Ephrin-A1 inhibits NSCLC tumor growth via induction of Cdx-2 a tumor suppressor gene

MISSING IMAGE

Material Information

Title:
Ephrin-A1 inhibits NSCLC tumor growth via induction of Cdx-2 a tumor suppressor gene
Physical Description:
Mixed Material
Language:
English
Creator:
Sukka-Ganesh, Bhagyalaxmi
Mohammed, Kamal A.
Kaye, Frederic
Goldberg, Eugene P
Nasreen, Najmunnisa
Publisher:
BioMed Central
Publication Date:

Notes

Abstract:
Background: Tumor formation is a complex process which involves constitutive activation of oncogenes and suppression of tumor suppressor genes. Receptor EphA2 and its ligand ephrin-A1 form an important cell communication system with its functional role in cell-cell interaction and tumor growth. Loss of cell-cell adhesion is central to the cellular transformation and acquisition of metastatic potential. Claudins, the integrated tight junction (TJ) cell-cell adhesion proteins located on the apico-lateral portion of epithelial cells, functions in maintaining cell polarity. There is extensive evidence implicating Eph receptors and ephrins in malignancy, but the mechanisms how these molecular players affect TJ proteins and regulate tumor growth are not clear. In the present study we hypothesized that EphA2 signaling modulates claudin-2 gene expression via induction of cdx-2, a tumor suppressor gene in NSCLC cells. Methods: The expression of EphA2, claudin-2 was determined in various NSCLC cell lines by using real-time quantitative polymerase chain reaction and Western blot analysis. The claudin-2 expression was also analyzed by immunofluorescence analysis. EphA2 and erk1/erk2 phosphorylation in ephrin-A1 activated cells was evaluated by Western blot analysis. The cell proliferation and tumor colony formation were determined by WST-1 and 3-D matrigel assays respectively. Results: NSCLC cells over expressed receptor EphA2 and claudin-2. Ephrin-A1 treatment significantly down regulated the claudin-2 and EphA2 expression in NSCLC cells. The transient transfection of cells with vector containing ephrin-A1 construct (pcDNA-EFNA1) decreased the expression of claudin-2, EphA2 when compared to empty vector. In addition ephrin-A1 activation increased cdx-2 expression in A549 cells. In contrast over-expression of EphA2 with plasmid pcDNA-EphA2 up regulated claudin-2 mRNA expression and decreased cdx-2 expression. The transient transfection of cells with vector containing cdx-2 construct (pcMV-cdx-2) decreased the expression of claudin-2 in A549 cells. Moreover, silencing the expression of receptor EphA2 by siRNA significantly reduced claudin-2 expression and decreased cell proliferation and tumor formation. Furthermore, silencing cdx-2 gene expression before ephrin-A1 treatment increased claudin-2 expression along with increased cell proliferation and tumor growth in A549 cells. Conclusions: Our study suggests that EphA2 signaling up-regulates the expression of the TJ-protein claudin-2 that plays an important role in promoting cell proliferation and tumor growth in NSCLC cells. We conclude that receptor EphA2 activation by ephrin-A1 induces tumor suppressor gene cdx-2 expression which attenuates cell proliferation, tumor growth and thus may be a promising therapeutic target against NSCLC. Keywords: Receptor EphA2, Ephrin-A1, Claudin-2, cdx-2, NSCLC
General Note:
Publication of this article was funded in part by the University of Florida Open-Access publishing Fund. In addition, requestors receiving funding through the UFOAP project are expected to submit a post-review, final draft of the article to UF's institutional repository, IR@UF, (www.uflib.ufl.edu/UFir) at the time of funding. The institutional Repository at the University of Florida community, with research, news, outreach, and educational materials.
General Note:
Sukka-Ganesh et al. BMC Cancer 2012, 12:309 http://www.biomedcentral.com/1471-2407/12/309
General Note:
doi:10.1186/1471-2407-12-309 Cite this article as: Sukka-Ganesh et al.: Ephrin-A1 inhibits NSCLC tumor growth via induction of Cdx-2 a tumor suppressor gene. BMC Cancer 2012 12:309. Pgs.1-13

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
All rights reserved by the source institution.
System ID:
AA00013230:00001


This item is only available as the following downloads:


Full Text


Sukka-Ganesh et al. BMC Cancer 2012, 12:309
http://www.biomedcentral.com/1471-2407/12/309


CBMancer
Cancer


Ephrin-A1 inhibits NSCLC tumor growth via

induction of Cdx-2 a tumor suppressor gene

Bhagyalaxmi Sukka-Ganeshl, Kamal A Mohammed1'2, Frederic Kaye4, Eugene P Goldberg3
and Najmunnisa Nasreen2*


Abstract
Background: Tumor formation is a complex process which involves constitutive activation of oncogenes and
suppression of tumor suppressor genes. Receptor EphA2 and its ligand ephrin-Al form an important cell
communication system with its functional role in cell-cell interaction and tumor growth. Loss of cell-cell adhesion is
central to the cellular transformation and acquisition of metastatic potential. Claudins, the integrated tight junction
(TJ) cell-cell adhesion proteins located on the apico- lateral portion of epithelial cells, functions in maintaining cell
polarity. There is extensive evidence implicating Eph receptors and ephrins in malignancy, but the mechanisms
how these molecular players affect TJ proteins and regulate tumor growth are not clear. In the present study we
hypothesized that EphA2 signaling modulates claudin-2 gene expression via induction of cdx 2, a tumor suppressor
gene in NSCLC cells.
Methods: The expression of EphA2, claudin-2 was determined in various NSCLC cell lines by using real-time
quantitative polymerase chain reaction and Western blot analysis. The claudin-2 expression was also analyzed by
immunofluorescence analysis. EphA2 and erkl/erk2 phosphorylation in ephrin-Al activated cells was evaluated by
Western blot analysis. The cell proliferation and tumor colony formation were determined by WST 1 and 3-D
matrigel assays respectively.
Results: NSCLC cells over expressed receptor EphA2 and claudin-2. Ephrin-Al treatment significantly down
regulated the claudin-2 and EphA2 expression in NSCLC cells. The transient transfection of cells with vector
containing ephrin-Al construct (pcDNA-EFNAI) decreased the expression of claudin-2, EphA2 when compared to
empty vector. In addition ephrin-Al activation increased cdx-2 expression in A549 cells. In contrast over-expression
of EphA2 with plasmid pcDNA-EphA2 up regulated claudin-2 mRNA expression and decreased cdx-2 expression.
The transient transfection of cells with vector containing cdx-2 construct (pcMV-cdx-2) decreased the expression of
claudin-2 in A549 cells. Moreover, silencing the expression of receptor EphA2 by siRNA significantly reduced
claudin-2 expression and decreased cell proliferation and tumor formation. Furthermore, silencing cdx-2 gene
expression before ephrin-Al treatment increased claudin-2 expression along with increased cell proliferation and
tumor growth in A549 cells.
Conclusions: Our study suggests that EphA2 signaling up-regulates the expression of the TJ-protein claudin-2 that
plays an important role in promoting cell proliferation and tumor growth in NSCLC cells. We conclude that receptor
EphA2 activation by ephrin-Al induces tumor suppressor gene cdx 2 expression which attenuates cell proliferation,
tumor growth and thus may be a promising therapeutic target against NSCLC.
Keywords: Receptor EphA2, Ephrin-Al, Claudin-2, cdx 2, NSCLC


*Correspondence nnasreen@medicineufl edu
2NF/SG Veterans Health System, Malcom Randall Veterans Affairs Medical
Center, University of Florida, Gainesville, FL, USA
Full list of author information is available at the end of the article
0 2012 Sukka-Ganesh et al., licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the
Biolloed Central Creative Commons Attribution License (http//creativecommons.org/licenses/by/2.0), which permits unrestricted use,
distribution, and reproduction in any medium, provided the original work is properly cited.






Sukka-Ganesh et al BMC Cancer 2012, 12:309
http://www.biomedcentral.com/1471-2407/12/309


Background
Tight junctions (TJ), the most apical cell-cell ..i...
owing to their cellular location are responsible for main-
taining the cellular integrity. Any I. -,i :-.,, of the TJ
characteristics could i:..e.- i :, 11; lead to cellular transform-
ation and acquisition of tumorogenesis potential [1]. How-
ever, emerging '!,i. from many studies related with
claudin and cancer have implicated claudin family members
in a wide range of human cancers. The expression of
claudins would decrease during tumorogenesis as tight
junctions are lost during cellular transformation, but it is
understood that claudins are expressed in a tissue specific
manner [2-11]. Down-regulation of claudins in cancer
seems to be well understood, but increased expression of
claudin .. .. i,.in.. to neoplastic progression is less clear
[1]. Aberrant tissue expression of certain claudins may con-
tribute to neoplasia by directly altering TJ structure and
function [1]. Furthermore it is also postulated that claudins
m ay affect i ..1 Iii -... l .... [12].
Cdx-2 is a transcriptional factor crucial to the normal
proliferation and differentiation of intestinal epithelial
cells [13], however little is known about the transcrip-
tional program that controls genes involved in NSCLC
tumor growth. In colorectal cancer reduced expression
of cdx-2 has been reported in rodents and humans
[14,15]. In addition, cdx-2 null mice embryos failed to
survive and heterozygote's developed intestinal tumors.
Furthermore the polyps developed in the colon do not
express cdx-2 which indicates that loss of cdx-2 pro-
motes tumorogenesis [16]. Cdx-2 regulates claudin-2
functions by binding to its 5' flanking region and affects
the expression of downstream pathway genes [17]. How-
ever, if receptor EphA2 activation with ephrin-A1
induced expression of cdx-2 plays any role in NSCLC
tumor growth is not known.
The Eph family of receptor tyrosine kinases plays key
role in the development of cancer. The Eph receptors
and ephrins were originally .I .. *... as neuronal
guidance and vasculature formation proteins during em-
bryonic development [18]. Eph receptors and their
ligands, ephrins are often dysregulated in i... 1;.. ), phe-
notypes including NSCLC [19- .i However the precise
role of these proteins in tumor growth is not well under-
stood. I ..r-.... the role of EphA2 and ephrin-A1 in
NSCLC is particularly important, as EphA2 receptor is
LI. ,1. expressed in NSCLC which contributes to tumor
development. The aim of our study was to ii.. .:t -i.
the underlying mechanisms of tumor suppressor effect
of ephrin-A1 in NSCLC. We report a novel mechanism
of ephrin-A1 mediated attenuation of NSCLC tumor
growth due to down regulation of. im. 2 and induc-
tion of tumor suppressor gene cdx-2. Thus providing the
evidence that receptor EphA2 may be a promising thera-
peutic target for NSCLC.


Methods
NSCLC cell culture
A549 NSCLC cell line was obtained from American Type
Culture Collection (Manassas, VA) and NCI-H2126, NCI-
H838, NCI-H522, NCI-H23 NSCLC cell-lines were a kind
gift from Dr. Frederic Kaye, MD, Division of Haemato-
logy/Oncology, University of Florida, t.. 1... i. Florida.
The NSCLC cells were resuspended in RPMI-1640 (Gibco
Laboratories, Grand Island, NY) containing 10% FBS,
penicillin (100 U/ml) and streptomycin (100 pg/ml). The
cells were plated in 100 mm Petri dishes (Corning Costar
Corporation, MA) and incubated at 37C in 5% CO2 and
95% air. The cell culture medium was changed on alter-
nate days. When the cells were confluent they were trypsi-
nized and seeded into 100 mm culture dishes or i. i ..... II
chambers as required for _-r.... assays.

Construction of vectors containing ephrin-A1 (EFN-A1)
and EphA2 and transient transfection of NSCLC cells
The gene transfer vector, pcDNA3.2/V5-DEST was used
as an expression vector for the expression of ephrin-A1
TFrI i,. and receptor EphA2, and pcDNA3.2/V5/CAT
was used as a control vector (Invitrogen, Carlsbad, CA)
as reported earlier [24]. For the over expression of cdx-2
gene, pcMV6-XL5 was used as an expression vector for
cdx-2 and control vector in A549 cells (Origene Tech-
nologies, Inc.; Rockville, MD). The cloned vectors were
designated as pcDNA-EFN-A1, pcDNA-EphA2 and
pcMV-cdx2 respectively. The control vectors were desig-
nated as Empty vector or pcMV-control. The NSCLC
cells were transfected with vectors using lipofectamine-
2000 reagent (Invitrogen, Carlsbad, CA). The transfected
cells were used for further experiments.

Transfection of NSCLC cells
The siRNA targeting the receptor EphA2 and cdx-2 were
designed using Oligoperfect design (Invitrogen, Carlsbad,
CA). A549 cells were plated into 6-well plates or 35 mm
plates as required for the experiments. The 11 were
:,!!, .._-:: to adhere for 24 hours. The transfection of siRNA
was performed using lipofectamine-2000 (Invitrogen)
according to the manufacturer's recommendation. The
concentration of siRNA used was 1OOnM. After 4 hours of
transfection, the culture medium with serum was added.
The assays were carried out 48 hours post-transfection as
reported earlier [25].

Total RNA isolation and quantitative real time PCR
analysis
Total RNA from cultured NSCLC cells was isolated and
diluted with RNase-free water to 100 ng/mL; then, 10 pl of
each sample were reverse transcribed into complementary
DNA (cDNA) as reported earlier [22]. In brief, after the re-
verse transcription reaction, 80 pl of RNase free water were


Page 2 of 13






Sukka-Ganesh et al BMC Cancer 2012, 12:309
http://www.biomedcentral.com/1471-2407/12/309


added to each sample. Ten microliters of diluted cDNA
product were mixed with 25 pl of SYBR Green :::.- i:1
Taq ,.i; :., 0.5 Vl of internal reference dye, and 2.0 Vl
of specific ,.1;,:,,1... 1. .1. primers to a total volume of
50 ul for quantification of the real time polymerase chain
reaction (PCR) (Table 1). The 1 .... :' .)... of real-time
PCR was performed by using the SYBR Green method on
the Applied Biosystems 7500 Real Time PCR System with
the f.11,. *.It,-*- profile: 1 cycle at 94C for 2 minutes; 40
cycles at 94C for 15 seconds, at 60C for 1 minute, and at
72C for 1 minute for the elongation step. The real-time
PCR products were ..i:_1 n. .1 by electrophoresis on 2%
agarose gels. Data analysis was carried out by using the ABI
sequence-detection software using relative ... r' ii
The threshold cycle (Ct), which was defined as the cycle at
which PCR :'r.t. :,.... reaches a significant value was
expressed as the mean value. The relative expression of
messenger RNA (mRNA) was calculated by using the ACt
method (where ACt was the value obtained by subtracting
the Ct value of the housekeeping gene P3-actin mRNA from
the Ct value of the target mRNA). The amount of the target
relative to P3-actin mRNA was expressed as 2 (A

Western blot analysis
NSCLC cells were cultured in 60 mm size cell culture
dishes (Fisher Scientific, Pittsburgh, VA) to confluence
and the 1:. were lysed in lysis buffer with the method
reported earlier [26]. Protein was estimated by BCA
method (PIERCE, Rockford, IL) and equal amount of
protein (20 pg/lane) were loaded. Proteins in the sample
were separated in denaturing sodium dodecyl sulphate
._':.4 polyacrylamide gels ,'....- :,.-",. and transferred
electrophoretically onto polyvinylidene .i.1 ....... in mem-
brane l .......,.. Millipore, Bedford, MA). The blots
were blocked with 5% Blotting Grade Blocker Non-fat
Dry milk (Bio-Rad, Hercules, CA) for 1 hr on shaker at
room temperature, and were overnight incubated at 4C
with respective -..ii..i., rabbit EphA2 antibody,
rabbit cdx-2 antibody (Cell signaling, Beverly, CA) and
rabbit claudin-2 antibody (Invitrogen, Grand Island,
NY), at 1:1000 dilutions. After .:.. they were
incubated with the secondary antibody (horseradish
peroxidase-conjugated goat anti-rabbit IgG Ab) at a
dilution of 1:1000 for 1 hr. Finally respective proteins
were detected by enhanced chemiluminescence (ECL,
Amersham Pharmacia Biotech). The Molecular mass


(kDa) of the proteins was determined using the pre-
stained protein marker !.., i' ..i


NSCLC cell proliferation
NSCLC cell proliferation was assessed by using an assay
based on cleavage of the tetrazolium salt WST-1 to
formazan by cellular mitochondrial dehydrogenases
(Roche, Indianapolis, IN) as reported earlier [22]. With
this assay, an increase in the number of viable cells
results in an increase in the overall activity of the mito-
chondrial dehydrogenases in the sample. The augmenta-
tion in enzyme activity leads to an increase in the
formazan dye formed. The formazan dye formed was
t.. ,,ti.. by using a plate reader at 450 nm. A549 cells
were plated in 96-well microplate at a density of 0.5 X
105 cells per well. The cells were transfected with
pcDNA-FF P. I. pcDNA-EphA2, siRNA for EphA2 or
with scrambled siRNA (sc-siRNA), cdx-2-siRNA by
using lipofectamine-2000 reagent, and a few wells were
left untreated. The negative controls received serum-free
media, and some of the wells were activated with recom-
binant ephrin-A1. Cells were allowed to incubate for 48
hours. Then, the WST-1 reagent was applied for 4 hours
to measure cell proliferation. The cell proliferation was
assessed in triplicate. The data are presented as a per-
centage of negative control proliferation with P values
<0.05 were considered i,..-


Immunofluorescence microscopy
Claudin-2 expression in NSCLC cells was analyzed
by using confocal laser-scanning microscopy (Zeiss LSM
510, Axiovert 100 M; Zeiss, Thornwood, NY), as
reported previously [22]. In brief, the cells were cultured
to confluence on gelatinized glass cover slips and fixed
in 5% paraformaldehyde (with 50 mM phosphate b,.. m. ii
in 50% Tris wash buffer (TWB). The glass cover 1.^
were rinsed 3 times and permeabilized with 1.2% Triton
X-100 for 5 minutes, rinsed 3 times, incubated with 1%
bovine serum albumin (BSA) in 100% TWB for 1 hour,
then stained for the expression claudin-2 using primary
antibody rabbit anti-claudin-2 at 1:150 .hi,.t..... and
secondary antibody goat anti-rabbit ,,... ,,..,'l:
G conjugated with fluorescein isothiocyanate (FITC)
(Zymed Laboratories, San Francisco, CA). 4, 6-diamino-
2- i.. .. 1..1. (DAPI) was used as a nuclear stain.


Table 1 Primers Used in Quantitative Reverse Transcriptase-Polymerase Chain Reaction analysis
Gene Name Forward Primer (5'-3') Reverse Primer (5'-3')
Claudin-2 GACCCCTAAGGCTGAGGAAC AGAAGAGGAGGCCCAAGGAAG
Cdx-2 GCCAGGTCCTCTGAGAAGTG CCTCTGAGAGCCAGGTCTGT


GACAAGGACGUGAGCAUGUACCCUA
AAACGGCTACCACATCCAAG


UAGGGUACAUGCUCACGUCCUUGUC
TAACGAGGATCCATTGGAGG


Page 3 of 13


Cdx-2-siRNA
18srRNA






Sukka-Ganesh et al BMC Cancer 2012, 12:309
http://www.biomedcentral.com/1471-2407/12/309


NSCLC tumor growth in matrigel
A 48-well culture plate was coated with 200 pl of matrigel
per well and then 1i,:.....1 to polymerize for about 1-2
hours at 37C. NSCLC cells at a density of ~1 x 103 cells
per well were plated in 0.3 ml of 2% FBS containing RPMI-
1640 as reported earlier [24]. The cells were activated with
ephrin-A1 or transfected with plasmid pcDNA-EphA2 or
pcDNA-EFNA1 or siRNA for EphA2 or cdx-2 or empty
vector by using lipofectamine-2000 and few wells were left
untreated as controls, media were changed every three
days. The number of colonies formed was recorded after
7 days of incubation. 4-6 randomly chosen fields (x10)
from the sample were photographed.


Statistical analysis
The Sigma Stat 3.5 statistical software program was used
to calculate statistical ,L_,.r. i... Kruskal-Wallis One
Way Analysis of Variance (ANOVA) was used to com-
pare the experimental '',... from the control groups.
The post hoc test Holm-Sidak method was applied for
pairwise comparisons. The differences at p < 0.05 were
considered statistically ,


Results
NSCLC cells express receptor EphA2 and Caludin-2
F C. i:. i,. NSCLC cells (A549, H2126, H838, H522, and
H23) expressed receptor EphA2, and claudin-2 and the
expression of ephrinAl was variable (Figure 1A). Receptor
EphA2 was over expressed in all the five NSCLC cell lines
tested. However highest expression of claudin-2 was
noticed in A549, H838 and H23 cell lines when compared
to H2126 and H522 cell lines. Whereas, the expression of
ephrin-Al was ,.. -.1.1 1 A549, H2126 and H838 cells
showed decreased expression of ephrin-Al when compared
to H522 and H23 (Figure 1A). In addition NSCLC cells
were transiently transfected with vector containing ephrin-
Al construct (pcDNA-EFNAl) or empty vector and the ex-
pression of receptor EphA2 was determined in all NSCLC
cell lines selected. Ephrin-Al activation down regulated the
expression of EphA2 when compared to empty vector
transfected NSCLC cells (Figure 1B). In ,.I.: .(.. A549 cells
were also activated with recombinant ephrin-Al for varying
time (5, 10, 30, 60 and 120 minutes) and the activation/
phosphorylation of receptor EphA2 was evaluated. Ephrin-
Al activation induced phosphorylation of receptor EphA2
up to 60 minutes in A549 cells. However, at 120 minutes
the phosphorylation was down regulated. The total receptor
expression was comparatively decreased when compared to
control at 120 minutes F; .... 1IC). The EphA2 signaling
pathway activation was also determined by. 1.' :.!!-.- Erkl/
Erk2 activation in NSCLC. EphrinAl activation inhibited
the phosphorylation of Erkl/Erk2 MAPK in NSCLC when
compared to control cells (Figure 1C).


Ephrin-A1 down regulated claudin-2 expression in NSCLC
cells
Ephrin-A1 activation of receptor EphA2 down regulated
the expression of claudin-2 in NSCLC cells. To identify
whether decrease in claudin-2 expression is directly due
to decrease in EphA2 receptor expression, A549 cells
were transfected with pcDNA-EFNA1 or empty vector
or left untransfected. In comparison to empty vector the
transient transfection of A549 cells with pcDNA-EFNA1
resulted in significantly decreased claudin-2 expression
(Figure 2A). This suggested that activation of receptor
EphA2 with the ligand ephrin-A1 induced rapid reduc-
tion of claudin-2 expression that plays a major role in
maintaining cellular integrity. In addition the expression
of claudin-2 and receptor EphA2 was also evaluated by
Western blot analysis. The decreased expression of re-
ceptor EphA2 further confirmed that treatment of A549
cell with ephrin-A1 down regulates the expression of re-
ceptor EphA2 and claudin-2 (Figure 2C, -2D). These
data suggests that ephrin-A1 treatment inhibits the ex-
pression of oncogenic protein EphA2 and claudin-2 in
NSCLC cells.
In order to determine if over expression of the receptor
EphA2 in A549 cells promotes claudin-2 expression, A549
cells were transiently transfected with i" ,F-' -f and
the expression of claudin-2 was evaluated. A significant in-
crease in the expression of claudin-2 was noted when com-
pared to empty vector transfected cells (Figure 2B and C).
To investigate whether this increase in claudin-2 expression
was directly due to the increases in EphA2 receptor expres-
sion, NSCLC cells were transfected with EphA2-siRNA. In
A549 ..- II. silencing the EphA2 receptor with siRNA sig-
nificantly reduced the claudin-2 expression when compared
to sc-siRNA transfected cells (Figure 2B and C). These
results suggest that increased EphA2 expression modulated
claudin-2 expression, which may play an important role in
tumor .*. '., in NSCLC.

Claudin-2 expression decreased in Ephrin-A1 treated
A549 cells
In order to evaluate the cellular 1- i.n, .... of caludin-2,
and morphological changes in activated cells, A549 cells
were activated with ephrin-Al and analyzed by immuno-
fluorescence microscopy. Fluorescence immuno-staining
analysis revealed that A549 cells showed punctuated
expression of claudin-2 whereas, ephrin-Al activation
decreased claudin-2 expression T, ... 2E). In cells
transfected with pcDNA-EFNA1 a marked decrease in
claudin-2 expression was noticed. In :..i ...i .. ephrin-Al
activated cells showed distorted cytoskeleton, and rounded
morphology. However, in cells transfected with pcDNA-
EphA2 a dense and higher expression of claudin-2 was
noticed when compared to control and empty vector
transfected cells. These data i that over expression


Page 4 of 13







Sukka-Ganesh et al. BMC Cancer 2012, 12:309
http://www.biomedcentral.com/1471-2407/12/309


0)
ci


(D
N
I]


co
Xc
I


(N
"


a_


CO,
N

m Ephrin-A1
EphA2


Claudin-2
3-actin


01F %= EphA2


amo


C 5 10 30 60 120

Ephrin-A1 treatment
(minutes)


p-actin


B
A549 H2126 H838





+ + + -

+ + +


H522


H23

MSl0S. EphA2


3-actin


- + -

- + -


+ pcDNA-EFNAI

- + Empty-vector


Figure 1 NSCLC cells express receptor EphA2, Ephrin-A1 and Caludin-2. Plate A: NSCLC cell lines (A549, H2126,
receptor EphA2, ephrin-Al, and claudin-2. Expression of EphA2, ephrin-Al, and claudin-2 was analyzed by Western bl
blot analysis of EphA2 protein expression the 3-actin was probed to demonstrate equal sample loading. NSCLC cell li


with pcDNA-EFNA1 (pcDNA-EFNAI is
Plate C: A549 cells were activated for a
performed, the 3-actin was probed to


sectorr containing ephrin-Al constru
minutes to 120 minutes with ephri
demonstrate equal sample loading.


of receptor EphA2 promotes the expression of claudin-2
in NSCLC cells. Ephrin-A1 activation or transfection of
cells with plasmid containing the ephrin-A1 construct
inhibits the expression of claudin-2 confirming its anti-
tumor effects on NSCLC cells.

Ephrin-A1 treatment increased cdx-2 expression in NSCLC
cells
Cdx-2 a tumor suppressor gene, found to be tissue specific
in its expression. Ephrin-A1 activation induced more than
five folds increases in cdx-2 mRNA expression in NSCLC
cells (Figure 3A). In addition this expression was also con-
firmed in the cells transfected with plasmid containing
ephrin-A1 construct pcDNA-EFNA1. The transfection with
pcDNA-EFNA1 also showed a significant increase of cdx-2
expression in A549 cells when compared to empty vector
(Figure 3A). Furthermore, the cells were also transfected
with plasmid pcDNA-EphA2 or empty vector and the ex-
pression of cdx-2 was evaluated. A remarkable reduction in
the expression of cdx-2 was noticed in cells transfected with
pcDNA-EphA2. However, knockdown of EphA2 gene with
siRNA-EphA2 significantly upregulated the expression of
cdx-2 in A549 cells when compared to sc-siRNA


H838, H522, H23) express
)t analysis. Plate B: Western
ies were either transfected


ct) or empty vector and receptor EphA2 expression was analyzed.
n-A1. Western blot analysis of phosphorylated EphA2 and Erkl/Erk2 was
Data presented is the representative of three separate experiments.

transfected cells (Figure 3B). These results suggest that un-
regulated/lost expression of cdx-2, a tumor suppressor gene
may result to increased EphA2 expression in A549 cells.
Furthermore cdx-2 expression with activation of ephrin-A1
or transfection with pcDNA-EFNA1 or PcDNA-EphA2 in
A549 cells was also confirmed with Western blot analysis
(Figure 3C). These data suggests that activation of receptor
with ephrin-A1 up regulates the expression of tumor sup-
pressor gene cdx-2. Silencing the expression of EphA2
receptor also increases the expression of cdx-2 which indi-
cates that knockdown of EphA2 either by ephrin-A1 activa-
tion or by silencing interference RNA could be potential in
inhibiting the oncogenic effect of receptor EphA2 and
tumor growth.

Silencing cdx-2 expression blocked ephrin-A1 mediated
inhibition of claudin-2 expression in NSCLC cells
Activation of A549 cells with ephrin-A1 or transfection
with pcDNA-EFNA1 resulted in significant decrease of
claudin-2 expression. In addition over expression of cdx2
by using pcMV-cdx-2, a plasmid with cdx2 construct
resulted in significant decrease of claudin-2 expression
(Figure 4A and B). Moreover, when A549 cells were


Page 5 of 13


P- EphA2


P-Erk /Erk-2


Erk 1/Erk2


__






Sukka-Ganesh et al. BMC Cancer 2012, 12:309
http://www.biomedcentral.com/1471-2407/12/309


< 4-
z
z 2-
E C


s. ^ .02


o


*







-- m m -Claudin-2
13-actin


S


1,


60 I


D
0 ##



0-


iii ii EphA2
S I I -actin

00 ^/C/10
4f 'T


Control EphrinAl pcDNA pcDNA empty
-EphA2 -EFNA1 vector
Figure 2 (See legend on next page.)


Page 6 of 13


4


S2


Merge



Claudin-2


F-actin


DAPI


/'
.,A


w







Sukka-Ganesh et al BMC Cancer 2012, 12:309
http://www.biomedcentral.com/1471-2407/12/309


transfected with cdx-2- siRNA and activated with ephrinAl
the expression of claudin-2 expression was significantly
upregulated (Figure 4A). Furthermore Immunofluorescence
staining for the expression of claudin-2 also confirmed that


silencing cdx-2 gene and activation with ephrin-A1 resulted
in enhanced expression of claudin-2 (Figure 4C). Our
results suggest that EphA2 signaling promoted claudin-2
expression in A549 cells and downregulated the expression


Page 7 of 13


(See figure on previous page.)
Figure 2 Ephrin-A1 activation decreases claudin-2 expression in NSCLC cells. Relative expression of claudin-2 mRNA normalized to
endogenous control. Plate A: Cells were either activated with ephrin-Al or transfected with pcDNA-EFNAI (vector containing Ephrin-A1
construct) or empty vector. Plate B: Cells either silenced with EphA2 siRNA or transfected with pcDNA-EphA2 (pcDNA-EphA2 is vector containing
EphA2 construct) Plate C: Claudin-2 protein expression by Western blot analysis, 3-actin was probed to demonstrate equal sample loading.
Plate D: Western blot analysis of EphA2 protein expression the 3-actin was probed to demonstrate equal sample loading. Data presented was the
mean + SEM of three independent experiments, *p< 0.001 compared to control; #p < 0.001 compared to empty vector; p< 0.001 compared to
sc-siRNA. Plate E: Claudin-2 expression in NSCLC as observed by immunofluorescence analysis. The photomicrographs show immunofluorescence
staining of claudin-2 in NSCLC. Blue colour represents the nuclear stain DAPI (4,6-diamino-2-phenylindole), Red colour represents Rhodamin
phalloidin for F-actin filament stain, and green colour represents Alexa Flour 488 labelled for claudin-2 expression. The data presented is a single
representative of three similar observations Scale Bar-40 pm.


A B o $

8 #

o 6- E -






4C

2-2



2 *
0-0









""a p w Cdx-2

P-actin







Figure 3 Transfection of pcDNA-EFNA1 increased whereas transfection of pcDNA-EphA2 attenuated cdx-2 expression in NSCLC cells.
Plate A: cells were either activated with ephrin-Al or transfected with pcDNA-EFNAI (pcDNA-EFNAI is vector containing ephrin-Al construct).
Cdx-2 mRNA expression was analyzed by quantitative real time PCR. Plate B: Cells either silenced with EphA2 siRNA or transfected with
pcDNA-EphA2 (pcDNA-EphA2 is vector containing EphA2 construct) Plate C: Western blot analysis of claudin-2 protein expression, the 3-actin was
probed to demonstrate equal sample loading. The Western blot represents three similar observations. Data presented is the mean +SEM of three
independent experiments. *p <0.001 compared to control, #p <0.001 compared to Empty vector, p <0.001 compared to sc-siRNA.






Sukka-Ganesh et al. BMC Cancer 2012, 12:309
http://www.biomedcentral.com/1471-2407/12/309


C 6- $

4-
06

< 2-
Zi*I| ^*
E 0 -, ,*


B4
a4-



o
2-
0


N


N x (
(p4 */z


ai.


CD
DAPI


m Claudin-2
-actin

,6 .4 ^ &
^

f Sf y ^ / S1 +
> ^ rf ^ ^ <


F-actin Claudin-2 Merge


Cmmmm control



EphrinAl +









Figure 4 Silencing cdx-2 expression restores Ephrin-A1 mediated inhibition of Claudin-2 expression in NSCLC cells. Plate A: Relative
mRNA expression of claudin-2 normalized to endogenous control. (pcDNA-EFNAI is vector containing ephrin-Al construct). Plate B: Claudin-2
expression was analyzed by Western blot, data represents mean +SEM of three independent experiments. *p <0.001 compared to control,
# p<0.001 compared to Empty vector, $p<0.001 compared to cdx2-siRNA alone. **p<0.001 compared to control. Plate C: Immunofluorescence
analysis of claudin-2 expression in NSCLC. Blue colour represents the nuclear stain DAPI (4, 6-diamino-2-phenylindole), Red colour represents
Rhodamin phalloidin for F-actin filaments, and green colour represents Alexa Flour-488 labelled for claudin-2 expression. The data presented is a
single representative of three similar observations. Scale Bar-40 pm.


of tumor suppressor gene cdx-2. These data also suggests
that ephrin-A1 mediated down regulation of claudin-2 ex-
pression in A549 cells is dependent on cdx-2.

Silencing cdx-2 expression blocked Ephrin-A1 mediated
inhibition of cell proliferation in NSCLC cells
Ephrin-A1 activation and transfection with ephrin-A1 vec-
tor pcDNA-EFNA1 resulted in suppression of prolifera-
tion in A549 cells when compared to control or empty
vector transfected cell (Figure 5A). Silencing of EphA2


receptor by EphA2-siRNA also showed decreased cell pro-
liferation as compared to sc-siRNA or control (Figure 5B).
In addition, the cells were transfected with pcDNA-EphA2
that showed a significant increase in proliferation when
compared to empty vector or control cells. However, when
cells were transfected with cdx2-siRNA and subsequently
activated with ephrin-A1 the proliferation of cells was
restored and showed close to control cell proliferation
rate. Moreover, knockdown of cdx-2 with siRNA and
transient transfection with pcDNA-EFNA1, resulted in


Page 8 of 13







Sukka-Ganesh et al BMC Cancer 2012, 12:309
http://www.biomedcentral.com/1471-2407/12/309


significant increase in cell proliferation compared to
pcDNA-EFNA1 transfected cells (Figure 5A, -5C). The
transfection of cdx-2-siRNA alone showed slight increase
in the proliferation rate but was not significant when com-
pared with control. These results suggest that ephrin-Al
induced increased expression of cdx-2 suppressed prolif-
eration of NSCLC. The transfection of NSCLC with cdx2-
siRNA followed by ephrin-Al activation blunted ephrin-
Al mediated inhibition of A549 cell proliferation.

Ephrin-A1 activation inhibited tumor growth and
silencing cdx-2 expression blunted Ephrin-A1 mediated
suppression of tumor growth in NSCLC cells in vitro
A549 cells were activated with eprhin-Al or transfected
with a plasmid pcDNA-EFNAI, or empty vector, or left


untransfected as control. The transfected or control cells
were plated on 3-D matrigels to determine the tumor
growth in vitro. The tumor growth was studied for
2 weeks. Microscopic examination revealed that A549
cells activated with ephrin-Al and those transfected with
pcDNA-EFNA1 showed suppressed tumor growth in
matrigel as compared to empty vector transfected or
control cells (Figure 6). In contrast NSCLC cells trans-
fected with pcDNA-EphA2 showed aggressive tumor
growth which was significantly larger in size as com-
pared to tumors grown after silencing the EphA2 with
siRNA. In addition, when the A549 cells were trans-
fected with cdx-2 siRNA and subsequently treated with
the ephrin-Al or transfected with pcDNA-EFNA1 we
noticed significantly increased tumor formation as


Page 9 of 13


A B B
E E25

S_ 2

1 1I



T 0





C
(0










E 2- NS $
0.5 #


~N0






S 2 NS


















Figure 5 Ephrin-A1 activation attenuates NSCLC cell proliferation. Proliferation of NSCLC cells as measured by WST-1 assay. Plate A:
Proliferation in cells either activated with ephrin-A1 or transfected with pcDNA-EFNA1 (pcDNA-EFNA1 is vector containing ephrin-A1 construct).
Plate B: Proliferation in cells either silenced with EphA2 siRNA or transfected with pcDNA-EphA2 (pcDNA-EphA2 is vector containing EphA2
construct). Plate C: Proliferation in cdx-2 siRNA transfected cells that were treated with ephrin-AI ligand or pcDNA-EFNAI transfected. Data
presented is the mean+SEM of three independent experiments. *p<0.05 compared to control; $ p<0.05 compared to ephrin-AI or
pcDNA-EFNAI alone, # p< 0.001 compared to empty vector or sc-siRNA+ephrinA1, NS is not ,
qcDNA-ENAI aloe ep <0.001 cmqaredto empty vectoro scsiRNA+eq riAl,NSis nt I






Sukka-Ganesh et al. BMC Cancer 2012, 12:309
http://www.biomedcentral.com/1471-2407/12/309


compared to cells either activated with ephrin-Al alone
and pcDNA-EFNAl transfected cells (Figure 6). Taken
together these results indicate that when A549 cells
transfected with pcDNA-EphA2 to over expressed
receptor EphA2 increased claudin-2 expression was
observed which promoted the A549 cell proliferation.
Activation of NSCLC cells with ephrin-Al leads to
tumor growth inhibition via cdx-2 expression.

Discussion
The major finding of our present study is that receptor
EphA2 is over expressed in NSCLC cell lines which pro-
motes tumor growth. In addition we also found that
EphA2 promotes tight junction protein claudin-2 ex-
pression in A549 cells. However, the expression of
ephrin-Al was found to dysregulated and A549 cells
showed minimal levels. There is accumulating evidence
that activation of receptor EphA2 with its ligand ephrin-
Al attenuates tumorogenic potential of malignant cells
[24,27,28]. The molecular mechanisms responsible for
tumor suppressive effects of ephrin-Al are still elusive.
In the present study, we report that proliferating NSCLC
cells showed enhanced expression of EphA2, and clau-
din-2. The activation of receptor EphA2 with ephrin-Al


Control


EphrinAl


Empty
vector


inhibited the expression of EphA2 and claudin-2. To fur-
ther examine the effect of ephrin-Al on NSCLC we
transfected the cells with vector expressing ephrinAl
construct, pcDNA-EFNAl. We found that forced ex-
pression of ephrin-Al down regulated the receptor
EphA2 and inhibited cell proliferation and tumor growth
in 3D matrigel. In addition the activation of receptor
EphA2 with ephrin-Al induced phosphorylation of
EphA2 and inhibited the downstream singling MAP
kinase pathway Erkl/Erk2. Furthermore, the activation
of EphA2 receptor with ephrinAl induced cdx-2, a
tumor suppressor gene in A549 cells. These data
suggests that ephrin-Al activation/transfection could
effectively bind and activate endogenous EphA2 in
NSCLC and led to internalization and degradation of
EphA2. In order to understand if receptor EphA2 signal-
ing modulates TJ protein claudin-2 we transfected the
A549 cells with EphA2 expressing vector, pcDNA-
EphA2. The expression of claudin-2 was higher in A549
cells transfected with pcDNA-EphA2 as compared to
empty vector transfected cells or control cells. In
addition, over expression of receptor EphA2 significantly
enhanced tumor growth. Whereas silencing the expres-
sion of receptor EphA2 by siRNA, decreased the


pcDNA-EFNA1 pcDNA-EphA2


P. "


Sc-siRNA siRNA -EphA2


siRNA-cdx-2 siRNA-cdx-2
+EphrinA1 +empty vector
-1111111111= 0


siRNA-cdx-2
+pcDNAEFNA1


pcMV-cdx-2 pcMV-control







Figure 6 Ephrin-A1 ligand activation decreases tumor growth in NSCLC. Equal number o
treatments as described and after 7 days of culture tumor growth was recorded by a SPOT dic
data presented are a single representative of three similar but independent experiments. ,


A549 cells was seeded in matrigels after various
ital camera attached to Nikon microscope. The
.1 I uM.


Page 10 of 13






Sukka-Ganesh et al. BMC Cancer 2012, 12:309
http://www.biomedcentral.com/1471-2407/12/309


expression of claudin-2 and interestingly a significant
up-regulation of cdx-2 was noticed in NSCLC cells as
compared to sc-siRNA transfected A549 cells. However,
i.,. 1 ;.!.. cdx-2 gene with siRNA and subsequent activa-
tion with ephrin-A1 or transfection with pcDNA-EFNA1
failed to inhibit tumor growth in A549 cells. Collectively
these data suggests that an ephrin-A1 mediated
anti-oncongenic effect is due to downregulation of
EphA2, claudin-2 expression and induction of cdx-2
gene in NSCLC.
EphA2 is an oncoprotein which promotes cell survival,
abnormal cell growth and invasion in a number of
malignancies, including NSCLC [18,20,21,29]. In malig-
nant cells such as A549, due to dysregulated cell division
and abnormal growth the cell-cell contacts are loose
which hinders the interaction between neighboring
cells. The loss of contact among the adjacent cells
results in accumulation of high levels of intracellular
EphA2 and claudin-2 an integral component of tight
junction. Tight junctions are the apical cell-cell adhe-
sions that .. L,: 1. t I=,I, permeability and are
critical for cell polarity. Alteration in tight junction
protein claudin-2, can cause the defects in normal regu-
lation of growth factor receptor activation due to a dif-
ferential I- 1 i-. .,i ... of the receptor and their respective
ligands, which can be observed with respect to receptor
EphA2 and its ligand Ephrin-Al [30]. In this study, we
attempted to understand the underlying mechanisms by
which EphA2 over expression leads to enhanced or ir-
,.1 claudin-2 expression via cdx-2 modulation and
promote tumor growth in NSCLC cells. Several ..i. ..
reported that receptor EphA2 is over expressed in a
number of malignancies [19,20,30]. Previously we have
reported that EphA2 is over expressed in ... .1. ...
mesothelioma cells (MMC) and posttranslational silen-
cing of EphA2 significantly suppresses the proliferation
and haptotactic migration of MMC [22,24]. In addition,
EphA2 receptor activation in MMC by its 1. .-*.i ephrin-
Al inhibited the RAS MAP kinase signaling pathways
[23,24]. Our study in A549 cells revealed that receptor
EphA2 signaling up regulates the TJ protein claudin-2.
In turn, the over expression of claudin-2 along with
EphA2 promotes A549 cell I. '..1i .... and tumor
growth. It was reported that EGF .... -h induced
claudin-2 expression which promoted colonization of
mammary tumor cells [31]. The up regulated levels of
claudin-2 caused leaky cellular barriers in MDCK1 cells
[32]. The junctional claudin-2 forms the selective cation
channels that are sufficient to transform the functional
(,i," junction into a 1. .1 one [33]. The leaky
barriers may contribute to increase uptake of nutrients
and growth factor which promote exaggerated tumor
colonization. In the present study we noted exaggerated
tumor colonies formation when EphA2 was over


expressed in A549 cells. It is plausible that over expres-
sion of receptor EphA2 promotes claudin-2 which in
turn enhances tumor colonization of A549 cells.
We demonstrate that activation of receptor EphA2
with ephrin-Al induced cdx-2 expression and inhibited
tumor formation. The over expression of cdx-2 by vector
pcMV-cdx-2 resulted in downregulation of claudin-2
and attenuation of cell proliferation and tumor growth
on matrigels. In addition silencing cdx-2 expression
using siRNA and activation with eprhin-Al resulted in
up regulation of claudin-2 in A549 cells. Cdx-2, a tumor
suppressor gene is homeobox transcriptional factor that
is known to control apical-basolateral polarity in mouse
enterocytes and human colonic 1:.1 cells [34].
Cdx-2 regulates epithelial cell polarity and morphogen-
esis through control of apical protein transport. At the
transcriptional level, transcriptional factors such as
cdx-2 can bind to the promoter regions of various clau-
din genes and affect their expression [1,10]. In ..1iii..i...
certain characteristics of claudin-2 and cdx-2 show simi-
larity that both are critical for epithelial cell polarity
[1,34]. Increased cdx-2 expression was used as a marker
for progression in gastric carcinogenesis [35], while
some of the gastric cancers studies showed aberrant ex-
pression of cdx-2 in intestinal metaplasia which is a sub-
set of gastric adenocarcinoma [36]. The down-regulation
of cdx-2 mechanism was related to the induction of
ulcer-associated cell I...:-. (UACL) [37]. In addition
loss of cdx-2 immunoreactivity was implicated as diag-
nostic feature in poorly .h1 .. n, .i, colorectal adeno-
carcinoma [38]. Whereas, the reduced expression of
cdx-1 and cdx-2 genes were associated with the develop-
ment of enterocolitis in intestinal mucosa [39]. Further-
more, activation of Ras oncogene was associated with
down i -.i,' i..:: of the cdx-2 in colon cancer cells [40].
All these studies confirm that expression of cdx-2 gene
though disease .. :-,. and tissue :.* ,. the expres-
sion of cdx2 was directly associated with tumor growth.
The plausible mechanisms for the reduced cdx-2 expres-
sion in carcinogenesis, could be that homeodomain pro-
teins signifies roles in 1i... .,_ the cells to ." :C..1
,, Yi, ....../pe during organogenesis in early stages of
development. However, a reduction of cdx-2 gene ex-
pression in the late stages such as in invasive tumors
may be iit. ',:i. i to over expression oncogenic proteins
which may lead to deviate from normal epithelial pheno-
type to the neoplastic phenotype [15].
It has been shown that, caudal-related homeobox gene
cdx-2 is positively involved in the regulation of the
human claudin-2 promoter activity [17]. The EphA2 sig-
1 ,i,:,,. caused reduced expression of transcription factor
cdx-2 that hinder its binding to claudin promoter and
thus cause irregular expression of claudin-2 which is
reported to be increased in NSCLC cells in the present


Page 11 of 13







Sukka-Ganesh et a. BMC Cancer 2012, 12:309
http://www.biomedcentral.com/1471-2407/12/309


study. It is conceivable that due to the disrupted TJ or
claudin-2 there is a disruption in epithelial cell polarity
leading to leakage of large solutes passing across epithe-
lial barriers to the other cells. Thus, the TJ disruption in
premalignant neoplastic tissue can increase the proba-
bility that it will develop into a complete carcinoma be-
cause of the continuous stimulation of cell division fol-
lowed by disrupted natural barriers between growth
factors and their receptors. The novel finding of our
present study is that receptor EphA2 mediated the
enhanced induction of functionally altered claudin-2 via
down-regulation of tumor suppressor gene expression
cdx-2 in NSCLC cells. It is possible that activation of
receptor EphA2 with ephrin-A1 downregulated claudin-
2 and induced the expression of cdx-2 suggesting
oncogenic protein EphA2 play a major role in I,_ -..1 :-.!.'
cdx-2 expression in NSCLC. Whereas, the forced ex-
pression of ephrin-A1 induced tumor suppressive signals
via downregulation and degradation EphA2 and inhib-
ited the oncogenic singling pathway in NSCLC. How-
ever, this needs to be further investigated.


Conclusions
In conclusion, we present the first evidence that EphA2
signaling promotes the expression of claudin-2 in NSCLC
cells. Activation of NSCLC with ligand ephrin-A1 sup-
pressed the caludin-2 expression via the induction of tran-
scriptional factor cdx-2. These studies suggest that
targeting EphA2 by using ephrin-A1 may be a promising
approach for the therapeutic inventions against NSCLC.

Competing interests
[he authors have no competing interests

Authors' contributions
BSG, carried cut ihe experiments NN and BSG dlrated the manuscript NN
and KAM critically analyzed, edited, reviewed and finalized the data FK, for
providing cei lines and editoria review, EPG provided the varuaole
comments and editorial review of the manuscript All authcts' read and
approved the final manuscript

Acknowledgements
This work was supported by NIR grant # 09KN-09; RC1 (#09KW-08) from
James & Esther King, Florida Department of I ealtn (Nasreen, N); VA Merit
Review (Mohammed, KA)

Author details
Division of Pulmonary & Critical Care Medicine, Department of Medicine,
University of Florida, Gainesville, FL, USA 2NF/SG Veterans Health System,
Malcom Randall Veterans Affairs Medical Center, University of Florida,
Gainesville, FL, USA Biomaterial Science and Engineering, University of
Florida, Gainesville, FL, USA 4Division of Hematology/Oncology, University of
Florida, Gainesville, FL, USA

Received: 28 December 2011 Accepted: 28 June 2012
Published: 23 July 2012

References
1 Singh AB, Sharma A, Dhawan P Claudin family of proteins and cancer: an
overview. j Oncol 2010. 2010:541957


2 Tan C, Cruet-Hennequart S, Troussard A, Fazli L, Costello P, Sutton K,
Wheeler J, Gleave M, Sanghera J, Dedhar S Regulation of tumor
angiogenesis by integrin-linked kinase (ILK). Conce Cfl 2004, 5(1)79-90
3 Kominsky SL, Argani P, Korz D, Evron E, Raman V, Garrett E, Rein A, Sauter G,
Kallioniemi OP, Sukumar S Loss of the tight junction protein claudin-7
correlates with histological grade in both ductal carcinoma in situ and
invasive ductal carcinoma of the breast. Oncogene 2003,
22(13)'2021-2033
4 Usami Y, Chiba H, Nakayama F, Ueda J, Matsuda Y, Sawada N, Komori 1, Ito
A, Yokozaki I' Reduced expression of claudin-7 correlates with invasion
and metastasis in squamous cell carcinoma of the esophagus.
Hum Pothoa 2006, 37(5)569-577
5 Sauer T, Pedersen MK, Ebeltoft K, Naess 0 Reduced expression of
Claudin-7 in fine needle aspirates from breast carcinomas correlate with
grading and metastatic disease. Cytopoihouogy 2005, 16(4) 193-198
6 Michl P, Barth C, Buchholz M, Lerch MM, Rolke M, lolzmann KI Menke A,
Fensterer H, Glehl K, Lohr M, et o' Claudin-4 expression decreases
invasiveness and metastatic potential of pancreatic cancer. Concern Res
2003, 63(1 9)'6265-6271
7 Rangel LB, Agaral R, D'Souza 1, Pizer ES, Alo PL, Lancaster WD, Gregoire L,
Schwartz DR, Cho KR, Morin PJ Tight junction proteins claudin-3 and
claudin-4 are frequently overexpressed in ovarian cancer but not in
ovarian cystadenomas. Clin Cancer Res 2003, 9(7) 2567-2575
8 Soini Y Expression of claudins 1, 2, 3, 4, 5 and 7 in various types of
tumours. Histopathology 2005, 46(5)551 -560
9 Lee JW, Lee SJ, Seo J, Song SY, Ahn G, Park CS, Lee JH, Kim BG, Bae DS
Increased expressions of claudin-1 and claudin-7 during the progression
of cervical neoplasia. Gyneco Oncol 2005, 97(1)53-59
10 Agarwal R, D Sou7a 1 Morin PJ Claudin-3 and claudin-4 expression in
ovarian epithelial cells enhances invasion and is associated with
increased matrix metalloproteinase-2 activity. Cancer Res 2005,
65( 16)7378-7385
11 Chao YC, Pan S Yang SC, Yu SL, Che TF, Lin CW, Tsai MS, Chang GC, Wu
CH, Wu y, e! al Claudin-1 is a metastasis suppressor and correlates with
clinical outcome in lung adenocarcinoma. Arn J Respir a rit Care Med 2009,
179(2) 123-133
12 Itoh M, Furuse M, Morita K, Kubota K, Saitou M, Tsukita S Direct binding of
three tight junction-associated MAGUKs, ZO-1, ZO-2, and ZO-3, with the
COOH termini of claudins. J Ce!l Biol 1999, 147(6) 1351 -1363
13 Duluc I, Lorentz 0, Fritsch C, Ieberquier C, Kedinger M, Freund iN
Changing intestinal connective tissue interactions alters homeobox gene
expression in epithelial cells. J Ceil Sd 1997, 110(Pt 11 )1317-1324
14 Mallo GV, Soubeyran P, Lssitzky JC, Andre F, Faraner C, Marvaldi J, Dagon
JC, lovanna JL Expression of the Cdxl and Cdx2 homeotic genes leads
to reduced malignancy in colon cancer-derived cells. J Biol Chem 1998,
273(22) 14030- 4036
15 Ee HC, Erler T, Bhathal PS, Young GP, James RJ Cdx-2 homeodomain
protein expression in human and rat colorectal adenoma and
carcinoma. Am Por ol 1995, 147(3)'586-592
16 Mallo GV, Rechreche Ii, Frigerio JM, Rocha D, Zweibaum A, Lacasa M,
Jordan BP, Dusetti NJ, Dagorn JC, lovanna IJ Molecular cloning,
sequencing and expression of the mRNA encoding human Cdx1 and
Cdx2 homeobox. Down-regulation of Cdx1 and Cdx2 mRNA expression
during colorectal carcinogenesis. !nt J 'once! 1997, 74(1)35-44
17 Sakaguchi T, Gu X, Golden I M, Suh E, Rhoads DB, Reinecker I C' Cloning of
the human claudin-2 5'-flanking region revealed a TATA-less promoter
with conserved binding sites in mouse and human for caudal-related
homeodomain proteins and hepatocyte nuclear factor-l alpha. Biol
Chrem 2002, 277(24)'21361-21370
18 Kinch MS, Moore MB, Harpcle DH Jr Predictive value of the EphA2
receptor tyrosine kinase in lung cancer recurrence and survival. Clin
Cancer Res 2003, 9(2)61 3-618
19 Sulman EP, Tang XX, Allen C, Biegel JA, Pleasure DE, Brodeur GM, Ikegaki N
ECK, a human EPH-related gene, maps to lp36.1, a common region of
alteration in human cancers. Genomics 1997, 40(2)'371-374
20 Walker Daniels 1, Coffmran K, Azimi M, Phirn mS, Bosrwick DG, Snyder P, Kerns
BJ, Waters DJ, Kinch MS' Overexpression of the EphA2 tyrosine kinase in
prostate cancer. Prostate 1999, 41 (4) 275-280
21 Nakamura R, Kataoka H, Sato N, Kanaror M, Ihara M, Igarashi H, Ravshanov
S, Wang 'Y, Li ZY, Shimarnura T, et a' EPHA2/EFNA1 expression in human
gastric cancer. Cancer Sc 2005, 96(1) 42-47


Page 12 of 13








Sukka-Ganesh et aL BMC Cancer 2012, 12:309 Page 13 of 13
http://www.biomedcentral.com/1471-2407/12/309





22 Nasreen N, Mohammed KA, Antony VB Silencing the receptor EphA2
suppresses the growth and haptotaxis of malignant mesothelioma cells.
Cancer 2006, 107(10)'2425-2435
23 Khodayari N, Mohammed KA, Goldberg EP, Nasreen N EphrinAl inhibits
malignant mesothelioma tumor growth via let-7 microRNA-mediated
repression of the RAS oncogene. Cancer Gene Ther 2011, 18(11)'806-816
24 Nasreen N, Mohammed KA, Lai Y, Antony VB Receptor EphA2 activation
with ephrinAl suppresses growth of malignant mesothelioma (MM).
Cancer Lett 2007, 258(2)'215-222
25 Mohammed KA, Wang X, Goldberg EP, Antony VB, Nasreen N Silencing
receptor EphA2 induces apoptosis and attenuates tumor growth in
malignant mesothelioma. American journal of cancer research 2011, 1(3)419-431
26 Nasreen N, Mohammed KA, Sanders K, Hardwick J, Van Horn RD, Sriram PS,
Ramirez- caza C, Hage C, Antony VB Pleural mesothelial cell (PMC)
defense mechanisms against malignancy. OncolRes 2003, 14(3)'155-161
27 Duxbury MS, Ito H, Zinner MJ, Ashley SW, Whang EE Ligation of EphA2 by
Ephrin Al-Fc inhibits pancreatic adenocarcinoma cellular invasiveness.
Biochem Biophys Res Commun 2004, 320(4)'1096-1102
28 Brantley DM, Cheng N, Thompson EJ, Lin Q, Brekken RA, Thorpe PE, Muraoka RS,
Cerretti DP, Pozzi A, Jackson D, et al Soluble Eph A receptors inhibit tumor
angiogenesis and progression in vivo. Oncogene 2002, 21(46)'7011-7026
29 Versnel MA, Claesson-Welsh L, Hammacher A, Bouts MJ, van der Kwast TH,
Eriksson A, Willemsen R, Weima SM, Hoogsteden HC, Hagemeijer A, et al
Human malignant mesothelioma cell lines express PDGF beta-receptors
whereas cultured normal mesothelial cells express predominantly PDGF
alpha-receptors. Oncogene 1991, 6(11)2005-2011
30 Kinch MS, Carles-Kinch K Overexpression and functional alterations of the
EphA2 tyrosine kinase in cancer. Clin Exp Metostosis 2003, 20(1)'59-68
31 Morin PJ Claudin proteins in human cancer: promising new targets for
diagnosis and therapy. Cancer Res 2005, 65(21)'9603-9606
32 Furuse M, Furuse K, Sasaki H, Tsukita S Conversion of zonulae occludentes
from tight to leaky strand type by introducing claudin-2 into Madin-
Darby canine kidney I cells. J Cel Bioe 2001, 153(2) 263-272
33 Amasheh S, Meiri N, Gitter AH, Schoneberg T, Mankertz J, Schulzke JD,
Fromm M Claudin-2 expression induces cation-selective channels in
tight junctions of epithelial cells. J Cell Sc 2002, 115(Pt 24)4969-4976
34 Gao N, Kaestner KH Cdx2 regulates endo-lysosomal function and
epithelial cell polarity. Genes Dev 2010, 24(12)'1295-1305
35 Kim HS, Lee JS, Freund JN, Min KW, Kim W, Juhng SW, Park CS CDX-2
homeobox gene expression in human gastric carcinoma and precursor
lesions. J Gastroenterol Hepotol 2006, 21(2) 438-442
36 Paik CH, Han DS, Lee SH, Chung YW, Kim JP, Sohn JH, Hahm JS, Oh YH, Park
YU Expression of Cdx-2 homeobox gene in intestinal metaplasia and
gastric adenocarcinoma. Korean J Goastroentero 2004, 44(4) 186-192
37 Kaneko Y, Nakamura T, Hayama M, Hosaka N, Akamatsu T, Ota H Altered
expression of CDX-2, PDX-1 and mucin core proteins in "Ulcer-associated
cell lineage (UACL)" in Crohn's disease. J MolHistol 2008, 39(2)'161-168
38 Levine PH, Joutovsky A, Cangiarella J, Yee H, Simsir A CDX-2 expression in
pulmonary fine-needle aspiration specimens: a useful adjunct for the
diagnosis of metastatic colorectal adenocarcinoma. Diogn Cytopotho/
2006, 34(3)'191-195
39 Lui VC, Li L, Sham MH, Tam PK CDX-1 and CDX-2 are expressed in human
colonic mucosa and are down-regulated in patients with Hirschsprung's
disease associated enterocolitis. Biochim Biophys Act 2001, 1537(2)89-100
40 Lorentz 0, Cadoret A, Duluc I, Capeau J, Gespach C, Cherqui G, Freund IJN
Downregulation of the colon tumour-suppressor homeobox gene Cdx-2
by oncogenic ras. Oncogene 1999, 18(1)87-92

doi:10.1~186!1471-240712309 Submit your next manuscript to BioMed Central
doi:10.1186/1471-2407-12-309
Cite this article as: Sukka-Ganesh et al Ephrin-A1 inhibits NSCLC tumor and take full advantage of:
growth via induction of Cdx-2 a tumor suppressor gene. BMC Cancer
2012 12309 Convenient online submission


* Thorough peer review
* No space constraints or color figure charges
* Immediate publication on acceptance
* Inclusion in PubMed, CAS, Scopus and Google Scholar
* Research which is freely available for redistribution

Submit your manuscript at e ntral
www.biomedcentral.com/submit IVlliad Central


J




Full Text

PAGE 1

RESEARCHARTICLEOpenAccessEphrin-A1inhibitsNSCLCtumorgrowthvia inductionof Cdx-2 atumorsuppressorgeneBhagyalaxmiSukka-Ganesh1,KamalAMohammed1,2,FredericKaye4,EugenePGoldberg3andNajmunnisaNasreen2*AbstractBackground: Tumorformationisacomplexprocesswhichinvolvesconstitutiveactivationofoncogenesand suppressionoftumorsuppressorgenes.ReceptorEphA2anditsligandephrin-A1formanimportantcell communicationsystemwithitsfunctionalroleincell-cellinteractionandtumorgrowth.Lossofcell-celladhesionis centraltothecellulartransformationandacquisitionofmetastaticpotential.Claudins,theintegratedtightjunction (TJ)cell-celladhesionproteinslocatedontheapico-lateralportionofepithelialcells,functionsinmaintainingcell polarity.ThereisextensiveevidenceimplicatingEphreceptorsandephrinsinmalignancy,butthemechanisms howthesemolecularplayersaffectTJproteinsandregulatetumorgrowtharenotclear.Inthepresentstudywe hypothesizedthatEphA2signalingmodulatesclaudin-2geneexpressionviainductionof cdx-2 ,atumorsuppressor geneinNSCLCcells. Methods: TheexpressionofEphA2,claudin-2wasdeterminedinvariousNSCLCcelllinesbyusingreal-time quantitativepolymerasechainreactionandWesternblotanalysis.Theclaudin-2expressionwasalsoanalyzedby immunofluorescenceanalysis.EphA2and erk1/erk2 phosphorylationinephrin-A1activatedcellswasevaluatedby Westernblotanalysis.ThecellproliferationandtumorcolonyformationweredeterminedbyWST-1and3-D matrigelassaysrespectively. Results: NSCLCcellsoverexpressedreceptorEphA2andclaudin-2.Ephrin-A1treatmentsignificantlydown regulatedtheclaudin-2andEphA2expressioninNSCLCcells.Thetransienttransfectionofcellswithvector containingephrin-A1construct(pcDNA-EFNA1)decreasedtheexpressionofclaudin-2,EphA2whencomparedto emptyvector.Inadditionephrin-A1activationincreasedc dx-2 expressioninA549cells.Incontrastover-expression ofEphA2withplasmidpcDNA-EphA2upregulatedclaudin-2mRNAexpressionanddecreased cdx-2 expression. Thetransienttransfectionofcellswithvectorcontaining cdx-2 construct(pcMVcdx-2 )decreasedtheexpressionof claudin-2inA549cells.Moreover,silencingtheexpressionofreceptorEphA2bysiRNAsignificantlyreduced claudin-2expressionanddecreasedcellproliferationandtumorformation.Furthermore,silencing cdx-2 gene expressionbeforeephrin-A1treatmentincreasedclaudin-2expressionalongwithincreasedcellproliferationand tumorgrowthinA549cells. Conclusions: OurstudysuggeststhatEphA2signalingup-regulatestheexpressionoftheTJ-proteinclaudin-2that playsanimportantroleinpromotingcellproliferationandtumorgrowthinNSCLCcells.Weconcludethatreceptor EphA2activationbyephrin-A1inducestumorsuppressorgene cdx-2 expressionwhichattenuatescellproliferation, tumorgrowthandthusmaybeapromisingtherapeutictargetagainstNSCLC. Keywords: ReceptorEphA2,Ephrin-A1,Claudin-2, cdx-2 ,NSCLC *Correspondence: nnasreen@medicine.ufl.edu2NF/SGVeteransHealthSystem,MalcomRandallVeteransAffairsMedical Center,UniversityofFlorida,Gainesville,FL,USA Fulllistofauthorinformationisavailableattheendofthearticle 2012Sukka-Ganeshetal.;licenseeBioMedCentralLtd.ThisisanOpenAccessarticledistributedunderthetermsofthe CreativeCommonsAttributionLicense(http://creativecommons.org/licenses/by/2.0),whichpermitsunrestricteduse, distribution,andreproductioninanymedium,providedtheoriginalworkisproperlycited.Sukka-Ganesh etal.BMCCancer 2012, 12 :309 http://www.biomedcentral.com/1471-2407/12/309

PAGE 2

BackgroundTightjunctions(TJ),themostapicalcell-celladhesion, owingtotheircellularlocationareresponsibleformaintainingthecellularintegrity.AnyderegulationoftheTJ characteristicscouldpotentiallyleadtocellulartransformationandacquisitionoftumorogenesispotential[1].However,emergingdetailsfrommanystudiesrelatedwith claudinandcancerhaveimplica tedclaudinfamilymembers inawiderangeofhumancancers.Theexpressionof claudinswoulddecreaseduringtumorogenesisastight junctionsarelostduringcellulartransformation,butitis understoodthatclaudinsareexpressedinatissuespecific manner[2-11].Down-regulationofclaudinsincancer seemstobewellunderstood,butincreasedexpressionof claudincontributingtoneoplasticprogressionislessclear [1].Aberranttissueexpressi onofcertainclaudinsmaycontributetoneoplasiabydirectlyalteringTJstructureand function[1].Furthermoreitisalsopostulatedthatclaudins mayaffectcell-signallingpathways[12]. Cdx-2 isatranscriptionalfactorcrucialtothenormal proliferationanddifferentiationofintestinalepithelial cells[13],howeverlittleisknownaboutthetranscriptionalprogramthatcontrolsgenesinvolvedinNSCLC tumorgrowth.Incolorectalcancerreducedexpression of cdx-2 hasbeenreportedinrodentsandhumans [14,15].Inaddition, cdx-2 nullmiceembryosfailedto surviveandheterozygote ’ sdevelopedintestinaltumors. Furthermorethepolypsdevelopedinthecolondonot express cdx-2 whichindicatesthatlossof cdx-2 promotestumorogenesis[16]. Cdx-2 regulatesclaudin-2 functionsbybindingtoits5 ’ flankingregionandaffects theexpressionofdownstreampathwaygenes[17].However,ifreceptorEphA2activationwithephrin-A1 inducedexpressionof cdx-2 playsanyroleinNSCLC tumorgrowthisnotknown. TheEphfamilyofreceptortyrosinekinasesplayskey roleinthedevelopmentofcancer.TheEphreceptors andephrinswereoriginallydiscoveredasneuronal guidanceandvasculatureformationproteinsduringembryonicdevelopment[18].Ephreceptorsandtheir ligands,ephrinsareoftendysregulatedinmalignantphenotypesincludingNSCLC[19-23].Howevertheprecise roleoftheseproteinsintumorgrowthisnotwellunderstood.DefiningtheroleofEphA2andephrin-A1in NSCLCisparticularlyimportant,asEphA2receptoris highlyexpressedinNSCLCwhichcontributestotumor development.Theaimofourstudywastoinvestigate theunderlyingmechanismsoftumorsuppressoreffect ofephrin-A1inNSCLC.Wereportanovelmechanism ofephrin-A1mediatedattenuationofNSCLCtumor growthduetodownregulationofclaudin-2andinductionoftumorsuppressorgene cdx-2 .Thusprovidingthe evidencethatreceptorEphA2maybeapromisingtherapeutictargetforNSCLC.MethodsNSCLCcellcultureA549NSCLCcelllinewasobtainedfromAmericanType CultureCollection(Manassas,VA)andNCI-H2126,NCIH838,NCI-H522,NCI-H23NSCLCcell-lineswereakind giftfromDr.FredericKaye,MD,DivisionofHaematology/Oncology,UniversityofFlorida,Gainesville,Florida. TheNSCLCcellswereresuspendedinRPMI-1640(Gibco Laboratories,GrandIsland,NY)containing10%FBS, penicillin(100U/ml)andstreptomycin(100 g/ml).The cellswereplatedin100mmPetridishes(CorningCostar Corporation,MA)andincubatedat37Cin5%CO2and 95%air.Thecellculturemediumwaschangedonalternatedays.Whenthecellswereconfluenttheyweretrypsinizedandseededinto100mmculturedishesortranswell chambersasrequiredfordifferentassays.Constructionofvectorscontainingephrin-A1(EFN-A1) andEphA2andtransienttransfectionofNSCLCcellsThegenetransfervector,pcDNA3.2/V5-DESTwasused asanexpressionvectorfortheexpressionofephrin-A1 (EFN-A1),andreceptorEphA2,andpcDNA3.2/V5/CAT wasusedasacontrolvector(Invitrogen,Carlsbad,CA) asreportedearlier[24].Fortheoverexpressionof cdx-2 gene,pcMV6-XL5wasusedasanexpressionvectorfor cdx-2 andcontrolvectorinA549cells(OrigeneTechnologies,Inc.;Rockville,MD).Theclonedvectorswere designatedaspcDNA-EFN-A1,pcDNA-EphA2and pcMVcdx2 respectively.ThecontrolvectorsweredesignatedasEmptyvectororpcMV-control.TheNSCLC cellsweretransfectedwithvectorsusinglipofectamine2000reagent(Invitrogen,Carlsbad,CA).Thetransfected cellswereusedforfurtherexperiments.TransfectionofNSCLCcellsThesiRNAtargetingthereceptorEphA2and cdx-2 were designedusingOligoperfectdesign(Invitrogen,Carlsbad, CA).A549cellswereplatedinto6-wellplatesor35mm platesasrequiredfortheexperiments.Thecellswere allowedtoadherefor24hours.ThetransfectionofsiRNA wasperformedusinglipofectamine-2000(Invitrogen) accordingtothemanufacturer ’ srecommendation.The concentrationofsiRNAusedwas100nM.After4hoursof transfection,theculturemediumwithserumwasadded. Theassayswerecarriedout48hourspost-transfectionas reportedearlier[25].TotalRNAisolationandquantitativerealtimePCR analysisTotalRNAfromculturedNSCLCcellswasisolatedand dilutedwithRNase-freewaterto100ng/mL;then,10 lof eachsamplewerereversetranscribedintocomplementary DNA(cDNA)asreportedearlier[22].Inbrief,afterthereversetranscriptionreaction,80 lofRNasefreewaterwereSukka-Ganesh etal.BMCCancer 2012, 12 :309 Page2of13 http://www.biomedcentral.com/1471-2407/12/309

PAGE 3

addedtoeachsample.TenmicrolitersofdilutedcDNA productweremixedwith25 lofSYBRGreenJumpStart TaqReadyMix,0.5 lofinternalreferencedye,and2.0 l ofspecificoligonucleotid eprimerstoatotalvolumeof 50 lforquantificationoftherealtimepolymerasechain reaction(PCR)(Table1).Thequantificationofreal-time PCRwasperformedbyusingtheSYBRGreenmethodon theAppliedBiosystems7500RealTimePCRSystemwith thefollowingprofile:1cycleat94Cfor2minutes;40 cyclesat94Cfor15seconds,at60Cfor1minute,andat 72Cfor1minutefortheelongationstep.Thereal-time PCRproductswereconfirmedbyelectrophoresison2% agarosegels.DataanalysiswascarriedoutbyusingtheABI sequence-detectionsoftwareus ingrelativequantification. Thethresholdcycle(Ct),whichwasdefinedasthecycleat whichPCRamplificationreachesasignificantvaluewas expressedasthemeanvalue.Therelativeexpressionof messengerRNA(mRNA)wascalculatedbyusingthe Ct method(where Ctwasthevalueobtainedbysubtracting theCtvalueofthehousekeepinggene -actinmRNAfrom theCtvalueofthetargetmRNA).Theamountofthetarget relativeto -actinmRNAwasexpressedas2-( Ct).WesternblotanalysisNSCLCcellswereculturedin60mmsizecellculture dishes(FisherScientific,Pittsburgh,VA)toconfluence andthecellswerelysedinlysisbufferwiththemethod reportedearlier[26].ProteinwasestimatedbyBCA method(PIERCE,Rockford,IL)andequalamountof protein(20 g/lane)wereloaded.Proteinsinthesample wereseparatedindenaturingsodiumdodecylsulphate (SDS)polyacrylamidegels(Bio-Rad),andtransferred electrophoreticallyontopolyvinylidenedifluoridemembrane(Immobilon-P,Millipore,Bedford,MA).Theblots wereblockedwith5%BlottingGradeBlockerNon-fat Drymilk(Bio-Rad,Hercules,CA)for1hronshakerat roomtemperature,andwereovernightincubatedat4C withrespectiveantibodies-rabbitEphA2antibody, rabbit cdx-2 antibody(Cellsignaling,Beverly,CA)and rabbitclaudin-2antibody(Invitrogen,GrandIsland, NY),at1:1000dilutions.Afterwashing,theywere incubatedwiththesecondaryantibody(horseradish peroxidase-conjugatedgoatanti-rabbitIgGAb)ata dilutionof1:1000for1hr.Finallyrespectiveproteins weredetectedbyenhancedchemiluminescence(ECL, AmershamPharmaciaBiotech).TheMolecularmass (kDa)oftheproteinswasdeterminedusingtheprestainedproteinmarker(Bio-Rad).NSCLCcellproliferationNSCLCcellproliferationwasassessedbyusinganassay basedoncleavageofthetetrazoliumsaltWST-1to formazanbycellularmitochondrialdehydrogenases (Roche,Indianapolis,IN)asreportedearlier[22].With thisassay,anincreaseinthenumberofviablecells resultsinanincreaseintheoverallactivityofthemitochondrialdehydrogenasesinthesample.Theaugmentationinenzymeactivityleadstoanincreaseinthe formazandyeformed.Theformazandyeformedwas quantifiedbyusingaplatereaderat450nm.A549cells wereplatedin96-wellmicroplateatadensityof0.5X 105cellsperwell.Thecellsweretransfectedwith pcDNA-EFNA1,pcDNA-EphA2,siRNAforEphA2or withscrambledsiRNA(sc-siRNA), cdx-2 -siRNAby usinglipofectamine-2000reagent,andafewwellswere leftuntreated.Thenegativecontrolsreceivedserum-free media,andsomeofthewellswereactivatedwithrecombinantephrin-A1.Cellswereallowedtoincubatefor48 hours.Then,theWST-1reagentwasappliedfor4hours tomeasurecellproliferation.Thecellproliferationwas assessedintriplicate.Thedataarepresentedasapercentageofnegativecontrolproliferationwith P values <0.05 wereconsideredsignificant.ImmunofluorescencemicroscopyClaudin-2expressioninNSCLCcellswasanalyzed byusingconfocallaser-scanningmicroscopy(ZeissLSM 510,Axiovert100M;Zeiss,Thornwood,NY),as reportedpreviously[22].Inbrief,thecellswerecultured toconfluenceongelatinizedglasscoverslipsandfixed in5%paraformaldehyde(with50mMphosphatebuffer) in50%Triswashbuffer(TWB).Theglasscoverslips wererinsed3timesandpermeabilizedwith1.2%Triton X-100for5minutes,rinsed3times,incubatedwith1% bovineserumalbumin(BSA)in100%TWBfor1hour, thenstainedfortheexpressionclaudin-2usingprimary antibodyrabbitanti-claudin-2at1:150dilutionand secondaryantibodygoatanti-rabbitimmunoglobulin Gconjugatedwithfluoresceinisothiocyanate(FITC) (ZymedLaboratories,SanFrancisco,CA).4,6-diamino2-phenylindole(DAPI)wasusedasanuclearstain. Table1PrimersUsedinQuantitativeReverseTranscriptase-PolymeraseChainReactionanalysisGeneNameForwardPrimer(5'-3')ReversePrimer(5'-3') Claudin-2GACCCCTAAGGCTGAGGAACAGAAGAGGAGGCCCAAGGAAG Cdx-2 GCCAGGTCCTCTGAGAAGTGCCTCTGAGAGCCAGGTCTGT Cdx-2 -siRNAGACAAGGACGUGAGCAUGUACCCUAUAGGGUACAUGCUCACGUCCUUGUC 18srRNAAAACGGCTACCACATCCAAGTAACGAGGATCCATTGGAGG Sukka-Ganesh etal.BMCCancer 2012, 12 :309 Page3of13 http://www.biomedcentral.com/1471-2407/12/309

PAGE 4

NSCLCtumorgrowthinmatrigelA48-wellcultureplatewascoatedwith200 lofmatrigel perwellandthenallowedtopolymerizeforabout1 – 2 hoursat37C.NSCLCcellsatadensityof~1x103cells perwellwereplatedin0.3mlof2%FBScontainingRPMI1640asreportedearlier[24].Thecellswereactivatedwith ephrin-A1ortransfectedwithplasmidpcDNA-EphA2or pcDNA-EFNA1orsiRNAforEphA2or cdx-2 orempty vectorbyusinglipofectamine-2000andfewwellswereleft untreatedascontrols,media werechangedeverythree days.Thenumberofcoloniesformedwasrecordedafter 7daysofincubation.4 – 6randomlychosenfields(x10) fromthesamplewerephotographed.StatisticalanalysisTheSigmaStat3.5statisticalsoftwareprogramwasused tocalculatestatisticalsignificance.Kruskal-WallisOne WayAnalysisofVariance(ANOVA)wasusedtocomparetheexperimentalgroupsfromthecontrolgroups. TheposthoctestHolm-Sidakmethodwasappliedfor pairwisecomparisons.Thedifferencesat p< 0.05were consideredstatisticallysignificant.ResultsNSCLCcellsexpressreceptorEphA2andCaludin-2ProliferatingNSCLCcells(A549,H2126,H838,H522,and H23)expressedreceptorEphA2,andclaudin-2andthe expressionofephrinA1wasvariable(Figure1A).Receptor EphA2wasoverexpressedinallthefiveNSCLCcelllines tested.Howeverhighestexp ressionofclaudin-2was noticedinA549,H838andH23celllineswhencompared toH2126andH522celllines.Whereas,theexpressionof ephrin-A1wasdysregulated .A549,H2126andH838cells showeddecreasedexpressionofephrin-A1whencompared toH522andH23(Figure1A).InadditionNSCLCcells weretransientlytransfectedwithvectorcontainingephrinA1construct(pcDNA-EFNA1)oremptyvectorandtheexpressionofreceptorEphA2wasdeterminedinallNSCLC celllinesselected.Ephrin-A1activationdownregulatedthe expressionofEphA2whencomparedtoemptyvector transfectedNSCLCcells(Figure1B).Inaddition,A549cells werealsoactivatedwithrecombinantephrin-A1forvarying time(5,10,30,60and120minutes)andtheactivation/ phosphorylationofreceptorEphA2wasevaluated.EphrinA1activationinducedphosph orylationofreceptorEphA2 upto60minutesinA549cells.However,at120minutes thephosphorylationwasdownregulated.Thetotalreceptor expressionwascomparativelydecreasedwhencomparedto controlat120minutes(Figure1C).TheEphA2signaling pathwayactivationwasalsodeterminedbyevaluating Erk1/ Erk2 activationinNSCLC.Ephri nA1activationinhibited thephosphorylationof Erk1/Erk2 MAPKinNSCLCwhen comparedtocontrolcells(Figure1C).Ephrin-A1downregulatedclaudin-2expressioninNSCLC cellsEphrin-A1activationofreceptorEphA2downregulated theexpressionofclaudin-2inNSCLCcells.Toidentify whetherdecreaseinclaudin-2expressionisdirectlydue todecreaseinEphA2receptorexpression,A549cells weretransfectedwithpcDNA-EFNA1oremptyvector orleftuntransfected.Incomparisontoemptyvectorthe transienttransfectionofA549cellswithpcDNA-EFNA1 resultedinsignificantlydecreasedclaudin-2expression (Figure2A).Thissuggestedthatactivationofreceptor EphA2withtheligandephrin-A1inducedrapidreductionofclaudin-2expressionthatplaysamajorrolein maintainingcellularintegrity.Inadditiontheexpression ofclaudin-2andreceptorEphA2wasalsoevaluatedby Westernblotanalysis.ThedecreasedexpressionofreceptorEphA2furtherconfirmedthattreatmentofA549 cellwithephrin-A1downregulatestheexpressionofreceptorEphA2andclaudin-2(Figure2C,-2D).These datasuggeststhatephrin-A1treatmentinhibitstheexpressionofoncogenicproteinEphA2andclaudin-2in NSCLCcells. Inordertodetermineifoverexpressionofthereceptor EphA2inA549cellspromotescl audin-2expression,A549 cellsweretransientlytransfectedwithpcDNA-EphA2and theexpressionofclaudin-2wasevaluated.Asignificantincreaseintheexpressionofclaudin-2wasnotedwhencomparedtoemptyvectortransfectedcells(Figure2BandC). Toinvestigatewhetherthisincr easeinclaudin-2expression wasdirectlyduetotheincreasesinEphA2receptorexpression,NSCLCcellsweretransfectedwithEphA2-siRNA.In A549cells,silencingtheEphA2receptorwithsiRNAsignificantlyreducedth eclaudin-2expressionwhencompared tosc-siRNAtransfectedcells(Figure2BandC).These resultssuggestthatincreasedEphA2expressionmodulated claudin-2expression,which mayplayanimportantrolein tumorgrowthinNSCLC.Claudin-2expressiondecreasedinEphrin-A1treated A549cellsInordertoevaluatethecellulardistributionofcaludin-2, andmorphologicalchangesinactivatedcells,A549cells wereactivatedwithephrin-A1andanalyzedbyimmunofluorescencemicroscopy.Fluorescenceimmuno-staining analysisrevealedthatA549cellsshowedpunctuated expressionofclaudin-2whereas,ephrin-A1activation decreasedclaudin-2expression(Figure2E).Incells transfectedwithpcDNA-EFNA1amarkeddecreasein claudin-2expressionwasnoticed.Inaddition,ephrin-A1 activatedcellsshoweddistortedcytoskeleton,androunded morphology.However,incellstransfectedwithpcDNAEphA2adenseandhigherexpressionofclaudin-2was noticedwhencomparedtocontrolandemptyvector transfectedcells.ThesedatasuggeststhatoverexpressionSukka-Ganesh etal.BMCCancer 2012, 12 :309 Page4of13 http://www.biomedcentral.com/1471-2407/12/309

PAGE 5

ofreceptorEphA2promotestheexpressionofclaudin-2 inNSCLCcells.Ephrin-A1activationortransfectionof cellswithplasmidcontainingtheephrin-A1construct inhibitstheexpressionofclaudin-2confirmingitsantitumoreffectsonNSCLCcells. Ephrin-A1treatmentincreased cdx-2 expressioninNSCLC cells Cdx-2 atumorsuppressorgene,foundtobetissuespecific initsexpression.Ephrin-A1activationinducedmorethan fivefoldsincreasesin cdx-2 mRNAexpressioninNSCLC cells(Figure3A).Inadditionthisexpressionwasalsoconfirmedinthecellstransfec tedwithplasmidcontaining ephrin-A1constructpcDNA-EFNA1.Thetransfectionwith pcDNA-EFNA1alsoshowedasignificantincreaseof cdx-2 expressioninA549cellswhencomparedtoemptyvector (Figure3A).Furthermore,thecellswerealsotransfected withplasmidpcDNA-EphA2oremptyvectorandtheexpressionof cdx-2 wasevaluated.Aremarkablereductionin theexpressionof cdx-2 wasnoticedincellstransfectedwith pcDNA-EphA2.However,knockdownofEphA2genewith siRNA-EphA2significantlyupregulatedtheexpressionof cdx-2 inA549cellswhencomparedtosc-siRNA transfectedcells(Figure3B).Theseresultssuggestthatunregulated/lostexpressionof cdx-2 ,atumorsuppressorgene mayresulttoincreasedEphA2expressioninA549cells. Furthermore cdx-2 expressionwithactivationofephrin-A1 ortransfectionwithpcDNA-EFNA1orPcDNA-EphA2in A549cellswasalsoconfirmedwithWesternblotanalysis (Figure3C).Thesedatasuggeststhatactivationofreceptor withephrin-A1upregulatestheexpressionoftumorsuppressorgene cdx-2 .Silencingtheexp ressionofEphA2 receptoralsoincreasestheexpressionof cdx-2 whichindicatesthatknockdow nofEphA2eitherbyephrin-A1activationorbysilencinginterferenceRNAcouldbepotentialin inhibitingtheoncogeniceffectofreceptorEphA2and tumorgrowth. Silencing cdx-2 expressionblockedephrin-A1mediated inhibitionofclaudin-2expressioninNSCLCcells ActivationofA549cellswithephrin-A1ortransfection withpcDNA-EFNA1resultedinsignificantdecreaseof claudin-2expression.Ina dditionoverexpressionof cdx2 byusingpcMVcdx-2 ,aplasmidwith cdx2 construct resultedinsignificantdecre aseofclaudin-2expression (Figure4AandB).Moreover,whenA549cellswere Figure1 NSCLCcellsexpressreceptorEphA2,Ephrin-A1andCaludin-2. Plate A :NSCLCcelllines(A549,H2126,H838,H522,H23)express receptorEphA2,ephrin-A1,andclaudin-2 ExpressionofEphA2,ephrin-A1,andclaudin-2wasanalyzedbyWesternblotanalysis.Plate B :Western blotanalysisofEphA2proteinexpressionthe -actinwasprobedtodemonstrateequalsampleloading.NSCLCcelllineswereeithertransfected withpcDNA-EFNA1(pcDNA-EFNA1isvectorcontainingephrin-A1construct)oremptyvectorandreceptorEphA2expressionwasanalyzed. Plate C :A549cellswereactivatedfor5minutesto120minuteswithephrin-A1.WesternblotanalysisofphosphorylatedEphA2and Erk1/Erk2 was performed,the -actinwasprobedtodemonstrateequalsampleloading.Datapresentedistherepresentativeofthreeseparateexperiments. Sukka-Ganesh etal.BMCCancer 2012, 12 :309 Page5of13 http://www.biomedcentral.com/1471-2407/12/309

PAGE 6

Figure2 (Seelegendonnextpage.) Sukka-Ganesh etal.BMCCancer 2012, 12 :309 Page6of13 http://www.biomedcentral.com/1471-2407/12/309

PAGE 7

transfectedwith cdx-2siRNAandactivatedwithephrinA1 theexpressionofclaudin-2ex pressionwassignificantly upregulated(Figure4A).Furt hermoreImmunofluorescence stainingfortheexpressionof claudin-2alsoconfirmedthat silencing cdx-2 geneandactivationwithephrin-A1resulted inenhancedexpressionofclaudin-2(Figure4C).Our resultssuggestthatEphA2signalingpromotedclaudin-2 expressioninA549cellsanddow nregulatedtheexpression (Seefigureonpreviouspage.) Figure2 Ephrin-A1activationdecreasesclaudin-2expressioninNSCLCcells. Relativeexpressionofclaudin-2mRNAnormalizedto endogenouscontrol.Plate A :Cellswereeitheractivatedwithephrin-A1ortransfectedwithpcDNA-EFNA1(vectorcontainingEphrin-A1 construct)oremptyvector.Plate B :CellseithersilencedwithEphA2siRNAortransfectedwithpcDNA-EphA2(pcDNA-EphA2isvectorcontaining EphA2construct)Plate C :Claudin-2proteinexpressionbyWesternblotanalysis, -actinwasprobedtodemonstrateequalsampleloading. Plate D :WesternblotanalysisofEphA2proteinexpressionthe -actinwasprobedtodemonstrateequalsampleloading.Datapresentedwasthe meanSEMofthreeindependentexperiments, *p<0.001 comparedtocontrol; #p<0.001 comparedtoemptyvector; $p<0.001 comparedto sc-siRNA.PlateE:Claudin-2expressioninNSCLCasobservedbyimmunofluorescenceanalysis.Thephotomicrographsshowimmunofluorescence stainingofclaudin-2inNSCLC.BluecolourrepresentsthenuclearstainDAPI(4,6-diamino-2-phenylindole),RedcolourrepresentsRhodamin phalloidinforF-actinfilamentstain,andgreencolourrepresentsAlexaFlour488labelledforclaudin-2expression.Thedatapresentedisasingle representativeofthreesimilarobservationsScaleBar=40 m. Figure3 TransfectionofpcDNA-EFNA1increasedwhereastransfectionofpcDNA-EphA2attenuated cdx-2 expressioninNSCLCcells. Plate A :cellswereeitheractivatedwithephrin-A1ortransfectedwithpcDNA-EFNA1(pcDNA-EFNA1isvectorcontainingephrin-A1construct). Cdx-2 mRNAexpressionwasanalyzedbyquantitativerealtimePCR.Plate B :CellseithersilencedwithEphA2siRNAortransfectedwith pcDNA-EphA2(pcDNA-EphA2isvectorcontainingEphA2construct)Plate C :Westernblotanalysisofclaudin-2proteinexpression,the -actinwas probedtodemonstrateequalsampleloading.TheWesternblotrepresentsthreesimilarobservations.DatapresentedisthemeanSEMofthree independentexperiments. *p<0.001 comparedtocontrol, #p<0.001 comparedtoEmptyvector, $p<0.001 comparedtosc-siRNA. Sukka-Ganesh etal.BMCCancer 2012, 12 :309 Page7of13 http://www.biomedcentral.com/1471-2407/12/309

PAGE 8

oftumorsuppressorgene cdx-2 .Thesedataalsosuggests thatephrin-A1mediateddownregulationofclaudin-2expressioninA549cellsisdependenton cdx-2. Silencing cdx2expressionblockedEphrin-A1mediated inhibitionofcellproliferationinNSCLCcells Ephrin-A1activationandtransfectionwithephrin-A1vectorpcDNA-EFNA1resultedinsuppressionofproliferationinA549cellswhencomparedtocontrolorempty vectortransfectedcell(Figure5A).SilencingofEphA2 receptorbyEphA2-siRNAalsoshoweddecreasedcellproliferationascomparedtosc-siRNAorcontrol(Figure5B). Inaddition,thecellsweretransfectedwithpcDNA-EphA2 thatshowedasignificantincreaseinproliferationwhen comparedtoemptyvectororcontrolcells.However,when cellsweretransfectedwith cdx2 -siRNAandsubsequently activatedwithephrin-A1theproliferationofcellswas restoredandshowedclosetocontrolcellproliferation rate.Moreover,knockdownof cdx-2 withsiRNAand transienttransfectionwithpcDNA-EFNA1,resultedin Figure4 Silencing cdx-2 expressionrestoresEphrin-A1mediatedinhibitionofClaudin-2expressioninNSCLCcells. Plate A :Relative mRNAexpressionofclaudin-2normalizedtoendogenouscontrol.(pcDNA-EFNA1isvectorcontainingephrin-A1construct).Plate B :Claudin-2 expressionwasanalyzedbyWesternblot,datarepresentsmeanSEMofthreeindependentexperiments. *p<0.001 comparedtocontrol, #p<0.001 comparedtoEmptyvector, $p<0.001 comparedto cdx2 -siRNAalone.* *p<0.001 comparedtocontrol.Plate C :Immunofluorescence analysisofclaudin-2expressioninNSCLC.BluecolourrepresentsthenuclearstainDAPI(4,6-diamino-2-phenylindole),Redcolourrepresents RhodaminphalloidinforF-actinfilaments,andgreencolourrepresentsAlexaFlour-488labelledforclaudin-2expression.Thedatapresentedisa singlerepresentativeofthreesimilarobservations.ScaleBar=40 m. Sukka-Ganesh etal.BMCCancer 2012, 12 :309 Page8of13 http://www.biomedcentral.com/1471-2407/12/309

PAGE 9

significantincreaseincellproliferationcomparedto pcDNA-EFNA1transfectedcells(Figure5A,-5C).The transfectionof cdx-2 -siRNAaloneshowedslightincrease intheproliferationratebutwasnotsignificantwhencomparedwithcontrol.Theseresultssuggestthatephrin-A1 inducedincreasedexpressionof cdx-2 suppressedproliferationofNSCLC.ThetransfectionofNSCLCwith cdx2siRNAfollowedbyephrin-A1activationbluntedephrinA1mediatedinhibitionofA549cellproliferation. Ephrin-A1activationinhibitedtumorgrowthand silencing cdx-2 expressionbluntedEphrin-A1mediated suppressionoftumorgrowthinNSCLCcells invitro A549cellswereactivatedwitheprhin-A1ortransfected withaplasmidpcDNA-EFNA1,oremptyvector,orleft untransfectedascontrol.Thetransfectedorcontrolcells wereplatedon3-Dmatrigelstodeterminethetumor growth invitro .Thetumorgrowthwasstudiedfor 2weeks.MicroscopicexaminationrevealedthatA549 cellsactivatedwithephrin-A1andthosetransfectedwith pcDNA-EFNA1showedsuppressedtumorgrowthin matrigelascomparedtoemptyvectortransfectedor controlcells(Figure6).IncontrastNSCLCcellstransfectedwithpcDNA-EphA2showedaggressivetumor growthwhichwassignificantlylargerinsizeascomparedtotumorsgrownaftersilencingtheEphA2with siRNA.Inaddition,whentheA549cellsweretransfectedwith cdx-2 siRNAandsubsequentlytreatedwith theephrin-A1ortransfectedwithpcDNA-EFNA1we noticedsignificantlyincreasedtumorformationas Figure5 Ephrin-A1activationattenuatesNSCLCcellproliferation. ProliferationofNSCLCcellsasmeasuredbyWST-1assay.Plate A : Proliferationincellseitheractivatedwithephrin-A1ortransfectedwithpcDNA-EFNA1(pcDNA-EFNA1isvectorcontainingephrin-A1construct). Plate B :ProliferationincellseithersilencedwithEphA2siRNAortransfectedwithpcDNA-EphA2(pcDNA-EphA2isvectorcontainingEphA2 construct).Plate C :Proliferationin cdx-2 siRNAtransfectedcellsthatweretreatedwithephrin-A1ligandorpcDNA-EFNA1transfected.Data presentedisthemeanSEMofthreeindependentexperiments.* p<0.05 comparedtocontrol;$ p<0.05 comparedtoephrin-A1or pcDNA-EFNA1alone,# p<0.001 comparedtoemptyvectororsc-siRNA+ephrinA1,NSisnotsignificant. Sukka-Ganesh etal.BMCCancer 2012, 12 :309 Page9of13 http://www.biomedcentral.com/1471-2407/12/309

PAGE 10

comparedtocellseitheractivatedwithephrin-A1alone andpcDNA-EFNA1transfectedcells(Figure6).Taken togethertheseresultsindicatethatwhenA549cells transfectedwithpcDNA-EphA2tooverexpressed receptorEphA2increasedclaudin-2expressionwas observedwhichpromotedtheA549cellproliferation. ActivationofNSCLCcellswithephrin-A1leadsto tumorgrowthinhibitionvia cdx2expression. Discussion Themajorfindingofourpresentstudyisthatreceptor EphA2isoverexpressedinNSCLCcelllineswhichpromotestumorgrowth.Inadditionwealsofoundthat EphA2promotestightjunctionproteinclaudin-2expressioninA549cells.However,theexpressionof ephrin-A1wasfoundtodysregulatedandA549cells showedminimallevels.Thereisaccumulatingevidence thatactivationofreceptorEphA2withitsligandephrinA1attenuatestumorogenicpotentialofmalignantcells [24,27,28].Themolecularmechanismsresponsiblefor tumorsuppressiveeffectsofephrin-A1arestillelusive. Inthepresentstudy,wereportthatproliferatingNSCLC cellsshowedenhancedexpressionofEphA2,andclaudin-2.TheactivationofreceptorEphA2withephrin-A1 inhibitedtheexpressionofEphA2andclaudin-2.Tofurtherexaminetheeffectofephrin-A1onNSCLCwe transfectedthecellswithvectorexpressingephrinA1 construct,pcDNA-EFNA1.Wefoundthatforcedexpressionofephrin-A1downregulatedthereceptor EphA2andinhibitedcellproliferationandtumorgrowth in3Dmatrigel.Inadditiontheactivationofreceptor EphA2withephrin-A1inducedphosphorylationof EphA2andinhibitedthedownstreamsinglingMAP kinasepathway Erk1/Erk2 .Furthermore,theactivation ofEphA2receptorwithephrinA1induced cdx-2 ,a tumorsuppressorgeneinA549cells.Thesedata suggeststhatephrin-A1activation/transfectioncould effectivelybindandactivateendogenousEphA2in NSCLCandledtointernalizationanddegradationof EphA2.InordertounderstandifreceptorEphA2signalingmodulatesTJproteinclaudin-2wetransfectedthe A549cellswithEphA2expressingvector,pcDNAEphA2.Theexpressionofclaudin-2washigherinA549 cellstransfectedwithpcDNA-EphA2ascomparedto emptyvectortransfectedcellsorcontrolcells.In addition,overexpressionofreceptorEphA2significantly enhancedtumorgrowth.WhereassilencingtheexpressionofreceptorEphA2bysiRNA,decreasedthe Figure6 Ephrin-A1ligandactivationdecreasestumorgrowthinNSCLC. EqualnumberofA549cellswasseededinmatrigelsaftervarious treatmentsasdescribedandafter7daysofculturetumorgrowthwasrecordedbyaSPOTdigitalcameraattachedtoNikonmicroscope.The datapresentedareasinglerepresentativeofthreesimilarbutindependentexperiments.Magnification=5 M. Sukka-Ganesh etal.BMCCancer 2012, 12 :309 Page10of13 http://www.biomedcentral.com/1471-2407/12/309

PAGE 11

expressionofclaudin-2andinterestinglyasignificant up-regulationof cdx-2 wasnoticedinNSCLCcellsas comparedtosc-siRNAtransfectedA549cells.However, silencing cdx-2 genewithsiRNAandsubsequentactivationwithephrin-A1ortransfectionwithpcDNA-EFNA1 failedtoinhibittumorgrowthinA549cells.Collectively thesedatasuggeststhatanephrin-A1mediated anti-oncongeniceffectisduetodownregulationof EphA2,claudin-2expressionandinductionof cdx-2 geneinNSCLC. EphA2isanoncoproteinwhichpromotescellsurvival, abnormalcellgrowthandinvasioninanumberof malignancies,includingNSCLC[18,20,21,29].InmalignantcellssuchasA549,duetodysregulatedcelldivision andabnormalgrowththecell-cellcontactsareloose whichhinderstheinteractionbetweenneighbouring cells.Thelossofcontactamongtheadjacentcells resultsinaccumulationofhighlevelsofintracellular EphA2andclaudin-2anintegralcomponentoftight junction.Tightjunctionsaretheapicalcell-celladhesionsthatregulateparacellularpermeabilityandare criticalforcellpolarity.Alterationintightjunction proteinclaudin-2,cancausethedefectsinnormalregulationofgrowthfactorreceptoractivationduetoadifferentialdistributionofthereceptorandtheirrespective ligands,whichcanbeobservedwithrespecttoreceptor EphA2anditsligandEphrin-A1[30].Inthisstudy,we attemptedtounderstandtheunderlyingmechanismsby whichEphA2overexpressionleadstoenhancedorirregularclaudin-2expressionvia cdx-2 modulationand promotetumorgrowthinNSCLCcells.Severalstudies reportedthatreceptorEphA2isoverexpressedina numberofmalignancies[19,20,30].Previouslywehave reportedthatEphA2isoverexpressedinmalignant mesotheliomacells(MMC)andposttranslationalsilencingofEphA2significantlysuppressestheproliferation andhaptotacticmigrationofMMC[22,24].Inaddition, EphA2receptoractivationinMMCbyitsligandephrinA1inhibitedthe RAS MAPkinasesignalingpathways [23,24].OurstudyinA549cellsrevealedthatreceptor EphA2signalingupregulatestheTJproteinclaudin-2. Inturn,theoverexpressionofclaudin-2alongwith EphA2promotesA549cellproliferationandtumor growth.ItwasreportedthatEGFsignalinginduced claudin-2expressionwhichpromotedcolonizationof mammarytumorcells[31].Theupregulatedlevelsof claudin-2causedleakycellularbarriersinMDCK1cells [32].Thejunctionalclaudin-2formstheselectivecation channelsthataresufficienttotransformthefunctional “ tight ” junctionintoa “ leaky ” one[33].Theleaky barriersmaycontributetoincreaseuptakeofnutrients andgrowthfactorwhichpromoteexaggeratedtumor colonization.Inthepresentstudywenotedexaggerated tumorcoloniesformationwhenEphA2wasover expressedinA549cells.ItisplausiblethatoverexpressionofreceptorEphA2promotesclaudin-2whichin turnenhancestumorcolonizationofA549cells. WedemonstratethatactivationofreceptorEphA2 withephrin-A1induced cdx-2 expressionandinhibited tumorformation.Theoverexpressionof cdx-2 byvector pcMVcdx-2 resultedindownregulationofclaudin-2 andattenuationofcellproliferationandtumorgrowth onmatrigels.Inadditionsilencing cdx-2 expression usingsiRNAandactivationwitheprhin-A1resultedin upregulationofclaudin-2inA549cells. Cdx-2,a tumor suppressorgeneishomeoboxtranscriptionalfactorthat isknowntocontrolapical-basolateralpolarityinmouse enterocytesandhumancolonicepithelialcells[34]. Cdx-2 regulatesepithelialcellpolarityandmorphogenesisthroughcontrolofapicalproteintransport.Atthe transcriptionallevel,transcriptionalfactorssuchas cdx-2 canbindtothepromoterregionsofvariousclaudingenesandaffecttheirexpression[1,10].Inaddition, certaincharacteristicsofclaudin-2and cdx-2 showsimilaritythatbotharecriticalforepithelialcellpolarity [1,34].Increased cdx-2 expressionwasusedasamarker forprogressioningastriccarcinogenesis[35],while someofthegastriccancersstudiesshowedaberrantexpressionof cdx-2 inintestinalmetaplasiawhichisasubsetofgastricadenocarcinoma[36].Thedown-regulation of cdx-2 mechanismwasrelatedtotheinductionofulcer-associatedcelllineage(UACL)[37].Inaddition lossof cdx-2 immunoreactivitywasimplicatedasdiagnosticfeatureinpoorlydifferentiatedcolorectaladenocarcinoma[38].Whereas,thereducedexpressionof cdx-1 and cdx-2 geneswereassociatedwiththedevelopmentofenterocolitisinintestinalmucosa[39].Furthermore,activationof Ras oncogenewasassociatedwith downregulationofthe cdx-2 incoloncancercells[40]. Allthesestudiesconfirmthatexpressionof cdx-2 gene thoughdiseasespecificandtissuespecific,theexpressionof cdx2 wasdirectlyassociatedwithtumorgrowth. Theplausiblemechanismsforthereduced cdx-2 expressionincarcinogenesis,couldbethathomeodomainproteinssignifiesrolesindirectingthecellstospecified cell-phenotypeduringorganogenesisinearlystagesof development.However,areductionof cdx-2 geneexpressioninthelatestagessuchasininvasivetumors maybeattributedtooverexpressiononcogenicproteins whichmayleadtodeviatefromnormalepithelialphenotypetotheneoplasticphenotype[15]. Ithasbeenshownthat,caudal-relatedhomeoboxgene cdx-2ispositivelyinvolvedintheregulationofthe humanclaudin-2promoteractivity[17].TheEphA2signalingcausedreducedexpressionoftranscriptionfactor cdx-2 thathinderitsbindingtoclaudinpromoterand thuscauseirregularexpressionofclaudin-2whichis reportedtobeincreasedinNSCLCcellsinthepresentSukka-Ganesh etal.BMCCancer 2012, 12 :309 Page11of13 http://www.biomedcentral.com/1471-2407/12/309

PAGE 12

study.ItisconceivablethatduetothedisruptedTJor claudin-2thereisadisruptioninepithelialcellpolarity leadingtoleakageoflargesolutespassingacrossepithelialbarrierstotheothercells.Thus,theTJdisruptionin premalignantneoplastictissuecanincreasetheprobabilitythatitwilldevelopintoacompletecarcinomabecauseofthecontinuousstimulationofcelldivisionfollowedbydisruptednaturalbarriersbetweengrowth factorsandtheirreceptors.Thenovelfindingofour presentstudyisthatreceptorEphA2mediatedthe enhancedinductionoffunctionallyalteredclaudin-2via down-regulationoftumorsuppressorgeneexpression cdx-2 inNSCLCcells.Itispossiblethatactivationof receptorEphA2withephrin-A1downregulatedclaudin2andinducedtheexpressionof cdx-2 suggesting oncogenicproteinEphA2playamajorroleinregulating cdx-2 expressioninNSCLC.Whereas,theforcedexpressionofephrin-A1inducedtumorsuppressivesignals viadownregulationanddegradationEphA2andinhibitedtheoncogenicsinglingpathwayinNSCLC.However,thisneedstobefurtherinvestigated.ConclusionsInconclusion,wepresentthefirstevidencethatEphA2 signalingpromotestheexpressionofclaudin-2inNSCLC cells.ActivationofNSCLCwithligandephrin-A1suppressedthecaludin-2expressionviatheinductionoftranscriptionalfactor cdx-2 .Thesestudiessuggestthat targetingEphA2byusingephrin-A1maybeapromising approachforthetherapeuticinventionsagainstNSCLC.Competinginterests Theauthorshavenocompetinginterests. Authors ’ contributions BSG,carriedouttheexperiments.NNandBSGdraftedthemanuscript.NN andKAMcriticallyanalyzed,edited,reviewedandfinalizedthedata.FK,for providingcelllinesandeditorialreview,EPGprovidedthevaluable commentsandeditorialreviewofthemanuscript.Allauthors ’ readand approvedthefinalmanuscript. Acknowledgements ThisworkwassupportedbyNIRgrant#09KN-09;RC1(#09KW-08)from James&EstherKing,FloridaDepartmentofHealth(Nasreen,N);VAMerit Review(Mohammed,KA). Authordetails1DivisionofPulmonary&CriticalCareMedicine,DepartmentofMedicine, UniversityofFlorida,Gainesville,FL,USA.2NF/SGVeteransHealthSystem, MalcomRandallVeteransAffairsMedicalCenter,UniversityofFlorida, Gainesville,FL,USA.3BiomaterialScienceandEngineering,Universityof Florida,Gainesville,FL,USA.4DivisionofHematology/Oncology,Universityof Florida,Gainesville,FL,USA. Received:28December2011Accepted:28June2012 Published:23July2012 References1.SinghAB,SharmaA,DhawanP: Claudinfamilyofproteinsandcancer:an overview. JOncol 2010, 2010: 541957. 2.TanC,Cruet-HennequartS,TroussardA,FazliL,CostelloP,SuttonK, WheelerJ,GleaveM,SangheraJ,DedharS: Regulationoftumor angiogenesisbyintegrin-linkedkinase(ILK). CancerCell 2004, 5 (1):79 – 90. 3.KominskySL,ArganiP,KorzD,EvronE,RamanV,GarrettE,ReinA,SauterG, KallioniemiOP,SukumarS: Lossofthetightjunctionproteinclaudin-7 correlateswithhistologicalgradeinbothductalcarcinomainsituand invasiveductalcarcinomaofthebreast. Oncogene 2003, 22 (13):2021 – 2033. 4.UsamiY,ChibaH,NakayamaF,UedaJ,MatsudaY,SawadaN,KomoriT,Ito A,YokozakiH: Reducedexpressionofclaudin-7correlateswithinvasion andmetastasisinsquamouscellcarcinomaoftheesophagus. HumPathol 2006, 37 (5):569 – 577. 5.SauerT,PedersenMK,EbeltoftK,NaessO: Reducedexpressionof Claudin-7infineneedleaspiratesfrombreastcarcinomascorrelatewith gradingandmetastaticdisease. Cytopathology 2005, 16 (4):193 – 198. 6.MichlP,BarthC,BuchholzM,LerchMM,RolkeM,HolzmannKH,MenkeA, FenstererH,GiehlK,LohrM, etal : Claudin-4expressiondecreases invasivenessandmetastaticpotentialofpancreaticcancer. CancerRes 2003, 63 (19):6265 – 6271. 7.RangelLB,AgarwalR,D'SouzaT,PizerES,AloPL,LancasterWD,GregoireL, SchwartzDR,ChoKR,MorinPJ: Tightjunctionproteinsclaudin-3and claudin-4arefrequentlyoverexpressedinovariancancerbutnotin ovariancystadenomas. ClinCancerRes 2003, 9 (7):2567 – 2575. 8.SoiniY: Expressionofclaudins1,2,3,4,5and7invarioustypesof tumours. Histopathology 2005, 46 (5):551 – 560. 9.LeeJW,LeeSJ,SeoJ,SongSY,AhnG,ParkCS,LeeJH,KimBG,BaeDS: Increasedexpressionsofclaudin-1andclaudin-7duringtheprogression ofcervicalneoplasia. GynecolOncol 2005, 97 (1):53 – 59. 10.AgarwalR,D'SouzaT,MorinPJ: Claudin-3andclaudin-4expressionin ovarianepithelialcellsenhancesinvasionandisassociatedwith increasedmatrixmetalloproteinase-2activity. CancerRes 2005, 65 (16):7378 – 7385. 11.ChaoYC,PanSH,YangSC,YuSL,CheTF,LinCW,TsaiMS,ChangGC,Wu CH,WuYY, etal : Claudin-1isametastasissuppressorandcorrelateswithclinicaloutcomeinlungadenocarcinoma. AmJRespirCritCareMed 2009, 179 (2):123 – 133. 12.ItohM,FuruseM,MoritaK,KubotaK,SaitouM,TsukitaS: Directbindingof threetightjunction-associatedMAGUKs,ZO-1,ZO-2,andZO-3,withthe COOHterminiofclaudins. JCellBiol 1999, 147 (6):1351 – 1363. 13.DulucI,LorentzO,FritschC,LeberquierC,KedingerM,FreundJN: Changingintestinalconnectivetissueinteractionsaltershomeoboxgene expressioninepithelialcells. JCellSci 1997, 110 (Pt11):1317 – 1324. 14.MalloGV,SoubeyranP,LissitzkyJC,AndreF,FarnarierC,MarvaldiJ,Dagorn JC,IovannaJL: ExpressionoftheCdx1andCdx2homeoticgenesleads toreducedmalignancyincoloncancer-derivedcells. JBiolChem 1998, 273 (22):14030 – 14036. 15.EeHC,ErlerT,BhathalPS,YoungGP,JamesRJ: Cdx-2homeodomain proteinexpressioninhumanandratcolorectaladenomaand carcinoma. AmJPathol 1995, 147 (3):586 – 592. 16.MalloGV,RechrecheH,FrigerioJM,RochaD,ZweibaumA,LacasaM, JordanBR,DusettiNJ,DagornJC,IovannaJL: Molecularcloning, sequencingandexpressionofthemRNAencodinghumanCdx1and Cdx2homeobox.Down-regulationofCdx1andCdx2mRNAexpression duringcolorectalcarcinogenesis. IntJCancer 1997, 74 (1):35 – 44. 17.SakaguchiT,GuX,GoldenHM,SuhE,RhoadsDB,ReineckerHC: Cloningof thehumanclaudin-25'-flankingregionrevealedaTATA-lesspromoter withconservedbindingsitesinmouseandhumanforcaudal-related homeodomainproteinsandhepatocytenuclearfactor-1alpha. JBiol Chem 2002, 277 (24):21361 – 21370. 18.KinchMS,MooreMB,HarpoleDHJr: PredictivevalueoftheEphA2 receptortyrosinekinaseinlungcancerrecurrenceandsurvival. Clin CancerRes 2003, 9 (2):613 – 618. 19.SulmanEP,TangXX,AllenC,BiegelJA,PleasureDE,BrodeurGM,IkegakiN: ECK,ahumanEPH-relatedgene,mapsto1p36.1,acommonregionof alterationinhumancancers. Genomics 1997, 40 (2):371 – 374. 20.Walker-DanielsJ,CoffmanK,AzimiM,RhimJS,BostwickDG,SnyderP,Kerns BJ,WatersDJ,KinchMS: OverexpressionoftheEphA2tyrosinekinasein prostatecancer. Prostate 1999, 41 (4):275 – 280. 21.NakamuraR,KataokaH,SatoN,KanamoriM,IharaM,IgarashiH,Ravshanov S,WangYJ,LiZY,ShimamuraT, etal : EPHA2/EFNA1expressioninhuman gastriccancer. CancerSci2005, 96 (1):42 – 47.Sukka-Ganesh etal.BMCCancer 2012, 12 :309 Page12of13 http://www.biomedcentral.com/1471-2407/12/309

PAGE 13

22.NasreenN,MohammedKA,AntonyVB: SilencingthereceptorEphA2 suppressesthegrowthandhaptotaxi sofmalignantmesotheliomacells. Cancer 2006, 107 (10):2425 – 2435. 23.KhodayariN,MohammedKA,GoldbergEP,NasreenN: EphrinA1inhibits malignantmesotheliomatumorgrowthvialet-7microRNA-mediated repressionoftheRASoncogene. CancerGeneTher 2011, 18 (11):806 – 816. 24.NasreenN,MohammedKA,LaiY,AntonyVB: ReceptorEphA2activation withephrinA1suppressesgrowthofmalignantmesothelioma(MM). CancerLett 2007, 258 (2):215 – 222. 25.MohammedKA,WangX,GoldbergEP,AntonyVB,NasreenN: Silencing receptorEphA2inducesapoptosi sandattenuatestumorgrowthin malignantmesothelioma. Americanjournalofcancerresearch 2011, 1 (3):419 – 431. 26.NasreenN,MohammedKA,SandersK,HardwickJ,VanHornRD,SriramPS, Ramirez-IcazaC,HageC,AntonyVB: Pleuralmesothelialcell(PMC) defensemechanismsagainstmalignancy. OncolRes 2003, 14 (3):155 – 161. 27.DuxburyMS,ItoH,ZinnerMJ,AshleySW,WhangEE: LigationofEphA2by EphrinA1-Fcinhibitspancreaticadenocarcinomacellularinvasiveness. BiochemBiophysResCommun 2004, 320 (4):1096 – 1102. 28.BrantleyDM,ChengN,ThompsonEJ,LinQ,BrekkenRA,ThorpePE,MuraokaRS, CerrettiDP,PozziA,JacksonD, etal : SolubleEphAreceptorsinhibittumor angiogenesisandprogressioninvivo. Oncogene 2002, 21 (46):7011 – 7026. 29.VersnelMA,Claesson-WelshL,HammacherA,BoutsMJ,vanderKwastTH, ErikssonA,WillemsenR,WeimaSM,HoogstedenHC,HagemeijerA, etal : HumanmalignantmesotheliomacelllinesexpressPDGFbeta-receptors whereasculturednormalmesothelialcellsexpresspredominantlyPDGF alpha-receptors. Oncogene 1991, 6 (11):2005 – 2011. 30.KinchMS,Carles-KinchK: Overexpressionandfunctionalalterationsofthe EphA2tyrosinekinaseincancer. ClinExpMetastasis 2003, 20 (1):59 – 68. 31.MorinPJ: Claudinproteinsinhumancancer:promisingnewtargetsfor diagnosisandtherapy. CancerRes 2005, 65 (21):9603 – 9606. 32.FuruseM,FuruseK,SasakiH,TsukitaS:Conversionofzonulaeoccludentes fromtighttoleakystrandtypebyintroducingclaudin-2intoMadinDarbycaninekidneyIcells. JCellBiol 2001, 153 (2):263 – 272. 33.AmashehS,MeiriN,GitterAH,SchonebergT,MankertzJ,SchulzkeJD, FrommM: Claudin-2expressioninducescation-selectivechannelsin tightjunctionsofepithelialcells. JCellSci 2002, 115 (Pt24):4969 – 4976. 34.GaoN,KaestnerKH: Cdx2regulatesendo-lysosomalfunctionand epithelialcellpolarity. GenesDev 2010, 24 (12):1295 – 1305. 35.KimHS,LeeJS,FreundJN,MinKW,KimW,JuhngSW,ParkCS: CDX-2 homeoboxgeneexpressioninhumangastriccarcinomaandprecursor lesions. JGastroenterolHepatol 2006, 21 (2):438 – 442. 36.PaikCH,HanDS,LeeSH,ChungYW,KimJP,SohnJH,HahmJS,OhYH,Park YU: ExpressionofCdx-2homeoboxgeneinintestinalmetaplasiaand gastricadenocarcinoma. KoreanJGastroenterol 2004, 44 (4):186 – 192. 37.KanekoY,NakamuraT,HayamaM,HosakaN,AkamatsuT,OtaH: Altered expressionofCDX-2,PDX-1andmucincoreproteinsin"Ulcer-associated celllineage(UACL)"inCrohn'sdisease. JMolHistol 2008, 39 (2):161 – 168. 38.LevinePH,JoutovskyA,CangiarellaJ,YeeH,SimsirA: CDX-2expressionin pulmonaryfine-needleaspirationspecimens:ausefuladjunctforthe diagnosisofmetastaticcolorectaladenocarcinoma. DiagnCytopathol 2006, 34 (3):191 – 195. 39.LuiVC,LiL,ShamMH,TamPK: CDX-1andCDX-2areexpressedinhuman colonicmucosaandaredown-regulate dinpatientswithHirschsprung's diseaseassociatedenterocolitis. BiochimBiophysActa 2001, 1537 (2):89 – 100. 40.LorentzO,CadoretA,DulucI,CapeauJ,GespachC,CherquiG,FreundJN: Downregulationofthecolontumour-suppressorhomeoboxgeneCdx-2 byoncogenicras. Oncogene 1999, 18 (1):87 – 92.doi:10.1186/1471-2407-12-309 Citethisarticleas: Sukka-Ganesh etal. : Ephrin-A1inhibitsNSCLCtumor growthviainductionof Cdx-2 atumorsuppressorgene. BMCCancer 2012 12 :309. Submit your next manuscript to BioMed Central and take full advantage of: € Convenient online submission € Thorough peer review € No space constraints or color “gure charges € Immediate publication on acceptance € Inclusion in PubMed, CAS, Scopus and Google Scholar € Research which is freely available for redistribution Submit your manuscript at www.biomedcentral.com/submit Sukka-Ganesh etal.BMCCancer 2012, 12 :309 Page13of13 http://www.biomedcentral.com/1471-2407/12/309


xml version 1.0 encoding utf-8 standalone no
mets ID sort-mets_mets OBJID sword-mets LABEL DSpace SWORD Item PROFILE METS SIP Profile xmlns http:www.loc.govMETS
xmlns:xlink http:www.w3.org1999xlink xmlns:xsi http:www.w3.org2001XMLSchema-instance
xsi:schemaLocation http:www.loc.govstandardsmetsmets.xsd
metsHdr CREATEDATE 2012-11-04T20:03:37
agent ROLE CUSTODIAN TYPE ORGANIZATION
name BioMed Central
dmdSec sword-mets-dmd-1 GROUPID sword-mets-dmd-1_group-1
mdWrap SWAP Metadata MDTYPE OTHER OTHERMDTYPE EPDCX MIMETYPE textxml
xmlData
epdcx:descriptionSet xmlns:epdcx http:purl.orgeprintepdcx2006-11-16 xmlns:MIOJAVI
http:purl.orgeprintepdcxxsd2006-11-16epdcx.xsd
epdcx:description epdcx:resourceId sword-mets-epdcx-1
epdcx:statement epdcx:propertyURI http:purl.orgdcelements1.1type epdcx:valueURI http:purl.orgeprintentityTypeScholarlyWork
http:purl.orgdcelements1.1title
epdcx:valueString Ephrin-A1 Inhibits NSCLC Tumor Growth via Induction of Cdx-2 a Tumor Suppressor Gene
http:purl.orgdctermsabstract
AbstractBackgroundTumor formation is a complex process which involves constitutive activation of oncogenes and suppression of tumor suppressor genes. Receptor EphA2 and its ligand ephrin-A1 form an important cell communication system with its functional role in cell-cell interaction and tumor growth. Loss of cell-cell adhesion is central to the cellular transformation and acquisition of metastatic potential. Claudins, the integrated tight junction (TJ) cell-cell adhesion proteins located on the apico-lateral portion of epithelial cells, functions in maintaining cell polarity. There is extensive evidence implicating Eph receptors and ephrins in malignancy, but the mechanisms how these molecular players affect TJ proteins and regulate tumor growth are not clear. In the present study we hypothesized that EphA2 signaling modulates claudin-2 gene expression via induction of cdx-2, a tumor suppressor gene in NSCLC cells.MethodsThe expression of EphA2, claudin-2 was determined in various NSCLC cell lines by using real-time quantitative polymerase chain reaction and Western blot analysis. The claudin-2 expression was also analyzed by immunofluorescence analysis. EphA2 and erk1/erk2 phosphorylation in ephrin-A1 activated cells was evaluated by Western blot analysis. The cell proliferation and tumor colony formation were determined by WST-1 and 3-D matrigel assays respectively.ResultsNSCLC cells over expressed receptor EphA2 and claudin-2. Ephrin-A1 treatment significantly down regulated the claudin-2 and EphA2 expression in NSCLC cells. The transient transfection of cells with vector containing ephrin-A1 construct (pcDNA-EFNA1) decreased the expression of claudin-2, EphA2 when compared to empty vector. In addition ephrin-A1 activation increased cdx-2 expression in A549 cells. In contrast over-expression of EphA2 with plasmid pcDNA-EphA2 up regulated claudin-2 mRNA expression and decreased cdx-2 expression. The transient transfection of cells with vector containing cdx-2 construct (pcMV-cdx-2) decreased the expression of claudin-2 in A549 cells. Moreover, silencing the expression of receptor EphA2 by siRNA significantly reduced claudin-2 expression and decreased cell proliferation and tumor formation. Furthermore, silencing cdx-2 gene expression before ephrin-A1 treatment increased claudin-2 expression along with increased cell proliferation and tumor growth in A549 cells.ConclusionsOur study suggests that EphA2 signaling up-regulates the expression of the TJ-protein claudin-2 that plays an important role in promoting cell proliferation and tumor growth in NSCLC cells. We conclude that receptor EphA2 activation by ephrin-A1 induces tumor suppressor gene cdx-2 expression which attenuates cell proliferation, tumor growth and thus may be a promising therapeutic target against NSCLC.
http:purl.orgdcelements1.1creator
Sukka-Ganesh, Bhagyalaxmi
Mohammed, Kamal A
Kaye, Frederic
Goldberg, Eugene P
Nasreen, Najmunnisa
http:purl.orgeprinttermsisExpressedAs epdcx:valueRef sword-mets-expr-1
http:purl.orgeprintentityTypeExpression
http:purl.orgdcelements1.1language epdcx:vesURI http:purl.orgdctermsRFC3066
en
http:purl.orgeprinttermsType
http:purl.orgeprinttypeJournalArticle
http:purl.orgdctermsavailable
epdcx:sesURI http:purl.orgdctermsW3CDTF 2012-07-23
http:purl.orgdcelements1.1publisher
BioMed Central Ltd
http:purl.orgeprinttermsstatus http:purl.orgeprinttermsStatus
http:purl.orgeprintstatusPeerReviewed
http:purl.orgeprinttermscopyrightHolder
Bhagyalaxmi Sukka-Ganesh et al.; licensee BioMed Central Ltd.
http:purl.orgdctermslicense
http://creativecommons.org/licenses/by/2.0
http:purl.orgdctermsaccessRights http:purl.orgeprinttermsAccessRights
http:purl.orgeprintaccessRightsOpenAccess
http:purl.orgeprinttermsbibliographicCitation
BMC Cancer. 2012 Jul 23;12(1):309
http:purl.orgdcelements1.1identifier
http:purl.orgdctermsURI http://dx.doi.org/10.1186/1471-2407-12-309
fileSec
fileGrp sword-mets-fgrp-1 USE CONTENT
file sword-mets-fgid-0 sword-mets-file-1
FLocat LOCTYPE URL xlink:href 1471-2407-12-309.xml
sword-mets-fgid-1 sword-mets-file-2 applicationpdf
1471-2407-12-309.pdf
structMap sword-mets-struct-1 structure LOGICAL
div sword-mets-div-1 DMDID Object
sword-mets-div-2 File
fptr FILEID
sword-mets-div-3


!DOCTYPE art SYSTEM 'http:www.biomedcentral.comxmlarticle.dtd'
ui 1471-2407-12-309ji 1471-2407fm dochead Research articlebibl title p Ephrin-A1 inhibits NSCLC tumor growth via induction of it Cdx-2 a tumor suppressor geneaug au id A1 snm Sukka-Ganeshfnm Bhagyalaxmiinsr iid I1 email bhagyalaxmi.sukkaganesh@medicine.ufl.eduA2 Mohammedmi AKamalI2 mkamal@medicine.ufl.eduA3 KayeFredericI4 fkaye@ufl.eduA4 GoldbergPEugeneI3 egold@mse.ufl.eduA5 ca yes NasreenNajmunnisannasreen@medicine.ufl.eduinsg ins Division of Pulmonary & Critical Care Medicine, Department of Medicine, University of Florida, Gainesville, FL, USANF/SG Veterans Health System, Malcom Randall Veterans Affairs Medical Center, University of Florida, Gainesville, FL, USABiomaterial Science and Engineering, University of Florida, Gainesville, FL, USADivision of Hematology/Oncology, University of Florida, Gainesville, FL, USAsource BMC Cancerissn 1471-2407pubdate 2012volume 12issue 1fpage 309url http://www.biomedcentral.com/1471-2407/12/309xrefbib pubidlist pubid idtype doi 10.1186/1471-2407-12-309pmpid 22824143history rec date day 28month 12year 2011acc 2862012pub 2372012cpyrt 2012collab Sukka-Ganesh et al.; licensee BioMed Central Ltd.note This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.kwdg kwd Receptor EphA2Ephrin-A1Claudin-2cdx-2NSCLCabs sec st AbstractBackgroundTumor formation is a complex process which involves constitutive activation of oncogenes and suppression of tumor suppressor genes. Receptor EphA2 and its ligand ephrin-A1 form an important cell communication system with its functional role in cell-cell interaction and tumor growth. Loss of cell-cell adhesion is central to the cellular transformation and acquisition of metastatic potential. Claudins, the integrated tight junction (TJ) cell-cell adhesion proteins located on the apico-lateral portion of epithelial cells, functions in maintaining cell polarity. There is extensive evidence implicating Eph receptors and ephrins in malignancy, but the mechanisms how these molecular players affect TJ proteins and regulate tumor growth are not clear. In the present study we hypothesized that EphA2 signaling modulates claudin-2 gene expression via induction of cdx-2, a tumor suppressor gene in NSCLC cells.MethodsThe expression of EphA2, claudin-2 was determined in various NSCLC cell lines by using real-time quantitative polymerase chain reaction and Western blot analysis. The claudin-2 expression was also analyzed by immunofluorescence analysis. EphA2 and erk1/erk2 phosphorylation in ephrin-A1 activated cells was evaluated by Western blot analysis. The cell proliferation and tumor colony formation were determined by WST-1 and 3-D matrigel assays respectively.ResultsNSCLC cells over expressed receptor EphA2 and claudin-2. Ephrin-A1 treatment significantly down regulated the claudin-2 and EphA2 expression in NSCLC cells. The transient transfection of cells with vector containing ephrin-A1 construct (pcDNA-EFNA1) decreased the expression of claudin-2, EphA2 when compared to empty vector. In addition ephrin-A1 activation increased cdx-2 expression in A549 cells. In contrast over-expression of EphA2 with plasmid pcDNA-EphA2 up regulated claudin-2 mRNA expression and decreased cdx-2 expression. The transient transfection of cells with vector containing cdx-2 construct (pcMV-cdx-2) decreased the expression of claudin-2 in A549 cells. Moreover, silencing the expression of receptor EphA2 by siRNA significantly reduced claudin-2 expression and decreased cell proliferation and tumor formation. Furthermore, silencing cdx-2 gene expression before ephrin-A1 treatment increased claudin-2 expression along with increased cell proliferation and tumor growth in A549 cells.ConclusionsOur study suggests that EphA2 signaling up-regulates the expression of the TJ-protein claudin-2 that plays an important role in promoting cell proliferation and tumor growth in NSCLC cells. We conclude that receptor EphA2 activation by ephrin-A1 induces tumor suppressor gene cdx-2 expression which attenuates cell proliferation, tumor growth and thus may be a promising therapeutic target against NSCLC.bdy BackgroundTight junctions (TJ), the most apical cell-cell adhesion, owing to their cellular location are responsible for maintaining the cellular integrity. Any deregulation of the TJ characteristics could potentially lead to cellular transformation and acquisition of tumorogenesis potential abbrgrp abbr bid B1 1. However, emerging details from many studies related with claudin and cancer have implicated claudin family members in a wide range of human cancers. The expression of claudins would decrease during tumorogenesis as tight junctions are lost during cellular transformation, but it is understood that claudins are expressed in a tissue specific manner B2 2B3 3B4 4B5 5B6 6B7 7B8 8B9 9B10 10B11 11. Down-regulation of claudins in cancer seems to be well understood, but increased expression of claudin contributing to neoplastic progression is less clear 1. Aberrant tissue expression of certain claudins may contribute to neoplasia by directly altering TJ structure and function 1. Furthermore it is also postulated that claudins may affect cell-signalling pathways B12 12.Cdx-2 is a transcriptional factor crucial to the normal proliferation and differentiation of intestinal epithelial cells B13 13, however little is known about the transcriptional program that controls genes involved in NSCLC tumor growth. In colorectal cancer reduced expression of cdx-2 has been reported in rodents and humans B14 14B15 15. In addition, cdx-2 null mice embryos failed to survive and heterozygote’s developed intestinal tumors. Furthermore the polyps developed in the colon do not express cdx-2 which indicates that loss of cdx-2 promotes tumorogenesis B16 16. Cdx-2 regulates claudin-2 functions by binding to its 5’ flanking region and affects the expression of downstream pathway genes B17 17. However, if receptor EphA2 activation with ephrin-A1 induced expression of cdx-2 plays any role in NSCLC tumor growth is not known.The Eph family of receptor tyrosine kinases plays key role in the development of cancer. The Eph receptors and ephrins were originally discovered as neuronal guidance and vasculature formation proteins during embryonic development B18 18. Eph receptors and their ligands, ephrins are often dysregulated in malignant phenotypes including NSCLC B19 19B20 20B21 21B22 22B23 23. However the precise role of these proteins in tumor growth is not well understood. Defining the role of EphA2 and ephrin-A1 in NSCLC is particularly important, as EphA2 receptor is highly expressed in NSCLC which contributes to tumor development. The aim of our study was to investigate the underlying mechanisms of tumor suppressor effect of ephrin-A1 in NSCLC. We report a novel mechanism of ephrin-A1 mediated attenuation of NSCLC tumor growth due to down regulation of claudin-2 and induction of tumor suppressor gene cdx-2. Thus providing the evidence that receptor EphA2 may be a promising therapeutic target for NSCLC.MethodsNSCLC cell cultureA549 NSCLC cell line was obtained from American Type Culture Collection (Manassas, VA) and NCI-H2126, NCI-H838, NCI-H522, NCI-H23 NSCLC cell-lines were a kind gift from Dr. Frederic Kaye, MD, Division of Haemato-logy/Oncology, University of Florida, Gainesville, Florida. The NSCLC cells were resuspended in RPMI-1640 (Gibco Laboratories, Grand Island, NY) containing 10% FBS, penicillin (100 U/ml) and streptomycin (100 μg/ml). The cells were plated in 100 mm Petri dishes (Corning Costar Corporation, MA) and incubated at 37°C in 5% COsub 2 and 95% air. The cell culture medium was changed on alternate days. When the cells were confluent they were trypsinized and seeded into 100 mm culture dishes or transwell chambers as required for different assays.Construction of vectors containing ephrin-A1 (EFN-A1) and EphA2 and transient transfection of NSCLC cellsThe gene transfer vector, pcDNA3.2/V5-DEST was used as an expression vector for the expression of ephrin-A1 (EFN-A1), and receptor EphA2, and pcDNA3.2/V5/CAT was used as a control vector (Invitrogen, Carlsbad, CA) as reported earlier B24 24. For the over expression of cdx-2 gene, pcMV6-XL5 was used as an expression vector for cdx-2 and control vector in A549 cells (Origene Technologies, Inc.; Rockville, MD). The cloned vectors were designated as pcDNA-EFN-A1, pcDNA-EphA2 and pcMV-cdx2 respectively. The control vectors were designated as Empty vector or pcMV-control. The NSCLC cells were transfected with vectors using lipofectamine-2000 reagent (Invitrogen, Carlsbad, CA). The transfected cells were used for further experiments.Transfection of NSCLC cellsThe siRNA targeting the receptor EphA2 and cdx-2 were designed using Oligoperfect design (Invitrogen, Carlsbad, CA). A549 cells were plated into 6-well plates or 35 mm plates as required for the experiments. The cells were allowed to adhere for 24 hours. The transfection of siRNA was performed using lipofectamine-2000 (Invitrogen) according to the manufacturer’s recommendation. The concentration of siRNA used was 100nM. After 4 hours of transfection, the culture medium with serum was added. The assays were carried out 48 hours post-transfection as reported earlier B25 25.Total RNA isolation and quantitative real time PCR analysisTotal RNA from cultured NSCLC cells was isolated and diluted with RNase-free water to 100 ng/mL; then, 10 μl of each sample were reverse transcribed into complementary DNA (cDNA) as reported earlier 22. In brief, after the reverse transcription reaction, 80 μl of RNase free water were added to each sample. Ten microliters of diluted cDNA product were mixed with 25 μl of SYBR Green JumpStart Taq ReadyMix, 0.5 μl of internal reference dye, and 2.0 μl of specific oligonucleotide primers to a total volume of 50 μl for quantification of the real time polymerase chain reaction (PCR) (Table tblr tid T1 1). The quantification of real-time PCR was performed by using the SYBR Green method on the Applied Biosystems 7500 Real Time PCR System with the following profile: 1 cycle at 94°C for 2 minutes; 40 cycles at 94°C for 15 seconds, at 60°C for 1 minute, and at 72°C for 1 minute for the elongation step. The real-time PCR products were confirmed by electrophoresis on 2% agarose gels. Data analysis was carried out by using the ABI sequence-detection software using relative quantification. The threshold cycle (Ct), which was defined as the cycle at which PCR amplification reaches a significant value was expressed as the mean value. The relative expression of messenger RNA (mRNA) was calculated by using the ΔCt method (where ΔCt was the value obtained by subtracting the Ct value of the housekeeping gene β-actin mRNA from the Ct value of the target mRNA). The amount of the target relative to β-actin mRNA was expressed as 2 sup -(ΔCt).table Table 1caption b Primers Used in Quantitative Reverse Transcriptase-Polymerase Chain Reaction analysistgroup align left cols 3 colspec colname c1 colnum 1 colwidth 1* c2 2 c3 thead valign top row rowsep entry Gene NameForward Primer (5'-3')Reverse Primer (5'-3')tbody Claudin-2GACCCCTAAGGCTGAGGAACAGAAGAGGAGGCCCAAGGAAGCdx-2GCCAGGTCCTCTGAGAAGTGCCTCTGAGAGCCAGGTCTGTCdx-2-siRNAGACAAGGACGUGAGCAUGUACCCUAUAGGGUACAUGCUCACGUCCUUGUC18srRNAAAACGGCTACCACATCCAAGTAACGAGGATCCATTGGAGGWestern blot analysisNSCLC cells were cultured in 60 mm size cell culture dishes (Fisher Scientific, Pittsburgh, VA) to confluence and the cells were lysed in lysis buffer with the method reported earlier B26 26. Protein was estimated by BCA method (PIERCE, Rockford, IL) and equal amount of protein (20 μg/lane) were loaded. Proteins in the sample were separated in denaturing sodium dodecyl sulphate (SDS) polyacrylamide gels (Bio-Rad), and transferred electrophoretically onto polyvinylidene difluoride membrane (Immobilon-P, Millipore, Bedford, MA). The blots were blocked with 5% Blotting Grade Blocker Non-fat Dry milk (Bio-Rad, Hercules, CA) for 1 hr on shaker at room temperature, and were overnight incubated at 4°C with respective antibodies rabbit EphA2 antibody, rabbit cdx-2 antibody (Cell signaling, Beverly, CA) and rabbit claudin-2 antibody (Invitrogen, Grand Island, NY), at 1:1000 dilutions. After washing, they were incubated with the secondary antibody (horseradish peroxidase-conjugated goat anti-rabbit IgG Ab) at a dilution of 1:1000 for 1 hr. Finally respective proteins were detected by enhanced chemiluminescence (ECL, Amersham Pharmacia Biotech). The Molecular mass (kDa) of the proteins was determined using the prestained protein marker (Bio-Rad).NSCLC cell proliferationNSCLC cell proliferation was assessed by using an assay based on cleavage of the tetrazolium salt WST-1 to formazan by cellular mitochondrial dehydrogenases (Roche, Indianapolis, IN) as reported earlier 22. With this assay, an increase in the number of viable cells results in an increase in the overall activity of the mitochondrial dehydrogenases in the sample. The augmentation in enzyme activity leads to an increase in the formazan dye formed. The formazan dye formed was quantified by using a plate reader at 450 nm. A549 cells were plated in 96-well microplate at a density of 0.5 X 105 cells per well. The cells were transfected with pcDNA-EFNA1, pcDNA-EphA2, siRNA for EphA2 or with scrambled siRNA (sc-siRNA), cdx-2-siRNA by using lipofectamine-2000 reagent, and a few wells were left untreated. The negative controls received serum-free media, and some of the wells were activated with recombinant ephrin-A1. Cells were allowed to incubate for 48 hours. Then, the WST-1 reagent was applied for 4 hours to measure cell proliferation. The cell proliferation was assessed in triplicate. The data are presented as a percentage of negative control proliferation with P values <0.05 were considered significant.Immunofluorescence microscopyClaudin-2 expression in NSCLC cells was analyzed by using confocal laser-scanning microscopy (Zeiss LSM 510, Axiovert 100 M; Zeiss, Thornwood, NY), as reported previously 22. In brief, the cells were cultured to confluence on gelatinized glass cover slips and fixed in 5% paraformaldehyde (with 50 mM phosphate buffer) in 50% Tris wash buffer (TWB). The glass cover slips were rinsed 3 times and permeabilized with 1.2% Triton X-100 for 5 minutes, rinsed 3 times, incubated with 1% bovine serum albumin (BSA) in 100% TWB for 1 hour, then stained for the expression claudin-2 using primary antibody rabbit anti-claudin-2 at 1:150 dilution and secondary antibody goat anti-rabbit immunoglobulin G conjugated with fluorescein isothiocyanate (FITC) (Zymed Laboratories, San Francisco, CA). 4, 6-diamino-2-phenylindole (DAPI) was used as a nuclear stain.NSCLC tumor growth in matrigelA 48-well culture plate was coated with 200 μl of matrigel per well and then allowed to polymerize for about 1–2 hours at 37°C. NSCLC cells at a density of ~1 x 103 cells per well were plated in 0.3 ml of 2% FBS containing RPMI-1640 as reported earlier 24. The cells were activated with ephrin-A1 or transfected with plasmid pcDNA-EphA2 or pcDNA-EFNA1 or siRNA for EphA2 or cdx-2 or empty vector by using lipofectamine-2000 and few wells were left untreated as controls, media were changed every three days. The number of colonies formed was recorded after 7 days of incubation. 4–6 randomly chosen fields (x10) from the sample were photographed.Statistical analysisThe Sigma Stat 3.5 statistical software program was used to calculate statistical significance. Kruskal-Wallis One Way Analysis of Variance (ANOVA) was used to compare the experimental groups from the control groups. The post hoc test Holm-Sidak method was applied for pairwise comparisons. The differences at p < 0.05 were considered statistically significant.ResultsNSCLC cells express receptor EphA2 and Caludin-2Proliferating NSCLC cells (A549, H2126, H838, H522, and H23) expressed receptor EphA2, and claudin-2 and the expression of ephrinA1 was variable (Figure figr fid F1 1A). Receptor EphA2 was over expressed in all the five NSCLC cell lines tested. However highest expression of claudin-2 was noticed in A549, H838 and H23 cell lines when compared to H2126 and H522 cell lines. Whereas, the expression of ephrin-A1 was dysregulated. A549, H2126 and H838 cells showed decreased expression of ephrin-A1 when compared to H522 and H23 (Figure 1A). In addition NSCLC cells were transiently transfected with vector containing ephrin-A1 construct (pcDNA-EFNA1) or empty vector and the expression of receptor EphA2 was determined in all NSCLC cell lines selected. Ephrin-A1 activation down regulated the expression of EphA2 when compared to empty vector transfected NSCLC cells (Figure 1B). In addition, A549 cells were also activated with recombinant ephrin-A1 for varying time (5, 10, 30, 60 and 120 minutes) and the activation/phosphorylation of receptor EphA2 was evaluated. Ephrin-A1 activation induced phosphorylation of receptor EphA2 up to 60 minutes in A549 cells. However, at 120 minutes the phosphorylation was down regulated. The total receptor expression was comparatively decreased when compared to control at 120 minutes (Figure 1C). The EphA2 signaling pathway activation was also determined by evaluating Erk1/Erk2 activation in NSCLC. EphrinA1 activation inhibited the phosphorylation of Erk1/Erk2 MAPK in NSCLC when compared to control cells (Figure 1C).fig Figure 1NSCLC cells express receptor EphA2, Ephrin-A1 and Caludin-2text
NSCLC cells express receptor EphA2, Ephrin-A1 and Caludin-2. Plate A: NSCLC cell lines (A549, H2126, H838, H522, H23) express receptor EphA2, ephrin-A1, and claudin-2. Expression of EphA2, ephrin-A1, and claudin-2 was analyzed by Western blot analysis. Plate B: Western blot analysis of EphA2 protein expression the β-actin was probed to demonstrate equal sample loading. NSCLC cell lines were either transfected with pcDNA-EFNA1 (pcDNA-EFNA1 is vector containing ephrin-A1 construct) or empty vector and receptor EphA2 expression was analyzed. Plate C: A549 cells were activated for 5 minutes to 120 minutes with ephrin-A1. Western blot analysis of phosphorylated EphA2 and Erk1/Erk2 was performed, the β-actin was probed to demonstrate equal sample loading. Data presented is the representative of three separate experiments.
graphic file 1471-2407-12-309-1 Ephrin-A1 down regulated claudin-2 expression in NSCLC cellsEphrin-A1 activation of receptor EphA2 down regulated the expression of claudin-2 in NSCLC cells. To identify whether decrease in claudin-2 expression is directly due to decrease in EphA2 receptor expression, A549 cells were transfected with pcDNA-EFNA1 or empty vector or left untransfected. In comparison to empty vector the transient transfection of A549 cells with pcDNA-EFNA1 resulted in significantly decreased claudin-2 expression (Figure F2 2A). This suggested that activation of receptor EphA2 with the ligand ephrin-A1 induced rapid reduction of claudin-2 expression that plays a major role in maintaining cellular integrity. In addition the expression of claudin-2 and receptor EphA2 was also evaluated by Western blot analysis. The decreased expression of receptor EphA2 further confirmed that treatment of A549 cell with ephrin-A1 down regulates the expression of receptor EphA2 and claudin-2 (Figure 2C, -2D). These data suggests that ephrin-A1 treatment inhibits the expression of oncogenic protein EphA2 and claudin-2 in NSCLC cells.Figure 2Ephrin-A1 activation decreases claudin-2 expression in NSCLC cells
Ephrin-A1 activation decreases claudin-2 expression in NSCLC cells. Relative expression of claudin-2 mRNA normalized to endogenous control. Plate A: Cells were either activated with ephrin-A1 or transfected with pcDNA-EFNA1 (vector containing Ephrin-A1 construct) or empty vector. Plate B: Cells either silenced with EphA2 siRNA or transfected with pcDNA-EphA2 (pcDNA-EphA2 is vector containing EphA2 construct) Plate C: Claudin-2 protein expression by Western blot analysis, β-actin was probed to demonstrate equal sample loading. Plate D: Western blot analysis of EphA2 protein expression the β-actin was probed to demonstrate equal sample loading. Data presented was the mean ± SEM of three independent experiments, *p < 0.001 compared to control; #p < 0.001 compared to empty vector; $p < 0.001 compared to sc-siRNA. Plate E: Claudin-2 expression in NSCLC as observed by immunofluorescence analysis. The photomicrographs show immunofluorescence staining of claudin-2 in NSCLC. Blue colour represents the nuclear stain DAPI (4,6-diamino-2-phenylindole), Red colour represents Rhodamin phalloidin for F-actin filament stain, and green colour represents Alexa Flour 488 labelled for claudin-2 expression. The data presented is a single representative of three similar observations Scale Bar = 40 μm.
1471-2407-12-309-2 In order to determine if over expression of the receptor EphA2 in A549 cells promotes claudin-2 expression, A549 cells were transiently transfected with pcDNA-EphA2 and the expression of claudin-2 was evaluated. A significant increase in the expression of claudin-2 was noted when compared to empty vector transfected cells (Figure 2B and C). To investigate whether this increase in claudin-2 expression was directly due to the increases in EphA2 receptor expression, NSCLC cells were transfected with EphA2-siRNA. In A549 cells, silencing the EphA2 receptor with siRNA significantly reduced the claudin-2 expression when compared to sc-siRNA transfected cells (Figure 2B and C). These results suggest that increased EphA2 expression modulated claudin-2 expression, which may play an important role in tumor growth in NSCLC.Claudin-2 expression decreased in Ephrin-A1 treated A549 cellsIn order to evaluate the cellular distribution of caludin-2, and morphological changes in activated cells, A549 cells were activated with ephrin-A1 and analyzed by immunofluorescence microscopy. Fluorescence immuno-staining analysis revealed that A549 cells showed punctuated expression of claudin-2 whereas, ephrin-A1 activation decreased claudin-2 expression (Figure 2E). In cells transfected with pcDNA-EFNA1 a marked decrease in claudin-2 expression was noticed. In addition, ephrin-A1 activated cells showed distorted cytoskeleton, and rounded morphology. However, in cells transfected with pcDNA-EphA2 a dense and higher expression of claudin-2 was noticed when compared to control and empty vector transfected cells. These data suggests that over expression of receptor EphA2 promotes the expression of claudin-2 in NSCLC cells. Ephrin-A1 activation or transfection of cells with plasmid containing the ephrin-A1 construct inhibits the expression of claudin-2 confirming its anti-tumor effects on NSCLC cells.Ephrin-A1 treatment increased cdx-2 expression in NSCLC cellsCdx-2 a tumor suppressor gene, found to be tissue specific in its expression. Ephrin-A1 activation induced more than five folds increases in cdx-2 mRNA expression in NSCLC cells (Figure F3 3A). In addition this expression was also confirmed in the cells transfected with plasmid containing ephrin-A1 construct pcDNA-EFNA1. The transfection with pcDNA-EFNA1 also showed a significant increase of cdx-2 expression in A549 cells when compared to empty vector (Figure 3A). Furthermore, the cells were also transfected with plasmid pcDNA-EphA2 or empty vector and the expression of cdx-2 was evaluated. A remarkable reduction in the expression of cdx-2 was noticed in cells transfected with pcDNA-EphA2. However, knockdown of EphA2 gene with siRNA-EphA2 significantly upregulated the expression of cdx-2 in A549 cells when compared to sc-siRNA transfected cells (Figure 3B). These results suggest that unregulated/lost expression of cdx-2, a tumor suppressor gene may result to increased EphA2 expression in A549 cells. Furthermore cdx-2 expression with activation of ephrin-A1 or transfection with pcDNA-EFNA1 or PcDNA-EphA2 in A549 cells was also confirmed with Western blot analysis (Figure 3C). These data suggests that activation of receptor with ephrin-A1 up regulates the expression of tumor suppressor gene cdx-2. Silencing the expression of EphA2 receptor also increases the expression of cdx-2 which indicates that knockdown of EphA2 either by ephrin-A1 activation or by silencing interference RNA could be potential in inhibiting the oncogenic effect of receptor EphA2 and tumor growth.Figure 3Transfection of pcDNA-EFNA1 increased whereas transfection of pcDNA-EphA2 attenuated cdx-2 expression in NSCLC cells
Transfection of pcDNA-EFNA1 increased whereas transfection of pcDNA-EphA2 attenuatedcdx-2 expression in NSCLC cells. Plate A: cells were either activated with ephrin-A1 or transfected with pcDNA-EFNA1 (pcDNA-EFNA1 is vector containing ephrin-A1 construct). Cdx-2 mRNA expression was analyzed by quantitative real time PCR. Plate B: Cells either silenced with EphA2 siRNA or transfected with pcDNA-EphA2 (pcDNA-EphA2 is vector containing EphA2 construct) Plate C: Western blot analysis of claudin-2 protein expression, the β-actin was probed to demonstrate equal sample loading. The Western blot represents three similar observations. Data presented is the mean ± SEM of three independent experiments. *p < 0.001 compared to control, #p < 0.001 compared to Empty vector, $p < 0.001 compared to sc-siRNA.
1471-2407-12-309-3 Silencing cdx-2 expression blocked ephrin-A1 mediated inhibition of claudin-2 expression in NSCLC cellsActivation of A549 cells with ephrin-A1 or transfection with pcDNA-EFNA1 resulted in significant decrease of claudin-2 expression. In addition over expression of cdx2 by using pcMV-cdx-2, a plasmid with cdx2 construct resulted in significant decrease of claudin-2 expression (Figure F4 4A and B). Moreover, when A549 cells were transfected with cdx-2- siRNA and activated with ephrinA1 the expression of claudin-2 expression was significantly upregulated (Figure 4A). Furthermore Immunofluorescence staining for the expression of claudin-2 also confirmed that silencing cdx-2 gene and activation with ephrin-A1 resulted in enhanced expression of claudin-2 (Figure 4C). Our results suggest that EphA2 signaling promoted claudin-2 expression in A549 cells and downregulated the expression of tumor suppressor gene cdx-2. These data also suggests that ephrin-A1 mediated down regulation of claudin-2 expression in A549 cells is dependent on cdx-2.Figure 4Silencing cdx-2 expression restores Ephrin-A1 mediated inhibition of Claudin-2 expression in NSCLC cells
Silencing cdx-2 expression restores Ephrin-A1 mediated inhibition of Claudin-2 expression in NSCLC cells. Plate A: Relative mRNA expression of claudin-2 normalized to endogenous control. (pcDNA-EFNA1 is vector containing ephrin-A1 construct). Plate B: Claudin-2 expression was analyzed by Western blot, data represents mean ± SEM of three independent experiments. *p < 0.001 compared to control, # p < 0.001 compared to Empty vector, $p < 0.001 compared to cdx2-siRNA alone. **p < 0.001 compared to control. Plate C: Immunofluorescence analysis of claudin-2 expression in NSCLC. Blue colour represents the nuclear stain DAPI (4, 6-diamino-2-phenylindole), Red colour represents Rhodamin phalloidin for F-actin filaments, and green colour represents Alexa Flour-488 labelled for claudin-2 expression. The data presented is a single representative of three similar observations. Scale Bar = 40 μm.
1471-2407-12-309-4 Silencing cdx-2 expression blocked Ephrin-A1 mediated inhibition of cell proliferation in NSCLC cellsEphrin-A1 activation and transfection with ephrin-A1 vector pcDNA-EFNA1 resulted in suppression of proliferation in A549 cells when compared to control or empty vector transfected cell (Figure F5 5A). Silencing of EphA2 receptor by EphA2-siRNA also showed decreased cell proliferation as compared to sc-siRNA or control (Figure 5B). In addition, the cells were transfected with pcDNA-EphA2 that showed a significant increase in proliferation when compared to empty vector or control cells. However, when cells were transfected with cdx2-siRNA and subsequently activated with ephrin-A1 the proliferation of cells was restored and showed close to control cell proliferation rate. Moreover, knockdown of cdx-2 with siRNA and transient transfection with pcDNA-EFNA1, resulted in significant increase in cell proliferation compared to pcDNA-EFNA1 transfected cells (Figure 5A, -5C). The transfection of cdx-2-siRNA alone showed slight increase in the proliferation rate but was not significant when compared with control. These results suggest that ephrin-A1 induced increased expression of cdx-2 suppressed proliferation of NSCLC. The transfection of NSCLC with cdx2-siRNA followed by ephrin-A1 activation blunted ephrin-A1 mediated inhibition of A549 cell proliferation.Figure 5Ephrin-A1 activation attenuates NSCLC cell proliferation
Ephrin-A1 activation attenuates NSCLC cell proliferation. Proliferation of NSCLC cells as measured by WST-1 assay. Plate A: Proliferation in cells either activated with ephrin-A1 or transfected with pcDNA-EFNA1 (pcDNA-EFNA1 is vector containing ephrin-A1 construct). Plate B: Proliferation in cells either silenced with EphA2 siRNA or transfected with pcDNA-EphA2 (pcDNA-EphA2 is vector containing EphA2 construct). Plate C: Proliferation in cdx-2 siRNA transfected cells that were treated with ephrin-A1 ligand or pcDNA-EFNA1 transfected. Data presented is the mean ± SEM of three independent experiments. *p < 0.05 compared to control; $ p < 0.05 compared to ephrin-A1 orpcDNA-EFNA1 alone, # p < 0.001 compared to empty vector or sc-siRNA + ephrinA1, NS is not significant.
1471-2407-12-309-5 Ephrin-A1 activation inhibited tumor growth and silencing cdx-2 expression blunted Ephrin-A1 mediated suppression of tumor growth in NSCLC cells in vitroA549 cells were activated with eprhin-A1 or transfected with a plasmid pcDNA-EFNA1, or empty vector, or left untransfected as control. The transfected or control cells were plated on 3-D matrigels to determine the tumor growth in vitro. The tumor growth was studied for 2 weeks. Microscopic examination revealed that A549 cells activated with ephrin-A1 and those transfected with pcDNA-EFNA1 showed suppressed tumor growth in matrigel as compared to empty vector transfected or control cells (Figure F6 6). In contrast NSCLC cells transfected with pcDNA-EphA2 showed aggressive tumor growth which was significantly larger in size as compared to tumors grown after silencing the EphA2 with siRNA. In addition, when the A549 cells were transfected with cdx-2 siRNA and subsequently treated with the ephrin-A1 or transfected with pcDNA-EFNA1 we noticed significantly increased tumor formation as compared to cells either activated with ephrin-A1 alone and pcDNA-EFNA1 transfected cells (Figure 6). Taken together these results indicate that when A549 cells transfected with pcDNA-EphA2 to over expressed receptor EphA2 increased claudin-2 expression was observed which promoted the A549 cell proliferation. Activation of NSCLC cells with ephrin-A1 leads to tumor growth inhibition via cdx-2 expression.Figure 6Ephrin-A1 ligand activation decreases tumor growth in NSCLC
Ephrin-A1 ligand activation decreases tumor growth in NSCLC. Equal number of A549 cells was seeded in matrigels after various treatments as described and after 7 days of culture tumor growth was recorded by a SPOT digital camera attached to Nikon microscope. The data presented are a single representative of three similar but independent experiments. Magnification = 5 μM.
1471-2407-12-309-6 DiscussionThe major finding of our present study is that receptor EphA2 is over expressed in NSCLC cell lines which promotes tumor growth. In addition we also found that EphA2 promotes tight junction protein claudin-2 expression in A549 cells. However, the expression of ephrin-A1 was found to dysregulated and A549 cells showed minimal levels. There is accumulating evidence that activation of receptor EphA2 with its ligand ephrin-A1 attenuates tumorogenic potential of malignant cells 24B27 27B28 28. The molecular mechanisms responsible for tumor suppressive effects of ephrin-A1 are still elusive. In the present study, we report that proliferating NSCLC cells showed enhanced expression of EphA2, and claudin-2. The activation of receptor EphA2 with ephrin-A1 inhibited the expression of EphA2 and claudin-2. To further examine the effect of ephrin-A1 on NSCLC we transfected the cells with vector expressing ephrinA1 construct, pcDNA-EFNA1. We found that forced expression of ephrin-A1 down regulated the receptor EphA2 and inhibited cell proliferation and tumor growth in 3D matrigel. In addition the activation of receptor EphA2 with ephrin-A1 induced phosphorylation of EphA2 and inhibited the downstream singling MAP kinase pathway Erk1/Erk2. Furthermore, the activation of EphA2 receptor with ephrinA1 induced cdx-2, a tumor suppressor gene in A549 cells. These data suggests that ephrin-A1 activation/transfection could effectively bind and activate endogenous EphA2 in NSCLC and led to internalization and degradation of EphA2. In order to understand if receptor EphA2 signaling modulates TJ protein claudin-2 we transfected the A549 cells with EphA2 expressing vector, pcDNA-EphA2. The expression of claudin-2 was higher in A549 cells transfected with pcDNA-EphA2 as compared to empty vector transfected cells or control cells. In addition, over expression of receptor EphA2 significantly enhanced tumor growth. Whereas silencing the expression of receptor EphA2 by siRNA, decreased the expression of claudin-2 and interestingly a significant up-regulation of cdx-2 was noticed in NSCLC cells as compared to sc-siRNA transfected A549 cells. However, silencing cdx-2 gene with siRNA and subsequent activation with ephrin-A1 or transfection with pcDNA-EFNA1 failed to inhibit tumor growth in A549 cells. Collectively these data suggests that an ephrin-A1 mediated anti-oncongenic effect is due to downregulation of EphA2, claudin-2 expression and induction of cdx-2 gene in NSCLC.EphA2 is an oncoprotein which promotes cell survival, abnormal cell growth and invasion in a number of malignancies, including NSCLC 182021B29 29. In malignant cells such as A549, due to dysregulated cell division and abnormal growth the cell-cell contacts are loose which hinders the interaction between neighbouring cells. The loss of contact among the adjacent cells results in accumulation of high levels of intracellular EphA2 and claudin-2 an integral component of tight junction. Tight junctions are the apical cell-cell adhesions that regulate paracellular permeability and are critical for cell polarity. Alteration in tight junction protein claudin-2, can cause the defects in normal regulation of growth factor receptor activation due to a differential distribution of the receptor and their respective ligands, which can be observed with respect to receptor EphA2 and its ligand Ephrin-A1 B30 30. In this study, we attempted to understand the underlying mechanisms by which EphA2 over expression leads to enhanced or irregular claudin-2 expression via cdx-2 modulation and promote tumor growth in NSCLC cells. Several studies reported that receptor EphA2 is over expressed in a number of malignancies 192030. Previously we have reported that EphA2 is over expressed in malignant mesothelioma cells (MMC) and posttranslational silencing of EphA2 significantly suppresses the proliferation and haptotactic migration of MMC 2224. In addition, EphA2 receptor activation in MMC by its ligand ephrin-A1 inhibited the RAS MAP kinase signaling pathways 2324. Our study in A549 cells revealed that receptor EphA2 signaling up regulates the TJ protein claudin-2. In turn, the over expression of claudin-2 along with EphA2 promotes A549 cell proliferation and tumor growth. It was reported that EGF signaling induced claudin-2 expression which promoted colonization of mammary tumor cells B31 31. The up regulated levels of claudin-2 caused leaky cellular barriers in MDCK1 cells B32 32. The junctional claudin-2 forms the selective cation channels that are sufficient to transform the functional “tight” junction into a “leaky” one B33 33. The leaky barriers may contribute to increase uptake of nutrients and growth factor which promote exaggerated tumor colonization. In the present study we noted exaggerated tumor colonies formation when EphA2 was over expressed in A549 cells. It is plausible that over expression of receptor EphA2 promotes claudin-2 which in turn enhances tumor colonization of A549 cells.We demonstrate that activation of receptor EphA2 with ephrin-A1 induced cdx-2 expression and inhibited tumor formation. The over expression of cdx-2 by vector pcMV-cdx-2 resulted in downregulation of claudin-2 and attenuation of cell proliferation and tumor growth on matrigels. In addition silencing cdx-2 expression using siRNA and activation with eprhin-A1 resulted in up regulation of claudin-2 in A549 cells. Cdx-2, a tumor suppressor gene is homeobox transcriptional factor that is known to control apical-basolateral polarity in mouse enterocytes and human colonic epithelial cells B34 34. Cdx-2 regulates epithelial cell polarity and morphogenesis through control of apical protein transport. At the transcriptional level, transcriptional factors such as cdx-2 can bind to the promoter regions of various claudin genes and affect their expression 110. In addition, certain characteristics of claudin-2 and cdx-2 show similarity that both are critical for epithelial cell polarity 134. Increased cdx-2 expression was used as a marker for progression in gastric carcinogenesis B35 35, while some of the gastric cancers studies showed aberrant expression of cdx-2 in intestinal metaplasia which is a subset of gastric adenocarcinoma B36 36. The down-regulation of cdx-2 mechanism was related to the induction of ulcer-associated cell lineage (UACL) B37 37. In addition loss of cdx-2 immunoreactivity was implicated as diagnostic feature in poorly differentiated colorectal adenocarcinoma B38 38. Whereas, the reduced expression of cdx-1 and cdx-2 genes were associated with the development of enterocolitis in intestinal mucosa B39 39. Furthermore, activation of Ras oncogene was associated with down regulation of the cdx-2 in colon cancer cells B40 40. All these studies confirm that expression of cdx-2 gene though disease specific and tissue specific, the expression of cdx2 was directly associated with tumor growth. The plausible mechanisms for the reduced cdx-2 expression in carcinogenesis, could be that homeodomain proteins signifies roles in directing the cells to specified cell-phenotype during organogenesis in early stages of development. However, a reduction of cdx-2 gene expression in the late stages such as in invasive tumors may be attributed to over expression oncogenic proteins which may lead to deviate from normal epithelial phenotype to the neoplastic phenotype 15.It has been shown that, caudal-related homeobox gene cdx-2 is positively involved in the regulation of the human claudin-2 promoter activity 17. The EphA2 signaling caused reduced expression of transcription factor cdx-2 that hinder its binding to claudin promoter and thus cause irregular expression of claudin-2 which is reported to be increased in NSCLC cells in the present study. It is conceivable that due to the disrupted TJ or claudin-2 there is a disruption in epithelial cell polarity leading to leakage of large solutes passing across epithelial barriers to the other cells. Thus, the TJ disruption in premalignant neoplastic tissue can increase the proba-bility that it will develop into a complete carcinoma because of the continuous stimulation of cell division followed by disrupted natural barriers between growth factors and their receptors. The novel finding of our present study is that receptor EphA2 mediated the enhanced induction of functionally altered claudin-2 via down-regulation of tumor suppressor gene expression cdx-2 in NSCLC cells. It is possible that activation of receptor EphA2 with ephrin-A1 downregulated claudin-2 and induced the expression of cdx-2 suggesting oncogenic protein EphA2 play a major role in regulating cdx-2 expression in NSCLC. Whereas, the forced expression of ephrin-A1 induced tumor suppressive signals via downregulation and degradation EphA2 and inhibited the oncogenic singling pathway in NSCLC. However, this needs to be further investigated.ConclusionsIn conclusion, we present the first evidence that EphA2 signaling promotes the expression of claudin-2 in NSCLC cells. Activation of NSCLC with ligand ephrin-A1 suppressed the caludin-2 expression via the induction of transcriptional factor cdx-2. These studies suggest that targeting EphA2 by using ephrin-A1 may be a promising approach for the therapeutic inventions against NSCLC.Competing interestsThe authors have no competing interests.Authors’ contributionsBSG, carried out the experiments. NN and BSG drafted the manuscript. NN and KAM critically analyzed, edited, reviewed and finalized the data. FK, for providing cell lines and editorial review, EPG provided the valuable comments and editorial review of the manuscript. All authors’ read and approved the final manuscript.bm ack AcknowledgementsThis work was supported by NIR grant # 09KN-09; RC1 (#09KW-08) from James & Esther King, Florida Department of Health (Nasreen, N); VA Merit Review (Mohammed, KA).refgrp Claudin family of proteins and cancer: an overviewSinghABSharmaADhawanPJ Oncol20102010541957pmcid 291049420671913Regulation of tumor angiogenesis by integrin-linked kinase (ILK)TanCCruet-HennequartSTroussardAFazliLCostelloPSuttonKWheelerJGleaveMSangheraJDedharSCancer Cell20045179lpage 9010.1016/S1535-6108(03)00281-2link fulltext 14749128Loss of the tight junction protein claudin-7 correlates with histological grade in both ductal carcinoma in situ and invasive ductal carcinoma of the breastKominskySLArganiPKorzDEvronERamanVGarrettEReinASauterGKallioniemiOPSukumarSOncogene200322132021203310.1038/sj.onc.120619912673207Reduced expression of claudin-7 correlates with invasion and metastasis in squamous cell carcinoma of the esophagusUsamiYChibaHNakayamaFUedaJMatsudaYSawadaNKomoriTItoAYokozakiHHum Pathol200637556957710.1016/j.humpath.2005.12.01816647955Reduced expression of Claudin-7 in fine needle aspirates from breast carcinomas correlate with grading and metastatic diseaseSauerTPedersenMKEbeltoftKNaessOCytopathology200516419319810.1111/j.1365-2303.2005.00257.x16048505Claudin-4 expression decreases invasiveness and metastatic potential of pancreatic cancerMichlPBarthCBuchholzMLerchMMRolkeMHolzmannKHMenkeAFenstererHGiehlKLohrMetal Cancer Res200363196265627114559813Tight junction proteins claudin-3 and claudin-4 are frequently overexpressed in ovarian cancer but not in ovarian cystadenomasRangelLBAgarwalRD'SouzaTPizerESAloPLLancasterWDGregoireLSchwartzDRChoKRMorinPJClin Cancer Res2003972567257512855632Expression of claudins 1, 2, 3, 4, 5 and 7 in various types of tumoursSoiniYHistopathology200546555156010.1111/j.1365-2559.2005.02127.x15842637Increased expressions of claudin-1 and claudin-7 during the progression of cervical neoplasiaLeeJWLeeSJSeoJSongSYAhnGParkCSLeeJHKimBGBaeDSGynecol Oncol2005971535910.1016/j.ygyno.2004.11.05815790437Claudin-3 and claudin-4 expression in ovarian epithelial cells enhances invasion and is associated with increased matrix metalloproteinase-2 activityAgarwalRD'SouzaTMorinPJCancer Res200565167378738510.1158/0008-5472.CAN-05-103616103090Claudin-1 is a metastasis suppressor and correlates with clinical outcome in lung adenocarcinomaChaoYCPanSHYangSCYuSLCheTFLinCWTsaiMSChangGCWuCHWuYYAm J Respir Crit Care Med2009179212313318787218Direct binding of three tight junction-associated MAGUKs, ZO-1, ZO-2, and ZO-3, with the COOH termini of claudinsItohMFuruseMMoritaKKubotaKSaitouMTsukitaSJ Cell Biol199914761351136310.1083/jcb.147.6.1351216808710601346Changing intestinal connective tissue interactions alters homeobox gene expression in epithelial cellsDulucILorentzOFritschCLeberquierCKedingerMFreundJNJ Cell Sci1997110Pt 11131713249202392Expression of the Cdx1 and Cdx2 homeotic genes leads to reduced malignancy in colon cancer-derived cellsMalloGVSoubeyranPLissitzkyJCAndreFFarnarierCMarvaldiJDagornJCIovannaJLJ Biol Chem199827322140301403610.1074/jbc.273.22.140309593754Cdx-2 homeodomain protein expression in human and rat colorectal adenoma and carcinomaEeHCErlerTBhathalPSYoungGPJamesRJAm J Pathol1995147358659218709747677172Molecular cloning, sequencing and expression of the mRNA encoding human Cdx1 and Cdx2 homeobox. Down-regulation of Cdx1 and Cdx2 mRNA expression during colorectal carcinogenesisMalloGVRechrecheHFrigerioJMRochaDZweibaumALacasaMJordanBRDusettiNJDagornJCIovannaJLInt J Cancer1997741354410.1002/(SICI)1097-0215(19970220)74:1<35::AID-IJC7>3.0.CO;2-19036867Cloning of the human claudin-2 5'-flanking region revealed a TATA-less promoter with conserved binding sites in mouse and human for caudal-related homeodomain proteins and hepatocyte nuclear factor-1alphaSakaguchiTGuXGoldenHMSuhERhoadsDBReineckerHCJ Biol Chem200227724213612137010.1074/jbc.M11026120011934881Predictive value of the EphA2 receptor tyrosine kinase in lung cancer recurrence and survivalKinchMSMooreMBHarpoleDHsuf JrClin Cancer Res20039261361812576426ECK, a human EPH-related gene, maps to 1p36.1, a common region of alteration in human cancersSulmanEPTangXXAllenCBiegelJAPleasureDEBrodeurGMIkegakiNGenomics199740237137410.1006/geno.1996.45699119409Overexpression of the EphA2 tyrosine kinase in prostate cancerWalker-DanielsJCoffmanKAzimiMRhimJSBostwickDGSnyderPKernsBJWatersDJKinchMSProstate199941427528010.1002/(SICI)1097-0045(19991201)41:4<275::AID-PROS8>3.0.CO;2-T10544301EPHA2/EFNA1 expression in human gastric cancerNakamuraRKataokaHSatoNKanamoriMIharaMIgarashiHRavshanovSWangYJLiZYShimamuraTCancer Sci2005961424710.1111/j.1349-7006.2005.00007.x15649254Silencing the receptor EphA2 suppresses the growth and haptotaxis of malignant mesothelioma cellsNasreenNMohammedKAAntonyVBCancer2006107102425243510.1002/cncr.2225417041885EphrinA1 inhibits malignant mesothelioma tumor growth via let-7 microRNA-mediated repression of the RAS oncogeneKhodayariNMohammedKAGoldbergEPNasreenNCancer Gene Ther2011181180681610.1038/cgt.2011.5021869823Receptor EphA2 activation with ephrinA1 suppresses growth of malignant mesothelioma (MM)NasreenNMohammedKALaiYAntonyVBCancer Lett2007258221522210.1016/j.canlet.2007.09.00517949899Silencing receptor EphA2 induces apoptosis and attenuates tumor growth in malignant mesotheliomaMohammedKAWangXGoldbergEPAntonyVBNasreenNAmerican journal of cancer research201113419431318006221968554Pleural mesothelial cell (PMC) defense mechanisms against malignancyNasreenNMohammedKASandersKHardwickJVan HornRDSriramPSRamirez-IcazaCHageCAntonyVBOncol Res200314315516114760864Ligation of EphA2 by Ephrin A1-Fc inhibits pancreatic adenocarcinoma cellular invasivenessDuxburyMSItoHZinnerMJAshleySWWhangEEBiochem Biophys Res Commun200432041096110210.1016/j.bbrc.2004.06.05415249202Soluble Eph A receptors inhibit tumor angiogenesis and progression in vivoBrantleyDMChengNThompsonEJLinQBrekkenRAThorpePEMuraokaRSCerrettiDPPozziAJacksonDOncogene200221467011702610.1038/sj.onc.120567912370823Human malignant mesothelioma cell lines express PDGF beta-receptors whereas cultured normal mesothelial cells express predominantly PDGF alpha-receptorsVersnelMAClaesson-WelshLHammacherABoutsMJvan der KwastTHErikssonAWillemsenRWeimaSMHoogstedenHCHagemeijerAOncogene1991611200520111658707Overexpression and functional alterations of the EphA2 tyrosine kinase in cancerKinchMSCarles-KinchKClin Exp Metastasis2003201596810.1023/A:102254662049512650608Claudin proteins in human cancer: promising new targets for diagnosis and therapyMorinPJCancer Res200565219603960610.1158/0008-5472.CAN-05-278216266975Conversion of zonulae occludentes from tight to leaky strand type by introducing claudin-2 into Madin-Darby canine kidney I cellsFuruseMFuruseKSasakiHTsukitaSJ Cell Biol2001153226327210.1083/jcb.153.2.263216945611309408Claudin-2 expression induces cation-selective channels in tight junctions of epithelial cellsAmashehSMeiriNGitterAHSchonebergTMankertzJSchulzkeJDFrommMJ Cell Sci2002115Pt 244969497612432083Cdx2 regulates endo-lysosomal function and epithelial cell polarityGaoNKaestnerKHGenes Dev201024121295130510.1101/gad.1921510288566420551175CDX-2 homeobox gene expression in human gastric carcinoma and precursor lesionsKimHSLeeJSFreundJNMinKWKimWJuhngSWParkCSJ Gastroenterol Hepatol200621243844210.1111/j.1440-1746.2005.03933.x16509871Expression of Cdx-2 homeobox gene in intestinal metaplasia and gastric adenocarcinomaPaikCHHanDSLeeSHChungYWKimJPSohnJHHahmJSOhYHParkYUKorean J Gastroenterol200444418619215505429Altered expression of CDX-2, PDX-1 and mucin core proteins in "Ulcer-associated cell lineage (UACL)" in Crohn's diseaseKanekoYNakamuraTHayamaMHosakaNAkamatsuTOtaHJ Mol Histol200839216116810.1007/s10735-007-9149-717957487CDX-2 expression in pulmonary fine-needle aspiration specimens: a useful adjunct for the diagnosis of metastatic colorectal adenocarcinomaLevinePHJoutovskyACangiarellaJYeeHSimsirADiagn Cytopathol200634319119510.1002/dc.2040316470859CDX-1 and CDX-2 are expressed in human colonic mucosa and are down-regulated in patients with Hirschsprung's disease associated enterocolitisLuiVCLiLShamMHTamPKBiochim Biophys Acta2001153728910010.1016/S0925-4439(01)00056-411566252Downregulation of the colon tumour-suppressor homeobox gene Cdx-2 by oncogenic rasLorentzOCadoretADulucICapeauJGespachCCherquiGFreundJNOncogene1999181879210.1038/sj.onc.12022809926923Pre-publication historyThe pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2407/12/309/prepub


xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E3FG1VXRH_QNGEX7 INGEST_TIME 2013-01-22T13:39:25Z PACKAGE AA00013230_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES