Regulation of in vitro human T cell development through interleukin-7 deprivation and anti-CD3 stimulation

MISSING IMAGE

Material Information

Title:
Regulation of in vitro human T cell development through interleukin-7 deprivation and anti-CD3 stimulation
Physical Description:
Mixed Material
Language:
English
Creator:
Patel, Ekta S.
Okada, Starlyn
Hachey, Kevin
Yang, Li-jun
Durum, Scott K.
Moreb, Jan S
Chang, Lung-Ji
Publisher:
BioMed Central (BMC Immunlogy)

Notes

Abstract:
Background: The role of IL-7 and pre-TCR signaling during T cell development has been well characterized in murine but not in human system. We and others have reported that human BM hematopoietic progenitor cells (HPCs) display poor proliferation, inefficient double negative (DN) to double positive (DP) transition and no functional maturation in the in vitro OP9-Delta-like 1 (DL1) culture system. Results: In this study, we investigated the importance of optimal IL-7 and pre-TCR signaling during adult human T cell development. Using a modified OP9-DL1 culture ectopically expressing IL-7 and Fms-like tyrosine kinase 3 ligand (Flt3L), we demonstrated enhanced T cell precursor expansion. IL-7 removal at various time points during T cell development promoted a slight increase of DP cells; however, these cells did not differentiate further and underwent cell death. As pre-TCR signaling rescues DN cells from programmed cell death, we treated the culture with anti-CD3 antibody. Upon pre-TCR stimulation, the IL-7 deprived T precursors differentiated into CD3 +TCRαβ+DP cells and further matured into functional CD4 T cells, albeit displayed a skewed TCR Vβ repertoire. Conclusions: Our study establishes for the first time a critical control for differentiation and maturation of adult human T cells from HPCs by concomitant regulation of IL-7 and pre-TCR signaling. Keywords: T cell development, Interleukin-7, T cell receptor, Vbeta repertoire
Abstract:
Publication of this article was funded in part by the University of Florida Open-Access publishing Fund. In addition, requestors receiving funding through the UFOAP project are expected to submit a post-review, final draft of the article to UF's institutional repository, IR@UF, (www.uflib.ufl.edu/UFir) at the time of funding. The institutional Repository at the University of FLorida comminuty, with research, news, outreach, and educational materials.
General Note:
Patel et al. BMC Immunology 2012, 13:46 http://www.biomedcentral.com/1471-2172/13/46
General Note:
doi:10.1186/1471-2172-13-46 Cite this article as: Patel et al.: Regulation of in vitro human T cell development through interleukin-7 deprivation and anti-CD3 stimulation. BMC Immunology 2012 13:46. Pgs.1-15

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
All rights reserved by the source institution.
System ID:
AA00013228:00001


This item is only available as the following downloads:


Full Text







.**'' '~ *




I '- B







!*;-:"c nm 11 y ,
! ; \ ______ -^Sf

















'' -, Ti ': i i
I, P

I I,~~


T' _




Full Text
xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E84ERTAEE_NE0DRC INGEST_TIME 2013-07-12T23:09:49Z PACKAGE AA00013228_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES



PAGE 1

Regulationof invitro humanTcelldevelopment throughinterleukin-7deprivationand anti-CD3stimulationPatel etal. Patel etal.BMCImmunology 2012, 13 :46 http://www.biomedcentral.com/1471-2172/13/46

PAGE 2

RESEARCHARTICLEOpenAccessRegulationof invitro humanTcelldevelopment throughinterleukin-7deprivationand anti-CD3stimulationEktaSPatel1,StarlynOkada1,KevinHachey1,Li-junYang2,ScottKDurum3,JanSMoreb4andLung-JiChang1,5*AbstractBackground: TheroleofIL-7andpre-TCRsignalingduringTcelldevelopmenthasbeenwellcharacterizedin murinebutnotinhumansystem.WeandothershavereportedthathumanBMhematopoieticprogenitorcells (HPCs)displaypoorproliferation,inefficientdoublenegative(DN)todoublepositive(DP)transitionandno functionalmaturationinthe invitro OP9-Delta-like1(DL1)culturesystem. Results: Inthisstudy,weinvestigatedtheimportanceofoptimalIL-7andpre-TCRsignalingduringadulthuman Tcelldevelopment.UsingamodifiedOP9-DL1cultureectopicallyexpressingIL-7andFms-liketyrosinekinase3 ligand(Flt3L),wedemonstratedenhancedTcellprecursorexpansion.IL-7removalatvarioustimepointsduring TcelldevelopmentpromotedaslightincreaseofDPcells;however,thesecellsdidnotdifferentiatefurtherand underwentcelldeath.Aspre-TCRsignalingrescuesDNcellsfromprogrammedcelldeath,wetreatedtheculture withanti-CD3antibody.Uponpre-TCRstimulation,theIL-7deprivedTprecursorsdifferentiatedintoCD3+TCR +DPcellsandfurthermaturedintofunctionalCD4Tcells,albeitdisplayedaskewedTCRV repertoire. Conclusions: Ourstudyestablishesforthefirsttimeacriticalcontrolfordifferentiationandmaturationofadult humanTcellsfromHPCsbyconcomitantregulationofIL-7andpre-TCRsignaling. Keywords: Tcelldevelopment,Interleukin-7,Tcellreceptor,VbetarepertoireBackgroundGenerationofmaturehumanTcellsfromadultbone marrow(BM)CD34+HPCs invitro mayovercometwo majorlimitationsinTcelltherapy,namelyHLAdisparityandimmunetolerance.PatientsundergoingchemotherapyorwithHIVinfectionsufferfromprolonged lymphodepletionleadingtoopportunisticinfectionsand mortality[1].Hematopoieticstemcelltransplant (HSCT)hasbeenusedtoreconstitutetheimmunesysteminsuchpatients[2].However,TcellstakethelongesttimetorecoverafterHSCT[2].Thus exvivo differentiationofTcellsusingan invitro OP9stromal celllineexpressingNotchligand,Deltalike-1(DL1),has beenoftremendousinterest[3-5].Recentreports showedthattheOP9DL1stromalcellculturesystem establishedbyZuniga-Pfluckercansupportterminal maturationofcordblood(CB)andpostnatalthymus derivedCD34+HPCs[6,7].Incaseofimmunerejection ofCBHPCsduetoHLAdisparityorlimitedavailability, BMCD34+HPCsmayserveasaconvenientsourceas theycanbeobtainedfrompatient ’ sownBM[8,9].We andothershavedemonstratedthatadultBM-derived CD34+HPCs,frombothnormaladultsandpatients undergoingchemotherapy,yieldsalownumberofTcell precursors invitro [10-12].Tcelldevelopmentofadult humanBMderivedCD34+HPCsintheOP9DL1culture systemislesswellstudiedduetolowcellularyields whencomparedtotheCBcounterparts.Inaddition,terminalTcelldifferentiationfromadulthumanBM derivedCD34+HPCs invitro hasnotyetbeendemonstrated[10,13]. Wehavepreviouslyreportedthatlentivector-modified OP9celllinesexpressingvariouscytokinesandgrowth factorssupportedenhancedHPCanddendriticcell *Correspondence: lchang@mgm.ufl.edu1DepartmentofMolecularGeneticsandMicrobiology,CollegeofMedicine, UniversityofFlorida,Gainesville,FL32610,USA5DepartmentofMolecularGeneticsandMicrobiology,UniversityofFlorida, 1600SWArcherRoad,ARBR1-252,Gainesville,FL32610,USA Fulllistofauthorinformationisavailableattheendofthearticle 2012Pateletal.;licenseeBioMedCentralLtd.ThisisanOpenAccessarticledistributedunderthetermsoftheCreative CommonsAttributionLicense(http://creativecommons.org/licenses/by/2.0),whichpermitsunrestricteduse,distribution,and reproductioninanymedium,providedtheoriginalworkisproperlycited.Patel etal.BMCImmunology 2012, 13 :46 http://www.biomedcentral.com/1471-2172/13/46

PAGE 3

precursorexpansionanddifferentiation[14].ToovercomethelimitedproliferationofBMHPCs invitro ,we modifiedapreviouslydefinedLmDL1cellline(Lentivector-modifiedOP9expressingDL1)[10],toectopically expressTcelldevelopmentalfactorsIL-7andFlt3L,and establishedLmDL1-FL7cellline.Wefoundthat LmDL1-FL7providedaproliferativeadvantagetoadult BMCD34+HPCsoverLmDL1celllinesupplemented withsolublerecombinanthIL-7andhFlt3L. DuringTcelldevelopment,theCD34+CD8-CD4-double negative(DN)thymocytesdifferentiatethroughCD3-CD8+immaturesinglepositivestage(ISP)inmiceandCD3-CD4+ISPinhumans,followedbyCD3loCD4+CD8+doublepositive(DP),CD3+TCR +DPandthenCD3+TCR +CD4+orCD8+maturesinglepositiveTcells[15,16].Weobserved thatthetransitionofCD3loDPtoCD3+TCR +DPstage, anintermediatestagethatprecedestheterminalmaturation toCD8orCD4Tcelllineage,isinefficientduringadultBM Tcelldevelopment invitro [17].IL-7playsaninhibitory roleduringDNtoDPtransitioninmice[18-22]andsignalingviaCD3/Pre-TCRcomplexplaysapermissiverolein transitionfromCD3loDPtoCD3+TCR +DP[23-25]. Thus,wehypothesizedthattheinefficientpre-TCR signalingiseitherduetocontinuedpresenceofIL-7ordue toinefficientstimulationviaCD3receptor.Herewereport thatintermittentIL-7withdrawalalonedidnotresultinefficientdifferentiationtoCD3+TCR +DPstage.Importantly,takingacombinationapproachofIL-7withdrawal andactivatingpre-TCRsignalingusinganti-CD3/CD28 antibodies,wedemonstrateforthefirsttime invitro differentiationofadultBMHPCstoCD3+TCR +DP stageandsubsequentfunctionalmaturationofCD4T cells.Ourfindingsprovideabetterunderstandingofthe factorsinvolvedinproliferationanddifferentiationofBM derivedHPCstomatureTcells invitro .ResultsOP9-DL1cellsectopicallyexpressingFlt3LandIL-7 supportenhancedTcellprecursorexpansionThepreviouslyestablishedmouseOP9-DL1cellline, LmDL1[10],wasinfectedwithlentivectorsexpressing humanFlt3L,orbothFlt3LandIL-7,togenerateLmDL1FLandLmDL1-FL7celllines,respectively(Figure1A). RNAwasharvestedandanalyzedbysemi-quantitative RT-PCRtoconfirmtransgeneexpressioninthesecell lines(Figure1B).Weconfirmedsurfaceexpressionof DL1onallthreecelllines,LmDL1,LmDL1-FLand LmDL1-FL7(Figure1C).BothLmDL1-FLandLmDL1FL7expressedhighlevelsofFlt3Loncellsurfaceandin cultureasdeterminedbyflowcytometryandELISA,respectively(Figure1D).ThesecretionofIL-7byLmDL1FL7wasmeasuredviaELISAtobeintherangeof 10 – 14ng/mLafter48hrofculture(Figure1E). ToexaminethedifferentiationandexpansionpotentialofadulthumanBMCD34+HPCsco-cultured withLmDL1exogenouslysupplementedwithrecombinanthumanFlt3L(5ng/mL)andIL-7(5ng/mL), orco-culturedwithLmDL1-FL7,wedeterminedthe proliferationrateoftheincubatedcellsbycounting totalnumberofsuspensioncellsatvarioustime pointsinthreeindependentexperiments.Theresult showedthatCD34+HPCscells,whenco-cultured withLmDL1-FL7for35days,expandeduptofive foldmorethanthoseco-culturedwithLmDL1supplementedwithrecombinantFlt3LandIL-7(Figure1F, representativeofthreedonors).Thus,LmDL1-FL7 wassuperiortoLmDL1insupportingTcellprecursor proliferation.AdultBMCD34+HPCsco-culturedonLmDL1-FL7or LmDL1supplementedwithIL-7andFlt3LfollowsimilarT celldifferentiationkineticsbutdonotundergofunctional TcellmaturationNext,weanalyzedsurfaceexpressionofCD8,CD4,CD7, CD1a,CD3,TCR andTCR ofthedifferentiatingcells inthetwoco-culturesystems.KineticsofCD8,CD4,CD7 andCD1awerecomparablebetweenthetwosystems.We observedCD4ISPfromday5(notshown)today15,and increasedCD8ISPafterday20(Figure2).Tcelllineage commitmentfromHPCsisdefinedbyupregulationof CD7,followedbyCD1aexpressionwhichisdecreased uponfurthermaturation.Aschematicillustrationofthe predictedkeyeventsandphenotypesofdevelopingTcell precursorsisshownattopofFigures2and3.Wedetected surfaceCD7onday15(datanotshown),andpeakedexpressionofCD7andCD1aaroundday42,followedbya gradualdecreaseofCD1a.Duetothelowcellnumberin theLmDL1+IL-7+Flt3Lcoculture,wehadlimitedcells foranalysisintheearlytimepoints.Inbothsystems,DP cellsappearedaroundday35anddecreasedbyday56. ThetimingofappearanceofCD8ISPandDPvarieddependingonthedonor,andwassimilarbetweenthetwo systems.TherapidexpansionofTcellprecursorsincoculturewithLmDL1-FL7,whichcontinuouslyproduced Flt3LandIL-7,wasaccompaniedbyaslowertransition intoDPandCD3positivestage,asbothDPcellsandCD3 surfaceexpressionweredetectedatlowerlevelsin LmDL1-FL7co-culturethaninLmDL1+IL-7+Flt3L coculture(Figures2&3).Nevertheless,neithersystem producedCD3hiTCRhiCD4orCD8cellpopulation (Figure3).TheanalysisofTCR surfacemarkersdetected no lineagediversificationinLmDL1-FL7co-culturebut someinLmDL1+IL-7+Flt3L(Figure3bottom).Thus, weconcludethatnofunctionallymatureTcellscouldbe generatedfromtheadultBM-derivedCD34+HPCsinthe invitro cultures.Patel etal.BMCImmunology 2012, 13 :46 Page2of15 http://www.biomedcentral.com/1471-2172/13/46

PAGE 4

IL-7deprivationalonedoesnotinduceefficientDNtoDP transitionInmurineTcelldevelopment,IL-7playsanegativerole duringtransitionofDNtoDPTcells[18-22].HumanthymocyteshavebeenreportedtoloseIL-7dependencyupon reachingCD7/CD1aDPstage[20].Wefoundthatday21 cellswerealwaysnegativeforCD1aexpression;hencewe chosethistimepointforIL-7deprivationtoensurethat thecellswereinIL-7dependentphaseofdevelopment. ToassesstheeffectofIL-7deprivationonDNtoDPtransition,weculturedadultCD34+HPCsonLmDL1-FL7for 21days,followedbycontinuedpresence(IL-7present)or deprivation(IL-7deprived)ofIL-7,i.e.,onLmDL1-FL7or LmDL1-Flt3L,foradditional10 – 15daysandanalyzedthe expressionofCD7,CD1a,CD4,CD8,CD3,TCR and TCR .WeobservedadeclineincellsurvivalpostIL-7 withdrawalindicativeofIL-7dependence(Figure4A, opencircles).WedetectedanincreaseinIL-7RaexpressionuponIL-7withdrawal(LmDL1-Flt3LorLmDL1+ Flt3L,IL-7deprived,Figure4B,C,farright).Additionally, weobservedanincreaseinpercentageofDPcells;however,thesecellslackedCD3hiTCR hiphenotype(Figure4 B,C).Thus,IL-7deprivationaloneisnotsufficienttoinduceCD3hiTCR hiDPtransitionofadulthumanTcell precursorsontheOP9culturesystem.IL-7withdrawaldoesnotincreaseTcellreceptorexcision circle(TREC)inthedevelopingTcellprecursorsDuringTcelldevelopment,DNTcellprecursorsrearrangetheirTCRbetachainfirst,whichisexpressedwith pre-TCRalphatoformapre-TCRcomplex[26].Signaling viaPre-TCRcomplexresultsinallelicexclusionatTCR locus,butinitiatesrearrangementattheTCR locusand promotesDPtransition[27].RearrangementattheTCR Figure1 EnhancedproliferationofTcellprecursorsonLmDL1-FL7. A ,LentivectorconstructsexpressingmouseDL1,humanIL-7and humanFlt3L. B ,qRT-PCRanalysisforDL-1,Flt3L,andIL-7. C & D ,FlowcytometryanalysisofmDL-1( C )andFlt3L( D )surfaceexpressioninthe variousOP9celllines.ELISAanalysesforFlt3L( D )andIL-7( E )production. F ,GrowthkineticsofdevelopingTcellsfromadulthumanBM-derived CD34+HPCsonLmDL+IL-7+Flt3LversusLmDL1-FL7withpvalueindicated. Patel etal.BMCImmunology 2012, 13 :46 Page3of15 http://www.biomedcentral.com/1471-2172/13/46

PAGE 5

locuscanbeevaluatedbythepresenceofTREC,anepisomalcircularpieceofDNAformedduetoexcisionofdelta locusuponTCR rearrangement[28].Inordertoassess thefrequencyof precursors,weanalyzedTRECcontentinthedevelopingTcellprecursorsbygenomicPCR. Theresultsshowedthatcellsfromday0andday25were negative,butfromday30werepositiveforTREC (Figure5A).WequantifiedTRECviaquantitativePCR analysisusingclonedTRECandRAG2asstandards (Additionalfile1)[29].Ourresultsshowedthat<1%cells werepositiveforTREConDay30,andIL-7deprivation hadnoeffectonTRECcontent(Figure5B).RT-PCRanalysisofRNAsshowedthatthiswasnotduetothelackof RAGorTCF1/LEFgeneexpression(Figure5C).Thisresultsuggeststhatonlyasmallpercentofcellsunderwent rearrangementatTCR locusinthe invitro system.AdulthumanHPCscandifferentiatetoDPTcellsand adoptaCD4Tcelllineage invitro uponIL-7deprivation followedbyanti-CD3stimulationSignalingviapre-TCRcomplex,composedofTCR pre-TCR andCD3iscrucialfor Tcelldevelopment [27,30].Pre-TCRisthoughttosignalinaligandindependentfashion,possiblythrougholigomerization [31,32].Pre-TCRsignalingcanbemimickedbyantiCD3antibodystimulation,as invivo administrationof anti-CD3antibodyinducesDNtoDPtransitionin Rag2 / pre-T / mice[25,33].Also,treatmentoffetal thymusorganculture(FTOC)fromTCR / ,Rag2 / orSCIDmicewithanti-CD3antibodiesinducesDNto DPtransition[24,25].Thus,wetestedifanti-CD3 stimulationofTcellprecursorsobtainedfromLmDL co-culturescaninducedifferentiationtoDPstage.In ordertomaximizecell-cellcontactforefficientstimulation,wetransferredcellsofbothIL-7presentandIL-7 deprivedgroupstoUbottom96wellplates,inastromal cellfreeenvironmentandsupplementedwithanti-CD3/ CD28antibody-conjugatedbeads.WefoundthatIL-7 deprivedprecursorsproliferateduponanti-CD3engagementbutIL-7presentgroupdidnot,asdemonstrated bythefoldincreaseincellnumberandintracellular Ki67staining(Figure6A,B).Ontheotherhand,TCR activationoftheIL-7presentgroupdidnotinduceproliferation.Additionally,percentageofTRECpositivecells Figure2 FlowcytometryanalysesofexpressionkineticsofCD8,CD4,CD7,andCD1aofthedevelopingTcellsunderLmDL1+IL-7+ Flt3LorLmDL1-FL7co-culturecondition. SchematicillustrationofkeystagesofTcelldevelopmentisshownattop.AdulthumanBM CD34+HPCswereplatedonLmDL1-FL7orLmDL1+IL-7+Flt3LandsurfaceexpressionofCD8,CD4,CD7andCD1awasexaminedovertimeas depicted.Thepercentagesofstainedcellsareindicatedintheflowgraphquadrons.ND,notdone,duetoinsufficientamountofdeveloping TcellsfromtheearlytimepointsoftheLmDL1+IL-7+Flt3Lcoculture. Patel etal.BMCImmunology 2012, 13 :46 Page4of15 http://www.biomedcentral.com/1471-2172/13/46

PAGE 6

increasedto~13%intheIL-7deprived,anti-CD3stimulatedgroupofcells,indicatingincreasedTCR rearrangement(Figure6C). WenextexaminedTcellmaturationmarkers2weeks poststimulationafterdeprivationofIL-7.Weobserved lowCD3expressionandnoTCR expressioninIL-7 presentandanti-CD3stimulat edgroup(Figure7A,i&iii). Interestingly,anti-CD3st imulatedcellsfromtheIL-7 deprivedgroupdisplayedarobusttransitionfromCD3loTCR loDPtoCD3+TCR +DPandCD4+SPTcells (Figure7,ii&iv).Additionally,wefoundthatthecells weremostlynegativeforCD56NKcellmarkerexpression (Additionalfile2).ThetimingofIL-7deprivationandantiCD3stimulationwascritical,asIL-7deprivationpostday 35andsubsequentanti-CD3simulationdidnotinduceT celldifferentiationandmatur ation(datanotshown).Thus, weconcludethatIL-7depriv ationisnecessarybutnot sufficienttopromoteDPtran sitionandsubsequentantiCD3stimulationplaysacriticalroleinTcellmaturation. Toseeifthe invitro developedCD4Tcellswerefunctional Tcells,wefurtherassessedeffectorfunctionsbyIFN, IL-17andIL-4secretioninresponsetoPMAandionomycin.Theresultsshowedthatuponstimulation,the invitro derivedCD4TcellsdisplayedeffectorTcellfunctionssimilartothatofperipheralbloodCD4Tcells(Figure7B).V repertoireanalysisofthe invitro generatedCD4 TcellsToevaluatetheTCRdiversityofthe invitro -derivedT lymphocytes,weperformedV repertoireanalysisfor23 V familiesofhumanTCR.The invitro derivedCD4+SP TcellswerestainedwiththeIOTestWpanelofantibodies. Themajorityofthe invitro differentiatedTcellsfrom adultBMHPCs(fouroffivedifferentdonors)displayeda Figure3 FlowcytometryanalysesofexpressionkineticsofCD3,TCR andTCR ofthedevelopingTcellsunderLmDL1+IL-7+ Flt3LorLmDL1-FL7co-culturecondition. SchematicillustrationofkeystagesofTcelldevelopmentisshownattop.TcellmarkersCD3, TCR ,andTCR wereanalyzedforthedevelopingTcellsunderthetwodifferentco-cultureconditionsupto56days.ND,notdone,dueto insufficientamountofdevelopingTcellsfromtheearlytimepointsoftheLmDL1+IL-7+Flt3Lcoculture. Patel etal.BMCImmunology 2012, 13 :46 Page5of15 http://www.biomedcentral.com/1471-2172/13/46

PAGE 7

skewedV distributionpattern,e.g.increasedpopulations ofV 13.2,9,20,5.1,and8,respectively,(Donors1to4, markedby*inFigure8A)ascomparedwiththecontrol PBMCs,whichshowedanevenlydistributedpattern. Notethatoneofthe invitro derivedTcells,donor5, showedalessskewedV distributionpattern.Thequantitativeanalysisofmultiplesamplesissummarizedin Figure8B.WefurtherexaminedV distributionsof healthydonorPBMCsstimulatedbyanti-CD3/CD28Ab orPHAforthreeweeks,anddemonstratedthattheentireCD4V cloneswereevenlyexpandedwithoutsubstantialskewing(notshown).Together,wefoundthat theV repertoiresofthe invitro -derivedCD4Tlymphocyteswerehighlyrestrictedcomparedwiththoseof normaladultCD4Tcells.DiscussionInvitro adulthumanBMHPC-derivedfunctionalTcells havegreatpotentialfortherapeuticapplications,asthis approachprovidesdonorHLA-matchedTcellsthatmay begeneticallyengineeredtofightinfections,cancerorto treatimmunodeficiencies.MurineHPCs,humanCBand post-natalthymicHPCsundergofullmaturationinthe OP9-DL1culturesystem[34,35].However,adulthuman Figure4 TheeffectofIL-7withdrawalonTcelldifferentiation. AdultBMCD34+HPCswereco-culturedonLmDL1-FL7for21daysand continuedonLmDL-FL7(IL-7present)ortransferredtoLmDL-Flt3L(IL-7deprived)foradditionalninedays. A ,Growthcurvesforthedeveloping TcellsinthepresenceorabsenceofIL-7afterday21.ThecellgrowthdeclinedmarkedlyuponIL-7removalatday21(depictedbyopencircles, datarepresents4independentexperiments). B ,AnalysisofTcellmarkersintheTcelldevelopmentcultureswithorwithoutIL-7withdrawalafter day21. C ,SummaryofflowcytometryanalysisofsurfacemarkerCD4CD8DP,CD4,andIL-7RainthedevelopingTcellswith(LmDL1-FL7)or withoutIL-7(LmDL1-Flt3L),andpvaluesweredeterminedasshown. Patel etal.BMCImmunology 2012, 13 :46 Page6of15 http://www.biomedcentral.com/1471-2172/13/46

PAGE 8

BMHPCsundergolimitedproliferationandarearrested atCD3loCD4+CD8+DPstageofTcelldevelopment [10,13].Inthisreport,wedemonstratedthatcell-based IL-7andFlt3Lprovidedaproliferativeadvantageto adultBMHPCsoverexogenouslysupplementedrecombinantIL-7andFlt3L.WethentookacombinationapproachofIL-7withdrawalandactivatingpre-TCR signalingusinganti-CD3/CD28antibodies,which successfullyovercamethearrestinCD3loCD4+CD8+DP stageandinduceddifferentiationtoCD3+TCR +CD4+CD8+DPstage,andsubsequentmaturationto CD4Tcells.Ourfindingsprovideabetterunderstanding ofthefactorsinvolvedinproliferationanddifferentiationofadultBM-derivedHPCs invitro LmDL1-FL7wassuperiorinsupportingTcellprecursor proliferationwhencomparedtoLmDL1supplemented Figure5 TCRrearrangementindevelopingTcellprecursorsinLmDL1-FL7co-culture. A ,TRECanalysisindevelopingTcells.PCRanalysis forTRECandRag2wasperformedusinggenomicDNAharvestedattheindicatedtimepointsfromco-culturesunderdifferentIL-7conditions. B QuantitativePCRanalysisofTREC-positivecellsindevelopingTcells.SYBRGreenquantitativePCRanalysisofTRECwasperformedusinggenomic DNAisolatedfromTcellprecursorsunderindicatedcultureconditions. C ,AnalysesofRag1,Rag2,TCF1andLEFRNAexpression.Theexpression oftheindicatedgeneswasdetectedbyRT-PCRusing1ugofmRNAharvestedfromday30ofthedevelopingTcellprecursors. Figure6 IncreasedproliferationandTCRrearrangementofdevelopingTcellsuponconcomitantIL-7removalandanti-CD3/CD28 co-stimulation. AdulthumanHPCswereco-culturedonLmDL1-FL7for21daysandcontinuedonLmDL-FL7(IL-7present)ortransferredto LmDL-Flt3(IL-7deprived)foranadditionalninedays. A ,DiminishedprecursorTcellgrowthuponcontinuedpresenceofIL-7.Day21Tprecursor cellsunderIL-7presentordeprivedconditionswerestimulatedusinganti-CD3/CD28beadsforanadditionaltwoweeks.Thefoldincreasesincell numberweredeterminedandsignificantdifferencewasobservedbetweenthetwogroups(n=5,P=0.006). B ,IntracellularstainingforKi67of thedevelopingTcellswithorwithoutIL-7andstimulatedbyanti-CD3/CD28Abbeads.Un-stimulatedandstimulatedPBMCsfromhealthy donorswereincludedascontrols. C ,QuantitativePCRanalysisofTRECpositivecellsinthedevelopingTcellpopulationafterIL-7deprivationand anti-CD3/28co-stimulation,ascomparedwithcontrolPBMCfromhealthydonors. Patel etal.BMCImmunology 2012, 13 :46 Page7of15 http://www.biomedcentral.com/1471-2172/13/46

PAGE 9

PBMC I n vitro derived CD4 T cells 20.3 67.8 8.6 24.1 69.8 3.5 97.8 99.4 1.5 5.6 1.5 1.6 53.9 1.4 4.9 59.7 1.9 2.0 58.0 1.7 83.4 86.7 10.9 1.2 5.9 12.3 61.7 9.1 + PMA + Ionomycin CD8 CD4CD8 CD4CD8 CD4CD8 CD4IFNCD4IL-4 CD4IL-17 CD4IFNCD4IL-4 CD4IL-17 CD4IFNCD4IL-4 CD4IL-17 CD4IFNCD4IL-4 CD4IL-17 CD4103 104 105 103 104 105 103 104 105 103 104 105 103 104 105 103 104 105 103 104 105 103 104 105 103 104 105 103 104 105 103 104 105 103 104 105 103 104 105 CD3 CD3 CD3 CD3 20 40 60 80 0 100 20 40 60 80 0 100 20 40 60 80 0 100 20 40 60 80 0 100 B LmDL1+ IL-7+Flt3L LmDL1 + Flt3L LmDL1+ IL-7+Flt3L (i) (ii) LmDL1-FL7 LmDL1 + Flt3L LmDL1FL7 (iii) (iv) Transfer to U bottom 96 well plate +Anti-CD3/CD28 Day 35 Day 21 Day 49 PBMC 8.5 6.6 42.9 41.9 8.2 10.9 34.6 46.2 3.6 10.7 29.3 56.3 17.7 1.7 65.7 14.9 15.4 2.9 0.0 81.7 0.9 18.5 17.3 63.4 29.3 1.2 39.0 2.7 13.8 11.8 18.7 55.7 13.6 16.5 18.4 51.5 CD4 CD8 CD4 CD3 CD4 TCR 28.3 39.4 13.6 18.7 0.2 78.2 20.4 1.1 24.0 54.0 13.1 8.5 48.5 40.4 3.5 7.6 0.1 91.3 7.5 1.2 14.0 76.2 7.9 1.9 103 104 105 103 104 105 103 104 105 102 103 104 105 102 103 104 105 102 103 104 105 102 103 104 105 102 103 104 105 selection CD4CD8DP CD3low DN CD4ISP CD4CD8DP CD3hiTCR hi TCR -chain rearrangement TCR -chain rearrangement Positive/negative selection ? Lineage commitment to CD4 *Anti-CD3 stimulation A (ii) (iv) 0 20 40 60 80 100 20 100 80 60 40 %CD4+CD3+TCR + Figure7 (Seelegendonnextpage.) Patel etal.BMCImmunology 2012, 13 :46 Page8of15 http://www.biomedcentral.com/1471-2172/13/46

PAGE 10

withexogenousFlt3LandIL-7.Themechanismthat enhancedprecursorproliferationonLmDL1-FL7remains tobeelucidated.Itispossiblethatconcentrationorcellbasedmodifications,orboth,couldcontributetothe enhancedproliferation.Asallthreecelllines,LmDL1, LmDL1-FLandLmDL1-FL7expressedhighlevelsof mDL1(Figure1),differentialDL1expressionleveldoes notseemtoplayarole.Flt3Lisexpressedasasolubleas wellasmembraneboundform[36],andglycosylatedform ofIL-7hasbeenreported[37].Besidessolublefactors, cell-cellinteractionsplayacriticalroleinTcelldevelopment.Ourresultsappeartopointtotheimportanceof cell-basedmodificationofcytokines,asuseofglycosylated IL-7forclinicaltrialsisbeingconsidered[38].Previous studiesdemonstratedthatahighdoseofIL-7hasa modesteffectonincreasingtheabsolutecellnumber duringTcelldevelopment[18,21].Thesestudiessupport ourviewthatexogenouslyaddedcytokinedosehas limitedeffectsonTcelldevelopment. WhiletheTcelldevelopmentpotentialsuchasoccurrenceofCD8ISPandDPcellswerecomparableforboth culturesystems,somedifferencesexist,suchasCD3expressionanddevelopmentofTCR cells.Cell-freeor cell-cellsignalingofthecytokinesmayaccountforthe differencesinproliferationanddifferentiationofthetwo systems.Nevertheless,differentiationtoDPstagewasinefficientandneithersystemsupportedterminalTcell maturation.Underbothcultureconditions,precursor proliferationratedeclinedbeyond30 – 35dayssuggesting adiscontinueddependenceforIL-7andNotchsignals, consistentwithpreviousreports[39,40],assuch, thisculturesystemalonedoesnotsupportcontinued differentiationofadulthumanTcellprecursorstoCD3 andTCR -bearingDPcells. SignalingthroughIL-7/IL-7Rsupportssurvivaland proliferationthroughDN3stageinmurineTcell developmentandthesameistrueforhumanTcelldevelopment[20,41].Intransgenicmice,expressionof IL-7underthecontrolof lck promoteratlowlevels enhancesproliferationofdeveloping Tcells,butat highlevels,itreducesproliferationanddisplaysa markedblockinDPtransition[21].RecentstudiesfurthersupportthatIL-7Rsignalsimpairdifferentiationof CD8ISPtoDPcellsinZap70 / andIL-7R transgenic mice[22],andIL-7Rsignalsinhibittheexpressionof HMGdomaintranscriptionfactorsTCF-1,LEF-1and ROR t,factorsimportantforpre-TtoDPtransition [22].Inaddition,IL-7suppressesanti-CD3antibody induceddifferentiationtoDPstageinfetalthymusorgan cultureofRag1-deficientmice[19].Thus,wehypothesizedthatIL-7withdrawalpriortoISPmightbenecessaryforefficientDPtransition.WhileIL-7hasbeen reportedtodisplayaninhibitoryroleinDPtransitionin murineTcelldevelopment,ourresultsshowedthatthe intermittentremovalofIL-7inthe invitro co-culture onlyhadaminimaleffectonhumanTcellDP transition. ThemechanismbywhichIL-7inhibitsTcelldevelopmentisunclear.Weobservedabundanttranscriptsof TCFandLEFinTcellprecursorsatvarioustimepoints. Thus,itseemsunlikelythatIL-7withdrawalpromotesT celldevelopmentbyde-repressingtranscriptionofthe abovefactors.OurdatasuggestthatIL-7doesnotinhibitTRECformation,neitherdoesitdirectlyinhibit pre-TCRsignaling.Interestingly,anincreaseinCD4surfaceexpressionpostIL-7withdrawalmayplayarolein howthesecellsrespondtoanti-CD3stimulation.Asin humanTcelldevelopment,CD4ISPprecedeDPstage,it ispossiblethatincreasedCD4mayaccountfor increasedresponsivenesstoanti-CD3stimulation.Alternativepossibilitiesare,IL-7mediatesitseffectthrough STAT-5ontranscriptionofgenesnecessaryforpre-TCR expressionandfunction,directlyinhibitspre-TCRactivation,orinterfereswiththeTGF signalingpathway [42].Detailedevaluationofthesepossibilitiesrequires furtherinvestigation. IL-7mediatessurvivalandproliferationofDNthymocytes[43].Inaddition,IL-7isrequiredforTCR generearrangementandalsoinducesTCR chainrearrangement [44-46].InordertoprogresstothenextDPmaturation stage,DN/ISPthymocytesmustseizetherearrangement andexpressafunctionalTCR orTCR [17].Itis (Seefigureonpreviouspage.) Figure7 Invitro maturationandfunctionalanalysisofCD4SPTcellsuponIL-7deprivationandanti-CD3/CD28co-stimulationinthe absenceofstromalcellenvironment. A ,AnalysisofTcelldevelopmentkineticsuponIL-7removal.Diagramofkeyeventsandmarkersfor precursorTcelldevelopmentisillustratedattop.AdultHPCswereco-culturedwithstromalcellsfor21daysandcontinuedonwithIL-7(IL-7 present,iandiii)ortransferredtoculturewithoutIL-7(IL-7deprived,iiandiv)foranadditional17days.Thecellswerethentransferredto96 wellUbottomplatesandstimulatedwithanti-CD3/CD28beadsforanadditional14days.RepresentativeresultsofanalysisofTcellsurface markerstwoweeksafterstimulationareshownwithpercentageofcellsindicatedintheflowgraphquadrons.ThepercentagesofCD4+CD3+TCR +cellpopulationoffourindependentTcelldevelopmentexperimentsareshown. B ,Analysisofeffectorfunctionsofthe invitro -derived CD4Tcells.PBMCsofhealthydonorsandthe invitro -derivedCD4Tcellswerestimulatedusinganti-CD3/CD28beadsinthepresenceofIL-2,IL7andIL-15fortwoweeks.Expressionofintracellulareffectorcytokine(IFN )andThelperfunctionalmarkers(IL-4,IL-17)wasdetectedafter BrefeldinAtreatment;unstimulated(leftpanel)orPMAandionomycinstimulated(rightpanel)cellswereanalyzedbyantibodystainingandflow cytometry.Notethatthesmallpercentageof invitro -derivedCD8+cellswerenotCD3+orviablepropagatingcells. Patel etal.BMCImmunology 2012, 13 :46 Page9of15 http://www.biomedcentral.com/1471-2172/13/46

PAGE 11

Figure8 V repertoireanalysisofthe invitro -derivedCD4Tcells. Afteranti-CD3/28stimulation,the invitroderivedCD4Tcellsweresurface stainedfor24V familiesusingtheIOTestWBetaMarkTCRV RepertoireKit.CD3-gatedpopulationwasevaluatedfortheexpressionofV familiesofprotein. A ,TCRV analysisof invitro developedCD4TcellsoffiveCD34+HPCdonorsversusacontrolPBMC. B ,Summaryanalysisof V distributionsoffourcontrolPBMCsversusfive invitro derivedCD4Tcells. Patel etal.BMCImmunology 2012, 13 :46 Page10of15 http://www.biomedcentral.com/1471-2172/13/46

PAGE 12

knownthatsignalingviaafunctionalTCRmediatesallelic exclusion,survivalandprogressiontoSPstage[27]. Interestingly,inmiceIL-7signalingisinhibitedatDP stagebydown-regulatingtheIL-7R .Inhumans,IL-7Ris expressedbutitsbindingpartner Cisdown-regulated andSTAT-5responsivenessislost[47].HenceitistemptingtospeculatethatIL-7signalingdown-regulationmight beanadditionalwayofterminatingrearrangementand preventingsurvivalofTcellswithnon-functionalTCRs. AsbothIL-7andTCRsignalingdeliversurvivalsignals, thedown-regulationofIL-7signalingensuresshutdown ofanalternativesurvivalpathwayandselectsforcellsthat respondtoTCRsignals.Clearly,thechangeinIL-7/IL-7R signalingisphysiologicallyimportantandthereasonfor suchregulationmightresideontheintracellularsignaling ofIL-7/IL-7RonTcellactivationandfatedecision:proliferation,deathordifferentiation. DuringTcelldevelopment,theappearanceofISPis dominatedbyCD4ISPinhumanandCD8ISPinmouse; pre-TCRsignalsdriveproliferation,TCR rearrangement,followedbytheappearanceofCD8ISPinmouse andCD4ISPinhuman.Interestingly,weobservedCD8 ISPderivedfromhumanCD34HPCs invitro ;wefound alackofproliferativeburstandminimalrearrangement intheTCR locus.Thus,theCD8ISPmaynotbetrue ISPgeneratedbypre-TCRsignals,ratheraresultof cytokine-mediatedCD8expression[48]. Tcelldevelopmentisacomplexprocessthatinvolves multiplecheckpointsandthree-dimensionalarchitecturecomposedofmultiplecelltypesandcompartments [49-52].Ourresults,assummarizedinFigure9,demonstratethatsignalingviaCD3andcell-cellcontactwas sufficienttodrivedifferentiationtoDPandsubsequent CD4lineagecommitmentintheabsenceofthymic environment.AsOP9cellsdonotexpressclassII MHCmoleculesbutthedevelopinghumanthymocytes do(datanotshown),theresultingCD4cellsaremost likelyselectedbyselfMHCofthedevelopingthymocytes.ThisalternatepathwayofCD4Tcelldevelopmenthasbeenreportedpreviously,especiallyin humanTcelldevelopment[53,54].Ourstudyisin agreementwithrecentreportsdemonstratingthat humanHPCswhentransplantedintoimmunecompromisedmice,candevelopintoCD4Tcells[55-58]. SuchTcelldevelopmentcanoccurviathymocytemediatedselection,anddoesnotrequirethepresence ofprofessionalantigenpresentingcellsorepithelial cellsexpressingMHC-II.ThehumanCD4Tcells derivedfromNOD/SCID C / micereceivingtransplantedhumanHPCsdisplaydiversevbetarepertoire [56,57].However,wefoundreduceddiversityunder the invitro systemillustratedbyhighlyskewedv repertoireinmostoccasions.Thethree-dimensionalenvironment invivo ,andtheHLAexpressionon thymocytesmayaccountforsuchdifferences.ItispossiblethatTCR rearrangementand selectionevents areinefficientinthissystemandtherarecellswith properlyarrangedTCRsareselecteduponanti-CD3 stimulation.AlthoughonecouldchallengethatexpansionofcontaminatingTcellsintheinitialsourceof BMCD34+HPCsmayoccur,wedonotthinkthisis possibleasthefoldincreasepostanti-CD3stimulation wouldhavebeeninamagnitudeofover300foldin twoweeksandweshouldalsoobservedexpansionof CD8TcellsalongwithCD4Tcells.Thus,even thoughlineagecommitmenttoCD4Tcellscanbe achievedindependentofthymicmicroenvironment,the latterisrequiredforestablishingabalancedTCR Figure9 Schematicillustrationof invitro TcelldevelopmentalprogramofadulthumanCD34+BMHPCs. Thekeyevents,knownsurface markersandcriticalcheckpointsofthe invitro developingTcellsfromadulthumanBMCD34+HPCsunderthestromalcellco-culturecondition areillustrated. Patel etal.BMCImmunology 2012, 13 :46 Page11of15 http://www.biomedcentral.com/1471-2172/13/46

PAGE 13

repertoire,supportingnegativeselectionaswellaspromotingCD8lineagecommitment.ConclusionsIL-7withdrawalisnecessarybutnotsufficientforfurtherdifferentiationtoDPstage,andanti-CD3stimulationplaysakeyroleininducingCD3+TCR +DP transitionandsubsequentmaturationtoCD4Tcells. Ourfindingsfurtheradvancetheexperimentalsystem requiredfor invitro modelingofadulthumanTcelldifferentiation,andwillhelpdevelopnovelapproachestowardgeneratingfunctionalTcellsfromadultHPCs.MethodsHumanCD34+cellsandcelllinesTheadultBMCD34+HPCsfromnormaldonorswere purchasedfromAllCellInc.(SanMateo,CA,USA). ControlPBMCswereobtainedfromCivitanRegional BloodCenterInc.(Gainesville,FL)reviewedand approvedbyUniversityofFloridaHealthScienceCenter InstitutionalReviewBoard(#507-1997,UFIRB-01).All studiesinvolvinghumansubjectsareconductedinaccordancewiththeguidelinesoftheWorldMedical Association'sDeclarationofHelsinki(mostrecentrevision).Themousefetalstromalcells(OP9)werepurchasedfromtheAmericanTypeCultureCollection (ATCC,Manassas,VA)andmaintainedaspreviously described[34].TheengineeredLmDL1andLmDL1-FL7 celllinesweregeneratedbytransducingcellswithlentivectorsencodingDL1,Flt3LandIL-7,respectively.The stromalcellsweremaintainedin -MEM(Invitrogen/ GibcoBRL,GrandIsland,NY)supplementedwith1520%fetalbovineserum(FBS,Invitrogen/GibcoBRL) and1%Penicillin-Streptomycin(MediatechInc., Manassas,VA).IL-7cytokinesecretionwasmeasured byusinghumanIL-7ELISAkit(RayBiotech,Inc)and solubleFlt3Linculturewasmeasuredusinghuman Flt3LELISAkit(AssayBiotechnologyCompany,Inc, Sunnyvale,CA).Cellfreesupernatantswereharvested fromLmDL1andLmDLFL7cellsculturedfor48hrs (80-90%confluent),ina12wellplatecontaining1ml ofmedia.Thesampleswerereadonmodel680microplatereader(Bio-Rad).Thesurfaceexpressionofmouse DL1andFlt3LwasanalyzedbyflowcytometrywithAlexa Fluor647-conjugatedanti-DL1Ab(Biolegend)andpurifiedanti-Flt3LAb(AbcamInc.Cambridge,MA)conjugatedwithZenon-Alexa488accordingtomanufacturer ’ s instructions(Invitrogen).LmDL1stromalcellandCD34+HPCco-cultureTheCD34+HPCswereseededinto24-well-plateat1x105cells/wellcontainingaconfluentmonolayerofLmDL1or LmDL1-FL7cells.Thecoculturesweremaintainedin completemediumfromday1,consistingof -MEMwith 20%FBSand1%Penicillin-Streptomycin,supplemented with5ng/mlIL-7(PeproTech,Inc.RockyHill,NJ)and 5ng/mlFlt3L(PeproTech,Inc.)asindicated.The cocultureswerereplenishedwithnewmediaevery 2 – 3days.Thecellsinsuspensionweretransferredtoa newconfluentstromalmonolayeroncethemonolayer begantodifferentiateorwhendevelopingcellsreached 80-90%confluent.Thecellsweretransferredbyvigorous pipetting,followedbyfilteringthrougha70 mfilter(BD/ Falcon,BDBiosciences,Sparks,MD)andcentrifugationat 250RCF,atroomtemperaturefor10min.Thecellpellet wastransferredtoafreshconfluentmonolayer.Thecells wereharvestedattheindicatedtimepointsduringtheT celldevelopmentforanalysis.MonoclonalantibodiesandflowcytometryThesurfaceexpressionofmouseDL1andFlt3Lwas analyzedbyflowcytometrywithAlexaFluor647conjugatedanti-DL1antibody(Biolegend)andpurified anti-Flt3Lantibody(AbcamInc.Cambridge,MA)conjugatedwithZenon-Alexa488accordingtomanufacturer ’ s instructions(Invitrogen).Theantibodiesusedforsurface stainingofTcelldevelopmentincludedCD4(clone RPA-T4Pacificblue),CD8(cloneRPA-T8PE),CD3 (cloneUCHT1,PacificBlue,cloneSK7,PE-Cy7),TCR (cloneT10B9.1A-31,FITC),CD1a(cloneHI149,APC), CD7(cloneM-T701,FITC,PE),andintracellularstainingforKi67(cloneB56,FITC),andisotypeIgG1 whichwerefromBDBiosciences(SanJose,CA).antiCD127(clone40131-FITC)wasfromR&Dsystems (Minneapolis,MN).V repertoireanalysiswasperformedusingIOTestWBetaMarkTCRV Repertoire Kitaccordingtomanufacturer ’ sinstructions(Beckman Coulter,Fullerton,CA).Forflowcytometricstaining, cellswerefirstwashedwithPBSplus2%FBSand blockedwithmouseandhumanserumat4Cfor 30min.Cellswereincubatedwithantibodiespermanufacturer ’ sinstructions.Foreachfluorochrome-labeled Abused,appropriateisotypecontrolwasincluded.After antibodystaining,thecellswerewashedtwiceandfixed with2%para-formaldehyde.Intracellularstainingwas performedusingBDcytofix/cytopermkit,accordingto themanufacturer ’ sprotocol.Datawasacquiredusing BDFACSDivasoftware(version5.0.1)onaBDFACSAriaoraBDLSRandanalyzedusingtheFlowjosoftware(version7.1.3.0,TreeStar,Inc.Pasadena,TX).TcellstimulationandeffectorfunctionanalysisTostimulatenaveTcells,aprotocolforlongterm stimulationwasfollowedusinganti-CD3/CD28beads (Dynal/Invitrogen,SanDiego,CA)permanufacturer ’ s instructions.Thecellsandthebeadsweremixedand platedintoa96wellplateat37Cfor2 – 3daysinX-Vivo 20(Gibco)media,onday3,12.5UofIL-2,5ng/mlofPatel etal.BMCImmunology 2012, 13 :46 Page12of15 http://www.biomedcentral.com/1471-2172/13/46

PAGE 14

IL-7and20ng/mlofIL-15wereaddedandthecells wereculturedforadditional11 – 12days.The invitro expandedCD4TcellswerestimulatedwithPMAand Ionomycin(Sigma-Aldrich,St.Louis,MO),andanalyzed forthereleaseofIFN,IL-4andIL-17.Brieflythecells wereincubatedwith25ng/mlPMAand1 g/mlionomycinforonehourfollowedbytheadditionof6 g/ mlmonensin(Sigma-Aldrich)toinhibitGolgi-mediated cytokinesecretion.After4 – 5hoursofincubation,the cellswereharvestedandsurfacestainedforCD4(clone RPA-T4,Pacificblue),CD8(cloneSK1,APC-Cy7),CD3 (cloneSK7PE-Cy7),CD25(cloneM-A251,PE)and intracellularstainedforIFN(clone25723.11,FITC), IL-4(cloneMP425D2,APC),FOXP3(clonePCH101, Alexa647);theaboveantibodieswerefromBDBiosciences,andIL-17(clone64CAP17,PE)antibodywas frome-Biosciences.Thedatawerecollectedbyflow cytometryusingBDFACSAriaandanalyzedusing Flowjo.RT-PCRRNAwasharvestedfromcellsusingTRI-Reagent (Sigma-Aldrich)and1ugRNAwasreversetranscribed intocDNAbyusingTwo-stepAMVRT-PCRkit(Gene Choice,MD).Thefollowingprimerswereusedforthe PCR:mGAPDH,F(Forward)5 ’ -TCACCACCATGG AGAAGGC-3 ’ andR(Reverse)5 ’ -GCTAAGCAG TTGGTGGTGCA-3 ’ ;mDL1,F5 ’ -GCTCTTCCC CTTGTTCTAACG-3 ’ andR5 ’ -CACATTGTCCTC GCAGTACC-3 ’ ;Flt3L,F5 ’ -AAGGATCCGCAGGAT GAGGCCTTG-3 ’ andR5 ’ -CGGCGACAGGAG GCATGAG-3 ’ ;IL-7,F5 ’ -TTCTCGAGTTATCAG TGTTCTTTAGTG-3 ’ andR5 ’ -AAGCGGCCGCCA CCATGTTCCATGTTTCT-3 ’ ;huGAPDH,F5 ’ -CCG ATGGCAAATTCGATGGC-3 ’ andR5 ’ -GATGAC CCTTTTGGCTCCCC-3 ’ ;hLEF-1,F5'-CGACGC CAAAGGAACACTGACATC-3'andR5'-GCACGC AGATATGGGGGGAGAAA-3';hTCF-1,F5'-CGG GACAGAGGACCATTACAACTAGATCAAGGA G-3',andR5'-CCACCTGCCTCGGCCTGCCAA AGT-3';Rag-1,F5'-CAGCGTTTTGCTGAGCTC CT-3'andR5'-GGCTTTCCAGAGAGTCCTC-3'; Rag-2F5'-GCAACATGGGAAATGGAACTG-3'and R5'-GGTGTCAAATTCATCATCACCATC-3'.After 30cyclesofamplification(95Cfor30seconds,55Cfor 30seconds,and72Cfor60seconds),PCRproducts wereseparatedona2%agarosegel.Tcellreceptorexcisioncircle(TREC)analysisTheTRECandRAG2sequenceswereamplifiedby nestedPCRsusingtwoouterprimersinthefirstround PCR,followedbyaddingtwoinnerprimersinthe secondroundPCRusinggenomicDNAofPBMCsas templates,andclonedintopSTblueandverifiedby DNAsequencing.Thetwo5 ’ primersforTRECamplificationwere:outer5'-AATCTAGAGCATGTTGCT TGAACTCCTC-3',andinner5'-AATCTAGAGTAG CATAATTTCCTGGTTGAC-3';thetwo3 ’ primers forTRECamplificationwere:outer5'-AATCTAGAC CAAGGTGAATCCTCTGATC-3',andinner 5'-AATCTAGAGTCCCACACTCCGTGCTG-3'. Thetwo5 ’ primersforRAG2amplificationwere:outer 5'-AAGGATCCAGCTGTGAATTGCACAGTC-3', andinner5'-AAGGATCCGCAATCCTGACTC AAACTAAC-3';thetwo3 ’ primersforRAG2amplificationwere:outer5'-AAGGATCCAGTTGAATAG AATGGTACC-3 ’ andinner5'-AAGGATCCGTAA TCCAGTAGCCTGTCTC-3'.CelllysateswerepreparedbyproteinaseKdigestion(100 g/mL)at56Cfor 1hr,followedbyheatinactivationat95Cfor10minutes.Inbrief,1.5 Lofcelllysatesequivalentto100ng DNAor15,000cells,wereusedastemplateforPCR amplification.Thefollowingprimerswereusedforthe PCRreactionforTREC:F5 ’ -CAGAGGGGTGCC TCTGTCA-3 ’ andR5 ’ -CTGTGAAACACTCCC CAGC-3 ’ ,andRAG2:F5 ’ -TCTTGGCATACCAGG AGACA-3 ’ andR-5 ’ -AGTGGAATCCCCTGGATC TT-3 ’ .PCRconditionswere95Cfor10minutes,followedby35cyclesof95Cfor30seconds,55C(RAG2) 59C(TREC)for60seconds,72Cfor60seconds,witha finalextensionat72Cfor10minutes.PCRproducts wereanalyzedon1%agarosegel.StatisticalanalysisThestatisticalanalysiswasperformedusingStudent ’ s t -testandGRAPHPADPRISM5software.AdditionalfilesAdditionalfile1: OptimizedPCRconditionforRag2andTREC genomicDNAamplification. A, TitrationcurvesofclonedRag2and TRECtemplatesofknownconcentrations.Thestandardizationcondition wasappliedtocreatealogdilutionseriesforeachassay.Thecoefficient ofcorrelationforRag2wereR=0.9993,andforTRECR=0.9992, indicatingequalamplificationofthetemplatesoverarangeofinput DNAconcentrations. B ,Theequalandcomparableslopesestablishedfor Rag2andTRECPCR. Additionalfile2: Surfacephenotypeanalysisofthe invitro differentiatedCD4Tcells. TheTcellsdevelopedfromadultBMHPCs intheLmDL1-FL7co-culturefollowingIL-7withdrawalandanti-CD3/ CD28stimulationwereanalyzedforvarioussurfacemarkersasshownby flowcytometry,incomparisonwithcontrolPBMCs. Competinginterests Theauthorsdeclarenocompetingfinancialinterests. Authors ’ contributions ESPandLJCdesignedthestudies,carriedouttheexperimentsanddrafted themanuscript;SOandKHperformedtheantibodystainingandgenomic PCRanalyses;LJY,SKDandJSMparticipatedinthedesignofthestudy;all authorsreadandapprovedthefinalmanuscript.Patel etal.BMCImmunology 2012, 13 :46 Page13of15 http://www.biomedcentral.com/1471-2172/13/46

PAGE 15

Acknowledgements WethankS.Williams,W.Chou,Dr.ShuhongHanandYulingYehfor technicalassistance,Dr.YungChangandDr.LiziWuforcriticalcomments andreadingthemanuscript,andN.Bensonforhelpwithflowcytometry analysis.ESPwassupportedbyNIHT32graduatetraininggrant.Thestudy wassupportedbyamfARgrant107768,YonglingFoundation,andflow cytometryfundofUFShandsCancerCenter. Authordetails1DepartmentofMolecularGeneticsandMicrobiology,CollegeofMedicine, UniversityofFlorida,Gainesville,FL32610,USA.2DepartmentofPathology, ImmunologyandLaboratoryMedicine,CollegeofMedicine,Universityof Florida,Gainesville,FL32610,USA.3SectionofCytokinesandImmunity, NationalCancerInstitute,Frederick,MD32610,USA.4Departmentof Medicine,CollegeofMedicine,UniversityofFlorida,Gainesville,FL32610, USA.5DepartmentofMolecularGeneticsandMicrobiology,Universityof Florida,1600SWArcherRoad,ARBR1-252,Gainesville,FL32610,USA. Received:15March2012Accepted:20June2012 Published:16August2012 References1.StorekJ,GooleyT,WitherspoonRP,SullivanKM,StorbR: Infectious morbidityinlong-termsurvivorsofallogeneicmarrowtransplantationis associatedwithlowCD4Tcellcounts. AmJHematol 1997, 54: 131 – 138. 2.DouekDC,VescioRA,BettsMR,BrenchleyJM,HillBJ,ZhangL,BerensonJR, CollinsRH,KoupRA: Assessmentofthymicoutputinadultsafter haematopoieticstemcelltransplantationandpredictionofT-cell reconstitution. Lancet 2000, 355: 1875 – 1881. 3.vandenBrinkMRM,AlpdoganO,BoydRL: StrategiestoenhanceT-cell reconstitutioninimmunocompromisedpatients. NatRevImmunol 2004, 4: 856 – 867. 4.HengTSP,ChidgeyAP,BoydRL: Gettingbackatnature:understanding thymicdevelopmentandovercomingitsatrophy. CurrOpinPharmacol 2010, 10: 425 – 433. 5.SchmittTM,Zuniga-PfluckerJC: T-celldevelopment,doingitinadish. ImmunolRev 2006, 209: 95 – 102. 6.VanCoppernolleS,VerstichelG,TimmermansF,VelgheI,VermijlenD,De SmedtM,LeclercqG,PlumJ,TaghonT,VandekerckhoveB, etal : FunctionallymatureCD4andCD8TCR cellsaregeneratedinOP9-DL1 culturesfromhumanCD34+hematopoieticcells. JImmunol 2009, 183: 4859 – 4870. 7.AwongG,HererE,LaMotte-MohsR,Zuniga-PfluckerJ: HumanCD8Tcells generatedinvitrofromhematopoieticstemcellsarefunctionally mature. BMCImmunol 2011, 12: 22. 8.SioudM: Doesourcurrentunderstandingofimmunetolerance, autoimmunity,andimmunosuppressivemechanismsfacilitatethe designofefficientcancervaccines? ScandJImmunol 2009, 70 :516 – 525. 9.StanevskyA,ShimoniA,YerushalmiR,NaglerA: Cordbloodstemcellsfor hematopoietictransplantation. StemCellRevRep 2011, 7: 425 – 433. 10.PatelE,WangB,LienL,YangL-J,MorebJS,ChangL-J: DiverseTcell differentiationpotentialsofhumanfetalthymus,fetalliver,cordblood andadultbonemarrowCD34cellsonlentiviralDelta-like1-modified mousestromalcells. Immunology 2009, 128: e497 – e505. 11.DeSmedtM,LeclercqG,VandekerckhoveB,KerreT,TaghonT,PlumJ: T-lymphoiddifferentiationpotentialmeasuredinvitroishigherin CD34+CD38 /lohematopoieticstemcellsfromumbilicalcordbloodthanfrombonemarrowandisanintrinsicpropertyofthecells. Haematologica 2011, 96: 646 – 654. 12.OffnerF,KerreT,DeSmedtM,PlumJ: BonemarrowCD34+cellsgenerate fewerTcellsinvitrowithincreasingageandfollowingchemotherapy. BrJHaematol 1999, 104: 801 – 808. 13.DeSmedtM,HoebekeI,PlumJ: HumanbonemarrowCD34+progenitor cellsmaturetoTcellsonOP9-DL1stromalcelllinewithoutthymus microenvironment. BloodCellsMolDis 2004, 33: 227 – 232. 14.HanS,WangY,WangB,PatelE,OkadaS,YangL-J,MorebJ,ChangL-J: Ex vivodevelopment,expansionandinvivoanalysisofanovellineageof dendriticcellsfromhematopoieticstemcells. JImmuneBasedTherVaccin 2010, 8: 8. 15.RamiroAR,TriguerosC,MrquezC,SanMillnJL,ToribioML: Regulationof pre-Tcellreceptor(pTalpha-TCRbeta)geneexpressionduringhuman thymicdevelopment. JExpMed 1996, 184: 519 – 530. 16.SpitsH: Developmentof Tcellsinthehumanthymus. NatRev Immunol 2002, 2: 760 – 772. 17.BlomB,VerschurenMCM,HeemskerkMHM,BakkerAQ,vanGastel-MolEJ, Wolvers-TetteroILM,vanDongenJJM,SpitsH: TCRgenerearrangements andexpressionofthepre-TcellreceptorcomplexduringhumanT-Cell differentiation. Blood 1999, 93: 3033 – 3043. 18.PlumJ,DeSmedtM,LeclercqG: ExogenousIL-7promotesthegrowthof CD3-CD4-CD8-CD44+CD25+/ precursorcellsandblocksthe differentiationpathwayofTCR-alphabetacellsinfetalthymusorgan culture. JImmunol 1993, 150: 2706 – 2716. 19.YasudaY,KanekoA,NishijimaI,MiyatakeS,AraiK: Interleukin-7inhibits pre-T-celldifferentiationinducedbythepre-T-cellreceptorsignaland theeffectismimickedbyhGM-CSFinhGM-CSFreceptortransgenic mice. Immunology 2002, 106: 212 – 221. 20.NapolitanoLA,StoddartCA,HanleyMB,WiederE,McCuneJM: Effectsof IL-7onearlyhumanthymocyteprogenitorcellsinvitroandinSCID-hu Thy/Livmice. JImmunol 2003, 171: 645 – 654. 21.ElKassarN,LucasPJ,KlugDB,ZamischM,MerchantM,BareCV,Choudhury B,SharrowSO,RichieE,MackallCL, etal : AdoseeffectofIL-7on thymocytedevelopment. Blood 2004, 104: 1419 – 1427. 22.YuQ,ErmanB,ParkJH,FeigenbaumL,SingerA: IL-7receptorsignals inhibitexpressionoftranscriptionfactorsTCF-1,LEF-1,and RORgammat:impactonthymocytedevelopment. JExpMed 2004, 200: 797 – 803. 23.BrodeurJ-F,LiS,MartinsMS,LaroseL,DaveVP: Criticalandmultipleroles fortheCD3 e intracytoplasmictailindoublenegativetodoublepositive thymocytedifferentiation. JImmunol 2009, 182: 4844 – 4853. 24.JacobsH,VandeputteD,TolkampL,DeVriesE,BorstJ,BernsA: CD3 componentsatthesurfaceofpro-Tcellscanmediatepre-Tcell developmentinvivo. EurJImmunol 1994, 24: 934 – 939. 25.ShinkaiY,AltFW: CD3 e -mediatedsignalsrescuethedevelopmentof CD4+CD8+thymocytesinRAG-2 / miceintheabsenceofTCR chain expression. IntImmunol 1994, 6: 995 – 1001. 26.FehlingHJ,KrotkovaA,Saint-RufC,vonBoehmerH: Crucialroleofthe pre-T-cellreceptoralphageneindevelopmentofalphabetabutnot gammadeltaTcells. Nature 1995, 375: 795 – 798. 27.MichieAM,Ziga-PflckerJC: Regulationofthymocytedifferentiation: pre-TCRsignalsand -selection. SeminImmunol 2002, 14: 311 – 323. 28.TakeshitaSTM,YamagishiH: ExcisionproductsoftheTcellreceptor genesupportaprogressiverearrangementmodelofthealpha/delta locus. EMBOJ 1989, 8: 3261 – 3270. 29.PonchelF,ToomesC,BransfieldK,LeongF,DouglasS,FieldS,BellS, CombaretV,PuisieuxA,MighellA, etal : Real-timePCRbasedonSYBRGreenIfluorescence:AnalternativetotheTaqManassayforarelative quantificationofgenerearrangements,geneamplificationsandmicro genedeletions. BMCBiotechnol 2003, 3: 18. 30.vonBoehmerH: Uniquefeaturesofthepre-T-cellreceptoralpha-chain: notjustasurrogate. NatRevImmunol 2005, 5: 571 – 577. 31.PanigadaM,PorcelliniS,BarbierE,HoeflingerS,CazenaveP-A,GuH,Band H,vonBoehmerH,GrassiF: Constitutiveendocytosisanddegradationof thepre-Tcellreceptor. JExpMed 2002, 195: 1585 – 1597. 32.YamasakiS,IshikawaE,SakumaM,OgataK,Sakata-SogawaK,HiroshimaM, WiestDL,TokunagaM,SaitoT: Mechanisticbasisofpre-Tcellreceptormediatedautonomoussignalingcriticalforthymocytedevelopment. Nat Immunol 2006, 7: 67 – 75. 33.FehlingHJ,IritaniBM,KrotkovaA,ForbushKA,LaplaceC,PerlmutterRM, vonBoehmerH: RestorationofthymopoiesisinpTalpha / miceby anti-CD3epsilonantibodytreatmentorwithtransgenesencoding activatedLckortaillesspTalpha. Immunity 1997, 6: 703 – 714. 34.SchmittTM,Zuniga-PfluckerJC: InductionofTcelldevelopmentfrom hematopoieticprogenitorcellsbydelta-like-1invitro.Immunity 2002, 17: 749 – 756. 35.LaMotte-MohsR,HererE,Zuniga-PfluckerJ: InductionofT-cell developmentfromhumancordbloodhematopoieticstemcellsby Delta-like1invitro. Blood 2005, 105: 1431 – 1439. 36.AlsheikhlyA-R,ZweiriJ,WalmesleyAJ,WatsonAJM,ChristmasSE: Both solubleandmembrane-boundformsofFlt3ligandenhancetumorPatel etal.BMCImmunology 2012, 13 :46 Page14of15 http://www.biomedcentral.com/1471-2172/13/46

PAGE 16

immunityfollowing “ suicide ” genetherapyinamurinecoloncarcinoma model. CancerImmunolImmunother 2004, 53: 946 – 954. 37.OpdenakkerG,RuddP,WormaldM,DwekR,VanDammeJ: Cellsregulate theactivitiesofcytokinesbyglycosylation. FASEBJ 1995, 9: 453 – 457. 38.LevyY,LacabaratzC,WeissL,ViardJ-P,GoujardC,LelivreJ-D,BouF, MolinaJ-M,RouziouxC,Avettand-FnolV, etal : EnhancedTcellrecovery inHIV-1 – infectedadultsthroughIL-7treatment. JClinInvest 2009, 119: 997 – 1007. 39.Garca-PeydrM,deYbenesVG,ToribioML: Notch1andIL-7receptor interplaymaintainsproliferationofhumanthymicprogenitorswhile suppressingnon-Tcellfates. JImmunol 2006, 177: 3711 – 3720. 40.XiongJ,ArmatoMA,YankeeTM: Immaturesingle-positiveCD8+ thymocytesrepresentthetransitionfromNotch-dependenttoNotchindependentT-celldevelopment. IntImmunol 2011, 23: 55 – 64. 41.vonFreeden-JeffryU,VieiraP,LucianLA,McNeilT,BurdachSE,MurrayR: LymphopeniaininterleukinIL-7gene-deletedmiceidentifiesIL-7asa nonredundantcytokine. JExpMed 1995, 181: 1519 – 1526. 42.PellegriniM,CalzasciaT,ElfordAR,ShahinianA,LinAE,DissanayakeD, DhanjiS,NguyenLT,GronskiMA,MorreM, etal : AdjuvantIL-7antagonizes multiplecellularandmolecularinhibitorynetworkstoenhance immunotherapies. NatMed 2009, 15: 528 – 536. 43.PlumJ,DeSmedtM,LeclercqG,VerhasseltB,VandekerckhoveB: Interleukin-7isacriticalgrowthfactorinearlyhumanT-cell development. Blood 1996, 88: 4239 – 4245. 44.GodfreyDI,KennedyJ,MombaertsP,TonegawaS,ZlotnikA: Onsetof TCR-betagenerearrangementandroleofTCR-betaexpressionduring CD3-CD4-CD8-thymocytedifferentiation. JImmunol 1994, 152: 4783 – 4792. 45.MakiK,SunagaS,KomagataY,KodairaY,MabuchiA,KarasuyamaH, YokomuroK,MiyazakiJI,IkutaK: Interleukin7receptor-deficientmicelack gammadeltaTcells. ProcNatlAcadSciUSA 1996, 93:7172 – 7177. 46.MooreT,vonFreeden-JeffryU,MurrayR,ZlotnikA: Inhibitionofgamma deltaTcelldevelopmentandearlythymocytematurationin IL-7 / mice. JImmunol 1996, 157: 2366 – 2373. 47.MarinoJH,TanC,TaylorAA,BentleyC,VanDeWieleCJ,RanneR,Paliotta M,BroughanTA,TeagueTK: DifferentialIL-7responsesindeveloping humanthymocytes. HumImmunol 2010, 71: 329 – 333. 48.SudaT,ZlotnikA: InvitroinductionofCD8expressiononthymicpre-T cells.I.Transforminggrowthfactor-betaandtumornecrosisfactor-alpha induceCD8expressiononCD8-thymicsubsetsincludingtheCD25 +CD3-CD4-CD8-pre-Tcellsubset. JImmunol 1992, 148: 1737 – 1745. 49.GermainRN: T-celldevelopmentandtheCD4-CD8lineagedecision. NatRevImmunol 2002, 2: 309 – 322. 50.YarilinAA,BelyakovIM: Cytokinesinthethymus:productionand biologicaleffects. CurrMedChem 2004, 11: 447 – 464. 51.TakahamaY: Journeythroughthethymus:stromalguidesforT-cell developmentandselection. NatRevImmunol 2006, 6: 127 – 135. 52.CarpenterAC,BosselutR: Decisioncheckpointsinthethymus. Nat Immunol 2010, 11: 666 – 673. 53.LiW,KimMG,GourleyTS,McCarthyBP,Sant'AngeloDB,ChangCH: An alternatepathwayforCD4Tcelldevelopment:thymocyte-expressed MHCclassIIselectsadistinctTcellpopulation. Immunity 2005, 23: 375 – 386. 54.BellE: T-celldevelopment:thymocyte-selectedCD4+Tcells. NatRev Immunol 2007, 7: 748 – 749. 55.SaitoY,KametaniY,HozumiK,MochidaN,AndoK,ItoM,NomuraT, TokudaY,MakuuchiH,TajimaT, etal : Theinvivodevelopmentofhuman TcellsfromCD34+cellsinthemurinethymicenvironment. IntImmunol 2002, 14: 1113 –1124. 56.YahataT,AndoK,NakamuraY,UeyamaY,ShimamuraK,TamaokiN,KatoS, HottaT: FunctionalhumanTlymphocytedevelopmentfromcordblood CD34+cellsinnonobesediabetic/Shi-scid,IL-2receptorgammanull mice. JImmunol 2002, 169: 204 – 209. 57.HiramatsuH,NishikomoriR,HeikeT,ItoM,KobayashiK,KatamuraK, NakahataT: Completereconstitutionofhumanlymphocytesfromcord bloodCD34+cellsusingtheNOD/SCID/gammaCnullmicemodel. Blood 2003, 102: 873 – 880. 58.TraggiaiE,ChichaL,MazzucchelliL,BronzL,PiffarettiJC,LanzavecchiaA, ManzMG: Developmentofahumanadaptiveimmunesystemincord bloodcell-transplantedmice. Science 2004, 304: 104 – 107.doi:10.1186/1471-2172-13-46 Citethisarticleas: Patel etal. : Regulationof invitro humanTcell developmentthroughinterleukin-7deprivationand anti-CD3stimulation. BMCImmunology 2012 13 :46. Submit your next manuscript to BioMed Central and take full advantage of: € Convenient online submission € Thorough peer review € No space constraints or color “gure charges € Immediate publication on acceptance € Inclusion in PubMed, CAS, Scopus and Google Scholar € Research which is freely available for redistribution Submit your manuscript at www.biomedcentral.com/submit Patel etal.BMCImmunology 2012, 13 :46 Page15of15 http://www.biomedcentral.com/1471-2172/13/46


xml version 1.0 encoding utf-8 standalone no
mets ID sort-mets_mets OBJID sword-mets LABEL DSpace SWORD Item PROFILE METS SIP Profile xmlns http:www.loc.govMETS
xmlns:xlink http:www.w3.org1999xlink xmlns:xsi http:www.w3.org2001XMLSchema-instance
xsi:schemaLocation http:www.loc.govstandardsmetsmets.xsd
metsHdr CREATEDATE 2012-11-13T12:05:17
agent ROLE CUSTODIAN TYPE ORGANIZATION
name BioMed Central
dmdSec sword-mets-dmd-1 GROUPID sword-mets-dmd-1_group-1
mdWrap SWAP Metadata MDTYPE OTHER OTHERMDTYPE EPDCX MIMETYPE textxml
xmlData
epdcx:descriptionSet xmlns:epdcx http:purl.orgeprintepdcx2006-11-16 xmlns:MIOJAVI
http:purl.orgeprintepdcxxsd2006-11-16epdcx.xsd
epdcx:description epdcx:resourceId sword-mets-epdcx-1
epdcx:statement epdcx:propertyURI http:purl.orgdcelements1.1type epdcx:valueURI http:purl.orgeprintentityTypeScholarlyWork
http:purl.orgdcelements1.1title
epdcx:valueString Regulation of in vitro human T cell development through interleukin-7 deprivation and anti-CD3 stimulation
http:purl.orgdctermsabstract
Abstract
Background
The role of IL-7 and pre-TCR signaling during T cell development has been well characterized in murine but not in human system. We and others have reported that human BM hematopoietic progenitor cells (HPCs) display poor proliferation, inefficient double negative (DN) to double positive (DP) transition and no functional maturation in the in vitro OP9-Delta-like 1 (DL1) culture system.
Results
In this study, we investigated the importance of optimal IL-7 and pre-TCR signaling during adult human T cell development. Using a modified OP9-DL1 culture ectopically expressing IL-7 and Fms-like tyrosine kinase 3 ligand (Flt3L), we demonstrated enhanced T cell precursor expansion. IL-7 removal at various time points during T cell development promoted a slight increase of DP cells; however, these cells did not differentiate further and underwent cell death. As pre-TCR signaling rescues DN cells from programmed cell death, we treated the culture with anti-CD3 antibody. Upon pre-TCR stimulation, the IL-7 deprived T precursors differentiated into CD3+TCRαβ+DP cells and further matured into functional CD4 T cells, albeit displayed a skewed TCR Vβ repertoire.
Conclusions
Our study establishes for the first time a critical control for differentiation and maturation of adult human T cells from HPCs by concomitant regulation of IL-7 and pre-TCR signaling.
http:purl.orgdcelements1.1creator
Patel, Ekta S
Okada, Starlyn
Hachey, Kevin
Yang, Li-jun
Durum, Scott K
Moreb, Jan S
Chang, Lung-Ji
http:purl.orgeprinttermsisExpressedAs epdcx:valueRef sword-mets-expr-1
http:purl.orgeprintentityTypeExpression
http:purl.orgdcelements1.1language epdcx:vesURI http:purl.orgdctermsRFC3066
en
http:purl.orgeprinttermsType
http:purl.orgeprinttypeJournalArticle
http:purl.orgdctermsavailable
epdcx:sesURI http:purl.orgdctermsW3CDTF 2012-08-16
http:purl.orgdcelements1.1publisher
BioMed Central Ltd
http:purl.orgeprinttermsstatus http:purl.orgeprinttermsStatus
http:purl.orgeprintstatusPeerReviewed
http:purl.orgeprinttermscopyrightHolder
Ekta S Patel et al.; licensee BioMed Central Ltd.
http:purl.orgdctermslicense
http://creativecommons.org/licenses/by/2.0
http:purl.orgdctermsaccessRights http:purl.orgeprinttermsAccessRights
http:purl.orgeprintaccessRightsOpenAccess
http:purl.orgeprinttermsbibliographicCitation
BMC Immunology. 2012 Aug 16;13(1):46
http:purl.orgdcelements1.1identifier
http:purl.orgdctermsURI http://dx.doi.org/10.1186/1471-2172-13-46
fileSec
fileGrp sword-mets-fgrp-1 USE CONTENT
file sword-mets-fgid-0 sword-mets-file-1
FLocat LOCTYPE URL xlink:href 1471-2172-13-46.xml
sword-mets-fgid-1 sword-mets-file-2 applicationpdf
1471-2172-13-46.pdf
sword-mets-fgid-3 sword-mets-file-3 imagetiff
1471-2172-13-46-S1.TIFF
sword-mets-fgid-4 sword-mets-file-4
1471-2172-13-46-S2.TIFF
structMap sword-mets-struct-1 structure LOGICAL
div sword-mets-div-1 DMDID Object
sword-mets-div-2 File
fptr FILEID
sword-mets-div-3
sword-mets-div-4
sword-mets-div-5


!DOCTYPE art SYSTEM 'http:www.biomedcentral.comxmlarticle.dtd'
ui 1471-2172-13-46
ji 1471-2172
fm
dochead Research article
bibl
title
p Regulation of it in vitro human T cell development through interleukin-7 deprivation and anti-CD3 stimulation
aug
au id A1 snm Patelmi Sfnm Ektainsr iid I1 email ektaspatel01@gmail.com
A2 OkadaStarlynhoshi@ufl.edu
A3 HacheyKevinkahachey@gmail.com
A4 YangLi-junI2 yanglj2007@gmail.com
A5 DurumKScottI3 durums@mail.nih.gov
A6 MorebSJanI4 Jan.Moreb@medicine.ufl.edu
A7 ca yes ChangLung-JiI5 lchang@mgm.ufl.edu
insg
ins Department of Molecular Genetics and Microbiology, College of Medicine, University of Florida, Gainesville, FL, 32610, USA
Department of Pathology, Immunology and Laboratory Medicine, College of Medicine, University of Florida, Gainesville, FL, 32610, USA
Section of Cytokines and Immunity, National Cancer Institute, Frederick, MD, 32610, USA
Department of Medicine, College of Medicine, University of Florida, Gainesville, FL, 32610, USA
Department of Molecular Genetics and Microbiology, University of Florida, 1600 SW Archer Road, ARB R1-252, Gainesville, FL, 32610, USA
source BMC Immunology
section Cellular immunology and immune regulationissn 1471-2172
pubdate 2012
volume 13
issue 1
fpage 46
url http://www.biomedcentral.com/1471-2172/13/46
xrefbib pubidlist pubid idtype doi 10.1186/1471-2172-13-46pmpid 22897934
history rec date day 15month 3year 2012acc 2062012pub 1682012
cpyrt 2012collab Patel et al.; licensee BioMed Central Ltd.note This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
kwdg
kwd T cell development
Interleukin-7
T cell receptor
Vbeta repertoire
abs
sec
st
Abstract
Background
The role of IL-7 and pre-TCR signaling during T cell development has been well characterized in murine but not in human system. We and others have reported that human BM hematopoietic progenitor cells (HPCs) display poor proliferation, inefficient double negative (DN) to double positive (DP) transition and no functional maturation in the in vitro OP9-Delta-like 1 (DL1) culture system.
Results
In this study, we investigated the importance of optimal IL-7 and pre-TCR signaling during adult human T cell development. Using a modified OP9-DL1 culture ectopically expressing IL-7 and Fms-like tyrosine kinase 3 ligand (Flt3L), we demonstrated enhanced T cell precursor expansion. IL-7 removal at various time points during T cell development promoted a slight increase of DP cells; however, these cells did not differentiate further and underwent cell death. As pre-TCR signaling rescues DN cells from programmed cell death, we treated the culture with anti-CD3 antibody. Upon pre-TCR stimulation, the IL-7 deprived T precursors differentiated into CD3sup +TCRαβ+DP cells and further matured into functional CD4 T cells, albeit displayed a skewed TCR Vβ repertoire.
Conclusions
Our study establishes for the first time a critical control for differentiation and maturation of adult human T cells from HPCs by concomitant regulation of IL-7 and pre-TCR signaling.
bdy
Background
Generation of mature human T cells from adult bone marrow (BM) CD34+HPCs in vitro may overcome two major limitations in T cell therapy, namely HLA disparity and immune tolerance. Patients undergoing chemotherapy or with HIV infection suffer from prolonged lymphodepletion leading to opportunistic infections and mortality abbrgrp
abbr bid B1 1
. Hematopoietic stem cell transplant (HSCT) has been used to reconstitute the immune system in such patients
B2 2
. However, T cells take the longest time to recover after HSCT
2
. Thus ex vivo differentiation of T cells using an in vitro OP9 stromal cell line expressing Notch ligand, Delta like-1 (DL1), has been of tremendous interest
B3 3
B4 4
B5 5
. Recent reports showed that the OP9DL1 stromal cell culture system established by Zuniga-Pflucker can support terminal maturation of cord blood (CB) and post natal thymus derived CD34+HPCs
B6 6
B7 7
. In case of immune rejection of CB HPCs due to HLA disparity or limited availability, BM CD34+HPCs may serve as a convenient source as they can be obtained from patient’s own BM
B8 8
B9 9
. We and others have demonstrated that adult BM-derived CD34+HPCs, from both normal adults and patients undergoing chemotherapy, yields a low number of T cell precursors in vitro
B10 10
B11 11
B12 12
. T cell development of adult human BM derived CD34+HPCs in the OP9 DL1 culture system is less well studied due to low cellular yields when compared to the CB counterparts. In addition, terminal T cell differentiation from adult human BM derived CD34+HPCs in vitro has not yet been demonstrated
10
B13 13
.We have previously reported that lentivector-modified OP9 cell lines expressing various cytokines and growth factors supported enhanced HPC and dendritic cell precursor expansion and differentiation
B14 14
. To overcome the limited proliferation of BM HPCs in vitro, we modified a previously defined LmDL1 cell line (Lentivector-modified OP9 expressing DL1)
10
, to ectopically express T cell developmental factors IL-7 and Flt3L, and established LmDL1-FL7 cell line. We found that LmDL1-FL7 provided a proliferative advantage to adult BM CD34+HPCs over LmDL1 cell line supplemented with soluble recombinant hIL-7 and hFlt3L.During T cell development, the CD34+CD8-CD4- double negative (DN) thymocytes differentiate through CD3-CD8+ immature single positive stage (ISP) in mice and CD3-CD4+ ISP in humans, followed by CD3loCD4+CD8+ double positive (DP), CD3+TCRαβ+DP and then CD3+TCRαβ+CD4+ or CD8+ mature single positive T cells
B15 15
B16 16
. We observed that the transition of CD3lo DP to CD3+TCRαβ+ DP stage, an intermediate stage that precedes the terminal maturation to CD8 or CD4 T cell lineage, is inefficient during adult BM T cell development in vitro
B17 17
. IL-7 plays an inhibitory role during DN to DP transition in mice
B18 18
B19 19
B20 20
B21 21
B22 22
and signaling via CD3/Pre-TCR complex plays a permissive role in transition from CD3lo DP to CD3+ TCRαβ+ DP
B23 23
B24 24
B25 25
. Thus, we hypothesized that the inefficient pre-TCR signaling is either due to continued presence of IL-7 or due to inefficient stimulation via CD3 receptor. Here we report that intermittent IL-7 withdrawal alone did not result in efficient differentiation to CD3+TCRαβ+ DP stage. Importantly, taking a combination approach of IL-7 withdrawal and activating pre-TCR signaling using anti-CD3/CD28 antibodies, we demonstrate for the first time in vitro differentiation of adult BM HPCs to CD3+TCRαβ+ DP stage and subsequent functional maturation of CD4 T cells. Our findings provide a better understanding of the factors involved in proliferation and differentiation of BM derived HPCs to mature T cells in vitro.
Results
OP9-DL1 cells ectopically expressing Flt3L and IL-7 support enhanced T cell precursor expansion
The previously established mouse OP9-DL1 cell line, LmDL1
10
, was infected with lentivectors expressing human Flt3L, or both Flt3L and IL-7, to generate LmDL1-FL and LmDL1-FL7 cell lines, respectively (Figure figr fid F1 1A). RNA was harvested and analyzed by semi-quantitative RT-PCR to confirm transgene expression in these cell lines (Figure 1B). We confirmed surface expression of DL1 on all three cell lines, LmDL1, LmDL1-FL and LmDL1-FL7 (Figure 1C). Both LmDL1-FL and LmDL1-FL7 expressed high levels of Flt3L on cell surface and in culture as determined by flow cytometry and ELISA, respectively (Figure 1D). The secretion of IL-7 by LmDL1-FL7 was measured via ELISA to be in the range of 10–14 ng/mL after 48 hr of culture (Figure 1E).
fig Figure 1caption Enhanced proliferation of T cell precursors on LmDL1-FL7text
b Enhanced proliferation of T cell precursors on LmDL1-FL7.A, Lentivector constructs expressing mouse DL1, human IL-7 and human Flt3L. B, qRT-PCR analysis for DL-1, Flt3L, and IL-7. C &D, Flow cytometry analysis of mDL-1 (C) and Flt3L (D) surface expression in the various OP9 cell lines. ELISA analyses for Flt3L (D) and IL-7 (E) production. F, Growth kinetics of developing T cells from adult human BM-derived CD34+ HPCs on LmDL + IL-7 + Flt3L versus LmDL1-FL7 with p value indicated.
graphic file 1471-2172-13-46-1 To examine the differentiation and expansion potential of adult human BM CD34+ HPCs co-cultured with LmDL1 exogenously supplemented with recombinant human Flt3L (5 ng/mL) and IL-7 (5 ng/mL), or co-cultured with LmDL1-FL7, we determined the proliferation rate of the incubated cells by counting total number of suspension cells at various time points in three independent experiments. The result showed that CD34+ HPCs cells, when co-cultured with LmDL1-FL7 for 35 days, expanded up to five fold more than those co-cultured with LmDL1 supplemented with recombinant Flt3L and IL-7 (Figure 1F, representative of three donors). Thus, LmDL1-FL7 was superior to LmDL1 in supporting T cell precursor proliferation.
Adult BM CD34+ HPCs co-cultured on LmDL1-FL7 or LmDL1 supplemented with IL-7 and Flt3L follow similar T cell differentiation kinetics but do not undergo functional T cell maturation
Next, we analyzed surface expression of CD8, CD4, CD7, CD1a, CD3, TCRαβ and TCRγδ of the differentiating cells in the two co-culture systems. Kinetics of CD8, CD4, CD7 and CD1a were comparable between the two systems. We observed CD4 ISP from day 5 (not shown) to day 15, and increased CD8 ISP after day 20 (Figure F2 2). T cell lineage commitment from HPCs is defined by upregulation of CD7, followed by CD1a expression which is decreased upon further maturation. A schematic illustration of the predicted key events and phenotypes of developing T cell precursors is shown at top of Figures 2 and F3 3. We detected surface CD7 on day 15 (data not shown), and peaked expression of CD7 and CD1a around day 42, followed by a gradual decrease of CD1a. Due to the low cell number in the LmDL1 + IL-7 + Flt3L coculture, we had limited cells for analysis in the early time points. In both systems, DP cells appeared around day 35 and decreased by day 56. The timing of appearance of CD8 ISP and DP varied depending on the donor, and was similar between the two systems. The rapid expansion of T cell precursors in co-culture with LmDL1-FL7, which continuously produced Flt3L and IL-7, was accompanied by a slower transition into DP and CD3 positive stage, as both DP cells and CD3 surface expression were detected at lower levels in LmDL1-FL7 co-culture than in LmDL1 + IL-7 + Flt3L coculture (Figures 2 & 3). Nevertheless, neither system produced CD3hiTCRhi CD4 or CD8 cell population (Figure 3). The analysis of TCRγδ surface markers detected no γδ lineage diversification in LmDL1-FL7 co-culture but some in LmDL1 + IL-7 + Flt3L (Figure 3 bottom). Thus, we conclude that no functionally mature T cells could be generated from the adult BM-derived CD34+ HPCs in the in vitro cultures.
Figure 2Flow cytometry analyses of expression kinetics of CD8, CD4, CD7, and CD1a of the developing T cells under LmDL1 + IL-7 + Flt3L or LmDL1-FL7 co-culture condition
Flow cytometry analyses of expression kinetics of CD8, CD4, CD7, and CD1a of the developing T cells under LmDL1 + IL-7 + Flt3L or LmDL1-FL7 co-culture condition. Schematic illustration of key stages of T cell development is shown at top. Adult human BM CD34+ HPCs were plated on LmDL1-FL7 or LmDL1 + IL-7 + Flt3L and surface expression of CD8, CD4, CD7 and CD1a was examined over time as depicted. The percentages of stained cells are indicated in the flow graph quadrons. ND, not done, due to insufficient amount of developing T cells from the early time points of the LmDL1 + IL-7 + Flt3L coculture.
1471-2172-13-46-2
Figure 3Flow cytometry analyses of expression kinetics of CD3, TCRαβ and TCRγδ of the developing T cells under LmDL1 + IL-7 + Flt3L or LmDL1-FL7 co-culture condition
Flow cytometry analyses of expression kinetics of CD3, TCRαβ and TCRγδ of the developing T cells under LmDL1 + IL-7 + Flt3L or LmDL1-FL7 co-culture condition. Schematic illustration of key stages of T cell development is shown at top. T cell markers CD3, TCRαβ, and TCRγδ were analyzed for the developing T cells under the two different co-culture conditions up to 56 days. ND, not done, due to insufficient amount of developing T cells from the early time points of the LmDL1 + IL-7 + Flt3L coculture.
1471-2172-13-46-3
IL-7 deprivation alone does not induce efficient DN to DP transition
In murine T cell development, IL-7 plays a negative role during transition of DN to DP T cells
18
19
20
21
22
. Human thymocytes have been reported to lose IL-7 dependency upon reaching CD7/CD1a DP stage
20
. We found that day 21 cells were always negative for CD1a expression; hence we chose this time point for IL-7 deprivation to ensure that the cells were in IL-7 dependent phase of development. To assess the effect of IL-7 deprivation on DN to DP transition, we cultured adult CD34+ HPCs on LmDL1-FL7 for 21 days, followed by continued presence (IL-7 present) or deprivation (IL-7 deprived) of IL-7, i.e., on LmDL1-FL7 or LmDL1-Flt3L, for additional 10–15 days and analyzed the expression of CD7, CD1a, CD4, CD8, CD3, TCRαβ and TCRγδ. We observed a decline in cell survival post IL-7 withdrawal indicative of IL-7 dependence (Figure F4 4A, open circles). We detected an increase in IL-7Ra expression upon IL-7 withdrawal (LmDL1-Flt3L or LmDL1 +Flt3L, IL-7 deprived, Figure 4 B, C, far right). Additionally, we observed an increase in percentage of DP cells; however, these cells lacked CD3hi TCRαβhi phenotype (Figure 4 B, C). Thus, IL-7 deprivation alone is not sufficient to induce CD3hi TCRαβhi DP transition of adult human T cell precursors on the OP9 culture system.
Figure 4The effect of IL-7 withdrawal on T cell differentiation
The effect of IL-7 withdrawal on T cell differentiation. Adult BM CD34+ HPCs were co-cultured on LmDL1-FL7 for 21 days and continued on LmDL-FL7 (IL-7 present) or transferred to LmDL-Flt3L (IL-7 deprived) for additional nine days. A, Growth curves for the developing T cells in the presence or absence of IL-7 after day 21. The cell growth declined markedly upon IL-7 removal at day 21 (depicted by open circles, data represents 4 independent experiments). B, Analysis of T cell markers in the T cell development cultures with or without IL-7 withdrawal after day 21. C, Summary of flow cytometry analysis of surface marker CD4CD8DP, CD4, and IL-7Ra in the developing T cells with (LmDL1-FL7) or without IL-7 (LmDL1-Flt3L), and p values were determined as shown.
1471-2172-13-46-4
IL-7 withdrawal does not increase T cell receptor excision circle (TREC) in the developing T cell precursors
During T cell development, DN T cell precursors rearrange their TCR beta chain first, which is expressed with pre-TCR alpha to form a pre-TCR complex
B26 26
. Signaling via Pre-TCR complex results in allelic exclusion at TCRβ locus, but initiates rearrangement at the TCRα locus and promotes DP transition
B27 27
. Rearrangement at the TCRα locus can be evaluated by the presence of TREC, an episomal circular piece of DNA formed due to excision of delta locus upon TCRα rearrangement
B28 28
. In order to assess the frequency of αβ precursors, we analyzed TREC content in the developing T cell precursors by genomic PCR. The results showed that cells from day 0 and day 25 were negative, but from day 30 were positive for TREC (Figure F5 5A). We quantified TREC via quantitative PCR analysis using cloned TREC and RAG2 as standards (Additional file supplr sid S1 1)
B29 29
. Our results showed that < 1% cells were positive for TREC on Day 30, and IL-7 deprivation had no effect on TREC content (Figure 5B). RT-PCR analysis of RNAs showed that this was not due to the lack of RAG or TCF1/LEF gene expression (Figure 5C). This result suggests that only a small percent of cells underwent rearrangement at TCRα locus in the in vitro system.
suppl
Additional file 1
Optimized PCR condition for Rag2 and TREC genomic DNA amplification.
A, Titration curves of cloned Rag2 and TREC templates of known concentrations. The standardization condition was applied to create a log dilution series for each assay. The coefficient of correlation for Rag2 were R = 0.9993, and for TREC R = 0.9992, indicating equal amplification of the templates over a range of input DNA concentrations. B, The equal and comparable slopes established for Rag2 and TREC PCR.
name 1471-2172-13-46-S1.tiff
Click here for file
Figure 5TCR rearrangement in developing T cell precursors in LmDL1-FL7 co-culture
TCR rearrangement in developing T cell precursors in LmDL1-FL7 co-culture.A, TREC analysis in developing T cells. PCR analysis for TREC and Rag2 was performed using genomic DNA harvested at the indicated time points from co-cultures under different IL-7 conditions. B, Quantitative PCR analysis of TREC-positive cells in developing T cells. SYBR Green quantitative PCR analysis of TREC was performed using genomic DNA isolated from T cell precursors under indicated culture conditions. C, Analyses of Rag1, Rag2, TCF1 and LEF RNA expression. The expression of the indicated genes was detected by RT-PCR using 1ug of mRNA harvested from day 30 of the developing T cell precursors.
1471-2172-13-46-5
Adult human HPCs can differentiate to DP T cells and adopt a CD4 T cell lineage in vitro upon IL-7 deprivation followed by anti-CD3 stimulation
Signaling via pre-TCR complex, composed of TCRβ, pre-TCRα and CD3 is crucial for αβ T cell development
27
B30 30
. Pre-TCR is thought to signal in a ligand independent fashion, possibly through oligomerization
B31 31
B32 32
. Pre-TCR signaling can be mimicked by anti-CD3 antibody stimulation, as in vivo administration of anti-CD3 antibody induces DN to DP transition in Rag2−/− pre-Tα−/− mice
25
B33 33
. Also, treatment of fetal thymus organ culture (FTOC) from TCRβ−/−, Rag2−/− or SCID mice with anti-CD3 antibodies induces DN to DP transition
24
25
. Thus, we tested if anti-CD3 stimulation of T cell precursors obtained from LmDL co-cultures can induce differentiation to DP stage. In order to maximize cell-cell contact for efficient stimulation, we transferred cells of both IL-7 present and IL-7 deprived groups to U bottom 96 well plates, in a stromal cell free environment and supplemented with anti-CD3/CD28 antibody-conjugated beads. We found that IL-7 deprived precursors proliferated upon anti-CD3 engagement but IL-7 present group did not, as demonstrated by the fold increase in cell number and intracellular Ki67 staining (Figure F6 6 A, B). On the other hand, TCR activation of the IL-7 present group did not induce proliferation. Additionally, percentage of TREC positive cells increased to ~13% in the IL-7 deprived, anti-CD3 stimulated group of cells, indicating increased TCRα rearrangement (Figure 6C).
Figure 6Increased proliferation and TCR rearrangement of developing T cells upon concomitant IL-7 removal and anti-CD3/CD28 co-stimulation
Increased proliferation and TCR rearrangement of developing T cells upon concomitant IL-7 removal and anti-CD3/CD28 co-stimulation. Adult human HPCs were co-cultured on LmDL1-FL7 for 21 days and continued on LmDL-FL7 (IL-7 present) or transferred to LmDL-Flt3 (IL-7 deprived) for an additional nine days. A, Diminished precursor T cell growth upon continued presence of IL-7. Day 21 T precursor cells under IL-7 present or deprived conditions were stimulated using anti-CD3/CD28 beads for an additional two weeks. The fold increases in cell number were determined and significant difference was observed between the two groups (n =5, P = 0.006). B, Intracellular staining for Ki67 of the developing T cells with or without IL-7 and stimulated by anti-CD3/CD28 Ab beads. Un-stimulated and stimulated PBMCs from healthy donors were included as controls. C, Quantitative PCR analysis of TREC positive cells in the developing T cell population after IL-7 deprivation and anti-CD3/28 co-stimulation, as compared with control PBMC from healthy donors.
1471-2172-13-46-6 We next examined T cell maturation markers 2 weeks post stimulation after deprivation of IL-7. We observed low CD3 expression and no TCRαβ expression in IL-7 present and anti-CD3 stimulated group (Figure F7 7A, i & iii). Interestingly, anti-CD3 stimulated cells from the IL-7 deprived group displayed a robust transition from CD3loTCRαβloDP to CD3+TCRαβ+DP and CD4+ SP T cells (Figure 7, ii & iv). Additionally, we found that the cells were mostly negative for CD56 NK cell marker expression (Additional file S2 2). The timing of IL-7 deprivation and anti-CD3 stimulation was critical, as IL-7 deprivation post day 35 and subsequent anti-CD3 simulation did not induce T cell differentiation and maturation (data not shown). Thus, we conclude that IL-7 deprivation is necessary but not sufficient to promote DP transition and subsequent anti-CD3 stimulation plays a critical role in T cell maturation. To see if the in vitro developed CD4 T cells were functional T cells, we further assessed effector functions by IFN-γ, IL-17 and IL-4 secretion in response to PMA and ionomycin. The results showed that upon stimulation, the in vitro derived CD4 T cells displayed effector T cell functions similar to that of peripheral blood CD4 T cells (Figure 7B).
Additional file 2
Surface phenotype analysis of the
in vitro
differentiated CD4 T cells. The T cells developed from adult BM HPCs in the LmDL1-FL7 co-culture following IL-7 withdrawal and anti-CD3/CD28 stimulation were analyzed for various surface markers as shown by flow cytometry, in comparison with control PBMCs.
1471-2172-13-46-S2.tiff
Click here for file
Figure 7In vitro maturation and functional analysis of CD4 SP T cells upon IL-7 deprivation and anti-CD3/CD28 co-stimulation in the absence of stromal cell environment
In vitromaturation and functional analysis of CD4 SP T cells upon IL-7 deprivation and anti-CD3/CD28 co-stimulation in the absence of stromal cell environment.A, Analysis of T cell development kinetics upon IL-7 removal. Diagram of key events and markers for precursor T cell development is illustrated at top. Adult HPCs were co-cultured with stromal cells for 21 days and continued on with IL-7 (IL-7 present, i and iii) or transferred to culture without IL-7 (IL-7 deprived, ii and iv) for an additional 17 days. The cells were then transferred to 96 well U bottom plates and stimulated with anti-CD3/CD28 beads for an additional 14 days. Representative results of analysis of T cell surface markers two weeks after stimulation are shown with percentage of cells indicated in the flow graph quadrons. The percentages of CD4+CD3+TCRαβ+ cell population of four independent T cell development experiments are shown. B, Analysis of effector functions of the in vitro-derived CD4 T cells. PBMCs of healthy donors and the in vitro-derived CD4 T cells were stimulated using anti-CD3/CD28 beads in the presence of IL-2, IL-7 and IL-15 for two weeks. Expression of intracellular effector cytokine (IFNγ) and T helper functional markers (IL-4, IL-17) was detected after Brefeldin A treatment; unstimulated (left panel) or PMA and ionomycin stimulated (right panel) cells were analyzed by antibody staining and flow cytometry. Note that the small percentage of in vitro-derived CD8+ cells were not CD3+ or viable propagating cells.
1471-2172-13-46-7
Vβ repertoire analysis of the in vitro generated CD4 T cells
To evaluate the TCR diversity of the in vitro-derived T lymphocytes, we performed Vβ repertoire analysis for 23 Vβ families of human TCR. The in vitro derived CD4+ SP T cells were stained with the IOTest® panel of antibodies. The majority of the in vitro differentiated T cells from adult BM HPCs (four of five different donors) displayed a skewed Vβ distribution pattern, e.g. increased populations of Vβ 13.2, 9, 20, 5.1, and 8, respectively, (Donors 1 to 4, marked by in Figure F8 8A) as compared with the control PBMCs, which showed an evenly distributed pattern. Note that one of the in vitro derived T cells, donor 5, showed a less skewed Vβ distribution pattern. The quantitative analysis of multiple samples is summarized in Figure 8B. We further examined Vβ distributions of healthy donor PBMCs stimulated by anti-CD3/CD28 Ab or PHA for three weeks, and demonstrated that the entire CD4 Vβ clones were evenly expanded without substantial skewing (not shown). Together, we found that the Vβ repertoires of the in vitro-derived CD4 T lymphocytes were highly restricted compared with those of normal adult CD4 T cells.
Figure 8Vβ repertoire analysis of the in vitro-derived CD4 T cells
Vβ repertoire analysis of thein vitro-derived CD4 T cells. After anti-CD3/28 stimulation, the in vitro-derived CD4 T cells were surface stained for 24 Vβ families using the IOTest® Beta Mark TCR Vβ Repertoire Kit. CD3-gated population was evaluated for the expression of Vβ families of protein. A, TCR Vβ analysis of in vitro developed CD4 T cells of five CD34+ HPC donors versus a control PBMC. B, Summary analysis of Vβ distributions of four control PBMCs versus five in vitro derived CD4 T cells.
1471-2172-13-46-8
Discussion
In vitro adult human BM HPC-derived functional T cells have great potential for therapeutic applications, as this approach provides donor HLA-matched T cells that may be genetically engineered to fight infections, cancer or to treat immunodeficiencies. Murine HPCs, human CB and post-natal thymic HPCs undergo full maturation in the OP9-DL1 culture system
B34 34
B35 35
. However, adult human BM HPCs undergo limited proliferation and are arrested at CD3loCD4+CD8+ DP stage of T cell development
10
13
. In this report, we demonstrated that cell-based IL-7 and Flt3L provided a proliferative advantage to adult BM HPCs over exogenously supplemented recombinant IL-7 and Flt3L. We then took a combination approach of IL-7 withdrawal and activating pre-TCR signaling using anti-CD3/CD28 antibodies, which successfully overcame the arrest in CD3loCD4+CD8+ DP stage and induced differentiation to CD3+TCRαβ+CD4+CD8+ DP stage, and subsequent maturation to CD4 T cells. Our findings provide a better understanding of the factors involved in proliferation and differentiation of adult BM-derived HPCs in vitro.LmDL1-FL7 was superior in supporting T cell precursor proliferation when compared to LmDL1 supplemented with exogenous Flt3L and IL-7. The mechanism that enhanced precursor proliferation on LmDL1-FL7 remains to be elucidated. It is possible that concentration or cell-based modifications, or both, could contribute to the enhanced proliferation. As all three cell lines, LmDL1, LmDL1-FL and LmDL1-FL7 expressed high levels of mDL1 (Figure 1), differential DL1 expression level does not seem to play a role. Flt3L is expressed as a soluble as well as membrane bound form
B36 36
, and glycosylated form of IL-7 has been reported
B37 37
. Besides soluble factors, cell-cell interactions play a critical role in T cell development. Our results appear to point to the importance of cell-based modification of cytokines, as use of glycosylated IL-7 for clinical trials is being considered
B38 38
. Previous studies demonstrated that a high dose of IL-7 has a modest effect on increasing the absolute cell number during T cell development
18
21
. These studies support our view that exogenously added cytokine dose has limited effects on T cell development.While the T cell development potential such as occurrence of CD8 ISP and DP cells were comparable for both culture systems, some differences exist, such as CD3 expression and development of TCRγδ cells. Cell-free or cell-cell signaling of the cytokines may account for the differences in proliferation and differentiation of the two systems. Nevertheless, differentiation to DP stage was inefficient and neither system supported terminal T cell maturation. Under both culture conditions, precursor proliferation rate declined beyond 30–35 days suggesting a discontinued dependence for IL-7 and Notch signals, consistent with previous reports
B39 39
B40 40
, as such, this culture system alone does not support continued differentiation of adult human T cell precursors to CD3 and TCRαβ-bearing DP cells.Signaling through IL-7/IL-7R supports survival and proliferation through DN3 stage in murine T cell development and the same is true for human T cell development
20
B41 41
. In transgenic mice, expression of IL-7 under the control of lck promoter at low levels enhances proliferation of developing αβ T cells, but at high levels, it reduces proliferation and displays a marked block in DP transition
21
. Recent studies further support that IL-7R signals impair differentiation of CD8 ISP to DP cells in Zap70−/− and IL-7Rα transgenic mice
22
, and IL-7R signals inhibit the expression of HMG domain transcription factors TCF-1, LEF-1 and RORγt, factors important for pre-T to DP transition
22
. In addition, IL-7 suppresses anti-CD3 antibody induced differentiation to DP stage in fetal thymus organ culture of Rag1-deficient mice
19
. Thus, we hypothesized that IL-7 withdrawal prior to ISP might be necessary for efficient DP transition. While IL-7 has been reported to display an inhibitory role in DP transition in murine T cell development, our results showed that the intermittent removal of IL-7 in the in vitro co-culture only had a minimal effect on human T cell DP transition.The mechanism by which IL-7 inhibits T cell development is unclear. We observed abundant transcripts of TCF and LEF in T cell precursors at various time points. Thus, it seems unlikely that IL-7 withdrawal promotes T cell development by de-repressing transcription of the above factors. Our data suggest that IL-7 does not inhibit TREC formation, neither does it directly inhibit pre-TCR signaling. Interestingly, an increase in CD4 surface expression post IL-7 withdrawal may play a role in how these cells respond to anti-CD3 stimulation. As in human T cell development, CD4ISP precede DP stage, it is possible that increased CD4 may account for increased responsiveness to anti-CD3 stimulation. Alternative possibilities are, IL-7 mediates its effect through STAT-5 on transcription of genes necessary for pre-TCR expression and function, directly inhibits pre-TCR activation, or interferes with the TGFβ signaling pathway
B42 42
. Detailed evaluation of these possibilities requires further investigation.IL-7 mediates survival and proliferation of DN thymocytes
B43 43
. In addition, IL-7 is required for TCRγδ gene rearrangement and also induces TCRβ chain rearrangement
B44 44
B45 45
B46 46
. In order to progress to the next DP maturation stage, DN/ISP thymocytes must seize the rearrangement and express a functional TCRγδ or TCRαβ
17
. It is known that signaling via a functional TCR mediates allelic exclusion, survival and progression to SP stage
27
. Interestingly, in mice IL-7 signaling is inhibited at DP stage by down-regulating the IL-7Rα. In humans, IL-7R is expressed but its binding partner γC is down-regulated and STAT-5 responsiveness is lost
B47 47
. Hence it is tempting to speculate that IL-7 signaling down-regulation might be an additional way of terminating rearrangement and preventing survival of T cells with non-functional TCRs. As both IL-7 and TCR signaling deliver survival signals, the down-regulation of IL-7 signaling ensures shutdown of an alternative survival pathway and selects for cells that respond to TCR signals. Clearly, the change in IL-7/IL-7R signaling is physiologically important and the reason for such regulation might reside on the intracellular signaling of IL-7/IL-7R on T cell activation and fate decision: proliferation, death or differentiation.During T cell development, the appearance of ISP is dominated by CD4 ISP in human and CD8 ISP in mouse; pre-TCR signals drive proliferation, TCRα rearrangement, followed by the appearance of CD8 ISP in mouse and CD4 ISP in human. Interestingly, we observed CD8 ISP derived from human CD34 HPCs in vitro; we found a lack of proliferative burst and minimal rearrangement in the TCRα locus. Thus, the CD8 ISP may not be true ISP generated by pre-TCR signals, rather a result of cytokine-mediated CD8 expression
B48 48
.T cell development is a complex process that involves multiple checkpoints and three-dimensional architecture composed of multiple cell types and compartments
B49 49
B50 50
B51 51
B52 52
. Our results, as summarized in Figure F9 9, demonstrate that signaling via CD3 and cell-cell contact was sufficient to drive differentiation to DP and subsequent CD4 lineage commitment in the absence of thymic environment. As OP9 cells do not express class II MHC molecules but the developing human thymocytes do (data not shown), the resulting CD4 cells are most likely selected by self MHC of the developing thymocytes. This alternate pathway of CD4 T cell development has been reported previously, especially in human T cell development
B53 53
B54 54
. Our study is in agreement with recent reports demonstrating that human HPCs when transplanted into immune compromised mice, can develop into CD4 T cells
B55 55
B56 56
B57 57
B58 58
. Such T cell development can occur via thymocyte-mediated selection, and does not require the presence of professional antigen presenting cells or epithelial cells expressing MHC-II. The human CD4 T cells derived from NOD/SCID γC−/− mice receiving transplanted human HPCs display diverse v beta repertoire
56
57
. However, we found reduced diversity under the in vitro system illustrated by highly skewed vβ repertoire in most occasions. The three-dimensional environment in vivo, and the HLA expression on thymocytes may account for such differences. It is possible that TCRβ rearrangement and β selection events are inefficient in this system and the rare cells with properly arranged TCRs are selected upon anti-CD3 stimulation. Although one could challenge that expansion of contaminating T cells in the initial source of BM CD34+ HPCs may occur, we do not think this is possible as the fold increase post anti-CD3 stimulation would have been in a magnitude of over 300 fold in two weeks and we should also observed expansion of CD8 T cells along with CD4 T cells. Thus, even though lineage commitment to CD4 T cells can be achieved independent of thymic microenvironment, the latter is required for establishing a balanced TCR repertoire, supporting negative selection as well as promoting CD8 lineage commitment.
Figure 9Schematic illustration of in vitro T cell developmental program of adult human CD34+ BM HPCs
Schematic illustration ofin vitroT cell developmental program of adult human CD34+BM HPCs. The key events, known surface markers and critical checkpoints of the in vitro developing T cells from adult human BM CD34+ HPCs under the stromal cell co-culture condition are illustrated.
1471-2172-13-46-9
Conclusions
IL-7 withdrawal is necessary but not sufficient for further differentiation to DP stage, and anti-CD3 stimulation plays a key role in inducing CD3+TCRαβ+DP transition and subsequent maturation to CD4 T cells. Our findings further advance the experimental system required for in vitro modeling of adult human T cell differentiation, and will help develop novel approaches toward generating functional T cells from adult HPCs.
Methods
Human CD34+ cells and cell lines
The adult BM CD34+ HPCs from normal donors were purchased from AllCell Inc. (San Mateo, CA, USA). Control PBMCs were obtained from Civitan Regional Blood Center Inc. (Gainesville, FL) reviewed and approved by University of Florida Health Science Center Institutional Review Board (#507-1997, UF IRB-01). All studies involving human subjects are conducted in accordance with the guidelines of the World Medical Association's Declaration of Helsinki (most recent revision). The mouse fetal stromal cells (OP9) were purchased from the American Type Culture Collection (ATCC, Manassas, VA) and maintained as previously described
34
. The engineered LmDL1 and LmDL1-FL7 cell lines were generated by transducing cells with lentivectors encoding DL1, Flt3L and IL-7, respectively. The stromal cells were maintained in α-MEM (Invitrogen/Gibco BRL, Grand Island, NY) supplemented with 15-20% fetal bovine serum (FBS, Invitrogen/Gibco BRL) and 1% Penicillin-Streptomycin (Mediatech Inc., Manassas, VA). IL-7 cytokine secretion was measured by using human IL-7 ELISA kit (Ray Biotech, Inc) and soluble Flt3L in culture was measured using human Flt3L ELISA kit (Assay Biotechnology Company, Inc, Sunnyvale, CA). Cell free supernatants were harvested from LmDL1 and LmDLFL7 cells cultured for 48 hrs (80-90% confluent), in a 12 well plate containing 1 ml of media. The samples were read on model 680 microplate reader (Bio-Rad). The surface expression of mouse DL1 and Flt3L was analyzed by flow cytometry with Alexa Fluor 647-conjugated anti-DL1 Ab (Biolegend) and purified anti-Flt3L Ab (Abcam Inc. Cambridge, MA) conjugated with Zenon-Alexa 488 according to manufacturer’s instructions (Invitrogen).
LmDL1 stromal cell and CD34+ HPC co-culture
The CD34+ HPCs were seeded into 24-well-plate at 1x105 cells/well containing a confluent monolayer of LmDL1 or LmDL1-FL7 cells. The cocultures were maintained in complete medium from day 1, consisting of α-MEM with 20% FBS and 1% Penicillin-Streptomycin, supplemented with 5 ng/ml IL-7 (PeproTech, Inc. Rocky Hill, NJ) and 5 ng/ml Flt3L (PeproTech, Inc.) as indicated. The cocultures were replenished with new media every 2–3 days. The cells in suspension were transferred to a new confluent stromal monolayer once the monolayer began to differentiate or when developing cells reached 80-90% confluent. The cells were transferred by vigorous pipetting, followed by filtering through a 70 μm filter (BD/Falcon, BD Biosciences, Sparks, MD) and centrifugation at 250 RCF, at room temperature for 10 min. The cell pellet was transferred to a fresh confluent monolayer. The cells were harvested at the indicated time points during the T cell development for analysis.
Monoclonal antibodies and flow cytometry
The surface expression of mouse DL1 and Flt3L was analyzed by flow cytometry with Alexa Fluor 647-conjugated anti-DL1 antibody (Biolegend) and purified anti-Flt3L antibody (Abcam Inc. Cambridge, MA) conjugated with Zenon-Alexa 488 according to manufacturer’s instructions (Invitrogen). The antibodies used for surface staining of T cell development included CD4 (clone RPA-T4 Pacific blue), CD8 (clone RPA-T8 PE), CD3 (clone UCHT1, Pacific Blue, clone SK7, PE-Cy7), TCRαβ (clone T10B9.1A-31, FITC), CD1a (clone HI149, APC), CD7 (clone M-T701, FITC, PE), and intracellular staining for Ki67 (clone B56, FITC), and isotype IgG1κ, which were from BD Biosciences (San Jose, CA). anti-CD127 (clone 40131-FITC) was from R&D systems (Minneapolis, MN). Vβ repertoire analysis was performed using IOTest® Beta Mark TCR Vβ Repertoire Kit according to manufacturer’s instructions (Beckman Coulter, Fullerton, CA). For flow cytometric staining, cells were first washed with PBS plus 2% FBS and blocked with mouse and human serum at 4°C for 30 min. Cells were incubated with antibodies per manufacturer’s instructions. For each fluorochrome-labeled Ab used, appropriate isotype control was included. After antibody staining, the cells were washed twice and fixed with 2% para-formaldehyde. Intracellular staining was performed using BD cytofix/cytoperm kit, according to the manufacturer’s protocol. Data was acquired using BD FACS Diva software (version 5.0.1) on a BD FACSAria or a BD LSR and analyzed using the Flowjo software (version 7.1.3.0, Tree Star, Inc. Pasadena, TX).
T cell stimulation and effector function analysis
To stimulate naïve T cells, a protocol for long term stimulation was followed using anti-CD3/CD28 beads (Dynal/Invitrogen, San Diego, CA) per manufacturer’s instructions. The cells and the beads were mixed and plated into a 96 well plate at 37°C for 2–3 days in X-Vivo 20 (Gibco) media, on day 3, 12.5 U of IL-2, 5 ng/ml of IL-7 and 20 ng/ml of IL-15 were added and the cells were cultured for additional 11–12 days. The in vitro expanded CD4 T cells were stimulated with PMA and Ionomycin (Sigma-Aldrich, St. Louis, MO), and analyzed for the release of IFN-γ, IL-4 and IL-17. Briefly the cells were incubated with 25 ng/ml PMA and 1 μg/ml ionomycin for one hour followed by the addition of 6 μg/ml monensin (Sigma-Aldrich) to inhibit Golgi-mediated cytokine secretion. After 4–5 hours of incubation, the cells were harvested and surface stained for CD4 (clone RPA-T4, Pacific blue), CD8 (clone SK1, APC-Cy7), CD3 (clone SK7 PE-Cy7), CD25 (clone M-A251, PE) and intracellular stained for IFN-γ (clone 25723.11, FITC), IL-4 (clone MP425D2, APC), FOXP3 (clone PCH101, Alexa 647); the above antibodies were from BD Biosciences, and IL-17 (clone 64CAP17, PE) antibody was from e-Biosciences. The data were collected by flow cytometry using BD FACSAria and analyzed using Flowjo.
RT-PCR
RNA was harvested from cells using TRI-Reagent (Sigma-Aldrich) and 1 ug RNA was reverse transcribed into cDNA by using Two-step AMV RT-PCR kit (Gene Choice, MD). The following primers were used for the PCR: mGAPDH, F (Forward) 5’-TCA CCA CCA TGG AGA AGG C-3’ and R (Reverse) 5’-GCT AAG CAG TTG GTG GTG CA-3’; mDL1, F 5’-GCT CTT CCC CTT GTT CTA ACG-3’ and R 5’-CAC ATT GTC CTC GCA GTA CC-3’; Flt3L, F 5’-AAG GAT CCG CAG GAT GAG GCC TTG-3’ and R 5’-CGG CGA CAG GAG GCA TGA G-3’; IL-7, F 5’-TTC TCG AGT TAT CAG TGT TCT TTA GTG-3’ and R 5’-AAG CGG CCG CCA CCA TGT TCC ATG TTT CT-3’; huGAPDH, F 5’-CCG ATG GCA AAT TCG ATG GC-3’ and R 5’-GAT GAC CCT TTT GGC TCC CC-3’; hLEF-1, F 5'-CGA CGC CAA AGG AAC ACT GAC ATC-3' and R 5'-GCA CGC AGA TAT GGG GGG AGA AA-3'; hTCF-1, F 5'-CGG GAC AGA GGA CCA TTA CAA CTA GAT CAA GGA G-3', and R 5'-CCA CCT GCC TCG GCC TGC CAA AGT-3'; Rag-1, F 5'-CAG CGT TTT GCT GAG CTC CT-3' and R 5'-GGC TTT CCA GAG AGT CCT C-3'; Rag-2 F 5'-GCA ACA TGG GAA ATG GAA CTG-3' and R 5'-GGT GTC AAA TTC ATC ATC ACC ATC-3'. After 30 cycles of amplification (95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 60 seconds), PCR products were separated on a 2% agarose gel.
T cell receptor excision circle (TREC) analysis
The TREC and RAG2 sequences were amplified by nested PCRs using two outer primers in the first round PCR, followed by adding two inner primers in the second round PCR using genomic DNA of PBMCs as templates, and cloned into pSTblue and verified by DNA sequencing. The two 5’ primers for TREC amplification were: outer 5'-AAT CTA GAG CAT GTT GCT TGA ACT CCT C-3', and inner 5'-AAT CTA GAG TAG CAT AAT TTC CTG GTT GAC-3'; the two 3’ primers for TREC amplification were: outer 5'-AAT CTA GAC CAA GGT GAA TCC TCT GAT C-3', and inner 5'-AAT CTA GAG TCC CAC ACT CCG TGC TG-3'. The two 5’ primers for RAG2 amplification were: outer 5'-AAG GAT CCA GCT GTG AAT TGC ACA GTC-3', and inner 5'-AAG GAT CCG CAA TCC TGA CTC AAA CTA AC-3'; the two 3’ primers for RAG2 amplification were: outer 5'-AAG GAT CCA GTT GAA TAG AAT GGT ACC-3’ and inner 5'-AAG GAT CCG TAA TCC AGT AGC CTG TCT C-3'. Cell lysates were prepared by proteinase K digestion (100 μg/mL) at 56°C for 1 hr, followed by heat inactivation at 95°C for 10 minutes. In brief, 1.5 μL of cell lysates equivalent to 100 ng DNA or 15,000 cells, were used as template for PCR amplification. The following primers were used for the PCR reaction for TREC: F 5’-CAG AGG GGT GCC TCT GTC A-3’ and R 5’-CTG TGA AAC ACT CCC CAG C-3’, and RAG2: F 5’-TCT TGG CAT ACC AGG AGA CA-3’ and R- 5’-AGT GGA ATC CCC TGG ATC TT-3’. PCR conditions were 95°C for 10 minutes, followed by 35 cycles of 95°C for 30 seconds, 55°C (RAG2) 59°C (TREC) for 60 seconds, 72°C for 60 seconds, with a final extension at 72°C for 10 minutes. PCR products were analyzed on 1% agarose gel.
Statistical analysis
The statistical analysis was performed using Student’s t-test and GRAPHPAD PRISM 5 software.
Competing interests
The authors declare no competing financial interests.
Authors’ contributions
ESP and LJC designed the studies, carried out the experiments and drafted the manuscript; SO and KH performed the antibody staining and genomic PCR analyses; LJY, SKD and JSM participated in the design of the study; all authors read and approved the final manuscript.
bm
ack
Acknowledgements
We thank S. Williams, W. Chou, Dr. Shuhong Han and Yuling Yeh for technical assistance, Dr. Yung Chang and Dr. Lizi Wu for critical comments and reading the manuscript, and N. Benson for help with flow cytometry analysis. ESP was supported by NIH T32 graduate training grant. The study was supported by amfAR grant 107768, Yongling Foundation, and flow cytometry fund of UF Shands Cancer Center.
refgrp Infectious morbidity in long-term survivors of allogeneic marrow transplantation is associated with low CD4 T cell countsStorekJGooleyTWitherspoonRPSullivanKMStorbRAm J Hematol199754131lpage 13810.1002/(SICI)1096-8652(199702)54:2<131::AID-AJH6>3.0.CO;2-Ylink fulltext 9034287Assessment of thymic output in adults after haematopoietic stemcell transplantation and prediction of T-cell reconstitutionDouekDCVescioRABettsMRBrenchleyJMHillBJZhangLBerensonJRCollinsRHKoupRALancet20003551875188110.1016/S0140-6736(00)02293-510866444Strategies to enhance T-cell reconstitution in immunocompromised patientsvan den BrinkMRMAlpdoganOBoydRLNat Rev Immunol2004485686710.1038/nri148415516965Getting back at nature: understanding thymic development and overcoming its atrophyHengTSPChidgeyAPBoydRLCurr Opin Pharmacol20101042543310.1016/j.coph.2010.04.00620483662T-cell development, doing it in a dishSchmittTMZuniga-PfluckerJCImmunol Rev20062099510210.1111/j.0105-2896.2006.00353.x16448536Functionally mature CD4 and CD8 TCRαβ cells are generated in OP9-DL1 cultures from human CD34+ hematopoietic cellsVan CoppernolleSVerstichelGTimmermansFVelgheIVermijlenDDe SmedtMLeclercqGPlumJTaghonTVandekerckhoveBetal J Immunol20091834859487010.4049/jimmunol.090071419801512Human CD8 T cells generated in vitro from hematopoietic stem cells are functionally matureAwongGHererELa Motte-MohsRZuniga-PfluckerJBMC Immunol2011122210.1186/1471-2172-12-22pmcid 307293921429219Does our current understanding of immune tolerance, autoimmunity, and immunosuppressive mechanisms facilitate the design of efficient cancer vaccines?SioudMScand J Immunol20097051652510.1111/j.1365-3083.2009.02326.x19906192Cord blood stem cells for hematopoietic transplantationStanevskyAShimoniAYerushalmiRNaglerAStem Cell Rev Rep2011742543310.1007/s12015-010-9183-9Diverse T cell differentiation potentials of human fetal thymus, fetal liver, cord blood and adult bone marrow CD34 cells on lentiviral Delta-like 1-modified mouse stromal cellsPatelEWangBLienLYangL-JMorebJSChangL-JImmunology2009128e497e50510.1111/j.1365-2567.2008.03013.x275393719740310T-lymphoid differentiation potential measured in vitro is higher in CD34+CD38−/lo hematopoietic stem cells from umbilical cord blood than from bone marrow and is an intrinsic property of the cellsDe SmedtMLeclercqGVandekerckhoveBKerreTTaghonTPlumJHaematologica20119664665410.3324/haematol.2010.036343308491021330325Bone marrow CD34+ cells generate fewer T cells in vitro with increasing age and following chemotherapyOffnerFKerreTDe SmedtMPlumJBr J Haematol199910480180810.1046/j.1365-2141.1999.01265.x10192443Human bone marrow CD34+ progenitor cells mature to T cells on OP9-DL1 stromal cell line without thymus microenvironmentDe SmedtMHoebekeIPlumJBlood Cells Mol Dis20043322723210.1016/j.bcmd.2004.08.00715528136Ex vivo development, expansion and in vivo analysis of a novel lineage of dendritic cells from hematopoietic stem cellsHanSWangYWangBPatelEOkadaSYangL-JMorebJChangL-JJ Immune Based Ther Vaccin20108810.1186/1476-8518-8-8Regulation of pre-T cell receptor (pT alpha-TCR beta) gene expression during human thymic developmentRamiroARTriguerosCMárquezCSan MillánJLToribioMLJ Exp Med199618451953010.1084/jem.184.2.51921927288760805Development of αβ T cells in the human thymusSpitsHNat Rev Immunol2002276077210.1038/nri91312360214TCR gene rearrangements and expression of the pre-T cell receptor complex during human T-Cell differentiationBlomBVerschurenMCMHeemskerkMHMBakkerAQvan Gastel-MolEJWolvers-TetteroILMvan DongenJJMSpitsHBlood1999933033304310216100Exogenous IL-7 promotes the growth of CD3-CD4-CD8-CD44+CD25+/− precursor cells and blocks the differentiation pathway of TCR-alpha beta cells in fetal thymus organ culturePlumJDe SmedtMLeclercqGJ Immunol1993150270627168095954Interleukin-7 inhibits pre-T-cell differentiation induced by the pre-T-cell receptor signal and the effect is mimicked by hGM-CSF in hGM-CSF receptor transgenic miceYasudaYKanekoANishijimaIMiyatakeSAraiKImmunology200210621222110.1046/j.1365-2567.2002.01402.x178272012047750Effects of IL-7 on early human thymocyte progenitor cells in vitro and in SCID-hu Thy/Liv miceNapolitanoLAStoddartCAHanleyMBWiederEMcCuneJMJ Immunol200317164565412847229A dose effect of IL-7 on thymocyte developmentEl KassarNLucasPJKlugDBZamischMMerchantMBareCVChoudhuryBSharrowSORichieEMackallCLBlood20041041419142710.1182/blood-2004-01-020115155461IL-7 receptor signals inhibit expression of transcription factors TCF-1, LEF-1, and RORgammat: impact on thymocyte developmentYuQErmanBParkJHFeigenbaumLSingerAJ Exp Med200420079780310.1084/jem.20032183221196015365098Critical and multiple roles for the CD3ε intracytoplasmic tail in double negative to double positive thymocyte differentiationBrodeurJ-FLiSMartinsMSLaroseLDaveVPJ Immunol20091824844485310.4049/jimmunol.080367919342663CD3 components at the surface of pro-T cells can mediate pre-T cell development in vivoJacobsHVandeputteDTolkampLDe VriesEBorstJBernsAEur J Immunol19942493493910.1002/eji.18302404238149963CD3ε-mediated signals rescue the development of CD4+CD8+ thymocytes in RAG-2−/− mice in the absence of TCR β chain expressionShinkaiYAltFWInt Immunol19946995100110.1093/intimm/6.7.9957947468Crucial role of the pre-T-cell receptor alpha gene in development of alpha beta but not gamma delta T cellsFehlingHJKrotkovaASaint-RufCvon BoehmerHNature199537579579810.1038/375795a07596413Regulation of thymocyte differentiation: pre-TCR signals and β-selectionMichieAMZúñiga-PflückerJCSemin Immunol20021431132310.1016/S1044-5323(02)00064-712220932Excision products of the T cell receptor gene support a progressive rearrangement model of the alpha/delta locusTakeshita STMYamagishiHEMBO J19898326132704014532583098Real-time PCR based on SYBR-Green I fluorescence: An alternative to the TaqMan assay for a relative quantification of gene rearrangements, gene amplifications and micro gene deletionsPonchelFToomesCBransfieldKLeongFDouglasSFieldSBellSCombaretVPuisieuxAMighellABMC Biotechnol200331810.1186/1472-6750-3-1827004014552656Unique features of the pre-T-cell receptor alpha-chain: not just a surrogatevon BoehmerHNat Rev Immunol2005557157710.1038/nri163615999096Constitutive endocytosis and degradation of the pre-T cell receptorPanigadaMPorcelliniSBarbierEHoeflingerSCazenaveP-AGuHBandHvon BoehmerHGrassiFJ Exp Med20021951585159710.1084/jem.20020047219356012070286Mechanistic basis of pre-T cell receptor-mediated autonomous signaling critical for thymocyte developmentYamasakiSIshikawaESakumaMOgataKSakata-SogawaKHiroshimaMWiestDLTokunagaMSaitoTNat Immunol20067677516327787Restoration of thymopoiesis in pT alpha−/− mice by anti-CD3epsilon antibody treatment or with transgenes encoding activated Lck or tailless pT alphaFehlingHJIritaniBMKrotkovaAForbushKALaplaceCPerlmutterRMvon BoehmerHImmunity1997670371410.1016/S1074-7613(00)80446-X9208843Induction of T cell development from hematopoietic progenitor cells by delta-like-1 in vitroSchmittTMZuniga-PfluckerJCImmunity20021774975610.1016/S1074-7613(02)00474-012479821Induction of T-cell development from human cord blood hematopoietic stem cells by Delta-like 1 in vitroLa Motte-MohsRHererEZuniga-PfluckerJBlood20051051431143910.1182/blood-2004-04-129315494433Both soluble and membrane-bound forms of Flt3 ligand enhance tumor immunity following “suicide” gene therapy in a murine colon carcinoma modelAlsheikhlyA-RZweiriJWalmesleyAJWatsonAJMChristmasSECancer Immunol Immunother20045394695415185012Cells regulate the activities of cytokines by glycosylationOpdenakkerGRuddPWormaldMDwekRVan DammeJFASEB J199594534577896019Enhanced T cell recovery in HIV-1–infected adults through IL-7 treatmentLevyYLacabaratzCWeissLViardJ-PGoujardCLelièvreJ-DBouéFMolinaJ-MRouziouxCAvettand-FénoêlVJ Clin Invest20091199971007266256819287090Notch1 and IL-7 receptor interplay maintains proliferation of human thymic progenitors while suppressing non-T cell fatesGarcía-PeydróMde YébenesVGToribioMLJ Immunol20061773711372016951331Immature single-positive CD8+ thymocytes represent the transition from Notch-dependent to Notch-independent T-cell developmentXiongJArmatoMAYankeeTMInt Immunol201123556410.1093/intimm/dxq457303130521148236Lymphopenia in interleukin IL-7 gene-deleted mice identifies IL-7 as a nonredundant cytokinevon Freeden-JeffryUVieiraPLucianLAMcNeilTBurdachSEMurrayRJ Exp Med19951811519152610.1084/jem.181.4.151921919547699333Adjuvant IL-7 antagonizes multiple cellular and molecular inhibitory networks to enhance immunotherapiesPellegriniMCalzasciaTElfordARShahinianALinAEDissanayakeDDhanjiSNguyenLTGronskiMAMorreMNat Med20091552853610.1038/nm.195319396174Interleukin-7 is a critical growth factor in early human T-cell developmentPlumJDe SmedtMLeclercqGVerhasseltBVandekerckhoveBBlood199688423942458943859Onset of TCR-beta gene rearrangement and role of TCR-beta expression during CD3-CD4-CD8- thymocyte differentiationGodfreyDIKennedyJMombaertsPTonegawaSZlotnikAJ Immunol1994152478347927513723Interleukin 7 receptor-deficient mice lack gammadelta T cellsMakiKSunagaSKomagataYKodairaYMabuchiAKarasuyamaHYokomuroKMiyazakiJIIkutaKProc Natl Acad Sci U S A1996937172717710.1073/pnas.93.14.7172389558692964Inhibition of gamma delta T cell development and early thymocyte maturation in IL-7 −/− miceMooreTvon Freeden-JeffryUMurrayRZlotnikAJ Immunol1996157236623738805634Differential IL-7 responses in developing human thymocytesMarinoJHTanCTaylorAABentleyCVan De WieleCJRanneRPaliottaMBroughanTATeagueTKHum Immunol20107132933310.1016/j.humimm.2010.01.009289607320074604In vitro induction of CD8 expression on thymic pre-T cells. I. Transforming growth factor-beta and tumor necrosis factor-alpha induce CD8 expression on CD8- thymic subsets including the CD25+CD3-CD4-CD8- pre-T cell subsetSudaTZlotnikAJ Immunol1992148173717451347307T-cell development and the CD4-CD8 lineage decisionGermainRNNat Rev Immunol2002230932210.1038/nri79812033737Cytokines in the thymus: production and biological effectsYarilinAABelyakovIMCurr Med Chem20041144746410.2174/092986704345597214965226Journey through the thymus: stromal guides for T-cell development and selectionTakahamaYNat Rev Immunol2006612713510.1038/nri178116491137Decision checkpoints in the thymusCarpenterACBosselutRNat Immunol20101166667310.1038/ni.1887338879920644572An alternate pathway for CD4 T cell development: thymocyte-expressed MHC class II selects a distinct T cell populationLiWKimMGGourleyTSMcCarthyBPSant'AngeloDBChangCHImmunity20052337538610.1016/j.immuni.2005.09.00216226503T-cell development: thymocyte-selected CD4+ T cellsBellENat Rev Immunol20077748749The in vivo development of human T cells from CD34+ cells in the murine thymic environmentSaitoYKametaniYHozumiKMochidaNAndoKItoMNomuraTTokudaYMakuuchiHTajimaTInt Immunol2002141113112410.1093/intimm/dxf08712356677Functional human T lymphocyte development from cord blood CD34+ cells in nonobese diabetic/Shi-scid, IL-2 receptor gamma null miceYahataTAndoKNakamuraYUeyamaYShimamuraKTamaokiNKatoSHottaTJ Immunol200216920420912077246Complete reconstitution of human lymphocytes from cord blood CD34+ cells using the NOD/SCID/gammaC null mice modelHiramatsuHNishikomoriRHeikeTItoMKobayashiKKatamuraKNakahataTBlood200310287388010.1182/blood-2002-09-275512689924Development of a human adaptive immune system in cord blood cell-transplanted miceTraggiaiEChichaLMazzucchelliLBronzLPiffarettiJCLanzavecchiaAManzMGScience200430410410710.1126/science.109393315064419