73.31498147 1.695257519 0.8072705 ENSBTAG00000002995 50.45956422 37.3941058 63.52502264 1.698797746 0.8072705 100297706 19.11062731 14.15391161 24.06734301 1.700402241 0.8072705 ENSBTAG00000032918 7.532693711 5.509675963 9.555711459 1.734350899 0.8072705 536092 7.281725268 5.220915328 9.342535208 1.789443923 0.8072705 515330 5.017019008 3.484469571 6.549568446 1.879645758 0.8072705 ENSBTAG00000020503 4.735198347 3.134004499 6.336392194 2.021819751 0.8072705 ENSBTAG00000000821 8.928375238 5.867904933 11.98884554 2.043121979 0.8072705 100336219 10.72825899 7.015251366 14.44126662 2.058552983 0.8072705 ENSBTAG00000032101 6.189003984 4.035020571 8.342987397 2.067644328 0.8072705 ENSBTAG00000003367 12.38412233 8.020402149 16.74784252 2.088154959 0.8072705 100300545 6.949291105 4.354633424 9.543948785 2.19167674 0.8072705 539323 6.645485939 4.065872789 9.225099089 2.268909916 0.8072705 ENSBTAG00000044151 2.478103181 1.416832904 3.539373457 2.498088128 0.8072705 ENSBTAG00000001904 8.361201809 4.739832664 11.98257095 2.528057804 0.8072705 537201 4.850296652 2.618187667 7.082405638 2.705079444 0.8072705 ENSBTAG00000000138 4.317553257 2.102370835 6.532735679 3.107318448 0.8072705 ENSBTAG00000001029 2.474103876 1.189776707 3.758431046 3.158938165 0.8072705 790997 0.625729845 0 1.25145969 NA 0.8072705 ENSBTAG00000013255 0.625729845 0 1.25145969 NA 0.8072705 ENSBTAG00000042939 0.625729845 0 1.25145969 NA 0.8072705 100329206 0.610923066 0 1.221846131 NA 0.8072705 100335376 0.610923066 0 1.221846131 NA 0.8072705 100337482 0.610923066 0 1.221846131 NA 0.8072705 518850 0.610923066 0 1.221846131 NA 0.8072705 535378 0.610923066 0 1.221846131 NA 0.8072705 538425 0.610923066 0 1.221846131 NA 0.8072705 538601 0.610923066 0 1.221846131 NA 0.8072705 540205 0.610923066 0 1.221846131 NA 0.8072705 614307 0.610923066 0 1.221846131 NA 0.8072705 ENSBTAG00000000494 0.610923066 0 1.221846131 NA 0.8072705

PAGE 172

ENSBTAG00000005830 0.610923066 0 1.221846131 NA 0.8072705 ENSBTAG00000013306 0.610923066 0 1.221846131 NA 0.8072705 ENSBTAG00000027949 0.610923066 0 1.221846131 NA 0.8072705 ENSBTAG00000040476 0.610923066 0 1.221846131 NA 0.8072705 ENSBTAG00000043676 0.610923066 0 1.221846131 NA 0.8072705 100313431 0.658284073 0 1.316568146 NA 0.8072705 ENSBTAG00000000617 0.658284073 0 1.316568146 NA 0.8072705 ENSBTAG00000015137 0.658284073 0 1.316568146 NA 0.8072705 ENSBTAG00000016667 0.658284073 0 1.316568146 NA 0.8072705 ENSBTAG00000042993 0.658284073 0 1.316568146 NA 0.8072705 ENSBTAG00000043465 0.658284073 0 1.316568146 NA 0.8072705 100337496 0.596116286 0 1.192232572 NA 0.8072705 521905 0.596116286 0 1.192232572 NA 0.8072705 533151 0.596116286 0 1.192232572 NA 0.8072705 786318 0.596116286 0 1.192232572 NA 0.8072705 ENSBTAG00000003781 0.596116286 0 1.192232572 NA 0.8072705 ENSBTAG00000006080 0.596116286 0 1.192232572 NA 0.8072705 ENSBTAG00000023187 0.596116286 0 1.192232572 NA 0.8072705 ENSBTAG00000042188 0.596116286 0 1.192232572 NA 0.8072705 100138392 0.673090852 0 1.346181705 NA 0.8072705 337916 0.673090852 0 1.346181705 NA 0.8072705 613670 0.673090852 0 1.346181705 NA 0.8072705 614931 0.673090852 0 1.346181705 NA 0.8072705 789339 0.673090852 0 1.346181705 NA 0.8072705 ENSBTAG00000011772 0.673090852 0 1.346181705 NA 0.8072705 ENSBTAG00000022485 0.673090852 0 1.346181705 NA 0.8072705 ENSBTAG00000042834 0.673090852 0 1.346181705 NA 0.8072705 100313203 0.578368838 0 1.156737675 NA 0.8072705 783159 0.578368838 0 1.156737675 NA 0.8072705 786410 0.578368838 0 1.156737675 NA 0.8072705 ENSBTAG00000032263 0.578368838 0 1.156737675 NA 0.8072705 ENSBTAG00000032810 0.578368838 0 1.156737675 NA 0.8072705 ENSBTAG00000039764 0.578368838 0 1.156737675 NA 0.8072705 ENSBTAG00000039810 0.578368838 0 1.156737675 NA 0.8072705 ENSBTAG00000043260 0.578368838 0 1.156737675 NA 0.8072705 100299244 0.563562058 0 1.127124116 NA 0.8072705 100313399 0.563562058 0 1.127124116 NA 0.8072705 100337266 0.563562058 0 1.127124116 NA 0.8072705 100337357 0.563562058 0 1.127124116 NA 0.8072705 353105 0.563562058 0 1.127124116 NA 0.8072705 517420 0.563562058 0 1.127124116 NA 0.8072705 539811 0.563562058 0 1.127124116 NA 0.8072705 614290 0.563562058 0 1.127124116 NA 0.8072705 615009 0.563562058 0 1.127124116 NA 0.8072705 616734 0.563562058 0 1.127124116 NA 0.8072705 617702 0.563562058 0 1.127124116 NA 0.8072705 ENSBTAG00000042534 0.563562058 0 1.127124116 NA 0.8072705 ENSBTAG00000043045 0.563562058 0 1.127124116 NA 0.8072705 512868 0.548755279 0 1.097510557 NA 0.8072705 528635 0.548755279 0 1.097510557 NA 0.8072705 ENSBTAG00000010427 0.548755279 0 1.097510557 NA 0.8072705 ENSBTAG00000015402 0.548755279 0 1.097510557 NA 0.8072705

PAGE 173

ENSBTAG00000017748 0.548755279 0 1.097510557 NA 0.8072705 ENSBTAG00000023143 0.548755279 0 1.097510557 NA 0.8072705 ENSBTAG00000030889 0.548755279 0 1.097510557 NA 0.8072705 ENSBTAG00000032461 0.548755279 0 1.097510557 NA 0.8072705 ENSBTAG00000037557 0.548755279 0 1.097510557 NA 0.8072705 ENSBTAG00000038901 0.548755279 0 1.097510557 NA 0.8072705 ENSBTAG00000042305 0.548755279 0 1.097510557 NA 0.8072705 100300664 0.533948499 0 1.067896998 NA 0.8072705 518794 0.533948499 0 1.067896998 NA 0.8072705 618351 0.533948499 0 1.067896998 NA 0.8072705 ENSBTAG00000008198 0.533948499 0 1.067896998 NA 0.8072705 ENSBTAG00000031099 0.533948499 0 1.067896998 NA 0.8072705 ENSBTAG00000032074 0.533948499 0 1.067896998 NA 0.8072705 ENSBTAG00000036578 0.533948499 0 1.067896998 NA 0.8072705 ENSBTAG00000038108 0.533948499 0 1.067896998 NA 0.8072705 ENSBTAG00000038311 0.533948499 0 1.067896998 NA 0.8072705 ENSBTAG00000039054 0.533948499 0 1.067896998 NA 0.8072705 ENSBTAG00000039716 0.533948499 0 1.067896998 NA 0.8072705 ENSBTAG00000039743 0.533948499 0 1.067896998 NA 0.8072705 504631 0.53100783 0 1.062015661 NA 0.8072705 527165 0.53100783 0 1.062015661 NA 0.8072705 ENSBTAG00000015843 0.53100783 0 1.062015661 NA 0.8072705 ENSBTAG00000017282 0.53100783 0 1.062015661 NA 0.8072705 ENSBTAG00000024230 0.53100783 0 1.062015661 NA 0.8072705 ENSBTAG00000030233 0.53100783 0 1.062015661 NA 0.8072705 ENSBTAG00000038399 0.53100783 0 1.062015661 NA 0.8072705 ENSBTAG00000040532 0.53100783 0 1.062015661 NA 0.8072705 ENSBTAG00000021940 0.72045186 0 1.44090372 NA 0.8072705 ENSBTAG00000039773 0.72045186 0 1.44090372 NA 0.8072705 ENSBTAG00000032862 6.372848499 7.635202909 5.110494088 0.669333107 0.8072763 ENSBTAG00000000097 535.7890668 609.2579626 462.320171 0.758824996 0.8072763 ENSBTAG00000012509 38.29772451 44.5051728 32.09027621 0.721045986 0.8073138 ENSBTAG00000006925 663.6537098 741.1162549 586.1911647 0.790957101 0.8073143 ENSBTAG00000006029 193.505683 164.4535947 222.5577714 1.353316549 0.8073143 100296550 2.609644014 3.496047627 1.723240402 0.49291102 0.8073231 ENSBTAG00000003922 1630.382922 1802.845988 1457.919855 0.808676873 0.8073231 100336942 2.171672937 3.245835317 1.097510557 0.338128848 0.8076903 ENSBTAG00000000964 2.171672937 3.245835317 1.097510557 0.338128848 0.8076903 100337320 3.270208635 4.096725008 2.443692262 0.596498974 0.8076903 100297496 7.705957691 9.47529599 5.936619393 0.626536564 0.8076903 524144 35.75176377 42.98469257 28.51883497 0.663464905 0.8076903 ENSBTAG00000024723 4210.118045 3707.924297 4712.311793 1.270875944 0.8076903 ENSBTAG00000012260 278.8712247 242.5320849 315.2103644 1.299664597 0.8076903 ENSBTAG00000011239 2770.957254 2371.823879 3170.090629 1.336562405 0.8076903 ENSBTAG00000020468 7.381778898 5.471127638 9.292430158 1.698448798 0.8076903 ENSBTAG00000002046 5.400895366 6.80746933 3.994321402 0.586755696 0.8077504 ENSBTAG00000013921 48.95511169 58.35763535 39.55258803 0.677762006 0.8077504 ENSBTAG00000019658 28.1105119 32.23094517 23.99007863 0.744318185 0.8077504 789750 5.401726187 5.964343539 4.839108836 0.811339723 0.8077504 ENSBTAG00000016069 2210.403876 1975.484278 2445.323475 1.237834947 0.8077504 534872 8.144363314 6.079501125 10.2092255 1.67928672 0.8077504 ENSBTAG00000018170 2.140820719 3.18413088 1.097510557 0.344681358 0.8081276

PAGE 174

100313247 31.91384029 38.28292085 25.54475974 0.667262559 0.8081276 509420 4.431295063 2.360279251 6.502310875 2.754890496 0.8081276 ENSBTAG00000015609 2.548095557 3.526899845 1.569291269 0.444949201 0.8081993 ENSBTAG00000032799 2.549178237 3.43434319 1.664013284 0.484521549 0.8081993 ENSBTAG00000032272 11.52762674 14.76561186 8.289641615 0.561415381 0.8081993 540997 6.68438218 8.443662326 4.925102034 0.583289791 0.8081993 ENSBTAG00000017362 1208.427191 1356.231922 1060.62246 0.782036201 0.8081993 ENSBTAG00000014053 2.12431193 3.245835317 1.002788542 0.308946217 0.8082143 ENSBTAG00000024496 3.222228298 4.065872789 2.378583806 0.585011861 0.8082172 ENSBTAG00000034758 113.3938446 97.3763561 129.4113331 1.328981062 0.8082172 540361 156.9358713 180.1445526 133.72719 0.742332688 0.8086745 ENSBTAG00000004188 40.41707268 32.29216222 48.54198314 1.503212538 0.8086745 516875 2.088841077 2.926222464 1.25145969 0.427670728 0.8091449 ENSBTAG00000005141 2.078033602 3.153278661 1.002788542 0.318014565 0.8092636 ENSBTAG00000009764 6.25019089 7.893111325 4.607270455 0.583707776 0.8092636 787574 7.575920804 9.30994423 5.841897378 0.627490051 0.8092636 100125301 47.28717624 54.85160742 39.72274506 0.724185615 0.8092636 534513 38.23381152 32.53800519 43.92961785 1.350101753 0.8092636 ENSBTAG00000011356 7.889439939 4.793840995 10.98503888 2.291490038 0.8092636 ENSBTAG00000004008 27.38353844 33.16614023 21.60093664 0.65129486 0.8094635 788592 7565.225491 8320.034911 6810.416071 0.818556189 0.8094635 ENSBTAG00000009408 9.34956462 11.87412357 6.825005673 0.574779741 0.8095 ENSBTAG00000008348 7.550925879 9.567852646 5.533999112 0.578395102 0.8095 100336238 97.75232805 113.2588818 82.24577433 0.726175052 0.8095 ENSBTAG00000037744 211.402334 237.9441442 184.8605237 0.77690722 0.8095 ENSBTAG00000004315 211.9541649 172.3175194 251.5908104 1.46004197 0.8095 100300375 2.02667329 2.926222464 1.127124116 0.385180597 0.809717 100335469 2.010627851 2.864518027 1.156737675 0.403815813 0.809717 786916 2.447516249 3.207286992 1.687745506 0.526222165 0.809717 ENSBTAG00000001570 6.387287807 8.354919827 4.419655787 0.528988414 0.809717 ENSBTAG00000015968 11.31474969 13.73786015 8.891639238 0.647236116 0.809717 ENSBTAG00000005393 2191.13844 2515.84878 1866.4281 0.741868158 0.809717 ENSBTAG00000017557 1549.966225 1752.065326 1347.867125 0.769301866 0.809717 ENSBTAG00000013327 2048.229782 2304.772965 1791.686598 0.77738095 0.809717 ENSBTAG00000020769 474.3348752 529.8260095 418.843741 0.790530728 0.809717 ENSBTAG00000018800 5593.125162 5026.799397 6159.450928 1.225322604 0.809717 ENSBTAG00000011494 31.3927437 27.02826144 35.75722597 1.322956937 0.809717 ENSBTAG00000010851 313.0289908 264.6403121 361.4176696 1.365693937 0.809717 529920 17.95702617 14.6812387 21.23281363 1.446254915 0.809717 ENSBTAG00000040443 19.08543203 15.02740223 23.14346183 1.540084007 0.809717 100336998 10.30710619 12.06311883 8.551093555 0.708862582 0.8097884 ENSBTAG00000007303 13733.20935 15440.95722 12025.46148 0.77880285 0.8097884 ENSBTAG00000012876 21.28217925 16.11741356 26.44694493 1.640892618 0.8100794 ENSBTAG00000015593 70.32884716 82.61844034 58.03925398 0.702497575 0.8103451 519708 19.27337141 24.37970894 14.16703389 0.581099386 0.8105512 100336037 23.84411269 27.97600933 19.71221605 0.704611434 0.8105578 ENSBTAG00000002845 1.966207512 2.864518027 1.067896998 0.372801633 0.8106526 ENSBTAG00000031768 6.512553796 7.762493733 5.262613859 0.677954024 0.8106901 532960 1.933653285 2.864518027 1.002788542 0.350072345 0.8107907 789591 1.933033955 2.833665808 1.032402102 0.36433446 0.8107907 ENSBTAG00000014218 2.401393901 3.268991429 1.533796373 0.469195593 0.8107907 100296357 1.92903465 2.606609611 1.25145969 0.480110134 0.8107907

PAGE 175

ENSBTAG00000033269 2.388289131 3.207286992 1.569291269 0.489289319 0.8107907 535545 16.72565284 21.0302263 12.42107938 0.590629849 0.8107907 ENSBTAG00000010313 2929.83529 3338.770452 2520.900127 0.755038468 0.8107907 100336940 127.2493877 144.7891002 109.7096752 0.75772054 0.8107907 ENSBTAG00000015879 130.1664317 147.4809221 112.8519412 0.765196878 0.8107907 ENSBTAG00000011079 249.1032862 282.0881809 216.1183916 0.766137705 0.8107907 ENSBTAG00000043559 5386.472366 5888.846163 4884.098569 0.829381246 0.8107907 ENSBTAG00000007116 4984.136673 4428.218082 5540.055265 1.251080042 0.8107907 100337258 1.919465835 2.895370245 0.943561424 0.325886275 0.8108543 100336003 6.279617002 8.447476483 4.111757521 0.486743885 0.8108543 ENSBTAG00000002084 7.410081516 9.629557083 5.190605949 0.539028525 0.8108543 ENSBTAG00000011233 84.32304116 96.73324844 71.91283388 0.743413821 0.8108543 ENSBTAG00000039186 15.40699774 12.56298826 18.25100721 1.45276003 0.8108543 ENSBTAG00000014312 40.43235719 32.52351996 48.34119443 1.486345712 0.8108543 ENSBTAG00000009032 32.20997444 24.70327153 39.71667735 1.607749698 0.8108543 790386 1.897099752 2.637461829 1.156737675 0.438579874 0.811044 531049 2.356354232 3.238139211 1.474569254 0.455375498 0.811044 ENSBTAG00000009126 133.9389899 152.3436085 115.5343713 0.758380168 0.8111062 ENSBTAG00000038339 225.5674431 200.2931726 250.8417136 1.252372761 0.8111062 507017 1.882292973 2.637461829 1.127124116 0.427351821 0.8112495 ENSBTAG00000034633 262.6140586 227.3751583 297.8529589 1.309962624 0.8112495 ENSBTAG00000007648 8832.36606 7817.962945 9846.769175 1.259505736 0.8113515 530225 1.866247534 2.575757392 1.156737675 0.449086424 0.8114066 ENSBTAG00000009472 244.0133161 276.9323646 211.0942677 0.76225929 0.8114066 ENSBTAG00000018448 1.852060084 2.606609611 1.097510557 0.421049072 0.8115593 787909 2.321502709 2.949378576 1.693626843 0.574231757 0.8115593 ENSBTAG00000018652 20.0380731 25.44219482 14.63395138 0.575184314 0.8115593 100335286 11.99499197 9.009605539 14.9803784 1.662711907 0.8115593 618745 1.837253304 2.606609611 1.067896998 0.409688123 0.811803 786648 1.83263467 2.348701195 1.316568146 0.560551572 0.811803 ENSBTAG00000018067 2817.694668 2548.799057 3086.590279 1.21099789 0.811803 100297815 73.483556 85.37549689 61.5916151 0.721420283 0.8119636 ENSBTAG00000043262 1.815506552 2.379553413 1.25145969 0.525922084 0.8120314 ENSBTAG00000013753 417.915578 334.5207204 501.3104355 1.498593076 0.8120314 ENSBTAG00000019888 3.262065926 3.892824923 2.63130693 0.67593765 0.8120586 ENSBTAG00000000037 2264.825342 2521.148711 2008.501973 0.796661444 0.81212 ENSBTAG00000008816 1539.858499 1361.107907 1718.609092 1.262654551 0.81212 ENSBTAG00000001500 41.95284079 35.6223029 48.28337868 1.355425527 0.81212 ENSBTAG00000014505 93.02352083 75.97306379 110.0739779 1.448855323 0.81212 ENSBTAG00000003897 15.61590115 11.41231506 19.81948724 1.736675436 0.81212 100336869 1.789272967 2.575757392 1.002788542 0.389317932 0.8121308 ENSBTAG00000014332 1.774466188 2.575757392 0.973174983 0.377820903 0.8124303 ENSBTAG00000019342 237.2261411 196.2609957 278.1912864 1.417455799 0.8126848 ENSBTAG00000026324 1.738531985 2.379553413 1.097510557 0.461225435 0.8128742 100337019 1.737912655 2.348701195 1.127124116 0.479892512 0.8128742 ENSBTAG00000039320 2.986685964 3.807964373 2.165407555 0.568652262 0.8128742 ENSBTAG00000006208 42.01538591 50.33348684 33.69728499 0.669480441 0.8128742 ENSBTAG00000004530 16.34208788 12.15518809 20.52898767 1.688907445 0.8128757 ENSBTAG00000018715 360.5794017 325.7841357 395.3746676 1.213609333 0.8129418 529720 1.705977757 2.379553413 1.032402102 0.433863806 0.8131136 100335548 1.705358428 2.348701195 1.062015661 0.452171465 0.8131136 100139494 1.707679767 2.317848976 1.097510557 0.473503912 0.8131136

PAGE 176

505564 89.80925956 97.45290188 82.16561723 0.84313156 0.8131136 529925 1.676364198 2.379553413 0.973174983 0.408973792 0.8131443 ENSBTAG00000020984 1.675744868 2.348701195 1.002788542 0.426954499 0.8131443 ENSBTAG00000042626 1.690551648 2.348701195 1.032402102 0.439562982 0.8131443 ENSBTAG00000000354 1.692872987 2.317848976 1.067896998 0.460727601 0.8131443 281771 5.8414496 3.538477901 8.144421299 2.301673637 0.8131443 ENSBTAG00000000072 844.6047227 970.2041562 719.0052893 0.74108659 0.8132626 ENSBTAG00000023426 112.164729 100.1924768 124.1369813 1.238985055 0.8132626 ENSBTAG00000016854 67.03983376 56.84540641 77.23426111 1.358671984 0.8132626 ENSBTAG00000045139 1.501750992 2.05994056 0.943561424 0.458052743 0.8133469 787749 1.579344888 2.090792779 1.067896998 0.510761759 0.8133469 ENSBTAG00000013906 1.594151668 2.090792779 1.097510557 0.524925554 0.8133469 ENSBTAG00000018439 1.623765227 2.090792779 1.156737675 0.553253143 0.8133469 ENSBTAG00000019425 8.28743269 10.52669121 6.048174175 0.574556055 0.8133469 ENSBTAG00000040367 70.15203753 82.60291254 57.70116253 0.698536659 0.8133469 ENSBTAG00000038495 29.41681861 34.29469989 24.53893734 0.715531479 0.8133469 ENSBTAG00000013615 9549.156784 10852.00398 8246.309591 0.759888184 0.8133469 ENSBTAG00000011505 916.0962941 790.0522379 1042.14035 1.319077778 0.8133469 ENSBTAG00000037527 4.530898358 5.821592709 3.240204008 0.556583768 0.8135277 ENSBTAG00000003408 36.24672711 28.12264211 44.37081212 1.577761149 0.8135504 100336073 78.90822003 88.71340147 69.10303859 0.778947007 0.8138485 ENSBTAG00000027937 2913.21484 3211.728484 2614.701196 0.814110287 0.8138485 ENSBTAG00000009838 1595.802953 1784.426135 1407.179772 0.788589533 0.8140357 505611 29.76808476 22.95524772 36.58092179 1.593575562 0.8140373 ENSBTAG00000015196 384.7052229 441.4590384 327.9514075 0.742880718 0.8143396 519566 8.214457428 10.7537474 5.675167453 0.527738586 0.814458 513688 94.84575137 107.6506186 82.04088416 0.76210323 0.814458 512286 936.7529147 1032.019469 841.48636 0.815378377 0.814458 ENSBTAG00000043987 79.17626203 64.8957538 93.45677026 1.44010609 0.814458 ENSBTAG00000010357 144.9795513 166.6379696 123.3211331 0.740054223 0.8146277 ENSBTAG00000037819 5.715875367 3.476773464 7.954977269 2.288034395 0.8146277 ENSBTAG00000020275 7.216814624 9.375462823 5.058166424 0.539511117 0.8147705 511390 2.114954605 2.660617941 1.569291269 0.589822103 0.8147705 100141038 4.95003101 5.621574573 4.278487446 0.761083463 0.8147705 ENSBTAG00000000693 189.9076728 215.3505878 164.4647578 0.76370703 0.8147705 ENSBTAG00000003906 517.7078306 578.2786214 457.1370399 0.790513471 0.8147705 519337 94.85784481 105.3620919 84.35359775 0.80060671 0.8147705 ENSBTAG00000015097 65.69640698 72.55841436 58.83439959 0.810855641 0.8147705 ENSBTAG00000014890 5748.906282 6147.51921 5350.293354 0.870317468 0.8147705 533910 216.8838186 196.4966507 237.2709866 1.207506519 0.8147705 100139419 403.7325935 352.3525932 455.1125938 1.291639689 0.8147705 100335406 218.1300154 185.6384846 250.6215462 1.350051671 0.8147705 100337272 128.6300542 106.4257559 150.8343525 1.41727302 0.8147705 ENSBTAG00000025410 8.144730338 10.49583899 5.79362169 0.551992242 0.8151964 ENSBTAG00000033254 5.990081058 7.684841902 4.295320213 0.558934103 0.8151964 ENSBTAG00000004425 34.5916271 40.55022385 28.63303036 0.706112757 0.8151964 ENSBTAG00000008991 46.13421951 53.70426099 38.56417802 0.718084139 0.8151964 ENSBTAG00000000559 2293.130128 2595.138349 1991.121907 0.767250774 0.8151964 ENSBTAG00000021000 107.4453432 88.99883534 125.891851 1.414533691 0.8151964 ENSBTAG00000010456 713.0117347 806.0275665 619.995903 0.769199378 0.8151974 ENSBTAG00000012615 16.5351996 20.13697413 12.93342508 0.642272518 0.8153421 ENSBTAG00000011019 29.90147958 34.75269423 25.05026492 0.720815047 0.815935

PAGE 177

784409 4.902670002 5.621574573 4.183765431 0.744233733 0.815935 ENSBTAG00000011197 2245.561262 2546.963481 1944.159043 0.763324271 0.815935 ENSBTAG00000037944 269.8763674 233.9922552 305.7604795 1.306711965 0.815935 ENSBTAG00000013226 186.5786795 163.2857282 209.8716308 1.285302966 0.8159779 ENSBTAG00000024185 2.819939565 3.261295323 2.378583806 0.729337141 0.8160093 ENSBTAG00000004933 3571.133451 3359.173898 3783.093005 1.126197428 0.8160093 ENSBTAG00000004855 1094.615689 957.6601882 1231.571189 1.28602108 0.8161062 ENSBTAG00000010128 395.3007827 455.6606901 334.9408753 0.735066427 0.8163475 ENSBTAG00000019387 4001.40297 4494.310016 3508.495924 0.78065285 0.8163475 ENSBTAG00000027766 28.48700278 32.8200445 24.15396107 0.735951503 0.8164233 ENSBTAG00000009526 1806.326861 1656.080223 1956.5735 1.181448503 0.8164233 ENSBTAG00000033704 316.7796962 278.4476534 355.111739 1.275326743 0.8164233 ENSBTAG00000010666 322.7967195 280.5554362 365.0380029 1.301126109 0.8164233 ENSBTAG00000020179 325.9957415 366.225593 285.7658901 0.780300163 0.8165763 618155 68.40755953 55.32408699 81.49103207 1.472975633 0.8165763 404118 5.552045592 3.249717267 7.854373917 2.416940698 0.8166715 100335669 16.7732516 20.74146566 12.80503754 0.61736416 0.8168194 ENSBTAG00000039018 4.384840076 5.274923659 3.494756493 0.662522667 0.8168194 ENSBTAG00000038569 469.2020221 415.1800873 523.2239569 1.260233747 0.8168194 ENSBTAG00000013046 170.0863231 143.1389771 197.033669 1.376520029 0.8168418 ENSBTAG00000014536 73.12272845 85.55417288 60.69128402 0.709390109 0.8171165 ENSBTAG00000012086 36.75742415 29.58481246 43.93003584 1.484884716 0.8173135 ENSBTAG00000013790 512.1554019 584.0048137 440.3059902 0.753942399 0.8175012 ENSBTAG00000030591 9635.022129 10471.66675 8798.377506 0.840207936 0.8176872 540193 8.437219416 5.87560104 10.99883779 1.871951094 0.8176872 ENSBTAG00000020379 527.4345081 463.8217116 591.0473047 1.274298486 0.817827 787961 7.340937832 9.317640336 5.364235329 0.57570749 0.8179564 ENSBTAG00000004714 1.063761953 1.767297976 0.36022593 0.203828633 0.818013 ENSBTAG00000039953 1.063761953 1.767297976 0.36022593 0.203828633 0.818013 ENSBTAG00000025174 2.740643659 3.292147541 2.189139777 0.664957979 0.818013 ENSBTAG00000012101 29.66586203 32.87079385 26.46093022 0.80499821 0.818013 ENSBTAG00000017633 21961.55547 20415.74934 23507.3616 1.15143271 0.8181843 ENSBTAG00000024604 67.06031735 54.41246764 79.70816705 1.464887929 0.8181843 100533481 4.301066144 2.337123139 6.26500915 2.680650004 0.8181843 100337383 4244.273411 4258.054106 4230.492716 0.993527234 0.8184342 522747 1.048335844 1.736445757 0.36022593 0.207450148 0.8184617 788323 1.048335844 1.736445757 0.36022593 0.207450148 0.8184617 ENSBTAG00000009258 1.048335844 1.736445757 0.36022593 0.207450148 0.8184617 ENSBTAG00000045262 1.048335844 1.736445757 0.36022593 0.207450148 0.8184617 504649 12.84948484 14.88957592 10.80939376 0.72597056 0.8184617 ENSBTAG00000018065 994.7150769 861.1026236 1128.32753 1.310328757 0.8184617 ENSBTAG00000007199 8.350056704 6.133509456 10.56660395 1.722766391 0.8184617 ENSBTAG00000006129 3.896310485 2.317848976 5.474771993 2.362005484 0.8184617 ENSBTAG00000031579 1278.415894 1441.852532 1114.979255 0.773296319 0.8186256 282182 160.9074166 170.5790606 151.2357725 0.886602213 0.8186256 ENSBTAG00000006240 12.10638222 14.44267224 9.770092207 0.676473996 0.8186453 ENSBTAG00000009952 14.04399382 18.09193839 9.99604925 0.552514 0.8187764 ENSBTAG00000002354 49.16212912 38.71061815 59.61364008 1.53998161 0.8187764 ENSBTAG00000017551 221.0345167 253.7004216 188.3686117 0.742484425 0.8188055 ENSBTAG00000043977 1.032909734 1.705593539 0.36022593 0.211202682 0.8188781 ENSBTAG00000003905 1.001594166 1.767297976 0.235890356 0.133475146 0.8192205 ENSBTAG00000006858 1.001594166 1.767297976 0.235890356 0.133475146 0.8192205

PAGE 178

ENSBTAG00000034468 1.001594166 1.767297976 0.235890356 0.133475146 0.8192205 ENSBTAG00000035110 1.001594166 1.767297976 0.235890356 0.133475146 0.8192205 100313072 0.986168057 1.736445757 0.235890356 0.13584666 0.8192205 515732 0.986168057 1.736445757 0.235890356 0.13584666 0.8192205 ENSBTAG00000014795 0.986168057 1.736445757 0.235890356 0.13584666 0.8192205 100138338 0.970741947 1.705593539 0.235890356 0.138303969 0.8192205 100335644 0.970741947 1.705593539 0.235890356 0.138303969 0.8192205 ENSBTAG00000002580 0.970741947 1.705593539 0.235890356 0.138303969 0.8192205 ENSBTAG00000021009 1.016400946 1.767297976 0.265503915 0.150231551 0.8192205 100299831 1.000974836 1.736445757 0.265503915 0.152900783 0.8192205 527123 0.985548727 1.705593539 0.265503915 0.155666581 0.8192205 ENSBTAG00000014543 0.985548727 1.705593539 0.265503915 0.155666581 0.8192205 ENSBTAG00000000333 0.970122618 1.67474132 0.265503915 0.158534283 0.8192205 ENSBTAG00000044873 0.970122618 1.67474132 0.265503915 0.158534283 0.8192205 ENSBTAG00000042999 1.017483625 1.67474132 0.36022593 0.215093475 0.8192205 ENSBTAG00000020205 4.803581212 6.114235294 3.492927131 0.57127784 0.8192205 ENSBTAG00000005299 58.24409652 73.5049841 42.98320894 0.58476591 0.8192205 537431 4.832136135 5.887179096 3.777093175 0.641579458 0.8192205 ENSBTAG00000017539 14.36487681 17.33804249 11.39171114 0.6570356 0.8192205 ENSBTAG00000037483 18.36439536 22.05853319 14.67025752 0.665060428 0.8192205 ENSBTAG00000020797 5.705963235 6.838321549 4.573604921 0.66881981 0.8192205 100335682 32.90720431 39.14150664 26.67290198 0.681448014 0.8192205 536516 122.6974045 145.8244124 99.57039666 0.682810203 0.8192205 ENSBTAG00000004191 5.766892362 6.776617112 4.757167613 0.701997403 0.8192205 505819 177.6105029 208.1918949 147.0291109 0.706219188 0.8192205 ENSBTAG00000017450 215.2288366 251.926737 178.5309363 0.708662123 0.8192205 100125285 41.38720099 47.4435285 35.33087347 0.744693209 0.8192205 ENSBTAG00000039721 87.59222055 100.3421695 74.84227164 0.745870575 0.8192205 524256 44.78414311 51.17002689 38.39825934 0.750405299 0.8192205 ENSBTAG00000010032 82.33948812 93.16593567 71.51304058 0.767587854 0.8192205 ENSBTAG00000001273 67.16223165 75.85679585 58.46766746 0.770763737 0.8192205 ENSBTAG00000009389 7273.801866 8196.186661 6351.417071 0.774923429 0.8192205 ENSBTAG00000010734 987.4645371 1099.440888 875.4881866 0.7963031 0.8192205 ENSBTAG00000001781 241.1445971 266.0307471 216.2584471 0.812907716 0.8192205 ENSBTAG00000002657 280.8232648 309.5135079 252.1330217 0.814610721 0.8192205 ENSBTAG00000020886 696.4908409 765.2975606 627.6841212 0.820183094 0.8192205 ENSBTAG00000019082 700.8446581 769.1849058 632.5044105 0.822304761 0.8192205 ENSBTAG00000003887 15827.16551 17275.16015 14379.17087 0.832361075 0.8192205 ENSBTAG00000043250 3588.470786 3817.270453 3359.671118 0.880123942 0.8192205 613669 709.4970964 649.4753978 769.5187949 1.184831323 0.8192205 ENSBTAG00000010442 722.7701517 644.0278837 801.5124196 1.244530617 0.8192205 ENSBTAG00000005025 814.8523636 725.900476 903.8042511 1.245080119 0.8192205 ENSBTAG00000037600 111.0179712 95.59748006 126.4384624 1.322612921 0.8192205 ENSBTAG00000022275 331.1121244 277.3793403 384.8449085 1.387431768 0.8192205 ENSBTAG00000019410 54.24208769 43.98984336 64.49433203 1.466118702 0.8192205 ENSBTAG00000014390 69.72485474 54.85943911 84.59027037 1.541945593 0.8192205 ENSBTAG00000032059 8.252677046 10.83423861 5.671115478 0.523443841 0.8192406 ENSBTAG00000019467 5.69453643 7.034525528 4.354547332 0.619025024 0.8192406 ENSBTAG00000011932 71.02297132 81.33173764 60.71420499 0.746500773 0.8192406 100301210 2841.727973 2519.008409 3164.447538 1.256227461 0.8194325 ENSBTAG00000011511 13.71529954 17.29845159 10.1321475 0.58572569 0.8194517 512800 4.036349557 2.275418702 5.797280413 2.54778622 0.819588

PAGE 179

524593 7.078722608 9.05973192 5.097713296 0.562678161 0.8196366 ENSBTAG00000005895 9.803563174 12.14361004 7.463516311 0.614604412 0.8196775 ENSBTAG00000033603 36.98785004 29.65906973 44.31663035 1.494201631 0.8198066 ENSBTAG00000003371 407.6276619 461.7398737 353.51545 0.765616032 0.8199539 ENSBTAG00000018581 290.767925 324.3723501 257.1634999 0.792803393 0.8199539 785108 7.324325908 4.720558501 9.928093315 2.103160741 0.8202124 ENSBTAG00000018631 4776.136521 5327.739521 4224.533521 0.792931693 0.8202933 ENSBTAG00000032405 13.32762845 9.598704864 17.05655203 1.7769639 0.8207116 100335360 4.707800562 5.887179096 3.528422027 0.599340018 0.8208419 ENSBTAG00000023823 271.6883547 235.7094268 307.6672826 1.305282045 0.8211078 ENSBTAG00000015109 347.7111474 404.3115976 291.1106973 0.720015698 0.8212162 ENSBTAG00000020908 1799.068943 1584.699647 2013.43824 1.270548803 0.8212162 ENSBTAG00000018026 434.372007 365.9341792 502.8098348 1.374044469 0.8212162 ENSBTAG00000023411 10.7631365 8.747815173 12.77845783 1.460759925 0.8213727 ENSBTAG00000011374 444.7561212 506.696752 382.8154905 0.755512028 0.8214302 100139219 125.4960907 106.7369819 144.2551995 1.351501578 0.8218108 ENSBTAG00000011460 500.7550481 569.1459587 432.3641375 0.759671804 0.8218596 100125921 61.31561628 69.45581726 53.1754153 0.765600599 0.8223985 505016 36.29267168 43.49614007 29.08920329 0.66877666 0.822417 ENSBTAG00000008250 256.9424971 296.1344954 217.7504987 0.735309469 0.822417 ENSBTAG00000013013 1071.683337 1216.015064 927.3516089 0.762615231 0.822417 100336751 200.2652213 214.8521171 185.6783255 0.864214549 0.822417 540017 14.21094563 18.12667256 10.2952187 0.567959655 0.8226863 ENSBTAG00000020535 40.30971594 46.78440566 33.83502622 0.723211629 0.8226863 ENSBTAG00000003642 8678.527052 7716.544828 9640.509276 1.249329783 0.8226863 ENSBTAG00000011893 671.8916009 576.6410383 767.1421635 1.330363454 0.8226865 526800 12.28580412 8.763275179 15.80833307 1.80392978 0.8228142 ENSBTAG00000004218 32.04617625 36.62800887 27.46434363 0.749818089 0.8230388 617852 6.887444633 8.647562411 5.127326855 0.592921636 0.8235942 ENSBTAG00000010943 10.53018105 12.3326053 8.727756793 0.707697731 0.8235942 ENSBTAG00000004040 890.4570797 976.9500147 803.9641447 0.822932732 0.8235942 ENSBTAG00000021721 309.4569756 339.4232774 279.4906738 0.823428128 0.8235942 ENSBTAG00000021664 28.17684935 32.79300643 23.56069227 0.718466979 0.8238328 ENSBTAG00000004407 9.548463625 10.94662461 8.150302636 0.744549386 0.8239459 ENSBTAG00000023648 109.5757606 120.5298929 98.62162824 0.818233766 0.8242388 505682 6.85212976 8.482210651 5.22204887 0.615647157 0.8244314 ENSBTAG00000003049 113.9020232 85.36718213 142.4368643 1.668520159 0.8244314 ENSBTAG00000032713 11.43036165 13.36423896 9.496484341 0.710589235 0.8244315 ENSBTAG00000008925 477.4455619 544.7383682 410.1527555 0.752935316 0.8244315 ENSBTAG00000010171 341.6168033 296.6505834 386.5830231 1.30315949 0.8244315 511438 12.14344743 8.967175264 15.31971959 1.70842201 0.8244315 ENSBTAG00000007336 7.286693411 4.716676552 9.856710271 2.089757515 0.8244315 ENSBTAG00000014992 4.55029143 5.856326877 3.244255983 0.553974539 0.8244708 ENSBTAG00000008807 10.51832323 12.8753924 8.161254066 0.633864492 0.8244708 619000 50.43441273 59.58651557 41.28230989 0.692812954 0.8244708 ENSBTAG00000005251 88.29974117 102.0192628 74.58021958 0.731040566 0.8244708 100101131 96.07797695 110.1943456 81.96160829 0.743791415 0.8244708 ENSBTAG00000015398 1245.434206 1070.952749 1419.915663 1.325843427 0.8244708 ENSBTAG00000017017 306.741975 246.4830756 367.0008744 1.48894959 0.8244708 511117 12.08085027 7.412028661 16.74967188 2.259795886 0.8244708 ENSBTAG00000000404 190.0297745 169.1233361 210.9362128 1.247233041 0.8244748 ENSBTAG00000012330 5296.378578 5997.190591 4595.566565 0.766286563 0.8245949

PAGE 180

ENSBTAG00000032764 496.4708116 435.0236646 557.9179585 1.28250025 0.8245949 ENSBTAG00000010353 9.457584934 11.01941972 7.895750151 0.716530485 0.8246917 ENSBTAG00000012582 578.4887116 515.3799255 641.5974977 1.244901995 0.8246917 ENSBTAG00000003067 4177.234574 3623.266339 4731.20281 1.305783889 0.8246917 100337427 7.908556795 9.80260495 6.01450864 0.61356228 0.8248262 524531 3.71857065 2.048362504 5.388778795 2.630773989 0.8248262 ENSBTAG00000039958 4.516059237 5.598418461 3.433700012 0.613333933 0.8249212 ENSBTAG00000000250 120.1308372 96.53968478 143.7219896 1.488734813 0.8249212 ENSBTAG00000006651 39.66214641 48.27494065 31.04935217 0.643177428 0.8250025 ENSBTAG00000020395 186.7771985 209.6738311 163.8805659 0.781597613 0.8250025 509382 774.8787682 887.1041586 662.6533778 0.746984862 0.825181 ENSBTAG00000007061 53.99001419 47.21147999 60.7685484 1.287156183 0.8252046 ENSBTAG00000037602 5.647319523 6.784313218 4.510325827 0.664816862 0.8254255 ENSBTAG00000020214 3.676447606 2.337123139 5.015772073 2.146130852 0.8255871 ENSBTAG00000031632 3.72657275 4.963006912 2.490138588 0.501739899 0.8257168 ENSBTAG00000018422 13.08579877 15.67820599 10.49339155 0.669297977 0.8257168 ENSBTAG00000009867 28.71485016 32.6917789 24.73792143 0.756701601 0.8257168 ENSBTAG00000014680 38.25058688 43.28946839 33.21170537 0.767200583 0.8257168 ENSBTAG00000017956 134.1898861 148.1594547 120.2203175 0.811425216 0.8257168 ENSBTAG00000043577 98938.4397 107852.5755 90024.30386 0.834697766 0.8257168 ENSBTAG00000037640 146.4147803 127.5092998 165.3202608 1.296534928 0.8257168 ENSBTAG00000007702 59.07984449 51.40076166 66.75892732 1.29879257 0.8257168 ENSBTAG00000010455 101.9203108 112.9790632 90.86155835 0.804233597 0.8257813 ENSBTAG00000032496 1041.215132 922.227851 1160.202412 1.25804313 0.8258321 407126 17.09524738 19.95955692 14.23093785 0.712988665 0.8263726 ENSBTAG00000010091 299.4412793 348.8749084 250.0076502 0.716611153 0.8263726 614711 802.7322863 907.0741412 698.3904314 0.769937538 0.8263726 ENSBTAG00000017731 3.696339861 4.932154693 2.460525029 0.498874261 0.8264201 ENSBTAG00000042185 3.696339861 4.932154693 2.460525029 0.498874261 0.8264201 ENSBTAG00000009392 5.57496359 7.042221634 4.107705546 0.583296829 0.8264201 100298141 6.675195215 8.193450016 5.156940414 0.629397922 0.8264201 ENSBTAG00000017860 166.1323311 191.0642747 141.2003875 0.739020352 0.8264201 ENSBTAG00000032145 49.70745142 54.70171567 44.71318716 0.817400087 0.8264201 ENSBTAG00000001035 2018.096987 2212.119181 1824.074794 0.824582513 0.8264201 100336929 1252.306132 1140.103438 1364.508825 1.196828971 0.8264201 ENSBTAG00000022382 144.7083495 125.63343 163.783269 1.303659934 0.8264201 ENSBTAG00000017719 27.45235139 23.55536992 31.34933286 1.330878393 0.8264201 ENSBTAG00000020689 86.52535805 72.24747239 100.8032437 1.395249416 0.8264201 100336399 11.04337091 7.038407478 15.04833434 2.138031136 0.8264201 539668 14.75387717 18.38458097 11.12317337 0.605027299 0.826444 ENSBTAG00000018239 196.6680848 227.2808177 166.0553518 0.73061754 0.826444 100296273 36.80202169 43.46965719 30.13438618 0.693228061 0.8265156 782171 117.9617236 135.0287221 100.894725 0.74720936 0.8267194 ENSBTAG00000014391 360.9111737 305.1863828 416.6359646 1.365185303 0.8267799 ENSBTAG00000030884 5.32495928 3.207286992 7.442631568 2.32053807 0.826811 ENSBTAG00000011314 6.627394902 7.997246037 5.257543766 0.657419284 0.8271856 ENSBTAG00000043502 7.809803134 9.352374504 6.267231763 0.670121985 0.8271856 788730 14440.55154 15730.43941 13150.66366 0.836001037 0.8271856 100336605 77.54086453 83.36581829 71.71591076 0.860255585 0.8271856 ENSBTAG00000034045 695.7720476 644.0114454 747.5326497 1.160744355 0.8271856 ENSBTAG00000040455 93.70853998 71.27725916 116.1398208 1.629409186 0.8271856 ENSBTAG00000033214 104.3214496 122.6222791 86.02062015 0.7015089 0.8272781

PAGE 181

ENSBTAG00000016287 172.0044491 188.026442 155.9824562 0.829577237 0.8272781 ENSBTAG00000012434 3.532067289 2.048362504 5.015772073 2.448674033 0.8272781 ENSBTAG00000000972 5.512795803 7.042221634 3.983369972 0.565641097 0.827329 509490 852.7834741 754.4107843 951.1561639 1.260793435 0.8276621 ENSBTAG00000042601 1666.478455 1736.973432 1595.983478 0.918830103 0.8277398 100337443 3.63017277 4.705098496 2.555247044 0.543080458 0.8279059 ENSBTAG00000000528 54.50661405 61.37322329 47.64000482 0.776234362 0.8279059 ENSBTAG00000015537 225.1911697 190.8524117 259.5299278 1.359846205 0.827941 ENSBTAG00000011190 25.06617525 18.03904042 32.09331007 1.779102952 0.8281047 613600 3.618745965 4.901302475 2.336189455 0.47664666 0.8282571 ENSBTAG00000027409 7.565782962 9.833457168 5.298108756 0.538783936 0.8283344 ENSBTAG00000043583 280.8516649 304.8879259 256.8154039 0.842327236 0.8285866 ENSBTAG00000019368 79.59350693 94.60425914 64.58275471 0.682662232 0.8289656 ENSBTAG00000025762 15.1159985 18.0577594 12.1742376 0.674183177 0.8291253 787888 83.44727919 93.92378131 72.97077707 0.776914814 0.8292095 ENSBTAG00000013109 275.391842 315.616432 235.1672519 0.745104589 0.8296013 ENSBTAG00000017136 4.299654535 4.762988776 3.836320293 0.805443908 0.8299063 100337356 26.3657213 31.72275665 21.00868595 0.662259153 0.8299513 ENSBTAG00000003986 140.6192864 159.2156894 122.0228833 0.766399868 0.8300493 ENSBTAG00000005782 5.407729663 7.145868958 3.669590368 0.513526121 0.8302508 539681 48.12004639 53.6542024 42.58589037 0.793710249 0.8302508 ENSBTAG00000007024 174.8187012 159.1725684 190.464834 1.196593332 0.8302508 507307 52.97640508 46.02946718 59.92334297 1.301847417 0.8302508 781063 4586.195722 4953.517743 4218.873701 0.851692458 0.8303699 ENSBTAG00000006538 5.38722157 6.980517197 3.793925942 0.543502127 0.8305312 536367 5.266158212 6.175939731 4.356376694 0.705378758 0.8305312 ENSBTAG00000001617 302.2075458 349.0407475 255.374344 0.731646221 0.8305312 781102 40.43627517 33.25100078 47.62154957 1.432183948 0.8305312 ENSBTAG00000018088 24.43301832 17.12644629 31.73959034 1.853250219 0.8305312 100335526 7.963115878 6.410692035 9.515539722 1.484323326 0.8305996 508969 22.38205408 25.92001851 18.84408964 0.727009112 0.8309292 ENSBTAG00000044153 3.472474186 2.263840645 4.681107727 2.067772631 0.8310094 ENSBTAG00000000566 182.5429199 203.1318985 161.9539414 0.797284634 0.8311717 ENSBTAG00000006493 140.0517548 155.1817792 124.9217304 0.805002565 0.8311717 ENSBTAG00000005099 126.4121177 109.3391544 143.4850811 1.312293678 0.8311717 ENSBTAG00000016991 20.56091867 14.87751047 26.24432686 1.764026778 0.8313288 525644 19.01330183 15.24336776 22.7832359 1.4946327 0.831778 100335849 5.211989034 6.630052126 3.793925942 0.572231691 0.8319529 ENSBTAG00000030595 574.7488226 633.4334746 516.0641705 0.814709344 0.8320839 ENSBTAG00000008884 33.84943081 26.65568282 41.0431788 1.539753421 0.8320839 ENSBTAG00000004652 7.869832134 5.193945059 10.54571921 2.030387132 0.8320839 ENSBTAG00000004017 7.521661829 8.805705453 6.237618204 0.708360987 0.8322066 ENSBTAG00000040397 135.9720304 114.1093519 157.834709 1.3831882 0.8322066 514102 7.369423003 9.286788117 5.452057889 0.587076804 0.8325956 ENSBTAG00000011023 781.6944559 860.1457131 703.2431987 0.817586123 0.8328549 ENSBTAG00000021978 36.87839294 41.71781922 32.03896667 0.767992366 0.8329426 ENSBTAG00000000857 47.06941668 52.88817326 41.2506601 0.779960009 0.8329874 ENSBTAG00000022564 7.80131966 5.317353933 10.28528539 1.934286398 0.8329874 540159 3.275836838 1.790454088 4.761219588 2.659224618 0.8329874 ENSBTAG00000016876 4.16014471 5.482705694 2.837583726 0.517551714 0.8338437 ENSBTAG00000039664 4.16014471 5.482705694 2.837583726 0.517551714 0.8338437 ENSBTAG00000007678 21.72346128 26.0506361 17.39628647 0.667787397 0.8339058

PAGE 182

524077 51.91054483 60.4340107 43.38707896 0.717924865 0.8339471 ENSBTAG00000011138 5508.799097 6232.685393 4784.912801 0.767712872 0.8342151 616913 59.12045583 67.41120112 50.82971053 0.754024697 0.8344198 ENSBTAG00000016149 54.46783757 45.86460281 63.07107232 1.375157931 0.8347707 ENSBTAG00000008192 24.37428411 27.20623382 21.54233439 0.791816116 0.8348533 ENSBTAG00000037938 214.3879349 188.195523 240.5803468 1.278353188 0.834902 ENSBTAG00000016398 29.86618475 35.74189762 23.99047188 0.671214274 0.8349554 ENSBTAG00000020403 3282.007709 3687.886685 2876.128733 0.779885332 0.8352315 790811 20444.1595 18624.73084 22263.58816 1.195377713 0.8352315 785169 7.811170014 10.23356123 5.388778795 0.526579035 0.8353837 ENSBTAG00000013982 8736.098861 9792.811499 7679.386222 0.784186056 0.8353837 514361 1130.497336 1032.946438 1228.048234 1.188878908 0.8353837 ENSBTAG00000014970 516.1034009 447.5092044 584.6975973 1.306559936 0.8353837 ENSBTAG00000014530 39.68971838 31.2644105 48.11502626 1.538971165 0.8353851 ENSBTAG00000024811 3.17587686 1.501693453 4.850060266 3.229727249 0.8353851 ENSBTAG00000037965 4.079170839 5.255649496 2.902692182 0.552299423 0.835756 ENSBTAG00000000737 724.4290882 637.7700755 811.0881009 1.271756283 0.8362563 ENSBTAG00000000496 7.324506972 9.187022744 5.461991201 0.594533327 0.8363824 505780 19.69849952 23.95984332 15.43715571 0.644292849 0.8365352 100336259 3.139888499 2.036784448 4.24299255 2.083181926 0.8365946 ENSBTAG00000001400 4.041997977 4.99774108 3.086254874 0.617529965 0.8368249 ENSBTAG00000019843 165.6588765 187.9679794 143.3497736 0.762628688 0.8368249 ENSBTAG00000000375 944.9223623 1005.021908 884.822817 0.880401522 0.8368651 ENSBTAG00000032571 5.282894816 7.184417283 3.381372349 0.470653668 0.8370776 788063 6.510997969 8.686110736 4.335885203 0.499174525 0.8370776 532076 38.7295646 44.9096462 32.54948301 0.724777097 0.8370776 ENSBTAG00000011591 2126.00976 2440.95042 1811.0691 0.741952432 0.8370776 615803 625.8073792 714.0498904 537.5648681 0.752839368 0.8370776 ENSBTAG00000005815 150.9310778 167.9011815 133.9609742 0.797856054 0.8370776 ENSBTAG00000009232 1881.697418 1722.478747 2040.916089 1.184871565 0.8370776 522998 320.0325897 275.9201406 364.1450388 1.319747946 0.8370776 523576 5.011605727 6.175939731 3.847271724 0.622945154 0.8372127 ENSBTAG00000027446 688.0135205 620.020012 756.007029 1.219326819 0.8372127 ENSBTAG00000018205 27.05758462 31.86071855 22.25445068 0.698491801 0.8374597 534844 3.062294603 2.005932229 4.118656976 2.053238347 0.8375105 ENSBTAG00000007152 1670.05365 1413.636622 1926.470677 1.362776436 0.8375349 ENSBTAG00000007343 16.54143422 12.82526602 20.25760242 1.579507387 0.8375349 ENSBTAG00000000049 390.4008862 428.4180823 352.38369 0.822522915 0.8376188 509563 3.042249859 1.717171595 4.367328124 2.543326559 0.8377418 ENSBTAG00000011855 1562.583097 1769.112586 1356.053608 0.766516286 0.8377523 ENSBTAG00000020026 2665.312414 2409.206771 2921.418058 1.212605781 0.8377524 ENSBTAG00000014082 6.457364406 7.850681051 5.064047762 0.645045663 0.8379145 ENSBTAG00000030578 54.96236179 64.69657485 45.22814873 0.699081038 0.8379385 ENSBTAG00000014288 19.03701428 23.24394056 14.83008799 0.638019528 0.8379819 100336402 11.20682953 12.85611824 9.557540821 0.743423531 0.8379819 100336578 58.19211654 71.78829989 44.59593318 0.621214505 0.8380922 ENSBTAG00000000018 6895.88622 6337.453697 7454.318742 1.176232458 0.8380922 ENSBTAG00000040289 6.435286106 8.42820232 4.442369892 0.527083917 0.8381413 ENSBTAG00000023037 267.4147057 231.4112215 303.4181899 1.311164549 0.8381966 ENSBTAG00000017835 22.37832014 17.71499044 27.04164985 1.526484022 0.8381966 530462 13.21610378 9.187022744 17.24518481 1.877124428 0.8381966 ENSBTAG00000012121 19.57046384 22.70503541 16.43589228 0.723887542 0.8384307

PAGE 183

ENSBTAG00000042278 3.213173136 4.496829072 1.929517199 0.429083954 0.8384399 ENSBTAG00000008836 14.01457863 11.63160736 16.3975499 1.409740665 0.8384399 ENSBTAG00000000275 6132.633441 6689.706599 5575.560282 0.833453635 0.838779 ENSBTAG00000026993 9010.433811 8159.078553 9861.789068 1.20868907 0.838779 594846 3.190963033 4.393181749 1.988744317 0.452688833 0.8392249 ENSBTAG00000019820 3.192045713 4.300625093 2.083466332 0.484456628 0.8392249 541459 63.01420698 73.12477717 52.9036368 0.723470742 0.8392249 ENSBTAG00000014689 299.242366 345.7359794 252.7487525 0.73104556 0.8392292 ENSBTAG00000031123 56.66170426 66.45132 46.87208852 0.705359781 0.8392443 ENSBTAG00000017941 77.45721743 87.17462186 67.739813 0.777058868 0.8392443 ENSBTAG00000009864 29.47202612 32.8514519 26.09260034 0.794260187 0.8392443 100296197 10.06677097 8.127863629 12.00567831 1.477101346 0.8392443 ENSBTAG00000021087 1701.019459 1535.630745 1866.408173 1.215401671 0.8395733 ENSBTAG00000010070 15.75552549 19.42058398 12.09046701 0.622559395 0.8397321 ENSBTAG00000035191 6.90375189 5.220915328 8.586588452 1.644651926 0.8397321 ENSBTAG00000033722 196.3184145 174.5230458 218.1137832 1.249770666 0.839907 ENSBTAG00000033835 9.070974169 10.99626361 7.145684732 0.649828432 0.8399726 ENSBTAG00000027868 3.872003405 4.936036643 2.807970167 0.568871419 0.8400442 539470 3.864444102 4.678128227 3.050759978 0.652132612 0.8400442 ENSBTAG00000027069 939.2648751 1075.172408 803.3573423 0.747189322 0.8400442 ENSBTAG00000001777 1741.351728 1770.032927 1712.670528 0.967592468 0.8400442 ENSBTAG00000003316 1010.249251 929.7520493 1090.746452 1.173158427 0.8400442 ENSBTAG00000024611 9.978593388 6.518708696 13.43847808 2.06152456 0.8400442 523615 3.144684705 4.300625093 1.988744317 0.462431455 0.8401614 ENSBTAG00000036202 2.667862801 3.534595952 1.80112965 0.509571582 0.8401614 ENSBTAG00000027024 1068.406309 1217.742966 919.069652 0.754732056 0.8401614 100139760 425.9374003 484.3423507 367.5324498 0.758827819 0.8401614 ENSBTAG00000005786 1548.517663 1736.79047 1360.244856 0.783194565 0.8401614 ENSBTAG00000039710 43.89419404 37.50531365 50.28307442 1.340692012 0.8401614 ENSBTAG00000021894 25.1778731 18.25451856 32.10122764 1.758535977 0.8401614 ENSBTAG00000005724 12.91529701 8.774853235 17.05574078 1.943706673 0.8401614 ENSBTAG00000030395 2.826752269 1.748023813 3.905480724 2.23422627 0.8401614 ENSBTAG00000001713 2.823192271 1.717171595 3.929212946 2.288188879 0.8401614 789582 2.831702451 1.201354763 4.462050139 3.71418192 0.8401614 ENSBTAG00000021706 215.363958 177.7456616 252.9822544 1.423282302 0.8402479 100299353 3.832509204 4.708980445 2.956037963 0.627744795 0.8403645 ENSBTAG00000004979 1970.437351 2219.836485 1721.038217 0.775299545 0.8404292 ENSBTAG00000001565 2089.535191 1862.596601 2316.473781 1.243679806 0.8404292 ENSBTAG00000016327 17.23711197 19.51757776 14.95664618 0.76631672 0.8406017 ENSBTAG00000011146 2294.197457 2090.268661 2498.126253 1.195122091 0.8406952 ENSBTAG00000021839 3.109369833 4.135273333 2.083466332 0.503827961 0.8407697 ENSBTAG00000020518 7628.152406 6902.111798 8354.193015 1.210382164 0.8409615 ENSBTAG00000044557 13.34328584 16.04024912 10.64632256 0.663725512 0.8410536 ENSBTAG00000018257 969.6598836 1106.889769 832.4299981 0.75204417 0.8410536 ENSBTAG00000000278 63.95090499 51.90562341 75.99618658 1.464122413 0.8410536 100336810 15.04148395 10.94274266 19.14022523 1.749125043 0.8410536 100335399 5.025605729 6.699452669 3.35175879 0.500303376 0.8410712 ENSBTAG00000018274 8.21064453 5.340510045 11.08077902 2.074854072 0.8410712 535900 79.5439837 91.19320765 67.89475976 0.744515535 0.8411343 100337165 17.34239613 21.1917639 13.49302836 0.636710961 0.8412448 ENSBTAG00000013320 26.81840017 24.44092599 29.19587436 1.194548618 0.8415264 527053 11.80025435 15.22790775 8.372600956 0.549819522 0.8417618

PAGE 184

ENSBTAG00000003956 3.765722783 4.451072029 3.080373537 0.692052053 0.8417618 ENSBTAG00000010503 222.8839916 258.5052177 187.2627655 0.724406135 0.8417618 ENSBTAG00000022003 125.086968 144.3776343 105.7963017 0.732774866 0.8417618 ENSBTAG00000019729 465.5696219 529.8016581 401.3375856 0.757524216 0.8417618 ENSBTAG00000006529 216.5463502 244.030655 189.0620453 0.774747112 0.8417618 537630 110.5617721 90.07498442 131.0485598 1.454882958 0.8417618 ENSBTAG00000037929 4.778384732 5.887179096 3.669590368 0.623318963 0.8418313 ENSBTAG00000039046 66.03773115 79.21099963 52.86446268 0.6673879 0.8418313 ENSBTAG00000001249 11.36164537 8.0165202 14.70677054 1.834557909 0.8418313 ENSBTAG00000000835 35.17631672 37.75670411 32.59592933 0.863315008 0.8420764 ENSBTAG00000005963 16.77810577 19.80578322 13.75042832 0.694263295 0.8421381 ENSBTAG00000013611 242.2621182 208.1607758 276.3634607 1.327644267 0.8421381 ENSBTAG00000005041 2.664624503 1.459263179 3.869985828 2.652013622 0.8421381 521163 9.757171006 11.41231506 8.102026948 0.709937195 0.8423685 539023 3.035155911 4.300625093 1.769686729 0.411495234 0.8424959 ENSBTAG00000020049 3.721921774 4.481924248 2.9619193 0.660858849 0.8424959 784169 77.41684539 91.77398789 63.0597029 0.687119568 0.8424959 100300115 9.737102219 11.44316728 8.031037155 0.701819431 0.8424959 ENSBTAG00000015103 114.4051938 129.4506882 99.35969937 0.767548638 0.8424959 ENSBTAG00000034467 10.49853035 13.3372009 7.659859795 0.574322892 0.8425047 100336638 8.815982378 10.80005963 6.831905128 0.632580316 0.8425047 ENSBTAG00000018989 19.5303129 22.86650522 16.19412058 0.708202693 0.8426646 ENSBTAG00000010506 454.4792415 498.9455394 410.0129436 0.821758912 0.8426646 ENSBTAG00000019077 9298.865712 8366.560034 10231.17139 1.222864755 0.8426646 ENSBTAG00000004484 29.30617088 25.8081199 32.80422187 1.271081427 0.8426646 ENSBTAG00000004463 359.6531611 289.5076938 429.7986284 1.484584478 0.8426646 100336744 2.609704193 1.201354763 4.018053624 3.344602068 0.8426646 ENSBTAG00000019479 3.691069556 4.420219811 2.9619193 0.670084165 0.8431623 ENSBTAG00000035291 6.539694654 4.901302475 8.178086833 1.668553793 0.8435277 ENSBTAG00000019006 12.04525511 14.62729816 9.463212058 0.646955573 0.8440048 790270 2.986116938 4.042716677 1.929517199 0.477282321 0.8440593 527565 2.983795599 4.073568896 1.894022303 0.464954037 0.8441026 ENSBTAG00000016299 70.95833925 81.38381357 60.53286492 0.743794893 0.8441026 ENSBTAG00000034598 12.01888972 14.14233355 9.895445898 0.699703897 0.8441976 ENSBTAG00000006369 682.5976173 769.0099169 596.1853176 0.775263497 0.8443623 ENSBTAG00000018656 1479.507504 1629.84146 1329.173548 0.815523215 0.8443623 ENSBTAG00000003152 17.52555186 21.21873417 13.83236954 0.651894191 0.8445735 ENSBTAG00000012721 4.678424754 5.598418461 3.758431046 0.671337999 0.8445735 ENSBTAG00000009337 199.5854503 220.9769513 178.1939492 0.806391563 0.8445735 ENSBTAG00000017024 594.6740663 657.2390191 532.1091135 0.809612786 0.8445735 ENSBTAG00000031205 545.1401332 490.3053848 599.9748815 1.223675897 0.8445735 ENSBTAG00000035243 48.20432434 55.00482594 41.40382273 0.752730729 0.8446775 ENSBTAG00000043944 172.4679353 149.7457376 195.190133 1.303477055 0.8446775 ENSBTAG00000020709 6.006012656 7.107808021 4.904217291 0.689976048 0.8448097 ENSBTAG00000009163 40.03299658 45.83770034 34.22829282 0.746727968 0.8448097 ENSBTAG00000037784 14.97072903 16.94514714 12.99631093 0.766963593 0.8448097 ENSBTAG00000000202 25.95646176 28.77351366 23.13940986 0.804191317 0.8448097 540841 414.7435825 439.8334573 389.6537077 0.885911932 0.8448097 524159 77.14861015 65.32380291 88.97341738 1.362036707 0.8448097 ENSBTAG00000032132 19.52906241 15.72014888 23.33797595 1.484590008 0.8448097 ENSBTAG00000011277 2.448185882 3.503743733 1.392628031 0.397468576 0.8448801 100337220 2.445888587 3.214983099 1.676794076 0.521556109 0.8448801

PAGE 185

ENSBTAG00000043816 2.446351937 3.091574224 1.80112965 0.582593048 0.8448801 ENSBTAG00000035247 10.41097776 12.73270936 8.089246156 0.635312244 0.8448801 ENSBTAG00000037303 55.10533797 63.60226197 46.60841396 0.732810635 0.8448801 ENSBTAG00000020251 11.46289405 14.58868204 8.33710606 0.571477672 0.8451647 512293 12.16608707 14.50000734 9.832166805 0.678080126 0.8453167 ENSBTAG00000039265 4.788824736 6.379839816 3.197809656 0.501236669 0.8453593 100313385 2.917009178 3.81566048 2.018357877 0.528966843 0.8453593 520101 2.919949847 3.81566048 2.024239214 0.530508211 0.8453593 ENSBTAG00000000965 17.0252631 20.45221764 13.59830855 0.664881862 0.8453593 ENSBTAG00000000231 2230.149234 2097.34429 2362.954179 1.126641053 0.8453593 100337294 279.5517946 318.8407725 240.2628168 0.753551106 0.8454239 ENSBTAG00000005040 884.1355598 1008.536211 759.7349081 0.753304541 0.8456185 ENSBTAG00000003898 22.635985 25.25430992 20.01766008 0.792643321 0.8456185 ENSBTAG00000017741 261.7321404 289.3679307 234.09635 0.808992031 0.8456185 100336860 54.68563395 60.08084183 49.29042607 0.820401722 0.8456185 ENSBTAG00000016133 558.8960403 607.07057 510.7215105 0.841288535 0.8456185 ENSBTAG00000011122 318.9502866 271.9178412 365.9827321 1.345931295 0.8456185 ENSBTAG00000005964 48.48924499 40.1081091 56.87038088 1.417927251 0.8456185 ENSBTAG00000023745 49.29826016 39.16521794 59.43130238 1.517451083 0.8456185 100299937 2.3837208 3.214983099 1.552458502 0.482882321 0.8466459 ENSBTAG00000002116 598.7853474 671.7789048 525.7917899 0.782685771 0.8466459 ENSBTAG00000017346 803.8442341 884.0039265 723.6845417 0.818644035 0.8466718 ENSBTAG00000032573 4.576901887 3.164856717 5.988947056 1.892328023 0.8466718 ENSBTAG00000019892 75.98991063 90.57602769 61.40379356 0.677925442 0.8467265 508144 16.35906582 12.73659131 19.98154032 1.568829511 0.8467265 ENSBTAG00000045121 4.56074869 2.102370835 7.019126544 3.338671955 0.8468654 ENSBTAG00000020353 5.882759762 7.015251366 4.750268158 0.677134419 0.8468851 ENSBTAG00000006016 168.1033863 191.313042 144.8937306 0.757364626 0.8468851 ENSBTAG00000010550 2.855924071 3.723103824 1.988744317 0.534163002 0.8469245 ENSBTAG00000012211 21.07390955 24.71096764 17.43685146 0.705632078 0.8469245 522045 142.8833208 160.0208221 125.7458194 0.785809108 0.8469245 ENSBTAG00000001790 202.1772103 219.1308277 185.2235929 0.845264881 0.8469245 ENSBTAG00000012791 127.8385806 114.8820345 140.7951267 1.225562615 0.8469245 ENSBTAG00000018395 90.14314554 73.82105397 106.4652371 1.44220695 0.8469245 613985 1.391458852 0.600677381 2.182240322 3.632965698 0.8469245 767927 4.521981577 2.906948301 6.137014852 2.111153765 0.847097 ENSBTAG00000004190 332.9696125 385.8439872 280.0952378 0.725928736 0.8471614 ENSBTAG00000013424 52.8248301 60.67708208 44.97257813 0.741178985 0.8471614 ENSBTAG00000012243 614.1608573 549.0862169 679.2354977 1.237028862 0.8471698 506088 2.340978427 3.472891515 1.209065339 0.348143711 0.8471871 ENSBTAG00000033945 2.320933683 3.18413088 1.457736487 0.457812993 0.8471888 100336832 2.335740463 3.18413088 1.487350046 0.467113351 0.8471888 ENSBTAG00000002075 139.826887 160.3605989 119.2931751 0.743905772 0.8471888 ENSBTAG00000000878 578.7011275 662.23901 495.1632449 0.747710777 0.8471888 ENSBTAG00000031295 741.6699826 672.7989226 810.5410426 1.204729995 0.8471888 ENSBTAG00000018775 6721.823829 6092.251429 7351.39623 1.206679717 0.8471888 ENSBTAG00000016533 681.513058 608.2285497 754.7975662 1.240976877 0.8471888 ENSBTAG00000001651 625.4978942 550.4577629 700.5380255 1.272646282 0.8471888 ENSBTAG00000010485 247.9172656 214.204284 281.6302472 1.314774112 0.8471888 790558 151.3868981 129.580954 173.1928422 1.336560944 0.8471888 ENSBTAG00000006212 33.53746513 24.72310088 42.35182938 1.713046822 0.8471888 ENSBTAG00000004797 4.470621265 2.679892104 6.261350426 2.33641885 0.8471888

PAGE 186

ENSBTAG00000040068 6.217652704 3.292147541 9.143157866 2.777262486 0.8471888 ENSBTAG00000003527 23.08793886 27.12470004 19.05117768 0.702355331 0.8474472 ENSBTAG00000007850 31.12824061 37.20885691 25.04762432 0.673162962 0.84757 541234 40.83002627 32.61565702 49.04439553 1.503707115 0.84757 ENSBTAG00000027911 4.435150413 2.360279251 6.510021574 2.758157355 0.8478128 789064 2.288379456 3.18413088 1.392628031 0.437365198 0.8479569 524501 4.637504446 5.864022984 3.410985908 0.581680174 0.8479569 ENSBTAG00000012037 20.57810762 23.52119093 17.6350243 0.749750485 0.8479569 ENSBTAG00000019262 3258.683386 3663.041282 2854.325491 0.779222857 0.8479569 ENSBTAG00000020681 522.9534937 468.7432587 577.1637288 1.231300329 0.8479569 100335345 1.468433418 0.600677381 2.336189455 3.889258241 0.8479569 ENSBTAG00000017958 134.7055227 151.9690803 117.4419652 0.77280171 0.8480415 ENSBTAG00000008176 1408.760744 1550.595052 1266.926436 0.817058221 0.8480415 ENSBTAG00000043171 654.1394681 690.4967919 617.7821443 0.894692273 0.8480415 ENSBTAG00000007158 474.7696521 420.8064508 528.7328534 1.256475162 0.8480415 ENSBTAG00000016505 2.19659811 3.18413088 1.209065339 0.379715968 0.8481101 ENSBTAG00000019033 2.165745891 3.122426443 1.209065339 0.387219799 0.8481101 ENSBTAG00000031111 2.211404889 3.18413088 1.238678898 0.389016327 0.8481101 100138044 2.271870667 3.245835317 1.297906017 0.399868105 0.8481101 540252 6.85215602 9.067428026 4.636884014 0.511378089 0.8481101 100335263 2.191360146 2.895370245 1.487350046 0.513699431 0.8481101 618436 2.269573372 2.957074682 1.582072061 0.535012548 0.8481101 ENSBTAG00000007452 4.510871577 5.575262349 3.446480804 0.618173745 0.8481101 ENSBTAG00000022880 8.015782212 9.875887443 6.155676981 0.62330368 0.8481101 ENSBTAG00000031240 12.33703819 14.7617977 9.912278666 0.671481812 0.8481101 789192 13.32593212 15.90574958 10.74611467 0.675611961 0.8481101 ENSBTAG00000014380 3.341379793 3.904402979 2.778356608 0.711595761 0.8481101 ENSBTAG00000021974 26.81342076 31.25615922 22.37068231 0.715720769 0.8481101 ENSBTAG00000038117 235.1023268 273.931563 196.2730906 0.716504109 0.8481101 ENSBTAG00000005431 9.121017904 10.6077376 7.634298211 0.719691465 0.8481101 ENSBTAG00000011704 43.69872075 50.81124274 36.58619876 0.720041408 0.8481101 ENSBTAG00000001602 24.43257223 28.38443247 20.48071198 0.721547348 0.8481101 ENSBTAG00000001829 11.62127601 13.49922589 9.743326127 0.721769248 0.8481101 ENSBTAG00000018326 115.2320061 133.0660594 97.39795275 0.731951883 0.8481101 510240 12.15968838 13.95722024 10.36215652 0.742422656 0.8481101 513059 2348.341724 2674.56274 2022.120709 0.756056562 0.8481101 ENSBTAG00000020938 1866.264234 2118.609595 1613.918873 0.761782103 0.8481101 ENSBTAG00000016980 562.5970408 636.7287919 488.4652896 0.767148111 0.8481101 ENSBTAG00000009067 1067.192948 1199.697955 934.6879421 0.779102722 0.8481101 ENSBTAG00000012878 1746.662297 1962.219867 1531.104727 0.780292134 0.8481101 ENSBTAG00000017001 226.4075363 254.1589034 198.6561691 0.781621916 0.8481101 ENSBTAG00000007273 25.55926331 28.64622284 22.47230378 0.784477029 0.8481101 ENSBTAG00000013111 1026.092818 1149.408008 902.7776271 0.785428343 0.8481101 ENSBTAG00000003604 96.43315299 106.2487583 86.61754768 0.815233505 0.8481101 100337224 58.36287744 64.00021742 52.72553745 0.823833724 0.8481101 ENSBTAG00000009907 471.5439954 515.6757636 427.4122272 0.828839083 0.8481101 ENSBTAG00000026829 1347.775039 1471.581435 1223.968643 0.831736942 0.8481101 ENSBTAG00000000500 1090.2163 1185.246523 995.1860762 0.839644797 0.8481101 100299201 8175.751929 8828.318709 7523.185149 0.852165106 0.8481101 518134 99.21291168 104.7678012 93.6580222 0.893958078 0.8481101 ENSBTAG00000018427 5353.637237 4923.800405 5783.474068 1.174595555 0.8481101 530186 6019.978503 5464.671067 6575.285939 1.203235448 0.8481101

PAGE 187

ENSBTAG00000017426 2073.204001 1832.40572 2314.002282 1.262822014 0.8481101 ENSBTAG00000017611 282.6776537 248.2326886 317.1226188 1.277521589 0.8481101 ENSBTAG00000017493 454.7930264 397.6176967 511.9683561 1.287589462 0.8481101 ENSBTAG00000003679 594.510489 517.1259235 671.8950545 1.299287125 0.8481101 ENSBTAG00000013337 261.0437022 225.9564608 296.1309435 1.310566392 0.8481101 786134 304.9052396 255.4272261 354.3832531 1.38741378 0.8481101 100299043 38.99996127 32.59631507 45.40360747 1.392906142 0.8481101 ENSBTAG00000036058 56.49682652 46.96189066 66.03176238 1.406071209 0.8481101 ENSBTAG00000015742 7.938172744 6.429966197 9.446379291 1.469118033 0.8481101 511923 7.365032357 5.821592709 8.908472006 1.530246524 0.8481101 781766 14.67824152 11.50098977 17.85549326 1.552517967 0.8481101 ENSBTAG00000015796 124.8715914 96.79384683 152.949336 1.580155568 0.8481101 100125919 31.81955776 24.18794209 39.45117343 1.631026455 0.8481101 ENSBTAG00000009655 16.75546148 12.65942687 20.85149609 1.647112172 0.8481101 ENSBTAG00000038141 53.11834825 38.67699435 67.55970216 1.746767123 0.8481101 ENSBTAG00000020856 1.742387273 1.178198651 2.306575896 1.957713918 0.8481101 ENSBTAG00000004955 1.712154384 1.147346432 2.276962337 1.984546492 0.8481101 100295586 4.385779892 2.906948301 5.864611482 2.017446089 0.8481101 100139810 1.81936184 1.178198651 2.460525029 2.088378754 0.8481101 100336779 1.81936184 1.178198651 2.460525029 2.088378754 0.8481101 ENSBTAG00000010158 5.116453453 3.226561155 7.006345752 2.171459153 0.8481101 ENSBTAG00000032146 4.236137567 2.649039885 5.823235249 2.198243704 0.8481101 ENSBTAG00000019874 1.788509621 1.116494213 2.460525029 2.203795595 0.8481101 ENSBTAG00000039290 1.896336406 1.178198651 2.614474162 2.219043589 0.8481101 ENSBTAG00000014574 1.866103518 1.147346432 2.584860603 2.252903335 0.8481101 ENSBTAG00000010990 2.462509073 1.478537341 3.446480804 2.331006941 0.8481101 100335789 1.913464525 1.147346432 2.679582618 2.335460802 0.8481101 ENSBTAG00000027899 2.402043295 1.416832904 3.387253686 2.390722065 0.8481101 522957 1.550645949 0.889438016 2.211853881 2.486799352 0.8481101 100313444 2.526378869 1.416832904 3.635924834 2.566234044 0.8481101 534258 1.535219839 0.858585797 2.211853881 2.57615941 0.8481101 ENSBTAG00000000033 1.597387626 0.858585797 2.336189455 2.720973795 0.8481101 ENSBTAG00000006170 1.629941854 0.858585797 2.401297911 2.796806001 0.8481101 ENSBTAG00000038521 1.644748634 0.858585797 2.43091147 2.83129709 0.8481101 ENSBTAG00000037501 2.285574528 1.189776707 3.381372349 2.84202265 0.8481101 ENSBTAG00000043158 1.674362193 0.858585797 2.490138588 2.900279269 0.8481101 100336898 1.766762869 0.889438016 2.644087722 2.97276221 0.8481101 532455 1.7217232 0.858585797 2.584860603 3.010602564 0.8481101 ENSBTAG00000001595 1.831251995 0.858585797 2.803918192 3.265740245 0.8481101 ENSBTAG00000029828 1.863806222 0.858585797 2.869026647 3.341572451 0.8481101 ENSBTAG00000045119 2.599354131 1.189776707 4.008931556 3.369482302 0.8481101 ENSBTAG00000009049 2.283277233 0.901016072 3.665538393 4.068227534 0.8481101 ENSBTAG00000009139 1.530601205 0.600677381 2.460525029 4.096250509 0.8481101 ENSBTAG00000007379 1.545407985 0.600677381 2.490138588 4.145550783 0.8481101 ENSBTAG00000003237 1.592768992 0.600677381 2.584860603 4.303242778 0.8481101 ENSBTAG00000037645 1.61051644 0.600677381 2.6203555 4.362334226 0.8481101 ENSBTAG00000037508 2.255960968 1.189776707 3.32214523 2.792242622 0.8483381 ENSBTAG00000002635 2.255341639 1.158924488 3.35175879 2.892128714 0.8483381 ENSBTAG00000022269 34.5443915 29.27719726 39.81158574 1.35981547 0.8486206 ENSBTAG00000008584 2.226347409 1.189776707 3.262918112 2.742462593 0.8486206 ENSBTAG00000032574 84.05403803 96.8161088 71.29196725 0.736364724 0.8487072 ENSBTAG00000017441 1489.5423 1323.676214 1655.408386 1.250614288 0.8487072

PAGE 188

ENSBTAG00000039068 41.58865016 47.83586867 35.34143165 0.738806102 0.8488842 ENSBTAG00000030777 63.02427702 74.11688773 51.93166631 0.700672517 0.8489555 510512 41.36923208 45.15271759 37.58574657 0.83241383 0.8492635 522128 111.486889 123.7712233 99.20255475 0.801499348 0.8494313 ENSBTAG00000018452 499.9904711 434.8153102 565.165632 1.299783192 0.8494313 ENSBTAG00000017071 405.5802455 448.1294228 363.0310682 0.810103175 0.8495343 ENSBTAG00000039555 858.5186922 985.5976748 731.4397097 0.74212808 0.8495813 ENSBTAG00000006792 3.357793655 2.325545083 4.390042228 1.887747634 0.8495813 ENSBTAG00000020409 8.67804276 10.77690351 6.579182005 0.610489089 0.8495898 ENSBTAG00000019099 6.707148075 8.205028072 5.209268078 0.634887295 0.8498058 ENSBTAG00000044018 2.034606085 0.901016072 3.168196097 3.516248151 0.8500102 ENSBTAG00000042401 9.708260254 11.97388894 7.442631568 0.621571789 0.8500243 ENSBTAG00000013138 12.50256636 10.23793057 14.76720215 1.442401084 0.8500243 ENSBTAG00000034935 13.30776121 10.1145217 16.50100073 1.631416811 0.8500243 ENSBTAG00000032481 8.060484697 5.937305477 10.18366392 1.71519959 0.8500243 618158 3.327132376 4.170007501 2.484257251 0.595744073 0.8501066 ENSBTAG00000005564 3642.007394 4014.15932 3269.855467 0.814580391 0.8501426 ENSBTAG00000014057 1091.072373 995.7463369 1186.398409 1.191466506 0.8502364 ENSBTAG00000031355 35.82895719 41.61459149 30.04332289 0.721942036 0.8503104 ENSBTAG00000012068 220.2781176 253.1778835 187.3783518 0.740105531 0.8503104 ENSBTAG00000015083 692.3264039 607.0604541 777.5923537 1.280914196 0.8503104 ENSBTAG00000010803 272.7922579 237.0918773 308.4926384 1.301152287 0.8503104 ENSBTAG00000005844 3571.721656 3035.721395 4107.721917 1.353128757 0.8503104 404108 15.29179553 11.08112416 19.5024669 1.759971879 0.8503104 ENSBTAG00000014265 12.43030228 8.216606128 16.64399843 2.025653679 0.8503104 100337161 1014.883765 914.5758066 1115.191723 1.219354061 0.8504291 ENSBTAG00000001852 19.57662141 15.59722739 23.55601542 1.510269411 0.8504291 ENSBTAG00000014912 9.597949161 7.311708107 11.88419022 1.625364421 0.8504291 520294 435.3562236 480.7372825 389.9751648 0.811202249 0.8504304 ENSBTAG00000005848 4.338579709 5.224797278 3.452362141 0.660764803 0.8510706 ENSBTAG00000009933 23.45693338 18.33112782 28.58273893 1.559246065 0.8510706 ENSBTAG00000000869 797.5937874 878.9101492 716.2774255 0.814960922 0.851348 ENSBTAG00000002014 3525.76731 3066.134463 3985.400157 1.299812583 0.851348 787967 4.323129556 5.513557912 3.132701201 0.568181427 0.8514997 ENSBTAG00000031146 248.0107879 279.5066769 216.5148989 0.774632296 0.8514997 523204 3.251859819 4.108303064 2.395416574 0.583067154 0.85161 511533 7.577071749 9.525422371 5.628721126 0.590915647 0.8516118 538548 18.41258483 20.78784568 16.03732397 0.771475997 0.8516118 ENSBTAG00000002329 401.170978 332.4267321 469.9152239 1.41359036 0.851614 ENSBTAG00000009534 152.311754 126.0826221 178.5408858 1.416062601 0.851614 ENSBTAG00000011290 77.21969465 66.86306991 87.57631938 1.309786097 0.8519154 541068 9.515436249 11.77768496 7.253187539 0.615841531 0.8524759 ENSBTAG00000042354 12.98980228 10.05281726 15.92678731 1.584310835 0.8524955 ENSBTAG00000004375 22.21962058 15.85569099 28.58355017 1.802731284 0.8524955 ENSBTAG00000037336 8.448533287 9.879769392 7.017297183 0.71026933 0.852511 514413 4.282600764 4.739832664 3.825368863 0.807068336 0.852511 ENSBTAG00000042837 10.23361725 7.79667272 12.67056178 1.625124233 0.852511 ENSBTAG00000043458 4.278089888 5.482705694 3.073474082 0.560576156 0.8526053 ENSBTAG00000019334 22.18452372 25.61967982 18.74936763 0.73183458 0.8526053 ENSBTAG00000019177 119.6389675 96.27352508 143.0044099 1.485397048 0.852625 281881 7.508607362 9.009605539 6.007609185 0.666800468 0.8526607 ENSBTAG00000020149 23.25700065 27.79526535 18.71873595 0.673450522 0.8526607

PAGE 189

100298968 59.90629255 70.96312168 48.84946341 0.688378164 0.8526607 ENSBTAG00000023541 4.26885262 4.966888861 3.570816378 0.718924155 0.8526607 100336051 45.37475532 50.48885829 40.26065235 0.797416573 0.8526607 785568 35.87437001 28.65780089 43.09093912 1.503637327 0.8527573 ENSBTAG00000032560 8.614692699 10.61876047 6.610624926 0.622542051 0.8533009 ENSBTAG00000018707 12.66143782 15.08910666 10.23376897 0.678222323 0.8533009 ENSBTAG00000000396 5031.981619 5409.797253 4654.165984 0.860321703 0.8533009 ENSBTAG00000017086 7.65788846 5.617692624 9.698084296 1.726346553 0.8534181 ENSBTAG00000002600 32.94665444 37.34342424 28.54988464 0.764522408 0.8536266 ENSBTAG00000011734 114.3748888 126.4607611 102.2890165 0.808859725 0.8536266 ENSBTAG00000024910 14.10738616 17.11431306 11.10045926 0.648606767 0.8537552 ENSBTAG00000031430 17.3500495 20.07526969 14.62482931 0.728499768 0.8537552 ENSBTAG00000012575 66.37948923 76.65125742 56.10772104 0.731986962 0.8537552 ENSBTAG00000018127 6026.157542 6807.659092 5244.655992 0.770405204 0.8537552 ENSBTAG00000002192 209.3340549 231.3894597 187.2786502 0.809365519 0.8537552 ENSBTAG00000020853 116.1464793 94.00538289 138.2875757 1.471060182 0.8537552 535613 3.080737215 1.478537341 4.682937089 3.167276848 0.8539653 ENSBTAG00000030307 3.12522695 3.819542429 2.43091147 0.636440494 0.8542259 ENSBTAG00000043187 15.95956853 19.50495714 12.41417993 0.636462815 0.8542626 ENSBTAG00000006132 7.396724887 8.81728351 5.976166264 0.677778622 0.8544186 ENSBTAG00000005974 6.648368735 4.666550171 8.630187298 1.849372016 0.8547614 100335608 59.30462612 65.64008899 52.96916325 0.806963611 0.8551459 ENSBTAG00000021604 42.24105561 46.49578061 37.98633062 0.816984469 0.8551459 527058 157.6265644 182.1515274 133.1016013 0.730719106 0.8554066 100335558 28.19497987 31.68815807 24.70180167 0.779527848 0.8554066 ENSBTAG00000017704 81.41627171 69.72426117 93.10828226 1.335378543 0.8556295 ENSBTAG00000037410 11.75061388 15.18887204 8.31235572 0.547266163 0.8563427 ENSBTAG00000002972 87.79609853 103.1352018 72.45699525 0.702543787 0.8563427 ENSBTAG00000025621 338.9380747 374.9936399 302.8825094 0.807700391 0.8563427 ENSBTAG00000040384 871.8136738 767.1380055 976.4893421 1.272899185 0.856647 ENSBTAG00000017981 16.0255259 18.49696697 13.55408484 0.732773371 0.8567607 ENSBTAG00000005483 209.8147694 182.9054911 236.7240477 1.294242433 0.8567607 ENSBTAG00000020852 4.131388232 5.224797278 3.037979186 0.581453983 0.8570243 ENSBTAG00000011832 289.789097 338.4522335 241.1259605 0.712437197 0.8570243 ENSBTAG00000040006 3111.68795 3508.657545 2714.718355 0.773719954 0.8570243 ENSBTAG00000017118 230.5245057 209.3849477 251.6640638 1.201920513 0.8570243 ENSBTAG00000012920 458.8810562 505.640186 412.1219263 0.815049788 0.8572565 ENSBTAG00000014443 21.3643495 17.54194257 25.18675642 1.435802011 0.8573876 ENSBTAG00000001645 41.54624677 46.15398642 36.93850712 0.800331889 0.8575085 100336069 5.442499687 7.019065522 3.865933853 0.550776145 0.8575642 ENSBTAG00000004780 47.52079186 54.74747271 40.29411101 0.735999472 0.8575642 ENSBTAG00000006099 1640.229224 1795.720597 1484.737851 0.826820082 0.8575642 ENSBTAG00000016255 53.98094877 64.51762769 43.44426984 0.673370541 0.8576478 784412 163.795526 180.0497118 147.5413402 0.8194478 0.8576478 ENSBTAG00000002835 1215.202322 1069.947759 1360.456886 1.271517113 0.8576478 ENSBTAG00000011068 243.266317 213.0997196 273.4329143 1.283121887 0.8576478 ENSBTAG00000006654 146.9889499 172.085047 121.8928528 0.708329137 0.8579251 ENSBTAG00000019808 782.2283965 686.1950435 878.2617495 1.27990104 0.8584409 ENSBTAG00000006474 16679.90639 15296.84057 18062.9722 1.180830259 0.8584942 ENSBTAG00000043549 69.95285135 78.02524046 61.88046223 0.793082621 0.8586561 ENSBTAG00000008025 84.59155228 71.24522878 97.93787578 1.374658731 0.8586684 ENSBTAG00000025200 28.78439946 33.2736695 24.29512941 0.730160808 0.8586883

PAGE 190

537096 113.2739598 97.59759795 128.9503217 1.32124483 0.8586883 ENSBTAG00000002056 16.91449097 13.94945634 19.8795256 1.425111138 0.8586883 520201 141.9040179 115.3460638 168.461972 1.460491728 0.8586883 ENSBTAG00000012235 10.97537181 8.162597798 13.78814583 1.689185989 0.8586883 ENSBTAG00000018661 169.8512364 194.4927358 145.2097371 0.74660751 0.8588579 539625 4.330189586 5.810014653 2.850364518 0.490595065 0.858926 100297236 4.315226826 5.655753561 2.974700092 0.525959991 0.858926 ENSBTAG00000002842 7.162273531 9.009605539 5.314941523 0.589919448 0.858926 ENSBTAG00000020105 9.020103467 11.23101591 6.809191024 0.606284514 0.858926 ENSBTAG00000011671 28.89264716 35.57120175 22.21409257 0.624496544 0.858926 ENSBTAG00000013534 28.83658909 34.35203499 23.32114319 0.678886802 0.858926 ENSBTAG00000020699 34.21935409 39.94663929 28.49206889 0.713253215 0.858926 509935 66.1815782 75.94693272 56.41622368 0.742837422 0.858926 ENSBTAG00000009681 174.1311931 199.0339953 149.2283908 0.749763329 0.858926 ENSBTAG00000009309 87.3142133 99.78045999 74.8479666 0.750126494 0.858926 ENSBTAG00000002707 141.3923468 158.8969836 123.88771 0.779673139 0.858926 787538 229.9253322 256.1162392 203.7344253 0.795476405 0.858926 781039 26.00315415 28.75756627 23.24874202 0.808439136 0.858926 ENSBTAG00000005912 39.12266686 43.012841 35.23249273 0.819115685 0.858926 ENSBTAG00000026191 75.01113143 81.82544093 68.19682192 0.833442767 0.858926 ENSBTAG00000015112 3344.630809 3031.391358 3657.87026 1.206663815 0.858926 ENSBTAG00000019781 287.0747058 242.4293996 331.720012 1.368315941 0.858926 ENSBTAG00000025564 137.9807639 114.9584447 161.003083 1.400532891 0.858926 ENSBTAG00000014878 270.5833538 225.3650773 315.8016302 1.401289117 0.858926 ENSBTAG00000010243 153.5896103 127.0018698 180.1773508 1.41869841 0.858926 789079 10.73873702 7.958697712 13.51877632 1.698616634 0.858926 ENSBTAG00000021396 13.53417602 16.70214355 10.36620849 0.620651383 0.8589572 ENSBTAG00000033021 1.00539915 0.300338691 1.71045961 5.69510244 0.8591637 ENSBTAG00000017116 56.72263725 64.64651626 48.79875824 0.754855189 0.8592434 ENSBTAG00000043571 60384.31959 64501.11772 56267.52146 0.872349557 0.8592434 ENSBTAG00000008283 25.94254263 30.84780386 21.03728139 0.681970149 0.8595229 ENSBTAG00000019092 4.041428951 5.232493384 2.850364518 0.544743072 0.8596446 ENSBTAG00000037330 13.47063777 15.95927052 10.98200503 0.688127005 0.8596446 788649 7.109698603 8.401232051 5.818165156 0.692537133 0.8596446 ENSBTAG00000038277 2.872556497 3.592486232 2.152626763 0.599202509 0.8596703 ENSBTAG00000015505 927.3923629 798.9738475 1055.810878 1.321458621 0.8602389 ENSBTAG00000024387 92.97330517 104.7001974 81.2464129 0.775991019 0.860305 ENSBTAG00000002614 103.3095962 89.02427565 117.5949167 1.320930901 0.8606063 ENSBTAG00000007788 49.58438959 39.83099432 59.33778486 1.48973898 0.8606371 535092 9.674365406 11.67791959 7.670811225 0.656864536 0.8606578 ENSBTAG00000020273 336.8167414 393.0609514 280.5725313 0.713814309 0.8606578 ENSBTAG00000002105 32.93800637 37.54011561 28.33589714 0.754816459 0.8606578 100300589 515.9389781 559.3344839 472.5434723 0.844831645 0.8606578 ENSBTAG00000037813 387.1018471 355.8168944 418.3867997 1.175848607 0.8606578 ENSBTAG00000010624 833.2400622 719.6249323 946.8551921 1.315762072 0.8606578 ENSBTAG00000014048 68.63701946 59.85218788 77.42185103 1.293550892 0.8606874 ENSBTAG00000012390 28.08592259 32.31483094 23.85701424 0.738268267 0.8607276 ENSBTAG00000031388 7.676044926 10.5030477 4.849042148 0.461679532 0.8608511 ENSBTAG00000000261 6.554253996 8.570397968 4.538110024 0.529509836 0.8608511 ENSBTAG00000020093 51.79827681 41.29462683 62.30192678 1.508717515 0.8608511 100296892 2.675176265 1.478537341 3.87181519 2.618679341 0.8608511 526697 3.980343844 5.139936728 2.820750959 0.548790989 0.8608605

PAGE 191

ENSBTAG00000007349 3.977403175 5.139936728 2.814869622 0.547646746 0.8609087 ENSBTAG00000016995 44.00649154 50.38465579 37.6283273 0.746821164 0.8610335 616964 7.633634101 9.956378654 5.310889548 0.533415786 0.8615594 100335836 109.0203653 86.39721804 131.6435126 1.523700827 0.8616694 ENSBTAG00000006624 2.630136597 1.447685123 3.812588071 2.6335755 0.8616694 524075 1.03501271 0.300338691 1.769686729 5.892303535 0.8616694 785323 11.21753713 13.506922 8.928152252 0.661005687 0.861672 100313957 2.62425526 1.447685123 3.800825397 2.62545034 0.861672 ENSBTAG00000034767 3.943170982 4.882028312 3.004313652 0.615382267 0.8617946 ENSBTAG00000009682 710.0862115 796.5135522 623.6588708 0.782985888 0.8618121 450206 4.15495705 5.459549582 2.850364518 0.522087853 0.8618809 ENSBTAG00000040066 30.5513688 35.40301061 25.69972699 0.725919252 0.8618809 ENSBTAG00000002332 1214.292428 1357.350395 1071.234461 0.789209968 0.8618809 ENSBTAG00000004538 70.5888473 61.14949386 80.02820075 1.308730387 0.8618809 ENSBTAG00000007888 9.209636537 5.952765483 12.46650759 2.094237985 0.8618809 ENSBTAG00000018436 138.5689768 118.4891587 158.6487948 1.33893089 0.8619708 ENSBTAG00000001898 92.99972278 108.7065822 77.29286336 0.711022845 0.8620525 ENSBTAG00000007040 5.725206431 3.476773464 7.973639398 2.293402052 0.8624798 786573 1.049819489 0.300338691 1.799300288 5.990904082 0.8626607 767958 443.632224 371.5522957 515.7121522 1.387993448 0.8627495 ENSBTAG00000011106 68.18299131 79.49643349 56.86954914 0.715372334 0.8627766 ENSBTAG00000016309 3803.357312 3491.894808 4114.819815 1.178391687 0.8627766 787554 455.8783585 509.6563014 402.1004156 0.788963885 0.86286 ENSBTAG00000032217 776.3335607 849.2204813 703.44664 0.828343941 0.86286 ENSBTAG00000006188 18.92814903 23.90244043 13.95385764 0.583783806 0.8628686 ENSBTAG00000009894 23.17893287 27.45637834 18.9014874 0.688418813 0.8628686 ENSBTAG00000018080 6.468033886 4.631816003 8.304251769 1.792871687 0.8628686 ENSBTAG00000040395 46.57172502 52.2528295 40.89062054 0.782553231 0.8629701 539940 143.5852078 127.9397009 159.2307147 1.244576262 0.8631607 ENSBTAG00000032084 427.7851757 509.0655965 346.5047549 0.680668184 0.8631626 ENSBTAG00000030718 47.80030719 54.15400405 41.44661033 0.765347107 0.8631626 536942 27.66523737 30.82520293 24.50527181 0.794975198 0.8631626 ENSBTAG00000009562 50.44302034 42.66466012 58.22138056 1.364627783 0.8631626 536815 2.450474879 3.249717267 1.651232492 0.508115739 0.8632311 ENSBTAG00000011545 2.512642666 3.249717267 1.775568066 0.546376168 0.8632311 ENSBTAG00000012193 2.497216557 3.218865048 1.775568066 0.551613081 0.8632311 789814 3.767475096 4.654972115 2.879978078 0.618688578 0.8632311 ENSBTAG00000003016 3.830262213 4.685824333 2.974700092 0.634829622 0.8632311 751811 2.475469804 2.991808851 1.959130758 0.654831527 0.8632311 ENSBTAG00000007392 6.099546315 7.311708107 4.887384524 0.668432663 0.8632311 788512 7.400125324 8.832188334 5.968062314 0.675717284 0.8632311 789579 3.733242903 4.397063699 3.069422107 0.698061779 0.8632311 ENSBTAG00000016928 21.74258318 25.58931499 17.89585138 0.699348591 0.8632311 100337091 12.48288053 14.64275817 10.3230029 0.704990329 0.8632311 100335717 81.07035432 95.05053984 67.0901688 0.705836799 0.8632311 ENSBTAG00000020626 52.23815259 60.68276084 43.79354434 0.721680157 0.8632311 ENSBTAG00000018569 612.3158154 704.4271687 520.204462 0.738478703 0.8632311 538889 54.93664235 62.88600741 46.98727728 0.747181753 0.8632311 ENSBTAG00000002539 26.08781387 29.85139176 22.32423598 0.747845734 0.8632311 ENSBTAG00000020446 112.5189552 128.4131552 96.62475524 0.752452154 0.8632311 ENSBTAG00000002256 1974.662287 2244.335022 1704.989552 0.759685847 0.8632311 515193 1036.275598 1175.516984 897.0342113 0.763097619 0.8632311

PAGE 192

ENSBTAG00000017574 16.82279148 19.05909603 14.58648694 0.765329421 0.8632311 ENSBTAG00000013478 682.3300159 771.6334487 593.0265831 0.768534055 0.8632311 ENSBTAG00000016190 189.807121 211.0221026 168.5921394 0.798931189 0.8632311 789054 220.5169 244.7527917 196.2810082 0.801956157 0.8632311 ENSBTAG00000004161 2191.794718 2430.038377 1953.551059 0.80391778 0.8632311 ENSBTAG00000014089 23.95076111 26.51355497 21.38796726 0.806680481 0.8632311 ENSBTAG00000002863 429.2540374 466.6624377 391.845637 0.839676831 0.8632311 100336735 37.78154347 40.65977046 34.90331647 0.858423844 0.8632311 100297857 7833.271673 8381.817294 7284.726052 0.869110576 0.8632311 ENSBTAG00000002658 703.9328815 636.6808528 771.1849102 1.21125821 0.8632311 ENSBTAG00000003288 587.5204618 522.5034141 652.5375094 1.248867456 0.8632311 ENSBTAG00000020905 1880.266445 1661.419059 2099.113831 1.263446341 0.8632311 ENSBTAG00000009516 2296.053116 2022.646109 2569.460123 1.270345866 0.8632311 ENSBTAG00000008112 323.1647212 284.0866204 362.242822 1.275113983 0.8632311 617407 6214.012481 5445.81751 6982.207452 1.282122921 0.8632311 ENSBTAG00000017201 147.8155162 128.1721012 167.4589313 1.306516237 0.8632311 ENSBTAG00000010945 153.1811739 132.6834833 173.6788645 1.308971247 0.8632311 ENSBTAG00000001747 100.3823429 86.06436159 114.7003242 1.3327273 0.8632311 ENSBTAG00000012156 44.54578068 37.03150749 52.06005386 1.405831342 0.8632311 ENSBTAG00000007812 792.1149743 657.5641667 926.665782 1.409240085 0.8632311 ENSBTAG00000016649 312.8005593 256.6616538 368.9394649 1.437454561 0.8632311 615428 16.77733409 13.72240014 19.83226803 1.445247757 0.8632311 100138613 58.80119795 47.8243584 69.7780375 1.459048063 0.8632311 ENSBTAG00000044334 138.251968 112.1971544 164.3067815 1.464446958 0.8632311 ENSBTAG00000026633 39.83887096 32.18802751 47.48971441 1.475384424 0.8632311 286815 30.37575032 24.28333813 36.46816251 1.501777158 0.8632311 ENSBTAG00000014059 65.88669644 52.31065199 79.46274088 1.519054683 0.8632311 100140579 13.24390938 10.21865641 16.26916235 1.592103864 0.8632311 ENSBTAG00000015773 4.727191289 3.534595952 5.919786626 1.674812823 0.8632311 ENSBTAG00000005275 6.277970527 4.600963784 7.954977269 1.728980632 0.8632311 ENSBTAG00000004863 4.698660409 3.442039296 5.955281522 1.730160817 0.8632311 ENSBTAG00000002284 17.8129136 12.8831563 22.74267091 1.765302724 0.8632311 ENSBTAG00000014610 13.89117004 9.780004019 18.00233607 1.840728903 0.8632311 ENSBTAG00000016469 3.752820805 2.348701195 5.156940414 2.195656232 0.8632311 ENSBTAG00000012482 5.473155309 3.280569485 7.665741132 2.336710491 0.8632311 100140659 1.097180497 0.300338691 1.894022303 6.306288072 0.8632311 781336 1.097180497 0.300338691 1.894022303 6.306288072 0.8632311 ENSBTAG00000015176 1.097180497 0.300338691 1.894022303 6.306288072 0.8632311 100296489 1.114927945 0.300338691 1.929517199 6.424470968 0.8632311 781331 1.114927945 0.300338691 1.929517199 6.424470968 0.8632311 ENSBTAG00000003069 1.114927945 0.300338691 1.929517199 6.424470968 0.8632311 ENSBTAG00000016958 0.58972589 0 1.17945178 NA 0.8632311 ENSBTAG00000025817 0.58972589 0 1.17945178 NA 0.8632311 100313023 0.60453267 0 1.209065339 NA 0.8632311 281621 0.60453267 0 1.209065339 NA 0.8632311 789472 0.619339449 0 1.238678898 NA 0.8632311 ENSBTAG00000000623 0.619339449 0 1.238678898 NA 0.8632311 ENSBTAG00000008842 0.619339449 0 1.238678898 NA 0.8632311 ENSBTAG00000010283 0.619339449 0 1.238678898 NA 0.8632311 100140149 0.634146229 0 1.268292457 NA 0.8632311 513307 0.634146229 0 1.268292457 NA 0.8632311 614121 0.634146229 0 1.268292457 NA 0.8632311

PAGE 193

786489 0.634146229 0 1.268292457 NA 0.8632311 ENSBTAG00000000536 0.634146229 0 1.268292457 NA 0.8632311 ENSBTAG00000006136 0.634146229 0 1.268292457 NA 0.8632311 ENSBTAG00000018133 0.634146229 0 1.268292457 NA 0.8632311 ENSBTAG00000020987 0.634146229 0 1.268292457 NA 0.8632311 ENSBTAG00000002996 2.316282707 2.703048216 1.929517199 0.713830108 0.8633148 ENSBTAG00000011390 3.718875429 4.593267678 2.844483181 0.619272244 0.8634324 ENSBTAG00000000512 33.71065975 38.75298063 28.66833887 0.739771197 0.8634324 ENSBTAG00000010048 817.7984017 931.7572273 703.839576 0.755389446 0.8634324 ENSBTAG00000006721 717.4400347 797.5999528 637.2801165 0.798997184 0.8634324 ENSBTAG00000040256 1.119546579 0.558247107 1.680846051 3.010935535 0.8634324 613821 18.27904269 22.39693282 14.16115255 0.632280887 0.8634838 789279 7.225204748 8.790245448 5.660164047 0.643914221 0.8634838 ENSBTAG00000002078 189.9040852 212.6076819 167.2004885 0.786427315 0.8634838 ENSBTAG00000019020 9161.609732 8488.483543 9834.73592 1.158597513 0.8635151 ENSBTAG00000009048 192.7338054 165.305811 220.1617999 1.331845496 0.8637772 ENSBTAG00000009181 1.129734724 0.300338691 1.959130758 6.523071516 0.8637772 ENSBTAG00000000257 152.3739378 125.8361562 178.9117194 1.421783093 0.8637928 ENSBTAG00000020541 752.627052 675.0705143 830.1835897 1.229773145 0.8638461 ENSBTAG00000011950 10.37730048 11.20071887 9.553882097 0.852970439 0.8640285 ENSBTAG00000000974 6070.532278 5625.309992 6515.754565 1.158292534 0.8641236 ENSBTAG00000040313 3.652860826 2.05994056 5.245781092 2.546569155 0.8641236 ENSBTAG00000007706 5.027049798 6.249222224 3.804877372 0.608856148 0.8641417 ENSBTAG00000013616 151.8062664 174.4184237 129.1941091 0.740713661 0.8641417 618018 109.5810212 120.8919361 98.27010639 0.812875611 0.8641417 ENSBTAG00000004941 18.10440544 22.39693282 13.81187805 0.61668614 0.8641471 ENSBTAG00000021175 15.63623241 18.86233687 12.41012795 0.657931625 0.8641471 ENSBTAG00000013769 28.38479168 34.1895904 22.57999296 0.660434732 0.8641471 ENSBTAG00000015277 808.9228674 924.226964 693.6187707 0.750485322 0.8641471 ENSBTAG00000022069 455.4501362 504.7748789 406.1253934 0.804567363 0.8641471 ENSBTAG00000016730 15096.94113 16577.76644 13616.11581 0.821348031 0.8641471 ENSBTAG00000025191 1404.633392 1259.369645 1549.897139 1.230692788 0.8641471 ENSBTAG00000021951 2806.821631 2496.478251 3117.165012 1.248624942 0.8641471 ENSBTAG00000015283 3770.559809 3343.479085 4197.640532 1.255470851 0.8641471 ENSBTAG00000016527 214.6712294 189.5370732 239.8053857 1.265216254 0.8641471 100533104 67.81048524 58.11574212 77.50522837 1.333635699 0.8641471 ENSBTAG00000004893 111.6218598 92.9847721 130.2589475 1.400863223 0.8641471 540975 4.553017389 3.411187078 5.6948477 1.669462146 0.8641471 ENSBTAG00000032944 1.149779468 0.589099325 1.71045961 2.903516498 0.8641471 100300012 1.149160138 0.558247107 1.740073169 3.117030341 0.8641471 ENSBTAG00000040155 1.144541504 0.300338691 1.988744317 6.621672063 0.8641471 ENSBTAG00000007149 1.159348284 0.300338691 2.018357877 6.72027261 0.8641471 ENSBTAG00000025451 1.159348284 0.300338691 2.018357877 6.72027261 0.8641471 100335847 0.648953008 0 1.297906017 NA 0.8641471 539901 0.648953008 0 1.297906017 NA 0.8641471 ENSBTAG00000000357 0.648953008 0 1.297906017 NA 0.8641471 ENSBTAG00000025522 18.02838607 22.62398902 13.43278312 0.593740702 0.864214 ENSBTAG00000002937 1.162288952 0.300338691 2.024239214 6.739854959 0.8642391 ENSBTAG00000022736 1.166907586 0.558247107 1.775568066 3.180613109 0.8644712 782205 0.651893677 0 1.303787354 NA 0.8644712 ENSBTAG00000014683 0.651893677 0 1.303787354 NA 0.8644712 ENSBTAG00000039491 0.651893677 0 1.303787354 NA 0.8644712

PAGE 194

ENSBTAG00000019494 1327.687866 1154.261567 1501.114166 1.3004974 0.8645287 782738 5.298518059 3.280569485 7.316466632 2.230242848 0.8645337 ENSBTAG00000040473 15.4478951 18.45016736 12.44562285 0.674553385 0.8647413 785237 11.10537872 8.532337032 13.67842041 1.603127063 0.8647942 ENSBTAG00000033720 1.178773697 0.558247107 1.799300288 3.223125147 0.8647942 ENSBTAG00000034963 1.178773697 0.558247107 1.799300288 3.223125147 0.8647942 514172 687.4164188 814.8798182 559.9530193 0.68716025 0.8648015 ENSBTAG00000006806 37.44704514 43.04639701 31.84769327 0.739845736 0.8648015 ENSBTAG00000011788 8.176078422 6.379839816 9.972317028 1.56309834 0.8648547 ENSBTAG00000009012 17.81995027 21.5884734 14.05142713 0.650876367 0.8649633 540516 40.83415011 46.0343917 35.63390852 0.774071454 0.8650767 ENSBTAG00000000146 31.98847127 35.33416524 28.64277729 0.810625554 0.8650767 ENSBTAG00000009855 32.54367103 26.17023082 38.91711125 1.487075583 0.8650767 515939 11.02884346 8.728541011 13.32914591 1.527076048 0.8650767 100138572 1.194199807 0.589099325 1.799300288 3.054324136 0.8650767 783838 1.191902511 0.300338691 2.083466332 6.937056053 0.8650767 ENSBTAG00000009769 1.191902511 0.300338691 2.083466332 6.937056053 0.8650767 ENSBTAG00000033267 139.0963091 161.0421365 117.1504817 0.727452357 0.8653086 ENSBTAG00000018904 25.67433178 26.93730253 24.41136104 0.906228863 0.8655989 100140626 1.206709291 0.300338691 2.113079891 7.0356566 0.8655989 534753 1.206709291 0.300338691 2.113079891 7.0356566 0.8655989 616408 1.206709291 0.300338691 2.113079891 7.0356566 0.8655989 ENSBTAG00000006059 3118.818598 3518.184344 2719.452852 0.77297054 0.865695 507092 1.211947255 0.589099325 1.834795184 3.114576957 0.865695 ENSBTAG00000027719 1.211947255 0.589099325 1.834795184 3.114576957 0.865695 100298891 13.60170183 17.06030473 10.14309893 0.594543831 0.8657616 788406 19.42555872 23.27867473 15.57244271 0.668957443 0.8657616 ENSBTAG00000019066 26.61378872 31.30677299 21.92080446 0.700193676 0.8657616 ENSBTAG00000031252 25.21075298 29.56595789 20.85554806 0.705390576 0.8657616 ENSBTAG00000008674 131.400203 150.9340521 111.866354 0.741160476 0.8657616 ENSBTAG00000007020 980.8190404 1122.444109 839.1939721 0.747648783 0.8657616 532808 56.72572099 64.68797176 48.76347021 0.753825926 0.8657616 ENSBTAG00000004804 96.59832113 110.1095528 83.08708942 0.754585658 0.8657616 ENSBTAG00000020355 5149.055466 5861.493647 4436.617285 0.756908998 0.8657616 540232 363.8331301 411.4085355 316.2577247 0.768719405 0.8657616 ENSBTAG00000011589 251.2832158 283.9476159 218.6188157 0.769926576 0.8657616 ENSBTAG00000015101 886.1701401 990.3831238 781.9571564 0.789550163 0.8657616 ENSBTAG00000006639 1321.47335 1459.912623 1183.034078 0.810345811 0.8657616 ENSBTAG00000007728 69.54428498 74.51533057 64.57323939 0.866576567 0.8657616 ENSBTAG00000007176 170.8251626 152.4326178 189.2177074 1.24132033 0.8657616 ENSBTAG00000004951 56.14464449 50.00174075 62.28754824 1.245707595 0.8657616 ENSBTAG00000005082 302.8834512 263.8441343 341.922768 1.295927116 0.8657616 ENSBTAG00000005807 615.2712491 535.1625398 695.3799583 1.299380855 0.8657616 ENSBTAG00000020777 331.7382396 279.5886175 383.8878617 1.373045388 0.8657616 ENSBTAG00000006740 49.56797905 40.17036872 58.96558939 1.467887681 0.8657616 100336833 9.582910712 7.238425613 11.92739581 1.647788683 0.8657616 ENSBTAG00000012023 10.15046748 7.323286163 12.9776488 1.77210729 0.8657616 ENSBTAG00000009365 4.209208963 2.895370245 5.523047681 1.907544533 0.8657616 ENSBTAG00000001333 3.399571044 1.802032144 4.997109944 2.773041514 0.8657616 ENSBTAG00000006233 1.241560814 0.589099325 1.894022303 3.215115383 0.8657616 533820 1.274115042 0.589099325 1.959130758 3.325637416 0.8657616 ENSBTAG00000008647 1.229075373 0.558247107 1.89990364 3.403338086 0.8657616

PAGE 195

ENSBTAG00000022514 1.240941484 0.558247107 1.923635862 3.445850124 0.8657616 100336373 1.258688932 0.558247107 1.959130758 3.509432892 0.8657616 ENSBTAG00000010107 1.258688932 0.558247107 1.959130758 3.509432892 0.8657616 ENSBTAG00000043602 1.258688932 0.558247107 1.959130758 3.509432892 0.8657616 519626 1.224456739 0.300338691 2.148574788 7.153839496 0.8657616 ENSBTAG00000014336 1.239263519 0.300338691 2.178188347 7.252440044 0.8657616 ENSBTAG00000022477 1.239263519 0.300338691 2.178188347 7.252440044 0.8657616 100298873 0.663759788 0 1.327519576 NA 0.8657616 537192 0.663759788 0 1.327519576 NA 0.8657616 100313100 0.666700456 0 1.333400913 NA 0.8657616 ENSBTAG00000003169 0.666700456 0 1.333400913 NA 0.8657616 ENSBTAG00000003686 0.666700456 0 1.333400913 NA 0.8657616 ENSBTAG00000004490 0.666700456 0 1.333400913 NA 0.8657616 ENSBTAG00000012270 0.666700456 0 1.333400913 NA 0.8657616 ENSBTAG00000040237 0.666700456 0 1.333400913 NA 0.8657616 ENSBTAG00000042979 0.666700456 0 1.333400913 NA 0.8657616 ENSBTAG00000043058 0.666700456 0 1.333400913 NA 0.8657616 ENSBTAG00000043516 0.666700456 0 1.333400913 NA 0.8657616 ENSBTAG00000013836 13.69108378 16.74457382 10.63759374 0.635286025 0.8659733 504548 48.54124653 55.89814591 41.18434715 0.736774833 0.8659733 ENSBTAG00000006432 47.78793706 54.52762523 41.0482489 0.752797297 0.8659733 ENSBTAG00000009441 1264.608888 1428.828804 1100.388973 0.770133532 0.8659733 281702 1775.802492 1928.797946 1622.807039 0.841356681 0.8659733 ENSBTAG00000024815 199.0491182 176.8564904 221.2417461 1.250967638 0.8659733 767893 114.5126157 100.459679 128.5655523 1.279772676 0.8659733 ENSBTAG00000020523 12.33467124 10.11063975 14.55870274 1.439938827 0.8659733 512948 1.303109271 0.558247107 2.047971436 3.668575101 0.8659733 539655 1.286624526 0.300338691 2.272910362 7.567824034 0.8659733 ENSBTAG00000040158 1.286624526 0.300338691 2.272910362 7.567824034 0.8659733 ENSBTAG00000030471 1.301431306 0.300338691 2.302523921 7.666424581 0.8659733 ENSBTAG00000037953 1.301431306 0.300338691 2.302523921 7.666424581 0.8659733 ENSBTAG00000006304 5.130997201 6.360565654 3.901428749 0.61337764 0.866185 ENSBTAG00000023600 14.7086119 18.188377 11.22884681 0.61736387 0.866185 506947 13.64792183 15.48588396 11.80995969 0.762627417 0.866185 ENSBTAG00000011248 166.6560922 187.4613208 145.8508636 0.778031772 0.866185 ENSBTAG00000013510 38.72570347 43.39692987 34.05447706 0.784720881 0.866185 ENSBTAG00000021480 14.25843219 15.29744388 13.21942049 0.864158783 0.866185 ENSBTAG00000020608 111.1059148 96.13361363 126.0782159 1.311489407 0.866185 ENSBTAG00000010249 22.87695349 26.38570896 19.36819802 0.734041221 0.8664342 ENSBTAG00000013340 4.653160008 5.063327467 4.24299255 0.837985016 0.8664342 ENSBTAG00000022004 835.6570871 699.9080993 971.406075 1.387905178 0.8664342 ENSBTAG00000000265 19.93022424 16.25960921 23.60083926 1.451501015 0.8664342 529222 3.700321204 5.116780616 2.283861792 0.446347413 0.8666556 ENSBTAG00000020933 25.48142836 19.28615223 31.6767045 1.642458492 0.8666556 781486 40.19203909 31.12997876 49.25409943 1.582207936 0.8666968 ENSBTAG00000013970 1.368217727 0.558247107 2.178188347 3.901835443 0.8669643 ENSBTAG00000006828 5.688128072 6.992095253 4.384160891 0.627016757 0.8670531 ENSBTAG00000021187 133.7573047 152.4401149 115.0744944 0.754883283 0.8670531 ENSBTAG00000001888 428.4978878 372.7953857 484.20039 1.298836865 0.8670531 100313036 1.383024506 0.558247107 2.207801906 3.954882846 0.8670531 ENSBTAG00000043793 2.183061541 0.858585797 3.507537285 4.085249599 0.8670531 ENSBTAG00000005540 24.68563107 29.9781274 19.39313473 0.646909478 0.867184

PAGE 196

ENSBTAG00000011626 6636.459224 6186.45419 7086.464258 1.145480762 0.867184 ENSBTAG00000034936 194.804769 163.9407529 225.6687851 1.376526465 0.867184 ENSBTAG00000010602 299.1098971 325.542802 272.6769923 0.837607192 0.8674013 ENSBTAG00000016169 8.712944587 11.33126867 6.094620501 0.537858617 0.8675413 ENSBTAG00000034817 5.021468407 6.360565654 3.68237116 0.578937686 0.8675413 ENSBTAG00000001893 8.731642912 10.55754342 6.905742401 0.654105044 0.8675413 ENSBTAG00000026523 23.57721859 27.63330815 19.52112903 0.706434746 0.8675413 ENSBTAG00000023032 54.38242553 63.43691021 45.32794084 0.71453576 0.8675413 ENSBTAG00000019211 4736.610883 5413.754165 4059.467602 0.749843358 0.8675413 ENSBTAG00000031567 997.0785787 1106.85014 887.307017 0.801650544 0.8675413 ENSBTAG00000002655 1909.426629 2092.250199 1726.60306 0.825237374 0.8675413 ENSBTAG00000033348 154.2993408 167.9067247 140.6919569 0.837917345 0.8675413 ENSBTAG00000045275 99.43435311 105.2277279 93.64097831 0.889888817 0.8675413 ENSBTAG00000008131 1384.051973 1274.716071 1493.387875 1.171545499 0.8675413 ENSBTAG00000005744 387.5664791 346.8248169 428.3081413 1.234940871 0.8675413 ENSBTAG00000005920 74.40039305 66.39682428 82.40396182 1.241082879 0.8675413 ENSBTAG00000016224 3543.347413 3092.856401 3993.838425 1.291310655 0.8675413 ENSBTAG00000006533 1553.171807 1331.46531 1774.878304 1.333026321 0.8675413 ENSBTAG00000021656 42.55001068 31.77308641 53.32693495 1.678368109 0.8675413 ENSBTAG00000035777 3.960537815 2.895370245 5.025705386 1.735772962 0.8675413 ENSBTAG00000005580 2.046835812 1.178198651 2.915472974 2.474517326 0.8675413 ENSBTAG00000042086 2.045597153 1.116494213 2.974700092 2.664321997 0.8675413 789268 2.073532747 0.858585797 3.288479696 3.830111919 0.8675413 ENSBTAG00000010517 1.49317263 0.589099325 2.397245936 4.069340827 0.8675413 782595 1.445192293 0.558247107 2.33213748 4.177607823 0.8675413 100313277 0.681507236 0 1.363014472 NA 0.8675413 506636 0.681507236 0 1.363014472 NA 0.8675413 ENSBTAG00000006658 0.681507236 0 1.363014472 NA 0.8675413 ENSBTAG00000033839 0.681507236 0 1.363014472 NA 0.8675413 ENSBTAG00000042285 0.681507236 0 1.363014472 NA 0.8675413 521092 4.982593536 6.164361675 3.800825397 0.616580531 0.8675905 ENSBTAG00000040340 3.589270424 5.013133293 2.165407555 0.431946934 0.867702 ENSBTAG00000039982 3.588031765 4.951428856 2.224634673 0.449291455 0.867702 280817 606.1581529 657.7623073 554.5539986 0.843091786 0.867702 ENSBTAG00000012071 25.25378415 19.49005231 31.01751599 1.591453707 0.867702 538977 3.904998176 2.606609611 5.203386741 1.996227866 0.867702 541114 1.999474805 1.178198651 2.820750959 2.394121703 0.867702 ENSBTAG00000038309 2.013662255 1.147346432 2.879978078 2.510120742 0.867702 515204 19.72513513 24.1719269 15.27834336 0.632069732 0.867891 ENSBTAG00000015108 12.92189924 15.64735377 10.19644471 0.651640198 0.867891 536093 4.948361343 5.906453258 3.990269427 0.675577923 0.867891 510212 3.318444685 3.881246867 2.755642504 0.70998898 0.867891 ENSBTAG00000002579 375.4890383 411.2813039 339.6967726 0.825947519 0.867891 ENSBTAG00000003052 1.640911307 2.102370835 1.17945178 0.561010341 0.8680297 ENSBTAG00000031020 4.87708809 6.071805019 3.68237116 0.606470588 0.8680297 ENSBTAG00000042198 6.573445513 8.120167523 5.026723503 0.619041847 0.8680297 ENSBTAG00000002757 1.717885874 2.102370835 1.333400913 0.634236782 0.8680297 782402 8.54792424 10.40328233 6.692566149 0.643312941 0.8680297 ENSBTAG00000007036 64.75889558 77.9435033 51.57428786 0.66168809 0.8680297 ENSBTAG00000018572 178.7110298 204.5080979 152.9139617 0.747715926 0.8680297 ENSBTAG00000020460 37.56414527 42.78751382 32.34077672 0.75584613 0.8680297 ENSBTAG00000010217 372.1994124 422.3188788 322.079946 0.762646337 0.8680297

PAGE 197

ENSBTAG00000008617 1739.125147 1968.928334 1509.32196 0.766570288 0.8680297 ENSBTAG00000024983 1608.971364 1765.329987 1452.612741 0.822856209 0.8680297 ENSBTAG00000012451 970.8428041 1062.912038 878.7735698 0.826760389 0.8680297 ENSBTAG00000012816 752.1745955 666.1533976 838.1957934 1.258262431 0.8680297 ENSBTAG00000011829 464.2546504 409.7303868 518.7789139 1.266147034 0.8680297 ENSBTAG00000015607 110.4474891 97.08031895 123.8146593 1.27538373 0.8680297 ENSBTAG00000014889 468.4053892 408.6441218 528.1666566 1.292485633 0.8680297 ENSBTAG00000027814 76.50464296 66.46678 86.54250591 1.3020415 0.8680297 540852 29.34866512 24.0100375 34.68729274 1.444699649 0.8680297 505438 55.91341946 45.18738396 66.63945496 1.474735847 0.8680297 ENSBTAG00000015052 1.767931775 1.147346432 2.388517119 2.081775 0.8680297 ENSBTAG00000001804 1.796926005 1.116494213 2.477357796 2.218872043 0.8680297 ENSBTAG00000004399 1.921880909 1.147346432 2.696415385 2.350131843 0.8680297 788178 1.804792812 0.889438016 2.720147607 3.058276753 0.8680297 505709 1.82254026 0.889438016 2.755642504 3.098183858 0.8680297 444876 1.840287708 0.889438016 2.7911374 3.138090963 0.8680297 ENSBTAG00000016294 1.840287708 0.889438016 2.7911374 3.138090963 0.8680297 ENSBTAG00000040330 1.855094488 0.889438016 2.820750959 3.171385649 0.8680297 505399 1.902455495 0.889438016 2.915472974 3.277882125 0.8680297 515276 1.854475158 0.858585797 2.850364518 3.319836558 0.8680297 ENSBTAG00000039499 1.884088717 0.858585797 2.909591637 3.388818736 0.8680297 785997 1.849856524 0.600677381 3.099035666 5.159234828 0.8680297 ENSBTAG00000021098 1.914964979 0.600677381 3.229252577 5.376018272 0.8680297 ENSBTAG00000020956 24.19921793 28.66494182 19.73349404 0.688419121 0.8680718 ENSBTAG00000014934 18.39180904 15.18166332 21.60195476 1.422897762 0.8681445 ENSBTAG00000013118 205.7310751 226.7961243 184.6660259 0.814238014 0.8681587 785883 3.489773795 4.600963784 2.378583806 0.51697512 0.8682386 507496 5.453032363 4.042716677 6.863348049 1.697706913 0.8688273 ENSBTAG00000003720 14.29852997 16.41775225 12.17930769 0.741837707 0.8688771 ENSBTAG00000017121 12.6907118 14.49231123 10.88911237 0.751371689 0.8688771 407131 0.696314016 0 1.392628031 NA 0.8688771 538131 0.696314016 0 1.392628031 NA 0.8688771 789493 0.696314016 0 1.392628031 NA 0.8688771 ENSBTAG00000040561 3.460160236 4.600963784 2.319356688 0.504102357 0.8689142 ENSBTAG00000005644 91.48822556 107.8276968 75.14875429 0.696933687 0.8689142 100336310 434.4706816 471.2949402 397.646423 0.843731577 0.8689142 ENSBTAG00000008347 996.4684201 886.679034 1106.257806 1.247641778 0.8702019 ENSBTAG00000014249 83.99609926 73.50851425 94.48368427 1.285343409 0.8702019 614936 26.25737122 30.82901709 21.68572534 0.703419291 0.8704779 ENSBTAG00000012014 70.71143493 81.11716648 60.30570338 0.743439471 0.8705905 ENSBTAG00000007799 1585.847339 1810.057023 1361.637655 0.752262298 0.8705905 ENSBTAG00000000833 167.4641031 141.0399331 193.8882732 1.374704802 0.8705905 536682 13.86980224 16.32131365 11.41829084 0.699593862 0.8706258 ENSBTAG00000008005 18.89769952 15.86283191 21.93256713 1.382638816 0.8706497 616238 4.749835891 5.752192166 3.747479616 0.651487208 0.8706522 ENSBTAG00000003305 18.04116713 21.76540322 14.31693105 0.657783865 0.8706522 100336443 8.985449929 10.81933379 7.151566069 0.660998746 0.8706522 781009 12.8161599 14.84665825 10.78566154 0.726470655 0.8706522 ENSBTAG00000023452 28.24266368 32.69282146 23.79250591 0.727759332 0.8706522 ENSBTAG00000013224 759.3331758 851.6526066 667.013745 0.783199323 0.8706522 ENSBTAG00000009668 111.4161002 121.5455792 101.2866212 0.833322132 0.8706522 ENSBTAG00000019497 1262.559775 1366.888553 1158.230998 0.847348524 0.8706522

PAGE 198

ENSBTAG00000013371 13238.4534 14299.68639 12177.22042 0.851572551 0.8706522 ENSBTAG00000012797 546.0192639 497.1738678 594.86466 1.19649221 0.8706522 ENSBTAG00000021754 245.8560588 221.8358889 269.8762286 1.216558015 0.8706522 ENSBTAG00000033685 62.17663004 55.64737842 68.70588166 1.234665201 0.8706522 ENSBTAG00000025221 847.7542928 755.0826462 940.4259393 1.245460936 0.8706522 ENSBTAG00000019468 5.282574441 4.104421114 6.460727768 1.574089887 0.8706522 ENSBTAG00000012738 3.676083989 2.05994056 5.292227419 2.569116566 0.8706522 404182 12.47348816 14.90448074 10.04249558 0.673790369 0.8709689 ENSBTAG00000020351 28.71435533 33.79378788 23.63492279 0.699386611 0.8710573 ENSBTAG00000015457 93.79584479 107.8109102 79.78077933 0.740006546 0.8714705 ENSBTAG00000032656 28.10247573 32.67347951 23.53147196 0.72020098 0.8716299 ENSBTAG00000014030 210.1236478 235.0229819 185.2243137 0.788111495 0.8719655 781071 5.21625137 3.723103824 6.709398916 1.802098258 0.8719655 ENSBTAG00000010420 0.711120795 0 1.422241591 NA 0.8720114 ENSBTAG00000038907 0.711120795 0 1.422241591 NA 0.8720114 100126273 21.6620449 25.90407112 17.42001869 0.672481889 0.8721904 ENSBTAG00000005446 118.6369612 130.5942882 106.6796341 0.816878254 0.8721951 ENSBTAG00000005247 49.88339134 38.22281416 61.54396853 1.610137032 0.8722938 ENSBTAG00000012908 1242.404783 1127.941898 1356.867668 1.202958832 0.8723365 ENSBTAG00000017053 26.30498837 20.3491255 32.26085124 1.585367943 0.8723365 100336416 11.95282311 14.65378104 9.251865168 0.631363683 0.8723574 ENSBTAG00000034812 100.1576936 110.471596 89.84379114 0.813275036 0.8723574 ENSBTAG00000009596 65.98428906 71.72416283 60.24441528 0.839945883 0.8723574 ENSBTAG00000039599 127.699273 107.9503343 147.4482117 1.365889347 0.8723574 100313334 0.714061464 0 1.428122928 NA 0.8723574 ENSBTAG00000022384 0.714061464 0 1.428122928 NA 0.8723574 ENSBTAG00000042129 0.714061464 0 1.428122928 NA 0.8723574 ENSBTAG00000014793 107.3639286 123.8275837 90.90027348 0.734087437 0.8724702 ENSBTAG00000025335 68.1314641 58.70435406 77.55857415 1.321172431 0.8724702 ENSBTAG00000011527 17.55534476 12.9641349 22.14655463 1.708294059 0.8724702 ENSBTAG00000014584 10.89827378 12.1055491 9.690998463 0.800541833 0.8724979 100337001 15.46658735 18.03848524 12.89468946 0.714843252 0.8725461 513039 23.45981751 19.82505738 27.09457764 1.366683441 0.8725461 537127 17.52877531 12.9641349 22.09341572 1.704195142 0.8725461 ENSBTAG00000014392 801.5517979 724.0201228 879.083473 1.214169945 0.8726497 ENSBTAG00000015080 21.43795342 25.13034587 17.74556097 0.706140738 0.8728804 ENSBTAG00000006324 37.87170976 42.95723492 32.78618461 0.763228468 0.8730439 100337252 5.102699228 3.81566048 6.389737976 1.674608632 0.8730831 539467 3.188503676 4.31220315 2.064804203 0.478828138 0.8732384 ENSBTAG00000013027 3.248993498 4.054294733 2.443692262 0.602741641 0.8732384 782038 4.557011887 5.555988187 3.558035586 0.640396536 0.8732384 ENSBTAG00000017520 9.710373956 11.82011524 7.600632676 0.64302526 0.8732384 100126054 94.48181988 113.3508154 75.61282431 0.667069081 0.8732384 ENSBTAG00000007175 24.83368698 29.573654 20.09371997 0.679446644 0.8732384 789345 8.143933497 9.660409301 6.627457693 0.686043157 0.8732384 ENSBTAG00000005679 8.708555406 10.24181252 7.175298291 0.700588717 0.8732384 ENSBTAG00000003298 118.3235033 137.600462 99.04654464 0.719812588 0.8732384 ENSBTAG00000038866 9.920191776 11.52802783 8.31235572 0.721056181 0.8732384 ENSBTAG00000038979 118.0080461 135.4008811 100.615211 0.743091258 0.8732384 ENSBTAG00000006509 25.84286612 29.64749167 22.03824057 0.7433425 0.8732384 ENSBTAG00000017488 30.83278372 35.21457053 26.45099691 0.751137853 0.8732384 ENSBTAG00000036331 6.202033042 7.05768164 5.346384444 0.757527006 0.8732384

PAGE 199

ENSBTAG00000020561 150.8382944 170.1728495 131.5037394 0.772765689 0.8732384 ENSBTAG00000031919 178.8522282 201.750016 155.9544404 0.773008317 0.8732384 100300326 15.3657501 17.33034638 13.40115382 0.773276744 0.8732384 ENSBTAG00000000505 1888.997761 2122.239023 1655.756499 0.780193221 0.8732384 ENSBTAG00000011116 129.5832581 145.0444532 114.122063 0.786807496 0.8732384 ENSBTAG00000031814 801.1955935 869.9473262 732.4438609 0.84194047 0.8732384 100335332 7655.01964 8275.299825 7034.739454 0.850088771 0.8732384 ENSBTAG00000010220 208.2871235 190.6085646 225.9656824 1.185495955 0.8732384 788127 1741.784113 1584.969672 1898.598555 1.197876898 0.8732384 100141266 9180.98367 8089.562125 10272.40521 1.269834517 0.8732384 100299516 275.560051 242.7775761 308.3425259 1.270061802 0.8732384 ENSBTAG00000017270 673.8596929 591.149865 756.5695208 1.279826937 0.8732384 786788 40.25491943 34.77480777 45.73503109 1.315177107 0.8732384 532359 208.7389754 173.6402657 243.8376852 1.404269247 0.8732384 ENSBTAG00000006506 123.2730691 101.3787954 145.1673427 1.431930041 0.8732384 ENSBTAG00000000799 73.83469761 60.0764047 87.59299051 1.458026507 0.8732384 ENSBTAG00000014402 5.029748009 3.723103824 6.336392194 1.701911226 0.8732384 ENSBTAG00000013550 15.63366805 10.95050656 20.31682953 1.855332392 0.8732384 100337207 0.728868243 0 1.457736487 NA 0.8732384 100337449 0.728868243 0 1.457736487 NA 0.8732384 529969 0.728868243 0 1.457736487 NA 0.8732384 534200 0.728868243 0 1.457736487 NA 0.8732384 618014 0.728868243 0 1.457736487 NA 0.8732384 783287 0.728868243 0 1.457736487 NA 0.8732384 787156 0.728868243 0 1.457736487 NA 0.8732384 ENSBTAG00000015604 0.728868243 0 1.457736487 NA 0.8732384 ENSBTAG00000030179 0.728868243 0 1.457736487 NA 0.8732384 ENSBTAG00000037932 0.728868243 0 1.457736487 NA 0.8732384 ENSBTAG00000018053 1774.250058 1655.030167 1893.469949 1.14406975 0.8733127 ENSBTAG00000014955 3.139464703 4.054294733 2.224634673 0.548710644 0.873902 ENSBTAG00000011445 14.94017289 18.26165949 11.6186863 0.636233871 0.873902 ENSBTAG00000021166 7.92193524 9.660409301 6.183461179 0.640082732 0.873902 ENSBTAG00000009667 10.21576875 12.40151845 8.030019037 0.64750289 0.873902 617871 3.134846069 3.796386317 2.473305821 0.651489499 0.873902 ENSBTAG00000006176 15.02741354 17.81142904 12.24339803 0.68738999 0.873902 ENSBTAG00000032433 53.75043407 61.52304725 45.9778209 0.747326782 0.873902 ENSBTAG00000017550 228.6800289 259.8160342 197.5440237 0.760322681 0.873902 ENSBTAG00000010898 1016.956337 1147.262983 886.6496904 0.772839099 0.873902 ENSBTAG00000001185 2343.95948 2610.302834 2077.616126 0.795929154 0.873902 ENSBTAG00000004908 8.604620166 9.406382835 7.802857498 0.829527953 0.873902 100336233 38.09939314 40.97113203 35.22765425 0.859816473 0.873902 ENSBTAG00000001580 541.6479358 489.2353512 594.0605203 1.214263276 0.873902 ENSBTAG00000009518 268.2800375 239.0154366 297.5446384 1.244876242 0.873902 ENSBTAG00000002000 1984.897533 1735.63011 2234.164957 1.287235653 0.873902 ENSBTAG00000040242 126.8951513 110.2113356 143.5789671 1.302760432 0.873902 ENSBTAG00000017496 125.8441089 104.9289192 146.7592986 1.398654439 0.873902 ENSBTAG00000009020 13.27638777 10.77690351 15.77587203 1.463859448 0.873902 ENSBTAG00000010129 25.58382546 30.09772212 21.06992881 0.700050613 0.873916 538427 9541.385058 10313.35806 8769.41206 0.850296481 0.873916 ENSBTAG00000003083 11.93582616 9.668105408 14.2035469 1.469113782 0.873916 ENSBTAG00000009928 19.58159149 16.85640464 22.30677835 1.323341414 0.8741388 100299171 41.4560999 47.19331619 35.7188836 0.756863185 0.8741902

PAGE 200

ENSBTAG00000009400 55.66158385 65.6341897 45.68897801 0.696115519 0.87428 ENSBTAG00000005066 322.0997288 348.279431 295.9200266 0.849662657 0.8743333 527129 990.8682277 1123.136775 858.5996807 0.764465825 0.8744673 100337389 3.10585184 3.827238536 2.384465144 0.623024962 0.8745115 617347 3.102911171 3.827238536 2.378583806 0.621488257 0.8745664 ENSBTAG00000008887 24.24721609 28.94551896 19.54891323 0.675369243 0.8748012 ENSBTAG00000006014 341.6610279 296.6564827 386.665573 1.303411843 0.8748131 100335959 1333.308978 1432.431614 1234.186342 0.861602278 0.8748194 ENSBTAG00000032001 10.07987456 11.91655384 8.243195289 0.691743217 0.8749633 ENSBTAG00000012312 3.085187767 3.507625683 2.662749851 0.759131701 0.8749633 ENSBTAG00000013412 391.4276998 347.4381149 435.4172848 1.253222563 0.8749633 ENSBTAG00000015090 313.6943098 258.3958831 368.9927364 1.428013218 0.8749633 100337301 4.003533535 2.883792189 5.12327488 1.776575614 0.8749633 ENSBTAG00000000955 64.40957257 58.07566384 70.74348129 1.21812609 0.8749719 100337183 3.072678282 3.796386317 2.348970247 0.618738466 0.8749886 ENSBTAG00000038103 114.1795148 122.2152375 106.143792 0.86849884 0.8749886 ENSBTAG00000015267 12.83097272 10.40328233 15.25866311 1.466716237 0.8749886 100336520 19.51333854 22.41676216 16.60991491 0.74095959 0.8751359 529006 32.59585064 38.43766933 26.75403195 0.696036789 0.8753 100336617 879.4832367 915.2385994 843.7278739 0.921866576 0.8753 506981 3.968062682 2.564179336 5.371946028 2.094996224 0.8753 ENSBTAG00000020342 15.7936853 18.33833654 13.24903405 0.722477419 0.8753179 ENSBTAG00000031747 2013.658488 2280.828413 1746.488564 0.765725538 0.8753531 100124521 524.7471118 584.4861675 465.008056 0.795584364 0.8753531 ENSBTAG00000018115 2558.323921 2327.184545 2789.463297 1.198642928 0.8753531 ENSBTAG00000008998 22.89356214 25.71611842 20.07100587 0.78048349 0.8754904 ENSBTAG00000030198 3.941985077 2.914644408 4.969325747 1.704950948 0.8755641 ENSBTAG00000044138 22.86072446 25.88147018 19.83997873 0.766570778 0.8756493 ENSBTAG00000035654 20.09650373 16.05182717 24.14118028 1.503952168 0.8756493 541016 116.5679104 136.7394564 96.39636446 0.704963783 0.8757724 ENSBTAG00000007966 19.93476091 23.84801251 16.02150932 0.671817382 0.8757751 513785 4.753033509 2.980230795 6.525836224 2.189708339 0.8757751 ENSBTAG00000004570 547.5485346 596.6337616 498.4633075 0.835459438 0.8758357 100138149 0.150169345 0.300338691 0 0 0.8759734 100294933 0.150169345 0.300338691 0 0 0.8759734 100295719 0.150169345 0.300338691 0 0 0.8759734 100295842 0.150169345 0.300338691 0 0 0.8759734 100295891 0.150169345 0.300338691 0 0 0.8759734 100299276 0.150169345 0.300338691 0 0 0.8759734 100300593 0.150169345 0.300338691 0 0 0.8759734 100301346 0.150169345 0.300338691 0 0 0.8759734 100312992 0.150169345 0.300338691 0 0 0.8759734 100313000 0.150169345 0.300338691 0 0 0.8759734 100313010 0.150169345 0.300338691 0 0 0.8759734 100313012 0.150169345 0.300338691 0 0 0.8759734 100313029 0.150169345 0.300338691 0 0 0.8759734 100313068 0.150169345 0.300338691 0 0 0.8759734 100313080 0.150169345 0.300338691 0 0 0.8759734 100313089 0.150169345 0.300338691 0 0 0.8759734 100313095 0.150169345 0.300338691 0 0 0.8759734 100313120 0.150169345 0.300338691 0 0 0.8759734 100313135 0.150169345 0.300338691 0 0 0.8759734

PAGE 201

100313153 0.150169345 0.300338691 0 0 0.8759734 100313170 0.150169345 0.300338691 0 0 0.8759734 100313176 0.150169345 0.300338691 0 0 0.8759734 100313241 0.150169345 0.300338691 0 0 0.8759734 100313245 0.150169345 0.300338691 0 0 0.8759734 100313254 0.150169345 0.300338691 0 0 0.8759734 100313261 0.150169345 0.300338691 0 0 0.8759734 100313289 0.150169345 0.300338691 0 0 0.8759734 100313307 0.150169345 0.300338691 0 0 0.8759734 100313315 0.150169345 0.300338691 0 0 0.8759734 100313325 0.150169345 0.300338691 0 0 0.8759734 100313345 0.150169345 0.300338691 0 0 0.8759734 100313353 0.150169345 0.300338691 0 0 0.8759734 100313372 0.150169345 0.300338691 0 0 0.8759734 100313394 0.150169345 0.300338691 0 0 0.8759734 100313453 0.150169345 0.300338691 0 0 0.8759734 100313480 0.150169345 0.300338691 0 0 0.8759734 100335294 0.150169345 0.300338691 0 0 0.8759734 100335356 0.150169345 0.300338691 0 0 0.8759734 100335366 0.150169345 0.300338691 0 0 0.8759734 100335400 0.150169345 0.300338691 0 0 0.8759734 100335878 0.150169345 0.300338691 0 0 0.8759734 100335948 0.150169345 0.300338691 0 0 0.8759734 100335972 0.150169345 0.300338691 0 0 0.8759734 100335973 0.150169345 0.300338691 0 0 0.8759734 100336180 0.150169345 0.300338691 0 0 0.8759734 100336189 0.150169345 0.300338691 0 0 0.8759734 100336213 0.150169345 0.300338691 0 0 0.8759734 100336527 0.150169345 0.300338691 0 0 0.8759734 100336690 0.150169345 0.300338691 0 0 0.8759734 100336849 0.150169345 0.300338691 0 0 0.8759734 100337008 0.150169345 0.300338691 0 0 0.8759734 100337066 0.150169345 0.300338691 0 0 0.8759734 100337160 0.150169345 0.300338691 0 0 0.8759734 100337223 0.150169345 0.300338691 0 0 0.8759734 100337335 0.150169345 0.300338691 0 0 0.8759734 100337499 0.150169345 0.300338691 0 0 0.8759734 281686 0.150169345 0.300338691 0 0 0.8759734 404063 0.150169345 0.300338691 0 0 0.8759734 504250 0.150169345 0.300338691 0 0 0.8759734 504483 0.150169345 0.300338691 0 0 0.8759734 505075 0.150169345 0.300338691 0 0 0.8759734 505298 0.150169345 0.300338691 0 0 0.8759734 505890 0.150169345 0.300338691 0 0 0.8759734 506831 0.150169345 0.300338691 0 0 0.8759734 506868 0.150169345 0.300338691 0 0 0.8759734 507133 0.150169345 0.300338691 0 0 0.8759734 510471 0.150169345 0.300338691 0 0 0.8759734 510984 0.150169345 0.300338691 0 0 0.8759734 511079 0.150169345 0.300338691 0 0 0.8759734 512168 0.150169345 0.300338691 0 0 0.8759734 512272 0.150169345 0.300338691 0 0 0.8759734

PAGE 202

512522 0.150169345 0.300338691 0 0 0.8759734 513994 0.150169345 0.300338691 0 0 0.8759734 514702 0.150169345 0.300338691 0 0 0.8759734 516106 0.150169345 0.300338691 0 0 0.8759734 517894 0.150169345 0.300338691 0 0 0.8759734 517953 0.150169345 0.300338691 0 0 0.8759734 519437 0.150169345 0.300338691 0 0 0.8759734 521326 0.150169345 0.300338691 0 0 0.8759734 522053 0.150169345 0.300338691 0 0 0.8759734 522232 0.150169345 0.300338691 0 0 0.8759734 522574 0.150169345 0.300338691 0 0 0.8759734 523324 0.150169345 0.300338691 0 0 0.8759734 523325 0.150169345 0.300338691 0 0 0.8759734 524352 0.150169345 0.300338691 0 0 0.8759734 525990 0.150169345 0.300338691 0 0 0.8759734 527077 0.150169345 0.300338691 0 0 0.8759734 527119 0.150169345 0.300338691 0 0 0.8759734 527415 0.150169345 0.300338691 0 0 0.8759734 529511 0.150169345 0.300338691 0 0 0.8759734 530179 0.150169345 0.300338691 0 0 0.8759734 530675 0.150169345 0.300338691 0 0 0.8759734 531174 0.150169345 0.300338691 0 0 0.8759734 531306 0.150169345 0.300338691 0 0 0.8759734 531522 0.150169345 0.300338691 0 0 0.8759734 531863 0.150169345 0.300338691 0 0 0.8759734 533149 0.150169345 0.300338691 0 0 0.8759734 533818 0.150169345 0.300338691 0 0 0.8759734 534129 0.150169345 0.300338691 0 0 0.8759734 535982 0.150169345 0.300338691 0 0 0.8759734 538107 0.150169345 0.300338691 0 0 0.8759734 538839 0.150169345 0.300338691 0 0 0.8759734 539229 0.150169345 0.300338691 0 0 0.8759734 539913 0.150169345 0.300338691 0 0 0.8759734 539960 0.150169345 0.300338691 0 0 0.8759734 540128 0.150169345 0.300338691 0 0 0.8759734 540209 0.150169345 0.300338691 0 0 0.8759734 540422 0.150169345 0.300338691 0 0 0.8759734 540552 0.150169345 0.300338691 0 0 0.8759734 540797 0.150169345 0.300338691 0 0 0.8759734 540845 0.150169345 0.300338691 0 0 0.8759734 614232 0.150169345 0.300338691 0 0 0.8759734 614455 0.150169345 0.300338691 0 0 0.8759734 616165 0.150169345 0.300338691 0 0 0.8759734 616514 0.150169345 0.300338691 0 0 0.8759734 616610 0.150169345 0.300338691 0 0 0.8759734 616701 0.150169345 0.300338691 0 0 0.8759734 617062 0.150169345 0.300338691 0 0 0.8759734 617264 0.150169345 0.300338691 0 0 0.8759734 617284 0.150169345 0.300338691 0 0 0.8759734 617982 0.150169345 0.300338691 0 0 0.8759734 618112 0.150169345 0.300338691 0 0 0.8759734 618314 0.150169345 0.300338691 0 0 0.8759734

PAGE 203

618568 0.150169345 0.300338691 0 0 0.8759734 618639 0.150169345 0.300338691 0 0 0.8759734 781337 0.150169345 0.300338691 0 0 0.8759734 781765 0.150169345 0.300338691 0 0 0.8759734 782107 0.150169345 0.300338691 0 0 0.8759734 782874 0.150169345 0.300338691 0 0 0.8759734 784092 0.150169345 0.300338691 0 0 0.8759734 784214 0.150169345 0.300338691 0 0 0.8759734 784340 0.150169345 0.300338691 0 0 0.8759734 784379 0.150169345 0.300338691 0 0 0.8759734 784517 0.150169345 0.300338691 0 0 0.8759734 784833 0.150169345 0.300338691 0 0 0.8759734 784849 0.150169345 0.300338691 0 0 0.8759734 784869 0.150169345 0.300338691 0 0 0.8759734 785024 0.150169345 0.300338691 0 0 0.8759734 785379 0.150169345 0.300338691 0 0 0.8759734 785436 0.150169345 0.300338691 0 0 0.8759734 785710 0.150169345 0.300338691 0 0 0.8759734 785714 0.150169345 0.300338691 0 0 0.8759734 786381 0.150169345 0.300338691 0 0 0.8759734 786803 0.150169345 0.300338691 0 0 0.8759734 786921 0.150169345 0.300338691 0 0 0.8759734 786948 0.150169345 0.300338691 0 0 0.8759734 787021 0.150169345 0.300338691 0 0 0.8759734 787304 0.150169345 0.300338691 0 0 0.8759734 787471 0.150169345 0.300338691 0 0 0.8759734 787480 0.150169345 0.300338691 0 0 0.8759734 787509 0.150169345 0.300338691 0 0 0.8759734 787988 0.150169345 0.300338691 0 0 0.8759734 788325 0.150169345 0.300338691 0 0 0.8759734 788654 0.150169345 0.300338691 0 0 0.8759734 788915 0.150169345 0.300338691 0 0 0.8759734 789016 0.150169345 0.300338691 0 0 0.8759734 789542 0.150169345 0.300338691 0 0 0.8759734 789841 0.150169345 0.300338691 0 0 0.8759734 790024 0.150169345 0.300338691 0 0 0.8759734 790415 0.150169345 0.300338691 0 0 0.8759734 790562 0.150169345 0.300338691 0 0 0.8759734 791004 0.150169345 0.300338691 0 0 0.8759734 791014 0.150169345 0.300338691 0 0 0.8759734 791052 0.150169345 0.300338691 0 0 0.8759734 791056 0.150169345 0.300338691 0 0 0.8759734 791062 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000000463 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000000658 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000000813 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000000924 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000000953 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000000963 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000000983 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000001214 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000001357 0.150169345 0.300338691 0 0 0.8759734

PAGE 204

ENSBTAG00000001414 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000001783 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000001816 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000001976 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000002148 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000002184 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000002247 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000002252 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000002442 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000002954 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000003184 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000003192 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000003376 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000003436 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000003739 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000003950 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000003992 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000004140 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000004487 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000004505 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000005045 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000005112 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000005154 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000005327 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000005603 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000005774 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000005951 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000006267 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000006440 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000006519 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000006605 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000006961 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000007125 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000007187 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000007297 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000007514 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000007550 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000007729 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000007917 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000008254 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000008645 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000008948 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000009000 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000009057 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000009089 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000009409 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000009447 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000009924 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000010233 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000010478 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000010858 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000010877 0.150169345 0.300338691 0 0 0.8759734

PAGE 205

ENSBTAG00000011098 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000011297 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000011657 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000012084 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000012172 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000012351 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000012384 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000012436 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000012512 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000012645 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000012848 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000012953 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000013079 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000013305 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000013383 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000013491 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000013702 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000013717 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000014454 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000014554 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000014555 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000015674 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000015772 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000015929 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000016017 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000016088 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000016090 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000016166 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000016204 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000016580 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000016594 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000016713 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000016749 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000017146 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000017284 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000017310 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000017456 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000017618 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000018270 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000018290 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000018497 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000018626 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000018805 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000018840 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000019152 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000019254 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000019283 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000019796 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000020007 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000020350 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000020510 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000020600 0.150169345 0.300338691 0 0 0.8759734

PAGE 206

ENSBTAG00000020622 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000020896 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000021030 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000021099 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000021106 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000021144 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000021233 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000021280 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000021493 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000021570 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000021748 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000021777 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000022233 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000022679 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000022779 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000022830 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000023063 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000023929 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000024088 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000024122 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000024423 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000024509 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000024758 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000024814 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000025140 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000025830 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000025954 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000026383 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000026567 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000026867 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000027258 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000027955 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000028229 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000028421 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000028704 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000029106 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000029159 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000029781 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000029785 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000029810 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000030085 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000030646 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000030722 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000031126 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000031222 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000032048 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000032060 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000032413 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000032567 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000032869 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000033036 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000033122 0.150169345 0.300338691 0 0 0.8759734

PAGE 207

ENSBTAG00000033227 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000033316 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000033592 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000033607 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000033729 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000033750 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000034024 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000034238 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000034281 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000034309 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000034321 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000034410 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000034569 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000034946 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000035054 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000035493 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000035552 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000035582 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000035592 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000035803 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000035989 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000036005 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000036047 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000036106 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000036243 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000036271 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000036403 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000036649 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000037275 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000037392 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000037430 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000037487 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000037554 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000037563 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000037608 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000037860 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000037903 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000037904 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000037947 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000038000 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000038027 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000038055 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000038075 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000038084 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000038086 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000038093 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000038095 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000038194 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000038209 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000038242 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000038317 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000038319 0.150169345 0.300338691 0 0 0.8759734

PAGE 208

ENSBTAG00000038342 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000038376 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000038392 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000038409 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000038435 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000038458 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000038474 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000038560 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000038622 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000038646 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000038724 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000038732 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000038864 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000038954 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000038982 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000039144 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000039304 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000039319 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000039322 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000039347 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000039461 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000039464 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000039473 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000039482 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000039502 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000039516 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000039525 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000039576 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000039653 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000039683 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000039690 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000039760 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000039781 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000039805 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000039808 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000039827 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000039881 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000039919 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000040020 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000040140 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000040143 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000040303 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000040379 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000040530 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000040570 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000042127 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000042266 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000042279 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000042307 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000042344 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000042367 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000042377 0.150169345 0.300338691 0 0 0.8759734

PAGE 209

ENSBTAG00000042394 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000042499 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000042513 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000042529 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000042530 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000042579 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000042599 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000042619 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000042624 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000042682 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000042703 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000042761 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000042768 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000042773 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000042789 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000042823 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000042878 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000042959 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000043014 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000043078 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000043163 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000043214 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000043276 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000043303 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000043463 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000043492 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000043497 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000043503 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000043507 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000043595 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000043668 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000043681 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000043699 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000043707 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000043795 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000043797 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000043806 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000043834 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000044035 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000044050 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000044203 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000044206 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000044251 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000044325 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000044407 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000044414 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000044502 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000044641 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000044674 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000044699 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000044727 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000044769 0.150169345 0.300338691 0 0 0.8759734

PAGE 210

ENSBTAG00000044830 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000044831 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000044854 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000044948 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000045007 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000045030 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000045081 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000045082 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000045135 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000045138 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000045165 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000045187 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000045252 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000045270 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000045302 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000045338 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000045373 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000045401 0.150169345 0.300338691 0 0 0.8759734 ENSBTAG00000045444 0.150169345 0.300338691 0 0 0.8759734 100140673 0.279123553 0.558247107 0 0 0.8759734 100170925 0.279123553 0.558247107 0 0 0.8759734 100295355 0.279123553 0.558247107 0 0 0.8759734 100295476 0.279123553 0.558247107 0 0 0.8759734 100298055 0.279123553 0.558247107 0 0 0.8759734 100313083 0.279123553 0.558247107 0 0 0.8759734 100313147 0.279123553 0.558247107 0 0 0.8759734 100313187 0.279123553 0.558247107 0 0 0.8759734 100313238 0.279123553 0.558247107 0 0 0.8759734 100313260 0.279123553 0.558247107 0 0 0.8759734 100313310 0.279123553 0.558247107 0 0 0.8759734 100313403 0.279123553 0.558247107 0 0 0.8759734 100335162 0.279123553 0.558247107 0 0 0.8759734 100335204 0.279123553 0.558247107 0 0 0.8759734 100335208 0.279123553 0.558247107 0 0 0.8759734 100335817 0.279123553 0.558247107 0 0 0.8759734 100336675 0.279123553 0.558247107 0 0 0.8759734 100336732 0.279123553 0.558247107 0 0 0.8759734 100337190 0.279123553 0.558247107 0 0 0.8759734 100498840 0.279123553 0.558247107 0 0 0.8759734 281554 0.279123553 0.558247107 0 0 0.8759734 407122 0.279123553 0.558247107 0 0 0.8759734 507057 0.279123553 0.558247107 0 0 0.8759734 507856 0.279123553 0.558247107 0 0 0.8759734 508367 0.279123553 0.558247107 0 0 0.8759734 509506 0.279123553 0.558247107 0 0 0.8759734 510214 0.279123553 0.558247107 0 0 0.8759734 510260 0.279123553 0.558247107 0 0 0.8759734 510388 0.279123553 0.558247107 0 0 0.8759734 511921 0.279123553 0.558247107 0 0 0.8759734 512010 0.279123553 0.558247107 0 0 0.8759734 512924 0.279123553 0.558247107 0 0 0.8759734 514194 0.279123553 0.558247107 0 0 0.8759734

PAGE 211

515090 0.279123553 0.558247107 0 0 0.8759734 518801 0.279123553 0.558247107 0 0 0.8759734 523062 0.279123553 0.558247107 0 0 0.8759734 523600 0.279123553 0.558247107 0 0 0.8759734 525276 0.279123553 0.558247107 0 0 0.8759734 528804 0.279123553 0.558247107 0 0 0.8759734 529156 0.279123553 0.558247107 0 0 0.8759734 530472 0.279123553 0.558247107 0 0 0.8759734 531104 0.279123553 0.558247107 0 0 0.8759734 534485 0.279123553 0.558247107 0 0 0.8759734 538476 0.279123553 0.558247107 0 0 0.8759734 538992 0.279123553 0.558247107 0 0 0.8759734 614914 0.279123553 0.558247107 0 0 0.8759734 615096 0.279123553 0.558247107 0 0 0.8759734 616454 0.279123553 0.558247107 0 0 0.8759734 616648 0.279123553 0.558247107 0 0 0.8759734 617135 0.279123553 0.558247107 0 0 0.8759734 617928 0.279123553 0.558247107 0 0 0.8759734 618265 0.279123553 0.558247107 0 0 0.8759734 782277 0.279123553 0.558247107 0 0 0.8759734 782879 0.279123553 0.558247107 0 0 0.8759734 782992 0.279123553 0.558247107 0 0 0.8759734 783350 0.279123553 0.558247107 0 0 0.8759734 783371 0.279123553 0.558247107 0 0 0.8759734 783508 0.279123553 0.558247107 0 0 0.8759734 784005 0.279123553 0.558247107 0 0 0.8759734 784021 0.279123553 0.558247107 0 0 0.8759734 784146 0.279123553 0.558247107 0 0 0.8759734 784301 0.279123553 0.558247107 0 0 0.8759734 784423 0.279123553 0.558247107 0 0 0.8759734 785207 0.279123553 0.558247107 0 0 0.8759734 785247 0.279123553 0.558247107 0 0 0.8759734 785610 0.279123553 0.558247107 0 0 0.8759734 786626 0.279123553 0.558247107 0 0 0.8759734 786764 0.279123553 0.558247107 0 0 0.8759734 786966 0.279123553 0.558247107 0 0 0.8759734 787458 0.279123553 0.558247107 0 0 0.8759734 788058 0.279123553 0.558247107 0 0 0.8759734 788666 0.279123553 0.558247107 0 0 0.8759734 789197 0.279123553 0.558247107 0 0 0.8759734 790212 0.279123553 0.558247107 0 0 0.8759734 790998 0.279123553 0.558247107 0 0 0.8759734 791000 0.279123553 0.558247107 0 0 0.8759734 791018 0.279123553 0.558247107 0 0 0.8759734 791032 0.279123553 0.558247107 0 0 0.8759734 791040 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000000487 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000000749 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000000917 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000001078 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000001751 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000002505 0.279123553 0.558247107 0 0 0.8759734

PAGE 212

ENSBTAG00000003131 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000003576 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000003601 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000003613 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000004342 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000004760 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000005268 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000005425 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000006156 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000006366 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000006473 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000006485 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000006725 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000006859 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000007947 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000008095 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000008312 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000008639 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000009883 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000009950 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000011537 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000012785 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000012895 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000013163 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000013203 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000014415 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000014456 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000014662 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000014738 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000014836 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000015045 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000015159 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000015315 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000015326 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000015361 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000015656 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000016127 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000016171 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000016734 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000016739 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000016785 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000017023 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000017049 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000017313 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000017396 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000017746 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000017778 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000017847 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000017978 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000019095 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000019482 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000019623 0.279123553 0.558247107 0 0 0.8759734

PAGE 213

ENSBTAG00000020010 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000020185 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000020824 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000020828 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000021437 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000021531 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000021969 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000022006 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000022819 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000023177 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000023202 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000023718 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000023780 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000024904 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000024929 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000025181 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000025260 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000026123 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000026365 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000027587 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000029126 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000029906 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000029956 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000029972 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000030469 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000030909 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000031032 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000031124 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000031160 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000031210 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000031302 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000031330 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000031727 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000031733 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000032587 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000033677 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000033764 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000034536 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000034632 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000034784 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000034898 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000035023 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000036929 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000037412 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000037808 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000037823 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000037870 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000038153 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000038162 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000038208 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000038275 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000038572 0.279123553 0.558247107 0 0 0.8759734

PAGE 214

ENSBTAG00000038632 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000038789 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000038847 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000039232 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000039267 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000039309 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000039672 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000039788 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000039811 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000039917 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000039978 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000040125 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000040232 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000040343 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000040351 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000040441 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000040529 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000040555 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000042124 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000042178 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000042200 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000042203 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000042224 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000042253 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000042269 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000042291 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000042399 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000042446 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000042474 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000042502 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000042546 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000042568 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000042704 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000042752 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000042755 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000042803 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000042824 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000042925 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000042926 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000042946 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000043015 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000043024 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000043314 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000043380 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000043427 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000043625 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000043784 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000043787 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000043807 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000044014 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000044101 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000044156 0.279123553 0.558247107 0 0 0.8759734

PAGE 215

ENSBTAG00000044210 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000044252 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000044346 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000044686 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000044893 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000044898 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000044978 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000045034 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000045355 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000045410 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000045414 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000045438 0.279123553 0.558247107 0 0 0.8759734 ENSBTAG00000045459 0.279123553 0.558247107 0 0 0.8759734 100137903 0.294549663 0.589099325 0 0 0.8759734 100139180 0.294549663 0.589099325 0 0 0.8759734 100170935 0.294549663 0.589099325 0 0 0.8759734 100297063 0.294549663 0.589099325 0 0 0.8759734 100300155 0.294549663 0.589099325 0 0 0.8759734 100300676 0.294549663 0.589099325 0 0 0.8759734 100313022 0.294549663 0.589099325 0 0 0.8759734 100313075 0.294549663 0.589099325 0 0 0.8759734 100313094 0.294549663 0.589099325 0 0 0.8759734 100313167 0.294549663 0.589099325 0 0 0.8759734 100313318 0.294549663 0.589099325 0 0 0.8759734 100313322 0.294549663 0.589099325 0 0 0.8759734 100335152 0.294549663 0.589099325 0 0 0.8759734 100335380 0.294549663 0.589099325 0 0 0.8759734 100335555 0.294549663 0.589099325 0 0 0.8759734 100336124 0.294549663 0.589099325 0 0 0.8759734 100336386 0.294549663 0.589099325 0 0 0.8759734 100336387 0.294549663 0.589099325 0 0 0.8759734 100336425 0.294549663 0.589099325 0 0 0.8759734 100336455 0.294549663 0.589099325 0 0 0.8759734 100336808 0.294549663 0.589099325 0 0 0.8759734 100336933 0.294549663 0.589099325 0 0 0.8759734 100337332 0.294549663 0.589099325 0 0 0.8759734 100337452 0.294549663 0.589099325 0 0 0.8759734 505451 0.294549663 0.589099325 0 0 0.8759734 505940 0.294549663 0.589099325 0 0 0.8759734 506936 0.294549663 0.589099325 0 0 0.8759734 507252 0.294549663 0.589099325 0 0 0.8759734 507426 0.294549663 0.589099325 0 0 0.8759734 509166 0.294549663 0.589099325 0 0 0.8759734 509799 0.294549663 0.589099325 0 0 0.8759734 510454 0.294549663 0.589099325 0 0 0.8759734 511622 0.294549663 0.589099325 0 0 0.8759734 511919 0.294549663 0.589099325 0 0 0.8759734 512006 0.294549663 0.589099325 0 0 0.8759734 512798 0.294549663 0.589099325 0 0 0.8759734 513657 0.294549663 0.589099325 0 0 0.8759734 515694 0.294549663 0.589099325 0 0 0.8759734 516433 0.294549663 0.589099325 0 0 0.8759734

PAGE 216

516557 0.294549663 0.589099325 0 0 0.8759734 520788 0.294549663 0.589099325 0 0 0.8759734 523590 0.294549663 0.589099325 0 0 0.8759734 524063 0.294549663 0.589099325 0 0 0.8759734 526409 0.294549663 0.589099325 0 0 0.8759734 527479 0.294549663 0.589099325 0 0 0.8759734 527918 0.294549663 0.589099325 0 0 0.8759734 528254 0.294549663 0.589099325 0 0 0.8759734 528860 0.294549663 0.589099325 0 0 0.8759734 528891 0.294549663 0.589099325 0 0 0.8759734 529992 0.294549663 0.589099325 0 0 0.8759734 535188 0.294549663 0.589099325 0 0 0.8759734 535834 0.294549663 0.589099325 0 0 0.8759734 535887 0.294549663 0.589099325 0 0 0.8759734 539185 0.294549663 0.589099325 0 0 0.8759734 539340 0.294549663 0.589099325 0 0 0.8759734 539766 0.294549663 0.589099325 0 0 0.8759734 540283 0.294549663 0.589099325 0 0 0.8759734 540503 0.294549663 0.589099325 0 0 0.8759734 540836 0.294549663 0.589099325 0 0 0.8759734 541007 0.294549663 0.589099325 0 0 0.8759734 613836 0.294549663 0.589099325 0 0 0.8759734 615012 0.294549663 0.589099325 0 0 0.8759734 615254 0.294549663 0.589099325 0 0 0.8759734 616092 0.294549663 0.589099325 0 0 0.8759734 616947 0.294549663 0.589099325 0 0 0.8759734 617436 0.294549663 0.589099325 0 0 0.8759734 618126 0.294549663 0.589099325 0 0 0.8759734 618660 0.294549663 0.589099325 0 0 0.8759734 618946 0.294549663 0.589099325 0 0 0.8759734 782129 0.294549663 0.589099325 0 0 0.8759734 782373 0.294549663 0.589099325 0 0 0.8759734 782831 0.294549663 0.589099325 0 0 0.8759734 783230 0.294549663 0.589099325 0 0 0.8759734 783569 0.294549663 0.589099325 0 0 0.8759734 784108 0.294549663 0.589099325 0 0 0.8759734 784304 0.294549663 0.589099325 0 0 0.8759734 784607 0.294549663 0.589099325 0 0 0.8759734 785571 0.294549663 0.589099325 0 0 0.8759734 785712 0.294549663 0.589099325 0 0 0.8759734 786049 0.294549663 0.589099325 0 0 0.8759734 786220 0.294549663 0.589099325 0 0 0.8759734 786897 0.294549663 0.589099325 0 0 0.8759734 787011 0.294549663 0.589099325 0 0 0.8759734 787528 0.294549663 0.589099325 0 0 0.8759734 788170 0.294549663 0.589099325 0 0 0.8759734 788353 0.294549663 0.589099325 0 0 0.8759734 789059 0.294549663 0.589099325 0 0 0.8759734 789544 0.294549663 0.589099325 0 0 0.8759734 790219 0.294549663 0.589099325 0 0 0.8759734 790624 0.294549663 0.589099325 0 0 0.8759734 790795 0.294549663 0.589099325 0 0 0.8759734

PAGE 217

790849 0.294549663 0.589099325 0 0 0.8759734 790979 0.294549663 0.589099325 0 0 0.8759734 790988 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000000698 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000000916 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000000960 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000000987 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000002751 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000003121 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000003343 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000004224 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000004241 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000005010 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000005060 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000005101 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000005777 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000006903 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000007568 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000008085 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000008126 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000008394 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000008779 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000009285 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000009350 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000010306 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000010522 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000010814 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000010817 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000012715 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000013450 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000015157 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000015377 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000015462 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000016646 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000016835 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000017391 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000017561 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000018237 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000018681 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000018975 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000019293 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000019432 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000019628 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000019670 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000020157 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000020453 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000020952 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000021059 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000022376 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000022399 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000022544 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000023078 0.294549663 0.589099325 0 0 0.8759734

PAGE 218

ENSBTAG00000023136 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000023955 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000024692 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000024713 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000024736 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000024820 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000024914 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000026992 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000027197 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000028153 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000029168 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000029793 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000029948 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000031925 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000032068 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000032650 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000032900 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000033083 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000033454 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000033841 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000034246 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000034284 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000034577 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000034601 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000035384 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000036031 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000037006 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000037687 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000037985 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000038022 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000038223 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000038306 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000038412 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000038705 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000038984 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000039174 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000039271 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000039344 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000039490 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000039527 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000039648 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000039909 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000039931 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000039948 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000039964 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000040025 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000040200 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000040257 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000040421 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000040544 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000042092 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000042098 0.294549663 0.589099325 0 0 0.8759734

PAGE 219

ENSBTAG00000042151 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000042182 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000042241 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000042245 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000042259 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000042317 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000042541 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000042576 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000042594 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000042782 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000042876 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000042886 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000042914 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000042929 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000042952 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000042973 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000042975 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000042977 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000042986 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000043084 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000043137 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000043189 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000043312 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000043449 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000043661 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000043733 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000043751 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000043792 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000043871 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000043891 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000043940 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000043954 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000044022 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000044088 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000044091 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000044271 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000044295 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000044331 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000044535 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000044570 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000044616 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000044645 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000044735 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000044868 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000045189 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000045308 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000045312 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000045324 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000045381 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000045398 0.294549663 0.589099325 0 0 0.8759734 ENSBTAG00000009182 1.897631368 2.822087752 0.973174983 0.344842212 0.8759734 ENSBTAG00000042984 1.75387038 2.564179336 0.943561424 0.367977938 0.8759734

PAGE 220

ENSBTAG00000016324 1.799529378 2.625883773 0.973174983 0.370608552 0.8759734 100298573 1.738444271 2.533327118 0.943561424 0.372459371 0.8759734 525377 1.844569047 2.656735992 1.032402102 0.388597928 0.8759734 ENSBTAG00000021183 2.829828504 4.031138621 1.628518387 0.403984715 0.8759734 100196899 1.843949717 2.625883773 1.062015661 0.404441229 0.8759734 ENSBTAG00000015957 1.78286461 2.533327118 1.032402102 0.407528145 0.8759734 ENSBTAG00000045203 2.798976286 3.969434184 1.628518387 0.410264615 0.8759734 522845 1.67057517 2.367975357 0.973174983 0.410973442 0.8759734 ENSBTAG00000011171 2.686686846 3.804082424 1.569291269 0.412528198 0.8759734 ENSBTAG00000021216 1.877123274 2.656735992 1.097510557 0.413104863 0.8759734 ENSBTAG00000043990 1.861697165 2.625883773 1.097510557 0.417958543 0.8759734 618437 2.007160162 2.822087752 1.192232572 0.422464741 0.8759734 100336558 2.479519412 3.484469571 1.474569254 0.423183278 0.8759734 ENSBTAG00000031283 1.876503945 2.625883773 1.127124116 0.429236102 0.8759734 784260 2.083052049 2.914644408 1.25145969 0.429369595 0.8759734 ENSBTAG00000011833 2.685448187 3.742377987 1.628518387 0.435156041 0.8759734 ENSBTAG00000025847 2.527499749 3.515321789 1.53967771 0.437990546 0.8759734 100141094 1.639103622 2.275418702 1.002788542 0.440705063 0.8759734 ENSBTAG00000020649 1.639103622 2.275418702 1.002788542 0.440705063 0.8759734 ENSBTAG00000007193 1.669336511 2.30627092 1.032402102 0.447649967 0.8759734 ENSBTAG00000037727 2.748235304 3.773230205 1.723240402 0.456701635 0.8759734 ENSBTAG00000042805 2.587346198 3.546174008 1.628518387 0.459232509 0.8759734 ENSBTAG00000001621 5.135822119 7.038339685 3.233304553 0.459384556 0.8759734 ENSBTAG00000005370 2.335139095 3.195708936 1.474569254 0.461421639 0.8759734 515122 2.084754058 2.852939971 1.316568146 0.461477689 0.8759734 ENSBTAG00000024974 1.732742957 2.367975357 1.097510557 0.463480565 0.8759734 ENSBTAG00000038947 2.796215641 3.804082424 1.788348858 0.470113068 0.8759734 100295394 2.716162388 3.692251606 1.740073169 0.471276975 0.8759734 538521 2.099560838 2.852939971 1.346181705 0.471857704 0.8759734 ENSBTAG00000003329 2.686530867 3.649821331 1.723240402 0.47214377 0.8759734 100296784 1.510768744 2.048362504 0.973174983 0.475099003 0.8759734 ENSBTAG00000034958 1.701890739 2.30627092 1.097510557 0.47588102 0.8759734 ENSBTAG00000007090 1.893012734 2.564179336 1.221846131 0.476505724 0.8759734 100138474 1.938671732 2.625883773 1.25145969 0.476586094 0.8759734 100313332 1.938671732 2.625883773 1.25145969 0.476586094 0.8759734 100336686 1.938671732 2.625883773 1.25145969 0.476586094 0.8759734 100336351 1.732123627 2.337123139 1.127124116 0.482269889 0.8759734 782475 1.732123627 2.337123139 1.127124116 0.482269889 0.8759734 ENSBTAG00000014817 1.495342634 2.017510285 0.973174983 0.482364323 0.8759734 ENSBTAG00000043101 3.215888206 4.331477312 2.100299099 0.484892093 0.8759734 539638 2.352267214 3.164856717 1.53967771 0.486492074 0.8759734 ENSBTAG00000021609 1.746930407 2.337123139 1.156737675 0.494940834 0.8759734 ENSBTAG00000018955 4.331909557 5.790740491 2.873078623 0.496150471 0.8759734 ENSBTAG00000040453 3.598631469 4.808745819 2.388517119 0.496702718 0.8759734 ENSBTAG00000044023 2.618060398 3.496047627 1.740073169 0.497725819 0.8759734 ENSBTAG00000022588 5.057934225 6.741395555 3.374472894 0.50055999 0.8759734 ENSBTAG00000042763 1.540382303 2.048362504 1.032402102 0.504013376 0.8759734 ENSBTAG00000019616 3.298669762 4.385485643 2.211853881 0.504357798 0.8759734 ENSBTAG00000042774 1.716078189 2.275418702 1.156737675 0.50836256 0.8759734 281617 2.412113662 3.195708936 1.628518387 0.509595342 0.8759734 ENSBTAG00000043575 2.881005223 3.81566048 1.946349966 0.510095166 0.8759734 100337081 2.175332669 2.876096083 1.474569254 0.512698189 0.8759734

PAGE 221

100336042 1.749251746 2.30627092 1.192232572 0.516952523 0.8759734 100336666 2.205565557 2.906948301 1.504182813 0.517443951 0.8759734 522122 10.21277257 13.42975756 6.995787574 0.520916893 0.8759734 100336450 1.779484635 2.337123139 1.221846131 0.52279921 0.8759734 ENSBTAG00000044659 1.733825637 2.275418702 1.192232572 0.523961841 0.8759734 522540 4.202336019 5.501979856 2.902692182 0.527572303 0.8759734 ENSBTAG00000033334 2.47429941 3.238139211 1.71045961 0.528223001 0.8759734 ENSBTAG00000019940 2.268972004 2.968652739 1.569291269 0.528620693 0.8759734 ENSBTAG00000007424 3.748557254 4.901302475 2.595812033 0.52961678 0.8759734 618459 1.764058526 2.30627092 1.221846131 0.529792975 0.8759734 619070 1.764058526 2.30627092 1.221846131 0.529792975 0.8759734 ENSBTAG00000001582 4.974621053 6.502761302 3.446480804 0.530002663 0.8759734 ENSBTAG00000033656 3.022288892 3.950160022 2.094417762 0.530210865 0.8759734 ENSBTAG00000039968 3.246584444 4.238920656 2.254248233 0.531797695 0.8759734 ENSBTAG00000002660 2.458873301 3.207286992 1.71045961 0.533304196 0.8759734 100335214 3.608975594 4.705098496 2.512852693 0.534070157 0.8759734 ENSBTAG00000000920 4.133122583 5.386267088 2.879978078 0.534689058 0.8759734 ENSBTAG00000000818 4.492573064 5.852444928 3.132701201 0.535280765 0.8759734 100299811 3.104062116 4.042716677 2.165407555 0.535631786 0.8759734 ENSBTAG00000045379 1.572936531 2.048362504 1.097510557 0.535798988 0.8759734 ENSBTAG00000021223 1.351581647 1.759601869 0.943561424 0.536235748 0.8759734 506335 2.016764901 2.618187667 1.415342136 0.540580858 0.8759734 ENSBTAG00000011113 5.320966764 6.907234704 3.734698824 0.540693777 0.8759734 ENSBTAG00000039079 2.519339079 3.268991429 1.769686729 0.541355573 0.8759734 ENSBTAG00000036155 1.603169419 2.079214723 1.127124116 0.542091254 0.8759734 ENSBTAG00000019872 5.880556992 7.619742904 4.14137108 0.543505356 0.8759734 ENSBTAG00000034724 1.557510421 2.017510285 1.097510557 0.543992546 0.8759734 ENSBTAG00000038129 1.557510421 2.017510285 1.097510557 0.543992546 0.8759734 ENSBTAG00000008227 2.682549524 3.465195408 1.89990364 0.548281818 0.8759734 ENSBTAG00000039898 1.58774331 2.048362504 1.127124116 0.550256175 0.8759734 617542 2.712782413 3.496047627 1.929517199 0.551913877 0.8759734 790464 7.903381015 10.18392224 5.622839789 0.552129097 0.8759734 ENSBTAG00000034330 2.72880989 3.515321789 1.942297991 0.552523526 0.8759734 ENSBTAG00000043432 3.81366571 4.901302475 2.726028944 0.556184598 0.8759734 ENSBTAG00000020032 5.979967393 7.681447341 4.278487446 0.556989752 0.8759734 510366 3.592310826 4.61254184 2.572079811 0.557627421 0.8759734 ENSBTAG00000043778 2.724648524 3.496047627 1.953249421 0.558702177 0.8759734 618048 3.217076561 4.127577227 2.306575896 0.558820773 0.8759734 786089 1.396621315 1.790454088 1.002788542 0.560074983 0.8759734 ENSBTAG00000016957 5.083548479 6.514339358 3.652757601 0.560725716 0.8759734 ENSBTAG00000014014 7.017943517 8.986449427 5.049437608 0.561894622 0.8759734 ENSBTAG00000039244 3.005960127 3.846512698 2.165407555 0.56295344 0.8759734 100298877 1.60255009 2.048362504 1.156737675 0.564713362 0.8759734 ENSBTAG00000042526 2.533526529 3.238139211 1.828913847 0.564803959 0.8759734 ENSBTAG00000004633 4.321501895 5.521254019 3.121749771 0.565405931 0.8759734 ENSBTAG00000011478 2.300906902 2.93780052 1.664013284 0.56641466 0.8759734 537305 4.99855126 6.379839816 3.617262705 0.566983311 0.8759734 100336428 4.081780233 5.201641165 2.9619193 0.569420151 0.8759734 ENSBTAG00000039717 1.381195206 1.759601869 1.002788542 0.569895134 0.8759734 ENSBTAG00000043340 5.237653592 6.668600451 3.806706734 0.570840428 0.8759734 ENSBTAG00000039809 2.521041088 3.207286992 1.834795184 0.572070784 0.8759734 ENSBTAG00000009784 4.97063971 6.318135379 3.623144042 0.573451473 0.8759734

PAGE 222

781484 1.841652422 2.337123139 1.346181705 0.575999477 0.8759734 100139097 2.270054683 2.876096083 1.664013284 0.578566653 0.8759734 539243 4.111393792 5.201641165 3.021146419 0.580806388 0.8759734 ENSBTAG00000025778 2.094358798 2.649039885 1.53967771 0.581221037 0.8759734 ENSBTAG00000031472 4.074464491 5.151514784 2.997414197 0.581851033 0.8759734 ENSBTAG00000002796 2.300287572 2.906948301 1.693626843 0.582613334 0.8759734 618065 4.602083897 5.810014653 3.394153141 0.584190117 0.8759734 282259 5.471975229 6.907234704 4.036715753 0.584418501 0.8759734 ENSBTAG00000010079 5.531839638 6.980517197 4.08316208 0.584936899 0.8759734 ENSBTAG00000033515 4.098908351 5.170788947 3.027027756 0.585409265 0.8759734 786521 5.150214978 6.495552584 3.804877372 0.585766542 0.8759734 788835 5.995754758 7.561920416 4.4295891 0.585775683 0.8759734 ENSBTAG00000012254 4.110173095 5.182367003 3.037979186 0.586214597 0.8759734 ENSBTAG00000010644 3.073315574 3.869668811 2.276962337 0.588412717 0.8759734 790980 2.786214943 3.507625683 2.064804203 0.588661502 0.8759734 ENSBTAG00000043179 2.284861463 2.876096083 1.693626843 0.588863096 0.8759734 100335884 6.464111123 8.135559736 4.792662509 0.589100525 0.8759734 ENSBTAG00000042600 5.283793902 6.649326288 3.918261516 0.589271957 0.8759734 ENSBTAG00000034693 4.793705165 6.029374744 3.558035586 0.590116842 0.8759734 100336501 1.604871429 2.017510285 1.192232572 0.5909425 0.8759734 618154 1.604871429 2.017510285 1.192232572 0.5909425 0.8759734 100141294 2.759524091 3.465195408 2.053852773 0.592709077 0.8759734 ENSBTAG00000040449 2.835415978 3.557752064 2.113079891 0.593936804 0.8759734 507264 2.789756979 3.496047627 2.083466332 0.59594907 0.8759734 790530 1.635104318 2.048362504 1.221846131 0.596498974 0.8759734 ENSBTAG00000032264 4.177121577 5.232493384 3.121749771 0.596608451 0.8759734 ENSBTAG00000003592 2.139398466 2.679892104 1.598904828 0.596630299 0.8759734 ENSBTAG00000032949 3.22839769 4.042716677 2.414078703 0.597142688 0.8759734 618898 6.861041836 8.581976024 5.140107647 0.598942205 0.8759734 535280 3.714325061 4.643394059 2.785256063 0.599831939 0.8759734 ENSBTAG00000007009 9.027419209 11.28114229 6.773696128 0.600444171 0.8759734 504658 6.29114354 7.850681051 4.731606029 0.602700071 0.8759734 ENSBTAG00000038902 2.123972357 2.649039885 1.598904828 0.603578994 0.8759734 ENSBTAG00000014172 3.973421833 4.955310805 2.99153286 0.603702366 0.8759734 512319 11.34349529 14.14177837 8.545212218 0.604253015 0.8759734 ENSBTAG00000010229 8.888956152 11.07724221 6.700670099 0.604904179 0.8759734 100336319 2.988676028 3.723103824 2.254248233 0.605475522 0.8759734 100300380 3.98660095 4.963006912 3.010194989 0.606526455 0.8759734 ENSBTAG00000009254 1.413749434 1.759601869 1.067896998 0.606896944 0.8759734 ENSBTAG00000032370 1.413749434 1.759601869 1.067896998 0.606896944 0.8759734 100139978 3.067508584 3.81566048 2.319356688 0.607851957 0.8759734 789760 4.016833839 4.99385913 3.039808548 0.60870931 0.8759734 ENSBTAG00000021448 7.466772373 9.275210061 5.658334686 0.610049222 0.8759734 532916 3.556376623 4.416337861 2.696415385 0.610554597 0.8759734 ENSBTAG00000022684 2.583208875 3.207286992 1.959130758 0.610837372 0.8759734 532708 12.19229513 15.12765499 9.256935261 0.611921363 0.8759734 ENSBTAG00000015827 1.443982322 1.790454088 1.097510557 0.612978889 0.8759734 ENSBTAG00000014908 2.344707911 2.906948301 1.782467521 0.613174827 0.8759734 ENSBTAG00000032591 4.221541916 5.232493384 3.210590448 0.613587101 0.8759734 281689 3.815473395 4.728254608 2.902692182 0.613903527 0.8759734 100140710 2.876386589 3.557752064 2.195021114 0.616968545 0.8759734 780976 8.529112074 10.53826926 6.519954887 0.618693139 0.8759734

PAGE 223

ENSBTAG00000007437 7.551977363 9.325336442 5.778618284 0.619668611 0.8759734 ENSBTAG00000032122 3.292812469 4.065872789 2.519752148 0.619732165 0.8759734 ENSBTAG00000030269 13.98884421 17.26808676 10.70960166 0.620196192 0.8759734 ENSBTAG00000030812 9.824539346 12.12045393 7.528624766 0.621150397 0.8759734 536731 5.276889853 6.50713064 4.046649065 0.62187918 0.8759734 785366 2.837117987 3.496047627 2.178188347 0.623043099 0.8759734 ENSBTAG00000033882 6.143822554 7.561920416 4.725724692 0.62493711 0.8759734 ENSBTAG00000042868 3.540331184 4.354633424 2.726028944 0.626006527 0.8759734 ENSBTAG00000012180 4.214226174 5.182367003 3.246085345 0.626371182 0.8759734 ENSBTAG00000014798 6.320212117 7.765820502 4.874603732 0.627699769 0.8759734 ENSBTAG00000038631 3.494672186 4.292928987 2.696415385 0.628106217 0.8759734 509356 3.386451804 4.158429445 2.614474162 0.62871673 0.8759734 613541 6.193115898 7.600468741 4.785763054 0.629666829 0.8759734 ENSBTAG00000023846 11.01538192 13.51801267 8.512751179 0.629733925 0.8759734 ENSBTAG00000042117 3.829660845 4.697402389 2.9619193 0.630544087 0.8759734 ENSBTAG00000013509 15.71706691 19.27450638 12.15962744 0.630865829 0.8759734 ENSBTAG00000011352 8.113167506 9.949169936 6.277165076 0.630923496 0.8759734 523334 2.895761699 3.550055957 2.241467441 0.631389327 0.8759734 ENSBTAG00000002273 11.22327436 13.75713431 8.689414417 0.631629685 0.8759734 ENSBTAG00000006500 2.40689366 2.949378576 1.864408743 0.632136125 0.8759734 ENSBTAG00000008946 14.20442816 17.38040497 11.02845135 0.634533624 0.8759734 ENSBTAG00000007109 12.05142092 14.74245575 9.360386093 0.634927196 0.8759734 ENSBTAG00000010239 20.06171506 24.52239198 15.60103815 0.636195611 0.8759734 ENSBTAG00000003526 1.932231032 2.360279251 1.504182813 0.637290191 0.8759734 537387 12.26043196 14.97388128 9.546982643 0.637575687 0.8759734 616000 9.968056773 12.17058031 7.76553324 0.638057763 0.8759734 ENSBTAG00000032260 8.507758919 10.38400817 6.631509669 0.638627162 0.8759734 ENSBTAG00000038158 7.591709315 9.263632005 5.919786626 0.639035167 0.8759734 ENSBTAG00000040486 7.591709315 9.263632005 5.919786626 0.639035167 0.8759734 ENSBTAG00000038058 8.865563776 10.81545184 6.915675713 0.639425501 0.8759734 ENSBTAG00000012567 4.83304352 5.894875202 3.771211838 0.639744135 0.8759734 100299005 17.92842028 21.83868571 14.01815485 0.641895535 0.8759734 ENSBTAG00000005048 5.952774906 7.250003669 4.655546143 0.642143971 0.8759734 ENSBTAG00000021021 4.8501896 5.906453258 3.793925942 0.642335726 0.8759734 524565 1.682465325 2.048362504 1.316568146 0.642741772 0.8759734 ENSBTAG00000039345 12.69783402 15.4588459 9.936822132 0.642791978 0.8759734 ENSBTAG00000026139 17.16158693 20.88754326 13.4356306 0.643236518 0.8759734 ENSBTAG00000032995 4.581455747 5.575262349 3.587649146 0.643494229 0.8759734 615631 18.74820792 22.81298428 14.68343157 0.64364361 0.8759734 618708 7.683526585 9.348492555 6.018560616 0.643800119 0.8759734 511863 7.855061105 9.55627459 6.15384762 0.643958853 0.8759734 ENSBTAG00000000995 16.70270809 20.31723071 13.08818546 0.644191408 0.8759734 ENSBTAG00000024284 9.547764879 11.6123332 7.483196557 0.644418002 0.8759734 ENSBTAG00000001446 27.73517491 33.72722672 21.7431231 0.644675688 0.8759734 ENSBTAG00000038337 6.491445348 7.889229376 5.093661321 0.645647512 0.8759734 ENSBTAG00000026501 1.237434218 1.501693453 0.973174983 0.648051692 0.8759734 ENSBTAG00000021376 11.44638764 13.8877519 9.005023382 0.648414765 0.8759734 ENSBTAG00000006635 8.848806699 10.73447324 6.963140157 0.648670876 0.8759734 ENSBTAG00000031987 10.09597031 12.2438628 7.948077814 0.649147899 0.8759734 ENSBTAG00000000892 8.165078882 9.899043555 6.431114209 0.649670261 0.8759734 ENSBTAG00000018391 3.857027413 4.674246277 3.039808548 0.650331276 0.8759734 ENSBTAG00000011327 32.81371217 39.71514596 25.91227838 0.652453308 0.8759734

PAGE 224

518625 1.667039216 2.017510285 1.316568146 0.652570723 0.8759734 ENSBTAG00000037288 9.138830036 11.05408609 7.223573979 0.653475459 0.8759734 ENSBTAG00000018294 2.200345555 2.660617941 1.740073169 0.654010913 0.8759734 ENSBTAG00000036172 4.140568045 5.005437186 3.275698904 0.654428131 0.8759734 ENSBTAG00000005169 24.47384959 29.54280178 19.40489741 0.656840118 0.8759734 ENSBTAG00000032253 13.51220367 16.30973559 10.71467175 0.656949445 0.8759734 ENSBTAG00000021189 6.220871468 7.507912086 4.93383085 0.657150856 0.8759734 ENSBTAG00000020890 1.697272104 2.048362504 1.346181705 0.657198959 0.8759734 540109 1.458169772 1.759601869 1.156737675 0.657386023 0.8759734 ENSBTAG00000008969 13.89105432 16.72911382 11.05299482 0.660704144 0.8759734 ENSBTAG00000033205 7.161660283 8.616710193 5.706610374 0.66227252 0.8759734 ENSBTAG00000012918 6.249883659 7.519490142 4.980277177 0.662315806 0.8759734 785345 2.907702157 3.496047627 2.319356688 0.663422509 0.8759734 ENSBTAG00000019997 2.215152335 2.660617941 1.769686729 0.665141244 0.8759734 100335937 5.892414805 7.076955803 4.707873807 0.665239962 0.8759734 ENSBTAG00000015679 1.49134333 1.790454088 1.192232572 0.665882795 0.8759734 ENSBTAG00000039156 8.752516989 10.50741704 6.997616936 0.665969277 0.8759734 789709 1.252240998 1.501693453 1.002788542 0.667771801 0.8759734 100313427 5.400606097 6.476278421 4.324933773 0.667811587 0.8759734 ENSBTAG00000015699 1.995018149 2.391131469 1.598904828 0.66868127 0.8759734 ENSBTAG00000011971 27.95825227 33.47078047 22.44572407 0.670606534 0.8759734 ENSBTAG00000000345 12.0952819 14.47685123 9.713712568 0.670982413 0.8759734 ENSBTAG00000024201 12.87610695 15.40871952 10.34349439 0.671275402 0.8759734 ENSBTAG00000018201 27.04575186 32.36440214 21.72710158 0.671327141 0.8759734 ENSBTAG00000042936 17.96149783 21.48052454 14.44247112 0.672351883 0.8759734 529844 15.82148138 18.91683259 12.72613017 0.672741069 0.8759734 ENSBTAG00000034722 7.336047891 8.770971285 5.901124496 0.672801712 0.8759734 ENSBTAG00000035804 7.336047891 8.770971285 5.901124496 0.672801712 0.8759734 100335946 3.211838598 3.838816592 2.584860603 0.673348294 0.8759734 ENSBTAG00000012775 10.47005363 12.51334927 8.426757981 0.673421464 0.8759734 ENSBTAG00000011961 12.10826661 14.46915512 9.747378102 0.673666017 0.8759734 541260 31.03125837 37.07817152 24.98434523 0.673828946 0.8759734 ENSBTAG00000010208 4.199193796 5.017015243 3.381372349 0.67398088 0.8759734 ENSBTAG00000025088 19.40787584 23.18611808 15.6296336 0.674094454 0.8759734 ENSBTAG00000003700 13.16085032 15.71675431 10.60494633 0.674754222 0.8759734 100335848 15.43326477 18.4231293 12.44340024 0.675422727 0.8759734 ENSBTAG00000017794 9.263878591 11.04638999 7.481367196 0.677268067 0.8759734 538826 20.19070074 24.07167414 16.30972734 0.677548526 0.8759734 ENSBTAG00000010174 7.914486208 9.433353104 6.395619313 0.677979425 0.8759734 514121 29.10074482 34.65237368 23.54911597 0.679581612 0.8759734 ENSBTAG00000013624 8.019459905 9.548578483 6.490341327 0.679718069 0.8759734 ENSBTAG00000021588 6.351014032 7.561920416 5.140107647 0.67973575 0.8759734 ENSBTAG00000032320 13.7907187 16.40998835 11.17144905 0.680771297 0.8759734 ENSBTAG00000016577 2.453635337 2.918526357 1.988744317 0.681420715 0.8759734 614416 6.252788404 7.434629592 5.070947216 0.682071266 0.8759734 ENSBTAG00000042439 2.976278302 3.538477901 2.414078703 0.682236479 0.8759734 100140536 1.506150109 1.790454088 1.221846131 0.682422487 0.8759734 787197 3.006511191 3.56933012 2.443692262 0.684636103 0.8759734 ENSBTAG00000030650 6.360031783 7.55034236 5.169721206 0.684700237 0.8759734 506005 99.72046308 118.3480691 81.09285702 0.685206422 0.8759734 ENSBTAG00000031509 4.215720546 4.99774108 3.433700012 0.687050401 0.8759734 531865 3.962412802 4.697402389 3.227423216 0.68706552 0.8759734

PAGE 225

ENSBTAG00000000029 25.06557195 29.70864093 20.42250298 0.687426363 0.8759734 100125944 14.37310602 17.03382184 11.7123902 0.687596143 0.8759734 ENSBTAG00000018195 7.131821125 8.451358432 5.812283819 0.687733678 0.8759734 ENSBTAG00000031609 17.05507092 20.19867856 13.91146329 0.688731357 0.8759734 ENSBTAG00000001178 74.30833946 87.98383552 60.6328434 0.68913617 0.8759734 ENSBTAG00000006921 7.916188217 9.371648667 6.460727768 0.689390736 0.8759734 ENSBTAG00000000534 2.26373404 2.679892104 1.847575976 0.689421777 0.8759734 ENSBTAG00000025775 3.14556583 3.723103824 2.568027836 0.689754559 0.8759734 505716 1.994398819 2.360279251 1.628518387 0.689968523 0.8759734 ENSBTAG00000030313 2.975057604 3.519203739 2.43091147 0.690756106 0.8759734 ENSBTAG00000037715 2.975057604 3.519203739 2.43091147 0.690756106 0.8759734 539795 17.43240464 20.61805679 14.2467525 0.69098425 0.8759734 512723 23.08301879 27.25968697 18.90635062 0.69356448 0.8759734 ENSBTAG00000025803 82.39807675 97.23867821 67.5574753 0.694759293 0.8759734 ENSBTAG00000001410 11.07351806 13.06778222 9.079253906 0.694781544 0.8759734 ENSBTAG00000022861 10.05632013 11.86254551 8.250094744 0.695474233 0.8759734 ENSBTAG00000008994 30.71768892 36.23116378 25.20421406 0.695650137 0.8759734 ENSBTAG00000031828 16.82993416 19.84433154 13.81553678 0.696195624 0.8759734 ENSBTAG00000019870 13.37638384 15.77076265 10.98200503 0.696352185 0.8759734 ENSBTAG00000007719 5.231781919 6.168243624 4.295320213 0.696360338 0.8759734 788175 8.657726709 10.19938225 7.116071173 0.697696292 0.8759734 ENSBTAG00000011548 35.35381892 41.63628544 29.07135241 0.698221566 0.8759734 ENSBTAG00000008587 16.33051436 19.22438 13.43664872 0.698937949 0.8759734 ENSBTAG00000016138 1.520956889 1.790454088 1.25145969 0.698962179 0.8759734 100294758 18.06192858 21.2568629 14.86699426 0.699397382 0.8759734 ENSBTAG00000024675 11.19696536 13.17573109 9.218199634 0.699634773 0.8759734 522345 37.94600457 44.6434865 31.24852264 0.699957039 0.8759734 ENSBTAG00000018453 15.11512582 17.78057682 12.44967482 0.700183967 0.8759734 ENSBTAG00000004785 16.02140148 18.84306271 13.19974024 0.700509278 0.8759734 509866 14.28046179 16.79518759 11.76573598 0.7005421 0.8759734 ENSBTAG00000001096 113.9857352 134.0375014 93.93396908 0.700803642 0.8759734 ENSBTAG00000007318 6.689712726 7.862259107 5.517166344 0.701727871 0.8759734 100138074 8.749026744 10.28036085 7.217692642 0.702085535 0.8759734 782348 4.420410661 5.193945059 3.646876264 0.702139938 0.8759734 407174 6.242961648 7.334864219 5.151059077 0.702270543 0.8759734 ENSBTAG00000016801 15.34487913 18.02690718 12.66285108 0.702441686 0.8759734 ENSBTAG00000009030 5.24079967 6.156665568 4.324933773 0.702479894 0.8759734 ENSBTAG00000004674 21.87558714 25.68859297 18.0625813 0.703136264 0.8759734 ENSBTAG00000015942 42.9918113 50.48337859 35.500244 0.70320658 0.8759734 ENSBTAG00000013473 5.787886496 6.795891274 4.779881717 0.703348762 0.8759734 541048 23.96714073 28.12208693 19.81219453 0.704506553 0.8759734 613814 21.37224832 25.07682493 17.66767172 0.704541814 0.8759734 516199 5.758254975 6.753461 4.76304895 0.705275258 0.8759734 ENSBTAG00000016589 4.921838489 5.771466328 4.072210649 0.705576437 0.8759734 ENSBTAG00000006069 15.63672588 18.32724587 12.94620588 0.706391237 0.8759734 ENSBTAG00000025277 35.3283489 41.40583468 29.25086312 0.706443026 0.8759734 ENSBTAG00000000003 17.34248871 20.32160005 14.36337737 0.706803467 0.8759734 ENSBTAG00000000949 123.0423484 144.1711617 101.913535 0.706892654 0.8759734 507024 2.984676724 3.496047627 2.473305821 0.707457702 0.8759734 785310 4.293314442 5.028593299 3.558035586 0.707560818 0.8759734 511283 11.91606802 13.94176023 9.890375805 0.709406534 0.8759734 ENSBTAG00000034197 4.20960754 4.924458587 3.494756493 0.709673242 0.8759734

PAGE 226

614651 4.290975142 5.017015243 3.564935041 0.710568908 0.8759734 ENSBTAG00000042408 1.284795226 1.501693453 1.067896998 0.71112849 0.8759734 ENSBTAG00000032347 29.16163567 34.07824697 24.24502436 0.71145163 0.8759734 ENSBTAG00000022102 12.29721495 14.36938975 10.22504015 0.711584857 0.8759734 ENSBTAG00000014930 19.014796 22.21618885 15.81340316 0.711796396 0.8759734 617935 4.057152779 4.739832664 3.374472894 0.711939246 0.8759734 ENSBTAG00000016770 20.00245473 23.36741723 16.63749223 0.711995342 0.8759734 100138599 15.11507194 17.653286 12.57685788 0.712437213 0.8759734 ENSBTAG00000003120 26.67426518 31.14862994 22.19990041 0.712708727 0.8759734 ENSBTAG00000012912 27.32620679 31.90689519 22.74551839 0.712871568 0.8759734 ENSBTAG00000018050 181.5833885 212.0113189 151.1554581 0.712959378 0.8759734 ENSBTAG00000008540 21.17692904 24.7147818 17.63907628 0.713705523 0.8759734 786327 7.552182773 8.81340156 6.290963986 0.713795229 0.8759734 ENSBTAG00000004330 2.280260791 2.660617941 1.89990364 0.714083601 0.8759734 ENSBTAG00000002309 57.14138486 66.66631075 47.61645898 0.714250698 0.8759734 ENSBTAG00000015837 70.88184518 82.66503657 59.09865378 0.714917167 0.8759734 ENSBTAG00000044142 1.803276824 2.102370835 1.504182813 0.715469787 0.8759734 ENSBTAG00000008535 87.3991685 101.8803261 72.91801091 0.715722198 0.8759734 ENSBTAG00000044015 42.52424624 49.56406314 35.48442935 0.715930598 0.8759734 ENSBTAG00000037731 57.05956532 66.50040381 47.61872683 0.716066732 0.8759734 504211 40.60763917 47.31900927 33.89626908 0.716335139 0.8759734 505878 9.047254099 10.54215121 7.552356988 0.716396193 0.8759734 ENSBTAG00000034190 11.56051488 13.46837367 9.652656087 0.716690546 0.8759734 ENSBTAG00000016926 15.21590696 17.72656849 12.70524543 0.716734625 0.8759734 ENSBTAG00000013941 25.89265725 30.15173045 21.63358406 0.717490629 0.8759734 ENSBTAG00000006572 18.77931006 21.86184183 15.69677829 0.717998896 0.8759734 ENSBTAG00000009117 22.34994227 26.01645711 18.68342743 0.718138805 0.8759734 ENSBTAG00000020921 32.80985015 38.19085158 27.42884873 0.71820469 0.8759734 ENSBTAG00000015662 33.20384838 38.64114982 27.76654693 0.718574552 0.8759734 ENSBTAG00000011530 13.67237757 15.90963152 11.43512361 0.718754774 0.8759734 786637 24.52181582 28.53432423 20.50930742 0.718759178 0.8759734 ENSBTAG00000036274 27.38553485 31.86065076 22.91041895 0.719081953 0.8759734 ENSBTAG00000038134 31.94738618 37.14763986 26.7471325 0.720022392 0.8759734 ENSBTAG00000004852 34.82480974 40.48942639 29.16019308 0.720192793 0.8759734 ENSBTAG00000019456 26.26305221 30.52437685 22.00172756 0.72079203 0.8759734 506525 3.330403105 3.869668811 2.7911374 0.721285861 0.8759734 ENSBTAG00000020569 84.80736337 98.535145 71.07958175 0.721362736 0.8759734 ENSBTAG00000038712 13.84623342 16.08656134 11.60590551 0.721465903 0.8759734 ENSBTAG00000039287 477.243927 554.4005194 400.0873347 0.721657576 0.8759734 ENSBTAG00000011176 51.01649115 59.25095532 42.78202698 0.722047885 0.8759734 407226 6.289703326 7.304012 5.275394651 0.722259855 0.8759734 ENSBTAG00000015077 65.66811847 76.19277569 55.14346125 0.723736086 0.8759734 ENSBTAG00000000287 228.390656 264.9409305 191.8403814 0.72408737 0.8759734 ENSBTAG00000015345 21.48111342 24.89559356 18.06663328 0.725696025 0.8759734 ENSBTAG00000007461 197.4096279 228.7680259 166.0512299 0.725849818 0.8759734 ENSBTAG00000009913 9.399658932 10.89261628 7.906701581 0.725877179 0.8759734 ENSBTAG00000000442 47.77237335 55.35529102 40.18945568 0.726027358 0.8759734 ENSBTAG00000030629 3.037225391 3.519203739 2.555247044 0.726086704 0.8759734 100336149 21.43812155 24.83049457 18.04574853 0.726757515 0.8759734 ENSBTAG00000018164 36.82396062 42.63325272 31.01466851 0.727476008 0.8759734 ENSBTAG00000014441 20.93444673 24.22981718 17.63907628 0.727990481 0.8759734 613930 355.7791766 411.7594665 299.7988867 0.728092275 0.8759734

PAGE 227

ENSBTAG00000003414 4.005594482 4.635697952 3.375491012 0.728151628 0.8759734 790651 3.789621662 4.385485643 3.193757681 0.72825633 0.8759734 538392 16.29614415 18.85464076 13.73764753 0.728608288 0.8759734 100294792 27.76106548 32.11904656 23.40308441 0.728635714 0.8759734 ENSBTAG00000012158 29.17527827 33.75523955 24.59531698 0.728637015 0.8759734 ENSBTAG00000011205 11.77400904 13.62214738 9.925870702 0.728656828 0.8759734 ENSBTAG00000003763 59.4270028 68.75328937 50.10071623 0.728702826 0.8759734 ENSBTAG00000015264 103.8995132 120.1993885 87.59963786 0.728786053 0.8759734 ENSBTAG00000020988 14.91522383 17.24548583 12.58496183 0.729753975 0.8759734 100337053 26.60920716 30.76294332 22.45547101 0.729951968 0.8759734 ENSBTAG00000000094 82.86588562 95.78924691 69.94252432 0.730170939 0.8759734 ENSBTAG00000004750 19.32533352 22.33911033 16.3115567 0.730179334 0.8759734 ENSBTAG00000012107 4.011475819 4.635697952 3.387253686 0.73068904 0.8759734 ENSBTAG00000017938 1.299602005 1.501693453 1.097510557 0.730848599 0.8759734 ENSBTAG00000025809 5.839797872 6.745764893 4.93383085 0.731396799 0.8759734 ENSBTAG00000007734 79.2422447 91.53493404 66.94955535 0.731409882 0.8759734 ENSBTAG00000019322 10.18310068 11.76278014 8.603421219 0.731410527 0.8759734 781021 11.77044904 13.59129516 9.949602924 0.732057012 0.8759734 510255 9.365050969 10.81163768 7.918464255 0.732401925 0.8759734 ENSBTAG00000038043 14.42817786 16.65250455 12.20385116 0.732853795 0.8759734 ENSBTAG00000009530 27.82208219 32.11086306 23.53330132 0.732876637 0.8759734 784933 7.62630898 8.801823504 6.450794456 0.732892957 0.8759734 ENSBTAG00000039902 3.299550887 3.807964373 2.7911374 0.732973612 0.8759734 ENSBTAG00000003961 17.99572436 20.76462178 15.22682694 0.73330625 0.8759734 ENSBTAG00000031765 17.2344736 19.88246027 14.58648694 0.733635915 0.8759734 ENSBTAG00000004114 21.87794589 25.23836253 18.51752925 0.733705652 0.8759734 ENSBTAG00000042675 14.13845805 16.30592143 11.97099466 0.73415015 0.8759734 ENSBTAG00000027110 116.7523578 134.5845222 98.92019332 0.735004231 0.8759734 527659 5.181040937 5.972039645 4.390042228 0.735099311 0.8759734 530813 36.9883653 42.63367232 31.34305827 0.73517144 0.8759734 ENSBTAG00000005615 10.79851995 12.44394873 9.153091178 0.735545555 0.8759734 514613 181.754266 209.4355443 154.0729878 0.735658258 0.8759734 787665 11.86311137 13.66506504 10.06115771 0.736268556 0.8759734 528615 481.704225 554.8660399 408.5424101 0.736290169 0.8759734 ENSBTAG00000015535 3.305941283 3.807964373 2.803918192 0.736329944 0.8759734 ENSBTAG00000001782 102.787147 118.3577826 87.21651145 0.736888691 0.8759734 ENSBTAG00000038411 23.54769288 27.09821716 19.99716859 0.737951448 0.8759734 538091 126.6879932 145.7803844 107.595602 0.738066389 0.8759734 789539 5.05258242 5.813896603 4.291268238 0.738105359 0.8759734 ENSBTAG00000001539 92.28366655 106.1505864 78.41674674 0.738731169 0.8759734 ENSBTAG00000031084 27.08632813 31.15251189 23.02014437 0.738949862 0.8759734 614783 39.2061799 45.08706341 33.32529639 0.739132112 0.8759734 ENSBTAG00000007794 9.927952906 11.41231506 8.443590748 0.7398666 0.8759734 ENSBTAG00000011760 32.58457524 37.45574245 27.71340803 0.739897442 0.8759734 ENSBTAG00000040108 93.44042313 107.4059494 79.47489681 0.739948739 0.8759734 ENSBTAG00000010964 28.08987747 32.28439832 23.89535661 0.740151834 0.8759734 ENSBTAG00000008091 16.7307112 19.22826195 14.23316046 0.740220853 0.8759734 786798 11.95873604 13.73786015 10.17961194 0.740989633 0.8759734 ENSBTAG00000013116 103.8699442 119.2849297 88.45495873 0.741543453 0.8759734 785947 18.92321873 21.73122423 16.11521322 0.741569506 0.8759734 ENSBTAG00000008089 32.69093629 37.5246556 27.85721697 0.742371023 0.8759734 ENSBTAG00000026772 8.53155719 9.787212737 7.275901643 0.74340896 0.8759734

PAGE 228

ENSBTAG00000012320 5.031367283 5.771466328 4.291268238 0.743531712 0.8759734 100139386 12.95073392 14.85435436 11.04711348 0.743695297 0.8759734 ENSBTAG00000000279 29.36369486 33.6781429 25.04924681 0.743783494 0.8759734 ENSBTAG00000031981 48.04027699 55.09356844 40.98698554 0.743952274 0.8759734 783090 68.44520533 78.47977245 58.41063821 0.744276345 0.8759734 100337473 30.64180325 35.12527285 26.15833366 0.744715458 0.8759734 789640 3.123855001 3.580908176 2.666801826 0.744727788 0.8759734 ENSBTAG00000021358 20.27774488 23.24012641 17.31536336 0.745063218 0.8759734 ENSBTAG00000037295 26.69808141 30.59426479 22.80189803 0.745299754 0.8759734 ENSBTAG00000040278 9.925280989 11.37369895 8.476863031 0.745303975 0.8759734 ENSBTAG00000038783 72.03295507 82.54120811 61.52470203 0.745381652 0.8759734 533397 108.5083792 124.2743517 92.74240661 0.746271498 0.8759734 ENSBTAG00000009498 84.1125958 96.33307658 71.89211502 0.74628692 0.8759734 ENSBTAG00000012423 124.8384277 142.957877 106.7189784 0.746506457 0.8759734 ENSBTAG00000024105 43.59621486 49.92229211 37.2701376 0.746563029 0.8759734 100335680 23.63347149 27.05578689 20.21115609 0.747017863 0.8759734 ENSBTAG00000016060 20.63137859 23.61374759 17.64900959 0.747404008 0.8759734 ENSBTAG00000035333 9.834989286 11.25417202 8.415806551 0.747794377 0.8759734 100125916 20.72734905 23.71400035 17.74069775 0.748110715 0.8759734 ENSBTAG00000019612 10.561721 12.0819056 9.041536396 0.748353504 0.8759734 ENSBTAG00000008492 61.95050811 70.84893887 53.05207735 0.748805532 0.8759734 ENSBTAG00000006745 104.2553247 119.2047903 89.30585912 0.74918012 0.8759734 ENSBTAG00000021193 406.4614559 464.6404988 348.2824129 0.749573948 0.8759734 280952 28.34032247 32.39241498 24.28822996 0.749812262 0.8759734 ENSBTAG00000010875 43.39201808 49.57231442 37.21172173 0.750655324 0.8759734 ENSBTAG00000007167 281.5153077 321.567532 241.4630834 0.750893854 0.8759734 ENSBTAG00000006816 1073.641443 1225.601052 921.6818336 0.75202435 0.8759734 782061 21.8910747 24.98045411 18.80169529 0.752656265 0.8759734 ENSBTAG00000011508 13.99850919 15.97084857 12.0261698 0.753007565 0.8759734 100336031 19.32439852 22.04314098 16.60565606 0.753325312 0.8759734 ENSBTAG00000006686 3.392570892 3.869668811 2.915472974 0.753416666 0.8759734 ENSBTAG00000002593 8.980449717 10.24181252 7.719086913 0.753683676 0.8759734 100298387 92.5177977 105.5065211 79.52907433 0.753783496 0.8759734 100335170 81.15980279 92.52899416 69.79061142 0.754256674 0.8759734 617774 17.90255195 20.41034255 15.39476136 0.754262763 0.8759734 ENSBTAG00000000564 21.73819501 24.78036818 18.69602185 0.75446909 0.8759734 ENSBTAG00000031352 100.334411 114.3599838 86.30883817 0.754711878 0.8759734 ENSBTAG00000013131 54.77174051 62.42455071 47.1189303 0.754814088 0.8759734 615798 62.66797021 71.41390731 53.92203312 0.755063476 0.8759734 ENSBTAG00000006387 2.372060098 2.703048216 2.041071981 0.755100101 0.8759734 100298642 9.07702972 10.33436918 7.819690265 0.756668369 0.8759734 ENSBTAG00000013202 11.35026282 12.92170462 9.778821023 0.756774846 0.8759734 ENSBTAG00000024081 63.28290358 72.03385886 54.53194831 0.757032168 0.8759734 ENSBTAG00000007846 26.86176127 30.57499062 23.14853192 0.757106755 0.8759734 ENSBTAG00000019857 467.1697628 531.7253486 402.6141769 0.757184471 0.8759734 100337047 12.07029083 13.73786015 10.40272151 0.757230121 0.8759734 516825 44.02456412 50.07557842 37.97354982 0.758324737 0.8759734 100299770 1273.168645 1447.902542 1098.434748 0.758638594 0.8759734 ENSBTAG00000039789 12.27366659 13.95333829 10.5939949 0.759244467 0.8759734 100336481 13.46767557 15.30895414 11.626397 0.759450769 0.8759734 613633 15.11426902 17.17989944 13.04863859 0.759529393 0.8759734 ENSBTAG00000002058 3623.862138 4118.373273 3129.351004 0.759851232 0.8759734

PAGE 229

100335876 49.27436238 55.99791128 42.55081347 0.759864297 0.8759734 540786 25.29180505 28.74210626 21.84150384 0.759913127 0.8759734 ENSBTAG00000020252 32.22624944 36.61982537 27.83267351 0.760043862 0.8759734 783403 8.993009505 10.21865641 7.767362602 0.76011584 0.8759734 540425 18.27615396 20.76080762 15.7915003 0.76063998 0.8759734 ENSBTAG00000018673 7.989552482 9.075191926 6.903913039 0.760745678 0.8759734 ENSBTAG00000012687 52.25989712 59.35473823 45.16505602 0.760934297 0.8759734 ENSBTAG00000010247 111.173246 126.2494995 96.09699238 0.761167313 0.8759734 337870 16.48959356 18.71965383 14.25953329 0.761741292 0.8759734 ENSBTAG00000018419 39.15732345 44.4400738 33.87457309 0.762252854 0.8759734 514637 2.372661466 2.69147016 2.053852773 0.763096988 0.8759734 ENSBTAG00000021121 61.12659678 69.32360192 52.92959163 0.763514736 0.8759734 ENSBTAG00000000390 319.1667679 361.9547732 276.3787626 0.763572642 0.8759734 539475 361.4410875 409.8747945 313.0073805 0.763665843 0.8759734 617860 201.5591551 228.5329896 174.5853206 0.763939249 0.8759734 ENSBTAG00000019901 140.0721961 158.7992184 121.3451738 0.764142135 0.8759734 ENSBTAG00000003295 76.71989832 86.97640053 66.4633961 0.764154365 0.8759734 ENSBTAG00000022539 128.0158901 145.1103742 110.9214059 0.764393356 0.8759734 ENSBTAG00000036224 18.37464968 20.82251206 15.92678731 0.764883087 0.8759734 ENSBTAG00000015217 49.16502102 55.71351999 42.61652205 0.764922447 0.8759734 613426 684.8750931 776.0882499 593.6619362 0.764941276 0.8759734 ENSBTAG00000023283 13.57439193 15.38223664 11.76654722 0.764943844 0.8759734 ENSBTAG00000018538 149.7746301 169.6752643 129.873996 0.765426808 0.8759734 ENSBTAG00000019417 11.09662381 12.5673576 9.625890008 0.765943829 0.8759734 ENSBTAG00000000785 5.123767959 5.802318547 4.445217371 0.766110536 0.8759734 ENSBTAG00000016948 156.3942815 177.0858479 135.7027151 0.766310333 0.8759734 ENSBTAG00000012170 1024.042068 1159.515784 888.5683528 0.766327087 0.8759734 ENSBTAG00000039695 44.28527073 50.13007414 38.44046732 0.766814492 0.8759734 785987 17.37640538 19.66310018 15.08971057 0.767412587 0.8759734 ENSBTAG00000039696 14.22602887 16.09425745 12.35780029 0.767839108 0.8759734 ENSBTAG00000007047 70.86996779 80.17427532 61.56566027 0.767897933 0.8759734 536389 1526.187579 1726.236072 1326.139087 0.7682258 0.8759734 ENSBTAG00000017964 95.02565318 107.4797871 82.57151924 0.768251608 0.8759734 ENSBTAG00000031106 40.35538217 45.63705923 35.07370512 0.768535609 0.8759734 100335974 85.63933382 96.82864448 74.45002316 0.768884286 0.8759734 ENSBTAG00000011595 72.01760952 81.41078384 62.6244352 0.769240047 0.8759734 ENSBTAG00000001187 153.4090367 173.4032926 133.4147808 0.769390124 0.8759734 ENSBTAG00000019534 967.7237766 1093.718175 841.7293784 0.769603539 0.8759734 ENSBTAG00000013113 4375.618436 4944.283176 3806.953696 0.769970805 0.8759734 ENSBTAG00000033405 64.78628353 73.20582356 56.3667435 0.769976223 0.8759734 ENSBTAG00000021886 33.51948624 37.87512067 29.16385181 0.770000235 0.8759734 ENSBTAG00000005915 46.08317495 52.06369866 40.10265124 0.770261281 0.8759734 ENSBTAG00000021790 820.497461 926.8425791 714.1523428 0.770521725 0.8759734 ENSBTAG00000009501 151.604296 171.1981815 132.0104106 0.771097038 0.8759734 ENSBTAG00000032288 40.64487983 45.88727154 35.40248813 0.771509984 0.8759734 ENSBTAG00000030845 27.43800439 30.97558208 23.9004267 0.771589268 0.8759734 ENSBTAG00000027809 195.1034133 220.2494705 169.957356 0.771658409 0.8759734 ENSBTAG00000038612 21.50434165 24.25304109 18.75564222 0.773331565 0.8759734 787914 220.4416914 248.5309421 192.3524406 0.773957717 0.8759734 100335607 399.2106997 449.8971532 348.5242461 0.774675376 0.8759734 ENSBTAG00000021304 487.5362896 549.4159413 425.6566379 0.77474388 0.8759734 ENSBTAG00000018796 13.61291297 15.33980636 11.88601958 0.774848085 0.8759734

PAGE 230

100298963 14.98287341 16.8834427 13.08230412 0.774859983 0.8759734 ENSBTAG00000026812 4.21689094 4.75141072 3.68237116 0.775005862 0.8759734 618559 7.299518402 8.224302235 6.37473457 0.775109473 0.8759734 ENSBTAG00000006405 194.5516242 219.1591074 169.9441409 0.775437275 0.8759734 ENSBTAG00000019929 945.4019879 1064.767833 826.0361424 0.775789911 0.8759734 ENSBTAG00000003397 1794.475864 2020.456471 1568.495258 0.776307374 0.8759734 ENSBTAG00000034681 654.087126 736.3836231 571.7906289 0.776484717 0.8759734 783323 9.652083334 10.86564601 8.438520655 0.776623925 0.8759734 ENSBTAG00000004856 388.1912323 436.8965551 339.4859095 0.777039566 0.8759734 100296271 83.43098364 93.88086365 72.98110363 0.777379977 0.8759734 280895 120.8407195 135.9668921 105.7145468 0.77750212 0.8759734 ENSBTAG00000013208 347.3285975 390.7884614 303.8687336 0.777578572 0.8759734 ENSBTAG00000007842 14247.59266 16025.79519 12469.39012 0.778082459 0.8759734 ENSBTAG00000011070 4804.316101 5403.919354 4204.712848 0.778085788 0.8759734 ENSBTAG00000001593 5.077489631 5.709761891 4.445217371 0.778529378 0.8759734 ENSBTAG00000011662 34.31770491 38.56835471 30.06705512 0.77957837 0.8759734 ENSBTAG00000030994 75.96022858 85.36822038 66.55223678 0.779590303 0.8759734 ENSBTAG00000016265 1671.736846 1878.636611 1464.83708 0.779734128 0.8759734 ENSBTAG00000010995 44.53896985 50.04237421 39.03556548 0.780050229 0.8759734 508193 45.43713898 51.0474572 39.82682076 0.780192059 0.8759734 ENSBTAG00000033699 50.34813259 56.54513551 44.15112966 0.780812165 0.8759734 ENSBTAG00000000962 143.6437004 161.3213192 125.9660815 0.780839644 0.8759734 ENSBTAG00000000752 2695.91948 3027.67331 2364.16565 0.780852294 0.8759734 ENSBTAG00000036858 9.010526626 10.11840365 7.902649606 0.781017429 0.8759734 524590 3.391332233 3.807964373 2.974700092 0.781178551 0.8759734 ENSBTAG00000004043 37.46526676 42.05184951 32.87868401 0.781860593 0.8759734 ENSBTAG00000006756 9298.844453 10435.23254 8162.456361 0.782201674 0.8759734 ENSBTAG00000016515 102.7483674 115.3010781 90.19565677 0.782262042 0.8759734 ENSBTAG00000007271 20.33852634 22.82074818 17.8563045 0.782459206 0.8759734 ENSBTAG00000003115 1787.969189 2005.508119 1570.430259 0.78305854 0.8759734 ENSBTAG00000021851 153.3735568 172.0286866 134.718427 0.783116058 0.8759734 ENSBTAG00000011011 34.92875863 39.1763086 30.68120866 0.783157213 0.8759734 ENSBTAG00000018105 86.94452304 97.49311143 76.39593464 0.783603411 0.8759734 515401 43.99605283 49.31391862 38.67818703 0.78432597 0.8759734 ENSBTAG00000019414 429.6768556 481.611493 377.7422182 0.784329742 0.8759734 ENSBTAG00000025242 33.76778175 37.84475584 29.69080766 0.784542191 0.8759734 100139490 146.1485319 163.7365816 128.5604822 0.785166521 0.8759734 ENSBTAG00000000429 10.57155147 11.83606263 9.307040311 0.786329086 0.8759734 783390 781.3452924 874.6253951 688.0651896 0.786697017 0.8759734 ENSBTAG00000017388 299.3239221 335.0509461 263.5968982 0.786736767 0.8759734 282447 37.97435125 42.50312252 33.44557999 0.786897009 0.8759734 ENSBTAG00000013905 16056.21708 17968.45812 14143.97604 0.787155801 0.8759734 ENSBTAG00000014177 14.13773926 15.81707487 12.45840364 0.78765535 0.8759734 ENSBTAG00000015758 30.22471638 33.80980307 26.63962969 0.787926201 0.8759734 281496 981.6472315 1097.875464 865.4189992 0.788267001 0.8759734 ENSBTAG00000002462 985.2357071 1101.883192 868.5882219 0.788276133 0.8759734 ENSBTAG00000032477 1552.566431 1735.571312 1369.56155 0.789112807 0.8759734 ENSBTAG00000013300 208.4319949 232.9766496 183.8873403 0.789295153 0.8759734 ENSBTAG00000005178 5.491190789 6.137391406 4.844990173 0.789421735 0.8759734 ENSBTAG00000003265 6364.286795 7111.836477 5616.737112 0.789773096 0.8759734 100138653 53.54281681 59.82958695 47.25604667 0.789844107 0.8759734 ENSBTAG00000007802 28678.48017 32043.71552 25313.24482 0.789959729 0.8759734

PAGE 231

ENSBTAG00000005760 351.0899484 392.2659433 309.9139535 0.790060822 0.8759734 ENSBTAG00000002568 25.78525243 28.80776044 22.76274441 0.790160153 0.8759734 ENSBTAG00000018680 224.9011234 251.2095926 198.5926542 0.790545664 0.8759734 ENSBTAG00000009071 23.09996717 25.78940092 20.41053343 0.79143108 0.8759734 615361 11.82291621 13.1988872 10.44694522 0.79150197 0.8759734 ENSBTAG00000030337 571.2301387 637.6979797 504.7622977 0.791538179 0.8759734 ENSBTAG00000020784 490.1574243 547.1478669 433.1669818 0.791681752 0.8759734 ENSBTAG00000023523 1827.233943 2039.534773 1614.933112 0.791814454 0.8759734 ENSBTAG00000019903 143.8098196 160.5096009 127.1100384 0.791915485 0.8759734 282034 3121.124663 3483.343269 2758.906058 0.792028188 0.8759734 ENSBTAG00000017061 617.707214 689.3897734 546.0246547 0.792040549 0.8759734 ENSBTAG00000011214 64.36774185 71.83530288 56.90018081 0.792092168 0.8759734 ENSBTAG00000019600 18.94216195 21.13831075 16.74601316 0.792211514 0.8759734 ENSBTAG00000002912 374.8065331 418.167205 331.4458612 0.792615627 0.8759734 ENSBTAG00000003027 97.43509265 108.7047176 86.16546771 0.792656194 0.8759734 ENSBTAG00000006595 9.274797825 10.34594723 8.203648417 0.792933526 0.8759734 ENSBTAG00000034883 32.65780846 36.42701596 28.88860096 0.793054281 0.8759734 ENSBTAG00000004595 12.42520566 13.85745486 10.99295646 0.793288274 0.8759734 513906 9451.062954 10536.06465 8366.061254 0.794040425 0.8759734 ENSBTAG00000034854 98.01236134 109.2601253 86.76459736 0.794110359 0.8759734 100336677 30.64957776 34.16359491 27.13556062 0.79428294 0.8759734 ENSBTAG00000002382 1572.843486 1753.16605 1392.520922 0.794289235 0.8759734 ENSBTAG00000005347 789.0908184 879.3095239 698.8721129 0.794796478 0.8759734 100299712 511.1003618 569.2586116 452.9421119 0.795670198 0.8759734 ENSBTAG00000003837 77.94277446 86.80869678 69.07685214 0.795736541 0.8759734 ENSBTAG00000017921 50.48186527 56.21831394 44.74541659 0.795922422 0.8759734 539217 739.3407926 823.2920888 655.3894964 0.79605951 0.8759734 ENSBTAG00000031088 301.5124497 335.6797719 267.3451276 0.796429067 0.8759734 ENSBTAG00000019615 131.0938729 145.9413033 116.2464424 0.79652874 0.8759734 ENSBTAG00000012408 2657.323786 2958.212055 2356.435518 0.796574239 0.8759734 ENSBTAG00000021035 84.32812872 93.85049882 74.80575863 0.797073639 0.8759734 ENSBTAG00000014451 1442.070674 1604.814464 1279.326884 0.797180554 0.8759734 ENSBTAG00000007629 100.636827 111.9781462 89.29550781 0.797436919 0.8759734 786396 116.4561178 129.5729867 103.339249 0.797536984 0.8759734 ENSBTAG00000033680 70.34936434 78.26331953 62.43540916 0.79776081 0.8759734 ENSBTAG00000023513 681.8955363 758.5738371 605.2172355 0.79783563 0.8759734 ENSBTAG00000003968 514.2788509 572.042774 456.5149278 0.798043343 0.8759734 ENSBTAG00000020734 9110.809848 10132.35102 8089.268678 0.798360485 0.8759734 ENSBTAG00000013192 349.0035823 388.0902527 309.916912 0.798569173 0.8759734 100337206 195.1374057 216.9892178 173.2855937 0.798590803 0.8759734 ENSBTAG00000001792 10.07385164 11.19683692 8.950866357 0.799410264 0.8759734 508938 808.3427775 898.3863813 718.2991738 0.799543703 0.8759734 515828 4.054781136 4.50508036 3.604481913 0.800092701 0.8759734 281662 2556.792704 2840.703722 2272.881686 0.800112193 0.8759734 ENSBTAG00000012159 9879.42217 10975.77019 8783.074153 0.800223948 0.8759734 ENSBTAG00000005517 4368.416565 4852.333174 3884.499956 0.800542712 0.8759734 ENSBTAG00000003550 1978.765113 2197.537585 1759.992642 0.800893079 0.8759734 ENSBTAG00000001786 112.5863803 125.0274762 100.1452844 0.800986211 0.8759734 616227 71.8147038 79.75004036 63.87936723 0.800994795 0.8759734 ENSBTAG00000036183 9.358697984 10.39225946 8.325136512 0.801090133 0.8759734 ENSBTAG00000016376 101.6875707 112.9056451 90.46949625 0.801284082 0.8759734 ENSBTAG00000000305 450.1649651 499.8117364 400.5181939 0.801338113 0.8759734

PAGE 232

783484 86.08855535 95.57911289 76.59799782 0.801409382 0.8759734 785419 73.78731968 81.91078887 65.66385049 0.801650813 0.8759734 ENSBTAG00000013648 80.26161415 89.09618093 71.42704738 0.801684726 0.8759734 ENSBTAG00000011683 1596.811627 1772.565369 1421.057885 0.801695616 0.8759734 523694 176.8201318 196.2793757 157.3608878 0.801718913 0.8759734 ENSBTAG00000020322 44.1759641 49.03624865 39.31567955 0.801767685 0.8759734 ENSBTAG00000003819 10.03164237 11.13513249 8.928152252 0.801800272 0.8759734 ENSBTAG00000008546 336.3924212 373.2673907 299.5174517 0.802420622 0.8759734 ENSBTAG00000014435 82.51088532 91.53320502 73.48856562 0.802862367 0.8759734 ENSBTAG00000005458 32.86823608 36.45884295 29.2776292 0.803032319 0.8759734 517598 14.58771446 16.179118 12.99631093 0.803276849 0.8759734 ENSBTAG00000020174 5537.222878 6141.061143 4933.384613 0.803343998 0.8759734 785629 94.90025774 105.2351528 84.56536263 0.803584737 0.8759734 ENSBTAG00000022204 161.8692643 179.4885403 144.2499883 0.803672413 0.8759734 ENSBTAG00000018155 1499.827386 1663.005401 1336.649371 0.80375528 0.8759734 531868 202.2682178 224.2529481 180.2834875 0.803929174 0.8759734 ENSBTAG00000002361 89.54408553 99.27289445 79.81527661 0.803998685 0.8759734 ENSBTAG00000007202 3615.38721 4007.150757 3223.623664 0.804467778 0.8759734 ENSBTAG00000001553 34324.8492 38039.02709 30610.67132 0.804717514 0.8759734 ENSBTAG00000007012 625.9533669 693.4921858 558.414548 0.805221111 0.8759734 ENSBTAG00000015193 165.4313761 183.28071 147.5820421 0.805224085 0.8759734 ENSBTAG00000003407 552.5814914 612.1611646 493.0018182 0.805346446 0.8759734 ENSBTAG00000008010 264.2673219 292.7267707 235.807873 0.805556227 0.8759734 ENSBTAG00000005075 278.8000859 308.8107132 248.7894586 0.805637395 0.8759734 ENSBTAG00000007763 940.1932015 1041.272655 839.113748 0.805854013 0.8759734 ENSBTAG00000002390 59.90266033 66.34004436 53.4652763 0.805927654 0.8759734 ENSBTAG00000003699 327.5904796 362.7671695 292.4137898 0.806064645 0.8759734 ENSBTAG00000005904 2134.591512 2363.147955 1906.03507 0.806566117 0.8759734 ENSBTAG00000013525 575.4781347 636.8918766 514.0643928 0.80714547 0.8759734 ENSBTAG00000011172 897.5919272 993.2335299 801.9503244 0.807413665 0.8759734 ENSBTAG00000034495 1451.63718 1606.000817 1297.273543 0.807766427 0.8759734 509964 13.97600049 15.45891369 12.49308729 0.808147813 0.8759734 ENSBTAG00000000918 30.39001055 33.61262431 27.16739679 0.808249797 0.8759734 618289 227.6675254 251.7947422 203.5403087 0.808358058 0.8759734 ENSBTAG00000035998 183.7115179 203.168027 164.2550087 0.808468789 0.8759734 ENSBTAG00000003809 21.65556856 23.94882045 19.36231668 0.808487279 0.8759734 618534 11.90039005 13.16033888 10.64044122 0.808523346 0.8759734 ENSBTAG00000007003 2719.019378 3006.646402 2431.392354 0.80867253 0.8759734 ENSBTAG00000016643 206.7230255 228.534015 184.9120359 0.809122598 0.8759734 ENSBTAG00000018828 70.65300766 78.08750007 63.21851525 0.809585595 0.8759734 ENSBTAG00000018188 773.5997921 854.8957038 692.3038804 0.809810925 0.8759734 ENSBTAG00000019780 46.1899302 51.0393415 41.34051889 0.809973594 0.8759734 ENSBTAG00000031769 91.78618742 101.3931451 82.17922977 0.810500845 0.8759734 100139380 4.19797918 4.635697952 3.760260408 0.811153023 0.8759734 ENSBTAG00000020089 692.5339146 764.6565166 620.4113126 0.811359479 0.8759734 100337273 324.5732141 358.3435508 290.8028775 0.811519774 0.8759734 100297304 76.72980179 84.66729023 68.79231334 0.812501654 0.8759734 ENSBTAG00000015974 80.6082058 88.94580178 72.27060982 0.812524126 0.8759734 100337444 225.672611 249.0123809 202.3328411 0.81254129 0.8759734 ENSBTAG00000013309 1746.552976 1925.634394 1567.471558 0.81400268 0.8759734 ENSBTAG00000017942 137.8501603 151.9832309 123.7170898 0.814018027 0.8759734 ENSBTAG00000021633 790.6730138 871.6584122 709.6876154 0.814180883 0.8759734

PAGE 233

ENSBTAG00000032372 342.9814165 378.0811117 307.8817213 0.814327169 0.8759734 ENSBTAG00000005488 76.45667659 84.27889981 68.63445337 0.814372916 0.8759734 ENSBTAG00000019278 656.2615815 723.2447826 589.2783804 0.814770316 0.8759734 ENSBTAG00000021986 1289.778057 1421.385279 1158.170835 0.814818369 0.8759734 ENSBTAG00000019984 13934.5594 15355.98932 12513.12949 0.81486964 0.8759734 ENSBTAG00000033460 152.6194278 168.1789827 137.0598729 0.814964336 0.8759734 ENSBTAG00000011880 185.9803071 204.89192 167.0686943 0.815399135 0.8759734 ENSBTAG00000010968 23.44551502 25.82413509 21.06689495 0.815783177 0.8759734 ENSBTAG00000007833 838.0296181 922.8743146 753.1849216 0.816129466 0.8759734 ENSBTAG00000020037 134.0048366 147.543114 120.4665592 0.816483779 0.8759734 ENSBTAG00000021785 32.51782381 35.7997879 29.23585972 0.816648964 0.8759734 ENSBTAG00000011345 42.06748869 46.30727274 37.82770464 0.816884744 0.8759734 ENSBTAG00000014576 47.04534732 51.78651608 42.30417856 0.816895628 0.8759734 ENSBTAG00000002485 450.8752801 496.2460214 405.5045388 0.817144161 0.8759734 326579 4901.19636 5393.534172 4408.858549 0.817434062 0.8759734 100335833 51.04430535 56.16818756 45.92042314 0.817552161 0.8759734 519739 15.50199379 17.0531638 13.95082378 0.818078331 0.8759734 ENSBTAG00000005854 2250.473572 2475.634057 2025.313087 0.818098734 0.8759734 507693 61.21233874 67.31101615 55.11366132 0.818791105 0.8759734 ENSBTAG00000007066 1389.942389 1527.886012 1251.998766 0.819432049 0.8759734 ENSBTAG00000033255 514.9499217 566.0540499 463.8457935 0.819437284 0.8759734 ENSBTAG00000000801 1003.212523 1102.751161 903.6738845 0.819472168 0.8759734 ENSBTAG00000000510 61.07485268 67.12590284 55.02380252 0.819710428 0.8759734 ENSBTAG00000014372 77.12398105 84.75652012 69.49144197 0.81989494 0.8759734 521416 22.89210263 25.15398937 20.63021589 0.820156818 0.8759734 ENSBTAG00000020244 41.72858282 45.84546424 37.61170141 0.820401801 0.8759734 ENSBTAG00000008895 13.78789351 15.14699694 12.42879008 0.820544833 0.8759734 514218 201.9185247 221.8066345 182.0304148 0.820671642 0.8759734 ENSBTAG00000005086 813.1125946 893.1412931 733.0838962 0.820792748 0.8759734 100335302 481.9351548 529.3420197 434.5282899 0.820883802 0.8759734 616954 1761.929332 1935.177167 1588.681497 0.820948864 0.8759734 ENSBTAG00000004873 154.2517312 169.3898982 139.1135641 0.821262457 0.8759734 ENSBTAG00000014835 5334.754177 5857.491009 4812.017344 0.821515105 0.8759734 ENSBTAG00000014106 253.3131879 278.1222091 228.5041667 0.82159626 0.8759734 ENSBTAG00000017131 10.72628793 11.77435819 9.678217671 0.821974116 0.8759734 ENSBTAG00000011556 74.75618953 82.00827004 67.50410902 0.823137825 0.8759734 ENSBTAG00000008764 68.38302273 75.01520001 61.75084545 0.823177775 0.8759734 ENSBTAG00000013393 15.60586179 17.11486824 14.09685534 0.823661342 0.8759734 ENSBTAG00000018847 1340.547957 1470.077085 1211.01883 0.823779136 0.8759734 ENSBTAG00000003712 9.712185496 10.65016787 8.774203119 0.823855851 0.8759734 ENSBTAG00000030170 413.8000813 453.6420909 373.9580717 0.824346063 0.8759734 618257 13.81775077 15.14748433 12.4880172 0.824428461 0.8759734 ENSBTAG00000006197 635.2372306 696.3673371 574.1071242 0.824431437 0.8759734 ENSBTAG00000008717 2620.09527 2870.491751 2369.698788 0.825537571 0.8759734 ENSBTAG00000015986 373.4705115 409.150293 337.7907301 0.82559083 0.8759734 ENSBTAG00000000580 55.31727849 60.58452542 50.05003155 0.826119066 0.8759734 ENSBTAG00000021078 710.8822942 778.3856509 643.3789375 0.826555496 0.8759734 ENSBTAG00000011785 2944.848535 3224.22855 2665.46852 0.826699621 0.8759734 ENSBTAG00000010403 200.9395201 219.9975292 181.8815111 0.826743426 0.8759734 ENSBTAG00000012095 239.5145086 262.2277707 216.8012465 0.826766921 0.8759734 ENSBTAG00000004238 79.17867732 86.65831764 71.699037 0.827376286 0.8759734 ENSBTAG00000003838 394.5704033 431.7951667 357.3456399 0.82758138 0.8759734

PAGE 234

ENSBTAG00000016830 855.8969526 936.5900277 775.2038775 0.82768752 0.8759734 ENSBTAG00000019730 7461.884751 8164.611928 6759.157573 0.827860238 0.8759734 781499 903.4830728 988.514552 818.4515935 0.827961098 0.8759734 ENSBTAG00000034879 351.1868016 384.2077007 318.1659024 0.828109124 0.8759734 100336798 51.88970488 56.75784207 47.02156768 0.828459398 0.8759734 ENSBTAG00000020607 860.268153 940.9195933 779.6167128 0.8285689 0.8759734 ENSBTAG00000017225 1873.400835 2048.936384 1697.865285 0.828656906 0.8759734 100126170 47.57869924 52.01412746 43.14327103 0.829452942 0.8759734 ENSBTAG00000000428 34.00960422 37.1515896 30.86761884 0.830855938 0.8759734 529009 154268.5125 168516.6241 140020.4009 0.830899632 0.8759734 539499 189.3140646 206.784996 171.8431332 0.83102322 0.8759734 ENSBTAG00000005824 642.1218653 701.1957638 583.0479668 0.831505261 0.8759734 ENSBTAG00000002590 2791.537522 3046.508042 2536.567001 0.832614576 0.8759734 515088 52.04085845 56.78813911 47.2935778 0.832807318 0.8759734 ENSBTAG00000019821 22214.90038 24233.74687 20196.05389 0.833385526 0.8759734 ENSBTAG00000002300 37.28316043 40.67023816 33.8960827 0.833437035 0.8759734 ENSBTAG00000023670 41.82765332 45.61785286 38.03745378 0.833828236 0.8759734 616893 20.32020765 22.15067025 18.48974505 0.834726211 0.8759734 ENSBTAG00000010961 512.100648 558.1989952 466.0023009 0.834831852 0.8759734 ENSBTAG00000021987 419.8532719 457.6448142 382.0617296 0.83484335 0.8759734 100336301 266.2338245 290.0852957 242.3823534 0.835555463 0.8759734 ENSBTAG00000003438 238.1472567 259.4714049 216.8231084 0.835633925 0.8759734 ENSBTAG00000026003 509.546145 555.0699701 464.0223198 0.835970859 0.8759734 ENSBTAG00000026708 255.8931659 278.7369692 233.0493625 0.83609061 0.8759734 513777 958.7285382 1044.225097 873.2319794 0.836248795 0.8759734 ENSBTAG00000008845 313.6496408 341.6189463 285.6803353 0.836254366 0.8759734 534649 240.2090298 261.6227918 218.7952678 0.836300486 0.8759734 ENSBTAG00000017321 2008.414241 2187.423797 1829.404685 0.836328419 0.8759734 ENSBTAG00000003861 2071.700767 2256.192254 1887.20928 0.836457654 0.8759734 ENSBTAG00000017996 288.7668213 314.4557785 263.0778641 0.836613229 0.8759734 ENSBTAG00000020484 58.36039756 63.5494318 53.17136333 0.836692978 0.8759734 ENSBTAG00000010083 1715.605571 1867.931966 1563.279176 0.836903701 0.8759734 616955 21.88334396 23.82589896 19.94078895 0.836937527 0.8759734 ENSBTAG00000001069 3607.465994 3927.485292 3287.446696 0.83703603 0.8759734 786015 11360.19294 12362.84541 10357.54046 0.83779584 0.8759734 ENSBTAG00000015329 400.3939587 435.5671425 365.2207749 0.838494779 0.8759734 ENSBTAG00000017593 282.7758122 307.565381 257.9862433 0.838801306 0.8759734 ENSBTAG00000025663 117.6653968 127.9489269 107.3818666 0.839255703 0.8759734 ENSBTAG00000015615 408.5117886 444.2050086 372.8185685 0.839293933 0.8759734 ENSBTAG00000000784 100.764617 109.5326546 91.99657954 0.83990094 0.8759734 100101130 617.8908641 671.6119261 564.1698021 0.840023502 0.8759734 282024 49.70290814 54.02005968 45.38575659 0.840164873 0.8759734 ENSBTAG00000013498 198.8105626 216.0699701 181.551155 0.840242422 0.8759734 532098 57505.42418 62484.42043 52526.42793 0.840632394 0.8759734 ENSBTAG00000012148 132.3958326 143.8427467 120.9489186 0.840841276 0.8759734 ENSBTAG00000008349 57.50841426 62.47869463 52.5381339 0.840896792 0.8759734 ENSBTAG00000009715 199.945893 217.1658807 182.7259052 0.841411665 0.8759734 ENSBTAG00000021120 1442.568069 1566.271059 1318.86508 0.842041403 0.8759734 509946 1108.54301 1203.554711 1013.53131 0.842114862 0.8759734 517876 6.523535352 7.080837752 5.966232952 0.842588569 0.8759734 ENSBTAG00000021895 1983.440172 2152.426789 1814.453555 0.842980381 0.8759734 514005 1351.473987 1466.479725 1236.46825 0.843154003 0.8759734

PAGE 235

ENSBTAG00000003784 2938.182943 3187.952675 2688.413211 0.84330399 0.8759734 ENSBTAG00000014262 1074.532517 1165.598319 983.4667154 0.843744109 0.8759734 ENSBTAG00000013757 5232.944622 5676.286247 4789.602998 0.843791661 0.8759734 ENSBTAG00000020965 70.67615325 76.66283548 64.68947102 0.843817876 0.8759734 ENSBTAG00000006805 527.6985424 572.2433645 483.1537203 0.844315112 0.8759734 ENSBTAG00000018037 73.30133161 79.4855462 67.11711701 0.844393984 0.8759734 ENSBTAG00000016557 12393.42345 13436.8375 11350.00941 0.844693508 0.8759734 ENSBTAG00000016045 1064.597404 1153.94008 975.2547272 0.845151966 0.8759734 ENSBTAG00000013443 748.9156288 811.5910174 686.2402403 0.845549329 0.8759734 ENSBTAG00000010775 490.681039 531.7171909 449.6448872 0.845646699 0.8759734 ENSBTAG00000014840 45.24260231 49.0223864 41.46281823 0.84579355 0.8759734 ENSBTAG00000011417 179.7016946 194.6453185 164.7580707 0.846452779 0.8759734 100337296 591.9892646 641.0469836 542.9315456 0.846945013 0.8759734 ENSBTAG00000037765 752.6307395 814.9150597 690.3464193 0.847139111 0.8759734 ENSBTAG00000010616 43.06553752 46.61967687 39.51139817 0.847526213 0.8759734 507078 1.942419178 2.102370835 1.782467521 0.847836876 0.8759734 ENSBTAG00000016468 633.5106306 685.5708754 581.4503859 0.848125857 0.8759734 ENSBTAG00000001745 168.2553899 182.0331108 154.477669 0.848624013 0.8759734 100336702 6.562785993 7.100111915 6.02546007 0.848642971 0.8759734 ENSBTAG00000010709 635.8671898 687.7740542 583.9603254 0.849058382 0.8759734 100336786 12.56570303 13.58796839 11.54343766 0.849533744 0.8759734 100502548 45.58813321 49.29519964 41.88106678 0.849597265 0.8759734 ENSBTAG00000039812 528.4143894 571.3268078 485.501971 0.849779783 0.8759734 ENSBTAG00000009834 567.6040685 613.656141 521.5519959 0.849909194 0.8759734 ENSBTAG00000001693 232.114696 250.7585401 213.470852 0.851300426 0.8759734 ENSBTAG00000013265 334.1032268 360.8332782 307.3731755 0.851842649 0.8759734 ENSBTAG00000001821 7563.090824 8159.51245 6966.669199 0.853809494 0.8759734 ENSBTAG00000000026 226.0497296 243.8736223 208.2258369 0.85382681 0.8759734 ENSBTAG00000022530 142.5697319 153.7903232 131.3491406 0.854079359 0.8759734 ENSBTAG00000037725 28.31615406 30.5364423 26.09586581 0.854581079 0.8759734 ENSBTAG00000014659 788.6360907 850.3812876 726.8908938 0.854782325 0.8759734 ENSBTAG00000038173 122.9673091 132.5622273 113.3723909 0.855239031 0.8759734 ENSBTAG00000001009 1189.573343 1282.320418 1096.826268 0.85534493 0.8759734 ENSBTAG00000039233 204.1155417 220.0224143 188.208669 0.855406798 0.8759734 618516 1157.460244 1247.061959 1067.858528 0.856299497 0.8759734 ENSBTAG00000000356 151.2198819 162.912446 139.5273179 0.856455853 0.8759734 ENSBTAG00000014328 653.463465 703.7572394 603.1696906 0.857070673 0.8759734 ENSBTAG00000043546 74760.4968 80507.23642 69013.75719 0.857236694 0.8759734 ENSBTAG00000013436 1703.872172 1834.301991 1573.442352 0.857788063 0.8759734 530961 175.4340224 188.7860845 162.0819604 0.858548239 0.8759734 100336585 21.12314335 22.72819152 19.51809518 0.858761471 0.8759734 ENSBTAG00000003421 28.88142884 31.07597042 26.68688726 0.858762796 0.8759734 ENSBTAG00000005180 1480.340939 1592.617797 1368.064081 0.859003387 0.8759734 ENSBTAG00000008920 2304.495997 2479.129499 2129.862494 0.859117079 0.8759734 ENSBTAG00000021262 1471.619849 1582.427046 1360.812653 0.859952853 0.8759734 ENSBTAG00000010073 59.04900907 63.45736253 54.64065561 0.86106093 0.8759734 783202 48.23850665 51.82083065 44.65618266 0.861741931 0.8759734 ENSBTAG00000002041 1098.831316 1180.402551 1017.260081 0.861790818 0.8759734 ENSBTAG00000017631 7.461250209 8.012706043 6.909794376 0.862354658 0.8759734 517781 51.67345361 55.47932286 47.86758435 0.862800443 0.8759734 ENSBTAG00000007798 41.11007873 44.11720197 38.10295549 0.863675704 0.8759734 ENSBTAG00000003815 3559.57815 3819.515413 3299.640886 0.863889926 0.8759734

PAGE 236

ENSBTAG00000016747 2466.188925 2646.227662 2286.150188 0.863928006 0.8759734 520743 19.77075391 21.21159325 18.32991458 0.864146053 0.8759734 ENSBTAG00000037719 212.4697818 227.8923695 197.0471941 0.864650249 0.8759734 ENSBTAG00000008624 739.5623513 793.1493047 685.975398 0.864875496 0.8759734 ENSBTAG00000007756 24.19872874 25.94705657 22.45040092 0.865238832 0.8759734 ENSBTAG00000012332 2332.699141 2499.057352 2166.340929 0.866863231 0.8759734 ENSBTAG00000010465 607.7764838 650.8743296 564.678638 0.867569379 0.8759734 ENSBTAG00000003566 145.1244274 155.4138277 134.8350272 0.867587068 0.8759734 ENSBTAG00000014012 467.1404902 500.2015255 434.0794549 0.867809138 0.8759734 ENSBTAG00000019830 427.5423044 457.7250214 397.3595874 0.868118562 0.8759734 ENSBTAG00000000630 18165.41778 19445.10047 16885.73509 0.868379935 0.8759734 100337431 3.080587094 3.292147541 2.869026647 0.87147572 0.8759734 ENSBTAG00000006272 752.5008143 803.9130024 701.0886262 0.872095145 0.8759734 ENSBTAG00000001731 2295.453729 2452.007927 2138.89953 0.872305308 0.8759734 100335749 292.1390983 311.9767987 272.301398 0.872825797 0.8759734 ENSBTAG00000003215 836.293643 893.0729437 779.5143423 0.872845099 0.8759734 ENSBTAG00000034645 58.41654947 62.37109756 54.46200138 0.873192929 0.8759734 ENSBTAG00000012365 1666.316692 1778.771788 1553.861596 0.873558714 0.8759734 518021 1752.073359 1869.818431 1634.328288 0.874057214 0.8759734 ENSBTAG00000017368 23062.69588 24609.0418 21516.34995 0.874327011 0.8759734 ENSBTAG00000002018 3397.200884 3623.56981 3170.831958 0.875057505 0.8759734 ENSBTAG00000019358 383.9485061 409.3191749 358.5778373 0.87603479 0.8759734 ENSBTAG00000019474 19877.95749 21167.68175 18588.23322 0.878142134 0.8759734 ENSBTAG00000009475 723.2250711 769.8875821 676.5625601 0.878780975 0.8759734 ENSBTAG00000017659 19.6434094 20.90355845 18.38326036 0.879432103 0.8759734 ENSBTAG00000010513 143.5824172 152.7393475 134.4254869 0.880097297 0.8759734 ENSBTAG00000012644 128.3681906 136.5515587 120.1848226 0.880142444 0.8759734 786974 108.8149527 115.7023603 101.9275451 0.880946117 0.8759734 ENSBTAG00000009195 85.13381915 90.5055211 79.7621172 0.881295596 0.8759734 ENSBTAG00000010188 791.8513748 840.9949718 742.7077778 0.883129867 0.8759734 ENSBTAG00000016763 38.58297738 40.89070861 36.27524614 0.887126865 0.8759734 516762 2267.277914 2402.274972 2132.280856 0.887608988 0.8759734 ENSBTAG00000015186 655.1614633 693.901334 616.4215926 0.888341847 0.8759734 ENSBTAG00000031648 22.21541229 23.51016806 20.92065652 0.889855677 0.8759734 ENSBTAG00000003034 554.8528395 586.9469965 522.7586824 0.890640357 0.8759734 ENSBTAG00000031239 84.41537216 89.26555022 79.56519409 0.89133147 0.8759734 ENSBTAG00000001983 1463.302637 1546.965845 1379.63943 0.891835741 0.8759734 286843 76.07563543 80.40534905 71.74592182 0.892302846 0.8759734 ENSBTAG00000006969 3886.423796 4095.933441 3676.91415 0.897698706 0.8759734 ENSBTAG00000021913 6346.154262 6682.290764 6010.017759 0.899394829 0.8759734 518852 15.99917505 16.79525538 15.20309471 0.905201759 0.8759734 507708 21.87503563 22.95192095 20.79815031 0.906161639 0.8759734 ENSBTAG00000018451 883.7288528 925.6161909 841.8415147 0.909493074 0.8759734 ENSBTAG00000026327 1039.88723 1084.933829 994.840631 0.91695973 0.8759734 ENSBTAG00000003086 41.88459814 43.59757098 40.17162529 0.921418886 0.8759734 ENSBTAG00000000759 179.8706656 187.1479462 172.593385 0.92222965 0.8759734 ENSBTAG00000019906 2282.851289 2370.563651 2195.138927 0.925998729 0.8759734 ENSBTAG00000003077 1344.36573 1395.266183 1293.465277 0.927038362 0.8759734 ENSBTAG00000009736 402.2063864 416.7905603 387.6222125 0.930016775 0.8759734 100337476 3245.600433 3357.05309 3134.147776 0.933600897 0.8759734 100337004 119.0159803 122.5529507 115.4790098 0.942278494 0.8759734 ENSBTAG00000010230 305.1026801 313.0716033 297.1337568 0.949092009 0.8759734

PAGE 237

100336840 4485.948498 4579.666801 4392.230194 0.959071999 0.8759734 ENSBTAG00000005572 103.6370499 105.4116674 101.8624324 0.966329771 0.8759734 ENSBTAG00000044821 2.131863207 2.102370835 2.16135558 1.028056299 0.8759734 100336997 281593.0291 271937.0104 291249.0479 1.071016584 0.8759734 ENSBTAG00000012347 13.61917914 13.04455832 14.19379997 1.088101232 0.8759734 100335186 905.7386032 861.0781914 950.399015 1.103731374 0.8759734 ENSBTAG00000020641 2720.7042 2581.904336 2859.504063 1.107517433 0.8759734 ENSBTAG00000006607 12193.88458 11487.99363 12899.77552 1.122891945 0.8759734 ENSBTAG00000015154 11000.52345 10358.50327 11642.54364 1.123960029 0.8759734 ENSBTAG00000015683 3878.985334 3650.74989 4107.220779 1.125034829 0.8759734 ENSBTAG00000019214 5629.195845 5289.532429 5968.859261 1.128428522 0.8759734 ENSBTAG00000010387 2284.699423 2146.274608 2423.124238 1.128990777 0.8759734 ENSBTAG00000006165 395.9057429 371.1331757 420.67831 1.133496916 0.8759734 ENSBTAG00000003415 863.7497425 808.6119055 918.8875796 1.136376516 0.8759734 ENSBTAG00000013859 3607.609194 3373.41482 3841.803569 1.138847066 0.8759734 ENSBTAG00000012975 10486.31327 9801.505094 11171.12145 1.13973531 0.8759734 ENSBTAG00000009734 360.3566821 336.806865 383.9064991 1.139841669 0.8759734 ENSBTAG00000002820 5020.626732 4691.218862 5350.034601 1.140435942 0.8759734 ENSBTAG00000016104 680.1420224 635.2231487 725.0608961 1.141427068 0.8759734 ENSBTAG00000016618 755.691606 705.0684161 806.3147958 1.143597951 0.8759734 ENSBTAG00000011395 5092.963649 4750.232874 5435.694424 1.14430062 0.8759734 ENSBTAG00000002767 1808.108681 1684.941788 1931.275574 1.146197209 0.8759734 100335533 2446.850882 2279.66217 2614.039593 1.146678498 0.8759734 ENSBTAG00000002708 1612.893927 1501.549264 1724.23859 1.148306374 0.8759734 ENSBTAG00000012293 4843.838781 4508.979173 5178.698389 1.14853012 0.8759734 ENSBTAG00000019085 1137.074596 1057.931211 1216.217982 1.149619152 0.8759734 ENSBTAG00000009683 3084.647112 2868.844502 3300.449722 1.150445665 0.8759734 ENSBTAG00000021845 2739.550489 2547.160584 2931.940395 1.151062251 0.8759734 ENSBTAG00000007399 8978.009341 8337.040366 9618.978316 1.153764153 0.8759734 ENSBTAG00000026172 4000.436242 3713.851872 4287.020613 1.154332688 0.8759734 100337304 28.86676883 26.76695846 30.9665792 1.156895702 0.8759734 ENSBTAG00000021606 650.1965383 602.7639057 697.6291709 1.157383785 0.8759734 281281 504.8429558 467.8011389 541.8847727 1.158365655 0.8759734 ENSBTAG00000009983 5352.934283 4955.628842 5750.239723 1.160345116 0.8759734 ENSBTAG00000015614 658.0436142 608.2528796 707.8343487 1.163717218 0.8759734 ENSBTAG00000024725 122.3150339 113.0346649 131.5954028 1.164203944 0.8759734 ENSBTAG00000032961 260.2917192 240.4155635 280.1678748 1.165348327 0.8759734 517669 224.6081111 207.4085411 241.807681 1.165852089 0.8759734 ENSBTAG00000010018 238.6633845 220.2979314 257.0288377 1.16673287 0.8759734 ENSBTAG00000013602 6416.229621 5917.658369 6914.800872 1.168502884 0.8759734 ENSBTAG00000004531 9725.228342 8967.236052 10483.22063 1.169058177 0.8759734 ENSBTAG00000015635 39.61718752 36.4890722 42.74530285 1.171454912 0.8759734 617051 1531.403266 1410.380768 1652.425764 1.171616773 0.8759734 ENSBTAG00000033095 1366.606572 1258.362739 1474.850406 1.172039158 0.8759734 ENSBTAG00000025787 532.5233427 490.2148583 574.8318272 1.172612003 0.8759734 ENSBTAG00000000504 1875.982154 1726.857625 2025.106684 1.172712014 0.8759734 ENSBTAG00000002476 905.5222294 833.4568896 977.5875692 1.172931175 0.8759734 ENSBTAG00000001254 531.2808863 488.7868035 573.774969 1.173875737 0.8759734 ENSBTAG00000004279 23350.01621 21446.06512 25253.96731 1.177557149 0.8759734 ENSBTAG00000017613 606.1219188 556.5552923 655.6885452 1.178119325 0.8759734 ENSBTAG00000005326 1571.932092 1442.59232 1701.271864 1.179315764 0.8759734 ENSBTAG00000039922 267.9893631 245.8767109 290.1020154 1.179867806 0.8759734

PAGE 238

ENSBTAG00000011145 3363.662969 3085.236891 3642.089048 1.180489271 0.8759734 ENSBTAG00000005057 1989.890878 1824.342676 2155.43908 1.181488055 0.8759734 ENSBTAG00000024918 913.0697205 836.4646587 989.6747823 1.183163893 0.8759734 ENSBTAG00000000203 915.7663395 838.5623633 992.9703158 1.184134131 0.8759734 ENSBTAG00000002187 515.8633769 472.1566115 559.5701422 1.185136729 0.8759734 ENSBTAG00000024608 392.5292111 358.6383464 426.4200757 1.18899744 0.8759734 ENSBTAG00000002432 445.891041 407.0384421 484.74364 1.190903831 0.8759734 ENSBTAG00000019748 1384.714803 1264.010593 1505.419013 1.190986073 0.8759734 ENSBTAG00000004901 1009.903126 921.7832229 1098.023029 1.191194417 0.8759734 ENSBTAG00000033224 322.1269855 293.9965512 350.2574198 1.191365743 0.8759734 ENSBTAG00000015024 121.0513514 110.4594627 131.64324 1.191778746 0.8759734 ENSBTAG00000002196 3469.792848 3166.121081 3773.464614 1.191825744 0.8759734 100301478 380.6184976 347.2740897 413.9629056 1.192035104 0.8759734 ENSBTAG00000012090 2301.48045 2099.525313 2503.435588 1.192381713 0.8759734 ENSBTAG00000040167 300.8054467 274.1912554 327.4196379 1.194128666 0.8759734 ENSBTAG00000007330 1127.960517 1027.697917 1228.223118 1.195120762 0.8759734 ENSBTAG00000038920 683.3217333 622.3746125 744.2688541 1.195853493 0.8759734 506860 134.1099847 121.9743826 146.2455868 1.19898608 0.8759734 ENSBTAG00000007442 2257.347966 2052.083891 2462.612042 1.200054273 0.8759734 ENSBTAG00000007510 312.8092086 284.2497686 341.3686486 1.200946091 0.8759734 ENSBTAG00000025822 25.77611297 23.42038299 28.13184296 1.201169211 0.8759734 ENSBTAG00000031010 255.084026 231.5431656 278.6248864 1.203338849 0.8759734 ENSBTAG00000007130 1571.603878 1425.960344 1717.247412 1.204274312 0.8759734 ENSBTAG00000013460 294.8101079 267.4638577 322.1563582 1.204485574 0.8759734 ENSBTAG00000004869 850.9026276 771.7162456 930.0890096 1.205221498 0.8759734 ENSBTAG00000023106 2960.905167 2684.169369 3237.640964 1.206198462 0.8759734 ENSBTAG00000039591 107.4503619 97.34155413 117.5591697 1.207697686 0.8759734 ENSBTAG00000023462 571.8699969 518.0382421 625.7017516 1.20782927 0.8759734 ENSBTAG00000020894 4060.097846 3676.050907 4444.144786 1.208945387 0.8759734 ENSBTAG00000021519 2835.403498 2566.996486 3103.810509 1.209121449 0.8759734 ENSBTAG00000040159 217.6683645 196.828045 238.5086841 1.211761689 0.8759734 ENSBTAG00000025443 259.8131989 234.9305736 284.6958242 1.211829605 0.8759734 ENSBTAG00000012691 1333.947841 1205.212933 1462.682748 1.213630147 0.8759734 522943 59.62765476 53.87238434 65.38292518 1.213663104 0.8759734 ENSBTAG00000008118 1292.405693 1167.630179 1417.181206 1.213724372 0.8759734 ENSBTAG00000005100 2137.265775 1930.530433 2344.001117 1.214174652 0.8759734 ENSBTAG00000018517 58.70997648 52.95542087 64.46453209 1.217335846 0.8759734 ENSBTAG00000000019 754.9188229 680.768143 829.0695028 1.217844153 0.8759734 ENSBTAG00000007871 1919.723156 1731.149453 2108.296859 1.217859529 0.8759734 ENSBTAG00000011895 2846.968728 2567.133753 3126.803703 1.218013553 0.8759734 ENSBTAG00000006876 120.7615238 108.8421243 132.6809233 1.219021809 0.8759734 ENSBTAG00000020855 107.4575671 96.83343341 118.0817008 1.219431106 0.8759734 ENSBTAG00000030448 145.0789084 130.7155442 159.4422727 1.219765206 0.8759734 ENSBTAG00000010508 92.98555272 83.77827181 102.1928336 1.219801166 0.8759734 ENSBTAG00000021607 208.0103421 187.4016972 228.6189869 1.219940856 0.8759734 ENSBTAG00000039794 141.7796921 127.6707018 155.8886823 1.221021582 0.8759734 ENSBTAG00000005816 56.3008966 50.69213541 61.9096578 1.221287233 0.8759734 ENSBTAG00000030632 1587.170481 1428.720143 1745.620819 1.221807383 0.8759734 ENSBTAG00000020525 773.1702687 695.917026 850.4235114 1.222018545 0.8759734 512354 255.1337355 229.4401718 280.8272992 1.223967438 0.8759734 ENSBTAG00000040345 118.4451358 106.4972373 130.3930343 1.224379501 0.8759734 ENSBTAG00000002377 890.0460341 799.9768239 980.1152443 1.225179549 0.8759734

PAGE 239

ENSBTAG00000013593 1895.90834 1703.832328 2087.984351 1.225463513 0.8759734 ENSBTAG00000010678 69.80516947 62.72433422 76.88600472 1.225776338 0.8759734 ENSBTAG00000000021 1541.918868 1385.500334 1698.337403 1.225793572 0.8759734 ENSBTAG00000021554 2258.092928 2028.517646 2487.66821 1.226347828 0.8759734 ENSBTAG00000012267 1117.785433 1004.067116 1231.50375 1.22651537 0.8759734 ENSBTAG00000013038 979.7622236 879.7305428 1079.793904 1.227414364 0.8759734 ENSBTAG00000013885 1155.08309 1037.042277 1273.123902 1.227648988 0.8759734 ENSBTAG00000000091 1883.178519 1689.746995 2076.610042 1.22894732 0.8759734 ENSBTAG00000015463 206.5123417 185.2341639 227.7905195 1.229743557 0.8759734 ENSBTAG00000037423 143.0954122 128.3316214 157.859203 1.23008812 0.8759734 ENSBTAG00000011330 77.67338665 69.65472504 85.69204826 1.230240278 0.8759734 ENSBTAG00000031741 228.5440705 204.9378932 252.1502478 1.230373963 0.8759734 ENSBTAG00000007141 182.7653904 163.8154751 201.7153057 1.23135684 0.8759734 ENSBTAG00000012658 1499.099734 1343.636055 1654.563413 1.231407423 0.8759734 ENSBTAG00000006665 6099.141941 5463.399461 6734.884421 1.232727804 0.8759734 ENSBTAG00000007685 738.6333277 661.4467778 815.8198775 1.233387031 0.8759734 ENSBTAG00000005155 395.460845 354.087793 436.8338971 1.233688102 0.8759734 ENSBTAG00000010593 594.4619543 532.2205184 656.7033903 1.23389341 0.8759734 ENSBTAG00000002287 427.420211 382.6560122 472.1844099 1.233965742 0.8759734 ENSBTAG00000027159 473.6152988 424.0100592 523.2205383 1.233981428 0.8759734 ENSBTAG00000021288 2610.764216 2337.128533 2884.399899 1.234164 0.8759734 ENSBTAG00000004915 11851.54789 10605.00207 13098.0937 1.235086388 0.8759734 ENSBTAG00000016746 694.0209795 620.6921116 767.3498474 1.236280973 0.8759734 ENSBTAG00000016762 71.27481514 63.72276368 78.82686661 1.237028372 0.8759734 ENSBTAG00000014248 153.770847 137.3788683 170.1628258 1.238639012 0.8759734 ENSBTAG00000012855 62.64547486 55.95936296 69.33158676 1.238963117 0.8759734 ENSBTAG00000016483 94.7374989 84.56648229 104.9085155 1.240544867 0.8759734 505723 132.4297328 118.1596969 146.6997687 1.241538127 0.8759734 ENSBTAG00000004204 187.4731623 167.2080787 207.7382458 1.242393593 0.8759734 ENSBTAG00000032281 388.3543713 346.3123989 430.3963436 1.242797962 0.8759734 784131 446.9135885 398.5017228 495.3254542 1.242969417 0.8759734 ENSBTAG00000005142 447.2047265 398.6406767 495.7687764 1.243648241 0.8759734 ENSBTAG00000005814 387.3558416 345.2479128 429.4637704 1.243928651 0.8759734 100140898 49.42135359 44.04669107 54.79601612 1.244043872 0.8759734 ENSBTAG00000012251 680.872228 606.8220867 754.9223693 1.24405882 0.8759734 ENSBTAG00000017571 302.1536713 269.2554221 335.0519204 1.244364618 0.8759734 ENSBTAG00000001632 1415.256107 1260.932505 1569.579709 1.244776943 0.8759734 ENSBTAG00000011593 533.0817585 474.7310467 591.4324704 1.245826399 0.8759734 536155 20.05043498 17.84560803 22.25526193 1.247100233 0.8759734 ENSBTAG00000000555 1402.03644 1247.804497 1556.268382 1.2472053 0.8759734 ENSBTAG00000012585 232.7906984 207.1114486 258.4699483 1.247975185 0.8759734 ENSBTAG00000024701 230.2259005 204.5160824 255.9357187 1.251420992 0.8759734 ENSBTAG00000012062 4867.473383 4322.702917 5412.243849 1.252050847 0.8759734 327683 436.9864034 387.7444453 486.2283614 1.253991817 0.8759734 ENSBTAG00000010617 270.5387237 240.0230243 301.0544231 1.254273101 0.8759734 ENSBTAG00000018593 902.9309109 800.5554555 1005.306366 1.255761059 0.8759734 ENSBTAG00000018548 1470.295075 1303.579607 1637.010544 1.255781032 0.8759734 100337136 997.2860641 883.9966414 1110.575487 1.256311885 0.8759734 ENSBTAG00000014074 145.4238324 128.8986072 161.9490577 1.256406575 0.8759734 507498 1008.648194 893.9789263 1123.317462 1.256536847 0.8759734 ENSBTAG00000021558 34.55589952 30.62511701 38.48668203 1.256703183 0.8759734 512642 2231.580144 1977.15684 2486.003449 1.257362794 0.8759734

PAGE 240

ENSBTAG00000032887 268.8747395 238.1617075 299.5877714 1.257917465 0.8759734 ENSBTAG00000006768 835.1767171 739.6699513 930.6834829 1.258241573 0.8759734 534574 98.97450366 87.60890491 110.3401024 1.25946218 0.8759734 ENSBTAG00000000289 204.2813384 180.6972565 227.8654202 1.261034199 0.8759734 ENSBTAG00000020498 1287.034632 1137.89439 1436.174873 1.262133714 0.8759734 ENSBTAG00000014679 342.5720212 302.8569558 382.2870866 1.262269462 0.8759734 ENSBTAG00000015663 1677.520979 1483.037185 1872.004773 1.262277704 0.8759734 ENSBTAG00000005773 679.6847734 600.7834859 758.5860608 1.262661306 0.8759734 ENSBTAG00000010309 492.6932741 435.3352973 550.0512508 1.263511721 0.8759734 530930 32.87017313 29.02698495 36.71336132 1.26480106 0.8759734 ENSBTAG00000011611 382.3044785 337.5277644 427.0811926 1.265321664 0.8759734 ENSBTAG00000002019 770.9792228 680.4515944 861.5068513 1.266081024 0.8759734 ENSBTAG00000032024 477.5156017 421.359002 533.6722014 1.266549899 0.8759734 ENSBTAG00000044032 678.50484 598.6691389 758.3405411 1.266710595 0.8759734 ENSBTAG00000034232 48.19274184 42.50644929 53.87903439 1.267549638 0.8759734 ENSBTAG00000000560 395.990764 349.0897044 442.8918237 1.268704915 0.8759734 ENSBTAG00000037966 27.15180007 23.92947849 30.37412164 1.269318161 0.8759734 ENSBTAG00000004472 248.8010902 219.187557 278.4146234 1.27021181 0.8759734 ENSBTAG00000013581 159.480426 140.4878521 178.4729999 1.270380301 0.8759734 ENSBTAG00000024542 2212.689357 1948.667718 2476.710996 1.270976562 0.8759734 534582 2337.493599 2058.402773 2616.584426 1.271172222 0.8759734 ENSBTAG00000027772 68.31182023 60.15203918 76.47160127 1.271305218 0.8759734 ENSBTAG00000003205 698.1757647 614.5803682 781.7711612 1.272040569 0.8759734 ENSBTAG00000008964 506.9572796 446.2400469 567.6745124 1.272128121 0.8759734 ENSBTAG00000037775 2481.33713 2183.447132 2779.227127 1.272862111 0.8759734 ENSBTAG00000011825 647.5275757 569.769661 725.2854905 1.272945087 0.8759734 ENSBTAG00000031397 139.0814694 122.3644385 155.7985003 1.273233483 0.8759734 ENSBTAG00000008310 2732.101748 2402.44909 3061.754406 1.274430505 0.8759734 ENSBTAG00000003209 638.121438 560.9922567 715.2506194 1.274974139 0.8759734 ENSBTAG00000001660 528.0268597 464.0993138 591.9544056 1.275490801 0.8759734 ENSBTAG00000009176 315.58106 277.3609688 353.8011511 1.275598195 0.8759734 ENSBTAG00000003804 155.3752144 136.5033775 174.2470512 1.276503588 0.8759734 ENSBTAG00000012888 19.68173642 17.29075548 22.07271735 1.276561766 0.8759734 ENSBTAG00000006085 1855.190722 1629.319537 2081.061907 1.277258303 0.8759734 ENSBTAG00000004945 99.51165257 87.38468809 111.638617 1.277553533 0.8759734 767979 1027.839111 902.4260218 1153.252201 1.277946527 0.8759734 ENSBTAG00000012927 1108.047997 972.646207 1243.449788 1.278419407 0.8759734 ENSBTAG00000015060 77.52840644 68.04903246 87.00778042 1.278604225 0.8759734 ENSBTAG00000003925 496.8276789 436.0080113 557.6473466 1.278984175 0.8759734 ENSBTAG00000016079 2528.352869 2218.624732 2838.081006 1.279207324 0.8759734 ENSBTAG00000007480 1588.366841 1393.775648 1782.958034 1.279228861 0.8759734 ENSBTAG00000015598 1971.518112 1729.852545 2213.183678 1.279405973 0.8759734 ENSBTAG00000019867 1135.72399 996.2692776 1275.178703 1.279953855 0.8759734 ENSBTAG00000004387 160.4382482 140.6985413 180.1779551 1.280595758 0.8759734 ENSBTAG00000003766 139.7485897 122.5462251 156.9509543 1.280748993 0.8759734 100335651 166.2528394 145.7724892 186.7331896 1.280990608 0.8759734 ENSBTAG00000025477 315.6061203 276.2985508 354.9136898 1.284529683 0.8759734 ENSBTAG00000011628 72.54519466 63.50970532 81.58068399 1.284538852 0.8759734 ENSBTAG00000002784 81.10020663 70.97864948 91.22176378 1.285200049 0.8759734 ENSBTAG00000015358 75.02877893 65.64292837 84.41462949 1.285966845 0.8759734 ENSBTAG00000013568 547.1542356 478.4679999 615.8404712 1.287109005 0.8759734 ENSBTAG00000021471 242.7636124 212.195932 273.3312929 1.288108072 0.8759734

PAGE 241

ENSBTAG00000013899 331.1799992 289.3831024 372.976896 1.288868952 0.8759734 ENSBTAG00000012539 177.1124505 154.7454788 199.4794222 1.289080778 0.8759734 ENSBTAG00000014858 558.4950956 487.8522692 629.1379221 1.289607453 0.8759734 ENSBTAG00000004929 237.2631057 207.2259832 267.3002283 1.289897262 0.8759734 ENSBTAG00000016502 178.5725331 155.8782722 201.266794 1.291179271 0.8759734 ENSBTAG00000002663 406.5899165 354.7339477 458.4458853 1.292365414 0.8759734 ENSBTAG00000018426 167.0258729 145.6028359 188.4489099 1.294266755 0.8759734 ENSBTAG00000024476 235.8965128 205.5780809 266.2149448 1.294957827 0.8759734 529852 231.7706661 201.7592927 261.7820396 1.297496815 0.8759734 ENSBTAG00000009761 467.0675706 406.2386407 527.8965005 1.299473875 0.8759734 ENSBTAG00000000704 403.4253402 350.7231258 456.1275545 1.300534584 0.8759734 ENSBTAG00000021499 2022.143228 1757.615076 2286.671379 1.301008059 0.8759734 783366 148.8865713 129.3835718 168.3895708 1.30147567 0.8759734 ENSBTAG00000008449 35.90402342 31.18959805 40.61844879 1.302307542 0.8759734 ENSBTAG00000009547 538.8818512 467.9233654 609.8403369 1.303291056 0.8759734 ENSBTAG00000006491 167.4059768 145.354556 189.4573976 1.303415613 0.8759734 ENSBTAG00000008116 323.1998199 280.594743 365.8048969 1.303676943 0.8759734 ENSBTAG00000013781 184.3165331 159.9899699 208.6430963 1.304101104 0.8759734 ENSBTAG00000010509 32.3747976 28.09462927 36.65496594 1.304696552 0.8759734 ENSBTAG00000000855 156.7766217 136.0185485 177.5346949 1.305224154 0.8759734 ENSBTAG00000008600 19.28328506 16.7137216 21.85284852 1.307479509 0.8759734 ENSBTAG00000009359 94.81950747 82.16918467 107.4698303 1.307909172 0.8759734 ENSBTAG00000032022 309.8171424 268.3488629 351.285422 1.309062458 0.8759734 ENSBTAG00000015917 23.75316815 20.56793041 26.93840589 1.309728561 0.8759734 ENSBTAG00000014991 391.0665441 338.609745 443.5233432 1.309836323 0.8759734 ENSBTAG00000007964 188.1805295 162.8874252 213.4736337 1.310559323 0.8759734 ENSBTAG00000024431 109.884291 95.03874557 124.7298364 1.312410382 0.8759734 ENSBTAG00000001059 375.4139522 324.6189688 426.2089357 1.312951419 0.8759734 ENSBTAG00000016526 145.2683208 125.611452 164.9251896 1.312978928 0.8759734 ENSBTAG00000011784 65.74152942 56.83771031 74.64534853 1.313306749 0.8759734 ENSBTAG00000039414 310.3694531 268.2375195 352.5013867 1.314139004 0.8759734 ENSBTAG00000001648 203.3114744 175.6572886 230.9656603 1.314865225 0.8759734 ENSBTAG00000017085 128.3640525 110.9010901 145.827015 1.314928599 0.8759734 ENSBTAG00000009278 132.470378 114.3369632 150.6037929 1.317192521 0.8759734 ENSBTAG00000020034 148.1017424 127.8020101 168.4014746 1.317674694 0.8759734 ENSBTAG00000005614 47.18886701 40.69381387 53.68392015 1.319215749 0.8759734 100336632 14.6106997 12.59384048 16.62755892 1.320292959 0.8759734 541246 52.37521648 45.12463696 59.62579601 1.321357911 0.8759734 ENSBTAG00000033735 34.74252443 29.92030491 39.56474395 1.322337592 0.8759734 ENSBTAG00000002516 50.88822687 43.82400421 57.95244954 1.322390562 0.8759734 ENSBTAG00000002327 296.7451197 255.4785306 338.0117087 1.323053283 0.8759734 ENSBTAG00000017082 78.28331267 67.38713803 89.17948731 1.323390337 0.8759734 ENSBTAG00000003977 191.8361777 165.1194389 218.5529165 1.32360501 0.8759734 ENSBTAG00000018531 21.2630884 18.30020781 24.22596898 1.323808409 0.8759734 515964 28.12473776 24.1796908 32.06978472 1.326310786 0.8759734 ENSBTAG00000031856 27.86381285 23.95214722 31.77547849 1.32662338 0.8759734 ENSBTAG00000018405 534.883964 459.6480976 610.1198303 1.327362897 0.8759734 ENSBTAG00000005129 123.5485238 106.1021255 140.994922 1.328860485 0.8759734 ENSBTAG00000005682 187.4227649 160.9160916 213.9294382 1.329447142 0.8759734 512457 430.1162086 369.2117737 491.0206434 1.329915995 0.8759734 ENSBTAG00000025161 19.08871719 16.37913613 21.79829824 1.330857627 0.8759734 ENSBTAG00000038116 112.6170204 96.62246019 128.6115806 1.331073338 0.8759734

PAGE 242

ENSBTAG00000018057 78.02591687 66.82895871 89.22287503 1.335093001 0.8759734 ENSBTAG00000020193 44.35549753 37.98209477 50.7289003 1.335600383 0.8759734 ENSBTAG00000017542 60.88851082 52.13649376 69.64052788 1.335734777 0.8759734 613998 128.4180966 109.9573769 146.8788162 1.335779557 0.8759734 ENSBTAG00000007488 22.97662425 19.66310018 26.29014832 1.337029669 0.8759734 ENSBTAG00000003268 65.63016059 56.13733534 75.12298584 1.338200066 0.8759734 ENSBTAG00000032505 327.5156047 280.0951448 374.9360647 1.338602513 0.8759734 ENSBTAG00000024482 35.50477981 30.36332664 40.64623299 1.338662047 0.8759734 ENSBTAG00000037814 91.23422143 78.00978045 104.4586624 1.339045717 0.8759734 ENSBTAG00000008692 289.3447777 247.3395085 331.3500469 1.339656769 0.8759734 ENSBTAG00000038594 22.98603945 19.64764017 26.32443872 1.339826996 0.8759734 506127 231.3933737 197.6811554 265.105592 1.341076702 0.8759734 ENSBTAG00000021744 277.6283285 237.1217591 318.134898 1.341652066 0.8759734 ENSBTAG00000007588 170.0668717 145.2486245 194.8851189 1.341734696 0.8759734 ENSBTAG00000022498 89.45609805 76.4011129 102.5110832 1.34174856 0.8759734 ENSBTAG00000025864 14.64295398 12.48249705 16.80341091 1.346157811 0.8759734 ENSBTAG00000024493 54.36500328 46.33798937 62.39201719 1.346454994 0.8759734 ENSBTAG00000044388 7515.181929 6402.068225 8628.295634 1.347735658 0.8759734 ENSBTAG00000040037 77.68248422 66.13621207 89.22875637 1.349166419 0.8759734 ENSBTAG00000031800 206.8848209 176.1159059 237.653736 1.349416652 0.8759734 ENSBTAG00000016534 33.83398383 28.79223264 38.87573501 1.350216063 0.8759734 ENSBTAG00000020781 118.1919674 100.5234008 135.860534 1.351531414 0.8759734 ENSBTAG00000005191 1208.273261 1027.621215 1388.925308 1.351592676 0.8759734 ENSBTAG00000039108 89.25172004 75.86213996 102.6413001 1.35299769 0.8759734 ENSBTAG00000017124 19.32478743 16.42107902 22.22849585 1.353656226 0.8759734 ENSBTAG00000005345 361.0041721 306.736677 415.2716671 1.353837667 0.8759734 ENSBTAG00000006429 234.0945188 198.8074986 269.3815389 1.354986813 0.8759734 ENSBTAG00000033339 111.9253471 94.97136237 128.8793319 1.357033622 0.8759734 100337446 23.19734198 19.67128367 26.72340028 1.358498038 0.8759734 ENSBTAG00000039015 33.94725858 28.77295848 39.12155868 1.359664099 0.8759734 ENSBTAG00000038486 4.650899588 3.938581966 5.363217211 1.361712733 0.8759734 ENSBTAG00000009034 2188.759791 1851.126773 2526.392808 1.364786489 0.8759734 ENSBTAG00000021601 189.0653477 159.898388 218.2323074 1.364818684 0.8759734 ENSBTAG00000030431 45.48695107 38.45991846 52.51398369 1.365421088 0.8759734 ENSBTAG00000027962 101.6508322 85.94629683 117.3553676 1.36544996 0.8759734 ENSBTAG00000004829 49.99016356 42.23030928 57.75001784 1.367501655 0.8759734 ENSBTAG00000002363 162.336497 137.1096024 187.5633916 1.367981442 0.8759734 522159 87.19938327 73.63303348 100.7657331 1.368485424 0.8759734 ENSBTAG00000039442 93.16364281 78.61482717 107.7124584 1.37012905 0.8759734 ENSBTAG00000009013 83.07535109 70.09511076 96.05559141 1.370360791 0.8759734 ENSBTAG00000010524 118.2402557 99.74641659 136.7340948 1.370817113 0.8759734 ENSBTAG00000008542 29.29539043 24.70708569 33.88369516 1.371416103 0.8759734 100337045 96.40236499 81.27544511 111.5292849 1.372238377 0.8759734 404124 18.35110974 15.47042395 21.23179552 1.372412002 0.8759734 ENSBTAG00000030172 36.09992637 30.43279498 41.76705777 1.372435815 0.8759734 533992 97.80857927 82.4421335 113.175025 1.372781371 0.8759734 537895 51.38135021 43.27684777 59.48585266 1.37454218 0.8759734 ENSBTAG00000024889 205.9926871 173.4687478 238.5166264 1.374983272 0.8759734 ENSBTAG00000019662 57.17362869 48.14348387 66.20377352 1.375134664 0.8759734 506110 9.874721261 8.312489552 11.43695297 1.375875771 0.8759734 ENSBTAG00000018329 26.08817883 21.95009694 30.22626072 1.377044521 0.8759734 ENSBTAG00000004170 22.61636861 19.00890186 26.22383537 1.379555514 0.8759734

PAGE 243

ENSBTAG00000038680 146.9558302 123.4585352 170.4531253 1.380650799 0.8759734 ENSBTAG00000021067 61.02291659 51.25488744 70.79094573 1.381155033 0.8759734 ENSBTAG00000012259 184.9809142 155.3087182 214.6531103 1.382105993 0.8759734 ENSBTAG00000002513 72.76477521 61.04251977 84.48703065 1.384068531 0.8759734 ENSBTAG00000032527 111.1084868 93.17660674 129.0403669 1.384900903 0.8759734 100301215 6.879028272 5.767584379 7.990472166 1.385410536 0.8759734 ENSBTAG00000010392 157.707436 132.1388994 183.2759727 1.386994848 0.8759734 ENSBTAG00000027930 57.70253956 48.25531469 67.14976443 1.391551684 0.8759734 ENSBTAG00000014370 12.31939639 10.29914762 14.33964515 1.39231378 0.8759734 ENSBTAG00000014592 47.49749265 39.67666543 55.31831987 1.39422805 0.8759734 ENSBTAG00000030164 169.7240169 141.7502926 197.6977412 1.39469018 0.8759734 ENSBTAG00000012587 125.3283815 104.5943337 146.0624294 1.396465986 0.8759734 ENSBTAG00000004937 306.2491643 255.3513247 357.1470038 1.398649505 0.8759734 ENSBTAG00000026704 30.24804266 25.21957575 35.27650957 1.398774901 0.8759734 ENSBTAG00000002180 22.57126527 18.81221049 26.33032006 1.399639881 0.8759734 ENSBTAG00000032557 88.85544919 74.00720985 103.7036885 1.401264671 0.8759734 ENSBTAG00000003199 211.5590091 176.1419863 246.9760318 1.402141744 0.8759734 ENSBTAG00000040368 42.27170272 35.17934897 49.36405647 1.4032112 0.8759734 ENSBTAG00000016057 62.20471759 51.74796775 72.66146743 1.404141468 0.8759734 ENSBTAG00000002069 35.52186134 29.54723891 41.49648376 1.404411556 0.8759734 ENSBTAG00000018358 14.94200115 12.42848872 17.45551359 1.404475956 0.8759734 516247 40.35664537 33.56291753 47.15037322 1.404835357 0.8759734 ENSBTAG00000002080 31.91691994 26.53997005 37.29386983 1.405196379 0.8759734 539078 11.96607687 9.948682548 13.9834712 1.405560096 0.8759734 ENSBTAG00000009483 137.8320277 114.5512675 161.1127879 1.406468836 0.8759734 ENSBTAG00000016421 16.51436522 13.72240014 19.30633029 1.406920808 0.8759734 ENSBTAG00000038821 16.51436522 13.72240014 19.30633029 1.406920808 0.8759734 511840 29.61258518 24.59525487 34.62991548 1.407991731 0.8759734 100336223 19.7084636 16.35216586 23.06476134 1.410501919 0.8759734 ENSBTAG00000005683 79.19209765 65.671009 92.7131863 1.411782577 0.8759734 ENSBTAG00000009822 86.79864633 71.81172718 101.7855655 1.417394756 0.8759734 ENSBTAG00000009228 179.2217031 148.1257631 210.317643 1.41985863 0.8759734 ENSBTAG00000018810 40.18749722 33.19317829 47.18181614 1.421431106 0.8759734 540573 21.97325744 18.14213256 25.80438232 1.422345594 0.8759734 512853 16.88710644 13.93018218 19.8440307 1.424534902 0.8759734 511903 53.18949053 43.87038422 62.50859683 1.424847262 0.8759734 ENSBTAG00000007163 107.7848755 88.76131145 126.8084395 1.428645402 0.8759734 ENSBTAG00000000825 232.3752942 191.3426398 273.4079486 1.428891903 0.8759734 ENSBTAG00000018402 20.63210736 16.98369546 24.28051926 1.42963699 0.8759734 616314 23.34868645 19.2161965 27.48117639 1.43010488 0.8759734 ENSBTAG00000025634 31.30987729 25.75466675 36.86508784 1.431394481 0.8759734 ENSBTAG00000038126 14.33822226 11.78926302 16.8871815 1.432420455 0.8759734 ENSBTAG00000008703 104.0822917 85.57378601 122.5907974 1.432574193 0.8759734 510700 383.3750683 315.1810936 451.569043 1.432728841 0.8759734 ENSBTAG00000000076 15.63895368 12.85611824 18.42178911 1.432920013 0.8759734 ENSBTAG00000015194 20.64547156 16.92968713 24.36125599 1.438966698 0.8759734 541096 24.99503026 20.4952031 29.49485743 1.439110278 0.8759734 ENSBTAG00000032234 24.64597421 20.19098246 29.10096597 1.441285288 0.8759734 ENSBTAG00000026403 155.5065117 127.3682823 183.6447411 1.441840447 0.8759734 ENSBTAG00000010010 48.28239891 39.53502496 57.02977286 1.442512631 0.8759734 286791 23.62117752 19.33239666 27.90995839 1.443688482 0.8759734 ENSBTAG00000009738 91.84702013 74.92361813 108.7704221 1.451750794 0.8759734

PAGE 244

ENSBTAG00000000662 97.21768 79.25128129 115.1840787 1.453403363 0.8759734 ENSBTAG00000001179 25.39453669 20.69140708 30.0976663 1.454597369 0.8759734 ENSBTAG00000013100 16.82114327 13.69542987 19.94685667 1.456460794 0.8759734 ENSBTAG00000002748 133.1638775 108.4045823 157.9231727 1.456794255 0.8759734 ENSBTAG00000025868 54.86707585 44.66338364 65.07076807 1.456915325 0.8759734 ENSBTAG00000017709 7.791696686 6.337409541 9.245983831 1.458953184 0.8759734 ENSBTAG00000016795 41.2213995 33.50509504 48.93770396 1.46060484 0.8759734 ENSBTAG00000005557 125.8554133 102.2027149 149.5081117 1.462858515 0.8759734 540948 14.00317128 11.36600284 16.64033971 1.464045007 0.8759734 ENSBTAG00000021079 177.3219796 143.8015623 210.8423968 1.466203798 0.8759734 ENSBTAG00000020810 13.75100988 11.13894664 16.36307312 1.468996454 0.8759734 ENSBTAG00000021549 28.64322201 23.15914781 34.12729622 1.473598964 0.8759734 ENSBTAG00000011351 63.68221111 51.48243102 75.88199119 1.47393955 0.8759734 ENSBTAG00000018809 31.81695984 25.71230427 37.92161541 1.474843134 0.8759734 ENSBTAG00000014771 45.31184866 36.61261666 54.01108067 1.475204058 0.8759734 ENSBTAG00000020373 16.04318825 12.9481875 19.138189 1.478059303 0.8759734 ENSBTAG00000039283 10.97033304 8.851462497 13.08920358 1.478761683 0.8759734 ENSBTAG00000014589 10.28386624 8.293702778 12.2740297 1.479921578 0.8759734 ENSBTAG00000011805 220.8804104 178.0223611 263.7384598 1.48149063 0.8759734 ENSBTAG00000044001 104.3874786 83.93335926 124.841598 1.487389509 0.8759734 ENSBTAG00000007077 76.09280962 61.18145644 91.0041628 1.48744682 0.8759734 ENSBTAG00000044841 98.68531391 79.3372522 118.0333756 1.487742168 0.8759734 536426 4.281742407 3.442039296 5.121445518 1.487910241 0.8759734 517948 36.04827458 28.96971764 43.12683151 1.488686636 0.8759734 ENSBTAG00000003912 28.62079954 22.997678 34.24392109 1.489016461 0.8759734 ENSBTAG00000038442 94.92086533 76.21939415 113.6223365 1.490727364 0.8759734 100138974 3.894462008 3.122426443 4.666497573 1.49451001 0.8759734 ENSBTAG00000040474 16.67623505 13.35266091 19.9998092 1.497814506 0.8759734 100301431 4.75240573 3.804082424 5.700729037 1.498581892 0.8759734 ENSBTAG00000007346 17.4476437 13.94564218 20.94964521 1.502235963 0.8759734 100300490 104.8898163 83.64459862 126.1350341 1.507987798 0.8759734 ENSBTAG00000017812 30.40864189 24.24527719 36.5720066 1.508417755 0.8759734 782214 4.73606494 3.773230205 5.698899675 1.51035038 0.8759734 538567 29.36894316 23.39057334 35.34731299 1.511177707 0.8759734 ENSBTAG00000022032 51.70448905 41.10174962 62.30722849 1.515926428 0.8759734 ENSBTAG00000038244 8.053472605 6.399113979 9.707831231 1.517058653 0.8759734 ENSBTAG00000020203 11.78383474 9.360070611 14.20759888 1.517894412 0.8759734 100335335 3.30665286 2.625883773 3.987421947 1.518506641 0.8759734 100336312 15.35563283 12.19373642 18.51752925 1.518609933 0.8759734 789328 10.30644233 8.18187196 12.4310127 1.51933601 0.8759734 ENSBTAG00000040432 28.80362758 22.83232623 34.77492892 1.523056765 0.8759734 ENSBTAG00000038747 22.57777958 17.88471154 27.27084762 1.52481339 0.8759734 514524 12.52135597 9.918317717 15.12439422 1.524895114 0.8759734 ENSBTAG00000008858 127.8813324 100.9016625 154.8610023 1.534771563 0.8759734 ENSBTAG00000021773 54.43778235 42.93463398 65.94093071 1.535844715 0.8759734 353108 5.181156014 4.085146952 6.277165076 1.536582441 0.8759734 ENSBTAG00000013745 60.73031927 47.77915654 73.68148199 1.542126051 0.8759734 ENSBTAG00000007823 13.80509135 10.83860795 16.77157474 1.547391954 0.8759734 ENSBTAG00000016560 28.6178351 22.45870505 34.77696516 1.548484878 0.8759734 ENSBTAG00000033840 14.46206822 11.32745452 17.59668193 1.553454212 0.8759734 540153 7.412283094 5.790740491 9.033825697 1.560046718 0.8759734 ENSBTAG00000011744 24.91416694 19.44041332 30.38792055 1.563131403 0.8759734

PAGE 245

ENSBTAG00000039208 15.62621414 12.18604031 19.06638796 1.564608968 0.8759734 ENSBTAG00000031001 7.732401302 6.029374744 9.435427861 1.564909839 0.8759734 100299725 10.60849518 8.266732509 12.95025785 1.566550972 0.8759734 ENSBTAG00000015215 17.27765906 13.44521756 21.11010055 1.570082481 0.8759734 ENSBTAG00000016890 21.04634649 16.37532198 25.717371 1.570495593 0.8759734 538362 38.40881728 29.87066592 46.94696865 1.571674658 0.8759734 534630 5.176976686 4.023442515 6.330510857 1.573406563 0.8759734 ENSBTAG00000013523 51.62289364 40.11303362 63.13275366 1.573871332 0.8759734 ENSBTAG00000026284 23.40866039 18.18123607 28.63608471 1.575035086 0.8759734 ENSBTAG00000009657 12.59751175 9.768425963 15.42659753 1.579230634 0.8759734 ENSBTAG00000038733 21.12930583 16.37532198 25.88328968 1.580627833 0.8759734 ENSBTAG00000000655 21.59617142 16.72529966 26.46704317 1.582455544 0.8759734 540675 37.42518756 28.95044348 45.89993165 1.58546558 0.8759734 ENSBTAG00000033740 13.52071768 10.44571261 16.59572275 1.588759271 0.8759734 ENSBTAG00000016501 30.44531773 23.51016806 37.38046739 1.589970233 0.8759734 ENSBTAG00000021490 46.96974705 36.24724676 57.69224733 1.591631158 0.8759734 616159 4.479001452 3.453617352 5.504385552 1.593802958 0.8759734 619131 4.815656197 3.711525768 5.919786626 1.594973872 0.8759734 ENSBTAG00000032638 10.79592389 8.31685889 13.27498889 1.596154156 0.8759734 ENSBTAG00000035572 10.79592389 8.31685889 13.27498889 1.596154156 0.8759734 ENSBTAG00000002616 21.93376204 16.81452955 27.05299453 1.608905825 0.8759734 ENSBTAG00000010976 40.16220068 30.71774145 49.6066599 1.614918856 0.8759734 ENSBTAG00000018440 3.825973578 2.926222464 4.725724692 1.614957424 0.8759734 ENSBTAG00000002685 11.56253983 8.836557672 14.28852198 1.616978298 0.8759734 ENSBTAG00000008142 8.404079415 6.422270091 10.38588874 1.617167854 0.8759734 532244 7.942747156 6.060226963 9.82526735 1.621270525 0.8759734 ENSBTAG00000017430 6.870596294 5.232493384 8.508699204 1.626127083 0.8759734 ENSBTAG00000007981 37.564672 28.57730968 46.55203432 1.628985893 0.8759734 ENSBTAG00000015184 4.166374281 3.164856717 5.167891845 1.63289915 0.8759734 ENSBTAG00000010664 4.852557751 3.68067355 6.024441953 1.636777039 0.8759734 ENSBTAG00000031875 9.667422025 7.311708107 12.02313594 1.644367604 0.8759734 531776 3.472468104 2.625883773 4.319052436 1.644799545 0.8759734 ENSBTAG00000001058 11.2336633 8.493788707 13.97353788 1.645147809 0.8759734 ENSBTAG00000043553 14.50094931 10.95432072 18.0475779 1.647530537 0.8759734 ENSBTAG00000038529 8.185744604 6.183148449 10.18834076 1.647759365 0.8759734 ENSBTAG00000031186 3.483825157 2.625883773 4.34176654 1.653449625 0.8759734 ENSBTAG00000034261 8.089103158 6.083383075 10.09482324 1.65940943 0.8759734 100335592 5.435302877 4.085146952 6.785458802 1.661007274 0.8759734 ENSBTAG00000037815 7.918205929 5.948883533 9.887528326 1.662081342 0.8759734 ENSBTAG00000017379 20.41744087 15.31283609 25.52204564 1.666709255 0.8759734 100298485 6.20395459 4.643394059 7.764515122 1.672163728 0.8759734 ENSBTAG00000022813 9.700763581 7.250003669 12.15152349 1.676071358 0.8759734 ENSBTAG00000000446 15.22208403 11.35830673 19.08586133 1.680343891 0.8759734 ENSBTAG00000043998 8.622627945 6.422270091 10.8229858 1.685227442 0.8759734 ENSBTAG00000008014 18.93039341 14.07293301 23.7878538 1.690326657 0.8759734 ENSBTAG00000018660 2.253221855 1.67474132 2.831702389 1.690829715 0.8759734 513466 21.85746467 16.24470438 27.47022496 1.691026461 0.8759734 ENSBTAG00000000237 7.932283109 5.887179096 9.977387121 1.694765347 0.8759734 ENSBTAG00000001695 10.23591603 7.581194579 12.89063748 1.700343837 0.8759734 782535 5.868705624 4.343055368 7.39435588 1.702570023 0.8759734 100139764 8.744549871 6.464700365 11.02439938 1.70532256 0.8759734 ENSBTAG00000023947 7.816715655 5.759888272 9.873543038 1.714190028 0.8759734

PAGE 246

ENSBTAG00000008127 5.915465263 4.354633424 7.476297103 1.716860267 0.8759734 513873 7.983186152 5.87560104 10.09077126 1.717402389 0.8759734 ENSBTAG00000037662 4.706475425 3.453617352 5.959333497 1.725533807 0.8759734 ENSBTAG00000039433 3.043070744 2.232988427 3.853153061 1.725558903 0.8759734 ENSBTAG00000010681 14.45279131 10.59615954 18.30942309 1.727930107 0.8759734 ENSBTAG00000035587 10.4833028 7.666055128 13.30055047 1.734992802 0.8759734 533175 8.574735322 6.237644168 10.91182648 1.749350585 0.8759734 ENSBTAG00000019855 6.497683368 4.716676552 8.278690185 1.755195654 0.8759734 100336324 3.221499661 2.337123139 4.105876184 1.75680781 0.8759734 ENSBTAG00000008510 16.53710264 11.99371828 21.08048699 1.757627326 0.8759734 ENSBTAG00000019162 11.36291522 8.228184184 14.49764626 1.761949652 0.8759734 ENSBTAG00000031327 8.106902397 5.844748821 10.36905597 1.774080681 0.8759734 ENSBTAG00000042368 2.366310647 1.705593539 3.027027756 1.774765023 0.8759734 100295249 4.436352875 3.195708936 5.676996815 1.77644364 0.8759734 ENSBTAG00000039326 13.4027066 9.645017088 17.16039611 1.779198103 0.8759734 ENSBTAG00000015401 10.57119883 7.600468741 13.54192891 1.781722861 0.8759734 100139818 10.53822919 7.561920416 13.51453796 1.787183311 0.8759734 ENSBTAG00000000735 2.883420297 2.067636667 3.699203927 1.789097663 0.8759734 ENSBTAG00000001292 6.204024343 4.44719008 7.960858606 1.790087328 0.8759734 ENSBTAG00000008632 3.684533929 2.637461829 4.731606029 1.793999813 0.8759734 100336639 2.34794387 1.67474132 3.021146419 1.803948098 0.8759734 ENSBTAG00000000219 4.145848226 2.957074682 5.33462177 1.804019967 0.8759734 ENSBTAG00000016448 9.929130558 7.076955803 12.78130531 1.80604566 0.8759734 100300862 7.721230356 5.501979856 9.940480855 1.806709787 0.8759734 504245 7.084451842 5.028593299 9.140310386 1.817667456 0.8759734 ENSBTAG00000021286 4.417366768 3.134004499 5.700729037 1.818991976 0.8759734 782989 2.789780962 1.975080011 3.604481913 1.8249802 0.8759734 ENSBTAG00000036030 8.773290755 6.187517787 11.35906372 1.835803001 0.8759734 ENSBTAG00000011752 7.089308228 4.99774108 9.180875376 1.837005005 0.8759734 ENSBTAG00000017060 12.08150079 8.513062869 15.64993871 1.838344078 0.8759734 ENSBTAG00000013279 5.029216394 3.538477901 6.519954887 1.842587426 0.8759734 ENSBTAG00000019728 2.380498097 1.67474132 3.086254874 1.842824821 0.8759734 505485 9.213703227 6.476278421 11.95112803 1.84536971 0.8759734 ENSBTAG00000026836 5.420132481 3.807964373 7.032300588 1.846734869 0.8759734 ENSBTAG00000021462 6.250146691 4.385485643 8.11480774 1.850378362 0.8759734 ENSBTAG00000006004 3.333969124 2.337123139 4.33081511 1.853053884 0.8759734 100296451 4.604813437 3.226561155 5.983065719 1.854316541 0.8759734 616199 3.731275607 2.606609611 4.855941603 1.862933975 0.8759734 540766 5.025147337 3.507625683 6.542668991 1.86527001 0.8759734 787091 3.779255944 2.637461829 4.921050058 1.865827973 0.8759734 781749 11.08908142 7.720063459 14.45809939 1.872795407 0.8759734 ENSBTAG00000008833 3.693227702 2.564179336 4.822276068 1.880631359 0.8759734 100337279 3.288310126 2.275418702 4.30120155 1.890290146 0.8759734 ENSBTAG00000026854 3.811810172 2.637461829 4.986158514 1.890514 0.8759734 783470 5.084374455 3.507625683 6.661123228 1.899040499 0.8759734 506034 2.86381486 1.975080011 3.752549709 1.899948199 0.8759734 ENSBTAG00000006789 5.031519771 3.465195408 6.597844134 1.904032344 0.8759734 ENSBTAG00000009796 5.9837701 4.108303064 7.859237137 1.913012992 0.8759734 ENSBTAG00000002790 6.919475717 4.728254608 9.110696827 1.92686257 0.8759734 100336964 4.307398667 2.93780052 5.676996815 1.932396967 0.8759734 ENSBTAG00000019179 8.689763875 5.918031315 11.46149644 1.936707636 0.8759734 782851 7.233694627 4.924458587 9.542930667 1.937863929 0.8759734

PAGE 247

538778 4.820948319 3.268991429 6.372905208 1.949501963 0.8759734 100337474 3.362344024 2.275418702 4.449269347 1.955362916 0.8759734 ENSBTAG00000044051 2.145575093 1.447685123 2.843465064 1.964146083 0.8759734 533449 3.483867162 2.348701195 4.619033129 1.966632937 0.8759734 ENSBTAG00000038051 6.479340634 4.36621148 8.592469789 1.967946314 0.8759734 ENSBTAG00000038845 3.389016915 2.275418702 4.502615128 1.978807296 0.8759734 788563 8.432821786 5.640848736 11.22479484 1.989912398 0.8759734 ENSBTAG00000004568 3.062312564 2.048362504 4.076262625 1.99001037 0.8759734 ENSBTAG00000005685 3.125099681 2.079214723 4.170984639 2.006038431 0.8759734 788571 2.582427568 1.705593539 3.459261596 2.028186387 0.8759734 ENSBTAG00000006089 2.156821874 1.416832904 2.896810845 2.044567737 0.8759734 ENSBTAG00000034125 2.156821874 1.416832904 2.896810845 2.044567737 0.8759734 ENSBTAG00000037633 3.991303807 2.606609611 5.375998003 2.06244847 0.8759734 ENSBTAG00000013642 6.770110782 4.397063699 9.143157866 2.079378079 0.8759734 ENSBTAG00000003434 5.463476222 3.538477901 7.388474543 2.088037498 0.8759734 100336476 2.237356439 1.447685123 3.027027756 2.090943471 0.8759734 789036 5.071958767 3.280569485 6.863348049 2.09212092 0.8759734 ENSBTAG00000034489 8.673974149 5.609996517 11.73795178 2.09232782 0.8759734 ENSBTAG00000011549 3.617729546 2.337123139 4.898335954 2.0958827 0.8759734 100298143 4.890062161 3.134004499 6.646119822 2.120647824 0.8759734 ENSBTAG00000011063 4.183920174 2.679892104 5.687948245 2.122454198 0.8759734 ENSBTAG00000010897 4.613780885 2.949378576 6.278183194 2.128646097 0.8759734 100300337 2.314950336 1.478537341 3.15136333 2.131405979 0.8759734 ENSBTAG00000012464 5.945959947 3.777112155 8.11480774 2.148415881 0.8759734 ENSBTAG00000011922 6.601628544 4.193163613 9.010093475 2.148757908 0.8759734 524909 2.75322743 1.748023813 3.758431046 2.150102886 0.8759734 100301323 4.629189032 2.93780052 6.320577545 2.151465868 0.8759734 100336266 4.587090032 2.906948301 6.267231763 2.155948821 0.8759734 536469 4.189691241 2.649039885 5.730342596 2.163177168 0.8759734 ENSBTAG00000008631 4.215253704 2.660617941 5.769889468 2.168627588 0.8759734 ENSBTAG00000032702 2.725935209 1.717171595 3.734698824 2.174912999 0.8759734 ENSBTAG00000011336 5.693908825 3.580908176 7.806909473 2.180147909 0.8759734 ENSBTAG00000001773 8.086054731 5.082601629 11.08950783 2.181856585 0.8759734 ENSBTAG00000011064 2.799987069 1.759601869 3.840372269 2.182523408 0.8759734 ENSBTAG00000033008 3.685159341 2.30627092 5.064047762 2.195773149 0.8759734 100296695 2.314331006 1.447685123 3.180976889 2.197285058 0.8759734 767866 2.266350669 1.416832904 3.115868434 2.199178481 0.8759734 ENSBTAG00000005852 4.240594285 2.637461829 5.84372674 2.215663057 0.8759734 ENSBTAG00000004420 4.218176411 2.618187667 5.818165156 2.222210894 0.8759734 ENSBTAG00000005087 5.601785538 3.476773464 7.726797612 2.222404678 0.8759734 100336064 5.699060561 3.519203739 7.878917384 2.23883525 0.8759734 528038 2.328518456 1.416832904 3.240204008 2.286934471 0.8759734 ENSBTAG00000000027 3.89136179 2.360279251 5.42244433 2.297374062 0.8759734 ENSBTAG00000012835 3.896837505 2.360279251 5.43339576 2.302013949 0.8759734 ENSBTAG00000000103 7.406521964 4.462650085 10.35039384 2.319337982 0.8759734 ENSBTAG00000021504 5.345555088 3.218865048 7.472245127 2.321391241 0.8759734 ENSBTAG00000018782 3.37253217 2.017510285 4.727554054 2.343261439 0.8759734 ENSBTAG00000005910 2.4238598 1.447685123 3.400034478 2.348600828 0.8759734 ENSBTAG00000012480 6.46656133 3.861972704 9.071149955 2.348838444 0.8759734 ENSBTAG00000018901 3.004857208 1.790454088 4.219260328 2.356530869 0.8759734 ENSBTAG00000019960 2.92724535 1.717171595 4.137319105 2.409380121 0.8759734 100337029 3.520108869 2.05994056 4.980277177 2.417680041 0.8759734

PAGE 248

ENSBTAG00000005819 2.502258987 1.459263179 3.545254794 2.429482801 0.8759734 513230 4.063058372 2.360279251 5.765837492 2.442862424 0.8759734 515978 4.078466519 2.348701195 5.808231844 2.472954779 0.8759734 ENSBTAG00000018599 2.013060887 1.158924488 2.867197286 2.47401562 0.8759734 ENSBTAG00000021015 2.060421894 1.158924488 2.9619193 2.555748309 0.8759734 ENSBTAG00000045422 3.600006142 2.017510285 5.182501998 2.568761129 0.8759734 510878 4.243171337 2.360279251 6.126063422 2.595482471 0.8759734 ENSBTAG00000006971 2.686441009 1.490115397 3.88276662 2.605681833 0.8759734 519500 3.131496159 1.717171595 4.545820723 2.647272257 0.8759734 ENSBTAG00000044201 2.119649013 1.158924488 3.080373537 2.657958796 0.8759734 539804 2.691703016 1.459263179 3.924142853 2.689126205 0.8759734 ENSBTAG00000021165 2.232737805 1.189776707 3.275698904 2.75320477 0.8759734 ENSBTAG00000042130 2.184757468 1.158924488 3.210590448 2.770318931 0.8759734 ENSBTAG00000009145 2.842729442 1.501693453 4.183765431 2.786031611 0.8759734 100336093 2.901956561 1.501693453 4.302219668 2.864912049 0.8759734 100337099 2.294286263 1.158924488 3.429648037 2.95933693 0.8759734 ENSBTAG00000026826 1.792325333 0.901016072 2.683634593 2.978453633 0.8759734 ENSBTAG00000000476 3.014426024 1.501693453 4.527158594 3.014702224 0.8759734 ENSBTAG00000006716 3.016452011 1.501693453 4.531210569 3.017400495 0.8759734 615819 1.898913458 0.901016072 2.896810845 3.215049026 0.8759734 ENSBTAG00000011135 1.901854127 0.901016072 2.902692182 3.221576476 0.8759734 ENSBTAG00000033414 1.993635473 0.901016072 3.086254874 3.42530502 0.8759734 504406 2.040996481 0.901016072 3.180976889 3.530433017 0.8759734 ENSBTAG00000025760 2.073550708 0.901016072 3.246085345 3.602694164 0.8759734 ENSBTAG00000039539 0.776229251 0 1.552458502 NA 0.8759734 ENSBTAG00000000144 0.79103603 0 1.582072061 NA 0.8759734 ENSBTAG00000021345 0.79103603 0 1.582072061 NA 0.8759734 ENSBTAG00000025431 0.80584281 0 1.61168562 NA 0.8759734 ENSBTAG00000013124 0.838397038 0 1.676794076 NA 0.8759734 ENSBTAG00000023039 0.853203817 0 1.706407635 NA 0.8759734 524957 0.900564825 0 1.80112965 NA 0.8759734 ENSBTAG00000005966 0.900564825 0 1.80112965 NA 0.8759734 ENSBTAG00000010836 0.900564825 0 1.80112965 NA 0.8759734 281848 15.88670559 16.79525538 14.97815579 0.891808755 0.8760019 ENSBTAG00000002483 13.63809 16.02867106 11.24750894 0.701711882 0.8760895 ENSBTAG00000011846 43.61577579 34.21434426 53.01720732 1.549560819 0.8762392 ENSBTAG00000010182 2.858043855 3.207286992 2.508800718 0.782218967 0.8762511 ENSBTAG00000039770 11670.9915 12873.27338 10468.70963 0.813212717 0.8762567 521251 31.51251453 35.69939955 27.32562951 0.76543667 0.8765409 ENSBTAG00000022278 278.7374815 242.5483713 314.9265916 1.298407365 0.8766918 ENSBTAG00000016378 15.01471863 10.41541557 19.61402169 1.883172261 0.8766918 ENSBTAG00000008218 2452.547657 2273.60891 2631.486404 1.157405037 0.8767667 ENSBTAG00000009900 67.22185437 59.30933299 75.13437575 1.266822134 0.8767667 ENSBTAG00000006227 4646.016986 4326.872822 4965.16115 1.147517238 0.8768383 ENSBTAG00000019886 174.1174128 198.4630598 149.7717657 0.754658151 0.8768441 ENSBTAG00000011484 762.4064409 654.2614072 870.5514746 1.33058662 0.8769406 ENSBTAG00000002444 972.2945682 1061.694317 882.8948198 0.831590417 0.8769434 ENSBTAG00000021289 476.0227077 516.4967587 435.5486567 0.843274714 0.8769531 ENSBTAG00000031895 39.63629534 33.52825115 45.74433953 1.36435209 0.8769605 ENSBTAG00000039714 3.947588061 4.654972115 3.240204008 0.696073774 0.8769956 ENSBTAG00000014261 8773.674569 8167.999378 9379.349759 1.148304416 0.8769956 ENSBTAG00000039891 10.71419237 12.60590593 8.822478807 0.699868685 0.877454

PAGE 249

ENSBTAG00000013218 6006.026834 5626.951223 6385.102444 1.134735702 0.8775382 ENSBTAG00000014972 11.80898284 14.88513879 8.732826886 0.586680918 0.8775747 ENSBTAG00000045080 3.922593136 4.912880531 2.932305741 0.596860787 0.8775747 100336661 2.161746587 2.895370245 1.428122928 0.493243629 0.8775802 ENSBTAG00000013076 42.27748681 44.99124778 39.56372583 0.879364939 0.8775802 ENSBTAG00000009216 8.286979165 6.61847407 9.955484261 1.504196308 0.8775802 ENSBTAG00000001538 666.1574859 581.1665075 751.1484643 1.292484089 0.8776022 ENSBTAG00000002700 7.323800201 8.451358432 6.196241971 0.733165209 0.8776033 ENSBTAG00000039990 9.688924922 11.0695461 8.308303744 0.750555052 0.8776106 ENSBTAG00000005607 1690.317669 1888.421783 1492.213554 0.790190818 0.8776381 784513 2.082450681 2.926222464 1.238678898 0.423303051 0.8776665 790067 2.082450681 2.926222464 1.238678898 0.423303051 0.8776665 ENSBTAG00000011502 2.097257461 2.926222464 1.268292457 0.433423116 0.8776665 783362 2.079534056 2.606609611 1.552458502 0.595585352 0.8776665 521133 2.094340836 2.606609611 1.582072061 0.606946301 0.8776665 616821 2.124573725 2.637461829 1.61168562 0.611074482 0.8776665 100336379 2.761619831 3.268991429 2.254248233 0.689585238 0.8776665 ENSBTAG00000003221 3018.699355 3349.814371 2687.584338 0.802308439 0.8776665 ENSBTAG00000010445 346.4931863 374.2968757 318.6894969 0.851435097 0.8776665 ENSBTAG00000012919 6.342050438 6.842203499 5.841897378 0.853803512 0.8776665 ENSBTAG00000007757 154.1257684 165.6459268 142.60561 0.860906228 0.8776665 ENSBTAG00000007237 940.7873615 1008.877968 872.6967549 0.86501716 0.8776665 407145 488.0987831 523.22058 452.9769862 0.865747647 0.8776665 ENSBTAG00000020301 556.8211921 514.7821553 598.8602289 1.163327483 0.8776665 ENSBTAG00000040275 410.4924387 373.2603854 447.724492 1.199496409 0.8776665 ENSBTAG00000012915 81.1358167 73.43086242 88.84077099 1.209856021 0.8776665 ENSBTAG00000005340 48.92713182 40.00889891 57.84536472 1.445812464 0.8776665 ENSBTAG00000000913 56.20784807 45.15659954 67.2590966 1.489463274 0.8776665 ENSBTAG00000031135 14.68875486 11.38915895 17.98835078 1.579427494 0.8776665 100336148 2.067024572 2.895370245 1.238678898 0.427813645 0.877705 100299006 28.52615025 31.80671022 25.24559029 0.793719002 0.877705 ENSBTAG00000005316 15458.39652 14308.34548 16608.44757 1.160752486 0.877705 ENSBTAG00000011633 3.854104706 4.716676552 2.99153286 0.63424592 0.8777628 ENSBTAG00000005195 579.4797346 652.7126472 506.2468219 0.775604432 0.8777628 ENSBTAG00000016337 945.1862096 1030.893927 859.4784925 0.83372156 0.8777628 ENSBTAG00000020513 14.32474411 16.68335677 11.96613144 0.717249628 0.8778031 ENSBTAG00000001473 17.27431012 14.79646408 19.75215617 1.334924078 0.8778031 ENSBTAG00000018207 1245.602775 1177.949033 1313.256516 1.114867009 0.8780108 ENSBTAG00000003724 158.2417636 182.4608716 134.0226555 0.7345282 0.8780646 ENSBTAG00000005098 2.01566426 2.668314048 1.363014472 0.510814862 0.8781067 ENSBTAG00000023439 1.952257814 2.606609611 1.297906017 0.497928808 0.8781167 ENSBTAG00000036226 1.952257814 2.606609611 1.297906017 0.497928808 0.8781167 ENSBTAG00000002559 2.00085748 2.668314048 1.333400913 0.499716633 0.8781167 ENSBTAG00000044064 2.00085748 2.668314048 1.333400913 0.499716633 0.8781167 ENSBTAG00000016434 1.955198482 2.606609611 1.303787354 0.500185125 0.8781167 785734 1.951638484 2.575757392 1.327519576 0.51538999 0.8781167 100126053 2.686347273 3.207286992 2.165407555 0.675152414 0.8781167 ENSBTAG00000005259 2.685727944 3.176434774 2.195021114 0.691032957 0.8781167 ENSBTAG00000018556 8.1482449 9.544696534 6.751793267 0.707386897 0.8781167 ENSBTAG00000012808 56.2115966 62.14639336 50.27679984 0.809005915 0.8781167 ENSBTAG00000012968 172.6847737 190.0236355 155.3459118 0.817508366 0.8781167 ENSBTAG00000001016 172.4868043 156.8086784 188.1649302 1.199965029 0.8781167

PAGE 250

ENSBTAG00000040196 216.9725353 195.5968128 238.3482578 1.218569231 0.8781167 ENSBTAG00000023054 187.2890139 167.9914497 206.5865782 1.229744601 0.8781167 ENSBTAG00000031396 75.05526026 66.86258252 83.24793801 1.245060165 0.8781167 534423 153.1425324 128.5339281 177.7511366 1.382912195 0.8781167 ENSBTAG00000025071 13.30239117 10.00317827 16.60160408 1.659632933 0.8781167 ENSBTAG00000006813 1.938070364 2.637461829 1.238678898 0.469648085 0.8781494 786257 1.922644254 2.606609611 1.238678898 0.47520691 0.8781494 407772 1.939772373 2.575757392 1.303787354 0.506176303 0.8781494 ENSBTAG00000004826 1.871283943 2.379553413 1.363014472 0.572802638 0.8781494 538699 1.855857833 2.348701195 1.363014472 0.580326895 0.8781494 ENSBTAG00000016350 1.886090722 2.379553413 1.392628031 0.585247645 0.8781494 ENSBTAG00000001066 5.717352629 7.061495797 4.373209461 0.619303556 0.8781494 788416 3.760465371 4.624119896 2.896810845 0.62645669 0.8781494 ENSBTAG00000033412 5.900193897 7.003673309 4.796714485 0.684885527 0.8781494 ENSBTAG00000017165 59.79822807 70.52772827 49.06872787 0.695736685 0.8781494 ENSBTAG00000012157 8.103668582 9.390435441 6.816901723 0.72594096 0.8781494 ENSBTAG00000039296 54.89502771 62.86950484 46.92055058 0.746316528 0.8781494 ENSBTAG00000018054 23.64853398 26.80945653 20.48761143 0.764193463 0.8781494 ENSBTAG00000017584 56.44629269 63.32612196 49.56646342 0.782717493 0.8781494 ENSBTAG00000007247 1934.834457 2137.855745 1731.813168 0.810070171 0.8781494 535362 29.41806823 32.35774861 26.47838785 0.818301303 0.8781494 ENSBTAG00000021746 3090.536105 2899.512123 3281.560088 1.131762845 0.8781494 ENSBTAG00000033983 82.30073186 74.56663079 90.03483292 1.207441344 0.8781494 ENSBTAG00000003901 3285.641527 2935.672792 3635.610262 1.238424892 0.8781494 ENSBTAG00000040585 138.2297504 119.4422336 157.0172673 1.3145875 0.8781494 ENSBTAG00000040208 15.0985091 12.96746167 17.22955654 1.328676111 0.8781494 ENSBTAG00000018334 1.840431724 2.317848976 1.363014472 0.588051459 0.878251 ENSBTAG00000035426 1.823922935 2.379553413 1.268292457 0.532996003 0.8783198 ENSBTAG00000009338 1.825624945 2.317848976 1.333400913 0.575275148 0.8783198 511707 1.764076487 2.348701195 1.17945178 0.502171916 0.8783501 ENSBTAG00000015132 1.778883267 2.348701195 1.209065339 0.514780399 0.8783501 100336971 1.763457158 2.317848976 1.209065339 0.521632493 0.8783501 ENSBTAG00000035140 1.681863957 2.05994056 1.303787354 0.632924745 0.8783501 100336756 1.712096846 2.090792779 1.333400913 0.637748957 0.8783501 ENSBTAG00000038985 1.696670737 2.05994056 1.333400913 0.647300674 0.8783501 ENSBTAG00000043271 1.741710405 2.090792779 1.392628031 0.666076546 0.8783501 100337329 1.726284296 2.05994056 1.392628031 0.676052532 0.8783501 516044 1.758838524 2.05994056 1.457736487 0.70765949 0.8783501 ENSBTAG00000030381 1.758838524 2.05994056 1.457736487 0.70765949 0.8783501 100138147 1.567716528 1.802032144 1.333400913 0.739942912 0.8783501 ENSBTAG00000018913 1.597330088 1.802032144 1.392628031 0.772809762 0.8783501 531691 30.47454307 34.16747686 26.78160928 0.783833392 0.8783501 100271721 1779.363247 1989.127622 1569.598871 0.789089073 0.8783501 ENSBTAG00000032451 97.44047623 89.04556716 105.8353853 1.188553105 0.8783501 ENSBTAG00000017570 99.63752651 90.15762424 109.1174288 1.210296186 0.8783501 ENSBTAG00000043561 344314.0763 306707.4192 381920.7334 1.245228219 0.8783501 ENSBTAG00000014235 67.90162979 56.51151171 79.29174786 1.403107888 0.8783501 ENSBTAG00000003801 23.83943991 26.608951 21.06992881 0.791836131 0.8783775 ENSBTAG00000020489 3.705105754 4.170007501 3.240204008 0.777025942 0.8784488 ENSBTAG00000015437 65.69732528 71.85360227 59.5410483 0.828643887 0.8784488 ENSBTAG00000012228 30.57637868 23.96476784 37.18798951 1.551777583 0.8784488 ENSBTAG00000016061 33.57343395 27.2486641 39.8982038 1.46422605 0.8784857

PAGE 251

ENSBTAG00000040440 2.587006625 2.949378576 2.224634673 0.754272338 0.8786374 ENSBTAG00000043509 12.53889075 14.5192815 10.5585 0.727205406 0.8786499 ENSBTAG00000034656 58.04877593 50.58806849 65.50948337 1.294959174 0.8786499 ENSBTAG00000038263 37.78294235 42.34158492 33.22429978 0.784673031 0.8787605 ENSBTAG00000017011 18.56841314 22.10817219 15.02865409 0.679778227 0.8788754 ENSBTAG00000042292 5.767240385 6.518708696 5.015772073 0.769442586 0.8792194 ENSBTAG00000022893 5.766001725 6.457004259 5.074999192 0.785968073 0.8792194 ENSBTAG00000003320 96.11200422 107.1254401 85.09856834 0.794382439 0.8792194 ENSBTAG00000001049 389.6367994 422.2027001 357.0708987 0.845733338 0.8792194 ENSBTAG00000036260 16.54410243 13.38351313 19.70469172 1.47231086 0.8792194 ENSBTAG00000004956 250.0335233 280.7813648 219.2856817 0.780983744 0.8793043 404141 2.540264947 2.980230795 2.100299099 0.704743775 0.8796552 ENSBTAG00000013718 43.33111563 47.96315949 38.69907178 0.806849928 0.8796552 ENSBTAG00000006730 11.62325302 8.109144648 15.13736139 1.866702599 0.8796637 ENSBTAG00000033516 12.3044311 14.16881643 10.44004576 0.736832594 0.8797409 540969 16.5313334 19.26681027 13.79585653 0.71604258 0.8799525 527795 10.13881241 11.58536293 8.692261896 0.750279637 0.8801357 ENSBTAG00000013855 129.0054962 138.8851516 119.1258408 0.857729134 0.8801357 509591 3321.792915 3654.398733 2989.187097 0.817969607 0.8801612 507983 103.0685383 96.76875401 109.3683225 1.13020286 0.8801612 ENSBTAG00000014581 72.19129529 80.3941228 63.98846779 0.795934647 0.8802037 ENSBTAG00000002603 5519.028498 5191.340637 5846.716359 1.126244022 0.8802037 ENSBTAG00000006647 20.39226328 17.08734279 23.69718376 1.386826733 0.8802037 ENSBTAG00000003696 89.03777194 75.65005638 102.4254875 1.353938019 0.8803418 100337300 34.94306983 42.84187395 27.04426571 0.631257768 0.8804467 783811 5.285294357 6.102657237 4.467931476 0.732128858 0.8804467 ENSBTAG00000017524 55.96496451 63.92138744 48.00854157 0.751056 0.8804467 ENSBTAG00000008787 568.7525287 611.2925985 526.212459 0.860819287 0.8804467 ENSBTAG00000002103 23.29645838 19.4668962 27.12602056 1.39344353 0.8804467 100313104 5.466823492 6.968939141 3.964707843 0.568911245 0.8805743 527882 11.12443413 13.53389227 8.714976001 0.643937149 0.88061 ENSBTAG00000014007 662.1169525 740.9434867 583.2904183 0.787226595 0.88061 ENSBTAG00000000986 19.56936089 16.56764401 22.57107777 1.36235893 0.88061 ENSBTAG00000016007 2899.645544 3211.542492 2587.748596 0.805765019 0.8811234 ENSBTAG00000008965 2.457433087 2.660617941 2.254248233 0.847264914 0.881304 615190 468.7609181 522.3934436 415.1283926 0.794666161 0.8813554 100299249 8.299678314 6.680178507 9.91917812 1.484867225 0.8813554 ENSBTAG00000005604 9.955225678 11.90497578 8.005475571 0.672447867 0.8816959 ENSBTAG00000006448 61.05845671 70.32826532 51.78864811 0.736384551 0.8816959 ENSBTAG00000004924 12.0135051 13.77640847 10.25060174 0.744069237 0.8816959 786062 11.15526752 12.62136593 9.689169102 0.767679913 0.8816959 ENSBTAG00000038702 126.6755024 142.7269389 110.6240658 0.775074886 0.8816959 ENSBTAG00000023635 61.18624315 68.63522461 53.73726168 0.782939984 0.8816959 ENSBTAG00000006904 5.590925169 6.26080028 4.921050058 0.786009749 0.8816959 ENSBTAG00000004629 3.516305098 3.881246867 3.15136333 0.811946119 0.8816959 ENSBTAG00000010192 417.204957 458.0334715 376.3764425 0.821722572 0.8816959 100336547 3.515685769 3.850394648 3.180976889 0.826143079 0.8816959 537351 810.6557895 871.0221786 750.2894003 0.861389547 0.8816959 ENSBTAG00000000837 6740.517491 7180.228685 6300.806296 0.877521674 0.8816959 ENSBTAG00000038274 407.2884032 373.3373293 441.2394772 1.181878807 0.8816959 ENSBTAG00000014139 1139.79093 1022.587981 1256.99388 1.229228099 0.8816959 ENSBTAG00000038657 63.81866144 56.31759193 71.31973095 1.266384597 0.8816959

PAGE 252

ENSBTAG00000004874 422.6712958 370.5913042 474.7512874 1.281064294 0.8816959 781112 53.79330789 46.58826947 60.9983463 1.309306978 0.8816959 541122 17.79236087 14.34623363 21.2384881 1.480422572 0.8816959 100300032 14.09964786 16.55606595 11.64322977 0.703260654 0.8817137 ENSBTAG00000016954 41.33784877 46.24161856 36.43407899 0.787906655 0.8817137 ENSBTAG00000012594 101.7108039 113.645611 89.77599684 0.789964488 0.8817137 520924 2103.682882 2302.044584 1905.32118 0.827664761 0.8817137 ENSBTAG00000010514 61.31760667 56.63713699 65.99807635 1.165279177 0.8817137 ENSBTAG00000002828 137.3675793 125.0520267 149.6831319 1.196966861 0.8817137 100138783 13.11952722 10.08366948 16.15538496 1.602133528 0.8817137 ENSBTAG00000043982 2.393587334 2.402709525 2.384465144 0.992406747 0.8817744 ENSBTAG00000007014 187.2094533 162.4755226 211.9433839 1.30446347 0.8817744 ENSBTAG00000020647 96.60722108 111.7633545 81.4510877 0.728781702 0.8819612 ENSBTAG00000026254 675.7791773 730.0924615 621.4658932 0.851215327 0.8819612 ENSBTAG00000008117 4.830177199 5.840866872 3.819487526 0.65392477 0.8822459 ENSBTAG00000016852 8.940302357 10.26496863 7.615636082 0.741905441 0.8822459 ENSBTAG00000021446 4.23487614 4.462650085 4.007102194 0.897919872 0.8822459 ENSBTAG00000000548 1289.483682 1169.770853 1409.196512 1.204677402 0.8822459 ENSBTAG00000016963 13.05008791 10.66119075 15.43898507 1.448148283 0.8822459 ENSBTAG00000038730 6.572079646 7.519490142 5.624669151 0.748012039 0.8822814 ENSBTAG00000006706 7.407081054 5.586840405 9.227321702 1.651617199 0.882304 515573 316.5207806 342.6827587 290.3588025 0.8473108 0.8823829 ENSBTAG00000017420 127.7154989 144.7550018 110.675996 0.764574589 0.8824036 ENSBTAG00000007530 17.73253969 19.44762204 16.01745735 0.823620354 0.8824036 ENSBTAG00000043573 334.369704 350.5956359 318.1437722 0.907437913 0.8824036 ENSBTAG00000006075 1421.64042 1255.670197 1587.610642 1.264353208 0.8824036 100138042 41.38412658 34.71365852 48.05459465 1.384313746 0.8824117 785533 31.10297299 25.71993258 36.4860134 1.418588998 0.8824924 ENSBTAG00000026067 28.95419348 33.40089253 24.50749442 0.733737711 0.8825949 ENSBTAG00000018636 227.0414371 207.6926484 246.3902259 1.186321364 0.8825949 614857 2.328478879 2.402709525 2.254248233 0.938210886 0.8827829 ENSBTAG00000032790 2.328478879 2.402709525 2.254248233 0.938210886 0.8827829 ENSBTAG00000030281 477.4303362 437.3367075 517.5239649 1.183353595 0.8830733 533844 12.80643017 15.41641562 10.19644471 0.661401778 0.8834234 786844 3.411394938 4.139155283 2.683634593 0.648353205 0.8834946 ENSBTAG00000004292 14.85555914 11.33515062 18.37596765 1.621148961 0.8834946 ENSBTAG00000021077 17.54583672 20.72607345 14.36559999 0.693117296 0.8835668 786383 72.17084184 61.48949124 82.85219244 1.34742036 0.8843128 ENSBTAG00000015204 8.885200681 10.19938225 7.571019117 0.742301733 0.88461 ENSBTAG00000014246 155.7949267 174.492681 137.0971725 0.785690103 0.88461 ENSBTAG00000033252 67.93067793 61.6079078 74.25344806 1.205258395 0.88461 ENSBTAG00000020648 879.4069168 791.068022 967.7458117 1.223340831 0.88461 ENSBTAG00000018072 71.54249543 62.74034941 80.34464145 1.28058964 0.88461 100337487 5141.283376 5255.582115 5026.984638 0.956503871 0.8846136 535430 1897.759057 1727.087767 2068.430347 1.197640552 0.8846136 616065 17.70623177 18.95163455 16.46082899 0.86857041 0.8847995 ENSBTAG00000003846 3511.154694 3192.94225 3829.367138 1.199322392 0.8847995 ENSBTAG00000025534 60.36282306 53.71098232 67.0146638 1.247690154 0.8847995 ENSBTAG00000001824 7.236111706 6.141205562 8.331017849 1.35657694 0.8847995 ENSBTAG00000018415 43.79982381 37.92912901 49.67051862 1.309561277 0.8849922 ENSBTAG00000002642 26.96228521 31.27155143 22.65301899 0.72439703 0.8852371 515112 2.196641541 1.201354763 3.191928319 2.656940663 0.8852733

PAGE 253

ENSBTAG00000015379 106.2336095 91.79783477 120.6693841 1.314512313 0.8856499 ENSBTAG00000001080 2.122607643 1.201354763 3.043860523 2.533689979 0.8856499 ENSBTAG00000003939 2.122607643 1.201354763 3.043860523 2.533689979 0.8856499 ENSBTAG00000039275 620.7897992 654.2271561 587.3524423 0.89778059 0.8856722 617869 31.50348761 26.08488288 36.92209234 1.415459387 0.8857289 538888 9.372490511 7.261581726 11.4833993 1.581390905 0.8857308 ENSBTAG00000042994 4.633949042 5.975366414 3.292531671 0.551017535 0.8858528 538919 304.7974881 344.4117881 265.1831881 0.769959674 0.8858528 613787 141.7861281 156.093263 127.4789932 0.816684786 0.8858528 100335267 20.29242209 22.27359174 18.31125245 0.822105957 0.8858528 ENSBTAG00000000012 15.46227248 12.81368796 18.11085699 1.413399253 0.8858528 536141 98.17061251 104.8135582 91.52766681 0.873242626 0.8859259 ENSBTAG00000012778 523.1742462 583.2815666 463.0669257 0.793899468 0.8860952 ENSBTAG00000013018 8.719824743 10.39558622 7.044063262 0.67760135 0.8864488 ENSBTAG00000023734 21.67531796 24.2684333 19.08220261 0.78629726 0.8865414 100337402 7051.313218 6733.396463 7369.229972 1.094429834 0.8865414 ENSBTAG00000009487 43.45095108 38.9260285 47.97587366 1.232488273 0.8865414 504592 17.09156029 13.91090801 20.27221257 1.457288953 0.8865592 512910 31.13946614 27.51759539 34.76133689 1.263240352 0.8865746 ENSBTAG00000012703 1411.573339 1317.970576 1505.176103 1.142040748 0.8866946 615672 9.246452928 7.323286163 11.16961969 1.525219614 0.8866946 404061 4.885302918 5.586840405 4.183765431 0.748860738 0.8868309 ENSBTAG00000002295 310.648928 341.2034457 280.0944103 0.820901471 0.8868514 ENSBTAG00000020277 75.79219188 82.68076775 68.90361601 0.83336933 0.8872542 ENSBTAG00000026936 428.8229923 478.5906459 379.0553388 0.792024127 0.8873655 ENSBTAG00000021039 3594.534293 3863.280348 3325.788237 0.860871575 0.8873655 ENSBTAG00000025669 41.96750209 47.20094451 36.73405968 0.778248403 0.887587 ENSBTAG00000002163 4.547117878 5.428697363 3.665538393 0.675215093 0.8876679 ENSBTAG00000038903 4.540929037 5.913661977 3.168196097 0.535741831 0.887807 ENSBTAG00000000873 14.17452446 16.11741356 12.23163535 0.758908078 0.887807 530846 42.46164864 44.34481335 40.57848392 0.915067194 0.887807 533303 6.242766175 6.487856477 5.997675873 0.924446448 0.887807 ENSBTAG00000012366 1037.777447 958.7194614 1116.835433 1.164924128 0.887807 ENSBTAG00000008800 14.25792917 10.85406796 17.66179038 1.627204699 0.887807 ENSBTAG00000004237 1574.765261 1669.552716 1479.977806 0.886451678 0.8879271 100139010 17.87669056 20.56793041 15.1854507 0.73830718 0.8880754 ENSBTAG00000020419 121.1010636 103.4096806 138.7924465 1.34216106 0.8880873 ENSBTAG00000002847 6.22344852 7.230729507 5.216167533 0.721388835 0.8880945 ENSBTAG00000011533 14.22316255 16.04024912 12.40607598 0.773434121 0.8880945 ENSBTAG00000023374 855.5115888 918.1390212 792.8841564 0.863577452 0.8880945 100337113 6.131855858 4.150733339 8.112978378 1.954589157 0.8880945 ENSBTAG00000035286 194.9072041 218.0009543 171.8134539 0.78813166 0.8881545 ENSBTAG00000007162 114.2369719 125.7227276 102.7512162 0.817284337 0.8881564 ENSBTAG00000010957 75.65412663 61.77055577 89.5376975 1.449520672 0.8882725 ENSBTAG00000003263 60.74567775 51.98611462 69.50524088 1.336996261 0.888307 ENSBTAG00000021602 110.2908828 91.83021695 128.7515487 1.402060814 0.888307 538058 45.48237393 51.10527969 39.85946818 0.779948147 0.8884263 100335509 4.482033466 5.10908451 3.854982423 0.754534871 0.8884787 100337261 2697.102179 2818.974037 2575.230322 0.913534601 0.8884787 100298410 80.31273765 70.62188268 90.00359263 1.274443405 0.8884787 ENSBTAG00000011124 9.854468881 7.900807432 11.80813033 1.494547289 0.8884787 ENSBTAG00000011813 16.66987439 19.27838833 14.06136044 0.729384646 0.8886046

PAGE 254

ENSBTAG00000033338 221.5734093 196.1029839 247.0438346 1.259765811 0.8886069 ENSBTAG00000021960 25.10193209 30.20081426 20.00304993 0.662334789 0.8887288 ENSBTAG00000011048 8.486887209 9.941473829 7.032300588 0.707370025 0.8887288 ENSBTAG00000002981 14.93662135 17.37610342 12.49713927 0.719214139 0.8887288 ENSBTAG00000010795 62.24050723 67.91792748 56.56308698 0.832815268 0.8887288 ENSBTAG00000007934 319.6022845 347.9596319 291.2449372 0.837007832 0.8887288 ENSBTAG00000021172 1289.035469 1179.131114 1398.939825 1.186415835 0.8887288 ENSBTAG00000039374 12175.38238 11088.30775 13262.45701 1.19607584 0.8887288 ENSBTAG00000038368 3381.74169 3630.899541 3132.583839 0.862756957 0.8887567 286804 27.64243731 31.92235519 23.36251942 0.731854504 0.8887855 ENSBTAG00000034206 13.03161651 14.62729816 11.43593485 0.781821408 0.8887855 100141057 31.15763967 34.56758092 27.74769843 0.802708714 0.8887855 ENSBTAG00000000079 49.55137636 53.93422436 45.16852836 0.837474329 0.8887855 538489 428.0683338 460.1583798 395.9782878 0.860526082 0.8887855 ENSBTAG00000019986 1622.017345 1466.043247 1777.991443 1.212782397 0.8887855 ENSBTAG00000033217 5796.001297 5166.574871 6425.427724 1.243653268 0.8887855 507402 9.750617356 8.385772045 11.11546267 1.325514527 0.8887855 ENSBTAG00000012433 21.61841952 17.54970647 25.68713258 1.463678759 0.8887855 ENSBTAG00000002348 25.40312449 22.77825011 28.02799887 1.230471996 0.8888263 ENSBTAG00000006225 1271.680556 1388.044747 1155.316364 0.83233366 0.8888734 ENSBTAG00000006807 10.64388795 12.03996271 9.247813193 0.768093175 0.8889616 ENSBTAG00000001074 14.81573801 16.40617419 13.22530183 0.80611736 0.8889616 ENSBTAG00000002721 316.0407084 349.9624193 282.1189975 0.806140837 0.8889616 ENSBTAG00000006611 791.9621647 716.8368836 867.0874457 1.209602164 0.8890473 ENSBTAG00000020056 668.7291095 592.1469378 745.3112812 1.258659352 0.8890674 ENSBTAG00000021282 539.1402398 580.5790779 497.7014016 0.857249978 0.889175 100138099 10.60452556 12.49407511 8.714976001 0.697528703 0.8893002 ENSBTAG00000001303 56.47387263 64.56152013 48.38622514 0.749459199 0.8894013 ENSBTAG00000003649 514.9720174 470.8016058 559.142429 1.187639171 0.8894013 ENSBTAG00000013722 4.694800253 5.359784208 4.029816298 0.751861669 0.8894412 ENSBTAG00000007214 117.9797935 130.9806613 104.9789257 0.801484163 0.8894412 ENSBTAG00000005137 1838.713409 1740.104902 1937.321916 1.113336279 0.8894412 618360 8.8309079 7.096229965 10.56558583 1.488901274 0.8894412 ENSBTAG00000016191 31.77636415 29.60353144 33.94919687 1.146795508 0.8896618 ENSBTAG00000017020 16.73840124 19.33572343 14.14107905 0.731344711 0.8896789 ENSBTAG00000014726 14632.81449 13770.99565 15494.63333 1.125164348 0.8896789 ENSBTAG00000007780 44.4266175 37.78256402 51.07067098 1.351699449 0.8896789 ENSBTAG00000006786 801.4428466 893.5423804 709.3433127 0.793855253 0.8897677 ENSBTAG00000000817 15.2756195 10.69259815 19.85864086 1.857232507 0.8897677 ENSBTAG00000013177 328.0235864 353.1646677 302.8825052 0.857624029 0.8899562 ENSBTAG00000002473 37.82243877 43.47347134 32.17140619 0.740023863 0.8901548 ENSBTAG00000031753 24.22611833 25.59375212 22.85848454 0.893127527 0.8901997 ENSBTAG00000012239 1430.583923 1304.01787 1557.149977 1.194117054 0.8902251 ENSBTAG00000012266 10.46430052 12.58663177 8.341969279 0.662764228 0.8904548 ENSBTAG00000004792 27.06537939 30.64390378 23.48685499 0.766444614 0.8904548 616412 12.7820142 14.08062911 11.4833993 0.815545897 0.8904548 ENSBTAG00000011161 13.62955742 14.96237102 12.29674381 0.821844599 0.8904548 100138807 104.0527608 112.4115222 95.69399934 0.851282835 0.8904548 785262 6.649792474 4.666550171 8.633034778 1.849982206 0.8904548 ENSBTAG00000017242 19.93887549 23.18223613 16.69551485 0.720185696 0.8908284 ENSBTAG00000000285 1858.371975 2087.572216 1629.171733 0.780414551 0.8909889 512881 392.1509473 415.1418951 369.1599996 0.889238123 0.8910757

PAGE 255

ENSBTAG00000019153 200.2751746 219.5014739 181.0488753 0.824818495 0.8911388 ENSBTAG00000017872 1592.703377 1744.677648 1440.729106 0.825785272 0.8916824 ENSBTAG00000043992 13.59524848 10.899825 16.29067196 1.494581056 0.8916824 ENSBTAG00000024095 1464.569764 1323.043863 1606.095665 1.213939848 0.8918092 ENSBTAG00000013973 8.479741826 10.22635251 6.733131138 0.658409842 0.8918462 100125264 35.11199493 38.57993277 31.64405708 0.820220638 0.8919412 524928 4.273320003 5.005437186 3.541202819 0.707471233 0.8920657 ENSBTAG00000010547 42.385636 37.93245577 46.83881623 1.234795251 0.8920938 ENSBTAG00000020263 12.32296215 14.89671684 9.749207464 0.654453432 0.8921808 785803 327.4721478 352.1319236 302.8123719 0.859940129 0.8921808 527199 143.396214 126.4120119 160.380416 1.268711838 0.8921808 ENSBTAG00000001838 3.125377071 2.005932229 4.244821912 2.116134259 0.8922622 ENSBTAG00000021414 2944.884448 3165.182669 2724.586227 0.860799048 0.8925066 ENSBTAG00000014449 281.0811494 259.6483304 302.5139684 1.165091137 0.8925073 ENSBTAG00000000300 4.242467784 4.943732749 3.541202819 0.716301426 0.8927003 ENSBTAG00000001404 24.11225363 26.543852 21.68065525 0.816786322 0.8927194 ENSBTAG00000003229 24392.01559 22225.56873 26558.46245 1.194950859 0.8927457 ENSBTAG00000021700 13.35713 15.28198387 11.43227613 0.748088483 0.892871 100335854 202.6682613 226.9270087 178.4095139 0.786197795 0.892871 ENSBTAG00000006601 43.40053953 32.28939063 54.51168843 1.688222892 0.892871 ENSBTAG00000000803 140.8690144 124.7773317 156.960697 1.257926379 0.8929983 ENSBTAG00000003101 4.524805681 5.298079771 3.751531591 0.708092696 0.8930172 ENSBTAG00000005533 36.72716985 38.80761194 34.64672775 0.892781751 0.8931463 531074 4.517246378 5.040171355 3.994321402 0.792497144 0.8931746 ENSBTAG00000000308 7625.324465 8427.512754 6823.136176 0.809626325 0.8933623 ENSBTAG00000011909 876.8096443 840.8941852 912.7251033 1.085422066 0.8933623 ENSBTAG00000042458 7.323842207 8.174175854 6.47350856 0.791946329 0.8934068 100297865 52.87628429 58.53567553 47.21689305 0.80663446 0.8934068 ENSBTAG00000021527 20.65659332 22.27844847 19.03473817 0.854401427 0.8934068 ENSBTAG00000001675 13.16252725 11.34284673 14.98220776 1.320850764 0.8934068 ENSBTAG00000007196 46.33458535 50.92744289 41.7417278 0.819631331 0.8934429 ENSBTAG00000003116 128.43172 113.709803 143.153637 1.258938396 0.8934946 100300732 17.29968044 19.77881295 14.82054793 0.749314328 0.8935839 ENSBTAG00000015318 230.9108461 249.5871306 212.2345616 0.850342568 0.8935839 ENSBTAG00000020209 12.38283876 10.44571261 14.3199649 1.370894016 0.8935839 281642 4.180299997 4.943732749 3.416867245 0.691151286 0.8936797 513654 128.4329266 114.5301923 142.3356608 1.242778503 0.8937221 ENSBTAG00000017999 577.2500557 621.7350899 532.7650215 0.856900359 0.893838 618737 2.984532708 2.067636667 3.901428749 1.886902478 0.893838 ENSBTAG00000002292 11.21550861 9.379344773 13.05167245 1.391533499 0.8938536 ENSBTAG00000018330 261.8567803 285.0223028 238.69