Bacillus anthracis’ lethal toxin induces broad transcriptional responses in human peripheral monocytes

MISSING IMAGE

Material Information

Title:
Bacillus anthracis’ lethal toxin induces broad transcriptional responses in human peripheral monocytes
Physical Description:
Mixed Material
Language:
English
Creator:
Chauncey, Kassidy M.
Lopez, Cecilia M.
Sidhu,Gurjit
Szarowicz, Sarah E.
Baker, Henry B.
Quinn, Conrad
Southwick, Frderick S.
Publisher:
BioMed Central
Publication Date:

Notes

Abstract:
Background: Anthrax lethal toxin (LT), produced by the Gram-positive bacterium Bacillus anthracis, is a highly effective zinc dependent metalloprotease that cleaves the N-terminus of mitogen-activated protein kinase kinases (MAPKK or MEKs) and is known to play a role in impairing the host immune system during an inhalation anthrax infection. Here, we present the transcriptional responses of LT treated human monocytes in order to further elucidate the mechanisms of LT inhibition on the host immune system. Results: Western Blot analysis demonstrated cleavage of endogenous MEK1 and MEK3 when human monocytes were treated with 500 ng/mL LT for four hours, proving their susceptibility to anthrax lethal toxin. Furthermore, staining with annexin V and propidium iodide revealed that LT treatment did not induce human peripheral monocyte apoptosis or necrosis. Using Affymetrix Human Genome U133 Plus 2.0 Arrays, we identified over 820 probe sets differentially regulated after LT treatment at the p <0.001 significance level, interrupting the normal transduction of over 60 known pathways. As expected, the MAPKK signaling pathway was most drastically affected by LT, but numerous genes outside the well-recognized pathways were also influenced by LT including the IL-18 signaling pathway, Toll-like receptor pathway and the IFN alpha signaling pathway. Multiple genes involved in actin regulation, signal transduction, transcriptional regulation and cytokine signaling were identified after treatment with anthrax LT. Conclusion: We conclude LT directly targets human peripheral monocytes and causes multiple aberrant gene responses that would be expected to be associated with defects in human monocyte’s normal signaling transduction pathways and function. This study provides further insights into the mechanisms associated with the host immune system collapse during an anthrax infection, and suggests that anthrax LT may have additional downstream targets outside the well-known MAPK pathway.
General Note:
Publication of this article was funded in part by the University of Florida Open-Access publishing Fund. In addition, requestors receiving funding through the UFOAP project are expected to submit a post-review, final draft of the article to UF's institutional repository, IR@UF, (www.uflib.ufl.edu/UFir) at the time of funding. The Institutional Repository at the University of Florida community, with research, news, outreach, and educational materials.
General Note:
Chauncey et al. BMC Immunology 2012, 13:33; pgs.1-26 http://www.biomedcentral.com/1471-2172/13/33
General Note:
doi:10.1186/1471-2172-13-33 Cite this article as: Chauncey et al.: Bacillus anthracis’ lethal toxin induces broad transcriptional responses in human peripheral monocytes. BMC Immunology 2012 13:33.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
All rights reserved by the source institution.
System ID:
AA00013224:00001


This item is only available as the following downloads:


Full Text


Chauncey et al. BMC Immunology 2012, 13:33
http://www.biomedcentral.com/1471-2172/13/33


iBMC
Immunology


Bacillus anthracis' lethal toxin induces

broad transcriptional responses in human

peripheral monocytes

Kassidy M Chauncey', M Cecilia Lopez2, Gurjit Sidhul, Sarah E Szarowiczl, Henry V Baker 2, Conrad Quinn3
and Frederick S Southwick"


Abstract
Background: Anthrax lethal toxin (LT), produced by the Gram-positive bacterium Bacillus anthracis, is a highly
effective zinc dependent metalloprotease that cleaves the N-terminus of mitogen-activated protein kinase kinases
(MAPKK or MEKs) and is known to play a role in impairing the host immune system during an inhalation anthrax
infection. Here, we present the transcriptional responses of LT treated human monocytes in order to further
elucidate the mechanisms of LT inhibition on the host immune system.
Results: Western Blot analysis demonstrated cleavage of endogenous MEK1 and MEK3 when human monocytes
were treated with 500 ng/mL LT for four hours, proving their susceptibility to anthrax lethal toxin. Furthermore,
staining with annexin V and propidium iodide revealed that LT treatment did not induce human peripheral
monocyte apoptosis or necrosis. Using Affymetrix Human Genome U133 Plus 2.0 Arrays, we identified over 820
probe sets differentially regulated after LT treatment at the p <0.001 significance level, interrupting the normal
transduction of over 60 known pathways. As expected, the MAPKK signaling pathway was most drastically affected
by LT, but numerous genes outside the well-recognized pathways were also influenced by LT including the IL-18
signaling pathway, Toll-like receptor pathway and the IFN alpha signaling pathway. Multiple genes involved in actin
regulation, signal transduction, transcriptional regulation and cytokine signaling were identified after treatment with
anthrax LT.
Conclusion: We conclude LT directly targets human peripheral monocytes and causes multiple aberrant gene
responses that would be expected to be associated with defects in human monocyte's normal signaling
transduction pathways and function. This study provides further insights into the mechanisms associated with the
host immune system collapse during an anthrax infection, and suggests that anthrax LT may have additional
downstream targets outside the well-known MAPK pathway.


Background
Bacillus anthracis, the causative agent of anthrax, is a
gram-positive bacterium that is naturally found in the
soil, and rarely affects the human population. Unfortu-
nately, deliberate dissemination of anthrax spores is
capable of delivering a highly potent and lethal air-borne
bioterrorist agent, as documented in the 2001 U.S. an-
thrax attacks. Inhalation anthrax is a highly fatal, acute


* Correspondence southfs@medicine ufl edu
Department of Medicine, University of Florida College of Medicine,
Gainesville FL 32610, USA
Full list of author information is available at the end of the article


disease characterized by a rapid onset of systemic shock
and ultimately death [1].
The most virulent strains of B. anthracis contain two
plasmids, pXO2 and pXO1, encoding an antiphagocytic
poly-D-glutamic acid capsule and three exotoxins: lethal
factor, edema factor and protective antigen [2]. Protect-
ive antigen is an 83 kDa protein that is known to bind to
two host cell receptors, TEM-8 and CMG-2, facilitating
the entry of edema and/or lethal factor into host cells
[3]. Lethal factor is a 90 kDa zinc-dependent metallopro-
tease that cleaves the N-terminus of mitogen-activated
protein kinase kinases (MAPKKs or MEKs) [4,5]. Edema


S 2012 Chauncey et al., Iicensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative
Biole led Central Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and
reproduction in any medium, provided the original work is properly cited.






Chauncey et al. BMC Immunology 2012, 13:33
http://www.biomedcentral.com/1471-2172/13/33


factor is an 89 kDa adenylate cyclase that increases
intracellular cAMP levels [6].
Previous studies using anthrax animal models have
documented resistance to anthrax lethal toxin (LT)
through depletion of host macrophages, suggesting that
these cells play a critical role in anthrax LT induced le-
thality [7,8]. LT has also been shown to suppress cyto-
kine responses by peripheral blood mononuclear cells,
induce macrophage apoptosis, and prevent monocyte
proliferation and il,. :. .....:: [1,9,10]. Inhalation an-
thrax cases present clinical manifestations indicative of
host immune collapse in humans and in nonhuman pri-
mate studies [11-13]. However, more recent studies in-
vestigating human monocytes and macrophages have
suggested human alveolar macrophages are resistant to
LT, and ...J .: -1 .m. i-,, :,.r.: human monocytic cell lines are
resistant to LT-induced death [10,14]. LT's targeting of
human monocytes/macrophages could help to explain
the rapid onset of fatal symptoms and host demise dur-
ing an inhalation anthrax infection, but the exact effects
LT exerts on human peripheral monocytes, along with
the mechanisms underlying the impairment of the host
immune cell's responses, have yet to be fully determined.
Previous -.. .:i- !: ;.-:it-. LT treated murine macro-
phages have shown a broad range in transcriptional effects
induced by LT. These studies concluded LT-induced
changes in macrophage inflammation, .1.. i:..-. and tran-
scription factors, along with changes in the immune re-
sponse by macrophages. This study discovered the down
.. 1, I.... of CD-137 after LT treatment, shown to play a
role in monocyte proliferation in response to LPS, and up
i ._.,1 :.... of plasminogen activator inhibitor type I, which
results in fibrin deposits, massive imbalances in ... -1,-
tion, and, in some instances, Il-II; '... nI failure [15,16].
Another study has measured the transcriptional responses
of THP-1 cells after B. anthracis spore exposure, finding
toxigenic B. anthracis strains ':!i:". the cell signaling
responses to infection [17].
Blood monocytes are mononuclear cells that play a
major role in the host immune response through
S-1 t; ... of inflammatory responses, secretion of
cytokine and antimicrobial factors, and direct pathogen
clearance [18]. Monocytes are derived from monoblasts
in the bone marrow, and circulate in the blood for
1-2 days before they migrate into tissues where they re-
plenish the macrophage and dendritic pools [19-21].
Here, we determined human monocyte susceptibility to
LT by demonstrating cleavage of MEKs, and utilized
All; .... i GeneChipx Human Genome U133 Plus 2.0
Arrays in order to identify additional mechanisms of LT
impairment on the transcriptional responses of human
peripheral monocytes. The arrays contained 54,675
probe sets representing over 22,000 of the best charac-
terized human genes, providing extensive insights into


the mechanisms behind LT induced dysfunction of human
peripheral monocytes.
This study is the first to determine direct human
monocyte susceptibility via cleavage of MEKs, along
with the analysis of the transcriptional responses, to
anthrax LT. The mechanisms of LT impairment on
human peripheral monocytes will help elucidate the
roles monocytes contribute during the host immune
system collapse documented during an anthrax infec-
tion. The transcriptional analysis will serve to not
only unravel the mechanisms behind the rapid onset
of death in anthrax victims, but will also potentially
provide new targets for controlling inflammation and
enhancing host defense.


Results and discussion
Monocyte purity, apoptosis and susceptibility to anthrax
LT
In order to first determine monocyte cell purity, iso-
lated cells were analyzed using flow cytometry and
gated using forward and side scatter, along with the
monocytic marker, CD14. It was found that mono-
cytes were isolated with a >85% purity (Figure 1A
and 1B). Because previous reports have documented
LT induced cell apoptosis, it was important to assure
the transcriptional response of LT treated monocytes
were independent of apoptosis. This was assured by
the analysis of the necrosis and apoptosis markers,
propidium iodide (PI) and annexin V, on human per-
ipheral monocytes. Nearly all (99%) human peripheral
monocytes showed no evidence of necrosis or apop-
tosis after a 4 h treatment of LT (Figure 1C and ID).
There has been some i... i;. ,;.. data suggesting mono-
cytes, along with monocyte-derived cells, are not suscep-
tible to the actions of anthrax LT. One study utilized
human monocytic cell lines and found that : .... l ...-
ated monocytic cells did not undergo LT-induced cytotox-
icity, while the I::T. Ia :ii, I cells were susceptible [10].
Another study investigating human alveolar macrophages
(AM) found that these cells were relatively resistant to the
actions of LT. It was ascertained that LT failed to suppress
human AM cytokine responses, cleave MEKs, and induce
apoptosis [14].
In order to explore the actions of LT on human per-
ipheral monocytes, a Western Blot analysis was per-
formed and MEK1, along with MEK3, cleavage was
determined after a 4-hour treatment with LT. Human
peripheral monocytes were found to be ., ..i. to
the actions of LT as evidenced by cleavage of MEK1 and
MEK3 (Figure 1E). HeLa cells were used as a positive
control and [-actin was used to assure equal loading
controls. We conclude that human peripheral mono-
cytes are a direct target of anthrax LT.


Page 2 of 26







Chauncey et al. BMC Immunology 2012, 13:33
http://www.biomedcentral.com/1471-2172/13/33


L


50 100 150 200 250
(x 1,000)


(c) __
_o

w




01-
a *;,1.,*.


FSC


tAnnen FITC*
Annexin FITC


(D)

o-=




(0


C1


FSC


10 10 10 10

Annexin FITC


MEK3

E i MEK1

SB-actin
HeLa HeLa Monocyte Monocyte
Control Toxin Control Toxin
Figure 1 Monocyte purity, apoptosis, and susceptibility to LT. Red -CD14+ monocytes. Green -CD14-lymphocytes. A.) Forward and side
scatter analysis of purified fixed human monocytes showing the monocyte population as compared t total population. B.) CD14 Pacific Blue and
forward scatter analysis of fixed purified human monocytes showing >85% monocytes. C.) PI and annexin-FITC analysis ofCD14+ monocytes
after a 4 h incubation showing 99.0% viable cells indicated in quadrant 3. D.) PI and annexin-FITC analysis of CD14+ monocytes after a 4 h LT
treatment showing 99.1% viable cells indicated in quadrant 3. HeLa cells or human monocytes were left untreated or treated with 500 ng/mL LT
for 4 h at 37'C. Samples were lysed, run on SDS-PAGE, transferred to PVDF membrane, and probed with indicated antibodies. Both MEK3 and
MEK1 were cleaved by LT while control cells showed no MEK cleavage. 3-actin loading controls show equivalent loading of both control and LT
treated cells.


Microarray analysis and results
Human peripheral monocytes were treated with LT or
media alone, and microarray analysis was performed using
four biological replicates from healthy volunteers. A total
of 8 microarray hybridizations were employed and ana-
lyzed on Affymetrix Gene Chips(HG U133 plus 2.0). The
chips contained 54,675 probe sets and identified multiple


differentially regulated pathways and genes by human per-
ipheral monocytes after LT treatment. Unsupervised hier-
archical analysis was used to assess the noise in the array
experiments. First, probe sets whose signal intensity varied
most in the data set were selected by applying a variation
filter. Probes sets that displayed a coefficient of variation of
greater than 0.5 were subjected to hierarchical analysis. The


Page 3 of 26


'-- ,, .,. ,










Chauncey et al. BMC Immunology 2012, 13:33
http://www.biomedcentral.com/1471-2172/13/33


clustering dendrogram showed the major node of separ-
ation between control and LT treated samples (Figure 2A).
To identify specific genes responsive to LT treatment,
a paired t-test (by donor) was performed at a signifi-
cance threshold of p <0.001. Genes specified by 820
probe sets were found to be significant among the treat-
ment groups (Table 1). The hierarchical cluster pattern
of the significant probe sets is shown (Figure 3A). Of these
probe sets, multiple gene products known to play a role in
monocyte function were discovered (Figure 2B). The abil-
ity of probe sets significant at p < 0.001 to function as a
classifier between treatment groups (LT treated vs. con-
trol) was established by leave-one-out-cross-validation
and Monte Carlo simulations. Using 4 different prediction
models, the classifier performed flawlessly. Of the signifi-
cant genes identified, many are known to play a role in
monocyte function (Figure 2C).
Using the Gene Set Expression Comparison Analysis,
as implemented in BRB Array tools, the Biocarta path-
ways that were associated with the differentially regulated
genes were identified. Over 60 differentially regulated
pathways were discovered in monocytes in response to LT


treatment. As expected, the most significant pathway
affected by LT treatment was the MAPK signaling path-
way, with the p38 MAPK signaling pathway being most
impacted with 103 genes affected (Figure 3B). Additional
pathways altered by LT at the p < 0.001 significance level
included the IL-18, Toll-Like Receptor, IFN alpha, and G-
Protein Family signaling pathways. It is interesting to note
that a previous study measuring the transcriptional re-
sponse of human alveolar macrophages to anthrax spores
detected an activation of the TLR pathways [22], and our
results indicated anthrax LT targets 87 genes within the
TLR signaling pathway (Figure 3B).
RGS14 is a protein involved in the regulation of G-
protein signaling through attenuation of G-protein het-
erotrimer signaling, thereby inactivating this signaling
cascade. The Affymetrix microarrays revealed that RGS14
expression in LT treated monocytes showed a 6 fold in-
crease in expression (Table 2). This is a potentially signifi-
cant finding in that RGS14 inhibits G-proteins important
for chemotaxis. Therefore LT could be impairing chemo-
taxis not only by blocking Hsp27 phosphorylation through
disruption of the p38 pathway [23], but also by causing


Fold change P-value



.4 .. .1111. .4 1 1-
.' 4-4 ..... l:.4 1 1
-',.:. a. ........,I J 4':


CO V -- CN

'IT O C4 .
00000000
Q Qccc


-_' 1 J'4 ._ _: 11 T....,.,= h I ,.,i I .,J.4'hll :. ,ll h.. I, h.:h.,.: 1 "
209828 s at Interleukin 16 (lymphocyte chemoattractant factor)



206991 s at Chemokine (C-C motif) receptor 5 (CCR5)
205403_at Interleukin 1 receptor, type II


2.19 0.0001590



2.66 0.0009506
-12.04 0.0001070


Performance of classifiers during cross-validation.


Pair ID Mean Number of Diagonal Linear
genes in Discriminant
classifier Analysis Correct?


1- Nearest
Neighbor
Correct?


3-Nearest
Neighbor
Correct?
','- .


II.-, I


1,',,', :


Figure 2 Unsupervised microarray analysis. A.) Hierarchical clustering dendr
each condition. Specimens were paired based on donor, using 4 separate done
(p < 0.001) up or down regulated after LT treatment, along with their fold chan
used to calculate mis-classification rate that yielded a 100% correct classification


11:,' ,::


ogram showing similarities between
rs as indicated in replica rl through
ge, p-value and probe ID. C.) Leave-
Sbetween pairs.


Page 4 of 26


Affymetrix
Probe ID Gene or gene product name


-_ l II .I--1II u | I. I--*.. -p l*.,I, [ ,-I
l-_' 1: ._ I I 1...l ....1 .....1. 1 71 1[ .I.71 1
_-'I -'I.D!. : I Z'.l..l, l.t. ll...i l. l. llijr IH 1313.-'- I.l...h. .h ....hll .hl t...l l


Nearest
Centroid
Correct?


express
r4. B.) 5
one-out-


11:,' ,::


patterns within
I genes
)ss validation was








Chauncey et al. BMC Immunology 2012, 13:33
http://www.biomedcentral.com/1471-2172/13/33





Table 1 Control vs Toxin corresponding P-value p<0.001
Paramet. Geometric mean Probe set Gene symbol
p-value of intensities


Page 5 of 26


Description


family with sequence simi
N-acetyltransferase 11


arity 91, member A2


tetratricopeptide repeat domain 3
mitochondrial translation optimizati
ankyrin repeat domain 11


Dmoloq (S. cerevisiae)


S 2.80E
2 2.90E
3 3.40E
4 7.80E
5 8.70E
6 9.80E
7 1.07E
8 1.22E
9 1.41E
10 1.49E
11 1.60E
12 1.66E
13 1.66E
14 1.84E
15 2.04E
16 2.18E
17 2.29E
18 2.35E
19 2.44E
20 2.63E
21 2.72E
22 2.91E
23 3.01E
24 3.07E
25 3.10E
26 3.13E
27 3.36E
28 3.37E
29 3.39E
30 3.46E
31 3.89E
32 3.90E
33 3.91E
34 4.05E
35 4.22E
36 4.47E
37 4.48E
38 4.63E
39 4.75E
40 5.00E
41 5.36E
42 5.39E
43 5.66E
44 5.88E
45 6.23E
46 6.35E


222001 x at
218734 at
230350 at
228930 at
208661 s at
218716 x at
238538 at
225896 at
227450 at
226602 s at
209123 at
213934 s at
226419 s at
227946 at
242989 at
242590 at
204559 sat
225902 at
220939 s at
218682 s at
212056 at
222477 sat
202512 s at
209042 s at
232181 at
1554452 a at
228772 at
221501 x at
239038 at
203839 s at
227558 at
214691 x at
228301 x at
1556306 at
229016 s at
223741 s at
49306 at
32209 at
225298 at
228726 at
1562984 at
201639 s at
221649 s at
225360 at
221005 sat
228914 at


FAM91A2
NAT11
NA
NA
TTC3
MTO1
ANKRD11
NA
ERP27
BCR
QDPR
ZNF23
SFRS1
OSBPL7
NA
NA
LSM7
NA
DPP8
SLC4A1AP
KIAA0182
TM7SF3
ATG5
UBE2G2
LOC 53346
HIG2
HNMT
LOC339047
C1orf52
TNK2
CBX4
FAM63B
NDUFB10
NA
TRERF1
TTYH2
RASSF4
FAM89B
PNKD
NA
NA
CPSF1
PPAN
TRABD
PTDSS2
NA


x, 10, 22kDa


NA
transcriptional regulating factor 1
tweety homolog 2 (Drosophila)
Ras association (RalGDS/AF-6) domain family member 4
family with sequence similarity 89, member B
paroxysmal nonkinesigenic dyskinesia
NA
NA
cleavage and polyadenylation specific factor 1, 160kDa
peter pan homolog (Drosophila)
TraB domain containing
phosphatidylserine synthase 2
NA


NA
endoplasmic reticulum protein 27 kDa
breakpoint cluster region
quinoid dihydropteridine reductase
zinc finger protein 23 (KOX 16)
splicing factor, arginine/serine-rich 1
oxysterol binding protein-like 7
NA
NA
LSM7 homolog, U6 small nuclear RNA associated (S. cerevisiae)
NA


dipeptidyl-peptidase 8
solute carrier family 4 anionn exchanger), member 1, a
KIAA0182
transmembrane 7 superfamily member 3
ATG5 autophagy related 5 homolog (S. cerevisiae)
ubiquitin-conjugating enzyme E2G 2 (UBC7 homolog,
hypothetical protein LOC 53346
hypoxia-inducible protein 2
histamine N-methyltransferase
hypothetical protein LOC339047
chromosome 1 open reading frame 52
tyrosine kinase, non-receptor, 2
chromobox homolog 4 (PC class homolog, Drosophila)
family with sequence similarity 63, member B
NADH dehydrogenase (ubiquinone) 1 beta subcomple


iaptor protein





yeast)








Chauncey et al. BMC Immunology 2012, 13:33
http://www.biomedcentral.com/1471-2172/13/33


Table 1 Control vs

47 6.47E-005 1.65
48 6.49E-005 1.64
49 6.55E-005 1.7
50 6.74E-005 1.82
51 6.76E-005 2.22
52 6.77E-005 1.93
53 6.78E-005 1.14
54 6.87E-005 1.55
55 7.02E-005 1.78
56 7.13E-005 2.55


66 9.00E-
67 9.02E-
68 9.14E-
69 9.25E-
09
70 9.51E-
71 9.96E
72 0.000
73 0.000
74 0.000
75 0.000
76 0.000
77 0.000
78 0.000
79 0.000
80 0.000
81 0.000
82 0.000


Toxin corresponding P-value p<0.001 (C

208206 s at RASGRP2
209198 sat SYT11
221575 at SCLY
229969 at NA
235513 at NA
236922 at NA
204364 s at REEP1
227025 at PPHLN1
227288 at SFRS121P1
205075 at SERPINF2


222988 sat
231831 at
221788 at
236004 at
219751 at
227273 at
235787 at
212888 at
1568593 a at


226721 at
227159 at
225982 at
220341 s at
214501 sat
226186 at
224946 s at
237059 at
38671 at
231912 s at
238492 at
228548 at
225757 sat
203926 x at
232520 s at
238012 at
211101 x at


210128 s at
223393 s at
213628 at
214870 x at
221756 at
222478 at
225719 9sat
212959 s at
238520 at
226974 at


TMEM9
COX19
NA
NA
SETD6
NA
NA
DICER1
NUDT16P


DPY19L4
GHDC
UBTF
C5orf45
H2AFY
NA
CCDC115
NA
PLXND1
DKFZP434B033!
NA
NA


RAS guanyl releasing protein 2 (calcium and DAG-regulated)
synaptotagmin XI
selenocysteine lyase


receptor accessory protein 1
periphilin 1
SFRS12-interacting protein 1
serpin peptidase inhibitor, clade F (alpha-2 an
epithelium derived factor), member 2
transmembrane protein 9
COX19 cytochrome c oxidase assembly home
NA
NA
SET domain containing 6
NA
NA


dicer 1, ribonuclease type II
nudix nucleosidee diphosphate
pseudogene
dpy-19-like 4 (C. elegans)
GH3 domain containing
upstream binding transcription
chromosome 5 open reading f
H2A histone family, member Y
NA
coiled-coil domain containing
NA
plexin D1
DKFZP434B0335 protein
NA
NA


tiplasmin, pigment



)log (S. cerevisiae)


linked moiety X)-type motif 16





factor, RNA polymerase
rame 45


CLMN calmin (calponin-like, transmembrane)
ATP5D ATP synthase, H+ transporting, mitochondrial F1 complex, delta subuni
NSFL1C NSFL1 (p97) cofactor (p47)
DPP7 dipeptidyl-peptidase 7
LILRA2 leukocyte immunoglobulin-like receptor, subfamily A (with TM domain)
member 2
LTB4R leukotriene B4 receptor
TSHZ3 teashirt zinc finger homeobox 3
CLCC1 chloride channel CLIC-like 1
LOC100132540 similar to LOC339047 protein
PIK31P1 phosphoinositide-3-kinase interacting protein 1
VPS36 vacuolar protein sorting 36 homolog (S. cerevisiae)
MRPL55 mitochondrial ribosomal protein L55
GNPTAB N-acetylglucosamine-l-phosphate transferase, alpha and beta subunits
TRERF1 transcriptional regulating factor 1
NA NA


Page 6 of 26


t








Chauncey et al. BMC Immunology 2012, 13:33
http://www.biomedcentral.com/1471-2172/13/33


Table 1 Control vs

93 0.0001269 2.06
94 0.0001288 2.04
95 0.0001306 1.46
96 0.0001312 1.5
97 0.0001336 1.19
98 0.0001350 1.73
99 0.0001354 1.8
100 0.0001371 2.61
101 0.0001408 1.44
102 0.0001408 3.15


103 0.0001409
104 0.0001414
105 0.0001418
106 0.0001426
107 0.0001451
108 0.0001454
109 0.0001462
110 0.0001537
111 0.0001561
112 0.0001565
113 0.0001590
114 0.0001593
115 0.0001593
116 0.0001599
117 0.0001646
118 0.0001669
119 0.0001709
120 0.0001738
121 0.0001748
122 0.0001762
123 0.0001767
124 0.0001784
125 0.0001787
126 0.0001789
127 0.0001799
128 0.0001836
129 0.0001843
130 0.0001852
131 0.0001878
132 0.0001878
133 0.0001902
134 0.0001983
135 0.0001987
136 0.0001990
137 0.0002007
138 0.0002010
139 0.0002032


Toxin corresponding P-value p<0.001 (C

225851 at FNTB
224452 sat MGC12966
226092 at MPP5
1558693 sat C1orf85
204020 at PURA
1555882 at SPIN3
235532 at PIGM
1553111_a at KBTBD6
227868 at LOC 54761
214058 at MYCL1


212686 at
218971 sat
225777 at
225366 at
238768 at
218674 at
218490 s at
202704 at
218361 at
222994 at
209828 s at
204611 s at
227730 at
228605 at
202135 s at
226183 at
65472 at
200098 s at
218181 s at
238135 at
203386 at
213670 x at
212109 at
219968 at
211495 x at
214177 _sat
1554085 at
203271 s at
226072 at
212235 at
205658 sat
218021 at
229429 x at
212429 s at
226873 at
227801 at
227679 at


PPM1H
WDR91
C9orfl40
PGM2
C2orf68
C5orf44
ZNF302
TOB1
GOLPH3L
PRDX5
IL16
PPP2R5B
NA
NA
ACTR1B
NA
C2orf68
ANAPC5
MAP4K4
AGTRAP
TBC1D4
NSUN5B
HN1L
ZNF589
TNFSF13
PBXIP1
DDX51
UNC119
FUK
PLXND1
SNAPC4
DHRS4
FAM91A2
GTF3C2
NA
TR M59
NA


continued)

farnesyltrar


sferase, CAAX box, beta


hypothetical protein LOC84792
membrane protein, palmitoylated 5 (MAGUK po
chromosome 1 open reading frame 85
purine-rich element binding protein A
spindlin family, member 3
phosphatidylinositol glycan anchor biosynthesis
kelch repeat and BTB (POZ) domain containing
hypothetical LOC154761
v-myc myelocytomatosis viral oncogene homo
derived (avian)
protein phosphatase 1H (PP2C domain contain
WD repeat domain 91
chromosome 9 open reading frame 140
phosphoglucomutase 2
chromosome 2 open reading frame 68
chromosome 5 open reading frame 44
zinc finger protein 302


subfamily member


, class M
6


, lung carcinoma


transducer of ERBB2, 1
golgi phosphoprotein 3-like
peroxiredoxin 5
interleukin 16 (lymphocyte chemoattractant factor)
protein phosphatase 2, regulatory subunit B@#$%&, beta is(


ARP1 actin-related protein


mmolog B, centractin beta (yeast)


chromosome 2 open reading frame 68
anaphase promoting complex subunit 5
mitogen-activated protein kinase kinase kinase kinase 4
angiotensin II receptor-associated protein
TBC1 domain family, member 4
NOL1/NOP2/Sun domain family, member 5B
hematological and neurological expressed 1-like
zinc finger protein 589
tumor necrosis factor superfamily, member 13
pre-B-cell leukemia homeobox interacting protein 1
DEAD (Asp-Glu-Ala-Asp) box polypeptide 51
unc- 119 homolog (C. elegans)
fucokinase
plexin D1
small nuclear RNA activating complex, polypeptide 4, 1
dehydrogenase/reductase (SDR family) member 4
family with sequence similarity 91, member A2
general transcription factor IIC, polypeptide 2, beta 110


)OkDa


kDa


tripartite motit-contai
NA


Page 7 of 26








Chauncey et al. BMC Immunology 2012, 13:33
http://www.biomedcentral.com/1471-2172/13/33


Table 1 Control vs

140 0.0002081 4.03
141 0.0002087 1.93
142 0.0002093 1.45
143 0.0002165 1.57
144 0.0002167 1.4
145 0.0002197 1.79
146 0.0002219 1.79
147 0.0002234 1.35
148 0.0002246 2.17
149 0.0002301 1.24
150 0.0002335 1.57
151 0.0002348 1.87
152 0.0002362 1.53
153 0.0002367 2.73
154 0.0002416 1.35
155 0.0002420 2.35
156 0.0002425 1.4
157 0.0002450 1.85
158 0.0002478 2.1
159 0.0002509 1.29
160 0.0002517 1.66
161 0.0002521 1.74
162 0.0002522 1.54
163 0.0002531 2.4
164 0.0002559 1.53
165 0.0002582 2.08
166 0.0002606 4.49
167 0.0002633 2.1
168 0.0002634 1.86
169 0.0002641 1.4
170 0.0002648 2.01
171 0.0002678 2.59
172 0.0002679 1.78
173 0.0002686 1.69
174 0.0002686 2.67
175 0.0002715 1.44


176 0.0002762
177 0.0002768
178 0.0002796
179 0.0002809
180 0.0002817
181 0.0002826
182 0.0002831
183 0.0002835
184 0.0002839
185 0.0002845
186 0.0002870


Toxin corresponding P-value p<0.001 (Continued)

218326 sat LGR4 leucine-rich rep.
235252 at KSR1 kinase suppress
1558522 at NA NA
225396 at NA NA
206469 x at AKR7A3 aldo-keto reduce
1563549 a at ANO8 anoctamin 8
211576 s at SLC19A1 solute carrier far
202846 sat PIGC phosphatidylinc
232231 at RUNX2 runt-related trar
213480 at VAMP4 vesicle-associate
1558755 x at ZNF763 zinc finger prot
1557667 at NA NA
211036 x at ANAPC5 anaphase prom
203387 sat TBC1D4 TBC1 domain fa
217896 sat NIP30 NEFA-interactin
212136 at ATP2B4 ATPase, Ca++ tr
207618 s at BCS1L BCS-like (yeast)
239300 at NA NA
229497 at ANKDD1A ankyrin repeat a
214035 x at LOC399491 LOC399491 pro
229874 x at NA NA
221264 s at LOC100128223 hypothetical pr
227630 at NA NA
226016 at CD47 CD47 molecule
1558947 at NA NA
222664 at KCTD15 potassium chan
207843 x at CYB5A cytochrome b5
218394_at ROGDI rogdi homolog
214100 x at NSUN5B NOL1/NOP2/Su
212895 sat ABR active BCR-relat
227580 s at DKFZP434B0335 DKFZP434B0335
227253 at CP ceruloplasmin (f
230917 at NA NA
200843 sat EPRS glutamyl-prolyl-
227346 at IKZF1 IKAROS family z
219095 at LOC100137047- hypothetical pr


229776 at
226436 at
221951 at
228606 at
232535 at
1569597 at
1555845 at
205955 at
220137 at
218459 at
238929 at


PLA2G4B
SLC03A1
RASSF4
TMEM80
TM4SF19
NA
NA
NA
NA
FLJ20674
TOR3A
SFRS2B


solute carrier <
Ras association
transmembrar
transmembrar


eat-containing G protein-coupled receptor 4
or of ras 1




tase family 7, member A3 (aflatoxin aldehyde reductase)


mily 19 (folate transporter), member 1
sitol glycan anchor biosynthesis, class C
scription factor 2
d membrane protein 4
ein 763


voting complex subunit 5
mily, member 4
g nuclear protein NIP30
ansporting, plasma membrane 4
)


nd death domai
tein


itainina 1A


otein LOC100128223


nel tetramerisation domain
type A (microsomal)
(Drosophila)
n domain family, member
ed gene
protein
erroxidase)


tRNA synthetase
inc finger 1 (Ikaros)
otein LOC8681


organic anion transporter family, member 3A1
(RalGDS/AF-6) domain family member 4
e protein 80
e 4 L six family member 19


NA
NA
NA
NA
hypothetical protein FLJ20674
torsin family 3, member A
splicing factor, arginine/serine-rich 2E


Page 8 of 26








Chauncey et al. BMC Immunology 2012, 13:33
http://www.biomedcentral.com/1471-2172/13/33


Table 1 Control vs

187 0.0002872 2.1
188 0.0002969 1.32
189 0.0003005 2.64
190 0.0003043 1.24
191 0.0003057 1.3
192 0.0003121 1.28
193 0.0003123 1.4
194 0.0003129 1.29
195 0.0003162 1.41
196 0.0003176 1.47
197 0.0003216 1.35
198 0.0003219 3.64
199 0.0003243 2.09
200 0.0003251 1.77
201 0.0003260 1.38
202 0.0003264 1.45
203 0.0003271 2.03
204 0.0003290 4.23
205 0.0003300 2.01
206 0.0003304 2.18
207 0.0003309 1.48
208 0.0003322 2.66
209 0.0003337 2.38
210 0.0003349 1.9
211 0.0003390 1.19
212 0.0003390 1.37


0.0003408
0.0003417
0.0003429
0.0003438
0.0003438
0.0003450
0.0003454
0.0003454
0.0003472
0.0003481
0.0003492
0.0003534
0.0003534
0.0003535
0.0003567
0.0003600
0.0003607
0.0003644
0.0003661
0.0003663
0.0003691


Toxin corresponding P-value p<0.001 (Continued)

203317 at PSD4 pleckstrin a
238263 at LOC285965 hypothetic
235159 at NA NA
218388 at PGLS 6-phospho
206729 at TNFRSF8 tumor necr
231130 at NA NA
1552257 a at TTLL12 tubulin tyr
219175 s at SLC41A3 solute carri
204786 s at IFNAR2 interferon (
225391 at LOC93622 hypothetic
227127 at TMEM110 transmemb
202341 sat TRIM2 tripartite m
210731 sat LGALS8 lectin, gala
213374 x at HIBCH 3-hydroxyis
200931 sat VCL vinculin
230304 at NA NA
235195 at FBXW2 F-box and
215726 sat CYB5A cytochrom
242794 at MAML3 mastermin
225961 at KLHDC5 kelch dom
212556 at SCRIB scribbled h
220494 s at NA NA
242297 at RREB1 ras response
228771 at ADRBK2 adrenergic,
227465 at KIAA0892 KIAA0892
228667 at AGPAT4 1-acvlalvce


202161 at
AFFX-LysX-Mat
223314 at
204610 s at
218027 at
204718 at
227313 at
228600 x at
226335 at
219147 sat
219801 at
224865 at
209450 at
239016 at
228670 at
210580 x at
213945 sat
218505 at
230343 at
230888 at
226368 at


PKN1
NA
TSPAN14
CCDC85B
MRPL15
EPHB6
CNPY4
C7orf46
RPS6KA3
C9orf95
ZNF34
FAR1
OSGEP
NA
TEP1
SULT1A3
NUP210
WDR59
NA
WDR91
CHST11


nd Sec7 domain con
al protein LOC285965


tainina 4


gluconolactonase
osis factor receptor superfamily, member 8


osine ligase-like family, member 12
er family 41, member 3
alpha, beta and omega) receptor 2
al LOC93622
rane protein 110
otif-containing 2
ctoside-binding, soluble, 8
obutyryl-Coenzyme A hydrolase




WD repeat domain containing 2
e b5 type A (microsomal)
d-like 3 (Drosophila)
ain containing 5
omolog (Drosophila)


ive element binding protein 1
beta, receptor kinase 2


rol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid
ase, delta)
ase N1


14
domain containing 85B
rial ribosomal protein L15
or B6
momolog (zebrafish)
ne 7 open reading frame 46
protein S6 kinase, 90kDa, polypeptide 3
ne 9 open reading frame 95
protein 34
oA reductase 1
protein endopeptidase


-associated protein 1
irase family, cytosolic, 1A, phenol-preferring, member 3
n 210kDa
domain 59


domain 91
te (chondroitin 4) sulfotransferase 11


Page 9 of 26








Chauncey et al. BMC Immunology 2012, 13:33
http://www.biomedcentral.com/1471-2172/13/33


Table 1 Control vs

234 0.0003691 1.67
235 0.0003706 2.17
236 0.0003712 1.45
237 0.0003730 1.59
238 0.0003737 1.49
239 0.0003762 1.33
240 0.0003796 2.03
241 0.0003812 1.45
242 0.0003827 1.46
243 0.0003831 1.46
244 0.0003841 1.31
245 0.0003893 1.45
246 0.0003907 2.04
247 0.0003909 1.18
248 0.0003923 1.63
249 0.0003984 1.13
250 0.0004011 1.54
251 0.0004028 1.79
252 0.0004062 1.24
253 0.0004150 2.05
254 0.0004182 2.92
255 0.0004259 2.11
256 0.0004308 1.57
257 0.0004325 1.6
258 0.0004326 1.25
259 0.0004339 2.03
260 0.0004343 1.38
261 0.0004347 1.58
262 0.0004367 1.8
263 0.0004371 1.88
264 0.0004382 1.61
265 0.0004389 2.71
266 0.0004422 1.62
267 0.0004451 1.37
268 0.0004463 1.46
269 0.0004468 1.98
270 0.0004483 1.15
271 0.0004501 2.15
272 0.0004505 1.72
273 0.0004518 1.34
274 0.0004529 1.47
275 0.0004530 2.34
276 0.0004546 2.47
277 0.0004555 2.08
278 0.0004560 1.75
279 0.0004590 1.55
280 0.0004608 3.5
281 0.0004636 1.94


Toxin corresponding P-value p<0.001 (C

213364 s at SNX1
213626_at CBR4
AFFX-PheX-3 at NA
206567 sat PHF20
221090 sat OGFOD1
44040 at FBX041
226238 at MCEE
204562 at IRF4
226241 sat MRPL52
220178 at C19orf28
209263 x at TSPAN4
232228 at ZNF530
208760 at UBE21
224562 at WASF2
213485 sat ABCC10
202942 at ETFB
AFFX-LysX-3_at NA
212135 sat ATP2B4
217828 at SLTM
212875s at C2CD2
1557411 s at SLC25A43
227117 at NA
207124 sat GNB5
227607 at STAMBPL1
204538 x at NPIP
244619 at BCL10
223239 at C14orf129
201087 at PXN
219149 x at DBR1
229905 at RAP1GDS1
222111 at NA
235052 at ZNF792
225748 at LTV1
241741 at CRLS1
221504 s at ATP6V1H
213448 at NA
201949 x at CAPZB
234295 at DBR1
217608 at SFRS121P1
215737 x at USF2
215873 x at ABCC10
1552256 a at SCARB1
208657sat 9-Sep
228096 at C1orfl51
222471 s at KCMF1
48808 at DHFR
227228 s at CCDC88C
1558445 at NA


carbonyl reductase 4


PHD finger protein 20
2-oxoglutarate and iron-dependent oxygenase domain cont
F-box protein 41
methylmalonyl CoA epimerase
interferon regulatory factor 4
mitochondrial ribosomal protein L52
chromosome 19 open reading frame 28
tetraspanin 4
zinc finger protein 530
ubiquitin-conjugating enzyme E21 (UBC9 homolog, yeast)
WAS protein family, member 2
ATP-binding cassette, sub-family C (CFTR/MRP), member 10
electron-transfer-flavoprotein, beta polypeptide
NA
ATPase, Ca++ transporting, plasma membrane 4
SAFB-like, transcription modulator
C2 calcium-dependent domain containing 2
solute carrier family 25, member 43
NA
guanine nucleotide binding protein (G protein), beta 5
STAM protein-like 1
nuclear pore complex interacting protein
B-cell CLL/lymphoma 10
chromosome 14 open reading frame 129
paxillin
debranching enzyme me olog 1 (S. cerevisiae)
RAP1, GTP-GDP dissociation stimulator 1


zinc finger protein 792
LTV1 homolog (S. cerevisiae)
cardiolipin synthase 1
ATPase, H+ transporting, lysosomal 50/


kDa, V subunit


capping protein actinn filament) muscle Z-line, beta
debranching enzyme me olog 1 (S. cerevisiae)
SFRS12-interacting protein 1
upstream transcription factor 2, c-fos interacting
ATP-binding cassette, sub-family C (CFTR/MRP), member 10
scavenger receptor class B, member 1
septin 9
chromosome 1 open reading frame 151
potassium channel modulatory factor 1
dihydrofolate reductase
coiled-coil domain containing 88C


Page 10 of 26








Chauncey et al. BMC Immunology 2012, 13:33
http://www.biomedcentral.com/1471-2172/13/33


Table 1 Control vs Toxin corresponding P-value p<0.001

282 0.0004641 1.13 205540 s at RRAGB
283 0.0004670 1.48 227239 at FAM126A
284 0.0004673 1.72 220246 at CAMK1 D
285 0.0004677 3.38 226478 at NA
286 0.0004700 1.41 230235 at NA
287 0.0004709 1.22 220750 sat LEPRE1
288 0.0004727 2.69 223455 at TCHP
289 0.0004736 1.31 238552 at NA
290 0.0004739 1.47 200827 at PLOD1
291 0.0004751 1.28 227710 s at NA
292 0.0004785 4.77 236798 at NA
293 0.0004788 1.88 242824 at NA
294 0.0004793 1.08 215846 at NA
295 0.0004795 1.92 211385 x at SULT1A2
296 0.0004800 1.38 226358 at LOC145842
297 0.0004832 1.95 213534 s at PASK
298 0.0004841 5.65 205698 s at MAP2K6
299 0.0004850 1.53 222661 at AGGF1
300 0.0004855 1.43 212036 s at PNN
301 0.0004858 1.6 244534 at NA
302 0.0004876 1.58 1555751 a at GEMIN7
303 0.0004879 1.87 203063 at PPM1F
304 0.0004973 1.16 205922 at VNN2
305 0.0004975 1.23 202797 at SACM1L
306 0.0005017 2.46 202826 at SPINT1
307 0.0005059 1.73 226073 at TMEM218
308 0.0005077 1.55 238523 at KLHL36
309 0.0005080 1.78 231843 at DDX55
310 0.0005094 2.26 219714 s at CACNA2D3
311 0.0005097 2.02 229202 at NA
312 0.0005114 3.54 209048 s at ZMYND8
313 0.0005132 1.64 218473 s at GLT25D1
314 0.0005172 1.71 65493 at HEATR6
315 0.0005179 2.03 236194 at NA
316 0.0005179 2.28 226531 at ORAl1
317 0.0005201 1.58 219351 at TRAPPC2
318 0.0005244 1.26 220036 s at LMBR1L
319 0.0005321 4.22 217974 at TM7SF3
320 0.0005335 1.26 211759 x at TBCB
321 0.0005359 1.4 242155 x at NA
322 0.0005397 2 209377 s at HMGN3
323 0.0005401 2.12 230653 at LOC100132218
324 0.0005504 1.77 224708 at KIAA2013
325 0.0005504 1.9 204000 at GNB5
326 0.0005559 1.32 244346 at NA
327 0.0005568 1.9 225108 at AGPS
328 0.0005599 1.85 236626 at NA
329 0.0005615 1.85 228314 at LRRC8C


(Continued)

Ras-related GTP bindi
family with sequence
calcium/calmodulin-d


leucine proline-er
trichoplein, keratir


similarity 126, member A
dependent protein kinase ID


:hed proteoglycan (leprecar
lament binding


NA
procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1
NA
NA
NA
NA
sulfotransferase family, cytosolic, 1A, phenol-preferring, member 2
hypothetical protein LOC145842
PAS domain containing serine/threonine kinase
mitogen-activated protein kinase kinase 6
angiogenic factor with G patch and FHA domains 1
pinin, desmosome associated protein
NA
gem (nuclear organelle) associated protein 7
protein phosphatase 1F (PP2C domain containing)
vanin 2
SAC1 suppressor of actin mutations 1-like (yeast)
serine peptidase inhibitor, Kunitz type 1
transmembrane protein 218
kelch-like 36 (Drosophila)
DEAD (Asp-Glu-Ala-Asp) box polypeptide 55
calcium channel, voltage-dependent, alpha 2/delta subunit 3
NA
zinc finger, MYND-type containing 8
glycosyltransferase 25 domain containing 1
HEAT repeat containing 6
NA
ORAI calcium release-activated calcium modulator 1
S protein particle complex 2
limb region 1 homolog (mouse)-like
transmembrane 7 superfamily member 3
tubulin folding cofactor B
NA
high mobility group nucleosomal binding domain 3
hypothetical protein LOC100132218
KIAA2013
guanine nucleotide binding protein (G protein), beta 5
NA
alkylglycerone phosphate synthase
NA


Page 11 of 26


8 family, member C


leucine rich repeat contain








Chauncey et al. BMC Immunology 2012, 13:33
http://www.biomedcentral.com/1471-2172/13/33


Table 1 Control vs

330 0.0005636 1.46
331 0.0005650 1.42
332 0.0005679 1.72
333 0.0005686 4.21
334 0.0005708 1.49
335 0.0005724 1.86
336 0.0005724 1.58
337 0.0005728 1.59
338 0.0005746 2.14
339 0.0005748 1.17
340 0.0005792 1.45
341 0.0005793 1.42
342 0.0005805 1.45
343 0.0005806 1.37
344 0.0005811 1.28
345 0.0005820 1.27
346 0.0005858 2.04
347 0.0005877 1.42
348 0.0005893 1.7
349 0.0005911 1.65
350 0.0005950 1.46
351 0.0005992 1.39
352 0.0006007 2.4
353 0.0006025 1.24
354 00006028 1.43


0.0006039
0.0006041
0.0006052
0.0006058
0.0006135
0.0006135


0.0006147
0.0006167
0.0006190
0.0006205
0.0006228


0.0006241
0.0006246
0.0006275
0.0006277
0.0006282
0.0006311
0.0006313
0.0006322
0.0006326
00006333


Toxin corresponding P-value p<0.001 (Continued)

1558754_at ZNF763 zinc finger
226155at FAM160B1 family with
229705 at NA NA
228891 at C9orf164 chromoso
225146 at C9orf25 chromoso
219817 at C12orf47 chromoso
235610 at ALKBH8 alkB, alkylat
217949 sat VKORC1 vitamin Ke
222858 s at DAPP dual adapt
223049 at GRB2 growth fac
212987 at FBX09 F-box prot
209903 s at ATR ataxia telan
201067 at PSMC2 proteasom
201076 at NHP2L1 NHP2 non-
236804 at NA NA
234107s at DTD1 D-tyrosyl-tF
1553987 at C12orf47 chromosor
226679 at SLC26A11 solute carri
1554608 at TGOLN2 trans-golgi
219256 sat SH3TC1 SH3 domain
232369 at NA NA
243750 x at C21orf70 chromosor
219759at ERAP2 endoplasm
203981 sat ABCD4 ATP-bindin
202428 x at DBI diazeoam


212886 at
221878 at
202039 at
40472 at
217751 at
228303 at


202172 at
1558692 at
207122 x at
1560874 at
212473 s at


225409 at
203615 x at
224724 at
225022 at
214879 x at
222843 at
210136 at
229512 at
209017 s at
237926 s at


CCDC69
C2orf68
TAF1
LPCAT4
GSTK1
GALNT6


VEZF1
Clorf85
SULT1A2
FLJ33046
MICAL2


C2orf64
SULT1A1
SULF2
GOPC
USF2
FIGNL1
MBP
FAM 20C
LONP1
NA


protein 763
sequence similarity 160, member B1


ne 9 open reading frame 164
ne 9 open reading frame 25
ne 12 open reading frame 47
ion repair homolog 8 (E. coli)
poxide reductase complex, subunit 1
or of phosphotyrosine and 3-phosphoinositides
tor receptor-bound protein 2
ein 9
giectasia and Rad3 related
e (prosome, macropain) 26S subunit, ATPase, 2
histone chromosome protein 2-like 1 (S. cerevisiae)


NA deacylase 1 homolog (S. cerevisiae)
ne 12 open reading frame 47
er family 26, member 11
network protein 2
n and tetratricopeptide repeats 1


ne 21 open reading frame 70
ic reticulum aminopeptidase 2
g cassette, sub-family D (ALD), member 4
binding inhibitor (GABA receptor modulator, acyl-Coenzyme A
otein)
domain containing 69
ne 2 open reading frame 68
aced anti-apoptotic factor 1
matidylcholine acyltransferase 4
e S-transferase kappa 1
tyl-alpha-D-galactosamine:polypeptide N-
tosaminyltransferase 6 (GalNAc-T6)
dothelial zinc finger 1
ne 1 open reading frame 85
irase family, cytosolic, 1A, phenol-preferring, member 2
a gene supported by AK057608
e associated monoxygenase, calponin and LIM domain
2
ne 2 open reading frame 64
irase family, cytosolic, 1A, phenol-preferring, member 1


iated PDZ and coiled-coil motif containing
transcription factor 2, c-fos interacting
el
ic protein
sequence similarity 120C
ase 1, mitochondria


Page 12 of 26








Chauncey et al. BMC Immunology 2012, 13:33
http://www.biomedcentral.com/1471-2172/13/33


Table 1 Control vs

376 0.0006351 1.44
377 0.0006411 3.49
378 0.0006490 1.28
379 0.0006513 1.28
380 00006514 1.63


0.0006519
0.0006526
0.0006530
0.0006586
0.0006622
0.0006623
0.0006635
0.0006636
0.0006637
0.0006659


0.0006723
0.0006726
0.0006730
0.0006742
0.0006762
0.0006771
0.0006773
0.0006786
0.0006802
0.0006837
0.0006840
0.0006879
0.0006921
0.0006924
0.0006928
0.0006952
0.0006964
0.0007029
0.0007045
0.0007099
0.0007119
0.0007129
0.0007138
0.0007143
0.0007160
0.0007165
0.0007176
0.0007186
0.0007225
0.0007231
0.0007247


Toxin corresponding P-value p<0.001 (Continued)

222294_sat RAB27A RAB27A, m
210986s at TPM1 tropomyos
209932 s at DUT deoxyuridi
227656 at C6orf70 chromosor
228131 at FRCC1 exision re


212848_s at
1552540 s at
239698 at
1553102 a at
228542 at
208956 x at
223528 s at
201234 at
228694 at
225136 at


212567 s at
219549 s at
232681 at
219627 at
231449 at
239035 at
205256 at
205945 at
230032 at
225888 at
227767 at
205060 at
239730 at
201029 s at
211709 sat
201985 at
204995 at
217521 at
1558184 s at
218167 at
226712 at
238668 at
221651 x at
64064_at
234734 s at
213582 at
226165 at
205565 sat
220251 at
225980 at
238379 x at


C9orf3
IQCD
NA
CCDC69
MRS2
DUT
METT11 D1
ILK
NA
PLEKHA2


MAP4
RTN3
NA
ZNF767
NA
MTHFR
ZBTB39
IL6R
OSGEPL1
C12orf30
CSNK1G3
PARG
DGCR14
CD99
CLEC11A
KIAA0196
CDK5R1
NA
ZNF17
AMZ2
SSR1
NA
IGKC
GIMAP5
TNRC6A
ATP11A
C8orf59
FXN
C1orfl07
C14orf43
NA


complete
chromosor
IQ motif cc


ember RAS


jene family


in I (alpha)
ne triphosphatase
ne 6 open reading frame 70
pair cross-complementing ro
station group 1 (includes ov
ne 9 open reading frame 3
ntaininq D


coiled-coil domain containing 69
MRS2 magnesium homeostasis factc
deoxyuridine triphosphatase
methyltransferase 11 domain contain
inteqrin-linked kinase


pleckstrin homology domain con
binding specific) member 2
microtubule-associated protein 4
reticulon 3


dent repair deficiency,
overlapping antisense sequence)


momolog (S. cerevisiae)


training, family A (phosphoinositide


NA
zinc finger family member 767
NA
5,10-methylenetetrahydrofolate reductase (NADPH)
zinc finger and BTB domain containing 39
interleukin 6 receptor
O-sialoglycoprotein endopeptidase-like 1
chromosome 12 open reading frame 30
casein kinase 1, gamma 3
poly (ADP-ribose) glycohydrolase
DiGeorge syndrome critical region gene 14
CD99 molecule
C-type lectin domain family 11, member A
KIAA0196
cyclin-dependent kinase 5, regulatory subunit 1 (p35
NA
zinc finger protein 17
archaelysin family metallopeptidase 2
signal sequence receptor, alpha
NA
immunoglobulin kappa constant
GTPase, IMAP family member 5
trinucleotide repeat containing 6A
ATPase, class VI, type 11A
chromosome 8 open reading frame 59
frataxin


)mosome 1 open reading
)mosome 14 open readii


rame 107
frame 43


Page 13 of 26








Chauncey et al. BMC Immunology 2012, 13:33
http://www.biomedcentral.com/1471-2172/13/33


Table 1 Control vs

422 0.0007266 1.72
423 0.0007273 1.21
424 0.0007318 1.1
425 0.0007329 2.14
426 0.0007344 1.55
427 0.0007348 1.28
428 0.0007380 1.4
429 0.0007392 1.58
430 0.0007393 2.07
431 0.0007417 1.42
432 0.0007421 1.69
433 0.0007485 1.99
434 0.0007547 2.15
435 0.0007563 1.5
436 0.0007563 2.14
437 0.0007578 1.62
438 0.0007655 1.46
439 0.0007691 2.28
440 0.0007694 1.25
441 0.0007712 1.4
442 0.0007728 1.82
443 0.0007796 1.29
444 0.0007836 1.46
445 0.0007841 2.01
446 0.0007848 1.59
447 0.0007851 1.62
448 0.0007878 1.79
449 0.0007894 2.2
450 0.0007896 2.19
451 0.0007925 1.3


Toxin corresponding P-value p<0.001 (Continued)

1559034_at SIRPB2 signal-regu
201053s at PSMF1 proteasom
40225_at GAK cycling G as
209729 at GAS2L1 growth arr
221027 sat PLA2G12A phospholip
209724_sat ZFP161 zinc finger
214494 sat SPG7 spastic par
205131 x at CLEC11A C-type lect
204019 sat SH3YL1 SH3 domain
214861 at JMJD2C jumonji do
242965 at NA NA
228167 at KLHL6 kelch-like 6
209269 sat SYK spleen tyro
244663 at NA NA
203802 x at NSUN5 NOL1/NOP
242108 at NA NA
205632 sat PIP5K1B phosphatid
238604 at NA NA
219084 at NSD1 nuclear rec
223716 sat ZRANB2 zinc finger,
209760 at KIAA0922 KIAA0922
214437 sat SHMT2 serine hydr
224704 at TNRC6A trinucleotic
223339 at ATPIF1 ATPase inh
222622 at PGP phosphogl
218231_at NAGK N-acetylglu
1554544 a at MBP myelin bas
1554250 sat TRIM73 tripartite m
216199 s at MAP3K4 mitogen-ac
206881 sat LILRA3 leukocyte i
domain), m


latory protein beta 2
e (prosome, macropain) inhibitor subunit 1 (P131)
sociated kinase
est-specific 2 like 1
ase A2, group XIIA
protein 161 homolog (mouse)
aplegia 7 (pure and complicated autosomal recessive)
in domain family 11, member A
n containing, Ysc84-like 1 (S. cerevisiae)
main containing 2C


(Drosophila)
sine kinase


2/Sun domain family, member 5


ylinositol-4-phosphate 5-kinase, type I, beta


eptor binding SET domain protein 1
RAN-binding domain containing 2


oxymethyltransferase 2 (mite
e repeat containing 6A
ibitory factor 1
ycolate phosphatase
cosamine kinase
ic protein
otif-containing 73
tivated protein kinase kinasE
mmunoglobulin-like receptor
member 3


e kinase 4
r, subfamily A (without TM


0.0007976
0.0007989
0.0007995
0.0008009
0.0008035

0.0008086
0.0008124
0.0008148
0.0008150
0.0008158
0.0008161
0.0008187
0.0008205
0.0008207


226716 at
202534 x at
202369 s at
218112 at
230925 at

213027_at
1562289 at
202615 at
219151_sat
1559214 at
203711 sat
233955 x at
201804 x at
211100 x at


PRR
DH
TRA
MR
APB

TRC
NA
GN/
RAB
NA
HIB(
CXX
TBC


466 0.0008229 5.13
467 00008232 1.76


12 proline rich 12
FR dihydrofolate reductase
M2 translocation associated membrane protein 2
PS34 mitochondrial ribosomal protein S34
B11P amyloid beta (A4) precursor protein-binding, family B, member 1
interacting protein
VE2 TROVE domain family, member 2
NA
AQ guanine nucleotide binding protein (G protein), q polypeptide
L2B RAB, member of RAS oncogene family-like 2B
NA
CH 3-hydroxyisobutyryl-Coenzyme A hydrolase
C5 CXXC finger 5
'B tubulin folding cofactor B
RA2 leukocyte immunoglobulin-like receptor, subfamily A (with TM domain),
member 2
MK2G calcium/calmodulin-dependent protein kinase (CaM kinase) II gamma
NA


Page 14 of 26


212757 s at CAF
214202 at NA








Chauncey et al. BMC Immunology 2012, 13:33
http://www.biomedcentral.com/1471-2172/13/33


Table 1 Control vs

468 0.0008255 2.01
469 0.0008277 1.35
470 0.0008278 1.41


0.0008279
0.0008283
0.0008318
0.0008344


0.0008347
0.0008361
0.0008444
0.0008451
0.0008463
0.0008510
0.0008526
0.0008590
0.0008602
0.0008607
0.0008619
0.0008625
0.0008648
0.0008654
0.0008674
0.0008682
0.0008701
0.0008755
0.0008868
0.0008925
0.0008958
0.0008961
0.0008967
0.0009020
0.0009056
0.0009103
0.0009114
0.0009136
0.0009154
0.0009189
0.0009197
0.0009228
0.0009245
0.0009272
0.0009308
0.0009357
0.0009370
0.0009378
0.0009417


Toxin corresponding P-value p<0.001 (C

221746_at UBL4A
1560587 sat PRDX5
211070 x at DBI


242887 at
206200 s at
203607 at
205282 at


209566 at
223306 at
210166 at
225050 at
226480 at
211152 sat
222603 at
226078 at
203409 at
222996 s at
229597 sat
209420 s at
213333 at
232524 x at
238058 at
212660 at
209197 at
200875 s at
207008 at
233694 at
217957 at
228070 at
225997 at
65438 at
218921 at
240001 at
227533 at
226333 at
1562249 at
204301 at
213296 at
224688 at
221843 s at
1569808 at
38290 at
226820 at
241344 at
228512 at
210830 s at


KCMF1
ANXA11
NPP5F
LRP8


INSIG2
EBPL
TLR5
ZNF512
NA
HTRA2
ERMP1
RPUSD1
DDB2
CXXC5
WDFY4
SMPD1
MDH2
ANAPC4
FLJ27365
PHF15
SYT11
NOL5A
IL8RB
HSPA1L
C16orf80
PPP2R5E
MOBKL1A
KIAA1609
SIGIRR
NA
NA
IL6R
LOC28596_
KBTBD11
RER1
C7orf42
KIAA1609
NA
RGS14
ZNF362
NA
PTCD3
PON2


continued)

ubiquitin-li


ke 4A


diazepam binding inhibitor (GABA receptor modulator, acyl-Coenzy
binding protein)
potassium channel modulatory factor 1
annexin A11
inositol polyphosphate-5-phosphatase F
low density lipoprotein receptor-related protein 8, apolipoprotein e
receptor
insulin induced gene 2
emopamil binding protein-like
toll-like receptor 5
zinc finger protein 512


HtrA serine peptidase 2
endoplasmic reticulum metallopeptidase 1
RNA pseudouridylate synthase domain containing 1
.... DNA binding protein 2, 48kDa
CXXC finger 5
WDFY family member 4
sphingomyelin phosphodiesterase 1, acid lysosoma
malate dehydrogenase 2, NAD (mitochondrial)
anaphase promoting complex subunit 4
FLJ27365 protein
PHD finger protein 15
synaptotagmin XI
nucleolar protein 5A (56kDa with KKE/D repeat)
interleukin 8 receptor, beta
heat shock 70kDa protein 1-like
chromosome 16 open reading frame 80
protein phosphatase 2, regulatory subunit B@#$%&, epsil
MOB1, Mps One Binder kinase activator-like 1A (yeast)
KIAA1609
single immunoglobulin and toll-interleukin 1 receptor (TI


me A


Sisoform




domain


interleukin 6 receptor
hypothetical protein LOC285965
kelch repeat and BTB (POZ) domair


iR1 retentior
:hromosome
;IAA1609


1 endoplasmic reticulum
open reading frame 42


regulator of G-protein signaling 14
zinc finger protein 362
NA
Pentatricopeptide repeat domain 3
paraoxonase 2


Page 15 of 26


moloq (S. cerevisiae)







Chauncey et al. BMC Immunology 2012, 13:33 Page 16 of 26
http://www.biomedcentral.com/1471-2172/13/33




Table 1 Control vs Toxin corresponding P-value p<0.001 (Continued)

514 0.0009436 1.44 219493 at SHCBP1 SHC SH2-domain binding protein 1
515 0.0009471 1.38 230122 at MLLT10 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog,
Drosophila); translocated to, 10
516 0.0009526 1.67 218380 at NLRP1 NLR family, pyrin domain containing 1
517 0.0009562 1.42 202200 sat SRPK1 SFRS protein kinase 1
518 0.0009575 1.63 202741 at PRKACB protein kinase, cAMP-dependent, catalytic, beta
519 0.0009592 1.43 228869 at NA NA
520 0.0009614 1.25 224252 sat FXYD5 FXYD domain containing ion transport regulator 5
521 0.0009626 1.45 221488 sat CUTA cutA divalent cation tolerance homolog (E. coli)
522 0.0009634 1.7 244687 at DBT dihydrolipoamide branched chain transacylase E2
523 0.0009679 1.17 209445 x at C7orf44 chromosome 7 open reading frame 44
524 0.0009703 1.14 244537 at NA NA
525 0.0009717 1.7 226104 at RNF170 ring finger protein 170
526 0.0009730 1.31 205240 at GPSM2 G-protein signaling modulator 2 (AGS3-like, C. elegans)
527 0.0009732 1.73 200766 at CTSD cathepsin D
528 0.0009734 1.41 231844 at MGC27345 hypothetical protein MGC27345
529 0.0009738 1.29 202634 at POLR2K polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa
530 0.0009760 1.58 224938 at NUFIP2 nuclear fragile X mental retardation protein interacting protein 2
531 0.0009764 2.26 204089 x at MAP3K4 mitogen-activated protein kinase kinase kinase 4
532 0.0009776 1.93 211985 sat CALM1 calmodulin 1 (phosphorylase kinase, delta)
533 0.0009778 2.65 213280 at GARNL4 GTPase activating Rap/RanGAP domain-like 4
534 0.0009805 1.48 236016 at NA NA
535 0.0009828 1.84 217394 at NA NA
536 0.0009900 1.58 201030 x at LDHB lactate dehydrogenase B
537 0.0009925 1.81 227379 at MBOAT1 membrane bound O-acyltransferase domain containing 1
538 0.0009997 -1.19 236663 at NA NA
539 0.0009983 -1.6 219766 at B9D2 B9 protein domain 2
540 0.0009949 -1.71 204157 s at KIAA0999 KIAA0999 protein
541 0.0009891 -1.23 214060 at SSBP1 single-stranded DNA binding protein 1
542 0.0009868 -1.47 226276 at TMEM167A transmembrane protein 167A
543 0.0009825 -1.75 203596 s at IFIT5 interferon-induced protein with tetratricopeptide repeats 5
544 0.0009805 -1.64 226310 at RICTOR rapamycin-insensitive companion of mTOR
545 0.0009772 -2.29 218986 s at DDX60 DEAD (Asp-Glu-Ala-Asp) box polypeptide 60
546 0.0009758 -1.52 217618 x at HUS1 HUS1 checkpoint homolog (S. pombe)
547 0.0009746 -2.4 219017 at ETNK1 ethanolamine kinase 1
548 0.0009745 -1.24 201957 at PPPIR12B protein phosphatase 1, regulatory (inhibitor) subunit 12B
549 0.0009737 -1.26 240887 at NA NA
550 0.0009681 -1.33 209514 s at RAB27A RAB27A, member RAS oncogene family
551 0.0009661 -2.54 219026 sat RASAL2 RAS protein activator like 2
552 0.0009592 -1.49 211395 x at FCGR2C Fc fragment of IgG, low affinity Ic, receptor for (CD32)
553 0.0009568 -3.72 205126 at VRK2 vaccinia related kinase 2
554 0.0009560 -1.22 1556514 at LOC338809 hypothetical protein LOC338809
555 0.0009506 -2.66 206991 sat CCR5 chemokine (C-C motif) receptor 5
556 0.0009500 -1.47 212840 at UBXN7 UBX domain protein 7
557 0.0009443 -1.25 244496 at NA NA
558 0.0009406 -1.21 236108 at KIAA1632 KIAA1632
559 0.0009366 -1.2 203654 s at COIL coilin
560 0.0009338 -2.95 236156 at LIPA lipase A, lysosomal acid, cholesterol esterase







Chauncey et al. BMC Immunology 2012, 13:33
http://www.biomedcentral.com/1471-2172/13/33


Table 1 Control vs

561 0.0009309 -1.3
562 0.0009278 -2.58
563 0.0009220 -1.58
564 0.0009134 -1.08
565 0.0009077 -1.25
566 0.0009071 -1.7
567 0.0009063 -3.06
568 0.0009031 -1.27
569 0.0008974 -142
570 0.0008959 -1.19
571 0.0008945 -1.16
572 0.0008922 -1.32
573 0.0008910 -3.14
574 0.0008877 -1.67
575 0.0008870 -1.29
576 0.0008761 -1.35
577 0.0008698 -1.32
578 0.0008616 -1.87
579 0.0008599 -1.25
580 0.0008580 -1.13
581 0.0008574 -1.28
582 0.0008537 -1.22
583 0.0008463 -1.07
584 0.0008408 -1.33
585 0.0008385 -1.24
586 0.0008384 -149
587 0.0008274 -1.34
588 0.0008198 -1.33
589 0.0008196 -2.91
590 0.0008172 -1.42
591 0.0008164 -1.3


0.0008160
0.0008023
0.0007993
0.0007951
0.0007921
0.0007824
0.0007777
0.0007732
0.0007729
0.0007690
0.0007673
0.0007657
0.0007625
0.0007608
0.0007426
0.0007405


Toxin corresponding P-value p<0.001

212462 at MYST4
219403_s at HPSE
1554747_aat 2-Sep
203291 at CNOT4
243772 at SDCCAG8
201656 at ITGA6
201325 sat EMP1
209531 at GSTZ1
208779 x at DDR1
242654 at FANCC
220386 s at EML4
227003 at RAB28
224009 x at DHRS9
32069 at N4BP1
232141 at U2AF1
240468 at NA
204367 at SP2
225076 sat ZNFX1
225056 at SIPA1 L2
207070 at RGR
217129 at NA
225268 at KPNA4
232295 at GFM1
211975 at ARFGAP2
244625 at NA
202083 sat SEC14L1
232987_at ARL17
1570541 sat NA
201324 at EMP1
222408 s at YPEL5
201585 sat SFPQ


243492 at
222537 s at
223225 sat
231139 at
206911 at
1554390 s at
208824 x at
214258 x at
208751 at
238337 sat
211314 at
217834 s at
208653 s at
209091 sat
1557533 at
1555785 a at


THEM
CDC42SE1
SEH1L
NA
TRIM25
ACTR2
PCTK1
KAT5
NAPA
DNAJC21
CACNA1G
SYNCRIP
CD164
SH3GLB1
NA
XRN1


(Continued)

MYST histone acetyltransferase (monocytic leukemia) 4
heparanase
septin 2
CCR4-NOT transcription complex, subunit 4
serologically defined colon cancer antigen 8
integrin, alpha 6
epithelial membrane protein 1
glutathione transferase zeta 1
discoidin domain receptor tyrosine kinase 1
Fanconi anemia, complementation group C
echinoderm microtubule associated protein like 4
RAB28, member RAS oncogene family
dehydrogenase/reductase (SDR family) member 9
NEDD4 binding protein 1
U2 small nuclear RNA auxiliary factor 1
NA


Sp2 transcription factor
zinc finger, NFXI-type containing
signal-induced proliferation-assoc
retinal G protein coupled receptc


iated 1 like 2


NA
karyopherin alpha 4 importingn alpha 3)
G elongation factor, mitochondrial 1
ADP-ribosylation factor GTPase activating protein 2
NA
SEC14-like 1 (S. cerevisiae)
ADP-ribosylation factor-like 17
NA
epithelial membrane protein 1
yippee-like 5 (Drosophila)
splicing factor proline/glutamine-rich (polypyrimidine tract binding protein
associated)
thioesterase superfamily member 4
CDC42 small effector 1
SEH-like (S. cerevisiae)
NA
tripartite motif-containing 25
ARP2 actin-related protein 2 homolog (yeast)
PCTAIRE protein kinase 1
K(lysine) acetyltransferase 5
N-ethylmaleimide-sensitive factor attachment protein, alpha
DnaJ (Hsp40) homolog, subfamily C, member 21
calcium channel, voltage-dependent, T type, alpha 1G subunit
synaptotagmin binding, cytoplasmic RNA interacting protein
CD164 molecule, sialomucin
SH3-domain GRB2-like endophilin B1
NA
5@#$%&-3@#$%& exoribonuclease 1


Page 17 of 26








Chauncey et al. BMC Immunology 2012, 13:33
http://www.biomedcentral.com/1471-2172/13/33


Table 1 Control vs

608 0.0007371 -141
609 0.0007346 -1.14
610 0.0007341 -1.29
611 0.0007227 -1.29


0.0007183
0.0007169
0.0007139
0.0006984
0.0006943
0.0006932
0.0006882
0.0006875
0.0006868
0.0006826
0.0006769
0.0006749
0.0006737
0.0006701
0.0006700
0.0006616
0.0006570
0.0006553
0.0006552


0.0006495
0.0006472
0.0006450
0.0006425
0.0006398
0.0006384


0.0006373
0.0006346
0.0006313
0.0006284
0.0006259
0.0006104
0.0006091
0.0005929
0.0005927
0.0005896
0.0005883
0.0005855
0.0005853
0.0005801
0.0005772
0.0005770
0.0005750


Toxin corresponding P-value p<0.001 (C

236961 at NA
204080 at TOE1
243852 at LUC7L2
210317 s at YWHAE


209284 sat
227361 at
211066 x at
202814 s at
226710 at
209969 s at
225242 s at
214121 x at
203916 at
208901 s at
206028 sat
205724 at
228121 at
226928 x at
1555301 a at
1566301 at
234519 at
218520 at
201878 at


1564131 a at
209102 s at
238586 at
216231 sat
1552772 at
201586 s at


41644_at
216652 sat
212436 at
212264 s at
226481 at
217490 at
1557463 at
238273 at
203840 at
237604 at
222881 at
220634 at
200669 sat
232017 at
213918 s at
215357 _sat
1561354 at


C3orf63
HS3ST3B1
PCDHGC3
HEXIM1
C8orf82
STAT1
CCDC80
PDLIM7
NDST2
TOPI
MERTK
PKP1
NA
SLC25A37
DIP2A
PPP1Rll
NOBOX
TBK1
ARIH1


NA
HBP1
LOC731489
B2M
CLEC4D
SFPQ


SASH1
DR1
TRIM33
WAPAL
VPRBP
NA
NA
PL-5283
BLZF1
LOC415056
HPSE
TBX4
UBE2D3
TJP2
NIPBL
POLDIP3
NA


continued)

NA
target of EGRI, member 1 (nuclear)
LUC7-like 2 (S. cerevisiae)
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase
protein, epsilon polypeptide
chromosome 3 open reading frame 63
heparan sulfate (glucosamine) 3-0-sulfotransferase 3B1
protocadherin gamma subfamily C, 3
hexamethylene bis-acetamide inducible 1
chromosome 8 open reading frame 82
signal transducer and activator of transcription 1, 91 kDa
coiled-coil domain containing 80
PDZ and LIM domain 7 (enigma)
N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2
topoisomerase (DNA) I
c-mer proto-oncogene tyrosine kinase
plakophilin 1 ectodermall dysplasia/skin I syndrome)


NA
solute carrier family 25, member 37
DIP2 disco-interacting protein 2 home


activate


A (Drosophila)


protein phosphatase 1, regulatory (inhibitor) subunit 11
NOBOX oogenesis homeobox
TANK-binding kinase 1
ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein,
(Drosophila)


HMG-box transcription factor 1
hypothetical protein LOC731489
beta-2-microglobulin
C-type lectin domain family 4, member D
splicing factor proline/glutamine-rich (polypyr
associated)
SAM and SH3 domain containing 1
down-regulator of transcription 1, TBP-bindin(
tripartite motif-containing 33
wings apart-like homolog (Drosophila)
Vpr (HIV-1) binding protein


midine tract binding protein



(negative cofactor 2)


PL-5283 protein
basic leucine zipper nuclear factor 1
hypothetical gene LOC415056
heparanase
T-box 4
ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast)
tight junction protein 2 Zonaa occludens 2)
Nipped-B homolog (Drosophila)
polymerase (DNA-directed), delta interacting protein 3
NA


Page 18 of 26








Chauncey et al. BMC Immunology 2012, 13:33
http://www.biomedcentral.com/1471-2172/13/33


Table 1 Control vs Toxin corresponding P-value p<0.001 (C

654 0.0005678 -1.08 206516 at AMH
655 0.0005652 -2.05 211030 sat SLC6A6
656 0.0005634 -2.18 222651 s at TRPS1
657 0.0005618 -2.05 57703_at SENP5
658 0.0005604 -11.89 211372s at IL1R2
659 0.0005547 -1.2 1567246 at OR5H1
660 0.0005488 -1.85 205003 at DOCK4
661 0.0005371 -2.37 222262 s at ETNK1
662 0.0005358 -1.38 201684 s at TOX4
663 0.0005357 -1.85 206011 at CASP1


0.0005349
0.0005342
0.0005321
0.0005228
0.0005162

0.0005087
0.0005005
0.0004997
0.0004992
0.0004955
0.0004947
0.0004946
0.0004897
0.0004707
0.0004609
0.0004595
0.0004582
0.0004567
0.0004553
0.0004545
0.0004543
0.0004511
0.0004444
0.0004435
0.0004430
0.0004418
0.0004358
0.0004288
0.0004258
0.0004189
0.0004130
0.0004109

0.0003904
0.0003884
0.0003884
00003882


211505s at
1554049 s at
225978 at
215056 at
202066 at

226128 at
1562449 s at
217847 sat
229845 at
211806 s at
217503 at
221147 x at
1552684 a at
206251 s at
223546 x at
208576 s at
202684 s at
201378 sat
202178 at
1555139 a at
244595 at
210592 s at
1554327 a at
223430 at
232437 at
202230 s at
211782 at
208869_s at
1554646 at
224410 s at
201698 s at
218578 at

1566456 at
226026 at
222035 sat
240313 at


STAU 1
WDR42A
FAM80B
NA
PPFIA1

NA
NA
THRAP3
MAPKAP1
KCNJ15
NA
WWOX
SENP8
AVPR1A
LUC7L
HIST1H3B
RNMT
UBAP2L
PRKCZ
OTUD7B
NA
04/01/12
CANT1
SNF1LK2
CPSF3L
CHERP
DS
GABARAPI
OSBPL1A
LMBR1
SFRS9
CDC73

NA
DIRC2
PAPOLA
DMRTB1


anti-Mullerian hormone
solute carrier family 6 (neurotransmitter transporter, taurine), member 6
trichorhinophalangeal syndrome
SUMOl/sentrin specific peptidase 5
interleukin 1 receptor, type I
olfactory receptor, family 5, subfamily H, member 1
dedicator of cytokinesis 4
ethanolamine kinase 1
TOX high mobility group box family member 4
caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta,
convertase)
staufen, RNA binding protein, homolog 1 (Drosophila)
WD repeat domain 42A
family with sequence similarity 80, member B
NA
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF),
interacting protein (liprin), alpha 1
NA
NA
thyroid hormone receptor associated protein 3
mitogen-activated protein kinase associated protein 1
potassium channel, subfamily J, member 15
NA
WW domain containing oxidoreductase
SUMO/sentrin specific peptidase family member 8
arginine vasopressin receptor 1A
LUC7-like (S. cerevisiae)
histone cluster 1, H3b
RNA (guanine-7-) methyltransferase
ubiquitin associated protein 2-like
protein kinase C, zeta
OTU domain containing 7B
NA
spermidine/spermine NI-acetyltransferase 1
calcium activated nucleotidase 1
SNFl-like kinase 2
cleavage and polyadenylation specific factor 3-like
calcium homeostasis endoplasmic reticulum protein
iduronate 2-sulfatase
GABA(A) receptor-associated protein like 1
oxysterol binding protein-like 1A
limb region 1 homolog (mouse)
splicing factor, arginine/serine-rich 9
cell division cycle 73, Pafl/RNA polymerase II complex component,
homolog (S. cerevisiae)
NA
disrupted in renal carcinoma 2
poly(A) polymerase alpha
DMRT-like family B with proline-rich C-terminal, 1


Page 19 of 26








Chauncey et al. BMC Immunology 2012, 13:33
http://www.biomedcentral.com/1471-2172/13/33


Table 1 Control vs

700 0.0003880 -1.65
701 0.0003868 -2.87
702 0.0003850 -143
703 0.0003839 -1.93


704 0.0003823
705 0.0003803
706 0.0003785
707 0.0003695
708 0.0003684
709 0.0003661
710 0.0003575
711 0.0003529
712 0.0003527
713 0.0003455
714 0.0003409
715 0.0003389
716 0.0003355
717 0.0003300
718 0.0003300
719 0.0003231
720 0.0003229
721 0.0003210
722 0.0003206
723 0.0003169
724 0.0003084
725 0.0003068
726 0.0002955
727 0.0002940
728 0.0002921


0.0002910
0.0002863
0.0002857
0.0002808
0.0002799
0.0002764
0.0002736
0.0002703
0.0002699
0.0002674
0.0002668
0.0002633
0.0002619
0.0002577

0.0002569
0.0002547
00002484


Toxin corresponding P-value p<0.001

242943 at ST8SIA4
243271 at NA
234173 s at NXF2
211368 s at CASP1


227712 at
201377 at
204858 s at
205415 s at
209237 sat
235833 at
209590 at
215966 x at
202807 s at
201198 s at
202068 s at
200914 x at
225395 sat
216306 x at
208985s at
1569932 at
204781 sat
209593 s at
237285 at
202550 sat
201461 s at
1563069 at
218382 s at
205570 at
208642 s at

221603 at
231211 sat
219062 s at
218570 at
223545 at
1555614 at
1556283 s at
226022 at
214838 at
206307 sat
208108 s at
239949 at
1554096 a at
203039 s at

1563541 at
210569 s at
203922 s at


LYRM2
UBAP2L
TYMP
ATXN3
SLC23A2
PPAT
BMP7
GK3P
TOM1
PSMD1
LDLR
KTN1
FAM120AOS
PTBP1
EIF3J
NHSL2
FAS
TOR1B
SORBS2
VAPB
MAPKAPK2
NA
U2AF2
PIP4K2A
XRCC5

PEX16
LOC541469
ZCCHC2
KBTBD4
FANCD2
SUGT1 P
FGFR1OP2
SASH1
SFT2D2
FOXD1
AVPR2
THNSL2
RBM33
NDUFS1

NA
SIGLEC9
CYBB


(Continued)

ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4
NA
nuclear RNA export factor 2
caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta,
convertase)
LYR motif containing 2
ubiquitin associated protein 2-like
thymidine phosphorylase
ataxin 3
solute carrier family 23 (nucleobase transporters), member 2
phosphoribosyl pyrophosphate amidotransferase
bone morphogenetic protein 7
glycerol kinase 3 pseudogene
target of mybl (chicken)
proteasome (prosome, macropain) 26S subunit, non-ATPase, 1
low density lipoprotein receptor
kinectin 1 (kinesin receptor)
family with sequence similarity 120A opposite strand
polypyrimidine tract binding protein 1
eukaryotic translation initiation factor 3, subunit J
NHS-like 2
Fas (TNF receptor superfamily, member 6)
torsin family 1, member B (torsin B)
sorbin and SH3 domain containing 2
VAMP (vesicle-associated membrane protein)-associated protein B and C
mitogen-activated protein kinase-activated protein kinase 2
NA


U2 small nuclear RNA auxiliary fact
phosphatidylinositol-5-phosphate 4-
X-ray repair complementing defect\
(double-strand-break rejoining)
peroxisomal biogenesis factor 16
hypothetical protein LOC541469
zinc finger, CCHC domain containing
kelch repeat and BTB (POZ) domain
Fanconi anemia, complementation
suppressor of G2 allele of SKP1 pseL
FGFR1 oncogene partner 2
SAM and SH3 domain containing 1


r 2
kinase, type II, alpha
ve repair in Chinese hamster cells





g 2
containing 4
group D2
dogene (S. cerevisiae)


S l2 domain containing 2
forkhead box D1
arginine vasopressin receptor 2
threonine synthase-like 2 (S. cerevisiae)
RNA binding motif protein 33
NADH dehydrogenase (ubiquinone) Fe-S protein
coenzyme Q reductase)
NA
sialic acid binding Ig-like lectin 9
cytochrome b-245, beta polypeptide


(Da (NAD-


Page 20 of 26








Chauncey et al. BMC Immunology 2012, 13:33
http://www.biomedcentral.com/1471-2172/13/33


Table 1 Control vs Toxin corresponding P-value p<0.001

746 0.0002482 -1.33 220012 at ERO1LB
747 0.0002373 -2.41 236106 at NA
748 0.0002362 -1.34 242834 at NA
749 0.0002316 -1.2 220498 at ACTL7B
750 0.0002303 -1.44 240873 x at DAB2
751 0.0002296 -1.19 221471 at SERINC3
752 0.0002267 -1.74 213236 at SASH1
753 0.0002262 -1.62 213988 s at 04/01/12
754 0.0002220 -1.2 239372 at NA
755 0.0002208 -1.35 240079 at ZNF81
756 0.0002182 -1.65 205227 at IL1RAP
757 0.0002149 -1.5 223751 x at TLRIO
758 0.0002132 -1.35 1553677 a at TIPRL
759 0.0002103 -1.44 AFFX- STAT1
HUMISGF3A/
M97935 5 at
760 0.0002103 -1.11 202240 at PLK1
761 0.0002099 -1.28 1556281 at NA
762 0.0002093 -1.53 222989 s at UBQLN1
763 0.0002070 -1.16 204682 at LTBP2
764 0.0002018 -1.37 225830 at PDZD8
765 0.0002016 -1.34 229208 at CEP27
766 0.0002006 -1.38 202211 at ARFGAP3
767 0.0001969 -1.21 208696 at CCT5
768 0.0001905 -1.71 219207 at EDC3
769 0.0001804 -1.31 221248 s at WHSC1L1
770 0.0001758 -1.59 211781 x at NA
771 0.0001730 -1.36 226037 s at TAF9B


72 0.000
73 0.000
74 0.000
75 0.000
76 0.000


200901
213173
206038
225397
211367

222810
231718
223905
211672
200828
244211
205403
209970


217502
237867
218516
226312
210940


0.0001034
0.0001029
0.0001028
9.94E-005
9.41E-005


M6PR
PCNX
NR2C2
C15orf57
CASP1

RASAL2
SLU7
CCDC131
ARPC4
ZNF207
NA
IL R2
CASP1


IFIT2
PID1
IMPAD1
RICTOR
GRM1


(Continued)

EROI-like beta (S. cerevisiae)
NA
NA
actin-like 7B
disabled homolog 2, mitogen-respor
serine incorporator 3
SAM and SH3 domain containing 1
spermidine/spermine NI-acetyltransf


isive phosphoprotein (Drosophila)


zinc finger protein 81
interleukin 1 receptor accessory protein
toll-like receptor 10
TIP41, TOR signaling pathway (S. cerevisiae)
signal transducer and activator of transcription 1, 91 kDa



polo-like kinase 1 (Drosophila)
NA
ubiquilin 1
latent transforming growth factor beta binding protein 2
PDZ domain containing 8
centrosomal protein 27kDa
ADP-ribosylation factor GTPase activating protein 3
chaperonin containing TCP1, subunit 5 (epsilon)
enhancer of mRNA decapping 3 homolog (S. cerevisiae)
Wolf-Hirschhorn syndrome candidate 1-like 1
NA
TAF9B RNA polymerase 1, TATA box binding protein (TBP)-associated
factor, 31kDa
mannose-6-phosphate receptor (cation dependent)
pecanex homolog (Drosophila)
nuclear receptor subfamily 2, group C, member 2
chromosome 15 open reading frame 57
caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta,
convertase)
RAS protein activator like 2
SLU7 splicing factor homolog (S. cerevisiae)
coiled-coil domain containing 135
actin related protein 2/3 complex, subunit 4, 20kDa
zinc finger protein 207
NA


interleukin 1 receptor, type I
caspase 1, apoptosis-related cysteine peptidase (interleukin
convertase)
interferon-induced protein with tetratricopeptide repeats 2
phosphotyrosine interaction domain containing 1
inositol monophosphatase domain containing 1
rapamycin-insensitive companion of mTOR
glutamate receptor, metabotropic 1


1, beta,


Page 21 of 26







Chauncey et al. BMC Immunology 2012, 13:33
http://www.biomedcentral.com/1471-2172/13/33




Table 1 Control vs Toxin corresponding P-value p<0.001 (Continued)


ATPase, class VI, type 11B
transmembrane anterior posterior transformation
CCAAT/enhancer binding protein (C/EBP), delta
keratin 33B
T-cell leukemia homeobox 2


solute carrier family 12 (potassium/


ide transporters), member 6


1554556 a at
226735 at
213006 at
207787 at
207410 s at
223596 at
231859 at
228277 at
210470 x at
222432 s at
238496 at
208698 s at
203946 s at
1559952 x at
220104 at
203595s at
1569859 at
224359 s at
205921 sat
205749 at
1566136 at
210992 x at
207801 s at
222816 s at
211884 s at
212664 at
212081_x at
1554177 a at


ATP11B
TAPT1
CEBPD
KRT33B
TLX2
SLC12A6
C14orfl32
FBXL19
NONO
CCDC47
NA
NONO
ARG2
LOC100132923
ZC3HAV1
IFIT5
NA
HOOK3
SLC6A6
CYP1A1
NA
FCGR2C
RNF10
ZCCHC2
CIITA
TUBB4
BAT2
ATP5S


ger protein 10
ger, CCHC domain


(CD32)


staining 2


class II, major histocompatibility complex, transactivatc
tubulin, beta 4
HLA-B associated transcript 2


ATP synthase, H+ transporting, mitc
(factor B)


drial FO complex, subunit s


818 7.00E-007 -1.82 224783 at FAM100B
819 6.00E-007 -1.57 208840 s at G3BP2
820 4.00E-007 -1.59 206717 at MYH8



over-expression of RGS14, thereby ,i,,,..I, L G-protein
mediated i.., required for actin-based motility.
RGS14 expression is down-regulated during the mat-
uration of monocytes to dendritic cells [24] and over-
expression of this G-protein L-:! :i .. would be expected
to block monocyte maturation. RGS14 levels are also
known to decrease in dendritic cells exposed to Leishmania
major or Toxoplasma J..'. ..--. that RGS14 down-
regulation may be an important step in a normal immune
response, and u ... 1 ,li- .n of RGS14 by LT could be
..-1, ;1! !,. .- to LTs immunosuppressive effects [25].
Three chemokine receptors were also altered after LT
treatment, -_- i:- .._- that LT may be inducing functional
defects in monocyte response -- -..i.. IL-8 receptor beta
(CXCR2) was up-regulated after LT treatment (Table 2).
CXCR2 transduces signaling through a G-protein activated


family with sequence similarity 100, member B
GTPase activating protein (SH3 domain) binding protein 2
myosin, heavy chain 8, skeletal muscle, perinata



second messenger system. This receptor is important
for monocyte transendothelial migration, and up-
I, .1 it;.. of CXCR2 could serve to enhance the deliv-
ery of monocytes to tissues. Anthrax spores must be
phagocytosed by macrophages in order to germinate
into viable bacteria. An increase in the macrophage
pool may aid in a reservoir for increased germination of
viable bacteria. IL-1 receptor type II (IL-1R2), was
found to be ..,: I,.; down-regulated. IL-1R2 is a
decoy receptor for IL-1 that functions either at the cell
surface or in a soluble form [26]. The decreased expres-
sion of the decoy receptor would presumably increase
IL-la levels and increase the febrile response of the
host potentially at least in part explaining the high fever
that commonly accompanies systemic anthrax [27].
CCR5 is a receptor for the monocyte chemokines


Page 22 of 26


chromosome 14 open reading frame 132
F-box and leucine-rich repeat protein 19
non-POU domain containing, octamer-binding
coiled-coil domain containing 47
NA
non-POU domain containing, octamer-binding
arginase, type I
similar to hCG1993470
zinc finger CCCH-type, antiviral 1
interferon-induced protein with tetratricopeptide repeats 5
NA
hook homolog 3 (Drosophila)
solute carrier family 6 (neurotransmitter transporter, taurine), member 6
cytochrome P450, family 1, subfamily A, polypeptide 1
NA


fragment of IgG, low affinity Ic, receptc







Chauncey et al. BMC Immunology 2012, 13:33
http://www.biomedcentral.com/1471-2172/13/33


Pathway Description


P-value


h_mapkPathway MAPKinase Signaling Pathway 228 0.00001
h_p38mapkPathway p38 MAPK Signaling Pathway 103 0.00001
h_ill8Pathway IL 18 Signaling Pathway 9 0.00004
h_tollPathway Toll-Like Receptor Pathway 87 0.00028
h_ifnaPathway IFN alpha signaling pathway 25 0.00043
h_gpcrPathway Signaling Pathway from G-Protein Families 70 0.00044
h_p53hypoxiaPathway Hypoxia and p53 in the Cardiovascular system 67 0.00191
h_arenrf2Pathway Oxidative Stress Induced Gene Expression Via Nrf2 51 0.00418


Microarray vs qRT-PCR

*

0*

0
*^^'


0 2 4 6 8
qRT-PCR Fold Change


:hical cluster ar
e left are from
wn-regulated c
the number of


alysis showing the 820 probe sets which were differentially expressed at
control samples, whereas the cluster on the right shows the LT treated
eenes are shown in blue. B.) Biocarta pathway analysis showing the
genes and p-value within each pathway that were affected. C.) Correlati


microarray analysis versus RT-PCR. Spearman


RANTES and MIP. The down-regulation of CCR5 by
LT could reflect an inability of toxin-treated monocytes
to differentiate into macrophages [28] (Table 2). During
the early stages of infection, macrophages play a critical
role in assisting B. anthracis pathogenesis by providing
a place for bacteria germination from their spore form
to viable bacteria. An increase in monocyte trafficking to

Table 2 Predicted effects of LT on monocyte function.1
Gene Microarray Effects


RGS-14 5.61

CXCR2 5.04


Blockade of monocyte maturation to dendriti
cells, inhibition ofchemotaxis
increased monocyte transendothelial migratic
into tissues


HPSE -2.58 Diminished inflammatory response
CCR5 -2.33 Reduced responsiveness to the inflammatory
mediators RANTES, MIP1 beta


R2 -12.


greased IL1 alpha responsiveness and
reased fever


1 Calculated fold changes compared to mock treated samples.


orrelati


efficient= 0.88'


allow an increase in spore uptake and subsequent germin-
ation would prove beneficial for B. anthracis. During later
stages of infection, after release of viable bacteria, limiting
monocyte differentiation to macrophages would assist in
preventing clearance of viable bacteria.
In addition to an alteration in the chemokine response
by LT, an additional enzyme, heparanase (HPSE), was
found to be decreased in LT-treated human monocytes.
This enzyme is an endoglycosidase that degrades heparin
sulfate, resulting in disassembly of extracellular barriers
required for cell migration [29]. Heparanase has also been
postulated to play a role in inflammation [30] and our
results showed a 2.6 fold decrease in heparanase gene ex-
pression (Table 2). One study has concluded that an
in vivo siRNA against heparanase, along with an inhibitor
of its enzymatic activity, results in a diminished inflamma-
tory response [31]. Thus LT- mediated inhibition of hepar-
anase expression could also contribute to the inhibition of
the host immune response during an anthrax infection.


Page 23 of 26


Biocarta
Pathway


# of
genes


(A)I



.-C M N -
2 2- 1- i -i
C C C C *s< Ms Cs T
0000 0000
0000 III


S 0
-2.0 2.0
Figure 3 Supervised microarray analysis. A.) Hier
the 0.001 level. The arrays clustering on
samples. Up-regulated genes are shown in red and
pathways most affected by LT, along wi
of aenes altered after treatment with anthrax LT usir







Chauncey et al. BMC Immunology 2012, 13:33
http://www.biomedcentral.com/1471-2172/13/33


An external verification method using ::.i ti.
real-time PCR was utilized to confirm the microarray
data. The eight genes corresponding to RGS14, IL8RB,
TLR5, PPM1H, CD47, SYK, CCR5, and IL1R2 were
chosen for microarray confirmation in monocytes. CCR5
and IL1R2 were confirmed to be down-regulated at 4 h
after LT treatment, reinforcing the microarray data,
while the other six genes were up-regulated, again con-
firming the microarray data (Table 3). A correlation
curve was plotted (Figure 3C) and analyzed, showing a
linear relationship between the microarray results and
RT-PCR with a correlation coefficient of 0.885. Results
were performed in duplicates and fold values were
normalized to GAPDH. To exclude the i '. i..i:; the
lymphocyte contamination might be contributing to our
microarray findings, a higher purity monocyte popula-
tion (98% purity), obtained by adherence :*!! ..-..:1 by
washing off:: .:: .I.. .. ,i lymphocytes, was treated with
500 ng/mL LT for 4 h and gene expression was assessed
using real-time PCR. These experiments. i .1 3 genes
to be increased after LT treatment: RGS14, TLR5, and
CD47 (1.21-1.70), as observed by the microarray of sus-
pended cells. These findings suggest that the changes in
messenger RNA observed are primarily contributed by
monocytes, but we cannot entirely exclude a contribu-
tion by lymphocytes.


Conclusions
Our investigations show human peripheral monocytes
are --. ..: -.;(l-.,l. to the actions of anthrax LT and do not
undergo LT-mediated cytotoxicity after a four hour toxin


Table 3 q-RTPCR confirmation of LT-induced genes.1
Probe Microarray q-RT-PCR
38290 at 5.61 740


207008 at


210166 at

212686 at


226016 at


209269 at


206991 at


205403 at


treatment. We also find that LT induces changes in sev-
eral genes involved in previously unidentified pathways
including the TLR pathway, IFN alpha pathway, and G-
Protein family signaling pathways. The i:. ,i ,:-- ,,.... of
several previously unappreciated gene products includ-
ing RGS14, IL8 receptor beta, CD47, TNF ligand, IL-16,
Syk, CCR5, and IL-1 receptor II adds to our understand-
ing of how LT impacts the immune response. Our path-
way analysis reveals that anthrax LT targets multiple
normal immune-regulatory pathways that would be
expected to protect the host against anthrax infection.
The increase in RGS14 levels and decrease in CCR5,
along with IL-1R2, would likely impair monocyte func-
tions and help to facilitate bacteria survival. B. anthracis
maintains a selective advantage by impairing the host
immune responses, thereby -, ..-. -for invasion and
dissemination of the highly fatal bacilli. Our findings en-
courage further investigations into how these pathways
converge functionally to impair normal monocyte func-
tion, along with providing new insights into the regula-
tion of the host defense system and inflammation.


Methods
Monocyte isolation and toxin treatment
Whole blood was II,. .i by venous puncture from
healthy human volunteers into 8 mL vacutainer tubes con-
taining Ficoll (BD Biosciences). The study i.i:,... I US
Department of Health and Human Services .. I. il and
was approved by the University of Florida Institutional Re-
view Board. Whole blood was incubated with a monocyte
negative selection :..'l....'; (Stem Cell Technologies) for


Gene name
RGS14-F
RGS14-R


238


Primer sequence
CAGGGATCTGTGAGAAACGAG
AGGTGATCCTGTTTTCCAGC
GTCTAACAGCTCTGACTACCAC
TTAAATCCTGACTGGGTCGC
TTTTCAGGAGCCCGAGC
AGCCGAGATTGTGTCACTG
GAGTACAGAGAAAGGAGCTTGG
TCCAATAGTTGCCATAATCCACCCG
TTTGCTATACTCCTGTTCTGGG
TGGGACGAAAAGAATGGCTC
CAAGTTCTCCAGCAAAAGCG
CATCCGCTCTCCTTCTCTAAC
CCAAAAGCACATTGCCAAACG
ACTTGAGTCCGTGTCACAAGCC
TGGCACCTACGTCTGCACTACT
TTGCGGGTATGAGATGAACG


1 Calculated fold changes comparedtomock treated samples.


Page 24 of 26







Chauncey et al. BMC Immunology 2012, 13:33
http://www.biomedcentral.com/1471-2172/13/33


20 min., centrifuged 1700 x g for 25 min at RT, no brake
over Ficoll, re-suspended in 10 mL RPMI ,..'.i, .r. i,;
complete media, centrifuged at 250 x g for 9 min. to re-
move platelets, and re-suspended to 7-9 x 105 cells/mL in
RPMI. Monocytes were inverted at 37C with 500 ng/mL
LF and 500 ng/mL PA for 4 h. l.ii, .... qRT-PCR
experiments were performed using higher monocyte
purities '" : obtained by first using a negative selection
antibody cocktail (Stem Cell Technologies) isolation tech-
nique, followed by plastic i.,ui ... .* for 4 h, as d. .. .i. .i
previously [32].

Toxin purification
LF and PA were .i.. i,..i as previously described [33].
Briefly, .;-, ,. anthracis culture media was :i.i ....
through a 0.22 uM filter, followed by diethylaminoethyl
cellulose (DEAE) anion exchange chromatography. The
toxins were then subjected to gel filtration and hydro-
phobic interaction fast protein i:i,-o I chromatography
(FPLC) and highly -.. -1 toxin components were con-
firmed by Coomassie Blue staining.

Monocyte purity and apoptosis analysis
Monocytes were inverted at 37C with 500 ng/mL LF and
500 ,-L '.,I PA for 4 h, stained with CD-14 Pac Blue (BD
Biosciences), Annexin-V-Fluorescein and propidium
iodide (Roche). The cell population was gated first for
CD14-Pac-Blue followed by analysis of the relative
amount of Annexin (FL1) and PI iT 2I using flow cyto-
metry FACScan (BD), and analyzed by FCS Express
(De Novo).

MEK cleavage
Purified monocytes were incubated at 37C with 500 ng/
mL lethal toxin for 4 h. ( li. were lysed, ran on a 10%
SDS-PAGE gel (P;........ transferred to a PVDF mem-
brane i '. i.....i) and probed for MEK1 (Upstate). Mem-
branes were then i. :'i. ,1 and probed for MEK3 (Santa
Cruz). 3-actin (Sigma) was used to check consistent
loading amounts.

RNA isolation
Purified monocytes from 4 healthy volunteers were incu-
bated at 37C with :-...:1 : alone or with 500 ng/mL LT
for 4 h. Total RNA was collected using RNAeasy mini
kit (Qiagen) and RNA quantity and 't" ili, was assessed
using NanoDrop (Thermo Scientific) technology.

Microarray procedure
100 ng total RNA was labeled using Affymetrix Gene-
ChipC 3' IVT Express Kit for each replicate. .*,'.q.:ii, .1
labeled RNA was purified, fragmented, then hybridized
for 16 h on Affymetrix C ... 1".i (HG U133 plus 2.0)
representing approximately 22,000 well-characterized


human genes. Arrays were washed using Affymetrix
GeneChip" Fluidics Station FS450 and scanned using
GeneChip Scanner 3000 7 G.

Microarray analysis
Low-level analysis was performed using dChipmodeled-
based expression matrix (dChip 2007 (DNA-Chip
Analyzer), Build date: Jan 4, 2008). Unsupervised analysis
- probes sets whose i,; i.n.lh i ... signal intensity exhib-
ited a coefficient of variation of greater than 0.5 were ana-
lyzed by unsupervised hierarchical cluster analysis using
algorithms implemented in dChip. Supervised analysis -
significant probe sets between the treatment groups were
identified using a paired t-test (by donor) at a significance
threshold of p <0.001. Leave-one-out-cross-validation
using 4 prediction models was used to test the ability of
probe sets .;,.i. 1n at p< 0.001 to distinguish between
the treatment groups. Microarray analyses were done
using dCHIP and BRB-ArrayTools by Richard Simon
(http://il .. i- -, 'i..,v/BRB-ArrayTools.html). The micro-
array data for this study was I. :.. :1. .1 in the National Cen-
ter for Pr... .1,1. Information (NCBI) Gene Expression
Omnibus (GEO) [30] with accession numbersGSM848717
through GSM 848724. The microarray data is also available
in a series with accession number GSE34407.

Quantitative real time-PCR (qRT-PCR)
RNA was .:i. I using RNAeasy mini kit (Qiagen),
quantitated using a Nanodrop system (Thermo :...... -r-.
and 233 pg total RNA was used for cDNAsynthesis using
SuperScript III First-Strand Synthesis (Invitrogen). cDNA
was quantitated using SYBR Green J,.1,q ':, 1 TaqReady-
Mix (Sigma) and 10 mM forward and 10 mM reverse pri-
mers were used for each indicated reaction. Primers used
were as follows ACTB-F TCACCGAGCGCGGCT,ACTB-
R TAATGTAGCACGCACGATTCCC,GAPDH-F GGTGAA
GGTCGGAGTCAACG, and GAPDH-R AGAGTTAAAA
GCAGCCCTGGTG. All other primers are listed in Table 2.
Reactions were run on the MJR Opticon Continuous Fluor-
escence detector (Bio-Rad) and analyzed with Opticon
Monitor Software 1.08 (Bio-Rad).

Authors' contributions
KC performed the experiments, arnayzed data, Irntepreted study, drafted, and
wrote the manuscript CL performed the gene expression profiing,
blostatistical analysis, and helped design the study SZ participated in the
study design and assisted with experiments GS participated in the design
and inlelpretation of the study, as well as edited the manuscript HB
participated in the design and analyses of the study CQ supplied the
puriied toxin and assisted in data interpretation FS conceived the study and
participated in the design and coordination, as well as edited the
manuscript Al authors read and approved the f;nal manuscript

Acknowledgements
We thank Dr yle Moldawer for his guidance and assistance in the flow
cytomety analysis The study was supported by the National Institutes of
Health RO1A 064891 PubDcaton of this article was funded n part by the
University of Florida Open Access Publishing Fund


Page 25 of 26








Chauncey et a. BMC Immunology 2012, 13:33
http://www.biomedcentral.com/1471-2172/13/33


Author details
Department of Medicine, University of Florida College of Medicine,
Gainesville FL 32610, USA 2USA, Department of Molecular Genetics and
Microbiology, University of Florida, Gainesville, FL 32610, USA Centers for
Disease Control and Prevention, Atlanta, GA 30333, USA

Received: 29 November 2011 Accepted: 18 April 2012
Published: 2 July 2012


References
S Fukao T Immune system paralysis by anthrax lethal toxin: the roles of
innate and adaptive immunity. Lancet Infect Dis 2004, 4:166-170
2 Mock M, Fouet A Anthrax. Annu Rev Microbiol 2001, 55:647-671
3 Collier RJ, Young JA Anthrax toxin. Annu Rev Cell Dev Biol 2003, 19:45-70
4 Pellizzari R, Guidi-Rontani C, Vitale G, Mock M, Montecucco C Lethal factor
of Bacillus anthracis cleaves the N-terminus of MAPKKs: analysis of the
intracellular consequences in macrophages. Int J Med Microbiol 2000,
290:421-427
5 Duesbery NS, Webb CP, Leppla SH, Gordon VM, Klimpel KR, Copeland TD,
Ahn NG, Oskarsson MK, Fukasawa K, Paull KD, et al Proteolytic inactivation
of MAP-kinase-kinase by anthrax lethal factor. Science 1998, 280:734-737
6 Leppla SH Anthrax toxin edema factor: a bacterial adenylate cyclase that
increases cyclic AMP concentrations of eukaryotic cells. Proc Nat/ Acad Sci
U SA 1982, 79:3162-3166
7 Hanna PC, Acosta D, Collier RJ On the role of macrophages in anthrax.
Proc Nat Acad Sci U S A 1993, 90:10198-10201
8 Hanna PC, Kruskal BA, Ezekowitz RA, Bloom BR, Collier RJ Role of
macrophage oxidative burst in the action of anthrax lethal toxin.
Mol Med 1994, 1:7-18
9 Popov SG, Villasmil R, Bernardi J, Grene E, Cardwell J, Popova T, Wu A,
Alibek D, Bailey C, Alibek K Effect of Bacillus anthracis lethal toxin on
human peripheral blood mononuclear cells. FEBS Lett 2002, 527:211-215
10 Kassam A, Der SD, Mogridge J Differentiation of human monocytic cell
lines confers susceptibility to Bacillus anthracis lethal toxin. Cell Microbiol
2005, 7:281-292
11 Stearns-Kurosawa DJ, Lupu F, Taylor FB Jr, Kinasewitz G, Kurosawa S Sepsis
and pathophysiology of anthrax in a nonhuman primate model. Am J
Pathol 2006, 169:433-444
12 Guarner J, Jernigan JA, Shieh WJ, Tatti K, Flannagan LM, Stephens DS,
Popovic T, Ashford DA, Perkins BA, Zaki SR Pathology and pathogenesis of
bioterrorism-related inhalational anthrax. Am J Patho 2003, 163:701-709
13 Twenhafel NA, Leffel E, Pitt ML Pathology of inhalational anthrax infection
in the african green monkey. Vet Pathol 2007, 44:716-721
14 Wu W, Mehta H, Chakrabarty K, Booth JL, Duggan ES, Patel KB, Ballard JD,
Coggeshall KM, Metcalf JP Resistance of human alveolar macrophages to
Bacillus anthracis lethal toxin. J mmunol 2009, 183:5799-5806
15 Comer JE, Galindo CL, Chopra AK, Peterson JW GeneChip analyses of
global transcriptional responses of murine macrophages to the lethal
toxin of Bacillus anthracis. Infect immun 2005, 73:1879-1885
16 Mesters RM, Florke N, Ostermann H, Kienast J Increase of plasminogen
activator inhibitor levels predicts outcome of leukocytopenic patients
with sepsis. Thromb Haemost 1996, 75:902-907
17 Bradburne C, Chung MC, Zong Q, Schlauch K, Liu D, Popova T, Popova A,
Bailey C, Soppet D, Popov S Transcriptional and apoptotic responses of
THP-1 cells to challenge with toxigenic, and non-toxigenic Bacillus
anthracis. BMC immunol 2008, 9:67
18 Serbina NV, Jia T, Hohl TM, Pamer EG Monocyte-mediated defense
against microbial pathogens. Annu Rev Immunol 2008, 26:421-452
19 Mosser DM The many faces of macrophage activation. J Leukoc Biol 2003,
73:209-212
20 Koski GK, Lyakh LA, Rice NR' Rapid lipopolysaccharide-induced differentiation
of CD14(+) monocytes into CD83(+) dendritic cells is modulated under
serum-free conditions by exogenously added IFN-gamma and endogenously
produced IL-10. EurJ immune 2001, 31:3773-3781
21 van Furth R Origin and turnover of monocytes and macrophages. Curr
Top Pathol 1989, 79:125-150
22 Dozmorov M, Wu W, Chakrabarty K, Booth JL, Hurst RE, Coggeshall KM,
Metcalf JP Gene expression profiling of human alveolar macrophages
infected by B. anthracis spores demonstrates TNF-alpha and NF-kappab
are key components of the innate immune response to the pathogen.
BMC Infect Dis 2009, 9:152


23 During RL, Gibson BG, Li W, Bishai EA, Sidhu GS, Landry J, Southwick FS
Anthrax lethal toxin paralyzes actin-based motility by blocking Hsp27
phosphorylation. EMBO J 2007, 26:2240-2250
24 Shi GX, Harrison K, Han SB, Moratz C, Kehrl JH Toll-like receptor signaling
alters the expression of regulator of G protein signaling proteins in
dendritic cells: implications for G protein- coupled receptor signaling.
J Immunol 2004, 172:5175-5184
25 Chaussabel D, Semnani RT, McDowell MA, Sacks D, Sher A, Nutman TB
Unique gene expression profiles of human macrophages and dendritic
cells to phylogenetically distinct parasites. Blood 2003, 102:672-681
26 Colotta F, Re F, Muzio M, Bertini R, Polentarutti N, Sironi M, Giri JG, Dower
SK, Sims JE, Mantovani A Interleukin-1 type II receptor: a decoy target for
IL-1 that is regulated by IL-4. Science 1993, 261:472-475
27 Jernigan DB, Raghunathan PL, Bell BP, Brechner R, Bresnitz EA, Butler JC, Cetron
M, Cohen M, Doyle T, Fischer M, et oa Investigation of bioterrorism-related
anthrax, United States, 2001: epidemiologic findings. Emerg Infect Dis 2002,
8:1019-1028
28 Tuttle DL, Harrison JK, Anders C, Sleasman JW, Goodenow MM Expression
of CCR5 increases during monocyte differentiation and directly mediates
macrophage susceptibility to infection by human immunodeficiency
virus type 1. J Viro 1998, 72:4962-4969
29 Vlodavsky I, Eldor A, Haimovitz Friedman A, Matzner Y, Ishai-Michaeli R, Lider
O, Naparstek Y, Cohen IR, Fuks Z Expression of heparanase by platelets
and circulating cells of the immune system: possible involvement in
diapedesis and extravasation. Invasion Metastasis 1992, 12:112-127
30 Vaday GG, Lider O Extracellular matrix moieties, cytokines, and enzymes:
dynamic effects on immune cell behavior and inflammation. J Leukoc Biol
2000, 67:149-159
31 Edovitsky E, Lerner I, Zcharia E, Peretz T, Vlodavsky I, Elkin M Role of
endothelial heparanase in delayed-type hypersensitivity. Blood 2006,
107:3609-3616
32 Elkord E, Williams PE, Kynaston H, Rowbottom AW Human monocyte
isolation methods influence cytokine production from in vitro generated
dendritic cells. immunology 2005, 114:204-212
33 Quinn CP, Shone CC, Turnbull PC, Melling J Purification of anthrax-toxin
components by high- performance anion-exchange, gel-filtration and
hydrophobic-interaction chromatography. Biochem J 1988, 252:753-758

doi:1 0.1186/1471-2172-13-33
Cite this article as: Chauncey et al Bacillus anthracis' lethal toxin
induces broad transcriptional responses in human peripheral
monocytes. BMC Immunology 2012 13'33


Page 26 of 26


Submit your next manuscript to BioMed Central
and take full advantage of:

* Convenient online submission
* Thorough peer review
* No space constraints or color figure charges
* Immediate publication on acceptance
* Inclusion in PubMed, CAS, Scopus and Google Scholar
* Research which is freely available for redistribution

Submit your manuscript at
www.biomedcentral.com/submit 0 Bil I Central




Full Text

PAGE 1

RESEARCHARTICLEOpenAccessBacillusanthracis ’ lethaltoxininduces broadtranscriptionalresponsesinhuman peripheralmonocytesKassidyMChauncey1,MCeciliaLopez2,GurjitSidhu1,SarahESzarowicz1,HenryVBaker2,ConradQuinn3andFrederickSSouthwick1*AbstractBackground: Anthraxlethaltoxin(LT),producedbytheGram-positivebacterium Bacillusanthracis ,isahighly effectivezincdependentmetalloproteasethatcleavestheN-terminusofmitogen-activatedproteinkinasekinases (MAPKKorMEKs)andisknowntoplayaroleinimpairingthehostimmunesystemduringaninhalationanthrax infection.Here,wepresentthetranscriptionalresponsesofLTtreatedhumanmonocytesinordertofurther elucidatethemechanismsofLTinhibitiononthehostimmunesystem. Results: WesternBlotanalysisdemonstratedcleavageofendogenousMEK1andMEK3whenhumanmonocytes weretreatedwith500ng/mLLTforfourhours,provingtheirsusceptibilitytoanthraxlethaltoxin.Furthermore, stainingwithannexinVandpropidiumiodiderevealedthatLTtreatmentdidnotinducehumanperipheral monocyteapoptosisornecrosis.UsingAffymetrixHumanGenomeU133Plus2.0Arrays,weidentifiedover820 probesetsdifferentiallyregulatedafterLTtreatmentatthep < 0.001significancelevel,interruptingthenormal transductionofover60knownpathways.Asexpected,theMAPKKsignalingpathwaywasmostdrasticallyaffected byLT,butnumerousgenesoutsidethewell-recognizedpathwayswerealsoinfluencedbyLTincludingtheIL-18 signalingpathway,Toll-likereceptorpathwayandtheIFNalphasignalingpathway.Multiplegenesinvolvedinactin regulation,signaltransduction,transcriptionalregulationandcytokinesignalingwereidentifiedaftertreatmentwith anthraxLT. Conclusion: WeconcludeLTdirectlytargetshumanperipheralmonocytesandcausesmultipleaberrantgene responsesthatwouldbeexpectedtobeassociatedwithdefectsinhumanmonocyte ’ snormalsignaling transductionpathwaysandfunction.Thisstudyprovidesfurtherinsightsintothemechanismsassociatedwiththe hostimmunesystemcollapseduringananthraxinfection,andsuggeststhatanthraxLTmayhaveadditional downstreamtargetsoutsidethewell-knownMAPKpathway.BackgroundBacillusanthracis ,thecausativeagentofanthrax,isa gram-positivebacteriumthatisnaturallyfoundinthe soil,andrarelyaffectsthehumanpopulation.Unfortunately,deliberatedisseminationofanthraxsporesis capableofdeliveringahighlypotentandlethalair-borne bioterroristagent,asdocumentedinthe2001U.S.anthraxattacks.Inhalationanthraxisahighlyfatal,acute diseasecharacterizedbyarapidonsetofsystemicshock andultimatelydeath[1]. Themostvirulentstrainsof B.anthracis containtwo plasmids,pXO2andpXO1,encodinganantiphagocytic poly-D-glutamicacidcapsuleandthreeexotoxins:lethal factor,edemafactorandprotectiveantigen[2].Protectiveantigenisan83kDaproteinthatisknowntobindto twohostcellreceptors,TEM-8andCMG-2,facilitating theentryofedemaand/orlethalfactorintohostcells [3].Lethalfactorisa90kDazinc-dependentmetalloproteasethatcleavestheN-terminusofmitogen-activated proteinkinasekinases(MAPKKsorMEKs)[4,5].Edema *Correspondence: southfs@medicine.ufl.edu1DepartmentofMedicine,UniversityofFloridaCollegeofMedicine, GainesvilleFL32610,USA Fulllistofauthorinformationisavailableattheendofthearticle 2012Chaunceyetal.;licenseeBioMedCentralLtd.ThisisanOpenAccessarticledistributedunderthetermsoftheCreative CommonsAttributionLicense(http://creativecommons.org/licenses/by/2.0),whichpermitsunrestricteduse,distribution,and reproductioninanymedium,providedtheoriginalworkisproperlycited.Chauncey etal.BMCImmunology 2012, 13 :33 http://www.biomedcentral.com/1471-2172/13/33

PAGE 2

factorisan89kDaadenylatecyclasethatincreases intracellularcAMPlevels[6]. Previousstudiesusinganthraxanimalmodelshave documentedresistancetoanthraxlethaltoxin(LT) throughdepletionofhostmacrophages,suggestingthat thesecellsplayacriticalroleinanthraxLTinducedlethality[7,8].LThasalsobeenshowntosuppresscytokineresponsesbyperipheralbloodmononuclearcells, inducemacrophageapoptosis,andpreventmonocyte proliferationanddifferentiation[1,9,10].Inhalationanthraxcasespresentclinicalmanifestationsindicativeof hostimmunecollapseinhumansandinnonhumanprimatestudies[11-13].However,morerecentstudiesinvestigatinghumanmonocytesandmacrophageshave suggestedhumanalveolarmacrophagesareresistantto LT,andundifferentiatedhumanmonocyticcelllinesare resistanttoLT-induceddeath[10,14].LT ’ stargetingof humanmonocytes/macrophagescouldhelptoexplain therapidonsetoffatalsymptomsandhostdemiseduringaninhalationanthraxinfection,buttheexacteffects LTexertsonhumanperipheralmonocytes,alongwith themechanismsunderlyingtheimpairmentofthehost immunecell ’ sresponses,haveyettobefullydetermined. PreviousstudiesinvestigatingLTtreatedmurinemacrophageshaveshownabroadrangeintranscriptionaleffects inducedbyLT.ThesestudiesconcludedLT-induced changesinmacrophageinflammation,signaling,andtranscriptionfactors,alongwithchangesintheimmuneresponsebymacrophages.Thisstudydiscoveredthedown regulationofCD-137afterLTtreatment,showntoplaya roleinmonocyteproliferationinresponsetoLPS,andup regulationofplasminogenactivatorinhibitortypeI,which resultsinfibrindeposits,massiveimbalancesincoagulation,and,insomeinstances,multi-organfailure[15,16]. Anotherstudyhasmeasuredthetranscriptionalresponses ofTHP-1cellsafter B.anthracis sporeexposure,finding toxigenic B.anthracis strainssuppressthecellsignaling responsestoinfection[17]. Bloodmonocytesaremononuclearcellsthatplaya majorroleinthehostimmuneresponsethrough regulationofinflammatoryresponses,secretionof cytokineandantimicrobialfactors,anddirectpathogen clearance[18].Monocytesarederivedfrommonoblasts inthebonemarrow,andcirculateinthebloodfor 1-2daysbeforetheymigrateintotissueswheretheyreplenishthemacrophageanddendriticpools[19-21]. Here,wedeterminedhumanmonocytesusceptibilityto LTbydemonstratingcleavageofMEKs,andutilized AffymetrixGeneChipWHumanGenomeU133Plus2.0 ArraysinordertoidentifyadditionalmechanismsofLT impairmentonthetranscriptionalresponsesofhuman peripheralmonocytes.Thearrayscontained54,675 probesetsrepresentingover22,000ofthebestcharacterizedhumangenes,providingextensiveinsightsinto themechanismsbehindLTinduceddysfunctionofhuman peripheralmonocytes. Thisstudyisthefirsttodeterminedirecthuman monocytesusceptibilityviacleavageofMEKs,along withtheanalysisofthetranscriptionalresponses,to anthraxLT.ThemechanismsofLTimpairmenton humanperipheralmonocyteswillhelpelucidatethe rolesmonocytescontributeduringthehostimmune systemcollapsedocumentedduringananthraxinfection.Thetranscriptionalanalysiswillservetonot onlyunravelthemechanismsbehindtherapidonset ofdeathinanthraxvictims,butwillalsopotentially providenewtargetsforcontrollinginflammationand enhancinghostdefense.ResultsanddiscussionMonocytepurity,apoptosisandsusceptibilitytoanthrax LTInordertofirstdeterminemonocytecellpurity,isolatedcellswereanalyzedusingflowcytometryand gatedusingforwardandsidescatter,alongwiththe monocyticmarker,CD14.Itwasfoundthatmonocyteswereisolatedwitha > 85%purity(Figure1A and1B).Becausepreviousreportshavedocumented LTinducedcellapoptosis,i twasimportanttoassure thetranscriptionalresponseofLTtreatedmonocytes wereindependentofapoptosis.Thiswasassuredby theanalysisofthenecrosisandapoptosismarkers, propidiumiodide(PI)andannexinV,onhumanperipheralmonocytes.Nearlyall(99%)humanperipheral monocytesshowednoevidenceofnecrosisorapoptosisaftera4htreatmentofLT(Figure1Cand1D). Therehasbeensomeconflictingdatasuggestingmonocytes,alongwithmonocyte-derivedcells,arenotsusceptibletotheactionsofanthraxLT.Onestudyutilized humanmonocyticcelllinesandfoundthatundifferentiatedmonocyticcellsdidnotundergoLT-inducedcytotoxicity,whilethedifferentiatedcellsweresusceptible[10]. Anotherstudyinvestigatinghumanalveolarmacrophages (AM)foundthatthesecellswererelativelyresistanttothe actionsofLT.ItwasascertainedthatLTfailedtosuppress humanAMcytokineresponses,cleaveMEKs,andinduce apoptosis[14]. InordertoexploretheactionsofLTonhumanperipheralmonocytes,aWesternBlotanalysiswasperformedandMEK1,alongwithMEK3,cleavagewas determinedaftera4-hourtreatmentwithLT.Human peripheralmonocyteswerefoundtobesusceptibleto theactionsofLTasevidencedbycleavageofMEK1and MEK3(Figure1E).HeLacellswereusedasapositive controland -actinwasusedtoassureequalloading controls.Weconcludetha thumanperipheralmonocytesareadirecttargetofanthraxLT.Chauncey etal.BMCImmunology 2012, 13 :33 Page2of26 http://www.biomedcentral.com/1471-2172/13/33

PAGE 3

MicroarrayanalysisandresultsHumanperipheralmonocytesweretreatedwithLTor mediaalone,andmicroarrayanalysiswasperformedusing fourbiologicalreplicatesfromhealthyvolunteers.Atotal of8microarrayhybridizationswereemployedandanalyzedonAffymetrixGeneChipsW(HGU133plus2.0).The chipscontained54,675probesetsandidentifiedmultiple differentiallyregulatedpathwaysandgenesbyhumanperipheralmonocytesafterLTtreatment.Unsupervisedhierarchicalanalysiswasusedtoassessthenoiseinthearray experiments.First,probesetswhosesignalintensityvaried mostinthedatasetwereselectedbyapplyingavariation filter.Probessetsthatdisplayedacoefficientofvariationof greaterthan0.5weresubjectedtohierarchicalanalysis.The (A)(B) (C)(D)SSC PI PIAnnexin FITC Annexin FITCCD14FSCFSCMEK3 MEK1 -actin HeLa HeLaMonocyte Monocyte ControlToxinControlToxin(E) Figure1 Monocytepurity,apoptosis,andsusceptibilitytoLT. Red=CD14+monocytes.Green=CD14-lymphocytes. A.) Forwardandside scatteranalysisofpurifiedfixedhumanmonocytesshowingthemonocytepopulationascomparedtototalpopulation. B.) CD14PacificBlueand forwardscatteranalysisoffixedpurifiedhumanmonocytesshowing > 85%monocytes. C.) PIandannexin-FITCanalysisofCD14+monocytes aftera4hincubationshowing99.0%viablecellsindicatedinquadrant3. D.) PIandannexin-FITCanalysisofCD14+monocytesaftera4hLT treatmentshowing99.1%viablecellsindicatedinquadrant3.HeLacellsorhumanmonocyteswereleftuntreatedortreatedwith500ng/mLLT for4hat37C.Sampleswerelysed,runonSDS-PAGE,transferredtoPVDFmembrane,andprobedwithindicatedantibodies.BothMEK3and MEK1werecleavedbyLTwhilecontrolcellsshowednoMEKcleavage. -actinloadingcontrolsshowequivalentloadingofbothcontrolandLT treatedcells. Chauncey etal.BMCImmunology 2012, 13 :33 Page3of26 http://www.biomedcentral.com/1471-2172/13/33

PAGE 4

clusteringdendrogramshow edthemajornodeofseparationbetweencontrolandLT treatedsamples(Figure2A). ToidentifyspecificgenesresponsivetoLTtreatment, apaired t -test(bydonor)wasperformedatasignificancethresholdofp < 0.001.Genesspecifiedby820 probesetswerefoundtobesignificantamongthetreatmentgroups(Table1).Thehierarchicalclusterpattern ofthesignificantprobesetsisshown(Figure3A).Ofthese probesets,multiplegeneproductsknowntoplayarolein monocytefunctionwerediscovered(Figure2B).Theabilityofprobesetssignificantatp < 0.001tofunctionasa classifierbetweentreatmentgroups(LTtreatedvs.control)wasestablishedbyleave-one-out-cross-validation andMonteCarlosimulations.Using4differentprediction models,theclassifierperformedflawlessly.Ofthesignificantgenesidentified,manyareknowntoplayarolein monocytefunction(Figure2C). UsingtheGeneSetExpressionComparisonAnalysis, asimplementedinBRBArraytools,theBiocartapathwaysthatwereassociatedwiththedifferentiallyregulated geneswereidentified.Over60differentiallyregulated pathwayswerediscoveredinmonocytesinresponsetoLT treatment.Asexpected,themostsignificantpathway affectedbyLTtreatmentwastheMAPKsignalingpathway,withthep38MAPKsignalingpathwaybeingmost impactedwith103genesaffected(Figure3B).Additional pathwaysalteredbyLTatthep < 0.001significancelevel includedtheIL-18,Toll-LikeReceptor,IFNalpha,andGProteinFamilysignalingpathways.Itisinterestingtonote thatapreviousstudymeasuringthetranscriptionalresponseofhumanalveolarmacrophagestoanthraxspores detectedanactivationoftheTLRpathways[22],andour resultsindicatedanthraxLTtargets87geneswithinthe TLRsignalingpathway(Figure3B). RGS14isaproteininvolvedintheregulationofGproteinsignalingthroughattenuationofG-proteinheterotrimersignaling,therebyinactivatingthissignaling cascade.TheAffymetrixmicroarraysrevealedthatRGS14 expressioninLTtreatedmonocytesshoweda6foldincreaseinexpression(Table2).ThisisapotentiallysignificantfindinginthatRGS14inhibitsG-proteinsimportant forchemotaxis.ThereforeLTcouldbeimpairingchemotaxisnotonlybyblockingHsp27phosphorylationthrough disruptionofthep38pathway[23],butalsobycausing (A) (B) 38290_atRegulator of G-protein signaling 14 (Rgs14)5.940.0009308 207008_atInterleukin 8 receptor, beta5.040.0008868210986_s_atTropomyosin 1 (alpha)3.490.0006411212686_atProtein phosphatase 1H (P P2C domain containing) 2.650.0001409 226016_atCD47 molecule2.400.0002531 211495_x_atTumor necrosis factor (ligand) superfamily, member 132.250.0001799 209828_s_atInterleukin 16 (lymphocyte chemoattractant factor)2.190.0001590 209269_s_atSpleen tyrosine kinase (Syk)2.150.0007547 229497_atAnkyrin repeat and death domain containing 1A2.10.0002478 206991_s_atChemokine (C-C motif) receptor 5 (CCR5)-2.660.0009506 205403_atInterleukin 1 receptor, type II-12.040.0001070Affymetrix Probe ID Gene or gene product nameFold change P-value Pair IDMean Number of genes in classifier Diagonal Linear Discriminant Analysis Correct? 1-Nearest Neighbor Correct? 3-Nearest Neighbor Correct? Nearest Centroid Correct? 1466YesYesYesYes2261YesYesYesYes3197YesYesYesYes 4199YesYesYesYesCorrect Classification:100%100%100%100%Performance of classifiers during cross-validation.(C) Figure2 Unsupervisedmicroarrayanalysis.A.) Hierarchicalclusteringdendrogramshowingsimilaritiesbetweenexpressionpatternswithin eachcondition.Specimenswerepairedbasedondonor,using4separatedonorsasindicatedinreplicar1throughr4. B.) Significantgenes (p < 0.001)upordownregulatedafterLTtreatment,alongwiththeirfoldchange,p-valueandprobeID. C.) Leave-one-out-crossvalidationwas usedtocalculatemis-classificationratethatyieldeda100%correctclassificationbetweenpairs. Chauncey etal.BMCImmunology 2012, 13 :33 Page4of26 http://www.biomedcentral.com/1471-2172/13/33

PAGE 5

Table1ControlvsToxincorrespondingP-valuep < 0.001Paramet. p-value Geometricmean ofintensities ProbesetGenesymbolDescription 12.80E-0061.78222001_x_atFAM91A2familywithsequencesimilarity91,memberA2 22.90E-0061.25218734_atNAT11N-acetyltransferase11 33.40E-0061.6230350_atNANA 47.80E-0061.56228930_atNANA 58.70E-0061.58208661_s_atTTC3tetratricopeptiderepeatdomain3 69.80E-0061.16218716_x_atMTO1mitochondrialtranslationoptimization1homolog(S.cerevisiae) 71.07E-0051.15238538_atANKRD11ankyrinrepeatdomain11 81.22E-0052.92225896_atNANA 91.41E-0053.87227450_atERP27endoplasmicreticulumprotein27kDa 101.49E-0051.23226602_s_atBCRbreakpointclusterregion 111.60E-0051.65209123_atQDPRquinoiddihydropteridinereductase 121.66E-0051.73213934_s_atZNF23zincfingerprotein23(KOX16) 131.66E-0051.56226419_s_atSFRS1splicingfactor,arginine/serine-rich1 141.84E-0052.91227946_atOSBPL7oxysterolbindingprotein-like7 152.04E-0051.84242989_atNANA 162.18E-0051.92242590_atNANA 172.29E-0051.36204559_s_atLSM7LSM7homolog,U6smallnuclearRNAassociated(S.cerevisiae) 182.35E-0051.68225902_atNANA 192.44E-0051.29220939_s_atDPP8dipeptidyl-peptidase8 202.63E-0051.2218682_s_atSLC4A1APsolutecarrierfamily4(anionexchanger),member1,adaptorprotein 212.72E-0052.21212056_atKIAA0182KIAA0182 222.91E-0052.87222477_s_atTM7SF3transmembrane7superfamilymember3 233.01E-0052.01202512_s_atATG5ATG5autophagyrelated5homolog(S.cerevisiae) 243.07E-0051.52209042_s_atUBE2G2ubiquitin-conjugatingenzymeE2G2(UBC7homolog,yeast) 253.10E-0055.25232181_atLOC153346hypotheticalproteinLOC153346 263.13E-0051.791554452_a_atHIG2hypoxia-inducibleprotein2 273.36E-0052.11228772_atHNMThistamineN-methyltransferase 283.37E-0051.3221501_x_atLOC339047hypotheticalproteinLOC339047 293.39E-0051.81239038_atC1orf52chromosome1openreadingframe52 303.46E-0051.95203839_s_atTNK2tyrosinekinase,non-receptor,2 313.89E-0051.89227558_atCBX4chromoboxhomolog4(Pcclasshomolog,Drosophila) 323.90E-0051.4214691_x_atFAM63Bfamilywithsequencesimilarity63,memberB 333.91E-0051.32228301_x_atNDUFB10NADHdehydrogenase(ubiquinone)1betasubcomplex,10,22kDa 344.05E-0051.81556306_atNANA 354.22E-0053.27229016_s_atTRERF1transcriptionalregulatingfactor1 364.47E-0053.85223741_s_atTTYH2tweetyhomolog2(Drosophila) 374.48E-0055.649306_atRASSF4Rasassociation(RalGDS/AF-6)domainfamilymember4 384.63E-0051.4932209_atFAM89Bfamilywithsequencesimilarity89,memberB 394.75E-0052.83225298_atPNKDparoxysmalnonkinesigenicdyskinesia 405.00E-0051.59228726_atNANA 415.36E-0051.171562984_atNANA 425.39E-0051.6201639_s_atCPSF1cleavageandpolyadenylationspecificfactor1,160kDa 435.66E-0051.47221649_s_atPPANpeterpanhomolog(Drosophila) 445.88E-0051.94225360_atTRABDTraBdomaincontaining 456.23E-0051.27221005_s_atPTDSS2phosphatidylserinesynthase2 466.35E-0052.13228914_atNANA Chauncey etal.BMCImmunology 2012, 13 :33 Page5of26 http://www.biomedcentral.com/1471-2172/13/33

PAGE 6

Table1ControlvsToxincorrespondingP-valuep < 0.001 (Continued)476.47E-0051.65208206_s_atRASGRP2RASguanylreleasingprotein2(calciumandDAG-regulated) 486.49E-0051.64209198_s_atSYT11synaptotagminXI 496.55E-0051.7221575_atSCLYselenocysteinelyase 506.74E-0051.82229969_atNANA 516.76E-0052.22235513_atNANA 526.77E-0051.93236922_atNANA 536.78E-0051.14204364_s_atREEP1receptoraccessoryprotein1 546.87E-0051.55227025_atPPHLN1periphilin1 557.02E-0051.78227288_atSFRS12IP1SFRS12-interactingprotein1 567.13E-0052.55205075_atSERPINF2serpinpeptidaseinhibitor,cladeF(alpha-2antiplasmin,pigment epitheliumderivedfactor),member2 577.16E-0052.29222988_s_atTMEM9transmembraneprotein9 587.35E-0051.39231831_atCOX19COX19cytochromecoxidaseassemblyhomolog(S.cerevisiae) 597.37E-0051.88221788_atNANA 607.66E-0051.61236004_atNANA 617.68E-0051.85219751_atSETD6SETdomaincontaining6 627.92E-0051.74227273_atNANA 638.67E-0051.56235787_atNANA 648.91E-0051.42212888_atDICER1dicer1,ribonucleasetypeIII 658.93E-0051.931568593_a_atNUDT16Pnudix(nucleosidediphosphatelinkedmoietyX)-typemotif16 pseudogene 669.00E-0051.92226721_atDPY19L4dpy-19-like4(C.elegans) 679.02E-0051.39227159_atGHDCGH3domaincontaining 689.14E-0052.36225982_atUBTFupstreambindingtranscriptionfactor,RNApolymeraseI 699.25E-0051.62220341_s_atC5orf45chromosome5openreadingframe45 709.51E-0051.36214501_s_atH2AFYH2Ahistonefamily,memberY 719.96E-0057.6226186_atNANA 720.00010012.59224946_s_atCCDC115coiled-coildomaincontaining115 730.00010561.66237059_atNANA 740.00010763.1138671_atPLXND1plexinD1 750.00010831.92231912_s_atDKFZP434B0335DKFZP434B0335protein 760.00010871.55238492_atNANA 770.00010882.05228548_atNANA 780.00010891.9225757_s_atCLMNcalmin(calponin-like,transmembrane) 790.00010931.15203926_x_atATP5DATPsynthase,H+transporting,mitochondrialF1complex,deltasubunit 800.00011001.41232520_s_atNSFL1CNSFL1(p97)cofactor(p47) 810.00011012.06238012_atDPP7dipeptidyl-peptidase7 820.00011011.38211101_x_atLILRA2leukocyteimmunoglobulin-likereceptor,subfamilyA(withTMdomain), member2 830.00011091.35210128_s_atLTB4RleukotrieneB4receptor 840.00011151.34223393_s_atTSHZ3teashirtzincfingerhomeobox3 850.00011231.46213628_atCLCC1chloridechannelCLIC-like1 860.00011521.27214870_x_atLOC100132540similartoLOC339047protein 870.00011712.41221756_atPIK3IP1phosphoinositide-3-kinaseinteractingprotein1 880.00011711.62222478_atVPS36vacuolarproteinsorting36homolog(S.cerevisiae) 890.00011921.99225719_s_atMRPL55mitochondrialribosomalproteinL55 900.00012061.87212959_s_atGNPTABN-acetylglucosamine-1-phosphatetransferase,alphaandbetasubunits 910.00012107.64238520_atTRERF1transcriptionalregulatingfactor1 920.00012353.04226974_atNANA Chauncey etal.BMCImmunology 2012, 13 :33 Page6of26 http://www.biomedcentral.com/1471-2172/13/33

PAGE 7

Table1ControlvsToxincorrespondingP-valuep < 0.001 (Continued)930.00012692.06225851_atFNTBfarnesyltransferase,CAAXbox,beta 940.00012882.04224452_s_atMGC12966hypotheticalproteinLOC84792 950.00013061.46226092_atMPP5membraneprotein,palmitoylated5(MAGUKp55subfamilymember5) 960.00013121.51558693_s_atC1orf85chromosome1openreadingframe85 970.00013361.19204020_atPURApurine-richelementbindingproteinA 980.00013501.731555882_atSPIN3spindlinfamily,member3 990.00013541.8235532_atPIGMphosphatidylinositolglycananchorbiosynthesis,classM 1000.00013712.611553111_a_atKBTBD6kelchrepeatandBTB(POZ)domaincontaining6 1010.00014081.44227868_atLOC154761hypotheticalLOC154761 1020.00014083.15214058_atMYCL1v-mycmyelocytomatosisviraloncogenehomolog1,lungcarcinoma derived(avian) 1030.00014092.65212686_atPPM1Hproteinphosphatase1H(PP2Cdomaincontaining) 1040.00014141.61218971_s_atWDR91WDrepeatdomain91 1050.00014182.07225777_atC9orf140chromosome9openreadingframe140 1060.00014261.92225366_atPGM2phosphoglucomutase2 1070.00014511.74238768_atC2orf68chromosome2openreadingframe68 1080.00014541.49218674_atC5orf44chromosome5openreadingframe44 1090.00014621.26218490_s_atZNF302zincfingerprotein302 1100.00015371.17202704_atTOB1transducerofERBB2,1 1110.00015611.69218361_atGOLPH3Lgolgiphosphoprotein3-like 1120.00015651.32222994_atPRDX5peroxiredoxin5 1130.00015902.19209828_s_atIL16interleukin16(lymphocytechemoattractantfactor) 1140.00015931.47204611_s_atPPP2R5Bproteinphosphatase2,regulatorysubunitB@#$%&,betaisoform 1150.00015931.48227730_atNANA 1160.00015991.14228605_atNANA 1170.00016461.54202135_s_atACTR1BARP1actin-relatedprotein1homologB,centractinbeta(yeast) 1180.00016691.73226183_atNANA 1190.00017091.8865472_atC2orf68chromosome2openreadingframe68 1200.00017381.57200098_s_atANAPC5anaphasepromotingcomplexsubunit5 1210.00017481.37218181_s_atMAP4K4mitogen-activatedproteinkinasekinasekinasekinase4 1220.00017622.81238135_atAGTRAPangiotensinIIreceptor-associatedprotein 1230.00017673.66203386_atTBC1D4TBC1domainfamily,member4 1240.00017842.06213670_x_atNSUN5BNOL1/NOP2/Sundomainfamily,member5B 1250.00017871.69212109_atHN1Lhematologicalandneurologicalexpressed1-like 1260.00017891.85219968_atZNF589zincfingerprotein589 1270.00017992.25211495_x_atTNFSF13tumornecrosisfactor(ligand)superfamily,member13 1280.00018362.07214177_s_atPBXIP1pre-B-cellleukemiahomeoboxinteractingprotein1 1290.00018431.641554085_atDDX51DEAD(Asp-Glu-Ala-Asp)boxpolypeptide51 1300.00018521.99203271_s_atUNC119unc-119homolog(C.elegans) 1310.00018781.43226072_atFUKfucokinase 1320.00018783.32212235_atPLXND1plexinD1 1330.00019021.67205658_s_atSNAPC4smallnuclearRNAactivatingcomplex,polypeptide4,190kDa 1340.00019831.84218021_atDHRS4dehydrogenase/reductase(SDRfamily)member4 1350.00019871.76229429_x_atFAM91A2familywithsequencesimilarity91,memberA2 1360.00019901.27212429_s_atGTF3C2generaltranscriptionfactorIIIC,polypeptide2,beta110kDa 1370.00020071.81226873_atNANA 1380.00020101.31227801_atTRIM59tripartitemotif-containing59 1390.00020321.36227679_atNANA Chauncey etal.BMCImmunology 2012, 13 :33 Page7of26 http://www.biomedcentral.com/1471-2172/13/33

PAGE 8

Table1ControlvsToxincorrespondingP-valuep < 0.001 (Continued)1400.00020814.03218326_s_atLGR4leucine-richrepeat-containingGprotein-coupledreceptor4 1410.00020871.93235252_atKSR1kinasesuppressorofras1 1420.00020931.451558522_atNANA 1430.00021651.57225396_atNANA 1440.00021671.4206469_x_atAKR7A3aldo-ketoreductasefamily7,memberA3(aflatoxinaldehydereductase) 1450.00021971.791563549_a_atANO8anoctamin8 1460.00022191.79211576_s_atSLC19A1solutecarrierfamily19(folatetransporter),member1 1470.00022341.35202846_s_atPIGCphosphatidylinositolglycananchorbiosynthesis,classC 1480.00022462.17232231_atRUNX2runt-relatedtranscriptionfactor2 1490.00023011.24213480_atVAMP4vesicle-associatedmembraneprotein4 1500.00023351.571558755_x_atZNF763zincfingerprotein763 1510.00023481.871557667_atNANA 1520.00023621.53211036_x_atANAPC5anaphasepromotingcomplexsubunit5 1530.00023672.73203387_s_atTBC1D4TBC1domainfamily,member4 1540.00024161.35217896_s_atNIP30NEFA-interactingnuclearproteinNIP30 1550.00024202.35212136_atATP2B4ATPase,Ca++transporting,plasmamembrane4 1560.00024251.4207618_s_atBCS1LBCS1-like(yeast) 1570.00024501.85239300_atNANA 1580.00024782.1229497_atANKDD1Aankyrinrepeatanddeathdomaincontaining1A 1590.00025091.29214035_x_atLOC399491LOC399491protein 1600.00025171.66229874_x_atNANA 1610.00025211.74221264_s_atLOC100128223hypotheticalproteinLOC100128223 1620.00025221.54227630_atNANA 1630.00025312.4226016_atCD47CD47molecule 1640.00025591.531558947_atNANA 1650.00025822.08222664_atKCTD15potassiumchanneltetramerisationdomaincontaining15 1660.00026064.49207843_x_atCYB5Acytochromeb5typeA(microsomal) 1670.00026332.1218394_atROGDIrogdihomolog(Drosophila) 1680.00026341.86214100_x_atNSUN5BNOL1/NOP2/Sundomainfamily,member5B 1690.00026411.4212895_s_atABRactiveBCR-relatedgene 1700.00026482.01227580_s_atDKFZP434B0335DKFZP434B0335protein 1710.00026782.59227253_atCPceruloplasmin(ferroxidase) 1720.00026791.78230917_atNANA 1730.00026861.69200843_s_atEPRSglutamyl-prolyl-tRNAsynthetase 1740.00026862.67227346_atIKZF1IKAROSfamilyzincfinger1(Ikaros) 1750.00027151.44219095_atLOC100137047PLA2G4B hypotheticalproteinLOC8681 1760.00027621.68229776_atSLCO3A1solutecarrierorganicaniontransporterfamily,member3A1 1770.00027684.48226436_atRASSF4Rasassociation(RalGDS/AF-6)domainfamilymember4 1780.00027961.37221951_atTMEM80transmembraneprotein80 1790.00028091.49228606_atTM4SF19transmembrane4Lsixfamilymember19 1800.00028171.66232535_atNANA 1810.00028261.281569597_atNANA 1820.00028311.771555845_atNANA 1830.00028352.77205955_atNANA 1840.00028392.47220137_atFLJ20674hypotheticalproteinFLJ20674 1850.00028452.56218459_atTOR3Atorsinfamily3,memberA 1860.00028701.73238929_atSFRS2Bsplicingfactor,arginine/serine-rich2B Chauncey etal.BMCImmunology 2012, 13 :33 Page8of26 http://www.biomedcentral.com/1471-2172/13/33

PAGE 9

Table1ControlvsToxincorrespondingP-valuep < 0.001 (Continued)1870.00028722.1203317_atPSD4pleckstrinandSec7domaincontaining4 1880.00029691.32238263_atLOC285965hypotheticalproteinLOC285965 1890.00030052.64235159_atNANA 1900.00030431.24218388_atPGLS6-phosphogluconolactonase 1910.00030571.3206729_atTNFRSF8tumornecrosisfactorreceptorsuperfamily,member8 1920.00031211.28231130_atNANA 1930.00031231.41552257_a_atTTLL12tubulintyrosineligase-likefamily,member12 1940.00031291.29219175_s_atSLC41A3solutecarrierfamily41,member3 1950.00031621.41204786_s_atIFNAR2interferon(alpha,betaandomega)receptor2 1960.00031761.47225391_atLOC93622hypotheticalLOC93622 1970.00032161.35227127_atTMEM110transmembraneprotein110 1980.00032193.64202341_s_atTRIM2tripartitemotif-containing2 1990.00032432.09210731_s_atLGALS8lectin,galactoside-binding,soluble,8 2000.00032511.77213374_x_atHIBCH3-hydroxyisobutyryl-CoenzymeAhydrolase 2010.00032601.38200931_s_atVCLvinculin 2020.00032641.45230304_atNANA 2030.00032712.03235195_atFBXW2F-boxandWDrepeatdomaincontaining2 2040.00032904.23215726_s_atCYB5Acytochromeb5typeA(microsomal) 2050.00033002.01242794_atMAML3mastermind-like3(Drosophila) 2060.00033042.18225961_atKLHDC5kelchdomaincontaining5 2070.00033091.48212556_atSCRIBscribbledhomolog(Drosophila) 2080.00033222.66220494_s_atNANA 2090.00033372.38242297_atRREB1rasresponsiveelementbindingprotein1 2100.00033491.9228771_atADRBK2adrenergic,beta,receptorkinase2 2110.00033901.19227465_atKIAA0892KIAA0892 2120.00033901.37228667_atAGPAT41-acylglycerol-3-phosphateO-acyltransferase4(lysophosphatidicacid acyltransferase,delta) 2130.00034081.72202161_atPKN1proteinkinaseN1 2140.00034171.32AFFX-LysX-M_atNANA 2150.00034291.57223314_atTSPAN14tetraspanin14 2160.00034382.51204610_s_atCCDC85Bcoiled-coildomaincontaining85B 2170.00034382.03218027_atMRPL15mitochondrialribosomalproteinL15 2180.00034502.45204718_atEPHB6EPHreceptorB6 2190.00034542.06227313_atCNPY4canopy4homolog(zebrafish) 2200.00034541.52228600_x_atC7orf46chromosome7openreadingframe46 2210.00034721.28226335_atRPS6KA3ribosomalproteinS6kinase,90kDa,polypeptide3 2220.00034811.48219147_s_atC9orf95chromosome9openreadingframe95 2230.00034921.41219801_atZNF34zincfingerprotein34 2240.00035341.37224865_atFAR1fattyacylCoAreductase1 2250.00035341.25209450_atOSGEPO-sialoglycoproteinendopeptidase 2260.00035351.8239016_atNANA 2270.00035671.44228670_atTEP1telomerase-associatedprotein1 2280.00036001.87210580_x_atSULT1A3sulfotransferasefamily,cytosolic,1A,phenol-preferring,member3 2290.00036071.38213945_s_atNUP210nucleoporin210kDa 2300.00036441.32218505_atWDR59WDrepeatdomain59 2310.00036612.32230343_atNANA 2320.00036632.08230888_atWDR91WDrepeatdomain91 2330.00036911.87226368_atCHST11carbohydrate(chondroitin4)sulfotransferase11 Chauncey etal.BMCImmunology 2012, 13 :33 Page9of26 http://www.biomedcentral.com/1471-2172/13/33

PAGE 10

Table1ControlvsToxincorrespondingP-valuep < 0.001 (Continued)2340.00036911.67213364_s_atSNX1sortingnexin1 2350.00037062.17213626_atCBR4carbonylreductase4 2360.00037121.45AFFX-PheX-3_atNANA 2370.00037301.59206567_s_atPHF20PHDfingerprotein20 2380.00037371.49221090_s_atOGFOD12-oxoglutarateandiron-dependentoxygenasedomaincontaining1 2390.00037621.3344040_atFBXO41F-boxprotein41 2400.00037962.03226238_atMCEEmethylmalonylCoAepimerase 2410.00038121.45204562_atIRF4interferonregulatoryfactor4 2420.00038271.46226241_s_atMRPL52mitochondrialribosomalproteinL52 2430.00038311.46220178_atC19orf28chromosome19openreadingframe28 2440.00038411.31209263_x_atTSPAN4tetraspanin4 2450.00038931.45232228_atZNF530zincfingerprotein530 2460.00039072.04208760_atUBE2Iubiquitin-conjugatingenzymeE2I(UBC9homolog,yeast) 2470.00039091.18224562_atWASF2WASproteinfamily,member2 2480.00039231.63213485_s_atABCC10ATP-bindingcassette,sub-familyC(CFTR/MRP),member10 2490.00039841.13202942_atETFBelectron-transfer-flavoprotein,betapolypeptide 2500.00040111.54AFFX-LysX-3_atNANA 2510.00040281.79212135_s_atATP2B4ATPase,Ca++transporting,plasmamembrane4 2520.00040621.24217828_atSLTMSAFB-like,transcriptionmodulator 2530.00041502.05212875_s_atC2CD2C2calcium-dependentdomaincontaining2 2540.00041822.921557411_s_atSLC25A43solutecarrierfamily25,member43 2550.00042592.11227117_atNANA 2560.00043081.57207124_s_atGNB5guaninenucleotidebindingprotein(Gprotein),beta5 2570.00043251.6227607_atSTAMBPL1STAMbindingprotein-like1 2580.00043261.25204538_x_atNPIPnuclearporecomplexinteractingprotein 2590.00043392.03244619_atBCL10B-cellCLL/lymphoma10 2600.00043431.38223239_atC14orf129chromosome14openreadingframe129 2610.00043471.58201087_atPXNpaxillin 2620.00043671.8219149_x_atDBR1debranchingenzymehomolog1(S.cerevisiae) 2630.00043711.88229905_atRAP1GDS1RAP1,GTP-GDPdissociationstimulator1 2640.00043821.61222111_atNANA 2650.00043892.71235052_atZNF792zincfingerprotein792 2660.00044221.62225748_atLTV1LTV1homolog(S.cerevisiae) 2670.00044511.37241741_atCRLS1cardiolipinsynthase1 2680.00044631.46221504_s_atATP6V1HATPase,H+transporting,lysosomal50/57kDa,V1subunitH 2690.00044681.98213448_atNANA 2700.00044831.15201949_x_atCAPZBcappingprotein(actinfilament)muscleZ-line,beta 2710.00045012.15234295_atDBR1debranchingenzymehomolog1(S.cerevisiae) 2720.00045051.72217608_atSFRS12IP1SFRS12-interactingprotein1 2730.00045181.34215737_x_atUSF2upstreamtranscriptionfactor2,c-fosinteracting 2740.00045291.47215873_x_atABCC10ATP-bindingcassette,sub-familyC(CFTR/MRP),member10 2750.00045302.341552256_a_atSCARB1scavengerreceptorclassB,member1 2760.00045462.47208657_s_at9-Sepseptin9 2770.00045552.08228096_atC1orf151chromosome1openreadingframe151 2780.00045601.75222471_s_atKCMF1potassiumchannelmodulatoryfactor1 2790.00045901.5548808_atDHFRdihydrofolatereductase 2800.00046083.5227228_s_atCCDC88Ccoiled-coildomaincontaining88C 2810.00046361.941558445_atNANA Chauncey etal.BMCImmunology 2012, 13 :33 Page10of26 http://www.biomedcentral.com/1471-2172/13/33

PAGE 11

Table1ControlvsToxincorrespondingP-valuep < 0.001 (Continued)2820.00046411.13205540_s_atRRAGBRas-relatedGTPbindingB 2830.00046701.48227239_atFAM126Afamilywithsequencesimilarity126,memberA 2840.00046731.72220246_atCAMK1Dcalcium/calmodulin-dependentproteinkinaseID 2850.00046773.38226478_atNANA 2860.00047001.41230235_atNANA 2870.00047091.22220750_s_atLEPRE1leucineproline-enrichedproteoglycan(leprecan)1 2880.00047272.69223455_atTCHPtrichoplein,keratinfilamentbinding 2890.00047361.31238552_atNANA 2900.00047391.47200827_atPLOD1procollagen-lysine1,2-oxoglutarate5-dioxygenase1 2910.00047511.28227710_s_atNANA 2920.00047854.77236798_atNANA 2930.00047881.88242824_atNANA 2940.00047931.08215846_atNANA 2950.00047951.92211385_x_atSULT1A2sulfotransferasefamily,cytosolic,1A,phenol-preferring,member2 2960.00048001.38226358_atLOC145842hypotheticalproteinLOC145842 2970.00048321.95213534_s_atPASKPASdomaincontainingserine/threoninekinase 2980.00048415.65205698_s_atMAP2K6mitogen-activatedproteinkinasekinase6 2990.00048501.53222661_atAGGF1angiogenicfactorwithGpatchandFHAdomains1 3000.00048551.43212036_s_atPNNpinin,desmosomeassociatedprotein 3010.00048581.6244534_atNANA 3020.00048761.581555751_a_atGEMIN7gem(nuclearorganelle)associatedprotein7 3030.00048791.87203063_atPPM1Fproteinphosphatase1F(PP2Cdomaincontaining) 3040.00049731.16205922_atVNN2vanin2 3050.00049751.23202797_atSACM1LSAC1suppressorofactinmutations1-like(yeast) 3060.00050172.46202826_atSPINT1serinepeptidaseinhibitor,Kunitztype1 3070.00050591.73226073_atTMEM218transmembraneprotein218 3080.00050771.55238523_atKLHL36kelch-like36(Drosophila) 3090.00050801.78231843_atDDX55DEAD(Asp-Glu-Ala-Asp)boxpolypeptide55 3100.00050942.26219714_s_atCACNA2D3calciumchannel,voltage-dependent,alpha2/deltasubunit3 3110.00050972.02229202_atNANA 3120.00051143.54209048_s_atZMYND8zincfinger,MYND-typecontaining8 3130.00051321.64218473_s_atGLT25D1glycosyltransferase25domaincontaining1 3140.00051721.7165493_atHEATR6HEATrepeatcontaining6 3150.00051792.03236194_atNANA 3160.00051792.28226531_atORAI1ORAIcalciumrelease-activatedcalciummodulator1 3170.00052011.58219351_atTRAPPC2traffickingproteinparticlecomplex2 3180.00052441.26220036_s_atLMBR1Llimbregion1homolog(mouse)-like 3190.00053214.22217974_atTM7SF3transmembrane7superfamilymember3 3200.00053351.26211759_x_atTBCBtubulinfoldingcofactorB 3210.00053591.4242155_x_atNANA 3220.00053972209377_s_atHMGN3highmobilitygroupnucleosomalbindingdomain3 3230.00054012.12230653_atLOC100132218hypotheticalproteinLOC100132218 3240.00055041.77224708_atKIAA2013KIAA2013 3250.00055041.9204000_atGNB5guaninenucleotidebindingprotein(Gprotein),beta5 3260.00055591.32244346_atNANA 3270.00055681.9225108_atAGPSalkylglyceronephosphatesynthase 3280.00055991.85236626_atNANA 3290.00056151.85228314_atLRRC8Cleucinerichrepeatcontaining8family,memberC Chauncey etal.BMCImmunology 2012, 13 :33 Page11of26 http://www.biomedcentral.com/1471-2172/13/33

PAGE 12

Table1ControlvsToxincorrespondingP-valuep < 0.001 (Continued)3300.00056361.461558754_atZNF763zincfingerprotein763 3310.00056501.42226155_atFAM160B1familywithsequencesimilarity160,memberB1 3320.00056791.72229705_atNANA 3330.00056864.21228891_atC9orf164chromosome9openreadingframe164 3340.00057081.49225146_atC9orf25chromosome9openreadingframe25 3350.00057241.86219817_atC12orf47chromosome12openreadingframe47 3360.00057241.58235610_atALKBH8alkB,alkylationrepairhomolog8(E.coli) 3370.00057281.59217949_s_atVKORC1vitaminKepoxidereductasecomplex,subunit1 3380.00057462.14222858_s_atDAPP1dualadaptorofphosphotyrosineand3-phosphoinositides 3390.00057481.17223049_atGRB2growthfactorreceptor-boundprotein2 3400.00057921.45212987_atFBXO9F-boxprotein9 3410.00057931.42209903_s_atATRataxiatelangiectasiaandRad3related 3420.00058051.45201067_atPSMC2proteasome(prosome,macropain)26Ssubunit,ATPase,2 3430.00058061.37201076_atNHP2L1NHP2non-histonechromosomeprotein2-like1(S.cerevisiae) 3440.00058111.28236804_atNANA 3450.00058201.27234107_s_atDTD1D-tyrosyl-tRNAdeacylase1homolog(S.cerevisiae) 3460.00058582.041553987_atC12orf47chromosome12openreadingframe47 3470.00058771.42226679_atSLC26A11solutecarrierfamily26,member11 3480.00058931.71554608_atTGOLN2trans-golginetworkprotein2 3490.00059111.65219256_s_atSH3TC1SH3domainandtetratricopeptiderepeats1 3500.00059501.46232369_atNANA 3510.00059921.39243750_x_atC21orf70chromosome21openreadingframe70 3520.00060072.4219759_atERAP2endoplasmicreticulumaminopeptidase2 3530.00060251.24203981_s_atABCD4ATP-bindingcassette,sub-familyD(ALD),member4 3540.00060281.43202428_x_atDBIdiazepambindinginhibitor(GABAreceptormodulator,acyl-CoenzymeA bindingprotein) 3550.00060391.54212886_atCCDC69coiled-coildomaincontaining69 3560.00060412.12221878_atC2orf68chromosome2openreadingframe68 3570.00060521.91202039_atTIAF1TGFB1-inducedanti-apoptoticfactor1 3580.00060582.840472_atLPCAT4lysophosphatidylcholineacyltransferase4 3590.00061351.48217751_atGSTK1glutathioneS-transferasekappa1 3600.00061351.84228303_atGALNT6UDP-N-acetyl-alpha-D-galactosamine:polypeptideNacetylgalactosaminyltransferase6(GalNAc-T6) 3610.00061471.44202172_atVEZF1vascularendothelialzincfinger1 3620.00061672.091558692_atC1orf85chromosome1openreadingframe85 3630.00061901.89207122_x_atSULT1A2sulfotransferasefamily,cytosolic,1A,phenol-preferring,member2 3640.00062051.491560874_atFLJ33046hypotheticalgenesupportedbyAK057608 3650.00062281.97212473_s_atMICAL2microtubuleassociatedmonoxygenase,calponinandLIMdomain containing2 3660.00062411.67225409_atC2orf64chromosome2openreadingframe64 3670.00062461.97203615_x_atSULT1A1sulfotransferasefamily,cytosolic,1A,phenol-preferring,member1 3680.00062751.4224724_atSULF2sulfatase2 3690.00062771.47225022_atGOPCgolgiassociatedPDZandcoiled-coilmotifcontaining 3700.00062821.18214879_x_atUSF2upstreamtranscriptionfactor2,c-fosinteracting 3710.00063111.43222843_atFIGNL1fidgetin-like1 3720.00063132.06210136_atMBPmyelinbasicprotein 3730.00063222.27229512_atFAM120Cfamilywithsequencesimilarity120C 3740.00063261.2209017_s_atLONP1lonpeptidase1,mitochondrial 3750.00063331.69237926_s_atNANA Chauncey etal.BMCImmunology 2012, 13 :33 Page12of26 http://www.biomedcentral.com/1471-2172/13/33

PAGE 13

Table1ControlvsToxincorrespondingP-valuep < 0.001 (Continued)3760.00063511.44222294_s_atRAB27ARAB27A,memberRASoncogenefamily 3770.00064113.49210986_s_atTPM1tropomyosin1(alpha) 3780.00064901.28209932_s_atDUTdeoxyuridinetriphosphatase 3790.00065131.28227656_atC6orf70chromosome6openreadingframe70 3800.00065141.63228131_atERCC1excisionrepaircross-complementingrodentrepairdeficiency, complementationgroup1(includesoverlappingantisensesequence) 3810.00065191.11212848_s_atC9orf3chromosome9openreadingframe3 3820.00065262.31552540_s_atIQCDIQmotifcontainingD 3830.00065302.09239698_atNANA 3840.00065861.621553102_a_atCCDC69coiled-coildomaincontaining69 3850.00066221.77228542_atMRS2MRS2magnesiumhomeostasisfactorhomolog(S.cerevisiae) 3860.00066231.37208956_x_atDUTdeoxyuridinetriphosphatase 3870.00066352.14223528_s_atMETT11D1methyltransferase11domaincontaining1 3880.00066361.38201234_atILKintegrin-linkedkinase 3890.00066371.57228694_atNANA 3900.00066591.36225136_atPLEKHA2pleckstrinhomologydomaincontaining,familyA(phosphoinositide bindingspecific)member2 3910.00067231.55212567_s_atMAP4microtubule-associatedprotein4 3920.00067261.52219549_s_atRTN3reticulon3 3930.00067301.89232681_atNANA 3940.00067422.21219627_atZNF767zincfingerfamilymember767 3950.00067622.7231449_atNANA 3960.00067711.58239035_atMTHFR5,10-methylenetetrahydrofolatereductase(NADPH) 3970.00067731.39205256_atZBTB39zincfingerandBTBdomaincontaining39 3980.00067861.51205945_atIL6Rinterleukin6receptor 3990.00068024.26230032_atOSGEPL1O-sialoglycoproteinendopeptidase-like1 4000.00068371.56225888_atC12orf30chromosome12openreadingframe30 4010.00068401.35227767_atCSNK1G3caseinkinase1,gamma3 4020.00068791.76205060_atPARGpoly(ADP-ribose)glycohydrolase 4030.00069211.37239730_atDGCR14DiGeorgesyndromecriticalregiongene14 4040.00069241.58201029_s_atCD99CD99molecule 4050.00069281.63211709_s_atCLEC11AC-typelectindomainfamily11,memberA 4060.00069521.95201985_atKIAA0196KIAA0196 4070.00069642.17204995_atCDK5R1cyclin-dependentkinase5,regulatorysubunit1(p35) 4080.00070291.52217521_atNANA 4090.00070451.351558184_s_atZNF17zincfingerprotein17 4100.00070991.24218167_atAMZ2archaelysinfamilymetallopeptidase2 4110.00071191.52226712_atSSR1signalsequencereceptor,alpha 4120.00071291.22238668_atNANA 4130.00071381.16221651_x_atIGKCimmunoglobulinkappaconstant 4140.00071431.8564064_atGIMAP5GTPase,IMAPfamilymember5 4150.00071601.24234734_s_atTNRC6Atrinucleotiderepeatcontaining6A 4160.00071651.34213582_atATP11AATPase,classVI,type11A 4170.00071761.34226165_atC8orf59chromosome8openreadingframe59 4180.00071862.61205565_s_atFXNfrataxin 4190.00072251.21220251_atC1orf107chromosome1openreadingframe107 4200.00072312.16225980_atC14orf43chromosome14openreadingframe43 4210.00072471.69238379_x_atNANA Chauncey etal.BMCImmunology 2012, 13 :33 Page13of26 http://www.biomedcentral.com/1471-2172/13/33

PAGE 14

Table1ControlvsToxincorrespondingP-valuep < 0.001 (Continued)4220.00072661.721559034_atSIRPB2signal-regulatoryproteinbeta2 4230.00072731.21201053_s_atPSMF1proteasome(prosome,macropain)inhibitorsubunit1(PI31) 4240.00073181.140225_atGAKcyclinGassociatedkinase 4250.00073292.14209729_atGAS2L1growtharrest-specific2like1 4260.00073441.55221027_s_atPLA2G12AphospholipaseA2,groupXIIA 4270.00073481.28209724_s_atZFP161zincfingerprotein161homolog(mouse) 4280.00073801.4214494_s_atSPG7spasticparaplegia7(pureandcomplicatedautosomalrecessive) 4290.00073921.58205131_x_atCLEC11AC-typelectindomainfamily11,memberA 4300.00073932.07204019_s_atSH3YL1SH3domaincontaining,Ysc84-like1(S.cerevisiae) 4310.00074171.42214861_atJMJD2Cjumonjidomaincontaining2C 4320.00074211.69242965_atNANA 4330.00074851.99228167_atKLHL6kelch-like6(Drosophila) 4340.00075472.15209269_s_atSYKspleentyrosinekinase 4350.00075631.5244663_atNANA 4360.00075632.14203802_x_atNSUN5NOL1/NOP2/Sundomainfamily,member5 4370.00075781.62242108_atNANA 4380.00076551.46205632_s_atPIP5K1Bphosphatidylinositol-4-phosphate5-kinase,typeI,beta 4390.00076912.28238604_atNANA 4400.00076941.25219084_atNSD1nuclearreceptorbindingSETdomainprotein1 4410.00077121.4223716_s_atZRANB2zincfinger,RAN-bindingdomaincontaining2 4420.00077281.82209760_atKIAA0922KIAA0922 4430.00077961.29214437_s_atSHMT2serinehydroxymethyltransferase2(mitochondrial) 4440.00078361.46224704_atTNRC6Atrinucleotiderepeatcontaining6A 4450.00078412.01223339_atATPIF1ATPaseinhibitoryfactor1 4460.00078481.59222622_atPGPphosphoglycolatephosphatase 4470.00078511.62218231_atNAGKN-acetylglucosaminekinase 4480.00078781.791554544_a_atMBPmyelinbasicprotein 4490.00078942.21554250_s_atTRIM73tripartitemotif-containing73 4500.00078962.19216199_s_atMAP3K4mitogen-activatedproteinkinasekinasekinase4 4510.00079251.3206881_s_atLILRA3leukocyteimmunoglobulin-likereceptor,subfamilyA(withoutTM domain),member3 4520.00079761.65226716_atPRR12prolinerich12 4530.00079891.67202534_x_atDHFRdihydrofolatereductase 4540.00079952.43202369_s_atTRAM2translocationassociatedmembraneprotein2 4550.00080092.59218112_atMRPS34mitochondrialribosomalproteinS34 4560.00080351.48230925_atAPBB1IPamyloidbeta(A4)precursorprotein-binding,familyB,member1 interactingprotein 4570.00080861.16213027_atTROVE2TROVEdomainfamily,member2 4580.00081242.991562289_atNANA 4590.00081481.41202615_atGNAQguaninenucleotidebindingprotein(Gprotein),qpolypeptide 4600.00081501.71219151_s_atRABL2BRAB,memberofRASoncogenefamily-like2B 4610.00081582.11559214_atNANA 4620.00081611.84203711_s_atHIBCH3-hydroxyisobutyryl-CoenzymeAhydrolase 4630.00081871.87233955_x_atCXXC5CXXCfinger5 4640.00082051.26201804_x_atTBCBtubulinfoldingcofactorB 4650.00082071.44211100_x_atLILRA2leukocyteimmunoglobulin-likereceptor,subfamilyA(withTMdomain), member2 4660.00082295.13212757_s_atCAMK2Gcalcium/calmodulin-dependentproteinkinase(CaMkinase)IIgamma 4670.00082321.76214202_atNANA Chauncey etal.BMCImmunology 2012, 13 :33 Page14of26 http://www.biomedcentral.com/1471-2172/13/33

PAGE 15

Table1ControlvsToxincorrespondingP-valuep < 0.001 (Continued)4680.00082552.01221746_atUBL4Aubiquitin-like4A 4690.00082771.351560587_s_atPRDX5peroxiredoxin5 4700.00082781.41211070_x_atDBIdiazepambindinginhibitor(GABAreceptormodulator,acyl-CoenzymeA bindingprotein) 4710.00082791.53242887_atKCMF1potassiumchannelmodulatoryfactor1 4720.00082831.29206200_s_atANXA11annexinA11 4730.00083181.72203607_atINPP5Finositolpolyphosphate-5-phosphataseF 4740.00083441.9205282_atLRP8lowdensitylipoproteinreceptor-relatedprotein8,apolipoproteine receptor 4750.00083471.42209566_atINSIG2insulininducedgene2 4760.00083611.54223306_atEBPLemopamilbindingprotein-like 4770.00084443.9210166_atTLR5toll-likereceptor5 4780.00084511.44225050_atZNF512zincfingerprotein512 4790.00084631.9226480_atNANA 4800.00085101.22211152_s_atHTRA2HtrAserinepeptidase2 4810.00085261.9222603_atERMP1endoplasmicreticulummetallopeptidase1 4820.00085901.42226078_atRPUSD1RNApseudouridylatesynthasedomaincontaining1 4830.00086021.89203409_atDDB2damage-specificDNAbindingprotein2,48kDa 4840.00086071.79222996_s_atCXXC5CXXCfinger5 4850.00086191.42229597_s_atWDFY4WDFYfamilymember4 4860.00086251.21209420_s_atSMPD1sphingomyelinphosphodiesterase1,acidlysosomal 4870.00086482.16213333_atMDH2malatedehydrogenase2,NAD(mitochondrial) 4880.00086541.57232524_x_atANAPC4anaphasepromotingcomplexsubunit4 4890.00086741.63238058_atFLJ27365FLJ27365protein 4900.00086822.88212660_atPHF15PHDfingerprotein15 4910.00087012.47209197_atSYT11synaptotagminXI 4920.00087551.49200875_s_atNOL5Anucleolarprotein5A(56kDawithKKE/Drepeat) 4930.00088685.04207008_atIL8RBinterleukin8receptor,beta 4940.00089251.33233694_atHSPA1Lheatshock70kDaprotein1-like 4950.00089581.35217957_atC16orf80chromosome16openreadingframe80 4960.00089611.64228070_atPPP2R5Eproteinphosphatase2,regulatorysubunitB@#$%&,epsilonisoform 4970.00089671.56225997_atMOBKL1AMOB1,MpsOneBinderkinaseactivator-like1A(yeast) 4980.00090201.9865438_atKIAA1609KIAA1609 4990.00090561.82218921_atSIGIRRsingleimmunoglobulinandtoll-interleukin1receptor(TIR)domain 5000.00091031.06240001_atNANA 5010.00091141.51227533_atNANA 5020.00091361.47226333_atIL6Rinterleukin6receptor 5030.00091541.681562249_atLOC285965hypotheticalproteinLOC285965 5040.00091893.86204301_atKBTBD11kelchrepeatandBTB(POZ)domaincontaining11 5050.00091971.67213296_atRER1RER1retentioninendoplasmicreticulum1homolog(S.cerevisiae) 5060.00092281.32224688_atC7orf42chromosome7openreadingframe42 5070.00092451.91221843_s_atKIAA1609KIAA1609 5080.00092721.241569808_atNANA 5090.00093085.9438290_atRGS14regulatorofG-proteinsignaling14 5100.00093573.85226820_atZNF362zincfingerprotein362 5110.00093701.35241344_atNANA 5120.00093781.73228512_atPTCD3Pentatricopeptiderepeatdomain3 5130.00094171.63210830_s_atPON2paraoxonase2 Chauncey etal.BMCImmunology 2012, 13 :33 Page15of26 http://www.biomedcentral.com/1471-2172/13/33

PAGE 16

Table1ControlvsToxincorrespondingP-valuep < 0.001 (Continued)5140.00094361.44219493_atSHCBP1SHCSH2-domainbindingprotein1 5150.00094711.38230122_atMLLT10myeloid/lymphoidormixed-lineageleukemia(trithoraxhomolog, Drosophila);translocatedto,10 5160.00095261.67218380_atNLRP1NLRfamily,pyrindomaincontaining1 5170.00095621.42202200_s_atSRPK1SFRSproteinkinase1 5180.00095751.63202741_atPRKACBproteinkinase,cAMP-dependent,catalytic,beta 5190.00095921.43228869_atNANA 5200.00096141.25224252_s_atFXYD5FXYDdomaincontainingiontransportregulator5 5210.00096261.45221488_s_atCUTAcutAdivalentcationtolerancehomolog(E.coli) 5220.00096341.7244687_atDBTdihydrolipoamidebranchedchaintransacylaseE2 5230.00096791.17209445_x_atC7orf44chromosome7openreadingframe44 5240.00097031.14244537_atNANA 5250.00097171.7226104_atRNF170ringfingerprotein170 5260.00097301.31205240_atGPSM2G-proteinsignalingmodulator2(AGS3-like,C.elegans) 5270.00097321.73200766_atCTSDcathepsinD 5280.00097341.41231844_atMGC27345hypotheticalproteinMGC27345 5290.00097381.29202634_atPOLR2Kpolymerase(RNA)II(DNAdirected)polypeptideK,7.0kDa 5300.00097601.58224938_atNUFIP2nuclearfragileXmentalretardationproteininteractingprotein2 5310.00097642.26204089_x_atMAP3K4mitogen-activatedproteinkinasekinasekinase4 5320.00097761.93211985_s_atCALM1calmodulin1(phosphorylasekinase,delta) 5330.00097782.65213280_atGARNL4GTPaseactivatingRap/RanGAPdomain-like4 5340.00098051.48236016_atNANA 5350.00098281.84217394_atNANA 5360.00099001.58201030_x_atLDHBlactatedehydrogenaseB 5370.00099251.81227379_atMBOAT1membraneboundO-acyltransferasedomaincontaining1 5380.0009997-1.19236663_atNANA 5390.0009983-1.6219766_atB9D2B9proteindomain2 5400.0009949-1.71204157_s_atKIAA0999KIAA0999protein 5410.0009891-1.23214060_atSSBP1single-strandedDNAbindingprotein1 5420.0009868-1.47226276_atTMEM167Atransmembraneprotein167A 5430.0009825-1.75203596_s_atIFIT5interferon-inducedproteinwithtetratricopeptiderepeats5 5440.0009805-1.64226310_atRICTORrapamycin-insensitivecompanionofmTOR 5450.0009772-2.29218986_s_atDDX60DEAD(Asp-Glu-Ala-Asp)boxpolypeptide60 5460.0009758-1.52217618_x_atHUS1HUS1checkpointhomolog(S.pombe) 5470.0009746-2.4219017_atETNK1ethanolaminekinase1 5480.0009745-1.24201957_atPPP1R12Bproteinphosphatase1,regulatory(inhibitor)subunit12B 5490.0009737-1.26240887_atNANA 5500.0009681-1.33209514_s_atRAB27ARAB27A,memberRASoncogenefamily 5510.0009661-2.54219026_s_atRASAL2RASproteinactivatorlike2 5520.0009592-1.49211395_x_atFCGR2CFcfragmentofIgG,lowaffinityIIc,receptorfor(CD32) 5530.0009568-3.72205126_atVRK2vacciniarelatedkinase2 5540.0009560-1.221556514_atLOC338809hypotheticalproteinLOC338809 5550.0009506-2.66206991_s_atCCR5chemokine(C-Cmotif)receptor5 5560.0009500-1.47212840_atUBXN7UBXdomainprotein7 5570.0009443-1.25244496_atNANA 5580.0009406-1.21236108_atKIAA1632KIAA1632 5590.0009366-1.2203654_s_atCOILcoilin 5600.0009338-2.95236156_atLIPAlipaseA,lysosomalacid,cholesterolesterase Chauncey etal.BMCImmunology 2012, 13 :33 Page16of26 http://www.biomedcentral.com/1471-2172/13/33

PAGE 17

Table1ControlvsToxincorrespondingP-valuep < 0.001 (Continued)5610.0009309-1.3212462_atMYST4MYSThistoneacetyltransferase(monocyticleukemia)4 5620.0009278-2.58219403_s_atHPSEheparanase 5630.0009220-1.581554747_a_at2-Sepseptin2 5640.0009134-1.08203291_atCNOT4CCR4-NOTtranscriptioncomplex,subunit4 5650.0009077-1.25243772_atSDCCAG8serologicallydefinedcoloncancerantigen8 5660.0009071-1.7201656_atITGA6integrin,alpha6 5670.0009063-3.06201325_s_atEMP1epithelialmembraneprotein1 5680.0009031-1.27209531_atGSTZ1glutathionetransferasezeta1 5690.0008974-1.42208779_x_atDDR1discoidindomainreceptortyrosinekinase1 5700.0008959-1.19242654_atFANCCFanconianemia,complementationgroupC 5710.0008945-1.16220386_s_atEML4echinodermmicrotubuleassociatedproteinlike4 5720.0008922-1.32227003_atRAB28RAB28,memberRASoncogenefamily 5730.0008910-3.14224009_x_atDHRS9dehydrogenase/reductase(SDRfamily)member9 5740.0008877-1.6732069_atN4BP1NEDD4bindingprotein1 5750.0008870-1.29232141_atU2AF1U2smallnuclearRNAauxiliaryfactor1 5760.0008761-1.35240468_atNANA 5770.0008698-1.32204367_atSP2Sp2transcriptionfactor 5780.0008616-1.87225076_s_atZNFX1zincfinger,NFX1-typecontaining1 5790.0008599-1.25225056_atSIPA1L2signal-inducedproliferation-associated1like2 5800.0008580-1.13207070_atRGRretinalGproteincoupledreceptor 5810.0008574-1.28217129_atNANA 5820.0008537-1.22225268_atKPNA4karyopherinalpha4(importinalpha3) 5830.0008463-1.07232295_atGFM1Gelongationfactor,mitochondrial1 5840.0008408-1.33211975_atARFGAP2ADP-ribosylationfactorGTPaseactivatingprotein2 5850.0008385-1.24244625_atNANA 5860.0008384-1.49202083_s_atSEC14L1SEC14-like1(S.cerevisiae) 5870.0008274-1.34232987_atARL17ADP-ribosylationfactor-like17 5880.0008198-1.331570541_s_atNANA 5890.0008196-2.91201324_atEMP1epithelialmembraneprotein1 5900.0008172-1.42222408_s_atYPEL5yippee-like5(Drosophila) 5910.0008164-1.3201585_s_atSFPQsplicingfactorproline/glutamine-rich(polypyrimidinetractbindingprotein associated) 5920.0008160-1.35243492_atTHEM4thioesterasesuperfamilymember4 5930.0008023-1.53222537_s_atCDC42SE1CDC42smalleffector1 5940.0007993-1.38223225_s_atSEH1LSEH1-like(S.cerevisiae) 5950.0007951-1.4231139_atNANA 5960.0007921-3.08206911_atTRIM25tripartitemotif-containing25 5970.0007824-1.551554390_s_atACTR2ARP2actin-relatedprotein2homolog(yeast) 5980.0007777-1.32208824_x_atPCTK1PCTAIREproteinkinase1 5990.0007732-1.36214258_x_atKAT5K(lysine)acetyltransferase5 6000.0007729-1.47208751_atNAPAN-ethylmaleimide-sensitivefactorattachmentprotein,alpha 6010.0007690-1.16238337_s_atDNAJC21DnaJ(Hsp40)homolog,subfamilyC,member21 6020.0007673-1.31211314_atCACNA1Gcalciumchannel,voltage-dependent,Ttype,alpha1Gsubunit 6030.0007657-1.53217834_s_atSYNCRIPsynaptotagminbinding,cytoplasmicRNAinteractingprotein 6040.0007625-1.85208653_s_atCD164CD164molecule,sialomucin 6050.0007608-1.45209091_s_atSH3GLB1SH3-domainGRB2-likeendophilinB1 6060.0007426-1.251557533_atNANA 6070.0007405-2.011555785_a_atXRN15@#$%&-3@#$%&exoribonuclease1 Chauncey etal.BMCImmunology 2012, 13 :33 Page17of26 http://www.biomedcentral.com/1471-2172/13/33

PAGE 18

Table1ControlvsToxincorrespondingP-valuep < 0.001 (Continued)6080.0007371-1.41236961_atNANA 6090.0007346-1.14204080_atTOE1targetofEGR1,member1(nuclear) 6100.0007341-1.29243852_atLUC7L2LUC7-like2(S.cerevisiae) 6110.0007227-1.29210317_s_atYWHAEtyrosine3-monooxygenase/tryptophan5-monooxygenaseactivation protein,epsilonpolypeptide 6120.0007183-1.4209284_s_atC3orf63chromosome3openreadingframe63 6130.0007169-3.19227361_atHS3ST3B1heparansulfate(glucosamine)3-O-sulfotransferase3B1 6140.0007139-1.19211066_x_atPCDHGC3protocadheringammasubfamilyC,3 6150.0006984-1.09202814_s_atHEXIM1hexamethylenebis-acetamideinducible1 6160.0006943-1.35226710_atC8orf82chromosome8openreadingframe82 6170.0006932-3.2209969_s_atSTAT1signaltransducerandactivatoroftranscription1,91kDa 6180.0006882-1.56225242_s_atCCDC80coiled-coildomaincontaining80 6190.0006875-1.5214121_x_atPDLIM7PDZandLIMdomain7(enigma) 6200.0006868-1.41203916_atNDST2N-deacetylase/N-sulfotransferase(heparanglucosaminyl)2 6210.0006826-1.32208901_s_atTOP1topoisomerase(DNA)I 6220.0006769-2.95206028_s_atMERTKc-merproto-oncogenetyrosinekinase 6230.0006749-1.35205724_atPKP1plakophilin1(ectodermaldysplasia/skinfragilitysyndrome) 6240.0006737-1.23228121_atNANA 6250.0006701-1.04226928_x_atSLC25A37solutecarrierfamily25,member37 6260.0006700-1.371555301_a_atDIP2ADIP2disco-interactingprotein2homologA(Drosophila) 6270.0006616-1.271566301_atPPP1R11proteinphosphatase1,regulatory(inhibitor)subunit11 6280.0006570-1.46234519_atNOBOXNOBOXoogenesishomeobox 6290.0006553-1.24218520_atTBK1TANK-bindingkinase1 6300.0006552-1.55201878_atARIH1ariadnehomolog,ubiquitin-conjugatingenzymeE2bindingprotein,1 (Drosophila) 6310.0006495-1.31564131_a_atNANA 6320.0006472-1.49209102_s_atHBP1HMG-boxtranscriptionfactor1 6330.0006450-1.18238586_atLOC731489hypotheticalproteinLOC731489 6340.0006425-1.03216231_s_atB2Mbeta-2-microglobulin 6350.0006398-1.791552772_atCLEC4DC-typelectindomainfamily4,memberD 6360.0006384-1.42201586_s_atSFPQsplicingfactorproline/glutamine-rich(polypyrimidinetractbindingprotein associated) 6370.0006373-1.7441644_atSASH1SAMandSH3domaincontaining1 6380.0006346-1.11216652_s_atDR1down-regulatoroftranscription1,TBP-binding(negativecofactor2) 6390.0006313-1.3212436_atTRIM33tripartitemotif-containing33 6400.0006284-1.57212264_s_atWAPALwingsapart-likehomolog(Drosophila) 6410.0006259-1.2226481_atVPRBPVpr(HIV-1)bindingprotein 6420.0006104-1.35217490_atNANA 6430.0006091-1.291557463_atNANA 6440.0005929-1.35238273_atPL-5283PL-5283protein 6450.0005927-1.77203840_atBLZF1basicleucinezippernuclearfactor1 6460.0005896-1.17237604_atLOC415056hypotheticalgeneLOC415056 6470.0005883-1.9222881_atHPSEheparanase 6480.0005855-1.25220634_atTBX4T-box4 6490.0005853-1.3200669_s_atUBE2D3ubiquitin-conjugatingenzymeE2D3(UBC4/5homolog,yeast) 6500.0005801-1.05232017_atTJP2tightjunctionprotein2(zonaoccludens2) 6510.0005772-1.35213918_s_atNIPBLNipped-Bhomolog(Drosophila) 6520.0005770-1.62215357_s_atPOLDIP3polymerase(DNA-directed),deltainteractingprotein3 6530.0005750-1.41561354_atNANA Chauncey etal.BMCImmunology 2012, 13 :33 Page18of26 http://www.biomedcentral.com/1471-2172/13/33

PAGE 19

Table1ControlvsToxincorrespondingP-valuep < 0.001 (Continued)6540.0005678-1.08206516_atAMHanti-Mullerianhormone 6550.0005652-2.05211030_s_atSLC6A6solutecarrierfamily6(neurotransmittertransporter,taurine),member6 6560.0005634-2.18222651_s_atTRPS1trichorhinophalangealsyndromeI 6570.0005618-2.0557703_atSENP5SUMO1/sentrinspecificpeptidase5 6580.0005604-11.89211372_s_atIL1R2interleukin1receptor,typeII 6590.0005547-1.21567246_atOR5H1olfactoryreceptor,family5,subfamilyH,member1 6600.0005488-1.85205003_atDOCK4dedicatorofcytokinesis4 6610.0005371-2.37222262_s_atETNK1ethanolaminekinase1 6620.0005358-1.38201684_s_atTOX4TOXhighmobilitygroupboxfamilymember4 6630.0005357-1.85206011_atCASP1caspase1,apoptosis-relatedcysteinepeptidase(interleukin1,beta, convertase) 6640.0005349-1.16211505_s_atSTAU1staufen,RNAbindingprotein,homolog1(Drosophila) 6650.0005342-1.471554049_s_atWDR42AWDrepeatdomain42A 6660.0005321-1.36225978_atFAM80Bfamilywithsequencesimilarity80,memberB 6670.0005228-1.15215056_atNANA 6680.0005162-1.38202066_atPPFIA1proteintyrosinephosphatase,receptortype,fpolypeptide(PTPRF), interactingprotein(liprin),alpha1 6690.0005087-1.13226128_atNANA 6700.0005005-1.171562449_s_atNANA 6710.0004997-1.51217847_s_atTHRAP3thyroidhormonereceptorassociatedprotein3 6720.0004992-1.6229845_atMAPKAP1mitogen-activatedproteinkinaseassociatedprotein1 6730.0004955-2.82211806_s_atKCNJ15potassiuminwardly-rectifyingchannel,subfamilyJ,member15 6740.0004947-2.32217503_atNANA 6750.0004946-1.2221147_x_atWWOXWWdomaincontainingoxidoreductase 6760.0004897-1.261552684_a_atSENP8SUMO/sentrinspecificpeptidasefamilymember8 6770.0004707-1.17206251_s_atAVPR1Aargininevasopressinreceptor1A 6780.0004609-1.24223546_x_atLUC7LLUC7-like(S.cerevisiae) 6790.0004595-1.33208576_s_atHIST1H3Bhistonecluster1,H3b 6800.0004582-1.97202684_s_atRNMTRNA(guanine-7-)methyltransferase 6810.0004567-1.36201378_s_atUBAP2Lubiquitinassociatedprotein2-like 6820.0004553-1.15202178_atPRKCZproteinkinaseC,zeta 6830.0004545-1.131555139_a_atOTUD7BOTUdomaincontaining7B 6840.0004543-1.47244595_atNANA 6850.0004511-1.32210592_s_at04/01/12spermidine/spermineN1-acetyltransferase1 6860.0004444-1.211554327_a_atCANT1calciumactivatednucleotidase1 6870.0004435-1.41223430_atSNF1LK2SNF1-likekinase2 6880.0004430-1.42232437_atCPSF3Lcleavageandpolyadenylationspecificfactor3-like 6890.0004418-1.11202230_s_atCHERPcalciumhomeostasisendoplasmicreticulumprotein 6900.0004358-1.8211782_atIDSiduronate2-sulfatase 6910.0004288-1.63208869_s_atGABARAPL1GABA(A)receptor-associatedproteinlike1 6920.0004258-1.141554646_atOSBPL1Aoxysterolbindingprotein-like1A 6930.0004189-1.29224410_s_atLMBR1limbregion1homolog(mouse) 6940.0004130-1.09201698_s_atSFRS9splicingfactor,arginine/serine-rich9 6950.0004109-1.57218578_atCDC73celldivisioncycle73,Paf1/RNApolymeraseIIcomplexcomponent, homolog(S.cerevisiae) 6960.0003904-1.31566456_atNANA 6970.0003884-2.78226026_atDIRC2disruptedinrenalcarcinoma2 6980.0003884-1.49222035_s_atPAPOLApoly(A)polymerasealpha 6990.0003882-1.25240313_atDMRTB1DMRT-likefamilyBwithproline-richC-terminal,1 Chauncey etal.BMCImmunology 2012, 13 :33 Page19of26 http://www.biomedcentral.com/1471-2172/13/33

PAGE 20

Table1ControlvsToxincorrespondingP-valuep < 0.001 (Continued)7000.0003880-1.65242943_atST8SIA4ST8alpha-N-acetyl-neuraminidealpha-2,8-sialyltransferase4 7010.0003868-2.87243271_atNANA 7020.0003850-1.43234173_s_atNXF2nuclearRNAexportfactor2 7030.0003839-1.93211368_s_atCASP1caspase1,apoptosis-relatedcysteinepeptidase(interleukin1,beta, convertase) 7040.0003823-1.24227712_atLYRM2LYRmotifcontaining2 7050.0003803-1.63201377_atUBAP2Lubiquitinassociatedprotein2-like 7060.0003785-1.4204858_s_atTYMPthymidinephosphorylase 7070.0003695-1.53205415_s_atATXN3ataxin3 7080.0003684-2.46209237_s_atSLC23A2solutecarrierfamily23(nucleobasetransporters),member2 7090.0003661-1.25235833_atPPATphosphoribosylpyrophosphateamidotransferase 7100.0003575-1.29209590_atBMP7bonemorphogeneticprotein7 7110.0003529-3.5215966_x_atGK3Pglycerolkinase3pseudogene 7120.0003527-1.22202807_s_atTOM1targetofmyb1(chicken) 7130.0003455-1.18201198_s_atPSMD1proteasome(prosome,macropain)26Ssubunit,non-ATPase,1 7140.0003409-3.97202068_s_atLDLRlowdensitylipoproteinreceptor 7150.0003389-1.07200914_x_atKTN1kinectin1(kinesinreceptor) 7160.0003355-1.77225395_s_atFAM120AOSfamilywithsequencesimilarity120Aoppositestrand 7170.0003300-1.17216306_x_atPTBP1polypyrimidinetractbindingprotein1 7180.0003300-1.38208985_s_atEIF3Jeukaryotictranslationinitiationfactor3,subunitJ 7190.0003231-1.151569932_atNHSL2NHS-like2 7200.0003229-1.41204781_s_atFASFas(TNFreceptorsuperfamily,member6) 7210.0003210-2209593_s_atTOR1Btorsinfamily1,memberB(torsinB) 7220.0003206-1.3237285_atSORBS2sorbinandSH3domaincontaining2 7230.0003169-1.19202550_s_atVAPBVAMP(vesicle-associatedmembraneprotein)-associatedproteinBandC 7240.0003084-1.34201461_s_atMAPKAPK2mitogen-activatedproteinkinase-activatedproteinkinase2 7250.0003068-1.111563069_atNANA 7260.0002955-1.14218382_s_atU2AF2U2smallnuclearRNAauxiliaryfactor2 7270.0002940-1.11205570_atPIP4K2Aphosphatidylinositol-5-phosphate4-kinase,typeII,alpha 7280.0002921-1.28208642_s_atXRCC5X-rayrepaircomplementingdefectiverepairinChinesehamstercells5 (double-strand-breakrejoining) 7290.0002910-1.24221603_atPEX16peroxisomalbiogenesisfactor16 7300.0002863-1.21231211_s_atLOC541469hypotheticalproteinLOC541469 7310.0002857-2.02219062_s_atZCCHC2zincfinger,CCHCdomaincontaining2 7320.0002808-1.2218570_atKBTBD4kelchrepeatandBTB(POZ)domaincontaining4 7330.0002799-1.16223545_atFANCD2Fanconianemia,complementationgroupD2 7340.0002764-1.341555614_atSUGT1PsuppressorofG2alleleofSKP1pseudogene(S.cerevisiae) 7350.0002736-1.531556283_s_atFGFR1OP2FGFR1oncogenepartner2 7360.0002703-1.66226022_atSASH1SAMandSH3domaincontaining1 7370.0002699-1.87214838_atSFT2D2SFT2domaincontaining2 7380.0002674-1.26206307_s_atFOXD1forkheadboxD1 7390.0002668-1.41208108_s_atAVPR2argininevasopressinreceptor2 7400.0002633-1.21239949_atTHNSL2threoninesynthase-like2(S.cerevisiae) 7410.0002619-1.761554096_a_atRBM33RNAbindingmotifprotein33 7420.0002577-1.25203039_s_atNDUFS1NADHdehydrogenase(ubiquinone)Fe-Sprotein1,75kDa(NADHcoenzymeQreductase) 7430.0002569-3.71563541_atNANA 7440.0002547-1.33210569_s_atSIGLEC9sialicacidbindingIg-likelectin9 7450.0002484-1.44203922_s_atCYBBcytochromeb-245,betapolypeptide Chauncey etal.BMCImmunology 2012, 13 :33 Page20of26 http://www.biomedcentral.com/1471-2172/13/33

PAGE 21

Table1ControlvsToxincorrespondingP-valuep < 0.001 (Continued)7460.0002482-1.33220012_atERO1LBERO1-likebeta(S.cerevisiae) 7470.0002373-2.41236106_atNANA 7480.0002362-1.34242834_atNANA 7490.0002316-1.2220498_atACTL7Bactin-like7B 7500.0002303-1.44240873_x_atDAB2disabledhomolog2,mitogen-responsivephosphoprotein(Drosophila) 7510.0002296-1.19221471_atSERINC3serineincorporator3 7520.0002267-1.74213236_atSASH1SAMandSH3domaincontaining1 7530.0002262-1.62213988_s_at04/01/12spermidine/spermineN1-acetyltransferase1 7540.0002220-1.2239372_atNANA 7550.0002208-1.35240079_atZNF81zincfingerprotein81 7560.0002182-1.65205227_atIL1RAPinterleukin1receptoraccessoryprotein 7570.0002149-1.5223751_x_atTLR10toll-likereceptor10 7580.0002132-1.351553677_a_atTIPRLTIP41,TORsignalingpathwayregulator-like(S.cerevisiae) 7590.0002103-1.44AFFXHUMISGF3A/ M97935_5_at STAT1signaltransducerandactivatoroftranscription1,91kDa 7600.0002103-1.11202240_atPLK1polo-likekinase1(Drosophila) 7610.0002099-1.281556281_atNANA 7620.0002093-1.53222989_s_atUBQLN1ubiquilin1 7630.0002070-1.16204682_atLTBP2latenttransforminggrowthfactorbetabindingprotein2 7640.0002018-1.37225830_atPDZD8PDZdomaincontaining8 7650.0002016-1.34229208_atCEP27centrosomalprotein27kDa 7660.0002006-1.38202211_atARFGAP3ADP-ribosylationfactorGTPaseactivatingprotein3 7670.0001969-1.21208696_atCCT5chaperonincontainingTCP1,subunit5(epsilon) 7680.0001905-1.71219207_atEDC3enhancerofmRNAdecapping3homolog(S.cerevisiae) 7690.0001804-1.31221248_s_atWHSC1L1Wolf-Hirschhornsyndromecandidate1-like1 7700.0001758-1.59211781_x_atNANA 7710.0001730-1.36226037_s_atTAF9BTAF9BRNApolymeraseII,TATAboxbindingprotein(TBP)-associated factor,31kDa 7720.0001724-1.14200901_s_atM6PRmannose-6-phosphatereceptor(cationdependent) 7730.0001713-1.67213173_atPCNXpecanexhomolog(Drosophila) 7740.0001667-2.06206038_s_atNR2C2nuclearreceptorsubfamily2,groupC,member2 7750.0001616-1.24225397_atC15orf57chromosome15openreadingframe57 7760.0001297-2.14211367_s_atCASP1caspase1,apoptosis-relatedcysteinepeptidase(interleukin1,beta, convertase) 7770.0001209-1.66222810_s_atRASAL2RASproteinactivatorlike2 7780.0001196-1.23231718_atSLU7SLU7splicingfactorhomolog(S.cerevisiae) 7790.0001187-1.32223905_atCCDC135coiled-coildomaincontaining135 7800.0001127-1.28211672_s_atARPC4actinrelatedprotein2/3complex,subunit4,20kDa 7810.0001127-1.38200828_s_atZNF207zincfingerprotein207 7820.0001073-1.29244211_atNANA 7830.0001070-12.04205403_atIL1R2interleukin1receptor,typeII 7840.0001065-1.83209970_x_atCASP1caspase1,apoptosis-relatedcysteinepeptidase(interleukin1,beta, convertase) 7850.0001034-6.35217502_atIFIT2interferon-inducedproteinwithtetratricopeptiderepeats2 7860.0001029-2.07237867_s_atPID1phosphotyrosineinteractiondomaincontaining1 7870.0001028-1.26218516_s_atIMPAD1inositolmonophosphatasedomaincontaining1 7889.94E-005-1.64226312_atRICTORrapamycin-insensitivecompanionofmTOR 7899.41E-005-1.2210940_s_atGRM1glutamatereceptor,metabotropic1 Chauncey etal.BMCImmunology 2012, 13 :33 Page21of26 http://www.biomedcentral.com/1471-2172/13/33

PAGE 22

over-expressionofRGS14,therebyinhibitingG-protein mediatedsignalingrequiredforactin-basedmotility. RGS14expressionisdown-regulatedduringthematurationofmonocytestodendriticcells[24]andoverexpressionofthisGproteinregulatorwouldbeexpected toblockmonocytematuration.RGS14levelsarealso knowntodecreaseindendriticcellsexposedto Leishmania major or Toxoplasmagondii ,suggestingthatRGS14downregulationmaybeanimportantstepinanormalimmune response,andup-regulationofRGS14byLTcouldbe contributingtoLT ’ simmunosuppressiveeffects[25]. ThreechemokinereceptorswerealsoalteredafterLT treatment,suggestingthatLTmaybeinducingfunctional defectsinmonocyteresponsesignaling.IL-8receptorbeta (CXCR2)wasup-regulatedafterLTtreatment(Table2). CXCR2transducessignalingthroughaG-proteinactivated secondmessengersystem.Thisreceptorisimportant formonocytetransendothelialmigration,andupregulationofCXCR2couldservetoenhancethedeliveryofmonocytestotissue s.Anthraxsporesmustbe phagocytosedbymacrophagesinordertogerminate intoviablebacteria.Anincreaseinthemacrophage poolmayaidinareservoirforincreasedgerminationof viablebacteria.IL-1receptortypeII(IL-1R2),was foundtobemarkedlydown-regulated.IL-1R2isa decoyreceptorforIL-1thatfunctionseitheratthecell surfaceorinasolubleform[26].Thedecreasedexpressionofthedecoyreceptorwouldpresumablyincrease IL-1alevelsandincreasethefebrileresponseofthe hostpotentiallyatleastinpartexplainingthehighfever thatcommonlyaccompaniessystemicanthrax[27]. CCR5isareceptorforthemonocytechemokines Table1ControlvsToxincorrespondingP-valuep < 0.001 (Continued)7909.02E-005-1.361554556_a_atATP11BATPase,classVI,type11B 7918.89E-005-1.14226735_atTAPT1transmembraneanteriorposteriortransformation1 7928.70E-005-3.84213006_atCEBPDCCAAT/enhancerbindingprotein(C/EBP),delta 7938.35E-005-1.31207787_atKRT33Bkeratin33B 7948.34E-005-1.29207410_s_atTLX2T-cellleukemiahomeobox2 7958.21E-005-1.6223596_atSLC12A6solutecarrierfamily12(potassium/chloridetransporters),member6 7967.98E-005-1.23231859_atC14orf132chromosome14openreadingframe132 7977.81E-005-1.25228277_atFBXL19F-boxandleucine-richrepeatprotein19 7987.75E-005-1.35210470_x_atNONOnon-POUdomaincontaining,octamer-binding 7997.52E-005-1.29222432_s_atCCDC47coiled-coildomaincontaining47 8007.19E-005-1.8238496_atNANA 8017.11E-005-1.38208698_s_atNONOnon-POUdomaincontaining,octamer-binding 8027.08E-005-4.66203946_s_atARG2arginase,typeII 8037.03E-005-1.171559952_x_atLOC100132923similartohCG1993470 8046.19E-005-2.35220104_atZC3HAV1zincfingerCCCH-type,antiviral1 8055.57E-005-2.43203595_s_atIFIT5interferon-inducedproteinwithtetratricopeptiderepeats5 8065.53E-005-1.331569859_atNANA 8075.31E-005-1.5224359_s_atHOOK3hookhomolog3(Drosophila) 8084.19E-005-2.51205921_s_atSLC6A6solutecarrierfamily6(neurotransmittertransporter,taurine),member6 8093.18E-005-2.18205749_atCYP1A1cytochromeP450,family1,subfamilyA,polypeptide1 8102.93E-005-1.381566136_atNANA 8112.02E-005-1.51210992_x_atFCGR2CFcfragmentofIgG,lowaffinityIIc,receptorfor(CD32) 8121.61E-005-1.22207801_s_atRNF10ringfingerprotein10 8131.32E-005-2.03222816_s_atZCCHC2zincfinger,CCHCdomaincontaining2 8141.29E-005-1.25211884_s_atCIITAclassII,majorhistocompatibilitycomplex,transactivator 8158.60E-006-1.68212664_atTUBB4tubulin,beta4 8164.60E-006-1.16212081_x_atBAT2HLA-Bassociatedtranscript2 8173.60E-006-1.211554177_a_atATP5SATPsynthase,H+transporting,mitochondrialF0complex,subunits (factorB) 8187.00E-007-1.82224783_atFAM100Bfamilywithsequencesimilarity100,memberB 8196.00E-007-1.57208840_s_atG3BP2GTPaseactivatingprotein(SH3domain)bindingprotein2 8204.00E-007-1.59206717_atMYH8myosin,heavychain8,skeletalmuscle,perinatal Chauncey etal.BMCImmunology 2012, 13 :33 Page22of26 http://www.biomedcentral.com/1471-2172/13/33

PAGE 23

RANTESandMIP.Thedown-regulationofCCR5by LTcouldreflectaninabilityoftoxin-treatedmonocytes todifferentiateintomacrophages[28](Table2).During theearlystagesofinfection,macrophagesplayacritical roleinassisting B.anthracis pathogenesisbyproviding aplaceforbacteriagerminationfromtheirsporeform toviablebacteria.Anincreaseinmonocytetraffickingto allowanincreaseinsporeuptakeandsubsequentgerminationwouldprovebeneficialfor B.anthracis .Duringlater stagesofinfection,afterreleaseofviablebacteria,limiting monocytedifferentiationtomacrophageswouldassistin preventingclearanceofviablebacteria. Inadditiontoanalterationinthechemokineresponse byLT,anadditionalenzyme,heparanase(HPSE),was foundtobedecreasedinLT-treatedhumanmonocytes. Thisenzymeisanendoglycosidasethatdegradesheparin sulfate,resultingindisassemblyofextracellularbarriers requiredforcellmigration[29].Heparanasehasalsobeen postulatedtoplayaroleininflammation[30]andour resultsshoweda2.6folddecreaseinheparanasegeneexpression(Table2).Onestudyhasconcludedthatan invivo siRNAagainstheparanase,alongwithaninhibitor ofitsenzymaticactivity,resultsinadiminishedinflammatoryresponse[31].ThusLT-mediatedinhibitionofheparanaseexpressioncouldalsocontributetotheinhibitionof thehostimmuneresponseduringananthraxinfection. C CCCT TTT-2.0 2.0 0Control r4 Control r3 Control r1 Control r2 Toxin r1 Toxin r2 Toxin r3 Toxin r4(A)(B) h_mapkPathwayMAPKinaseSignaling Pathway2280.00001 h_p38mapkPathwayp38 MAPK Signaling Pathway 1030.00001 h_il18PathwayIL 18 Signaling Pathway90.00004 h_tollPathwayToll-Like Receptor Pathway870.00028 h_ifnaPathwayIFN alpha signaling pathway250.00043 h_gpcrPathwaySignaling Pathway from G-Protein Families700.00044 h_p53hypoxiaPathwayHypoxia and p53 in the Cardiovascular system670.00191h_arenrf2PathwayOxidative Stress Induced Gene Expression Via Nrf2510.00418Biocarta# of Pathway Description PathwaygenesP-value (C) Figure3 Supervisedmicroarrayanalysis.A.) Hierarchicalclusteranalysisshowingthe820probesetswhichweredifferentiallyexpressedat the0.001significancelevel.Thearraysclusteringontheleftarefromcontrolsamples,whereastheclusterontherightshowstheLTtreated samples.Up-regulatedgenesareshowninredanddown-regulatedgenesareshowninblue. B.) Biocartapathwayanalysisshowingthe pathwaysmostsignificantlyaffectedbyLT,alongwiththenumberofgenesandp-valuewithineachpathwaythatwereaffected. C.) Correlation ofgenesalteredaftertreatmentwithanthraxLTusingmicroarrayanalysisversusRT-PCR.Spearmancorrelationcoefficient=0.885. Table2PredictedeffectsofLTonmonocytefunction.1GeneMicroarrayEffects RGS-145.61Blockadeofmonocytematurationtodendritic cells,inhibitionofchemotaxis CXCR25.04Increasedmonocytetransendothelialmigration intotissues HPSE-2.58Diminishedinflammatoryresponse CCR5-2.33Reducedresponsivenesstotheinflammatory mediatorsRANTES,MIP1beta ILIR2-12.5IncreasedIL1alpharesponsivenessand increasedfever1Calculatedfoldchangescomparedtomocktreatedsamples.Chauncey etal.BMCImmunology 2012, 13 :33 Page23of26 http://www.biomedcentral.com/1471-2172/13/33

PAGE 24

Anexternalverificationmethodusingquantitative real-timePCRwasutilizedtoconfirmthemicroarray data.TheeightgenescorrespondingtoRGS14,IL8RB, TLR5,PPM1H,CD47,SYK,CCR5,andIL1R2were chosenformicroarrayconfirmationinmonocytes.CCR5 andIL1R2wereconfirmedtobedown-regulatedat4h afterLTtreatment,reinforcingthemicroarraydata, whiletheothersixgeneswereup-regulated,againconfirmingthemicroarraydata(Table3).Acorrelation curvewasplotted(Figure3C)andanalyzed,showinga linearrelationshipbetweenthemicroarrayresultsand RT-PCRwithacorrelationcoefficientof0.885.Results wereperformedinduplicatesandfoldvalueswere normalizedtoGAPDH.Toexcludethepossibilitythe lymphocytecontaminationmightbecontributingtoour microarrayfindings,ahigherpuritymonocytepopulation(98%purity),obtainedbyadherencefollowedby washingoffnon-adherentlymphocytes,wastreatedwith 500ng/mLLTfor4handgeneexpressionwasassessed usingreal-timePCR.Theseexperimentsverified3genes tobeincreasedafterLTtreatment:RGS14,TLR5,and CD47(1.21-1.70),asobservedbythemicroarrayofsuspendedcells.Thesefindingssuggestthatthechangesin messengerRNAobservedareprimarilycontributedby monocytes,butwecannotentirelyexcludeacontributionbylymphocytes.ConclusionsOurinvestigationsshowhumanperipheralmonocytes aresusceptibletotheactionsofanthraxLTanddonot undergoLT-mediatedcytotoxicityafterafourhourtoxin treatment.WealsofindthatLTinduceschangesinseveralgenesinvolvedinpreviouslyunidentifiedpathways includingtheTLRpathway,IFNalphapathway,andGProteinfamilysignalingpathways.Theidentificationof severalpreviouslyunappreciatedgeneproductsincludingRGS14,IL8receptorbeta,CD47,TNFligand,IL-16, Syk,CCR5,andIL-1receptorIIaddstoourunderstandingofhowLTimpactstheimmuneresponse.OurpathwayanalysisrevealsthatanthraxLTtargetsmultiple normalimmune-regulatorypathwaysthatwouldbe expectedtoprotectthehostagainstanthraxinfection. TheincreaseinRGS14levelsanddecreaseinCCR5, alongwithIL-1R2,wouldlikelyimpairmonocytefunctionsandhelptofacilitatebacteriasurvival. B.anthracis maintainsaselectiveadvantagebyimpairingthehost immuneresponses,therebyallowingforinvasionand disseminationofthehighlyfatalbacilli.Ourfindingsencouragefurtherinvestigationsintohowthesepathways convergefunctionallytoimpairnormalmonocytefunction,alongwithprovidingnewinsightsintotheregulationofthehostdefensesystemandinflammation.MethodsMonocyteisolationandtoxintreatmentWholebloodwascollectedbyvenouspuncturefrom healthyhumanvolunteersinto8mLvacutainertubescontainingFicoll(BDBiosciences).ThestudyfollowedUS DepartmentofHealthandHumanServicesguidelinesand wasapprovedbytheUniversityofFloridaInstitutionalReviewBoard.Wholebloodwasincubatedwithamonocyte negativeselectionantibody(StemCellTechnologies)for Table3q-RTPCRconfirmationofLT-inducedgenes.1ProbeMicroarrayq-RT-PCRGenenamePrimersequence 38290_at5.617.40RGS14-FCAGGGATCTGTGAGAAACGAG RGS14-RAGGTGATCCTGTTTTCCAGC 207008_at5.047.50IL8RB-FGTCTAACAGCTCTGACTACCAC L8RB-RTTAAATCCTGACTGGGTCGC 210166_at3.902.24TLR5-FTTTTCAGGAGCCCGAGC TLR5-RAGCCGAGATTGTGTCACTG 212686_at2.653.85PPM1H-FGAGTACAGAGAAAGGAGCTTGG PPM1H-RTCCAATAGTTGCCATTACCCG 226016_at2.381.60CD47-FTTTGCTATACTCCTGTTCTGGG CD47-RTGGGACGAAAAGAATGGCTC 209269_at2.151.60SYK-FCAAGTTCTCCAGCAAAAGCG SYK-RCATCCGCTCTCCTTTCTCTAAC 206991_at-2.66-2.33CCR5-FCCAAAAGCACATTGCCAAACG CCR5-RACTTGAGTCCGTGTCACAAGCC 205403_at-12.5-28.0IL1R2-FTGGCACCTACGTCTGCACTACT IL1R2-RTTGCGGGTATGAGATGAACG1Calculatedfoldchangescomparedtomocktreatedsamples.Chauncey etal.BMCImmunology 2012, 13 :33 Page24of26 http://www.biomedcentral.com/1471-2172/13/33

PAGE 25

20min.,centrifuged1700gfor25minatRT,nobrake overFicoll,re-suspendedin10mLRPMI(Mediatech) completemedia,centrifugedat250gfor9min.toremoveplatelets,andre-suspendedto7-9105cells/mLin RPMI.Monocyteswereinvertedat37Cwith500ng/mL LFand500ng/mLPAfor4h.AdditionalqRT-PCR experimentswereperformedusinghighermonocyte purities(98%),obtainedbyfirstusinganegativeselection antibodycocktail(StemCellTechnologies)isolationtechnique,followedbyplasticadherencefor4h,asdescribed previously[32].ToxinpurificationLFandPAwerepurifiedaspreviouslydescribed[33]. Briefly, Bacillusanthracis culturemediawasfiltered througha0.22uMfilter,followedbydiethylaminoethyl cellulose(DEAE)anionexchangechromatography.The toxinswerethensubjectedtogelfiltrationandhydrophobicinteractionfastproteinliquidchromatography (FPLC)andhighlypurifiedtoxincomponentswereconfirmedbyCoomassieBluestaining.MonocytepurityandapoptosisanalysisMonocyteswereinvertedat37Cwith500ng/mLLFand 500ng/mLPAfor4h,stainedwithCD-14PacBlue(BD Biosciences),Annexin-V-Fluoresceinandpropidium iodide(Roche).Thecellpopulationwasgatedfirstfor CD14-Pac-Bluefollowedbyanalysisoftherelative amountofAnnexin(FL1)andPI(FL2)usingflowcytometryFACScan(BD),andanalyzedbyFCSExpress (DeNovo).MEKcleavagePurifiedmonocyteswereincubatedat37Cwith500ng/ mLlethaltoxinfor4h.Cellswerelysed,ranona10% SDS-PAGEgel(Pierce),transferredtoaPVDFmembrane(Bio-rad)andprobedforMEK1(Upstate).MembraneswerethenstrippedandprobedforMEK3(Santa Cruz). -actin(Sigma)wasusedtocheckconsistent loadingamounts.RNAisolationPurifiedmonocytesfrom4healthyvolunteerswereincubatedat37Cwithmediaaloneorwith500ng/mLLT for4h.TotalRNAwascollectedusingRNAeasymini kit(Qiagen)andRNAquantityandqualitywasassessed usingNanoDrop(ThermoScientific)technology.Microarrayprocedure100ngtotalRNAwaslabeledusingAffymetrixGeneChipW3'IVTExpressKitforeachreplicate.Amplified labeledRNAwaspurified,fragmented,thenhybridized for16honAffymetrixGeneChipsW(HGU133plus2.0) representingapproximately22,000well-characterized humangenes.ArrayswerewashedusingAffymetrix GeneChipWFluidicsStationFS450andscannedusing GeneChipWScanner30007G.MicroarrayanalysisLow-levelanalysiswasperformedusingdChipmodeledbasedexpressionmatrix(dChip2007(DNA-Chip Analyzer),Builddate:Jan4,2008).Unsupervisedanalysis -probessetswhosehybridizationsignalintensityexhibitedacoefficientofvariationofgreaterthan0.5wereanalyzedbyunsupervisedhierarchicalclusteranalysisusing algorithmsimplementedindChip.Supervisedanalysissignificantprobesetsbetweenthetreatmentgroupswere identifiedusingapaired t -test(bydonor)atasignificance thresholdofp < 0.001.Leave-one-out-cross-validation using4predictionmodelswasusedtotesttheabilityof probesetssignificantatp < 0.001todistinguishbetween thetreatmentgroups.Microarrayanalysesweredone usingdCHIPandBRB-ArrayToolsbyRichardSimon (http://linus.nci.nih.gov/BRB -ArrayTools.html).ThemicroarraydataforthisstudywasdepositedintheNationalCenterforBiotechnologyInformation(NCBI)GeneExpression Omnibus(GEO)[30]withaccessionnumbersGSM848717 throughGSM848724.Themicroarraydataisalsoavailable inaserieswithaccessionnumberGSE34407.Quantitativerealtime-PCR(qRT-PCR)RNAwascollectedusingRNAeasyminikit(Qiagen), quantitatedusingaNanodropsystem(ThermoScientific), and233 gtotalRNAwasusedforcDNAsynthesisusing SuperScriptIIIFirst-StrandSynthesis(Invitrogen).cDNA wasquantitatedusingSYBRGreenJumpStartTaqReadyMix(Sigma)and10mMforwardand10mMreverseprimerswereusedforeachindicatedreaction.Primersused wereasfollowsACTB-FTCACCGAGCGCGGCT,ACTBRTAATGTCACGCACGATTTCCC,GAPDH-FGGTGAA GGTCGGAGTCAACG,andGAPDH-RAGAGTTAAAA GCAGCCCTGGTG.AllotherprimersarelistedinTable2. ReactionswererunontheMJROpticonContinuousFluorescencedetector(Bio-Rad)andanalyzedwithOpticon MonitorSoftware1.08(Bio-Rad).Authors ’ contributions KCperformedtheexperiments,analyzeddata,interpretedstudy,drafted,and wrotethemanuscript.CLperformedthegeneexpressionprofiling, biostatisticalanalysis,andhelpeddesignthestudy.SZparticipatedinthe studydesignandassistedwithexperiments.GSparticipatedinthedesign andinterpretationofthestudy,aswellaseditedthemanuscript.HB participatedinthedesignandanalysesofthestudy.CQsuppliedthe purifiedtoxinandassistedindatainterpretation.FSconceivedthestudyand participatedinthedesignandcoordination,aswellaseditedthe manuscript.Allauthorsreadandapprovedthefinalmanuscript. Acknowledgements WethankDr.LyleMoldawerforhisguidanceandassistanceintheflow cytometryanalysis.ThestudywassupportedbytheNationalInstitutesof HealthRO1AI064891.Publicationofthisarticlewasfundedinpartbythe UniversityofFloridaOpen-AccessPublishingFund.Chauncey etal.BMCImmunology 2012, 13 :33 Page25of26 http://www.biomedcentral.com/1471-2172/13/33

PAGE 26

Authordetails1DepartmentofMedicine,UniversityofFloridaCollegeofMedicine, GainesvilleFL32610,USA.2USA,DepartmentofMolecularGeneticsand Microbiology,UniversityofFlorida,Gainesville,FL32610,USA.3Centersfor DiseaseControlandPrevention,Atlanta,GA30333,USA. Received:29November2011Accepted:18April2012 Published:2July2012 References1.FukaoT: Immunesystemparalysisbyanthraxlethaltoxin:therolesof innateandadaptiveimmunity. LancetInfectDis 2004, 4: 166 – 170. 2.MockM,FouetA: Anthrax. AnnuRevMicrobiol 2001, 55: 647 – 671. 3.CollierRJ,YoungJA: Anthraxtoxin. AnnuRevCellDevBiol 2003, 19: 45 – 70. 4.PellizzariR,Guidi-RontaniC,VitaleG,MockM,MontecuccoC: Lethalfactor ofBacillusanthraciscleavestheN-terminusofMAPKKs:analysisofthe intracellularconsequencesinmacrophages. IntJMedMicrobiol 2000, 290: 421 – 427. 5.DuesberyNS,WebbCP,LepplaSH,GordonVM,KlimpelKR,CopelandTD, AhnNG,OskarssonMK,FukasawaK,PaullKD, etal : Proteolyticinactivation ofMAP-kinase-kinasebyanthraxlethalfactor. Science 1998, 280: 734 – 737. 6.LepplaSH: Anthraxtoxinedemafactor:abacterialadenylatecyclasethat increasescyclicAMPconcentrationsofeukaryoticcells. ProcNatlAcadSci USA 1982, 79: 3162 – 3166. 7.HannaPC,AcostaD,CollierRJ: Ontheroleofmacrophagesinanthrax. ProcNatlAcadSciUSA 1993, 90: 10198 – 10201. 8.HannaPC,KruskalBA,EzekowitzRA,BloomBR,CollierRJ: Roleof macrophageoxidativeburstintheactionofanthraxlethaltoxin. MolMed 1994, 1: 7 – 18. 9.PopovSG,VillasmilR,BernardiJ,GreneE,CardwellJ,PopovaT,WuA, AlibekD,BaileyC,AlibekK: EffectofBacillusanthracislethaltoxinon humanperipheralbloodmononuclearcells. FEBSLett 2002, 527: 211 – 215. 10.KassamA,DerSD,MogridgeJ: Differentiationofhumanmonocyticcell linesconferssusceptibilitytoBacillusanthracislethaltoxin. CellMicrobiol 2005, 7: 281 – 292. 11.Stearns-KurosawaDJ,LupuF,TaylorFBJr,KinasewitzG,KurosawaS: Sepsis andpathophysiologyofanthraxinanonhumanprimatemodel. AmJ Pathol 2006, 169: 433– 444. 12.GuarnerJ,JerniganJA,ShiehWJ,TattiK,FlannaganLM,StephensDS, PopovicT,AshfordDA,PerkinsBA,ZakiSR: Pathologyandpathogenesisof bioterrorism-relatedinhalationalanthrax. AmJPathol 2003, 163: 701 – 709. 13.TwenhafelNA,LeffelE,PittML: Pathologyofinhalationalanthraxinfection intheafricangreenmonkey. VetPathol 2007, 44: 716 – 721. 14.WuW,MehtaH,ChakrabartyK,BoothJL,DugganES,PatelKB,BallardJD, CoggeshallKM,MetcalfJP: Resistanceofhumanalveolarmacrophagesto Bacillusanthracislethaltoxin. JImmunol 2009, 183: 5799 – 5806. 15.ComerJE,GalindoCL,ChopraAK,PetersonJW: GeneChipanalysesof globaltranscriptionalresponsesofmurinemacrophagestothelethal toxinofBacillusanthracis. InfectImmun 2005, 73: 1879 – 1885. 16.MestersRM,FlorkeN,OstermannH,KienastJ: Increaseofplasminogen activatorinhibitorlevelspredictsoutcomeofleukocytopenicpatients withsepsis. ThrombHaemost 1996, 75: 902 – 907. 17.BradburneC,ChungMC,ZongQ,SchlauchK,LiuD,PopovaT,PopovaA, BaileyC,SoppetD,PopovS: Transcriptionalandapoptoticresponsesof THP-1cellstochallengewithtoxigenic,andnon-toxigenicBacillus anthracis. BMCImmunol 2008, 9: 67. 18.SerbinaNV,JiaT,HohlTM,PamerEG: Monocyte-mediateddefense againstmicrobialpathogens. AnnuRevImmunol 2008, 26: 421 – 452. 19.MosserDM: Themanyfacesofmacrophageactivation. JLeukocBiol 2003, 73: 209 – 212. 20.KoskiGK,LyakhLA,RiceNR: Rapidlipopolysaccharide-induceddifferentiation ofCD14(+)monocytesintoCD83(+)de ndriticcellsismodulatedunder serum-freeconditionsbyexogenouslyaddedIFN-gammaandendogenously producedIL-10. EurJImmunol 2001, 31: 3773 – 3781. 21.vanFurthR: Originandturnoverofmonocytesandmacrophages. Curr TopPathol 1989, 79: 125 – 150. 22.DozmorovM,WuW,ChakrabartyK,BoothJL,HurstRE,CoggeshallKM, MetcalfJP: Geneexpressionprofilingofhumanalveolarmacrophages infectedbyB.anthracissporesdemonstratesTNF-alphaandNF-kappab arekeycomponentsoftheinnateimmuneresponsetothepathogen. BMCInfectDis 2009,9: 152. 23.DuringRL,GibsonBG,LiW,BishaiEA,SidhuGS,LandryJ,SouthwickFS: Anthraxlethaltoxinparalyzesactin-basedmotilitybyblockingHsp27 phosphorylation. EMBOJ 2007, 26: 2240 – 2250. 24.ShiGX,HarrisonK,HanSB,MoratzC,KehrlJH: Toll-likereceptorsignaling alterstheexpressionofregulatorofGproteinsignalingproteinsin dendriticcells:implicationsforGprotein-coupledreceptorsignaling. JImmunol 2004, 172: 5175 – 5184. 25.ChaussabelD,SemnaniRT,McDowellMA,SacksD,SherA,NutmanTB: Uniquegeneexpressionprofilesofhumanmacrophagesanddendritic cellstophylogeneticallydistinctparasites. Blood 2003, 102: 672 – 681. 26.ColottaF,ReF,MuzioM,BertiniR,PolentaruttiN,SironiM,GiriJG,Dower SK,SimsJE,MantovaniA: Interleukin-1typeIIreceptor:adecoytargetfor IL-1thatisregulatedbyIL-4. Science 1993, 261: 472 – 475. 27.JerniganDB,RaghunathanPL,BellBP,BrechnerR,BresnitzEA,ButlerJC,Cetron M,CohenM,DoyleT,FischerM, etal : Investigationofbioterrorism-related anthrax,UnitedStates,2001:epidemiologicfindings. EmergInfectDis 2002, 8: 1019 – 1028. 28.TuttleDL,HarrisonJK,AndersC,SleasmanJW,GoodenowMM: Expression ofCCR5increasesduringmonocytedifferentiationanddirectlymediates macrophagesusceptibilitytoinfectionbyhumanimmunodeficiency virustype1. JVirol 1998, 72: 4962 – 4969. 29.VlodavskyI,EldorA,Haimovitz-FriedmanA,MatznerY,Ishai-MichaeliR,Lider O,NaparstekY,CohenIR,FuksZ: Expressionofheparanasebyplatelets andcirculatingcellsoftheimmunesystem:possibleinvolvementin diapedesisandextravasation. InvasionMetastasis 1992, 12: 112 – 127. 30.VadayGG,LiderO: Extracellularmatrixmoieties,cytokines,andenzymes: dynamiceffectsonimmunecellbehaviorandinflammation. JLeukocBiol 2000, 67: 149 – 159. 31.EdovitskyE,LernerI,ZchariaE,PeretzT,VlodavskyI,ElkinM: Roleof endothelialheparanaseindelayed-typehypersensitivity. Blood 2006, 107: 3609 – 3616. 32.ElkordE,WilliamsPE,KynastonH,RowbottomAW: Humanmonocyte isolationmethodsinfluencecytokineproductionfrominvitrogenerated dendriticcells. Immunology 2005, 114: 204 – 212. 33.QuinnCP,ShoneCC,TurnbullPC,MellingJ: Purificationofanthrax-toxincomponentsbyhigh-performanceanion-exchange,gel-filtrationand hydrophobic-interactionchromatography. BiochemJ 1988, 252: 753 – 758.doi:10.1186/1471-2172-13-33 Citethisarticleas: Chauncey etal. : Bacillusanthracis ’ lethaltoxin inducesbroadtranscriptionalresponsesinhumanperipheral monocytes. BMCImmunology 2012 13 :33. Submit your next manuscript to BioMed Central and take full advantage of: € Convenient online submission € Thorough peer review € No space constraints or color “gure charges € Immediate publication on acceptance € Inclusion in PubMed, CAS, Scopus and Google Scholar € Research which is freely available for redistribution Submit your manuscript at www.biomedcentral.com/submit Chauncey etal.BMCImmunology 2012, 13 :33 Page26of26 http://www.biomedcentral.com/1471-2172/13/33


xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E69JU8GJW_9S2QN7 INGEST_TIME 2013-01-22T13:57:39Z PACKAGE AA00013224_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES


xml version 1.0 encoding utf-8 standalone no
mets ID sort-mets_mets OBJID sword-mets LABEL DSpace SWORD Item PROFILE METS SIP Profile xmlns http:www.loc.govMETS
xmlns:xlink http:www.w3.org1999xlink xmlns:xsi http:www.w3.org2001XMLSchema-instance
xsi:schemaLocation http:www.loc.govstandardsmetsmets.xsd
metsHdr CREATEDATE 2012-10-18T16:07:19
agent ROLE CUSTODIAN TYPE ORGANIZATION
name BioMed Central
dmdSec sword-mets-dmd-1 GROUPID sword-mets-dmd-1_group-1
mdWrap SWAP Metadata MDTYPE OTHER OTHERMDTYPE EPDCX MIMETYPE textxml
xmlData
epdcx:descriptionSet xmlns:epdcx http:purl.orgeprintepdcx2006-11-16 xmlns:MIOJAVI
http:purl.orgeprintepdcxxsd2006-11-16epdcx.xsd
epdcx:description epdcx:resourceId sword-mets-epdcx-1
epdcx:statement epdcx:propertyURI http:purl.orgdcelements1.1type epdcx:valueURI http:purl.orgeprintentityTypeScholarlyWork
http:purl.orgdcelements1.1title
epdcx:valueString Bacillus anthracis lethal toxin induces
broad transcriptional responses in human
peripheral monocytes
http:purl.orgdctermsabstract
Abstract
Background
Anthrax lethal toxin (LT), produced by the Gram-positive bacterium Bacillus anthracis, is a highly effective zinc dependent metalloprotease that cleaves the N-terminus of mitogen-activated protein kinase kinases (MAPKK or MEKs) and is known to play a role in impairing the host immune system during an inhalation anthrax infection. Here, we present the transcriptional responses of LT treated human monocytes in order to further elucidate the mechanisms of LT inhibition on the host immune system.
Results
Western Blot analysis demonstrated cleavage of endogenous MEK1 and MEK3 when human monocytes were treated with 500 ng/mL LT for four hours, proving their susceptibility to anthrax lethal toxin. Furthermore, staining with annexin V and propidium iodide revealed that LT treatment did not induce human peripheral monocyte apoptosis or necrosis. Using Affymetrix Human Genome U133 Plus 2.0 Arrays, we identified over 820 probe sets differentially regulated after LT treatment at the p <0.001 significance level, interrupting the normal transduction of over 60 known pathways. As expected, the MAPKK signaling pathway was most drastically affected by LT, but numerous genes outside the well-recognized pathways were also influenced by LT including the IL-18 signaling pathway, Toll-like receptor pathway and the IFN alpha signaling pathway. Multiple genes involved in actin regulation, signal transduction, transcriptional regulation and cytokine signaling were identified after treatment with anthrax LT.
Conclusion
We conclude LT directly targets human peripheral monocytes and causes multiple aberrant gene responses that would be expected to be associated with defects in human monocyte’s normal signaling transduction pathways and function. This study provides further insights into the mechanisms associated with the host immune system collapse during an anthrax infection, and suggests that anthrax LT may have additional downstream targets outside the well-known MAPK pathway.
http:purl.orgdcelements1.1creator
Chauncey, Kassidy M
Lopez, M C
Sidhu, Gurjit
Szarowicz, Sarah E
Baker, Henry V
Quinn, Conrad
Southwick, Frederick S
http:purl.orgeprinttermsisExpressedAs epdcx:valueRef sword-mets-expr-1
http:purl.orgeprintentityTypeExpression
http:purl.orgdcelements1.1language epdcx:vesURI http:purl.orgdctermsRFC3066
en
http:purl.orgeprinttermsType
http:purl.orgeprinttypeJournalArticle
http:purl.orgdctermsavailable
epdcx:sesURI http:purl.orgdctermsW3CDTF 2012-07-02
http:purl.orgdcelements1.1publisher
BioMed Central Ltd
http:purl.orgeprinttermsstatus http:purl.orgeprinttermsStatus
http:purl.orgeprintstatusPeerReviewed
http:purl.orgeprinttermscopyrightHolder
Kassidy M Chauncey et al.; licensee BioMed Central Ltd.
http:purl.orgdctermslicense
http://creativecommons.org/licenses/by/2.0
http:purl.orgdctermsaccessRights http:purl.orgeprinttermsAccessRights
http:purl.orgeprintaccessRightsOpenAccess
http:purl.orgeprinttermsbibliographicCitation
BMC Immunology. 2012 Jul 02;13(1):33
http:purl.orgdcelements1.1identifier
http:purl.orgdctermsURI http://dx.doi.org/10.1186/1471-2172-13-33
fileSec
fileGrp sword-mets-fgrp-1 USE CONTENT
file sword-mets-fgid-0 sword-mets-file-1
FLocat LOCTYPE URL xlink:href 1471-2172-13-33.xml
sword-mets-fgid-1 sword-mets-file-2 applicationpdf
1471-2172-13-33.pdf
structMap sword-mets-struct-1 structure LOGICAL
div sword-mets-div-1 DMDID Object
sword-mets-div-2 File
fptr FILEID
sword-mets-div-3


!DOCTYPE art SYSTEM 'http:www.biomedcentral.comxmlarticle.dtd'
ui 1471-2172-13-33
ji 1471-2172
fm
dochead Research article
bibl
title
p
it Bacillus anthracis’ lethal toxin induces broad transcriptional responses in human peripheral monocytes
aug
au id A1 snm Chaunceymi Mfnm Kassidyinsr iid I1 email kassidy@ufl.edu
A2 Lopezmnm CeciliaMI2 mclopez@ufl.edu
A3 SidhuGurjitgssidhu@ufl.edu
A4 SzarowiczESarahsguilmai@ufl.edu
A5 BakerVHenryhvbaker@ufl.edu
A6 QuinnConradI3 cquinn@cdc.gov
A7 ca yes SouthwickSFredericksouthfs@medicine.ufl.edu
insg
ins Department of Medicine, University of Florida College of Medicine, Gainesville, FL, 32610, USA
USA, Department of Molecular Genetics and Microbiology, University of Florida, Gainesville, FL, 32610, USA
Centers for Disease Control and Prevention, Atlanta, GA, 30333, USA
source BMC Immunology
section Cellular immunology and immune regulationissn 1471-2172
pubdate 2012
volume 13
issue 1
fpage 33
url http://www.biomedcentral.com/1471-2172/13/33
xrefbib pubidlist pubid idtype doi 10.1186/1471-2172-13-33pmpid 22747600
history rec date day 29month 11year 2011acc 1842012pub 272012
cpyrt 2012collab Chauncey et al.; licensee BioMed Central Ltd.note This is an Open Access article distributed under the terms of the Creative Commons Attribution License (
http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
abs
sec
st
Abstract
Background
Anthrax lethal toxin (LT), produced by the Gram-positive bacterium Bacillus anthracis, is a highly effective zinc dependent metalloprotease that cleaves the N-terminus of mitogen-activated protein kinase kinases (MAPKK or MEKs) and is known to play a role in impairing the host immune system during an inhalation anthrax infection. Here, we present the transcriptional responses of LT treated human monocytes in order to further elucidate the mechanisms of LT inhibition on the host immune system.
Results
Western Blot analysis demonstrated cleavage of endogenous MEK1 and MEK3 when human monocytes were treated with 500 ng/mL LT for four hours, proving their susceptibility to anthrax lethal toxin. Furthermore, staining with annexin V and propidium iodide revealed that LT treatment did not induce human peripheral monocyte apoptosis or necrosis. Using Affymetrix Human Genome U133 Plus 2.0 Arrays, we identified over 820 probe sets differentially regulated after LT treatment at the p <0.001 significance level, interrupting the normal transduction of over 60 known pathways. As expected, the MAPKK signaling pathway was most drastically affected by LT, but numerous genes outside the well-recognized pathways were also influenced by LT including the IL-18 signaling pathway, Toll-like receptor pathway and the IFN alpha signaling pathway. Multiple genes involved in actin regulation, signal transduction, transcriptional regulation and cytokine signaling were identified after treatment with anthrax LT.
Conclusion
We conclude LT directly targets human peripheral monocytes and causes multiple aberrant gene responses that would be expected to be associated with defects in human monocyte’s normal signaling transduction pathways and function. This study provides further insights into the mechanisms associated with the host immune system collapse during an anthrax infection, and suggests that anthrax LT may have additional downstream targets outside the well-known MAPK pathway.
bdy
Background
Bacillus anthracis, the causative agent of anthrax, is a gram-positive bacterium that is naturally found in the soil, and rarely affects the human population. Unfortunately, deliberate dissemination of anthrax spores is capable of delivering a highly potent and lethal air-borne bioterrorist agent, as documented in the 2001 U.S. anthrax attacks. Inhalation anthrax is a highly fatal, acute disease characterized by a rapid onset of systemic shock and ultimately death
abbrgrp
abbr bid B1 1
.
The most virulent strains of B. anthracis contain two plasmids, pXO2 and pXO1, encoding an antiphagocytic poly-D-glutamic acid capsule and three exotoxins: lethal factor, edema factor and protective antigen
B2 2
. Protective antigen is an 83 kDa protein that is known to bind to two host cell receptors, TEM-8 and CMG-2, facilitating the entry of edema and/or lethal factor into host cells
B3 3
. Lethal factor is a 90 kDa zinc-dependent metalloprotease that cleaves the N-terminus of mitogen-activated protein kinase kinases (MAPKKs or MEKs)
B4 4
B5 5
. Edema factor is an 89 kDa adenylate cyclase that increases intracellular cAMP levels
B6 6
.
Previous studies using anthrax animal models have documented resistance to anthrax lethal toxin (LT) through depletion of host macrophages, suggesting that these cells play a critical role in anthrax LT induced lethality
B7 7
B8 8
. LT has also been shown to suppress cytokine responses by peripheral blood mononuclear cells, induce macrophage apoptosis, and prevent monocyte proliferation and differentiation
1
B9 9
B10 10
. Inhalation anthrax cases present clinical manifestations indicative of host immune collapse in humans and in nonhuman primate studies
B11 11
B12 12
B13 13
. However, more recent studies investigating human monocytes and macrophages have suggested human alveolar macrophages are resistant to LT, and undifferentiated human monocytic cell lines are resistant to LT-induced death
10
B14 14
. LT’s targeting of human monocytes/macrophages could help to explain the rapid onset of fatal symptoms and host demise during an inhalation anthrax infection, but the exact effects LT exerts on human peripheral monocytes, along with the mechanisms underlying the impairment of the host immune cell’s responses, have yet to be fully determined.
Previous studies investigating LT treated murine macrophages have shown a broad range in transcriptional effects induced by LT. These studies concluded LT-induced changes in macrophage inflammation, signaling, and transcription factors, along with changes in the immune response by macrophages. This study discovered the down regulation of CD-137 after LT treatment, shown to play a role in monocyte proliferation in response to LPS, and up regulation of plasminogen activator inhibitor type I, which results in fibrin deposits, massive imbalances in coagulation, and, in some instances, multi-organ failure
B15 15
B16 16
. Another study has measured the transcriptional responses of THP-1 cells after B. anthracis spore exposure, finding toxigenic B. anthracis strains suppress the cell signaling responses to infection
B17 17
.
Blood monocytes are mononuclear cells that play a major role in the host immune response through regulation of inflammatory responses, secretion of cytokine and antimicrobial factors, and direct pathogen clearance
B18 18
. Monocytes are derived from monoblasts in the bone marrow, and circulate in the blood for 1-2 days before they migrate into tissues where they replenish the macrophage and dendritic pools
B19 19
B20 20
B21 21
. Here, we determined human monocyte susceptibility to LT by demonstrating cleavage of MEKs, and utilized Affymetrix GeneChip® Human Genome U133 Plus 2.0 Arrays in order to identify additional mechanisms of LT impairment on the transcriptional responses of human peripheral monocytes. The arrays contained 54,675 probe sets representing over 22,000 of the best characterized human genes, providing extensive insights into the mechanisms behind LT induced dysfunction of human peripheral monocytes.
This study is the first to determine direct human monocyte susceptibility via cleavage of MEKs, along with the analysis of the transcriptional responses, to anthrax LT. The mechanisms of LT impairment on human peripheral monocytes will help elucidate the roles monocytes contribute during the host immune system collapse documented during an anthrax infection. The transcriptional analysis will serve to not only unravel the mechanisms behind the rapid onset of death in anthrax victims, but will also potentially provide new targets for controlling inflammation and enhancing host defense.
Results and discussion
Monocyte purity, apoptosis and susceptibility to anthrax LT
In order to first determine monocyte cell purity, isolated cells were analyzed using flow cytometry and gated using forward and side scatter, along with the monocytic marker, CD14. It was found that monocytes were isolated with a >85% purity (Figure 
figr fid F1 1A and
1B). Because previous reports have documented LT induced cell apoptosis, it was important to assure the transcriptional response of LT treated monocytes were independent of apoptosis. This was assured by the analysis of the necrosis and apoptosis markers, propidium iodide (PI) and annexin V, on human peripheral monocytes. Nearly all (99%) human peripheral monocytes showed no evidence of necrosis or apoptosis after a 4 h treatment of LT (Figure 
1C and
1D). There has been some conflicting data suggesting monocytes, along with monocyte-derived cells, are not susceptible to the actions of anthrax LT. One study utilized human monocytic cell lines and found that undifferentiated monocytic cells did not undergo LT-induced cytotoxicity, while the differentiated cells were susceptible
10
. Another study investigating human alveolar macrophages (AM) found that these cells were relatively resistant to the actions of LT. It was ascertained that LT failed to suppress human AM cytokine responses, cleave MEKs, and induce apoptosis
14
.
fig Figure 1caption Monocyte purity, apoptosis, and susceptibility to LT. Red = CD14+ monocytestext
b Monocyte purity, apoptosis, and susceptibility to LT. Red = CD14+ monocytes. Green = CD14-lymphocytes. A.) Forward and side scatter analysis of purified fixed human monocytes showing the monocyte population as compared to total population. B.) CD14 Pacific Blue and forward scatter analysis of fixed purified human monocytes showing 85% monocytes. bC.)/b PI and annexin-FITC analysis of CD14 + monocytes after a 4 h incubation showing 99.0% viable cells indicated in quadrant 3. bD.)/b PI and annexin-FITC analysis of CD14 + monocytes after a 4 h LT treatment showing 99.1% viable cells indicated in quadrant 3. HeLa cells or human monocytes were left untreated or treated with 500 ngmL LT for 4 h at 37°C. Samples were lysed, run on SDS-PAGE, transferred to PVDF membrane, and probed with indicated antibodies. Both MEK3 and MEK1 were cleaved by LT while control cells showed no MEK cleavage. β-actin loading controls show equivalent loading of both control and LT treated cells./p
/textgraphic file="1471-2172-13-33-1"//fig
pIn order to explore the actions of LT on human peripheral monocytes, a Western Blot analysis was performed and MEK1, along with MEK3, cleavage was determined after a 4-hour treatment with LT. Human peripheral monocytes were found to be susceptible to the actions of LT as evidenced by cleavage of MEK1 and MEK3 (Figure 
figr fid="F1"1/figrE). HeLa cells were used as a positive control and β-actin was used to assure equal loading controls. We conclude that human peripheral monocytes are a direct target of anthrax LT./p
/sec
sec
st
pMicroarray analysis and results/p
/st
pHuman peripheral monocytes were treated with LT or media alone, and microarray analysis was performed using four biological replicates from healthy volunteers. A total of 8 microarray hybridizations were employed and analyzed on Affymetrix Gene Chips®(HG U133 plus 2.0). The chips contained 54,675 probe sets and identified multiple differentially regulated pathways and genes by human peripheral monocytes after LT treatment. Unsupervised hierarchical analysis was used to assess the noise in the array experiments. First, probe sets whose signal intensity varied most in the data set were selected by applying a variation filter. Probes sets that displayed a coefficient of variation of greater than 0.5 were subjected to hierarchical analysis. The clustering dendrogram showed the major node of separation between control and LT treated samples (Figure 
figr fid="F2"2/figrA)./p
fig id="F2"titlepFigure 2/p/titlecaptionpUnsupervised microarray analysis. A.) Hierarchical clustering dendrogram showing similarities between expression patterns within each condition/p/captiontext
pbUnsupervised microarray analysis. A.)/b Hierarchical clustering dendrogram showing similarities between expression patterns within each condition. Specimens were paired based on donor, using 4 separate donors as indicated in replica r1 through r4. bB.)/b Significant genes (p < 0.001) up or down regulated after LT treatment, along with their fold change, p-value and probe ID. bC.)/b Leave-one-out-cross validation was used to calculate mis-classification rate that yielded a 100% correct classification between pairs./p
/textgraphic file="1471-2172-13-33-2"//fig
pTo identify specific genes responsive to LT treatment, a paired itt/it-test (by donor) was performed at a significance threshold of p < 0.001. Genes specified by 820 probe sets were found to be significant among the treatment groups (Table 
tblr tid="T1"1/tblr). The hierarchical cluster pattern of the significant probe sets is shown (Figure 
figr fid="F3"3/figrA). Of these probe sets, multiple gene products known to play a role in monocyte function were discovered (Figure 
figr fid="F2"2/figrB). The ability of probe sets significant at p < 0.001 to function as a classifier between treatment groups (LT treated vs. control) was established by leave-one-out-cross-validation and Monte Carlo simulations. Using 4 different prediction models, the classifier performed flawlessly. Of the significant genes identified, many are known to play a role in monocyte function (Figure 
figr fid="F2"2/figrC)./p
table id="T1"
title
pTable 1/p
/title
caption
p
bControl vs Toxin corresponding P-value p<0.001/b
/p
/caption
tgroup align="left" cols="6"
colspec align="left" colname="c1" colnum="1" colwidth="1*"/
colspec align="left" colname="c2" colnum="2" colwidth="1*"/
colspec align="left" colname="c3" colnum="3" colwidth="1*"/
colspec align="left" colname="c4" colnum="4" colwidth="1*"/
colspec align="left" colname="c5" colnum="5" colwidth="1*"/
colspec align="left" colname="c6" colnum="6" colwidth="1*"/
thead valign="top"
row rowsep="1"
entry colname="c1"/
entry colname="c2"
p
bParamet. p-value/b
/p
/entry
entry colname="c3"
p
bGeometric mean of intensities/b
/p
/entry
entry colname="c4"
p
bProbe set/b
/p
/entry
entry colname="c5"
p
bGene symbol/b
/p
/entry
entry colname="c6"
p
bDescription/b
/p
/entry
/row
/thead
tbody valign="top"
row rowsep="1"
entry colname="c1"
p1/p
/entry
entry colname="c2"
p2.80E-006/p
/entry
entry colname="c3"
p1.78/p
/entry
entry colname="c4"
p222001_x_at/p
/entry
entry colname="c5"
pFAM91A2/p
/entry
entry colname="c6"
pfamily with sequence similarity 91, member A2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p2/p
/entry
entry colname="c2"
p2.90E-006/p
/entry
entry colname="c3"
p1.25/p
/entry
entry colname="c4"
p218734_at/p
/entry
entry colname="c5"
pNAT11/p
/entry
entry colname="c6"
pN-acetyltransferase 11/p
/entry
/row
row rowsep="1"
entry colname="c1"
p3/p
/entry
entry colname="c2"
p3.40E-006/p
/entry
entry colname="c3"
p1.6/p
/entry
entry colname="c4"
p230350_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p4/p
/entry
entry colname="c2"
p7.80E-006/p
/entry
entry colname="c3"
p1.56/p
/entry
entry colname="c4"
p228930_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p5/p
/entry
entry colname="c2"
p8.70E-006/p
/entry
entry colname="c3"
p1.58/p
/entry
entry colname="c4"
p208661_s_at/p
/entry
entry colname="c5"
pTTC3/p
/entry
entry colname="c6"
ptetratricopeptide repeat domain 3/p
/entry
/row
row rowsep="1"
entry colname="c1"
p6/p
/entry
entry colname="c2"
p9.80E-006/p
/entry
entry colname="c3"
p1.16/p
/entry
entry colname="c4"
p218716_x_at/p
/entry
entry colname="c5"
pMTO1/p
/entry
entry colname="c6"
pmitochondrial translation optimization 1 homolog (S. cerevisiae)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p7/p
/entry
entry colname="c2"
p1.07E-005/p
/entry
entry colname="c3"
p1.15/p
/entry
entry colname="c4"
p238538_at/p
/entry
entry colname="c5"
pANKRD11/p
/entry
entry colname="c6"
pankyrin repeat domain 11/p
/entry
/row
row rowsep="1"
entry colname="c1"
p8/p
/entry
entry colname="c2"
p1.22E-005/p
/entry
entry colname="c3"
p2.92/p
/entry
entry colname="c4"
p225896_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p9/p
/entry
entry colname="c2"
p1.41E-005/p
/entry
entry colname="c3"
p3.87/p
/entry
entry colname="c4"
p227450_at/p
/entry
entry colname="c5"
pERP27/p
/entry
entry colname="c6"
pendoplasmic reticulum protein 27 kDa/p
/entry
/row
row rowsep="1"
entry colname="c1"
p10/p
/entry
entry colname="c2"
p1.49E-005/p
/entry
entry colname="c3"
p1.23/p
/entry
entry colname="c4"
p226602_s_at/p
/entry
entry colname="c5"
pBCR/p
/entry
entry colname="c6"
pbreakpoint cluster region/p
/entry
/row
row rowsep="1"
entry colname="c1"
p11/p
/entry
entry colname="c2"
p1.60E-005/p
/entry
entry colname="c3"
p1.65/p
/entry
entry colname="c4"
p209123_at/p
/entry
entry colname="c5"
pQDPR/p
/entry
entry colname="c6"
pquinoid dihydropteridine reductase/p
/entry
/row
row rowsep="1"
entry colname="c1"
p12/p
/entry
entry colname="c2"
p1.66E-005/p
/entry
entry colname="c3"
p1.73/p
/entry
entry colname="c4"
p213934_s_at/p
/entry
entry colname="c5"
pZNF23/p
/entry
entry colname="c6"
pzinc finger protein 23 (KOX 16)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p13/p
/entry
entry colname="c2"
p1.66E-005/p
/entry
entry colname="c3"
p1.56/p
/entry
entry colname="c4"
p226419_s_at/p
/entry
entry colname="c5"
pSFRS1/p
/entry
entry colname="c6"
psplicing factor, arginineserine-rich 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p14/p
/entry
entry colname="c2"
p1.84E-005/p
/entry
entry colname="c3"
p2.91/p
/entry
entry colname="c4"
p227946_at/p
/entry
entry colname="c5"
pOSBPL7/p
/entry
entry colname="c6"
poxysterol binding protein-like 7/p
/entry
/row
row rowsep="1"
entry colname="c1"
p15/p
/entry
entry colname="c2"
p2.04E-005/p
/entry
entry colname="c3"
p1.84/p
/entry
entry colname="c4"
p242989_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p16/p
/entry
entry colname="c2"
p2.18E-005/p
/entry
entry colname="c3"
p1.92/p
/entry
entry colname="c4"
p242590_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p17/p
/entry
entry colname="c2"
p2.29E-005/p
/entry
entry colname="c3"
p1.36/p
/entry
entry colname="c4"
p204559_s_at/p
/entry
entry colname="c5"
pLSM7/p
/entry
entry colname="c6"
pLSM7 homolog, U6 small nuclear RNA associated (S. cerevisiae)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p18/p
/entry
entry colname="c2"
p2.35E-005/p
/entry
entry colname="c3"
p1.68/p
/entry
entry colname="c4"
p225902_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p19/p
/entry
entry colname="c2"
p2.44E-005/p
/entry
entry colname="c3"
p1.29/p
/entry
entry colname="c4"
p220939_s_at/p
/entry
entry colname="c5"
pDPP8/p
/entry
entry colname="c6"
pdipeptidyl-peptidase 8/p
/entry
/row
row rowsep="1"
entry colname="c1"
p20/p
/entry
entry colname="c2"
p2.63E-005/p
/entry
entry colname="c3"
p1.2/p
/entry
entry colname="c4"
p218682_s_at/p
/entry
entry colname="c5"
pSLC4A1AP/p
/entry
entry colname="c6"
psolute carrier family 4 (anion exchanger), member 1, adaptor protein/p
/entry
/row
row rowsep="1"
entry colname="c1"
p21/p
/entry
entry colname="c2"
p2.72E-005/p
/entry
entry colname="c3"
p2.21/p
/entry
entry colname="c4"
p212056_at/p
/entry
entry colname="c5"
pKIAA0182/p
/entry
entry colname="c6"
pKIAA0182/p
/entry
/row
row rowsep="1"
entry colname="c1"
p22/p
/entry
entry colname="c2"
p2.91E-005/p
/entry
entry colname="c3"
p2.87/p
/entry
entry colname="c4"
p222477_s_at/p
/entry
entry colname="c5"
pTM7SF3/p
/entry
entry colname="c6"
ptransmembrane 7 superfamily member 3/p
/entry
/row
row rowsep="1"
entry colname="c1"
p23/p
/entry
entry colname="c2"
p3.01E-005/p
/entry
entry colname="c3"
p2.01/p
/entry
entry colname="c4"
p202512_s_at/p
/entry
entry colname="c5"
pATG5/p
/entry
entry colname="c6"
pATG5 autophagy related 5 homolog (S. cerevisiae)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p24/p
/entry
entry colname="c2"
p3.07E-005/p
/entry
entry colname="c3"
p1.52/p
/entry
entry colname="c4"
p209042_s_at/p
/entry
entry colname="c5"
pUBE2G2/p
/entry
entry colname="c6"
pubiquitin-conjugating enzyme E2G 2 (UBC7 homolog, yeast)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p25/p
/entry
entry colname="c2"
p3.10E-005/p
/entry
entry colname="c3"
p5.25/p
/entry
entry colname="c4"
p232181_at/p
/entry
entry colname="c5"
pLOC153346/p
/entry
entry colname="c6"
phypothetical protein LOC153346/p
/entry
/row
row rowsep="1"
entry colname="c1"
p26/p
/entry
entry colname="c2"
p3.13E-005/p
/entry
entry colname="c3"
p1.79/p
/entry
entry colname="c4"
p1554452_a_at/p
/entry
entry colname="c5"
pHIG2/p
/entry
entry colname="c6"
phypoxia-inducible protein 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p27/p
/entry
entry colname="c2"
p3.36E-005/p
/entry
entry colname="c3"
p2.11/p
/entry
entry colname="c4"
p228772_at/p
/entry
entry colname="c5"
pHNMT/p
/entry
entry colname="c6"
phistamine N-methyltransferase/p
/entry
/row
row rowsep="1"
entry colname="c1"
p28/p
/entry
entry colname="c2"
p3.37E-005/p
/entry
entry colname="c3"
p1.3/p
/entry
entry colname="c4"
p221501_x_at/p
/entry
entry colname="c5"
pLOC339047/p
/entry
entry colname="c6"
phypothetical protein LOC339047/p
/entry
/row
row rowsep="1"
entry colname="c1"
p29/p
/entry
entry colname="c2"
p3.39E-005/p
/entry
entry colname="c3"
p1.81/p
/entry
entry colname="c4"
p239038_at/p
/entry
entry colname="c5"
pC1orf52/p
/entry
entry colname="c6"
pchromosome 1 open reading frame 52/p
/entry
/row
row rowsep="1"
entry colname="c1"
p30/p
/entry
entry colname="c2"
p3.46E-005/p
/entry
entry colname="c3"
p1.95/p
/entry
entry colname="c4"
p203839_s_at/p
/entry
entry colname="c5"
pTNK2/p
/entry
entry colname="c6"
ptyrosine kinase, non-receptor, 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p31/p
/entry
entry colname="c2"
p3.89E-005/p
/entry
entry colname="c3"
p1.89/p
/entry
entry colname="c4"
p227558_at/p
/entry
entry colname="c5"
pCBX4/p
/entry
entry colname="c6"
pchromobox homolog 4 (Pc class homolog, Drosophila)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p32/p
/entry
entry colname="c2"
p3.90E-005/p
/entry
entry colname="c3"
p1.4/p
/entry
entry colname="c4"
p214691_x_at/p
/entry
entry colname="c5"
pFAM63B/p
/entry
entry colname="c6"
pfamily with sequence similarity 63, member B/p
/entry
/row
row rowsep="1"
entry colname="c1"
p33/p
/entry
entry colname="c2"
p3.91E-005/p
/entry
entry colname="c3"
p1.32/p
/entry
entry colname="c4"
p228301_x_at/p
/entry
entry colname="c5"
pNDUFB10/p
/entry
entry colname="c6"
pNADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa/p
/entry
/row
row rowsep="1"
entry colname="c1"
p34/p
/entry
entry colname="c2"
p4.05E-005/p
/entry
entry colname="c3"
p1.8/p
/entry
entry colname="c4"
p1556306_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p35/p
/entry
entry colname="c2"
p4.22E-005/p
/entry
entry colname="c3"
p3.27/p
/entry
entry colname="c4"
p229016_s_at/p
/entry
entry colname="c5"
pTRERF1/p
/entry
entry colname="c6"
ptranscriptional regulating factor 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p36/p
/entry
entry colname="c2"
p4.47E-005/p
/entry
entry colname="c3"
p3.85/p
/entry
entry colname="c4"
p223741_s_at/p
/entry
entry colname="c5"
pTTYH2/p
/entry
entry colname="c6"
ptweety homolog 2 (Drosophila)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p37/p
/entry
entry colname="c2"
p4.48E-005/p
/entry
entry colname="c3"
p5.6/p
/entry
entry colname="c4"
p49306_at/p
/entry
entry colname="c5"
pRASSF4/p
/entry
entry colname="c6"
pRas association (RalGDSAF-6) domain family member 4/p
/entry
/row
row rowsep="1"
entry colname="c1"
p38/p
/entry
entry colname="c2"
p4.63E-005/p
/entry
entry colname="c3"
p1.49/p
/entry
entry colname="c4"
p32209_at/p
/entry
entry colname="c5"
pFAM89B/p
/entry
entry colname="c6"
pfamily with sequence similarity 89, member B/p
/entry
/row
row rowsep="1"
entry colname="c1"
p39/p
/entry
entry colname="c2"
p4.75E-005/p
/entry
entry colname="c3"
p2.83/p
/entry
entry colname="c4"
p225298_at/p
/entry
entry colname="c5"
pPNKD/p
/entry
entry colname="c6"
pparoxysmal nonkinesigenic dyskinesia/p
/entry
/row
row rowsep="1"
entry colname="c1"
p40/p
/entry
entry colname="c2"
p5.00E-005/p
/entry
entry colname="c3"
p1.59/p
/entry
entry colname="c4"
p228726_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p41/p
/entry
entry colname="c2"
p5.36E-005/p
/entry
entry colname="c3"
p1.17/p
/entry
entry colname="c4"
p1562984_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p42/p
/entry
entry colname="c2"
p5.39E-005/p
/entry
entry colname="c3"
p1.6/p
/entry
entry colname="c4"
p201639_s_at/p
/entry
entry colname="c5"
pCPSF1/p
/entry
entry colname="c6"
pcleavage and polyadenylation specific factor 1, 160kDa/p
/entry
/row
row rowsep="1"
entry colname="c1"
p43/p
/entry
entry colname="c2"
p5.66E-005/p
/entry
entry colname="c3"
p1.47/p
/entry
entry colname="c4"
p221649_s_at/p
/entry
entry colname="c5"
pPPAN/p
/entry
entry colname="c6"
ppeter pan homolog (Drosophila)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p44/p
/entry
entry colname="c2"
p5.88E-005/p
/entry
entry colname="c3"
p1.94/p
/entry
entry colname="c4"
p225360_at/p
/entry
entry colname="c5"
pTRABD/p
/entry
entry colname="c6"
pTraB domain containing/p
/entry
/row
row rowsep="1"
entry colname="c1"
p45/p
/entry
entry colname="c2"
p6.23E-005/p
/entry
entry colname="c3"
p1.27/p
/entry
entry colname="c4"
p221005_s_at/p
/entry
entry colname="c5"
pPTDSS2/p
/entry
entry colname="c6"
pphosphatidylserine synthase 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p46/p
/entry
entry colname="c2"
p6.35E-005/p
/entry
entry colname="c3"
p2.13/p
/entry
entry colname="c4"
p228914_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p47/p
/entry
entry colname="c2"
p6.47E-005/p
/entry
entry colname="c3"
p1.65/p
/entry
entry colname="c4"
p208206_s_at/p
/entry
entry colname="c5"
pRASGRP2/p
/entry
entry colname="c6"
pRAS guanyl releasing protein 2 (calcium and DAG-regulated)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p48/p
/entry
entry colname="c2"
p6.49E-005/p
/entry
entry colname="c3"
p1.64/p
/entry
entry colname="c4"
p209198_s_at/p
/entry
entry colname="c5"
pSYT11/p
/entry
entry colname="c6"
psynaptotagmin XI/p
/entry
/row
row rowsep="1"
entry colname="c1"
p49/p
/entry
entry colname="c2"
p6.55E-005/p
/entry
entry colname="c3"
p1.7/p
/entry
entry colname="c4"
p221575_at/p
/entry
entry colname="c5"
pSCLY/p
/entry
entry colname="c6"
pselenocysteine lyase/p
/entry
/row
row rowsep="1"
entry colname="c1"
p50/p
/entry
entry colname="c2"
p6.74E-005/p
/entry
entry colname="c3"
p1.82/p
/entry
entry colname="c4"
p229969_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p51/p
/entry
entry colname="c2"
p6.76E-005/p
/entry
entry colname="c3"
p2.22/p
/entry
entry colname="c4"
p235513_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p52/p
/entry
entry colname="c2"
p6.77E-005/p
/entry
entry colname="c3"
p1.93/p
/entry
entry colname="c4"
p236922_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p53/p
/entry
entry colname="c2"
p6.78E-005/p
/entry
entry colname="c3"
p1.14/p
/entry
entry colname="c4"
p204364_s_at/p
/entry
entry colname="c5"
pREEP1/p
/entry
entry colname="c6"
preceptor accessory protein 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p54/p
/entry
entry colname="c2"
p6.87E-005/p
/entry
entry colname="c3"
p1.55/p
/entry
entry colname="c4"
p227025_at/p
/entry
entry colname="c5"
pPPHLN1/p
/entry
entry colname="c6"
pperiphilin 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p55/p
/entry
entry colname="c2"
p7.02E-005/p
/entry
entry colname="c3"
p1.78/p
/entry
entry colname="c4"
p227288_at/p
/entry
entry colname="c5"
pSFRS12IP1/p
/entry
entry colname="c6"
pSFRS12-interacting protein 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p56/p
/entry
entry colname="c2"
p7.13E-005/p
/entry
entry colname="c3"
p2.55/p
/entry
entry colname="c4"
p205075_at/p
/entry
entry colname="c5"
pSERPINF2/p
/entry
entry colname="c6"
pserpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p57/p
/entry
entry colname="c2"
p7.16E-005/p
/entry
entry colname="c3"
p2.29/p
/entry
entry colname="c4"
p222988_s_at/p
/entry
entry colname="c5"
pTMEM9/p
/entry
entry colname="c6"
ptransmembrane protein 9/p
/entry
/row
row rowsep="1"
entry colname="c1"
p58/p
/entry
entry colname="c2"
p7.35E-005/p
/entry
entry colname="c3"
p1.39/p
/entry
entry colname="c4"
p231831_at/p
/entry
entry colname="c5"
pCOX19/p
/entry
entry colname="c6"
pCOX19 cytochrome c oxidase assembly homolog (S. cerevisiae)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p59/p
/entry
entry colname="c2"
p7.37E-005/p
/entry
entry colname="c3"
p1.88/p
/entry
entry colname="c4"
p221788_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p60/p
/entry
entry colname="c2"
p7.66E-005/p
/entry
entry colname="c3"
p1.61/p
/entry
entry colname="c4"
p236004_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p61/p
/entry
entry colname="c2"
p7.68E-005/p
/entry
entry colname="c3"
p1.85/p
/entry
entry colname="c4"
p219751_at/p
/entry
entry colname="c5"
pSETD6/p
/entry
entry colname="c6"
pSET domain containing 6/p
/entry
/row
row rowsep="1"
entry colname="c1"
p62/p
/entry
entry colname="c2"
p7.92E-005/p
/entry
entry colname="c3"
p1.74/p
/entry
entry colname="c4"
p227273_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p63/p
/entry
entry colname="c2"
p8.67E-005/p
/entry
entry colname="c3"
p1.56/p
/entry
entry colname="c4"
p235787_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p64/p
/entry
entry colname="c2"
p8.91E-005/p
/entry
entry colname="c3"
p1.42/p
/entry
entry colname="c4"
p212888_at/p
/entry
entry colname="c5"
pDICER1/p
/entry
entry colname="c6"
pdicer 1, ribonuclease type III/p
/entry
/row
row rowsep="1"
entry colname="c1"
p65/p
/entry
entry colname="c2"
p8.93E-005/p
/entry
entry colname="c3"
p1.93/p
/entry
entry colname="c4"
p1568593_a_at/p
/entry
entry colname="c5"
pNUDT16P/p
/entry
entry colname="c6"
pnudix (nucleoside diphosphate linked moiety X)-type motif 16 pseudogene/p
/entry
/row
row rowsep="1"
entry colname="c1"
p66/p
/entry
entry colname="c2"
p9.00E-005/p
/entry
entry colname="c3"
p1.92/p
/entry
entry colname="c4"
p226721_at/p
/entry
entry colname="c5"
pDPY19L4/p
/entry
entry colname="c6"
pdpy-19-like 4 (C. elegans)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p67/p
/entry
entry colname="c2"
p9.02E-005/p
/entry
entry colname="c3"
p1.39/p
/entry
entry colname="c4"
p227159_at/p
/entry
entry colname="c5"
pGHDC/p
/entry
entry colname="c6"
pGH3 domain containing/p
/entry
/row
row rowsep="1"
entry colname="c1"
p68/p
/entry
entry colname="c2"
p9.14E-005/p
/entry
entry colname="c3"
p2.36/p
/entry
entry colname="c4"
p225982_at/p
/entry
entry colname="c5"
pUBTF/p
/entry
entry colname="c6"
pupstream binding transcription factor, RNA polymerase I/p
/entry
/row
row rowsep="1"
entry colname="c1"
p69/p
/entry
entry colname="c2"
p9.25E-005/p
/entry
entry colname="c3"
p1.62/p
/entry
entry colname="c4"
p220341_s_at/p
/entry
entry colname="c5"
pC5orf45/p
/entry
entry colname="c6"
pchromosome 5 open reading frame 45/p
/entry
/row
row rowsep="1"
entry colname="c1"
p70/p
/entry
entry colname="c2"
p9.51E-005/p
/entry
entry colname="c3"
p1.36/p
/entry
entry colname="c4"
p214501_s_at/p
/entry
entry colname="c5"
pH2AFY/p
/entry
entry colname="c6"
pH2A histone family, member Y/p
/entry
/row
row rowsep="1"
entry colname="c1"
p71/p
/entry
entry colname="c2"
p9.96E-005/p
/entry
entry colname="c3"
p7.6/p
/entry
entry colname="c4"
p226186_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p72/p
/entry
entry colname="c2"
p0.0001001/p
/entry
entry colname="c3"
p2.59/p
/entry
entry colname="c4"
p224946_s_at/p
/entry
entry colname="c5"
pCCDC115/p
/entry
entry colname="c6"
pcoiled-coil domain containing 115/p
/entry
/row
row rowsep="1"
entry colname="c1"
p73/p
/entry
entry colname="c2"
p0.0001056/p
/entry
entry colname="c3"
p1.66/p
/entry
entry colname="c4"
p237059_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p74/p
/entry
entry colname="c2"
p0.0001076/p
/entry
entry colname="c3"
p3.11/p
/entry
entry colname="c4"
p38671_at/p
/entry
entry colname="c5"
pPLXND1/p
/entry
entry colname="c6"
pplexin D1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p75/p
/entry
entry colname="c2"
p0.0001083/p
/entry
entry colname="c3"
p1.92/p
/entry
entry colname="c4"
p231912_s_at/p
/entry
entry colname="c5"
pDKFZP434B0335/p
/entry
entry colname="c6"
pDKFZP434B0335 protein/p
/entry
/row
row rowsep="1"
entry colname="c1"
p76/p
/entry
entry colname="c2"
p0.0001087/p
/entry
entry colname="c3"
p1.55/p
/entry
entry colname="c4"
p238492_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p77/p
/entry
entry colname="c2"
p0.0001088/p
/entry
entry colname="c3"
p2.05/p
/entry
entry colname="c4"
p228548_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p78/p
/entry
entry colname="c2"
p0.0001089/p
/entry
entry colname="c3"
p1.9/p
/entry
entry colname="c4"
p225757_s_at/p
/entry
entry colname="c5"
pCLMN/p
/entry
entry colname="c6"
pcalmin (calponin-like, transmembrane)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p79/p
/entry
entry colname="c2"
p0.0001093/p
/entry
entry colname="c3"
p1.15/p
/entry
entry colname="c4"
p203926_x_at/p
/entry
entry colname="c5"
pATP5D/p
/entry
entry colname="c6"
pATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit/p
/entry
/row
row rowsep="1"
entry colname="c1"
p80/p
/entry
entry colname="c2"
p0.0001100/p
/entry
entry colname="c3"
p1.41/p
/entry
entry colname="c4"
p232520_s_at/p
/entry
entry colname="c5"
pNSFL1C/p
/entry
entry colname="c6"
pNSFL1 (p97) cofactor (p47)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p81/p
/entry
entry colname="c2"
p0.0001101/p
/entry
entry colname="c3"
p2.06/p
/entry
entry colname="c4"
p238012_at/p
/entry
entry colname="c5"
pDPP7/p
/entry
entry colname="c6"
pdipeptidyl-peptidase 7/p
/entry
/row
row rowsep="1"
entry colname="c1"
p82/p
/entry
entry colname="c2"
p0.0001101/p
/entry
entry colname="c3"
p1.38/p
/entry
entry colname="c4"
p211101_x_at/p
/entry
entry colname="c5"
pLILRA2/p
/entry
entry colname="c6"
pleukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p83/p
/entry
entry colname="c2"
p0.0001109/p
/entry
entry colname="c3"
p1.35/p
/entry
entry colname="c4"
p210128_s_at/p
/entry
entry colname="c5"
pLTB4R/p
/entry
entry colname="c6"
pleukotriene B4 receptor/p
/entry
/row
row rowsep="1"
entry colname="c1"
p84/p
/entry
entry colname="c2"
p0.0001115/p
/entry
entry colname="c3"
p1.34/p
/entry
entry colname="c4"
p223393_s_at/p
/entry
entry colname="c5"
pTSHZ3/p
/entry
entry colname="c6"
pteashirt zinc finger homeobox 3/p
/entry
/row
row rowsep="1"
entry colname="c1"
p85/p
/entry
entry colname="c2"
p0.0001123/p
/entry
entry colname="c3"
p1.46/p
/entry
entry colname="c4"
p213628_at/p
/entry
entry colname="c5"
pCLCC1/p
/entry
entry colname="c6"
pchloride channel CLIC-like 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p86/p
/entry
entry colname="c2"
p0.0001152/p
/entry
entry colname="c3"
p1.27/p
/entry
entry colname="c4"
p214870_x_at/p
/entry
entry colname="c5"
pLOC100132540/p
/entry
entry colname="c6"
psimilar to LOC339047 protein/p
/entry
/row
row rowsep="1"
entry colname="c1"
p87/p
/entry
entry colname="c2"
p0.0001171/p
/entry
entry colname="c3"
p2.41/p
/entry
entry colname="c4"
p221756_at/p
/entry
entry colname="c5"
pPIK3IP1/p
/entry
entry colname="c6"
pphosphoinositide-3-kinase interacting protein 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p88/p
/entry
entry colname="c2"
p0.0001171/p
/entry
entry colname="c3"
p1.62/p
/entry
entry colname="c4"
p222478_at/p
/entry
entry colname="c5"
pVPS36/p
/entry
entry colname="c6"
pvacuolar protein sorting 36 homolog (S. cerevisiae)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p89/p
/entry
entry colname="c2"
p0.0001192/p
/entry
entry colname="c3"
p1.99/p
/entry
entry colname="c4"
p225719_s_at/p
/entry
entry colname="c5"
pMRPL55/p
/entry
entry colname="c6"
pmitochondrial ribosomal protein L55/p
/entry
/row
row rowsep="1"
entry colname="c1"
p90/p
/entry
entry colname="c2"
p0.0001206/p
/entry
entry colname="c3"
p1.87/p
/entry
entry colname="c4"
p212959_s_at/p
/entry
entry colname="c5"
pGNPTAB/p
/entry
entry colname="c6"
pN-acetylglucosamine-1-phosphate transferase, alpha and beta subunits/p
/entry
/row
row rowsep="1"
entry colname="c1"
p91/p
/entry
entry colname="c2"
p0.0001210/p
/entry
entry colname="c3"
p7.64/p
/entry
entry colname="c4"
p238520_at/p
/entry
entry colname="c5"
pTRERF1/p
/entry
entry colname="c6"
ptranscriptional regulating factor 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p92/p
/entry
entry colname="c2"
p0.0001235/p
/entry
entry colname="c3"
p3.04/p
/entry
entry colname="c4"
p226974_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p93/p
/entry
entry colname="c2"
p0.0001269/p
/entry
entry colname="c3"
p2.06/p
/entry
entry colname="c4"
p225851_at/p
/entry
entry colname="c5"
pFNTB/p
/entry
entry colname="c6"
pfarnesyltransferase, CAAX box, beta/p
/entry
/row
row rowsep="1"
entry colname="c1"
p94/p
/entry
entry colname="c2"
p0.0001288/p
/entry
entry colname="c3"
p2.04/p
/entry
entry colname="c4"
p224452_s_at/p
/entry
entry colname="c5"
pMGC12966/p
/entry
entry colname="c6"
phypothetical protein LOC84792/p
/entry
/row
row rowsep="1"
entry colname="c1"
p95/p
/entry
entry colname="c2"
p0.0001306/p
/entry
entry colname="c3"
p1.46/p
/entry
entry colname="c4"
p226092_at/p
/entry
entry colname="c5"
pMPP5/p
/entry
entry colname="c6"
pmembrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p96/p
/entry
entry colname="c2"
p0.0001312/p
/entry
entry colname="c3"
p1.5/p
/entry
entry colname="c4"
p1558693_s_at/p
/entry
entry colname="c5"
pC1orf85/p
/entry
entry colname="c6"
pchromosome 1 open reading frame 85/p
/entry
/row
row rowsep="1"
entry colname="c1"
p97/p
/entry
entry colname="c2"
p0.0001336/p
/entry
entry colname="c3"
p1.19/p
/entry
entry colname="c4"
p204020_at/p
/entry
entry colname="c5"
pPURA/p
/entry
entry colname="c6"
ppurine-rich element binding protein A/p
/entry
/row
row rowsep="1"
entry colname="c1"
p98/p
/entry
entry colname="c2"
p0.0001350/p
/entry
entry colname="c3"
p1.73/p
/entry
entry colname="c4"
p1555882_at/p
/entry
entry colname="c5"
pSPIN3/p
/entry
entry colname="c6"
pspindlin family, member 3/p
/entry
/row
row rowsep="1"
entry colname="c1"
p99/p
/entry
entry colname="c2"
p0.0001354/p
/entry
entry colname="c3"
p1.8/p
/entry
entry colname="c4"
p235532_at/p
/entry
entry colname="c5"
pPIGM/p
/entry
entry colname="c6"
pphosphatidylinositol glycan anchor biosynthesis, class M/p
/entry
/row
row rowsep="1"
entry colname="c1"
p100/p
/entry
entry colname="c2"
p0.0001371/p
/entry
entry colname="c3"
p2.61/p
/entry
entry colname="c4"
p1553111_a_at/p
/entry
entry colname="c5"
pKBTBD6/p
/entry
entry colname="c6"
pkelch repeat and BTB (POZ) domain containing 6/p
/entry
/row
row rowsep="1"
entry colname="c1"
p101/p
/entry
entry colname="c2"
p0.0001408/p
/entry
entry colname="c3"
p1.44/p
/entry
entry colname="c4"
p227868_at/p
/entry
entry colname="c5"
pLOC154761/p
/entry
entry colname="c6"
phypothetical LOC154761/p
/entry
/row
row rowsep="1"
entry colname="c1"
p102/p
/entry
entry colname="c2"
p0.0001408/p
/entry
entry colname="c3"
p3.15/p
/entry
entry colname="c4"
p214058_at/p
/entry
entry colname="c5"
pMYCL1/p
/entry
entry colname="c6"
pv-myc myelocytomatosis viral oncogene homolog 1, lung carcinoma derived (avian)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p103/p
/entry
entry colname="c2"
p0.0001409/p
/entry
entry colname="c3"
p2.65/p
/entry
entry colname="c4"
p212686_at/p
/entry
entry colname="c5"
pPPM1H/p
/entry
entry colname="c6"
pprotein phosphatase 1H (PP2C domain containing)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p104/p
/entry
entry colname="c2"
p0.0001414/p
/entry
entry colname="c3"
p1.61/p
/entry
entry colname="c4"
p218971_s_at/p
/entry
entry colname="c5"
pWDR91/p
/entry
entry colname="c6"
pWD repeat domain 91/p
/entry
/row
row rowsep="1"
entry colname="c1"
p105/p
/entry
entry colname="c2"
p0.0001418/p
/entry
entry colname="c3"
p2.07/p
/entry
entry colname="c4"
p225777_at/p
/entry
entry colname="c5"
pC9orf140/p
/entry
entry colname="c6"
pchromosome 9 open reading frame 140/p
/entry
/row
row rowsep="1"
entry colname="c1"
p106/p
/entry
entry colname="c2"
p0.0001426/p
/entry
entry colname="c3"
p1.92/p
/entry
entry colname="c4"
p225366_at/p
/entry
entry colname="c5"
pPGM2/p
/entry
entry colname="c6"
pphosphoglucomutase 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p107/p
/entry
entry colname="c2"
p0.0001451/p
/entry
entry colname="c3"
p1.74/p
/entry
entry colname="c4"
p238768_at/p
/entry
entry colname="c5"
pC2orf68/p
/entry
entry colname="c6"
pchromosome 2 open reading frame 68/p
/entry
/row
row rowsep="1"
entry colname="c1"
p108/p
/entry
entry colname="c2"
p0.0001454/p
/entry
entry colname="c3"
p1.49/p
/entry
entry colname="c4"
p218674_at/p
/entry
entry colname="c5"
pC5orf44/p
/entry
entry colname="c6"
pchromosome 5 open reading frame 44/p
/entry
/row
row rowsep="1"
entry colname="c1"
p109/p
/entry
entry colname="c2"
p0.0001462/p
/entry
entry colname="c3"
p1.26/p
/entry
entry colname="c4"
p218490_s_at/p
/entry
entry colname="c5"
pZNF302/p
/entry
entry colname="c6"
pzinc finger protein 302/p
/entry
/row
row rowsep="1"
entry colname="c1"
p110/p
/entry
entry colname="c2"
p0.0001537/p
/entry
entry colname="c3"
p1.17/p
/entry
entry colname="c4"
p202704_at/p
/entry
entry colname="c5"
pTOB1/p
/entry
entry colname="c6"
ptransducer of ERBB2, 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p111/p
/entry
entry colname="c2"
p0.0001561/p
/entry
entry colname="c3"
p1.69/p
/entry
entry colname="c4"
p218361_at/p
/entry
entry colname="c5"
pGOLPH3L/p
/entry
entry colname="c6"
pgolgi phosphoprotein 3-like/p
/entry
/row
row rowsep="1"
entry colname="c1"
p112/p
/entry
entry colname="c2"
p0.0001565/p
/entry
entry colname="c3"
p1.32/p
/entry
entry colname="c4"
p222994_at/p
/entry
entry colname="c5"
pPRDX5/p
/entry
entry colname="c6"
pperoxiredoxin 5/p
/entry
/row
row rowsep="1"
entry colname="c1"
p113/p
/entry
entry colname="c2"
p0.0001590/p
/entry
entry colname="c3"
p2.19/p
/entry
entry colname="c4"
p209828_s_at/p
/entry
entry colname="c5"
pIL16/p
/entry
entry colname="c6"
pinterleukin 16 (lymphocyte chemoattractant factor)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p114/p
/entry
entry colname="c2"
p0.0001593/p
/entry
entry colname="c3"
p1.47/p
/entry
entry colname="c4"
p204611_s_at/p
/entry
entry colname="c5"
pPPP2R5B/p
/entry
entry colname="c6"
pprotein phosphatase 2, regulatory subunit B@#$%&, beta isoform/p
/entry
/row
row rowsep="1"
entry colname="c1"
p115/p
/entry
entry colname="c2"
p0.0001593/p
/entry
entry colname="c3"
p1.48/p
/entry
entry colname="c4"
p227730_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p116/p
/entry
entry colname="c2"
p0.0001599/p
/entry
entry colname="c3"
p1.14/p
/entry
entry colname="c4"
p228605_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p117/p
/entry
entry colname="c2"
p0.0001646/p
/entry
entry colname="c3"
p1.54/p
/entry
entry colname="c4"
p202135_s_at/p
/entry
entry colname="c5"
pACTR1B/p
/entry
entry colname="c6"
pARP1 actin-related protein 1 homolog B, centractin beta (yeast)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p118/p
/entry
entry colname="c2"
p0.0001669/p
/entry
entry colname="c3"
p1.73/p
/entry
entry colname="c4"
p226183_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p119/p
/entry
entry colname="c2"
p0.0001709/p
/entry
entry colname="c3"
p1.88/p
/entry
entry colname="c4"
p65472_at/p
/entry
entry colname="c5"
pC2orf68/p
/entry
entry colname="c6"
pchromosome 2 open reading frame 68/p
/entry
/row
row rowsep="1"
entry colname="c1"
p120/p
/entry
entry colname="c2"
p0.0001738/p
/entry
entry colname="c3"
p1.57/p
/entry
entry colname="c4"
p200098_s_at/p
/entry
entry colname="c5"
pANAPC5/p
/entry
entry colname="c6"
panaphase promoting complex subunit 5/p
/entry
/row
row rowsep="1"
entry colname="c1"
p121/p
/entry
entry colname="c2"
p0.0001748/p
/entry
entry colname="c3"
p1.37/p
/entry
entry colname="c4"
p218181_s_at/p
/entry
entry colname="c5"
pMAP4K4/p
/entry
entry colname="c6"
pmitogen-activated protein kinase kinase kinase kinase 4/p
/entry
/row
row rowsep="1"
entry colname="c1"
p122/p
/entry
entry colname="c2"
p0.0001762/p
/entry
entry colname="c3"
p2.81/p
/entry
entry colname="c4"
p238135_at/p
/entry
entry colname="c5"
pAGTRAP/p
/entry
entry colname="c6"
pangiotensin II receptor-associated protein/p
/entry
/row
row rowsep="1"
entry colname="c1"
p123/p
/entry
entry colname="c2"
p0.0001767/p
/entry
entry colname="c3"
p3.66/p
/entry
entry colname="c4"
p203386_at/p
/entry
entry colname="c5"
pTBC1D4/p
/entry
entry colname="c6"
pTBC1 domain family, member 4/p
/entry
/row
row rowsep="1"
entry colname="c1"
p124/p
/entry
entry colname="c2"
p0.0001784/p
/entry
entry colname="c3"
p2.06/p
/entry
entry colname="c4"
p213670_x_at/p
/entry
entry colname="c5"
pNSUN5B/p
/entry
entry colname="c6"
pNOL1NOP2Sun domain family, member 5B/p
/entry
/row
row rowsep="1"
entry colname="c1"
p125/p
/entry
entry colname="c2"
p0.0001787/p
/entry
entry colname="c3"
p1.69/p
/entry
entry colname="c4"
p212109_at/p
/entry
entry colname="c5"
pHN1L/p
/entry
entry colname="c6"
phematological and neurological expressed 1-like/p
/entry
/row
row rowsep="1"
entry colname="c1"
p126/p
/entry
entry colname="c2"
p0.0001789/p
/entry
entry colname="c3"
p1.85/p
/entry
entry colname="c4"
p219968_at/p
/entry
entry colname="c5"
pZNF589/p
/entry
entry colname="c6"
pzinc finger protein 589/p
/entry
/row
row rowsep="1"
entry colname="c1"
p127/p
/entry
entry colname="c2"
p0.0001799/p
/entry
entry colname="c3"
p2.25/p
/entry
entry colname="c4"
p211495_x_at/p
/entry
entry colname="c5"
pTNFSF13/p
/entry
entry colname="c6"
ptumor necrosis factor (ligand) superfamily, member 13/p
/entry
/row
row rowsep="1"
entry colname="c1"
p128/p
/entry
entry colname="c2"
p0.0001836/p
/entry
entry colname="c3"
p2.07/p
/entry
entry colname="c4"
p214177_s_at/p
/entry
entry colname="c5"
pPBXIP1/p
/entry
entry colname="c6"
ppre-B-cell leukemia homeobox interacting protein 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p129/p
/entry
entry colname="c2"
p0.0001843/p
/entry
entry colname="c3"
p1.64/p
/entry
entry colname="c4"
p1554085_at/p
/entry
entry colname="c5"
pDDX51/p
/entry
entry colname="c6"
pDEAD (Asp-Glu-Ala-Asp) box polypeptide 51/p
/entry
/row
row rowsep="1"
entry colname="c1"
p130/p
/entry
entry colname="c2"
p0.0001852/p
/entry
entry colname="c3"
p1.99/p
/entry
entry colname="c4"
p203271_s_at/p
/entry
entry colname="c5"
pUNC119/p
/entry
entry colname="c6"
punc-119 homolog (C. elegans)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p131/p
/entry
entry colname="c2"
p0.0001878/p
/entry
entry colname="c3"
p1.43/p
/entry
entry colname="c4"
p226072_at/p
/entry
entry colname="c5"
pFUK/p
/entry
entry colname="c6"
pfucokinase/p
/entry
/row
row rowsep="1"
entry colname="c1"
p132/p
/entry
entry colname="c2"
p0.0001878/p
/entry
entry colname="c3"
p3.32/p
/entry
entry colname="c4"
p212235_at/p
/entry
entry colname="c5"
pPLXND1/p
/entry
entry colname="c6"
pplexin D1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p133/p
/entry
entry colname="c2"
p0.0001902/p
/entry
entry colname="c3"
p1.67/p
/entry
entry colname="c4"
p205658_s_at/p
/entry
entry colname="c5"
pSNAPC4/p
/entry
entry colname="c6"
psmall nuclear RNA activating complex, polypeptide 4, 190kDa/p
/entry
/row
row rowsep="1"
entry colname="c1"
p134/p
/entry
entry colname="c2"
p0.0001983/p
/entry
entry colname="c3"
p1.84/p
/entry
entry colname="c4"
p218021_at/p
/entry
entry colname="c5"
pDHRS4/p
/entry
entry colname="c6"
pdehydrogenasereductase (SDR family) member 4/p
/entry
/row
row rowsep="1"
entry colname="c1"
p135/p
/entry
entry colname="c2"
p0.0001987/p
/entry
entry colname="c3"
p1.76/p
/entry
entry colname="c4"
p229429_x_at/p
/entry
entry colname="c5"
pFAM91A2/p
/entry
entry colname="c6"
pfamily with sequence similarity 91, member A2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p136/p
/entry
entry colname="c2"
p0.0001990/p
/entry
entry colname="c3"
p1.27/p
/entry
entry colname="c4"
p212429_s_at/p
/entry
entry colname="c5"
pGTF3C2/p
/entry
entry colname="c6"
pgeneral transcription factor IIIC, polypeptide 2, beta 110kDa/p
/entry
/row
row rowsep="1"
entry colname="c1"
p137/p
/entry
entry colname="c2"
p0.0002007/p
/entry
entry colname="c3"
p1.81/p
/entry
entry colname="c4"
p226873_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p138/p
/entry
entry colname="c2"
p0.0002010/p
/entry
entry colname="c3"
p1.31/p
/entry
entry colname="c4"
p227801_at/p
/entry
entry colname="c5"
pTRIM59/p
/entry
entry colname="c6"
ptripartite motif-containing 59/p
/entry
/row
row rowsep="1"
entry colname="c1"
p139/p
/entry
entry colname="c2"
p0.0002032/p
/entry
entry colname="c3"
p1.36/p
/entry
entry colname="c4"
p227679_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p140/p
/entry
entry colname="c2"
p0.0002081/p
/entry
entry colname="c3"
p4.03/p
/entry
entry colname="c4"
p218326_s_at/p
/entry
entry colname="c5"
pLGR4/p
/entry
entry colname="c6"
pleucine-rich repeat-containing G protein-coupled receptor 4/p
/entry
/row
row rowsep="1"
entry colname="c1"
p141/p
/entry
entry colname="c2"
p0.0002087/p
/entry
entry colname="c3"
p1.93/p
/entry
entry colname="c4"
p235252_at/p
/entry
entry colname="c5"
pKSR1/p
/entry
entry colname="c6"
pkinase suppressor of ras 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p142/p
/entry
entry colname="c2"
p0.0002093/p
/entry
entry colname="c3"
p1.45/p
/entry
entry colname="c4"
p1558522_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p143/p
/entry
entry colname="c2"
p0.0002165/p
/entry
entry colname="c3"
p1.57/p
/entry
entry colname="c4"
p225396_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p144/p
/entry
entry colname="c2"
p0.0002167/p
/entry
entry colname="c3"
p1.4/p
/entry
entry colname="c4"
p206469_x_at/p
/entry
entry colname="c5"
pAKR7A3/p
/entry
entry colname="c6"
paldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p145/p
/entry
entry colname="c2"
p0.0002197/p
/entry
entry colname="c3"
p1.79/p
/entry
entry colname="c4"
p1563549_a_at/p
/entry
entry colname="c5"
pANO8/p
/entry
entry colname="c6"
panoctamin 8/p
/entry
/row
row rowsep="1"
entry colname="c1"
p146/p
/entry
entry colname="c2"
p0.0002219/p
/entry
entry colname="c3"
p1.79/p
/entry
entry colname="c4"
p211576_s_at/p
/entry
entry colname="c5"
pSLC19A1/p
/entry
entry colname="c6"
psolute carrier family 19 (folate transporter), member 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p147/p
/entry
entry colname="c2"
p0.0002234/p
/entry
entry colname="c3"
p1.35/p
/entry
entry colname="c4"
p202846_s_at/p
/entry
entry colname="c5"
pPIGC/p
/entry
entry colname="c6"
pphosphatidylinositol glycan anchor biosynthesis, class C/p
/entry
/row
row rowsep="1"
entry colname="c1"
p148/p
/entry
entry colname="c2"
p0.0002246/p
/entry
entry colname="c3"
p2.17/p
/entry
entry colname="c4"
p232231_at/p
/entry
entry colname="c5"
pRUNX2/p
/entry
entry colname="c6"
prunt-related transcription factor 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p149/p
/entry
entry colname="c2"
p0.0002301/p
/entry
entry colname="c3"
p1.24/p
/entry
entry colname="c4"
p213480_at/p
/entry
entry colname="c5"
pVAMP4/p
/entry
entry colname="c6"
pvesicle-associated membrane protein 4/p
/entry
/row
row rowsep="1"
entry colname="c1"
p150/p
/entry
entry colname="c2"
p0.0002335/p
/entry
entry colname="c3"
p1.57/p
/entry
entry colname="c4"
p1558755_x_at/p
/entry
entry colname="c5"
pZNF763/p
/entry
entry colname="c6"
pzinc finger protein 763/p
/entry
/row
row rowsep="1"
entry colname="c1"
p151/p
/entry
entry colname="c2"
p0.0002348/p
/entry
entry colname="c3"
p1.87/p
/entry
entry colname="c4"
p1557667_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p152/p
/entry
entry colname="c2"
p0.0002362/p
/entry
entry colname="c3"
p1.53/p
/entry
entry colname="c4"
p211036_x_at/p
/entry
entry colname="c5"
pANAPC5/p
/entry
entry colname="c6"
panaphase promoting complex subunit 5/p
/entry
/row
row rowsep="1"
entry colname="c1"
p153/p
/entry
entry colname="c2"
p0.0002367/p
/entry
entry colname="c3"
p2.73/p
/entry
entry colname="c4"
p203387_s_at/p
/entry
entry colname="c5"
pTBC1D4/p
/entry
entry colname="c6"
pTBC1 domain family, member 4/p
/entry
/row
row rowsep="1"
entry colname="c1"
p154/p
/entry
entry colname="c2"
p0.0002416/p
/entry
entry colname="c3"
p1.35/p
/entry
entry colname="c4"
p217896_s_at/p
/entry
entry colname="c5"
pNIP30/p
/entry
entry colname="c6"
pNEFA-interacting nuclear protein NIP30/p
/entry
/row
row rowsep="1"
entry colname="c1"
p155/p
/entry
entry colname="c2"
p0.0002420/p
/entry
entry colname="c3"
p2.35/p
/entry
entry colname="c4"
p212136_at/p
/entry
entry colname="c5"
pATP2B4/p
/entry
entry colname="c6"
pATPase, Ca++ transporting, plasma membrane 4/p
/entry
/row
row rowsep="1"
entry colname="c1"
p156/p
/entry
entry colname="c2"
p0.0002425/p
/entry
entry colname="c3"
p1.4/p
/entry
entry colname="c4"
p207618_s_at/p
/entry
entry colname="c5"
pBCS1L/p
/entry
entry colname="c6"
pBCS1-like (yeast)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p157/p
/entry
entry colname="c2"
p0.0002450/p
/entry
entry colname="c3"
p1.85/p
/entry
entry colname="c4"
p239300_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p158/p
/entry
entry colname="c2"
p0.0002478/p
/entry
entry colname="c3"
p2.1/p
/entry
entry colname="c4"
p229497_at/p
/entry
entry colname="c5"
pANKDD1A/p
/entry
entry colname="c6"
pankyrin repeat and death domain containing 1A/p
/entry
/row
row rowsep="1"
entry colname="c1"
p159/p
/entry
entry colname="c2"
p0.0002509/p
/entry
entry colname="c3"
p1.29/p
/entry
entry colname="c4"
p214035_x_at/p
/entry
entry colname="c5"
pLOC399491/p
/entry
entry colname="c6"
pLOC399491 protein/p
/entry
/row
row rowsep="1"
entry colname="c1"
p160/p
/entry
entry colname="c2"
p0.0002517/p
/entry
entry colname="c3"
p1.66/p
/entry
entry colname="c4"
p229874_x_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p161/p
/entry
entry colname="c2"
p0.0002521/p
/entry
entry colname="c3"
p1.74/p
/entry
entry colname="c4"
p221264_s_at/p
/entry
entry colname="c5"
pLOC100128223/p
/entry
entry colname="c6"
phypothetical protein LOC100128223/p
/entry
/row
row rowsep="1"
entry colname="c1"
p162/p
/entry
entry colname="c2"
p0.0002522/p
/entry
entry colname="c3"
p1.54/p
/entry
entry colname="c4"
p227630_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p163/p
/entry
entry colname="c2"
p0.0002531/p
/entry
entry colname="c3"
p2.4/p
/entry
entry colname="c4"
p226016_at/p
/entry
entry colname="c5"
pCD47/p
/entry
entry colname="c6"
pCD47 molecule/p
/entry
/row
row rowsep="1"
entry colname="c1"
p164/p
/entry
entry colname="c2"
p0.0002559/p
/entry
entry colname="c3"
p1.53/p
/entry
entry colname="c4"
p1558947_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p165/p
/entry
entry colname="c2"
p0.0002582/p
/entry
entry colname="c3"
p2.08/p
/entry
entry colname="c4"
p222664_at/p
/entry
entry colname="c5"
pKCTD15/p
/entry
entry colname="c6"
ppotassium channel tetramerisation domain containing 15/p
/entry
/row
row rowsep="1"
entry colname="c1"
p166/p
/entry
entry colname="c2"
p0.0002606/p
/entry
entry colname="c3"
p4.49/p
/entry
entry colname="c4"
p207843_x_at/p
/entry
entry colname="c5"
pCYB5A/p
/entry
entry colname="c6"
pcytochrome b5 type A (microsomal)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p167/p
/entry
entry colname="c2"
p0.0002633/p
/entry
entry colname="c3"
p2.1/p
/entry
entry colname="c4"
p218394_at/p
/entry
entry colname="c5"
pROGDI/p
/entry
entry colname="c6"
progdi homolog (Drosophila)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p168/p
/entry
entry colname="c2"
p0.0002634/p
/entry
entry colname="c3"
p1.86/p
/entry
entry colname="c4"
p214100_x_at/p
/entry
entry colname="c5"
pNSUN5B/p
/entry
entry colname="c6"
pNOL1NOP2Sun domain family, member 5B/p
/entry
/row
row rowsep="1"
entry colname="c1"
p169/p
/entry
entry colname="c2"
p0.0002641/p
/entry
entry colname="c3"
p1.4/p
/entry
entry colname="c4"
p212895_s_at/p
/entry
entry colname="c5"
pABR/p
/entry
entry colname="c6"
pactive BCR-related gene/p
/entry
/row
row rowsep="1"
entry colname="c1"
p170/p
/entry
entry colname="c2"
p0.0002648/p
/entry
entry colname="c3"
p2.01/p
/entry
entry colname="c4"
p227580_s_at/p
/entry
entry colname="c5"
pDKFZP434B0335/p
/entry
entry colname="c6"
pDKFZP434B0335 protein/p
/entry
/row
row rowsep="1"
entry colname="c1"
p171/p
/entry
entry colname="c2"
p0.0002678/p
/entry
entry colname="c3"
p2.59/p
/entry
entry colname="c4"
p227253_at/p
/entry
entry colname="c5"
pCP/p
/entry
entry colname="c6"
pceruloplasmin (ferroxidase)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p172/p
/entry
entry colname="c2"
p0.0002679/p
/entry
entry colname="c3"
p1.78/p
/entry
entry colname="c4"
p230917_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p173/p
/entry
entry colname="c2"
p0.0002686/p
/entry
entry colname="c3"
p1.69/p
/entry
entry colname="c4"
p200843_s_at/p
/entry
entry colname="c5"
pEPRS/p
/entry
entry colname="c6"
pglutamyl-prolyl-tRNA synthetase/p
/entry
/row
row rowsep="1"
entry colname="c1"
p174/p
/entry
entry colname="c2"
p0.0002686/p
/entry
entry colname="c3"
p2.67/p
/entry
entry colname="c4"
p227346_at/p
/entry
entry colname="c5"
pIKZF1/p
/entry
entry colname="c6"
pIKAROS family zinc finger 1 (Ikaros)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p175/p
/entry
entry colname="c2"
p0.0002715/p
/entry
entry colname="c3"
p1.44/p
/entry
entry colname="c4"
p219095_at/p
/entry
entry colname="c5"
pLOC100137047-PLA2G4B/p
/entry
entry colname="c6"
phypothetical protein LOC8681/p
/entry
/row
row rowsep="1"
entry colname="c1"
p176/p
/entry
entry colname="c2"
p0.0002762/p
/entry
entry colname="c3"
p1.68/p
/entry
entry colname="c4"
p229776_at/p
/entry
entry colname="c5"
pSLCO3A1/p
/entry
entry colname="c6"
psolute carrier organic anion transporter family, member 3A1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p177/p
/entry
entry colname="c2"
p0.0002768/p
/entry
entry colname="c3"
p4.48/p
/entry
entry colname="c4"
p226436_at/p
/entry
entry colname="c5"
pRASSF4/p
/entry
entry colname="c6"
pRas association (RalGDSAF-6) domain family member 4/p
/entry
/row
row rowsep="1"
entry colname="c1"
p178/p
/entry
entry colname="c2"
p0.0002796/p
/entry
entry colname="c3"
p1.37/p
/entry
entry colname="c4"
p221951_at/p
/entry
entry colname="c5"
pTMEM80/p
/entry
entry colname="c6"
ptransmembrane protein 80/p
/entry
/row
row rowsep="1"
entry colname="c1"
p179/p
/entry
entry colname="c2"
p0.0002809/p
/entry
entry colname="c3"
p1.49/p
/entry
entry colname="c4"
p228606_at/p
/entry
entry colname="c5"
pTM4SF19/p
/entry
entry colname="c6"
ptransmembrane 4 L six family member 19/p
/entry
/row
row rowsep="1"
entry colname="c1"
p180/p
/entry
entry colname="c2"
p0.0002817/p
/entry
entry colname="c3"
p1.66/p
/entry
entry colname="c4"
p232535_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p181/p
/entry
entry colname="c2"
p0.0002826/p
/entry
entry colname="c3"
p1.28/p
/entry
entry colname="c4"
p1569597_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p182/p
/entry
entry colname="c2"
p0.0002831/p
/entry
entry colname="c3"
p1.77/p
/entry
entry colname="c4"
p1555845_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p183/p
/entry
entry colname="c2"
p0.0002835/p
/entry
entry colname="c3"
p2.77/p
/entry
entry colname="c4"
p205955_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p184/p
/entry
entry colname="c2"
p0.0002839/p
/entry
entry colname="c3"
p2.47/p
/entry
entry colname="c4"
p220137_at/p
/entry
entry colname="c5"
pFLJ20674/p
/entry
entry colname="c6"
phypothetical protein FLJ20674/p
/entry
/row
row rowsep="1"
entry colname="c1"
p185/p
/entry
entry colname="c2"
p0.0002845/p
/entry
entry colname="c3"
p2.56/p
/entry
entry colname="c4"
p218459_at/p
/entry
entry colname="c5"
pTOR3A/p
/entry
entry colname="c6"
ptorsin family 3, member A/p
/entry
/row
row rowsep="1"
entry colname="c1"
p186/p
/entry
entry colname="c2"
p0.0002870/p
/entry
entry colname="c3"
p1.73/p
/entry
entry colname="c4"
p238929_at/p
/entry
entry colname="c5"
pSFRS2B/p
/entry
entry colname="c6"
psplicing factor, arginineserine-rich 2B/p
/entry
/row
row rowsep="1"
entry colname="c1"
p187/p
/entry
entry colname="c2"
p0.0002872/p
/entry
entry colname="c3"
p2.1/p
/entry
entry colname="c4"
p203317_at/p
/entry
entry colname="c5"
pPSD4/p
/entry
entry colname="c6"
ppleckstrin and Sec7 domain containing 4/p
/entry
/row
row rowsep="1"
entry colname="c1"
p188/p
/entry
entry colname="c2"
p0.0002969/p
/entry
entry colname="c3"
p1.32/p
/entry
entry colname="c4"
p238263_at/p
/entry
entry colname="c5"
pLOC285965/p
/entry
entry colname="c6"
phypothetical protein LOC285965/p
/entry
/row
row rowsep="1"
entry colname="c1"
p189/p
/entry
entry colname="c2"
p0.0003005/p
/entry
entry colname="c3"
p2.64/p
/entry
entry colname="c4"
p235159_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p190/p
/entry
entry colname="c2"
p0.0003043/p
/entry
entry colname="c3"
p1.24/p
/entry
entry colname="c4"
p218388_at/p
/entry
entry colname="c5"
pPGLS/p
/entry
entry colname="c6"
p6-phosphogluconolactonase/p
/entry
/row
row rowsep="1"
entry colname="c1"
p191/p
/entry
entry colname="c2"
p0.0003057/p
/entry
entry colname="c3"
p1.3/p
/entry
entry colname="c4"
p206729_at/p
/entry
entry colname="c5"
pTNFRSF8/p
/entry
entry colname="c6"
ptumor necrosis factor receptor superfamily, member 8/p
/entry
/row
row rowsep="1"
entry colname="c1"
p192/p
/entry
entry colname="c2"
p0.0003121/p
/entry
entry colname="c3"
p1.28/p
/entry
entry colname="c4"
p231130_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p193/p
/entry
entry colname="c2"
p0.0003123/p
/entry
entry colname="c3"
p1.4/p
/entry
entry colname="c4"
p1552257_a_at/p
/entry
entry colname="c5"
pTTLL12/p
/entry
entry colname="c6"
ptubulin tyrosine ligase-like family, member 12/p
/entry
/row
row rowsep="1"
entry colname="c1"
p194/p
/entry
entry colname="c2"
p0.0003129/p
/entry
entry colname="c3"
p1.29/p
/entry
entry colname="c4"
p219175_s_at/p
/entry
entry colname="c5"
pSLC41A3/p
/entry
entry colname="c6"
psolute carrier family 41, member 3/p
/entry
/row
row rowsep="1"
entry colname="c1"
p195/p
/entry
entry colname="c2"
p0.0003162/p
/entry
entry colname="c3"
p1.41/p
/entry
entry colname="c4"
p204786_s_at/p
/entry
entry colname="c5"
pIFNAR2/p
/entry
entry colname="c6"
pinterferon (alpha, beta and omega) receptor 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p196/p
/entry
entry colname="c2"
p0.0003176/p
/entry
entry colname="c3"
p1.47/p
/entry
entry colname="c4"
p225391_at/p
/entry
entry colname="c5"
pLOC93622/p
/entry
entry colname="c6"
phypothetical LOC93622/p
/entry
/row
row rowsep="1"
entry colname="c1"
p197/p
/entry
entry colname="c2"
p0.0003216/p
/entry
entry colname="c3"
p1.35/p
/entry
entry colname="c4"
p227127_at/p
/entry
entry colname="c5"
pTMEM110/p
/entry
entry colname="c6"
ptransmembrane protein 110/p
/entry
/row
row rowsep="1"
entry colname="c1"
p198/p
/entry
entry colname="c2"
p0.0003219/p
/entry
entry colname="c3"
p3.64/p
/entry
entry colname="c4"
p202341_s_at/p
/entry
entry colname="c5"
pTRIM2/p
/entry
entry colname="c6"
ptripartite motif-containing 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p199/p
/entry
entry colname="c2"
p0.0003243/p
/entry
entry colname="c3"
p2.09/p
/entry
entry colname="c4"
p210731_s_at/p
/entry
entry colname="c5"
pLGALS8/p
/entry
entry colname="c6"
plectin, galactoside-binding, soluble, 8/p
/entry
/row
row rowsep="1"
entry colname="c1"
p200/p
/entry
entry colname="c2"
p0.0003251/p
/entry
entry colname="c3"
p1.77/p
/entry
entry colname="c4"
p213374_x_at/p
/entry
entry colname="c5"
pHIBCH/p
/entry
entry colname="c6"
p3-hydroxyisobutyryl-Coenzyme A hydrolase/p
/entry
/row
row rowsep="1"
entry colname="c1"
p201/p
/entry
entry colname="c2"
p0.0003260/p
/entry
entry colname="c3"
p1.38/p
/entry
entry colname="c4"
p200931_s_at/p
/entry
entry colname="c5"
pVCL/p
/entry
entry colname="c6"
pvinculin/p
/entry
/row
row rowsep="1"
entry colname="c1"
p202/p
/entry
entry colname="c2"
p0.0003264/p
/entry
entry colname="c3"
p1.45/p
/entry
entry colname="c4"
p230304_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p203/p
/entry
entry colname="c2"
p0.0003271/p
/entry
entry colname="c3"
p2.03/p
/entry
entry colname="c4"
p235195_at/p
/entry
entry colname="c5"
pFBXW2/p
/entry
entry colname="c6"
pF-box and WD repeat domain containing 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p204/p
/entry
entry colname="c2"
p0.0003290/p
/entry
entry colname="c3"
p4.23/p
/entry
entry colname="c4"
p215726_s_at/p
/entry
entry colname="c5"
pCYB5A/p
/entry
entry colname="c6"
pcytochrome b5 type A (microsomal)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p205/p
/entry
entry colname="c2"
p0.0003300/p
/entry
entry colname="c3"
p2.01/p
/entry
entry colname="c4"
p242794_at/p
/entry
entry colname="c5"
pMAML3/p
/entry
entry colname="c6"
pmastermind-like 3 (Drosophila)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p206/p
/entry
entry colname="c2"
p0.0003304/p
/entry
entry colname="c3"
p2.18/p
/entry
entry colname="c4"
p225961_at/p
/entry
entry colname="c5"
pKLHDC5/p
/entry
entry colname="c6"
pkelch domain containing 5/p
/entry
/row
row rowsep="1"
entry colname="c1"
p207/p
/entry
entry colname="c2"
p0.0003309/p
/entry
entry colname="c3"
p1.48/p
/entry
entry colname="c4"
p212556_at/p
/entry
entry colname="c5"
pSCRIB/p
/entry
entry colname="c6"
pscribbled homolog (Drosophila)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p208/p
/entry
entry colname="c2"
p0.0003322/p
/entry
entry colname="c3"
p2.66/p
/entry
entry colname="c4"
p220494_s_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p209/p
/entry
entry colname="c2"
p0.0003337/p
/entry
entry colname="c3"
p2.38/p
/entry
entry colname="c4"
p242297_at/p
/entry
entry colname="c5"
pRREB1/p
/entry
entry colname="c6"
pras responsive element binding protein 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p210/p
/entry
entry colname="c2"
p0.0003349/p
/entry
entry colname="c3"
p1.9/p
/entry
entry colname="c4"
p228771_at/p
/entry
entry colname="c5"
pADRBK2/p
/entry
entry colname="c6"
padrenergic, beta, receptor kinase 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p211/p
/entry
entry colname="c2"
p0.0003390/p
/entry
entry colname="c3"
p1.19/p
/entry
entry colname="c4"
p227465_at/p
/entry
entry colname="c5"
pKIAA0892/p
/entry
entry colname="c6"
pKIAA0892/p
/entry
/row
row rowsep="1"
entry colname="c1"
p212/p
/entry
entry colname="c2"
p0.0003390/p
/entry
entry colname="c3"
p1.37/p
/entry
entry colname="c4"
p228667_at/p
/entry
entry colname="c5"
pAGPAT4/p
/entry
entry colname="c6"
p1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid acyltransferase, delta)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p213/p
/entry
entry colname="c2"
p0.0003408/p
/entry
entry colname="c3"
p1.72/p
/entry
entry colname="c4"
p202161_at/p
/entry
entry colname="c5"
pPKN1/p
/entry
entry colname="c6"
pprotein kinase N1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p214/p
/entry
entry colname="c2"
p0.0003417/p
/entry
entry colname="c3"
p1.32/p
/entry
entry colname="c4"
pAFFX-LysX-M_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p215/p
/entry
entry colname="c2"
p0.0003429/p
/entry
entry colname="c3"
p1.57/p
/entry
entry colname="c4"
p223314_at/p
/entry
entry colname="c5"
pTSPAN14/p
/entry
entry colname="c6"
ptetraspanin 14/p
/entry
/row
row rowsep="1"
entry colname="c1"
p216/p
/entry
entry colname="c2"
p0.0003438/p
/entry
entry colname="c3"
p2.51/p
/entry
entry colname="c4"
p204610_s_at/p
/entry
entry colname="c5"
pCCDC85B/p
/entry
entry colname="c6"
pcoiled-coil domain containing 85B/p
/entry
/row
row rowsep="1"
entry colname="c1"
p217/p
/entry
entry colname="c2"
p0.0003438/p
/entry
entry colname="c3"
p2.03/p
/entry
entry colname="c4"
p218027_at/p
/entry
entry colname="c5"
pMRPL15/p
/entry
entry colname="c6"
pmitochondrial ribosomal protein L15/p
/entry
/row
row rowsep="1"
entry colname="c1"
p218/p
/entry
entry colname="c2"
p0.0003450/p
/entry
entry colname="c3"
p2.45/p
/entry
entry colname="c4"
p204718_at/p
/entry
entry colname="c5"
pEPHB6/p
/entry
entry colname="c6"
pEPH receptor B6/p
/entry
/row
row rowsep="1"
entry colname="c1"
p219/p
/entry
entry colname="c2"
p0.0003454/p
/entry
entry colname="c3"
p2.06/p
/entry
entry colname="c4"
p227313_at/p
/entry
entry colname="c5"
pCNPY4/p
/entry
entry colname="c6"
pcanopy 4 homolog (zebrafish)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p220/p
/entry
entry colname="c2"
p0.0003454/p
/entry
entry colname="c3"
p1.52/p
/entry
entry colname="c4"
p228600_x_at/p
/entry
entry colname="c5"
pC7orf46/p
/entry
entry colname="c6"
pchromosome 7 open reading frame 46/p
/entry
/row
row rowsep="1"
entry colname="c1"
p221/p
/entry
entry colname="c2"
p0.0003472/p
/entry
entry colname="c3"
p1.28/p
/entry
entry colname="c4"
p226335_at/p
/entry
entry colname="c5"
pRPS6KA3/p
/entry
entry colname="c6"
pribosomal protein S6 kinase, 90kDa, polypeptide 3/p
/entry
/row
row rowsep="1"
entry colname="c1"
p222/p
/entry
entry colname="c2"
p0.0003481/p
/entry
entry colname="c3"
p1.48/p
/entry
entry colname="c4"
p219147_s_at/p
/entry
entry colname="c5"
pC9orf95/p
/entry
entry colname="c6"
pchromosome 9 open reading frame 95/p
/entry
/row
row rowsep="1"
entry colname="c1"
p223/p
/entry
entry colname="c2"
p0.0003492/p
/entry
entry colname="c3"
p1.41/p
/entry
entry colname="c4"
p219801_at/p
/entry
entry colname="c5"
pZNF34/p
/entry
entry colname="c6"
pzinc finger protein 34/p
/entry
/row
row rowsep="1"
entry colname="c1"
p224/p
/entry
entry colname="c2"
p0.0003534/p
/entry
entry colname="c3"
p1.37/p
/entry
entry colname="c4"
p224865_at/p
/entry
entry colname="c5"
pFAR1/p
/entry
entry colname="c6"
pfatty acyl CoA reductase 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p225/p
/entry
entry colname="c2"
p0.0003534/p
/entry
entry colname="c3"
p1.25/p
/entry
entry colname="c4"
p209450_at/p
/entry
entry colname="c5"
pOSGEP/p
/entry
entry colname="c6"
pO-sialoglycoprotein endopeptidase/p
/entry
/row
row rowsep="1"
entry colname="c1"
p226/p
/entry
entry colname="c2"
p0.0003535/p
/entry
entry colname="c3"
p1.8/p
/entry
entry colname="c4"
p239016_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p227/p
/entry
entry colname="c2"
p0.0003567/p
/entry
entry colname="c3"
p1.44/p
/entry
entry colname="c4"
p228670_at/p
/entry
entry colname="c5"
pTEP1/p
/entry
entry colname="c6"
ptelomerase-associated protein 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p228/p
/entry
entry colname="c2"
p0.0003600/p
/entry
entry colname="c3"
p1.87/p
/entry
entry colname="c4"
p210580_x_at/p
/entry
entry colname="c5"
pSULT1A3/p
/entry
entry colname="c6"
psulfotransferase family, cytosolic, 1A, phenol-preferring, member 3/p
/entry
/row
row rowsep="1"
entry colname="c1"
p229/p
/entry
entry colname="c2"
p0.0003607/p
/entry
entry colname="c3"
p1.38/p
/entry
entry colname="c4"
p213945_s_at/p
/entry
entry colname="c5"
pNUP210/p
/entry
entry colname="c6"
pnucleoporin 210kDa/p
/entry
/row
row rowsep="1"
entry colname="c1"
p230/p
/entry
entry colname="c2"
p0.0003644/p
/entry
entry colname="c3"
p1.32/p
/entry
entry colname="c4"
p218505_at/p
/entry
entry colname="c5"
pWDR59/p
/entry
entry colname="c6"
pWD repeat domain 59/p
/entry
/row
row rowsep="1"
entry colname="c1"
p231/p
/entry
entry colname="c2"
p0.0003661/p
/entry
entry colname="c3"
p2.32/p
/entry
entry colname="c4"
p230343_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p232/p
/entry
entry colname="c2"
p0.0003663/p
/entry
entry colname="c3"
p2.08/p
/entry
entry colname="c4"
p230888_at/p
/entry
entry colname="c5"
pWDR91/p
/entry
entry colname="c6"
pWD repeat domain 91/p
/entry
/row
row rowsep="1"
entry colname="c1"
p233/p
/entry
entry colname="c2"
p0.0003691/p
/entry
entry colname="c3"
p1.87/p
/entry
entry colname="c4"
p226368_at/p
/entry
entry colname="c5"
pCHST11/p
/entry
entry colname="c6"
pcarbohydrate (chondroitin 4) sulfotransferase 11/p
/entry
/row
row rowsep="1"
entry colname="c1"
p234/p
/entry
entry colname="c2"
p0.0003691/p
/entry
entry colname="c3"
p1.67/p
/entry
entry colname="c4"
p213364_s_at/p
/entry
entry colname="c5"
pSNX1/p
/entry
entry colname="c6"
psorting nexin 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p235/p
/entry
entry colname="c2"
p0.0003706/p
/entry
entry colname="c3"
p2.17/p
/entry
entry colname="c4"
p213626_at/p
/entry
entry colname="c5"
pCBR4/p
/entry
entry colname="c6"
pcarbonyl reductase 4/p
/entry
/row
row rowsep="1"
entry colname="c1"
p236/p
/entry
entry colname="c2"
p0.0003712/p
/entry
entry colname="c3"
p1.45/p
/entry
entry colname="c4"
pAFFX-PheX-3_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p237/p
/entry
entry colname="c2"
p0.0003730/p
/entry
entry colname="c3"
p1.59/p
/entry
entry colname="c4"
p206567_s_at/p
/entry
entry colname="c5"
pPHF20/p
/entry
entry colname="c6"
pPHD finger protein 20/p
/entry
/row
row rowsep="1"
entry colname="c1"
p238/p
/entry
entry colname="c2"
p0.0003737/p
/entry
entry colname="c3"
p1.49/p
/entry
entry colname="c4"
p221090_s_at/p
/entry
entry colname="c5"
pOGFOD1/p
/entry
entry colname="c6"
p2-oxoglutarate and iron-dependent oxygenase domain containing 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p239/p
/entry
entry colname="c2"
p0.0003762/p
/entry
entry colname="c3"
p1.33/p
/entry
entry colname="c4"
p44040_at/p
/entry
entry colname="c5"
pFBXO41/p
/entry
entry colname="c6"
pF-box protein 41/p
/entry
/row
row rowsep="1"
entry colname="c1"
p240/p
/entry
entry colname="c2"
p0.0003796/p
/entry
entry colname="c3"
p2.03/p
/entry
entry colname="c4"
p226238_at/p
/entry
entry colname="c5"
pMCEE/p
/entry
entry colname="c6"
pmethylmalonyl CoA epimerase/p
/entry
/row
row rowsep="1"
entry colname="c1"
p241/p
/entry
entry colname="c2"
p0.0003812/p
/entry
entry colname="c3"
p1.45/p
/entry
entry colname="c4"
p204562_at/p
/entry
entry colname="c5"
pIRF4/p
/entry
entry colname="c6"
pinterferon regulatory factor 4/p
/entry
/row
row rowsep="1"
entry colname="c1"
p242/p
/entry
entry colname="c2"
p0.0003827/p
/entry
entry colname="c3"
p1.46/p
/entry
entry colname="c4"
p226241_s_at/p
/entry
entry colname="c5"
pMRPL52/p
/entry
entry colname="c6"
pmitochondrial ribosomal protein L52/p
/entry
/row
row rowsep="1"
entry colname="c1"
p243/p
/entry
entry colname="c2"
p0.0003831/p
/entry
entry colname="c3"
p1.46/p
/entry
entry colname="c4"
p220178_at/p
/entry
entry colname="c5"
pC19orf28/p
/entry
entry colname="c6"
pchromosome 19 open reading frame 28/p
/entry
/row
row rowsep="1"
entry colname="c1"
p244/p
/entry
entry colname="c2"
p0.0003841/p
/entry
entry colname="c3"
p1.31/p
/entry
entry colname="c4"
p209263_x_at/p
/entry
entry colname="c5"
pTSPAN4/p
/entry
entry colname="c6"
ptetraspanin 4/p
/entry
/row
row rowsep="1"
entry colname="c1"
p245/p
/entry
entry colname="c2"
p0.0003893/p
/entry
entry colname="c3"
p1.45/p
/entry
entry colname="c4"
p232228_at/p
/entry
entry colname="c5"
pZNF530/p
/entry
entry colname="c6"
pzinc finger protein 530/p
/entry
/row
row rowsep="1"
entry colname="c1"
p246/p
/entry
entry colname="c2"
p0.0003907/p
/entry
entry colname="c3"
p2.04/p
/entry
entry colname="c4"
p208760_at/p
/entry
entry colname="c5"
pUBE2I/p
/entry
entry colname="c6"
pubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p247/p
/entry
entry colname="c2"
p0.0003909/p
/entry
entry colname="c3"
p1.18/p
/entry
entry colname="c4"
p224562_at/p
/entry
entry colname="c5"
pWASF2/p
/entry
entry colname="c6"
pWAS protein family, member 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p248/p
/entry
entry colname="c2"
p0.0003923/p
/entry
entry colname="c3"
p1.63/p
/entry
entry colname="c4"
p213485_s_at/p
/entry
entry colname="c5"
pABCC10/p
/entry
entry colname="c6"
pATP-binding cassette, sub-family C (CFTRMRP), member 10/p
/entry
/row
row rowsep="1"
entry colname="c1"
p249/p
/entry
entry colname="c2"
p0.0003984/p
/entry
entry colname="c3"
p1.13/p
/entry
entry colname="c4"
p202942_at/p
/entry
entry colname="c5"
pETFB/p
/entry
entry colname="c6"
pelectron-transfer-flavoprotein, beta polypeptide/p
/entry
/row
row rowsep="1"
entry colname="c1"
p250/p
/entry
entry colname="c2"
p0.0004011/p
/entry
entry colname="c3"
p1.54/p
/entry
entry colname="c4"
pAFFX-LysX-3_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p251/p
/entry
entry colname="c2"
p0.0004028/p
/entry
entry colname="c3"
p1.79/p
/entry
entry colname="c4"
p212135_s_at/p
/entry
entry colname="c5"
pATP2B4/p
/entry
entry colname="c6"
pATPase, Ca++ transporting, plasma membrane 4/p
/entry
/row
row rowsep="1"
entry colname="c1"
p252/p
/entry
entry colname="c2"
p0.0004062/p
/entry
entry colname="c3"
p1.24/p
/entry
entry colname="c4"
p217828_at/p
/entry
entry colname="c5"
pSLTM/p
/entry
entry colname="c6"
pSAFB-like, transcription modulator/p
/entry
/row
row rowsep="1"
entry colname="c1"
p253/p
/entry
entry colname="c2"
p0.0004150/p
/entry
entry colname="c3"
p2.05/p
/entry
entry colname="c4"
p212875_s_at/p
/entry
entry colname="c5"
pC2CD2/p
/entry
entry colname="c6"
pC2 calcium-dependent domain containing 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p254/p
/entry
entry colname="c2"
p0.0004182/p
/entry
entry colname="c3"
p2.92/p
/entry
entry colname="c4"
p1557411_s_at/p
/entry
entry colname="c5"
pSLC25A43/p
/entry
entry colname="c6"
psolute carrier family 25, member 43/p
/entry
/row
row rowsep="1"
entry colname="c1"
p255/p
/entry
entry colname="c2"
p0.0004259/p
/entry
entry colname="c3"
p2.11/p
/entry
entry colname="c4"
p227117_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p256/p
/entry
entry colname="c2"
p0.0004308/p
/entry
entry colname="c3"
p1.57/p
/entry
entry colname="c4"
p207124_s_at/p
/entry
entry colname="c5"
pGNB5/p
/entry
entry colname="c6"
pguanine nucleotide binding protein (G protein), beta 5/p
/entry
/row
row rowsep="1"
entry colname="c1"
p257/p
/entry
entry colname="c2"
p0.0004325/p
/entry
entry colname="c3"
p1.6/p
/entry
entry colname="c4"
p227607_at/p
/entry
entry colname="c5"
pSTAMBPL1/p
/entry
entry colname="c6"
pSTAM binding protein-like 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p258/p
/entry
entry colname="c2"
p0.0004326/p
/entry
entry colname="c3"
p1.25/p
/entry
entry colname="c4"
p204538_x_at/p
/entry
entry colname="c5"
pNPIP/p
/entry
entry colname="c6"
pnuclear pore complex interacting protein/p
/entry
/row
row rowsep="1"
entry colname="c1"
p259/p
/entry
entry colname="c2"
p0.0004339/p
/entry
entry colname="c3"
p2.03/p
/entry
entry colname="c4"
p244619_at/p
/entry
entry colname="c5"
pBCL10/p
/entry
entry colname="c6"
pB-cell CLLlymphoma 10/p
/entry
/row
row rowsep="1"
entry colname="c1"
p260/p
/entry
entry colname="c2"
p0.0004343/p
/entry
entry colname="c3"
p1.38/p
/entry
entry colname="c4"
p223239_at/p
/entry
entry colname="c5"
pC14orf129/p
/entry
entry colname="c6"
pchromosome 14 open reading frame 129/p
/entry
/row
row rowsep="1"
entry colname="c1"
p261/p
/entry
entry colname="c2"
p0.0004347/p
/entry
entry colname="c3"
p1.58/p
/entry
entry colname="c4"
p201087_at/p
/entry
entry colname="c5"
pPXN/p
/entry
entry colname="c6"
ppaxillin/p
/entry
/row
row rowsep="1"
entry colname="c1"
p262/p
/entry
entry colname="c2"
p0.0004367/p
/entry
entry colname="c3"
p1.8/p
/entry
entry colname="c4"
p219149_x_at/p
/entry
entry colname="c5"
pDBR1/p
/entry
entry colname="c6"
pdebranching enzyme homolog 1 (S. cerevisiae)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p263/p
/entry
entry colname="c2"
p0.0004371/p
/entry
entry colname="c3"
p1.88/p
/entry
entry colname="c4"
p229905_at/p
/entry
entry colname="c5"
pRAP1GDS1/p
/entry
entry colname="c6"
pRAP1, GTP-GDP dissociation stimulator 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p264/p
/entry
entry colname="c2"
p0.0004382/p
/entry
entry colname="c3"
p1.61/p
/entry
entry colname="c4"
p222111_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p265/p
/entry
entry colname="c2"
p0.0004389/p
/entry
entry colname="c3"
p2.71/p
/entry
entry colname="c4"
p235052_at/p
/entry
entry colname="c5"
pZNF792/p
/entry
entry colname="c6"
pzinc finger protein 792/p
/entry
/row
row rowsep="1"
entry colname="c1"
p266/p
/entry
entry colname="c2"
p0.0004422/p
/entry
entry colname="c3"
p1.62/p
/entry
entry colname="c4"
p225748_at/p
/entry
entry colname="c5"
pLTV1/p
/entry
entry colname="c6"
pLTV1 homolog (S. cerevisiae)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p267/p
/entry
entry colname="c2"
p0.0004451/p
/entry
entry colname="c3"
p1.37/p
/entry
entry colname="c4"
p241741_at/p
/entry
entry colname="c5"
pCRLS1/p
/entry
entry colname="c6"
pcardiolipin synthase 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p268/p
/entry
entry colname="c2"
p0.0004463/p
/entry
entry colname="c3"
p1.46/p
/entry
entry colname="c4"
p221504_s_at/p
/entry
entry colname="c5"
pATP6V1H/p
/entry
entry colname="c6"
pATPase, H+ transporting, lysosomal 5057kDa, V1 subunit H/p
/entry
/row
row rowsep="1"
entry colname="c1"
p269/p
/entry
entry colname="c2"
p0.0004468/p
/entry
entry colname="c3"
p1.98/p
/entry
entry colname="c4"
p213448_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p270/p
/entry
entry colname="c2"
p0.0004483/p
/entry
entry colname="c3"
p1.15/p
/entry
entry colname="c4"
p201949_x_at/p
/entry
entry colname="c5"
pCAPZB/p
/entry
entry colname="c6"
pcapping protein (actin filament) muscle Z-line, beta/p
/entry
/row
row rowsep="1"
entry colname="c1"
p271/p
/entry
entry colname="c2"
p0.0004501/p
/entry
entry colname="c3"
p2.15/p
/entry
entry colname="c4"
p234295_at/p
/entry
entry colname="c5"
pDBR1/p
/entry
entry colname="c6"
pdebranching enzyme homolog 1 (S. cerevisiae)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p272/p
/entry
entry colname="c2"
p0.0004505/p
/entry
entry colname="c3"
p1.72/p
/entry
entry colname="c4"
p217608_at/p
/entry
entry colname="c5"
pSFRS12IP1/p
/entry
entry colname="c6"
pSFRS12-interacting protein 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p273/p
/entry
entry colname="c2"
p0.0004518/p
/entry
entry colname="c3"
p1.34/p
/entry
entry colname="c4"
p215737_x_at/p
/entry
entry colname="c5"
pUSF2/p
/entry
entry colname="c6"
pupstream transcription factor 2, c-fos interacting/p
/entry
/row
row rowsep="1"
entry colname="c1"
p274/p
/entry
entry colname="c2"
p0.0004529/p
/entry
entry colname="c3"
p1.47/p
/entry
entry colname="c4"
p215873_x_at/p
/entry
entry colname="c5"
pABCC10/p
/entry
entry colname="c6"
pATP-binding cassette, sub-family C (CFTRMRP), member 10/p
/entry
/row
row rowsep="1"
entry colname="c1"
p275/p
/entry
entry colname="c2"
p0.0004530/p
/entry
entry colname="c3"
p2.34/p
/entry
entry colname="c4"
p1552256_a_at/p
/entry
entry colname="c5"
pSCARB1/p
/entry
entry colname="c6"
pscavenger receptor class B, member 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p276/p
/entry
entry colname="c2"
p0.0004546/p
/entry
entry colname="c3"
p2.47/p
/entry
entry colname="c4"
p208657_s_at/p
/entry
entry colname="c5"
p9-Sep/p
/entry
entry colname="c6"
pseptin 9/p
/entry
/row
row rowsep="1"
entry colname="c1"
p277/p
/entry
entry colname="c2"
p0.0004555/p
/entry
entry colname="c3"
p2.08/p
/entry
entry colname="c4"
p228096_at/p
/entry
entry colname="c5"
pC1orf151/p
/entry
entry colname="c6"
pchromosome 1 open reading frame 151/p
/entry
/row
row rowsep="1"
entry colname="c1"
p278/p
/entry
entry colname="c2"
p0.0004560/p
/entry
entry colname="c3"
p1.75/p
/entry
entry colname="c4"
p222471_s_at/p
/entry
entry colname="c5"
pKCMF1/p
/entry
entry colname="c6"
ppotassium channel modulatory factor 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p279/p
/entry
entry colname="c2"
p0.0004590/p
/entry
entry colname="c3"
p1.55/p
/entry
entry colname="c4"
p48808_at/p
/entry
entry colname="c5"
pDHFR/p
/entry
entry colname="c6"
pdihydrofolate reductase/p
/entry
/row
row rowsep="1"
entry colname="c1"
p280/p
/entry
entry colname="c2"
p0.0004608/p
/entry
entry colname="c3"
p3.5/p
/entry
entry colname="c4"
p227228_s_at/p
/entry
entry colname="c5"
pCCDC88C/p
/entry
entry colname="c6"
pcoiled-coil domain containing 88C/p
/entry
/row
row rowsep="1"
entry colname="c1"
p281/p
/entry
entry colname="c2"
p0.0004636/p
/entry
entry colname="c3"
p1.94/p
/entry
entry colname="c4"
p1558445_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p282/p
/entry
entry colname="c2"
p0.0004641/p
/entry
entry colname="c3"
p1.13/p
/entry
entry colname="c4"
p205540_s_at/p
/entry
entry colname="c5"
pRRAGB/p
/entry
entry colname="c6"
pRas-related GTP binding B/p
/entry
/row
row rowsep="1"
entry colname="c1"
p283/p
/entry
entry colname="c2"
p0.0004670/p
/entry
entry colname="c3"
p1.48/p
/entry
entry colname="c4"
p227239_at/p
/entry
entry colname="c5"
pFAM126A/p
/entry
entry colname="c6"
pfamily with sequence similarity 126, member A/p
/entry
/row
row rowsep="1"
entry colname="c1"
p284/p
/entry
entry colname="c2"
p0.0004673/p
/entry
entry colname="c3"
p1.72/p
/entry
entry colname="c4"
p220246_at/p
/entry
entry colname="c5"
pCAMK1D/p
/entry
entry colname="c6"
pcalciumcalmodulin-dependent protein kinase ID/p
/entry
/row
row rowsep="1"
entry colname="c1"
p285/p
/entry
entry colname="c2"
p0.0004677/p
/entry
entry colname="c3"
p3.38/p
/entry
entry colname="c4"
p226478_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p286/p
/entry
entry colname="c2"
p0.0004700/p
/entry
entry colname="c3"
p1.41/p
/entry
entry colname="c4"
p230235_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p287/p
/entry
entry colname="c2"
p0.0004709/p
/entry
entry colname="c3"
p1.22/p
/entry
entry colname="c4"
p220750_s_at/p
/entry
entry colname="c5"
pLEPRE1/p
/entry
entry colname="c6"
pleucine proline-enriched proteoglycan (leprecan) 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p288/p
/entry
entry colname="c2"
p0.0004727/p
/entry
entry colname="c3"
p2.69/p
/entry
entry colname="c4"
p223455_at/p
/entry
entry colname="c5"
pTCHP/p
/entry
entry colname="c6"
ptrichoplein, keratin filament binding/p
/entry
/row
row rowsep="1"
entry colname="c1"
p289/p
/entry
entry colname="c2"
p0.0004736/p
/entry
entry colname="c3"
p1.31/p
/entry
entry colname="c4"
p238552_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p290/p
/entry
entry colname="c2"
p0.0004739/p
/entry
entry colname="c3"
p1.47/p
/entry
entry colname="c4"
p200827_at/p
/entry
entry colname="c5"
pPLOD1/p
/entry
entry colname="c6"
pprocollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p291/p
/entry
entry colname="c2"
p0.0004751/p
/entry
entry colname="c3"
p1.28/p
/entry
entry colname="c4"
p227710_s_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p292/p
/entry
entry colname="c2"
p0.0004785/p
/entry
entry colname="c3"
p4.77/p
/entry
entry colname="c4"
p236798_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p293/p
/entry
entry colname="c2"
p0.0004788/p
/entry
entry colname="c3"
p1.88/p
/entry
entry colname="c4"
p242824_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p294/p
/entry
entry colname="c2"
p0.0004793/p
/entry
entry colname="c3"
p1.08/p
/entry
entry colname="c4"
p215846_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p295/p
/entry
entry colname="c2"
p0.0004795/p
/entry
entry colname="c3"
p1.92/p
/entry
entry colname="c4"
p211385_x_at/p
/entry
entry colname="c5"
pSULT1A2/p
/entry
entry colname="c6"
psulfotransferase family, cytosolic, 1A, phenol-preferring, member 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p296/p
/entry
entry colname="c2"
p0.0004800/p
/entry
entry colname="c3"
p1.38/p
/entry
entry colname="c4"
p226358_at/p
/entry
entry colname="c5"
pLOC145842/p
/entry
entry colname="c6"
phypothetical protein LOC145842/p
/entry
/row
row rowsep="1"
entry colname="c1"
p297/p
/entry
entry colname="c2"
p0.0004832/p
/entry
entry colname="c3"
p1.95/p
/entry
entry colname="c4"
p213534_s_at/p
/entry
entry colname="c5"
pPASK/p
/entry
entry colname="c6"
pPAS domain containing serinethreonine kinase/p
/entry
/row
row rowsep="1"
entry colname="c1"
p298/p
/entry
entry colname="c2"
p0.0004841/p
/entry
entry colname="c3"
p5.65/p
/entry
entry colname="c4"
p205698_s_at/p
/entry
entry colname="c5"
pMAP2K6/p
/entry
entry colname="c6"
pmitogen-activated protein kinase kinase 6/p
/entry
/row
row rowsep="1"
entry colname="c1"
p299/p
/entry
entry colname="c2"
p0.0004850/p
/entry
entry colname="c3"
p1.53/p
/entry
entry colname="c4"
p222661_at/p
/entry
entry colname="c5"
pAGGF1/p
/entry
entry colname="c6"
pangiogenic factor with G patch and FHA domains 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p300/p
/entry
entry colname="c2"
p0.0004855/p
/entry
entry colname="c3"
p1.43/p
/entry
entry colname="c4"
p212036_s_at/p
/entry
entry colname="c5"
pPNN/p
/entry
entry colname="c6"
ppinin, desmosome associated protein/p
/entry
/row
row rowsep="1"
entry colname="c1"
p301/p
/entry
entry colname="c2"
p0.0004858/p
/entry
entry colname="c3"
p1.6/p
/entry
entry colname="c4"
p244534_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p302/p
/entry
entry colname="c2"
p0.0004876/p
/entry
entry colname="c3"
p1.58/p
/entry
entry colname="c4"
p1555751_a_at/p
/entry
entry colname="c5"
pGEMIN7/p
/entry
entry colname="c6"
pgem (nuclear organelle) associated protein 7/p
/entry
/row
row rowsep="1"
entry colname="c1"
p303/p
/entry
entry colname="c2"
p0.0004879/p
/entry
entry colname="c3"
p1.87/p
/entry
entry colname="c4"
p203063_at/p
/entry
entry colname="c5"
pPPM1F/p
/entry
entry colname="c6"
pprotein phosphatase 1F (PP2C domain containing)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p304/p
/entry
entry colname="c2"
p0.0004973/p
/entry
entry colname="c3"
p1.16/p
/entry
entry colname="c4"
p205922_at/p
/entry
entry colname="c5"
pVNN2/p
/entry
entry colname="c6"
pvanin 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p305/p
/entry
entry colname="c2"
p0.0004975/p
/entry
entry colname="c3"
p1.23/p
/entry
entry colname="c4"
p202797_at/p
/entry
entry colname="c5"
pSACM1L/p
/entry
entry colname="c6"
pSAC1 suppressor of actin mutations 1-like (yeast)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p306/p
/entry
entry colname="c2"
p0.0005017/p
/entry
entry colname="c3"
p2.46/p
/entry
entry colname="c4"
p202826_at/p
/entry
entry colname="c5"
pSPINT1/p
/entry
entry colname="c6"
pserine peptidase inhibitor, Kunitz type 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p307/p
/entry
entry colname="c2"
p0.0005059/p
/entry
entry colname="c3"
p1.73/p
/entry
entry colname="c4"
p226073_at/p
/entry
entry colname="c5"
pTMEM218/p
/entry
entry colname="c6"
ptransmembrane protein 218/p
/entry
/row
row rowsep="1"
entry colname="c1"
p308/p
/entry
entry colname="c2"
p0.0005077/p
/entry
entry colname="c3"
p1.55/p
/entry
entry colname="c4"
p238523_at/p
/entry
entry colname="c5"
pKLHL36/p
/entry
entry colname="c6"
pkelch-like 36 (Drosophila)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p309/p
/entry
entry colname="c2"
p0.0005080/p
/entry
entry colname="c3"
p1.78/p
/entry
entry colname="c4"
p231843_at/p
/entry
entry colname="c5"
pDDX55/p
/entry
entry colname="c6"
pDEAD (Asp-Glu-Ala-Asp) box polypeptide 55/p
/entry
/row
row rowsep="1"
entry colname="c1"
p310/p
/entry
entry colname="c2"
p0.0005094/p
/entry
entry colname="c3"
p2.26/p
/entry
entry colname="c4"
p219714_s_at/p
/entry
entry colname="c5"
pCACNA2D3/p
/entry
entry colname="c6"
pcalcium channel, voltage-dependent, alpha 2delta subunit 3/p
/entry
/row
row rowsep="1"
entry colname="c1"
p311/p
/entry
entry colname="c2"
p0.0005097/p
/entry
entry colname="c3"
p2.02/p
/entry
entry colname="c4"
p229202_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p312/p
/entry
entry colname="c2"
p0.0005114/p
/entry
entry colname="c3"
p3.54/p
/entry
entry colname="c4"
p209048_s_at/p
/entry
entry colname="c5"
pZMYND8/p
/entry
entry colname="c6"
pzinc finger, MYND-type containing 8/p
/entry
/row
row rowsep="1"
entry colname="c1"
p313/p
/entry
entry colname="c2"
p0.0005132/p
/entry
entry colname="c3"
p1.64/p
/entry
entry colname="c4"
p218473_s_at/p
/entry
entry colname="c5"
pGLT25D1/p
/entry
entry colname="c6"
pglycosyltransferase 25 domain containing 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p314/p
/entry
entry colname="c2"
p0.0005172/p
/entry
entry colname="c3"
p1.71/p
/entry
entry colname="c4"
p65493_at/p
/entry
entry colname="c5"
pHEATR6/p
/entry
entry colname="c6"
pHEAT repeat containing 6/p
/entry
/row
row rowsep="1"
entry colname="c1"
p315/p
/entry
entry colname="c2"
p0.0005179/p
/entry
entry colname="c3"
p2.03/p
/entry
entry colname="c4"
p236194_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p316/p
/entry
entry colname="c2"
p0.0005179/p
/entry
entry colname="c3"
p2.28/p
/entry
entry colname="c4"
p226531_at/p
/entry
entry colname="c5"
pORAI1/p
/entry
entry colname="c6"
pORAI calcium release-activated calcium modulator 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p317/p
/entry
entry colname="c2"
p0.0005201/p
/entry
entry colname="c3"
p1.58/p
/entry
entry colname="c4"
p219351_at/p
/entry
entry colname="c5"
pTRAPPC2/p
/entry
entry colname="c6"
ptrafficking protein particle complex 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p318/p
/entry
entry colname="c2"
p0.0005244/p
/entry
entry colname="c3"
p1.26/p
/entry
entry colname="c4"
p220036_s_at/p
/entry
entry colname="c5"
pLMBR1L/p
/entry
entry colname="c6"
plimb region 1 homolog (mouse)-like/p
/entry
/row
row rowsep="1"
entry colname="c1"
p319/p
/entry
entry colname="c2"
p0.0005321/p
/entry
entry colname="c3"
p4.22/p
/entry
entry colname="c4"
p217974_at/p
/entry
entry colname="c5"
pTM7SF3/p
/entry
entry colname="c6"
ptransmembrane 7 superfamily member 3/p
/entry
/row
row rowsep="1"
entry colname="c1"
p320/p
/entry
entry colname="c2"
p0.0005335/p
/entry
entry colname="c3"
p1.26/p
/entry
entry colname="c4"
p211759_x_at/p
/entry
entry colname="c5"
pTBCB/p
/entry
entry colname="c6"
ptubulin folding cofactor B/p
/entry
/row
row rowsep="1"
entry colname="c1"
p321/p
/entry
entry colname="c2"
p0.0005359/p
/entry
entry colname="c3"
p1.4/p
/entry
entry colname="c4"
p242155_x_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p322/p
/entry
entry colname="c2"
p0.0005397/p
/entry
entry colname="c3"
p2/p
/entry
entry colname="c4"
p209377_s_at/p
/entry
entry colname="c5"
pHMGN3/p
/entry
entry colname="c6"
phigh mobility group nucleosomal binding domain 3/p
/entry
/row
row rowsep="1"
entry colname="c1"
p323/p
/entry
entry colname="c2"
p0.0005401/p
/entry
entry colname="c3"
p2.12/p
/entry
entry colname="c4"
p230653_at/p
/entry
entry colname="c5"
pLOC100132218/p
/entry
entry colname="c6"
phypothetical protein LOC100132218/p
/entry
/row
row rowsep="1"
entry colname="c1"
p324/p
/entry
entry colname="c2"
p0.0005504/p
/entry
entry colname="c3"
p1.77/p
/entry
entry colname="c4"
p224708_at/p
/entry
entry colname="c5"
pKIAA2013/p
/entry
entry colname="c6"
pKIAA2013/p
/entry
/row
row rowsep="1"
entry colname="c1"
p325/p
/entry
entry colname="c2"
p0.0005504/p
/entry
entry colname="c3"
p1.9/p
/entry
entry colname="c4"
p204000_at/p
/entry
entry colname="c5"
pGNB5/p
/entry
entry colname="c6"
pguanine nucleotide binding protein (G protein), beta 5/p
/entry
/row
row rowsep="1"
entry colname="c1"
p326/p
/entry
entry colname="c2"
p0.0005559/p
/entry
entry colname="c3"
p1.32/p
/entry
entry colname="c4"
p244346_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p327/p
/entry
entry colname="c2"
p0.0005568/p
/entry
entry colname="c3"
p1.9/p
/entry
entry colname="c4"
p225108_at/p
/entry
entry colname="c5"
pAGPS/p
/entry
entry colname="c6"
palkylglycerone phosphate synthase/p
/entry
/row
row rowsep="1"
entry colname="c1"
p328/p
/entry
entry colname="c2"
p0.0005599/p
/entry
entry colname="c3"
p1.85/p
/entry
entry colname="c4"
p236626_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p329/p
/entry
entry colname="c2"
p0.0005615/p
/entry
entry colname="c3"
p1.85/p
/entry
entry colname="c4"
p228314_at/p
/entry
entry colname="c5"
pLRRC8C/p
/entry
entry colname="c6"
pleucine rich repeat containing 8 family, member C/p
/entry
/row
row rowsep="1"
entry colname="c1"
p330/p
/entry
entry colname="c2"
p0.0005636/p
/entry
entry colname="c3"
p1.46/p
/entry
entry colname="c4"
p1558754_at/p
/entry
entry colname="c5"
pZNF763/p
/entry
entry colname="c6"
pzinc finger protein 763/p
/entry
/row
row rowsep="1"
entry colname="c1"
p331/p
/entry
entry colname="c2"
p0.0005650/p
/entry
entry colname="c3"
p1.42/p
/entry
entry colname="c4"
p226155_at/p
/entry
entry colname="c5"
pFAM160B1/p
/entry
entry colname="c6"
pfamily with sequence similarity 160, member B1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p332/p
/entry
entry colname="c2"
p0.0005679/p
/entry
entry colname="c3"
p1.72/p
/entry
entry colname="c4"
p229705_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p333/p
/entry
entry colname="c2"
p0.0005686/p
/entry
entry colname="c3"
p4.21/p
/entry
entry colname="c4"
p228891_at/p
/entry
entry colname="c5"
pC9orf164/p
/entry
entry colname="c6"
pchromosome 9 open reading frame 164/p
/entry
/row
row rowsep="1"
entry colname="c1"
p334/p
/entry
entry colname="c2"
p0.0005708/p
/entry
entry colname="c3"
p1.49/p
/entry
entry colname="c4"
p225146_at/p
/entry
entry colname="c5"
pC9orf25/p
/entry
entry colname="c6"
pchromosome 9 open reading frame 25/p
/entry
/row
row rowsep="1"
entry colname="c1"
p335/p
/entry
entry colname="c2"
p0.0005724/p
/entry
entry colname="c3"
p1.86/p
/entry
entry colname="c4"
p219817_at/p
/entry
entry colname="c5"
pC12orf47/p
/entry
entry colname="c6"
pchromosome 12 open reading frame 47/p
/entry
/row
row rowsep="1"
entry colname="c1"
p336/p
/entry
entry colname="c2"
p0.0005724/p
/entry
entry colname="c3"
p1.58/p
/entry
entry colname="c4"
p235610_at/p
/entry
entry colname="c5"
pALKBH8/p
/entry
entry colname="c6"
palkB, alkylation repair homolog 8 (E. coli)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p337/p
/entry
entry colname="c2"
p0.0005728/p
/entry
entry colname="c3"
p1.59/p
/entry
entry colname="c4"
p217949_s_at/p
/entry
entry colname="c5"
pVKORC1/p
/entry
entry colname="c6"
pvitamin K epoxide reductase complex, subunit 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p338/p
/entry
entry colname="c2"
p0.0005746/p
/entry
entry colname="c3"
p2.14/p
/entry
entry colname="c4"
p222858_s_at/p
/entry
entry colname="c5"
pDAPP1/p
/entry
entry colname="c6"
pdual adaptor of phosphotyrosine and 3-phosphoinositides/p
/entry
/row
row rowsep="1"
entry colname="c1"
p339/p
/entry
entry colname="c2"
p0.0005748/p
/entry
entry colname="c3"
p1.17/p
/entry
entry colname="c4"
p223049_at/p
/entry
entry colname="c5"
pGRB2/p
/entry
entry colname="c6"
pgrowth factor receptor-bound protein 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p340/p
/entry
entry colname="c2"
p0.0005792/p
/entry
entry colname="c3"
p1.45/p
/entry
entry colname="c4"
p212987_at/p
/entry
entry colname="c5"
pFBXO9/p
/entry
entry colname="c6"
pF-box protein 9/p
/entry
/row
row rowsep="1"
entry colname="c1"
p341/p
/entry
entry colname="c2"
p0.0005793/p
/entry
entry colname="c3"
p1.42/p
/entry
entry colname="c4"
p209903_s_at/p
/entry
entry colname="c5"
pATR/p
/entry
entry colname="c6"
pataxia telangiectasia and Rad3 related/p
/entry
/row
row rowsep="1"
entry colname="c1"
p342/p
/entry
entry colname="c2"
p0.0005805/p
/entry
entry colname="c3"
p1.45/p
/entry
entry colname="c4"
p201067_at/p
/entry
entry colname="c5"
pPSMC2/p
/entry
entry colname="c6"
pproteasome (prosome, macropain) 26S subunit, ATPase, 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p343/p
/entry
entry colname="c2"
p0.0005806/p
/entry
entry colname="c3"
p1.37/p
/entry
entry colname="c4"
p201076_at/p
/entry
entry colname="c5"
pNHP2L1/p
/entry
entry colname="c6"
pNHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p344/p
/entry
entry colname="c2"
p0.0005811/p
/entry
entry colname="c3"
p1.28/p
/entry
entry colname="c4"
p236804_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p345/p
/entry
entry colname="c2"
p0.0005820/p
/entry
entry colname="c3"
p1.27/p
/entry
entry colname="c4"
p234107_s_at/p
/entry
entry colname="c5"
pDTD1/p
/entry
entry colname="c6"
pD-tyrosyl-tRNA deacylase 1 homolog (S. cerevisiae)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p346/p
/entry
entry colname="c2"
p0.0005858/p
/entry
entry colname="c3"
p2.04/p
/entry
entry colname="c4"
p1553987_at/p
/entry
entry colname="c5"
pC12orf47/p
/entry
entry colname="c6"
pchromosome 12 open reading frame 47/p
/entry
/row
row rowsep="1"
entry colname="c1"
p347/p
/entry
entry colname="c2"
p0.0005877/p
/entry
entry colname="c3"
p1.42/p
/entry
entry colname="c4"
p226679_at/p
/entry
entry colname="c5"
pSLC26A11/p
/entry
entry colname="c6"
psolute carrier family 26, member 11/p
/entry
/row
row rowsep="1"
entry colname="c1"
p348/p
/entry
entry colname="c2"
p0.0005893/p
/entry
entry colname="c3"
p1.7/p
/entry
entry colname="c4"
p1554608_at/p
/entry
entry colname="c5"
pTGOLN2/p
/entry
entry colname="c6"
ptrans-golgi network protein 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p349/p
/entry
entry colname="c2"
p0.0005911/p
/entry
entry colname="c3"
p1.65/p
/entry
entry colname="c4"
p219256_s_at/p
/entry
entry colname="c5"
pSH3TC1/p
/entry
entry colname="c6"
pSH3 domain and tetratricopeptide repeats 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p350/p
/entry
entry colname="c2"
p0.0005950/p
/entry
entry colname="c3"
p1.46/p
/entry
entry colname="c4"
p232369_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p351/p
/entry
entry colname="c2"
p0.0005992/p
/entry
entry colname="c3"
p1.39/p
/entry
entry colname="c4"
p243750_x_at/p
/entry
entry colname="c5"
pC21orf70/p
/entry
entry colname="c6"
pchromosome 21 open reading frame 70/p
/entry
/row
row rowsep="1"
entry colname="c1"
p352/p
/entry
entry colname="c2"
p0.0006007/p
/entry
entry colname="c3"
p2.4/p
/entry
entry colname="c4"
p219759_at/p
/entry
entry colname="c5"
pERAP2/p
/entry
entry colname="c6"
pendoplasmic reticulum aminopeptidase 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p353/p
/entry
entry colname="c2"
p0.0006025/p
/entry
entry colname="c3"
p1.24/p
/entry
entry colname="c4"
p203981_s_at/p
/entry
entry colname="c5"
pABCD4/p
/entry
entry colname="c6"
pATP-binding cassette, sub-family D (ALD), member 4/p
/entry
/row
row rowsep="1"
entry colname="c1"
p354/p
/entry
entry colname="c2"
p0.0006028/p
/entry
entry colname="c3"
p1.43/p
/entry
entry colname="c4"
p202428_x_at/p
/entry
entry colname="c5"
pDBI/p
/entry
entry colname="c6"
pdiazepam binding inhibitor (GABA receptor modulator, acyl-Coenzyme A binding protein)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p355/p
/entry
entry colname="c2"
p0.0006039/p
/entry
entry colname="c3"
p1.54/p
/entry
entry colname="c4"
p212886_at/p
/entry
entry colname="c5"
pCCDC69/p
/entry
entry colname="c6"
pcoiled-coil domain containing 69/p
/entry
/row
row rowsep="1"
entry colname="c1"
p356/p
/entry
entry colname="c2"
p0.0006041/p
/entry
entry colname="c3"
p2.12/p
/entry
entry colname="c4"
p221878_at/p
/entry
entry colname="c5"
pC2orf68/p
/entry
entry colname="c6"
pchromosome 2 open reading frame 68/p
/entry
/row
row rowsep="1"
entry colname="c1"
p357/p
/entry
entry colname="c2"
p0.0006052/p
/entry
entry colname="c3"
p1.91/p
/entry
entry colname="c4"
p202039_at/p
/entry
entry colname="c5"
pTIAF1/p
/entry
entry colname="c6"
pTGFB1-induced anti-apoptotic factor 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p358/p
/entry
entry colname="c2"
p0.0006058/p
/entry
entry colname="c3"
p2.8/p
/entry
entry colname="c4"
p40472_at/p
/entry
entry colname="c5"
pLPCAT4/p
/entry
entry colname="c6"
plysophosphatidylcholine acyltransferase 4/p
/entry
/row
row rowsep="1"
entry colname="c1"
p359/p
/entry
entry colname="c2"
p0.0006135/p
/entry
entry colname="c3"
p1.48/p
/entry
entry colname="c4"
p217751_at/p
/entry
entry colname="c5"
pGSTK1/p
/entry
entry colname="c6"
pglutathione S-transferase kappa 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p360/p
/entry
entry colname="c2"
p0.0006135/p
/entry
entry colname="c3"
p1.84/p
/entry
entry colname="c4"
p228303_at/p
/entry
entry colname="c5"
pGALNT6/p
/entry
entry colname="c6"
pUDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p361/p
/entry
entry colname="c2"
p0.0006147/p
/entry
entry colname="c3"
p1.44/p
/entry
entry colname="c4"
p202172_at/p
/entry
entry colname="c5"
pVEZF1/p
/entry
entry colname="c6"
pvascular endothelial zinc finger 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p362/p
/entry
entry colname="c2"
p0.0006167/p
/entry
entry colname="c3"
p2.09/p
/entry
entry colname="c4"
p1558692_at/p
/entry
entry colname="c5"
pC1orf85/p
/entry
entry colname="c6"
pchromosome 1 open reading frame 85/p
/entry
/row
row rowsep="1"
entry colname="c1"
p363/p
/entry
entry colname="c2"
p0.0006190/p
/entry
entry colname="c3"
p1.89/p
/entry
entry colname="c4"
p207122_x_at/p
/entry
entry colname="c5"
pSULT1A2/p
/entry
entry colname="c6"
psulfotransferase family, cytosolic, 1A, phenol-preferring, member 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p364/p
/entry
entry colname="c2"
p0.0006205/p
/entry
entry colname="c3"
p1.49/p
/entry
entry colname="c4"
p1560874_at/p
/entry
entry colname="c5"
pFLJ33046/p
/entry
entry colname="c6"
phypothetical gene supported by AK057608/p
/entry
/row
row rowsep="1"
entry colname="c1"
p365/p
/entry
entry colname="c2"
p0.0006228/p
/entry
entry colname="c3"
p1.97/p
/entry
entry colname="c4"
p212473_s_at/p
/entry
entry colname="c5"
pMICAL2/p
/entry
entry colname="c6"
pmicrotubule associated monoxygenase, calponin and LIM domain containing 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p366/p
/entry
entry colname="c2"
p0.0006241/p
/entry
entry colname="c3"
p1.67/p
/entry
entry colname="c4"
p225409_at/p
/entry
entry colname="c5"
pC2orf64/p
/entry
entry colname="c6"
pchromosome 2 open reading frame 64/p
/entry
/row
row rowsep="1"
entry colname="c1"
p367/p
/entry
entry colname="c2"
p0.0006246/p
/entry
entry colname="c3"
p1.97/p
/entry
entry colname="c4"
p203615_x_at/p
/entry
entry colname="c5"
pSULT1A1/p
/entry
entry colname="c6"
psulfotransferase family, cytosolic, 1A, phenol-preferring, member 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p368/p
/entry
entry colname="c2"
p0.0006275/p
/entry
entry colname="c3"
p1.4/p
/entry
entry colname="c4"
p224724_at/p
/entry
entry colname="c5"
pSULF2/p
/entry
entry colname="c6"
psulfatase 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p369/p
/entry
entry colname="c2"
p0.0006277/p
/entry
entry colname="c3"
p1.47/p
/entry
entry colname="c4"
p225022_at/p
/entry
entry colname="c5"
pGOPC/p
/entry
entry colname="c6"
pgolgi associated PDZ and coiled-coil motif containing/p
/entry
/row
row rowsep="1"
entry colname="c1"
p370/p
/entry
entry colname="c2"
p0.0006282/p
/entry
entry colname="c3"
p1.18/p
/entry
entry colname="c4"
p214879_x_at/p
/entry
entry colname="c5"
pUSF2/p
/entry
entry colname="c6"
pupstream transcription factor 2, c-fos interacting/p
/entry
/row
row rowsep="1"
entry colname="c1"
p371/p
/entry
entry colname="c2"
p0.0006311/p
/entry
entry colname="c3"
p1.43/p
/entry
entry colname="c4"
p222843_at/p
/entry
entry colname="c5"
pFIGNL1/p
/entry
entry colname="c6"
pfidgetin-like 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p372/p
/entry
entry colname="c2"
p0.0006313/p
/entry
entry colname="c3"
p2.06/p
/entry
entry colname="c4"
p210136_at/p
/entry
entry colname="c5"
pMBP/p
/entry
entry colname="c6"
pmyelin basic protein/p
/entry
/row
row rowsep="1"
entry colname="c1"
p373/p
/entry
entry colname="c2"
p0.0006322/p
/entry
entry colname="c3"
p2.27/p
/entry
entry colname="c4"
p229512_at/p
/entry
entry colname="c5"
pFAM120C/p
/entry
entry colname="c6"
pfamily with sequence similarity 120C/p
/entry
/row
row rowsep="1"
entry colname="c1"
p374/p
/entry
entry colname="c2"
p0.0006326/p
/entry
entry colname="c3"
p1.2/p
/entry
entry colname="c4"
p209017_s_at/p
/entry
entry colname="c5"
pLONP1/p
/entry
entry colname="c6"
plon peptidase 1, mitochondrial/p
/entry
/row
row rowsep="1"
entry colname="c1"
p375/p
/entry
entry colname="c2"
p0.0006333/p
/entry
entry colname="c3"
p1.69/p
/entry
entry colname="c4"
p237926_s_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p376/p
/entry
entry colname="c2"
p0.0006351/p
/entry
entry colname="c3"
p1.44/p
/entry
entry colname="c4"
p222294_s_at/p
/entry
entry colname="c5"
pRAB27A/p
/entry
entry colname="c6"
pRAB27A, member RAS oncogene family/p
/entry
/row
row rowsep="1"
entry colname="c1"
p377/p
/entry
entry colname="c2"
p0.0006411/p
/entry
entry colname="c3"
p3.49/p
/entry
entry colname="c4"
p210986_s_at/p
/entry
entry colname="c5"
pTPM1/p
/entry
entry colname="c6"
ptropomyosin 1 (alpha)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p378/p
/entry
entry colname="c2"
p0.0006490/p
/entry
entry colname="c3"
p1.28/p
/entry
entry colname="c4"
p209932_s_at/p
/entry
entry colname="c5"
pDUT/p
/entry
entry colname="c6"
pdeoxyuridine triphosphatase/p
/entry
/row
row rowsep="1"
entry colname="c1"
p379/p
/entry
entry colname="c2"
p0.0006513/p
/entry
entry colname="c3"
p1.28/p
/entry
entry colname="c4"
p227656_at/p
/entry
entry colname="c5"
pC6orf70/p
/entry
entry colname="c6"
pchromosome 6 open reading frame 70/p
/entry
/row
row rowsep="1"
entry colname="c1"
p380/p
/entry
entry colname="c2"
p0.0006514/p
/entry
entry colname="c3"
p1.63/p
/entry
entry colname="c4"
p228131_at/p
/entry
entry colname="c5"
pERCC1/p
/entry
entry colname="c6"
pexcision repair cross-complementing rodent repair deficiency, complementation group 1 (includes overlapping antisense sequence)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p381/p
/entry
entry colname="c2"
p0.0006519/p
/entry
entry colname="c3"
p1.11/p
/entry
entry colname="c4"
p212848_s_at/p
/entry
entry colname="c5"
pC9orf3/p
/entry
entry colname="c6"
pchromosome 9 open reading frame 3/p
/entry
/row
row rowsep="1"
entry colname="c1"
p382/p
/entry
entry colname="c2"
p0.0006526/p
/entry
entry colname="c3"
p2.3/p
/entry
entry colname="c4"
p1552540_s_at/p
/entry
entry colname="c5"
pIQCD/p
/entry
entry colname="c6"
pIQ motif containing D/p
/entry
/row
row rowsep="1"
entry colname="c1"
p383/p
/entry
entry colname="c2"
p0.0006530/p
/entry
entry colname="c3"
p2.09/p
/entry
entry colname="c4"
p239698_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p384/p
/entry
entry colname="c2"
p0.0006586/p
/entry
entry colname="c3"
p1.62/p
/entry
entry colname="c4"
p1553102_a_at/p
/entry
entry colname="c5"
pCCDC69/p
/entry
entry colname="c6"
pcoiled-coil domain containing 69/p
/entry
/row
row rowsep="1"
entry colname="c1"
p385/p
/entry
entry colname="c2"
p0.0006622/p
/entry
entry colname="c3"
p1.77/p
/entry
entry colname="c4"
p228542_at/p
/entry
entry colname="c5"
pMRS2/p
/entry
entry colname="c6"
pMRS2 magnesium homeostasis factor homolog (S. cerevisiae)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p386/p
/entry
entry colname="c2"
p0.0006623/p
/entry
entry colname="c3"
p1.37/p
/entry
entry colname="c4"
p208956_x_at/p
/entry
entry colname="c5"
pDUT/p
/entry
entry colname="c6"
pdeoxyuridine triphosphatase/p
/entry
/row
row rowsep="1"
entry colname="c1"
p387/p
/entry
entry colname="c2"
p0.0006635/p
/entry
entry colname="c3"
p2.14/p
/entry
entry colname="c4"
p223528_s_at/p
/entry
entry colname="c5"
pMETT11D1/p
/entry
entry colname="c6"
pmethyltransferase 11 domain containing 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p388/p
/entry
entry colname="c2"
p0.0006636/p
/entry
entry colname="c3"
p1.38/p
/entry
entry colname="c4"
p201234_at/p
/entry
entry colname="c5"
pILK/p
/entry
entry colname="c6"
pintegrin-linked kinase/p
/entry
/row
row rowsep="1"
entry colname="c1"
p389/p
/entry
entry colname="c2"
p0.0006637/p
/entry
entry colname="c3"
p1.57/p
/entry
entry colname="c4"
p228694_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p390/p
/entry
entry colname="c2"
p0.0006659/p
/entry
entry colname="c3"
p1.36/p
/entry
entry colname="c4"
p225136_at/p
/entry
entry colname="c5"
pPLEKHA2/p
/entry
entry colname="c6"
ppleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p391/p
/entry
entry colname="c2"
p0.0006723/p
/entry
entry colname="c3"
p1.55/p
/entry
entry colname="c4"
p212567_s_at/p
/entry
entry colname="c5"
pMAP4/p
/entry
entry colname="c6"
pmicrotubule-associated protein 4/p
/entry
/row
row rowsep="1"
entry colname="c1"
p392/p
/entry
entry colname="c2"
p0.0006726/p
/entry
entry colname="c3"
p1.52/p
/entry
entry colname="c4"
p219549_s_at/p
/entry
entry colname="c5"
pRTN3/p
/entry
entry colname="c6"
preticulon 3/p
/entry
/row
row rowsep="1"
entry colname="c1"
p393/p
/entry
entry colname="c2"
p0.0006730/p
/entry
entry colname="c3"
p1.89/p
/entry
entry colname="c4"
p232681_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p394/p
/entry
entry colname="c2"
p0.0006742/p
/entry
entry colname="c3"
p2.21/p
/entry
entry colname="c4"
p219627_at/p
/entry
entry colname="c5"
pZNF767/p
/entry
entry colname="c6"
pzinc finger family member 767/p
/entry
/row
row rowsep="1"
entry colname="c1"
p395/p
/entry
entry colname="c2"
p0.0006762/p
/entry
entry colname="c3"
p2.7/p
/entry
entry colname="c4"
p231449_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p396/p
/entry
entry colname="c2"
p0.0006771/p
/entry
entry colname="c3"
p1.58/p
/entry
entry colname="c4"
p239035_at/p
/entry
entry colname="c5"
pMTHFR/p
/entry
entry colname="c6"
p5,10-methylenetetrahydrofolate reductase (NADPH)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p397/p
/entry
entry colname="c2"
p0.0006773/p
/entry
entry colname="c3"
p1.39/p
/entry
entry colname="c4"
p205256_at/p
/entry
entry colname="c5"
pZBTB39/p
/entry
entry colname="c6"
pzinc finger and BTB domain containing 39/p
/entry
/row
row rowsep="1"
entry colname="c1"
p398/p
/entry
entry colname="c2"
p0.0006786/p
/entry
entry colname="c3"
p1.51/p
/entry
entry colname="c4"
p205945_at/p
/entry
entry colname="c5"
pIL6R/p
/entry
entry colname="c6"
pinterleukin 6 receptor/p
/entry
/row
row rowsep="1"
entry colname="c1"
p399/p
/entry
entry colname="c2"
p0.0006802/p
/entry
entry colname="c3"
p4.26/p
/entry
entry colname="c4"
p230032_at/p
/entry
entry colname="c5"
pOSGEPL1/p
/entry
entry colname="c6"
pO-sialoglycoprotein endopeptidase-like 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p400/p
/entry
entry colname="c2"
p0.0006837/p
/entry
entry colname="c3"
p1.56/p
/entry
entry colname="c4"
p225888_at/p
/entry
entry colname="c5"
pC12orf30/p
/entry
entry colname="c6"
pchromosome 12 open reading frame 30/p
/entry
/row
row rowsep="1"
entry colname="c1"
p401/p
/entry
entry colname="c2"
p0.0006840/p
/entry
entry colname="c3"
p1.35/p
/entry
entry colname="c4"
p227767_at/p
/entry
entry colname="c5"
pCSNK1G3/p
/entry
entry colname="c6"
pcasein kinase 1, gamma 3/p
/entry
/row
row rowsep="1"
entry colname="c1"
p402/p
/entry
entry colname="c2"
p0.0006879/p
/entry
entry colname="c3"
p1.76/p
/entry
entry colname="c4"
p205060_at/p
/entry
entry colname="c5"
pPARG/p
/entry
entry colname="c6"
ppoly (ADP-ribose) glycohydrolase/p
/entry
/row
row rowsep="1"
entry colname="c1"
p403/p
/entry
entry colname="c2"
p0.0006921/p
/entry
entry colname="c3"
p1.37/p
/entry
entry colname="c4"
p239730_at/p
/entry
entry colname="c5"
pDGCR14/p
/entry
entry colname="c6"
pDiGeorge syndrome critical region gene 14/p
/entry
/row
row rowsep="1"
entry colname="c1"
p404/p
/entry
entry colname="c2"
p0.0006924/p
/entry
entry colname="c3"
p1.58/p
/entry
entry colname="c4"
p201029_s_at/p
/entry
entry colname="c5"
pCD99/p
/entry
entry colname="c6"
pCD99 molecule/p
/entry
/row
row rowsep="1"
entry colname="c1"
p405/p
/entry
entry colname="c2"
p0.0006928/p
/entry
entry colname="c3"
p1.63/p
/entry
entry colname="c4"
p211709_s_at/p
/entry
entry colname="c5"
pCLEC11A/p
/entry
entry colname="c6"
pC-type lectin domain family 11, member A/p
/entry
/row
row rowsep="1"
entry colname="c1"
p406/p
/entry
entry colname="c2"
p0.0006952/p
/entry
entry colname="c3"
p1.95/p
/entry
entry colname="c4"
p201985_at/p
/entry
entry colname="c5"
pKIAA0196/p
/entry
entry colname="c6"
pKIAA0196/p
/entry
/row
row rowsep="1"
entry colname="c1"
p407/p
/entry
entry colname="c2"
p0.0006964/p
/entry
entry colname="c3"
p2.17/p
/entry
entry colname="c4"
p204995_at/p
/entry
entry colname="c5"
pCDK5R1/p
/entry
entry colname="c6"
pcyclin-dependent kinase 5, regulatory subunit 1 (p35)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p408/p
/entry
entry colname="c2"
p0.0007029/p
/entry
entry colname="c3"
p1.52/p
/entry
entry colname="c4"
p217521_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p409/p
/entry
entry colname="c2"
p0.0007045/p
/entry
entry colname="c3"
p1.35/p
/entry
entry colname="c4"
p1558184_s_at/p
/entry
entry colname="c5"
pZNF17/p
/entry
entry colname="c6"
pzinc finger protein 17/p
/entry
/row
row rowsep="1"
entry colname="c1"
p410/p
/entry
entry colname="c2"
p0.0007099/p
/entry
entry colname="c3"
p1.24/p
/entry
entry colname="c4"
p218167_at/p
/entry
entry colname="c5"
pAMZ2/p
/entry
entry colname="c6"
parchaelysin family metallopeptidase 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p411/p
/entry
entry colname="c2"
p0.0007119/p
/entry
entry colname="c3"
p1.52/p
/entry
entry colname="c4"
p226712_at/p
/entry
entry colname="c5"
pSSR1/p
/entry
entry colname="c6"
psignal sequence receptor, alpha/p
/entry
/row
row rowsep="1"
entry colname="c1"
p412/p
/entry
entry colname="c2"
p0.0007129/p
/entry
entry colname="c3"
p1.22/p
/entry
entry colname="c4"
p238668_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p413/p
/entry
entry colname="c2"
p0.0007138/p
/entry
entry colname="c3"
p1.16/p
/entry
entry colname="c4"
p221651_x_at/p
/entry
entry colname="c5"
pIGKC/p
/entry
entry colname="c6"
pimmunoglobulin kappa constant/p
/entry
/row
row rowsep="1"
entry colname="c1"
p414/p
/entry
entry colname="c2"
p0.0007143/p
/entry
entry colname="c3"
p1.85/p
/entry
entry colname="c4"
p64064_at/p
/entry
entry colname="c5"
pGIMAP5/p
/entry
entry colname="c6"
pGTPase, IMAP family member 5/p
/entry
/row
row rowsep="1"
entry colname="c1"
p415/p
/entry
entry colname="c2"
p0.0007160/p
/entry
entry colname="c3"
p1.24/p
/entry
entry colname="c4"
p234734_s_at/p
/entry
entry colname="c5"
pTNRC6A/p
/entry
entry colname="c6"
ptrinucleotide repeat containing 6A/p
/entry
/row
row rowsep="1"
entry colname="c1"
p416/p
/entry
entry colname="c2"
p0.0007165/p
/entry
entry colname="c3"
p1.34/p
/entry
entry colname="c4"
p213582_at/p
/entry
entry colname="c5"
pATP11A/p
/entry
entry colname="c6"
pATPase, class VI, type 11A/p
/entry
/row
row rowsep="1"
entry colname="c1"
p417/p
/entry
entry colname="c2"
p0.0007176/p
/entry
entry colname="c3"
p1.34/p
/entry
entry colname="c4"
p226165_at/p
/entry
entry colname="c5"
pC8orf59/p
/entry
entry colname="c6"
pchromosome 8 open reading frame 59/p
/entry
/row
row rowsep="1"
entry colname="c1"
p418/p
/entry
entry colname="c2"
p0.0007186/p
/entry
entry colname="c3"
p2.61/p
/entry
entry colname="c4"
p205565_s_at/p
/entry
entry colname="c5"
pFXN/p
/entry
entry colname="c6"
pfrataxin/p
/entry
/row
row rowsep="1"
entry colname="c1"
p419/p
/entry
entry colname="c2"
p0.0007225/p
/entry
entry colname="c3"
p1.21/p
/entry
entry colname="c4"
p220251_at/p
/entry
entry colname="c5"
pC1orf107/p
/entry
entry colname="c6"
pchromosome 1 open reading frame 107/p
/entry
/row
row rowsep="1"
entry colname="c1"
p420/p
/entry
entry colname="c2"
p0.0007231/p
/entry
entry colname="c3"
p2.16/p
/entry
entry colname="c4"
p225980_at/p
/entry
entry colname="c5"
pC14orf43/p
/entry
entry colname="c6"
pchromosome 14 open reading frame 43/p
/entry
/row
row rowsep="1"
entry colname="c1"
p421/p
/entry
entry colname="c2"
p0.0007247/p
/entry
entry colname="c3"
p1.69/p
/entry
entry colname="c4"
p238379_x_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p422/p
/entry
entry colname="c2"
p0.0007266/p
/entry
entry colname="c3"
p1.72/p
/entry
entry colname="c4"
p1559034_at/p
/entry
entry colname="c5"
pSIRPB2/p
/entry
entry colname="c6"
psignal-regulatory protein beta 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p423/p
/entry
entry colname="c2"
p0.0007273/p
/entry
entry colname="c3"
p1.21/p
/entry
entry colname="c4"
p201053_s_at/p
/entry
entry colname="c5"
pPSMF1/p
/entry
entry colname="c6"
pproteasome (prosome, macropain) inhibitor subunit 1 (PI31)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p424/p
/entry
entry colname="c2"
p0.0007318/p
/entry
entry colname="c3"
p1.1/p
/entry
entry colname="c4"
p40225_at/p
/entry
entry colname="c5"
pGAK/p
/entry
entry colname="c6"
pcyclin G associated kinase/p
/entry
/row
row rowsep="1"
entry colname="c1"
p425/p
/entry
entry colname="c2"
p0.0007329/p
/entry
entry colname="c3"
p2.14/p
/entry
entry colname="c4"
p209729_at/p
/entry
entry colname="c5"
pGAS2L1/p
/entry
entry colname="c6"
pgrowth arrest-specific 2 like 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p426/p
/entry
entry colname="c2"
p0.0007344/p
/entry
entry colname="c3"
p1.55/p
/entry
entry colname="c4"
p221027_s_at/p
/entry
entry colname="c5"
pPLA2G12A/p
/entry
entry colname="c6"
pphospholipase A2, group XIIA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p427/p
/entry
entry colname="c2"
p0.0007348/p
/entry
entry colname="c3"
p1.28/p
/entry
entry colname="c4"
p209724_s_at/p
/entry
entry colname="c5"
pZFP161/p
/entry
entry colname="c6"
pzinc finger protein 161 homolog (mouse)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p428/p
/entry
entry colname="c2"
p0.0007380/p
/entry
entry colname="c3"
p1.4/p
/entry
entry colname="c4"
p214494_s_at/p
/entry
entry colname="c5"
pSPG7/p
/entry
entry colname="c6"
pspastic paraplegia 7 (pure and complicated autosomal recessive)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p429/p
/entry
entry colname="c2"
p0.0007392/p
/entry
entry colname="c3"
p1.58/p
/entry
entry colname="c4"
p205131_x_at/p
/entry
entry colname="c5"
pCLEC11A/p
/entry
entry colname="c6"
pC-type lectin domain family 11, member A/p
/entry
/row
row rowsep="1"
entry colname="c1"
p430/p
/entry
entry colname="c2"
p0.0007393/p
/entry
entry colname="c3"
p2.07/p
/entry
entry colname="c4"
p204019_s_at/p
/entry
entry colname="c5"
pSH3YL1/p
/entry
entry colname="c6"
pSH3 domain containing, Ysc84-like 1 (S. cerevisiae)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p431/p
/entry
entry colname="c2"
p0.0007417/p
/entry
entry colname="c3"
p1.42/p
/entry
entry colname="c4"
p214861_at/p
/entry
entry colname="c5"
pJMJD2C/p
/entry
entry colname="c6"
pjumonji domain containing 2C/p
/entry
/row
row rowsep="1"
entry colname="c1"
p432/p
/entry
entry colname="c2"
p0.0007421/p
/entry
entry colname="c3"
p1.69/p
/entry
entry colname="c4"
p242965_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p433/p
/entry
entry colname="c2"
p0.0007485/p
/entry
entry colname="c3"
p1.99/p
/entry
entry colname="c4"
p228167_at/p
/entry
entry colname="c5"
pKLHL6/p
/entry
entry colname="c6"
pkelch-like 6 (Drosophila)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p434/p
/entry
entry colname="c2"
p0.0007547/p
/entry
entry colname="c3"
p2.15/p
/entry
entry colname="c4"
p209269_s_at/p
/entry
entry colname="c5"
pSYK/p
/entry
entry colname="c6"
pspleen tyrosine kinase/p
/entry
/row
row rowsep="1"
entry colname="c1"
p435/p
/entry
entry colname="c2"
p0.0007563/p
/entry
entry colname="c3"
p1.5/p
/entry
entry colname="c4"
p244663_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p436/p
/entry
entry colname="c2"
p0.0007563/p
/entry
entry colname="c3"
p2.14/p
/entry
entry colname="c4"
p203802_x_at/p
/entry
entry colname="c5"
pNSUN5/p
/entry
entry colname="c6"
pNOL1NOP2Sun domain family, member 5/p
/entry
/row
row rowsep="1"
entry colname="c1"
p437/p
/entry
entry colname="c2"
p0.0007578/p
/entry
entry colname="c3"
p1.62/p
/entry
entry colname="c4"
p242108_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p438/p
/entry
entry colname="c2"
p0.0007655/p
/entry
entry colname="c3"
p1.46/p
/entry
entry colname="c4"
p205632_s_at/p
/entry
entry colname="c5"
pPIP5K1B/p
/entry
entry colname="c6"
pphosphatidylinositol-4-phosphate 5-kinase, type I, beta/p
/entry
/row
row rowsep="1"
entry colname="c1"
p439/p
/entry
entry colname="c2"
p0.0007691/p
/entry
entry colname="c3"
p2.28/p
/entry
entry colname="c4"
p238604_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p440/p
/entry
entry colname="c2"
p0.0007694/p
/entry
entry colname="c3"
p1.25/p
/entry
entry colname="c4"
p219084_at/p
/entry
entry colname="c5"
pNSD1/p
/entry
entry colname="c6"
pnuclear receptor binding SET domain protein 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p441/p
/entry
entry colname="c2"
p0.0007712/p
/entry
entry colname="c3"
p1.4/p
/entry
entry colname="c4"
p223716_s_at/p
/entry
entry colname="c5"
pZRANB2/p
/entry
entry colname="c6"
pzinc finger, RAN-binding domain containing 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p442/p
/entry
entry colname="c2"
p0.0007728/p
/entry
entry colname="c3"
p1.82/p
/entry
entry colname="c4"
p209760_at/p
/entry
entry colname="c5"
pKIAA0922/p
/entry
entry colname="c6"
pKIAA0922/p
/entry
/row
row rowsep="1"
entry colname="c1"
p443/p
/entry
entry colname="c2"
p0.0007796/p
/entry
entry colname="c3"
p1.29/p
/entry
entry colname="c4"
p214437_s_at/p
/entry
entry colname="c5"
pSHMT2/p
/entry
entry colname="c6"
pserine hydroxymethyltransferase 2 (mitochondrial)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p444/p
/entry
entry colname="c2"
p0.0007836/p
/entry
entry colname="c3"
p1.46/p
/entry
entry colname="c4"
p224704_at/p
/entry
entry colname="c5"
pTNRC6A/p
/entry
entry colname="c6"
ptrinucleotide repeat containing 6A/p
/entry
/row
row rowsep="1"
entry colname="c1"
p445/p
/entry
entry colname="c2"
p0.0007841/p
/entry
entry colname="c3"
p2.01/p
/entry
entry colname="c4"
p223339_at/p
/entry
entry colname="c5"
pATPIF1/p
/entry
entry colname="c6"
pATPase inhibitory factor 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p446/p
/entry
entry colname="c2"
p0.0007848/p
/entry
entry colname="c3"
p1.59/p
/entry
entry colname="c4"
p222622_at/p
/entry
entry colname="c5"
pPGP/p
/entry
entry colname="c6"
pphosphoglycolate phosphatase/p
/entry
/row
row rowsep="1"
entry colname="c1"
p447/p
/entry
entry colname="c2"
p0.0007851/p
/entry
entry colname="c3"
p1.62/p
/entry
entry colname="c4"
p218231_at/p
/entry
entry colname="c5"
pNAGK/p
/entry
entry colname="c6"
pN-acetylglucosamine kinase/p
/entry
/row
row rowsep="1"
entry colname="c1"
p448/p
/entry
entry colname="c2"
p0.0007878/p
/entry
entry colname="c3"
p1.79/p
/entry
entry colname="c4"
p1554544_a_at/p
/entry
entry colname="c5"
pMBP/p
/entry
entry colname="c6"
pmyelin basic protein/p
/entry
/row
row rowsep="1"
entry colname="c1"
p449/p
/entry
entry colname="c2"
p0.0007894/p
/entry
entry colname="c3"
p2.2/p
/entry
entry colname="c4"
p1554250_s_at/p
/entry
entry colname="c5"
pTRIM73/p
/entry
entry colname="c6"
ptripartite motif-containing 73/p
/entry
/row
row rowsep="1"
entry colname="c1"
p450/p
/entry
entry colname="c2"
p0.0007896/p
/entry
entry colname="c3"
p2.19/p
/entry
entry colname="c4"
p216199_s_at/p
/entry
entry colname="c5"
pMAP3K4/p
/entry
entry colname="c6"
pmitogen-activated protein kinase kinase kinase 4/p
/entry
/row
row rowsep="1"
entry colname="c1"
p451/p
/entry
entry colname="c2"
p0.0007925/p
/entry
entry colname="c3"
p1.3/p
/entry
entry colname="c4"
p206881_s_at/p
/entry
entry colname="c5"
pLILRA3/p
/entry
entry colname="c6"
pleukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 3/p
/entry
/row
row rowsep="1"
entry colname="c1"
p452/p
/entry
entry colname="c2"
p0.0007976/p
/entry
entry colname="c3"
p1.65/p
/entry
entry colname="c4"
p226716_at/p
/entry
entry colname="c5"
pPRR12/p
/entry
entry colname="c6"
pproline rich 12/p
/entry
/row
row rowsep="1"
entry colname="c1"
p453/p
/entry
entry colname="c2"
p0.0007989/p
/entry
entry colname="c3"
p1.67/p
/entry
entry colname="c4"
p202534_x_at/p
/entry
entry colname="c5"
pDHFR/p
/entry
entry colname="c6"
pdihydrofolate reductase/p
/entry
/row
row rowsep="1"
entry colname="c1"
p454/p
/entry
entry colname="c2"
p0.0007995/p
/entry
entry colname="c3"
p2.43/p
/entry
entry colname="c4"
p202369_s_at/p
/entry
entry colname="c5"
pTRAM2/p
/entry
entry colname="c6"
ptranslocation associated membrane protein 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p455/p
/entry
entry colname="c2"
p0.0008009/p
/entry
entry colname="c3"
p2.59/p
/entry
entry colname="c4"
p218112_at/p
/entry
entry colname="c5"
pMRPS34/p
/entry
entry colname="c6"
pmitochondrial ribosomal protein S34/p
/entry
/row
row rowsep="1"
entry colname="c1"
p456/p
/entry
entry colname="c2"
p0.0008035/p
/entry
entry colname="c3"
p1.48/p
/entry
entry colname="c4"
p230925_at/p
/entry
entry colname="c5"
pAPBB1IP/p
/entry
entry colname="c6"
pamyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein/p
/entry
/row
row rowsep="1"
entry colname="c1"
p457/p
/entry
entry colname="c2"
p0.0008086/p
/entry
entry colname="c3"
p1.16/p
/entry
entry colname="c4"
p213027_at/p
/entry
entry colname="c5"
pTROVE2/p
/entry
entry colname="c6"
pTROVE domain family, member 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p458/p
/entry
entry colname="c2"
p0.0008124/p
/entry
entry colname="c3"
p2.99/p
/entry
entry colname="c4"
p1562289_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p459/p
/entry
entry colname="c2"
p0.0008148/p
/entry
entry colname="c3"
p1.41/p
/entry
entry colname="c4"
p202615_at/p
/entry
entry colname="c5"
pGNAQ/p
/entry
entry colname="c6"
pguanine nucleotide binding protein (G protein), q polypeptide/p
/entry
/row
row rowsep="1"
entry colname="c1"
p460/p
/entry
entry colname="c2"
p0.0008150/p
/entry
entry colname="c3"
p1.71/p
/entry
entry colname="c4"
p219151_s_at/p
/entry
entry colname="c5"
pRABL2B/p
/entry
entry colname="c6"
pRAB, member of RAS oncogene family-like 2B/p
/entry
/row
row rowsep="1"
entry colname="c1"
p461/p
/entry
entry colname="c2"
p0.0008158/p
/entry
entry colname="c3"
p2.1/p
/entry
entry colname="c4"
p1559214_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p462/p
/entry
entry colname="c2"
p0.0008161/p
/entry
entry colname="c3"
p1.84/p
/entry
entry colname="c4"
p203711_s_at/p
/entry
entry colname="c5"
pHIBCH/p
/entry
entry colname="c6"
p3-hydroxyisobutyryl-Coenzyme A hydrolase/p
/entry
/row
row rowsep="1"
entry colname="c1"
p463/p
/entry
entry colname="c2"
p0.0008187/p
/entry
entry colname="c3"
p1.87/p
/entry
entry colname="c4"
p233955_x_at/p
/entry
entry colname="c5"
pCXXC5/p
/entry
entry colname="c6"
pCXXC finger 5/p
/entry
/row
row rowsep="1"
entry colname="c1"
p464/p
/entry
entry colname="c2"
p0.0008205/p
/entry
entry colname="c3"
p1.26/p
/entry
entry colname="c4"
p201804_x_at/p
/entry
entry colname="c5"
pTBCB/p
/entry
entry colname="c6"
ptubulin folding cofactor B/p
/entry
/row
row rowsep="1"
entry colname="c1"
p465/p
/entry
entry colname="c2"
p0.0008207/p
/entry
entry colname="c3"
p1.44/p
/entry
entry colname="c4"
p211100_x_at/p
/entry
entry colname="c5"
pLILRA2/p
/entry
entry colname="c6"
pleukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p466/p
/entry
entry colname="c2"
p0.0008229/p
/entry
entry colname="c3"
p5.13/p
/entry
entry colname="c4"
p212757_s_at/p
/entry
entry colname="c5"
pCAMK2G/p
/entry
entry colname="c6"
pcalciumcalmodulin-dependent protein kinase (CaM kinase) II gamma/p
/entry
/row
row rowsep="1"
entry colname="c1"
p467/p
/entry
entry colname="c2"
p0.0008232/p
/entry
entry colname="c3"
p1.76/p
/entry
entry colname="c4"
p214202_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p468/p
/entry
entry colname="c2"
p0.0008255/p
/entry
entry colname="c3"
p2.01/p
/entry
entry colname="c4"
p221746_at/p
/entry
entry colname="c5"
pUBL4A/p
/entry
entry colname="c6"
pubiquitin-like 4A/p
/entry
/row
row rowsep="1"
entry colname="c1"
p469/p
/entry
entry colname="c2"
p0.0008277/p
/entry
entry colname="c3"
p1.35/p
/entry
entry colname="c4"
p1560587_s_at/p
/entry
entry colname="c5"
pPRDX5/p
/entry
entry colname="c6"
pperoxiredoxin 5/p
/entry
/row
row rowsep="1"
entry colname="c1"
p470/p
/entry
entry colname="c2"
p0.0008278/p
/entry
entry colname="c3"
p1.41/p
/entry
entry colname="c4"
p211070_x_at/p
/entry
entry colname="c5"
pDBI/p
/entry
entry colname="c6"
pdiazepam binding inhibitor (GABA receptor modulator, acyl-Coenzyme A binding protein)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p471/p
/entry
entry colname="c2"
p0.0008279/p
/entry
entry colname="c3"
p1.53/p
/entry
entry colname="c4"
p242887_at/p
/entry
entry colname="c5"
pKCMF1/p
/entry
entry colname="c6"
ppotassium channel modulatory factor 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p472/p
/entry
entry colname="c2"
p0.0008283/p
/entry
entry colname="c3"
p1.29/p
/entry
entry colname="c4"
p206200_s_at/p
/entry
entry colname="c5"
pANXA11/p
/entry
entry colname="c6"
pannexin A11/p
/entry
/row
row rowsep="1"
entry colname="c1"
p473/p
/entry
entry colname="c2"
p0.0008318/p
/entry
entry colname="c3"
p1.72/p
/entry
entry colname="c4"
p203607_at/p
/entry
entry colname="c5"
pINPP5F/p
/entry
entry colname="c6"
pinositol polyphosphate-5-phosphatase F/p
/entry
/row
row rowsep="1"
entry colname="c1"
p474/p
/entry
entry colname="c2"
p0.0008344/p
/entry
entry colname="c3"
p1.9/p
/entry
entry colname="c4"
p205282_at/p
/entry
entry colname="c5"
pLRP8/p
/entry
entry colname="c6"
plow density lipoprotein receptor-related protein 8, apolipoprotein e receptor/p
/entry
/row
row rowsep="1"
entry colname="c1"
p475/p
/entry
entry colname="c2"
p0.0008347/p
/entry
entry colname="c3"
p1.42/p
/entry
entry colname="c4"
p209566_at/p
/entry
entry colname="c5"
pINSIG2/p
/entry
entry colname="c6"
pinsulin induced gene 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p476/p
/entry
entry colname="c2"
p0.0008361/p
/entry
entry colname="c3"
p1.54/p
/entry
entry colname="c4"
p223306_at/p
/entry
entry colname="c5"
pEBPL/p
/entry
entry colname="c6"
pemopamil binding protein-like/p
/entry
/row
row rowsep="1"
entry colname="c1"
p477/p
/entry
entry colname="c2"
p0.0008444/p
/entry
entry colname="c3"
p3.9/p
/entry
entry colname="c4"
p210166_at/p
/entry
entry colname="c5"
pTLR5/p
/entry
entry colname="c6"
ptoll-like receptor 5/p
/entry
/row
row rowsep="1"
entry colname="c1"
p478/p
/entry
entry colname="c2"
p0.0008451/p
/entry
entry colname="c3"
p1.44/p
/entry
entry colname="c4"
p225050_at/p
/entry
entry colname="c5"
pZNF512/p
/entry
entry colname="c6"
pzinc finger protein 512/p
/entry
/row
row rowsep="1"
entry colname="c1"
p479/p
/entry
entry colname="c2"
p0.0008463/p
/entry
entry colname="c3"
p1.9/p
/entry
entry colname="c4"
p226480_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p480/p
/entry
entry colname="c2"
p0.0008510/p
/entry
entry colname="c3"
p1.22/p
/entry
entry colname="c4"
p211152_s_at/p
/entry
entry colname="c5"
pHTRA2/p
/entry
entry colname="c6"
pHtrA serine peptidase 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p481/p
/entry
entry colname="c2"
p0.0008526/p
/entry
entry colname="c3"
p1.9/p
/entry
entry colname="c4"
p222603_at/p
/entry
entry colname="c5"
pERMP1/p
/entry
entry colname="c6"
pendoplasmic reticulum metallopeptidase 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p482/p
/entry
entry colname="c2"
p0.0008590/p
/entry
entry colname="c3"
p1.42/p
/entry
entry colname="c4"
p226078_at/p
/entry
entry colname="c5"
pRPUSD1/p
/entry
entry colname="c6"
pRNA pseudouridylate synthase domain containing 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p483/p
/entry
entry colname="c2"
p0.0008602/p
/entry
entry colname="c3"
p1.89/p
/entry
entry colname="c4"
p203409_at/p
/entry
entry colname="c5"
pDDB2/p
/entry
entry colname="c6"
pdamage-specific DNA binding protein 2, 48kDa/p
/entry
/row
row rowsep="1"
entry colname="c1"
p484/p
/entry
entry colname="c2"
p0.0008607/p
/entry
entry colname="c3"
p1.79/p
/entry
entry colname="c4"
p222996_s_at/p
/entry
entry colname="c5"
pCXXC5/p
/entry
entry colname="c6"
pCXXC finger 5/p
/entry
/row
row rowsep="1"
entry colname="c1"
p485/p
/entry
entry colname="c2"
p0.0008619/p
/entry
entry colname="c3"
p1.42/p
/entry
entry colname="c4"
p229597_s_at/p
/entry
entry colname="c5"
pWDFY4/p
/entry
entry colname="c6"
pWDFY family member 4/p
/entry
/row
row rowsep="1"
entry colname="c1"
p486/p
/entry
entry colname="c2"
p0.0008625/p
/entry
entry colname="c3"
p1.21/p
/entry
entry colname="c4"
p209420_s_at/p
/entry
entry colname="c5"
pSMPD1/p
/entry
entry colname="c6"
psphingomyelin phosphodiesterase 1, acid lysosomal/p
/entry
/row
row rowsep="1"
entry colname="c1"
p487/p
/entry
entry colname="c2"
p0.0008648/p
/entry
entry colname="c3"
p2.16/p
/entry
entry colname="c4"
p213333_at/p
/entry
entry colname="c5"
pMDH2/p
/entry
entry colname="c6"
pmalate dehydrogenase 2, NAD (mitochondrial)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p488/p
/entry
entry colname="c2"
p0.0008654/p
/entry
entry colname="c3"
p1.57/p
/entry
entry colname="c4"
p232524_x_at/p
/entry
entry colname="c5"
pANAPC4/p
/entry
entry colname="c6"
panaphase promoting complex subunit 4/p
/entry
/row
row rowsep="1"
entry colname="c1"
p489/p
/entry
entry colname="c2"
p0.0008674/p
/entry
entry colname="c3"
p1.63/p
/entry
entry colname="c4"
p238058_at/p
/entry
entry colname="c5"
pFLJ27365/p
/entry
entry colname="c6"
pFLJ27365 protein/p
/entry
/row
row rowsep="1"
entry colname="c1"
p490/p
/entry
entry colname="c2"
p0.0008682/p
/entry
entry colname="c3"
p2.88/p
/entry
entry colname="c4"
p212660_at/p
/entry
entry colname="c5"
pPHF15/p
/entry
entry colname="c6"
pPHD finger protein 15/p
/entry
/row
row rowsep="1"
entry colname="c1"
p491/p
/entry
entry colname="c2"
p0.0008701/p
/entry
entry colname="c3"
p2.47/p
/entry
entry colname="c4"
p209197_at/p
/entry
entry colname="c5"
pSYT11/p
/entry
entry colname="c6"
psynaptotagmin XI/p
/entry
/row
row rowsep="1"
entry colname="c1"
p492/p
/entry
entry colname="c2"
p0.0008755/p
/entry
entry colname="c3"
p1.49/p
/entry
entry colname="c4"
p200875_s_at/p
/entry
entry colname="c5"
pNOL5A/p
/entry
entry colname="c6"
pnucleolar protein 5A (56kDa with KKED repeat)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p493/p
/entry
entry colname="c2"
p0.0008868/p
/entry
entry colname="c3"
p5.04/p
/entry
entry colname="c4"
p207008_at/p
/entry
entry colname="c5"
pIL8RB/p
/entry
entry colname="c6"
pinterleukin 8 receptor, beta/p
/entry
/row
row rowsep="1"
entry colname="c1"
p494/p
/entry
entry colname="c2"
p0.0008925/p
/entry
entry colname="c3"
p1.33/p
/entry
entry colname="c4"
p233694_at/p
/entry
entry colname="c5"
pHSPA1L/p
/entry
entry colname="c6"
pheat shock 70kDa protein 1-like/p
/entry
/row
row rowsep="1"
entry colname="c1"
p495/p
/entry
entry colname="c2"
p0.0008958/p
/entry
entry colname="c3"
p1.35/p
/entry
entry colname="c4"
p217957_at/p
/entry
entry colname="c5"
pC16orf80/p
/entry
entry colname="c6"
pchromosome 16 open reading frame 80/p
/entry
/row
row rowsep="1"
entry colname="c1"
p496/p
/entry
entry colname="c2"
p0.0008961/p
/entry
entry colname="c3"
p1.64/p
/entry
entry colname="c4"
p228070_at/p
/entry
entry colname="c5"
pPPP2R5E/p
/entry
entry colname="c6"
pprotein phosphatase 2, regulatory subunit B@#$%&, epsilon isoform/p
/entry
/row
row rowsep="1"
entry colname="c1"
p497/p
/entry
entry colname="c2"
p0.0008967/p
/entry
entry colname="c3"
p1.56/p
/entry
entry colname="c4"
p225997_at/p
/entry
entry colname="c5"
pMOBKL1A/p
/entry
entry colname="c6"
pMOB1, Mps One Binder kinase activator-like 1A (yeast)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p498/p
/entry
entry colname="c2"
p0.0009020/p
/entry
entry colname="c3"
p1.98/p
/entry
entry colname="c4"
p65438_at/p
/entry
entry colname="c5"
pKIAA1609/p
/entry
entry colname="c6"
pKIAA1609/p
/entry
/row
row rowsep="1"
entry colname="c1"
p499/p
/entry
entry colname="c2"
p0.0009056/p
/entry
entry colname="c3"
p1.82/p
/entry
entry colname="c4"
p218921_at/p
/entry
entry colname="c5"
pSIGIRR/p
/entry
entry colname="c6"
psingle immunoglobulin and toll-interleukin 1 receptor (TIR) domain/p
/entry
/row
row rowsep="1"
entry colname="c1"
p500/p
/entry
entry colname="c2"
p0.0009103/p
/entry
entry colname="c3"
p1.06/p
/entry
entry colname="c4"
p240001_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p501/p
/entry
entry colname="c2"
p0.0009114/p
/entry
entry colname="c3"
p1.51/p
/entry
entry colname="c4"
p227533_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p502/p
/entry
entry colname="c2"
p0.0009136/p
/entry
entry colname="c3"
p1.47/p
/entry
entry colname="c4"
p226333_at/p
/entry
entry colname="c5"
pIL6R/p
/entry
entry colname="c6"
pinterleukin 6 receptor/p
/entry
/row
row rowsep="1"
entry colname="c1"
p503/p
/entry
entry colname="c2"
p0.0009154/p
/entry
entry colname="c3"
p1.68/p
/entry
entry colname="c4"
p1562249_at/p
/entry
entry colname="c5"
pLOC285965/p
/entry
entry colname="c6"
phypothetical protein LOC285965/p
/entry
/row
row rowsep="1"
entry colname="c1"
p504/p
/entry
entry colname="c2"
p0.0009189/p
/entry
entry colname="c3"
p3.86/p
/entry
entry colname="c4"
p204301_at/p
/entry
entry colname="c5"
pKBTBD11/p
/entry
entry colname="c6"
pkelch repeat and BTB (POZ) domain containing 11/p
/entry
/row
row rowsep="1"
entry colname="c1"
p505/p
/entry
entry colname="c2"
p0.0009197/p
/entry
entry colname="c3"
p1.67/p
/entry
entry colname="c4"
p213296_at/p
/entry
entry colname="c5"
pRER1/p
/entry
entry colname="c6"
pRER1 retention in endoplasmic reticulum 1 homolog (S. cerevisiae)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p506/p
/entry
entry colname="c2"
p0.0009228/p
/entry
entry colname="c3"
p1.32/p
/entry
entry colname="c4"
p224688_at/p
/entry
entry colname="c5"
pC7orf42/p
/entry
entry colname="c6"
pchromosome 7 open reading frame 42/p
/entry
/row
row rowsep="1"
entry colname="c1"
p507/p
/entry
entry colname="c2"
p0.0009245/p
/entry
entry colname="c3"
p1.91/p
/entry
entry colname="c4"
p221843_s_at/p
/entry
entry colname="c5"
pKIAA1609/p
/entry
entry colname="c6"
pKIAA1609/p
/entry
/row
row rowsep="1"
entry colname="c1"
p508/p
/entry
entry colname="c2"
p0.0009272/p
/entry
entry colname="c3"
p1.24/p
/entry
entry colname="c4"
p1569808_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p509/p
/entry
entry colname="c2"
p0.0009308/p
/entry
entry colname="c3"
p5.94/p
/entry
entry colname="c4"
p38290_at/p
/entry
entry colname="c5"
pRGS14/p
/entry
entry colname="c6"
pregulator of G-protein signaling 14/p
/entry
/row
row rowsep="1"
entry colname="c1"
p510/p
/entry
entry colname="c2"
p0.0009357/p
/entry
entry colname="c3"
p3.85/p
/entry
entry colname="c4"
p226820_at/p
/entry
entry colname="c5"
pZNF362/p
/entry
entry colname="c6"
pzinc finger protein 362/p
/entry
/row
row rowsep="1"
entry colname="c1"
p511/p
/entry
entry colname="c2"
p0.0009370/p
/entry
entry colname="c3"
p1.35/p
/entry
entry colname="c4"
p241344_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p512/p
/entry
entry colname="c2"
p0.0009378/p
/entry
entry colname="c3"
p1.73/p
/entry
entry colname="c4"
p228512_at/p
/entry
entry colname="c5"
pPTCD3/p
/entry
entry colname="c6"
pPentatricopeptide repeat domain 3/p
/entry
/row
row rowsep="1"
entry colname="c1"
p513/p
/entry
entry colname="c2"
p0.0009417/p
/entry
entry colname="c3"
p1.63/p
/entry
entry colname="c4"
p210830_s_at/p
/entry
entry colname="c5"
pPON2/p
/entry
entry colname="c6"
pparaoxonase 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p514/p
/entry
entry colname="c2"
p0.0009436/p
/entry
entry colname="c3"
p1.44/p
/entry
entry colname="c4"
p219493_at/p
/entry
entry colname="c5"
pSHCBP1/p
/entry
entry colname="c6"
pSHC SH2-domain binding protein 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p515/p
/entry
entry colname="c2"
p0.0009471/p
/entry
entry colname="c3"
p1.38/p
/entry
entry colname="c4"
p230122_at/p
/entry
entry colname="c5"
pMLLT10/p
/entry
entry colname="c6"
pmyeloidlymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10/p
/entry
/row
row rowsep="1"
entry colname="c1"
p516/p
/entry
entry colname="c2"
p0.0009526/p
/entry
entry colname="c3"
p1.67/p
/entry
entry colname="c4"
p218380_at/p
/entry
entry colname="c5"
pNLRP1/p
/entry
entry colname="c6"
pNLR family, pyrin domain containing 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p517/p
/entry
entry colname="c2"
p0.0009562/p
/entry
entry colname="c3"
p1.42/p
/entry
entry colname="c4"
p202200_s_at/p
/entry
entry colname="c5"
pSRPK1/p
/entry
entry colname="c6"
pSFRS protein kinase 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p518/p
/entry
entry colname="c2"
p0.0009575/p
/entry
entry colname="c3"
p1.63/p
/entry
entry colname="c4"
p202741_at/p
/entry
entry colname="c5"
pPRKACB/p
/entry
entry colname="c6"
pprotein kinase, cAMP-dependent, catalytic, beta/p
/entry
/row
row rowsep="1"
entry colname="c1"
p519/p
/entry
entry colname="c2"
p0.0009592/p
/entry
entry colname="c3"
p1.43/p
/entry
entry colname="c4"
p228869_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p520/p
/entry
entry colname="c2"
p0.0009614/p
/entry
entry colname="c3"
p1.25/p
/entry
entry colname="c4"
p224252_s_at/p
/entry
entry colname="c5"
pFXYD5/p
/entry
entry colname="c6"
pFXYD domain containing ion transport regulator 5/p
/entry
/row
row rowsep="1"
entry colname="c1"
p521/p
/entry
entry colname="c2"
p0.0009626/p
/entry
entry colname="c3"
p1.45/p
/entry
entry colname="c4"
p221488_s_at/p
/entry
entry colname="c5"
pCUTA/p
/entry
entry colname="c6"
pcutA divalent cation tolerance homolog (E. coli)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p522/p
/entry
entry colname="c2"
p0.0009634/p
/entry
entry colname="c3"
p1.7/p
/entry
entry colname="c4"
p244687_at/p
/entry
entry colname="c5"
pDBT/p
/entry
entry colname="c6"
pdihydrolipoamide branched chain transacylase E2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p523/p
/entry
entry colname="c2"
p0.0009679/p
/entry
entry colname="c3"
p1.17/p
/entry
entry colname="c4"
p209445_x_at/p
/entry
entry colname="c5"
pC7orf44/p
/entry
entry colname="c6"
pchromosome 7 open reading frame 44/p
/entry
/row
row rowsep="1"
entry colname="c1"
p524/p
/entry
entry colname="c2"
p0.0009703/p
/entry
entry colname="c3"
p1.14/p
/entry
entry colname="c4"
p244537_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p525/p
/entry
entry colname="c2"
p0.0009717/p
/entry
entry colname="c3"
p1.7/p
/entry
entry colname="c4"
p226104_at/p
/entry
entry colname="c5"
pRNF170/p
/entry
entry colname="c6"
pring finger protein 170/p
/entry
/row
row rowsep="1"
entry colname="c1"
p526/p
/entry
entry colname="c2"
p0.0009730/p
/entry
entry colname="c3"
p1.31/p
/entry
entry colname="c4"
p205240_at/p
/entry
entry colname="c5"
pGPSM2/p
/entry
entry colname="c6"
pG-protein signaling modulator 2 (AGS3-like, C. elegans)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p527/p
/entry
entry colname="c2"
p0.0009732/p
/entry
entry colname="c3"
p1.73/p
/entry
entry colname="c4"
p200766_at/p
/entry
entry colname="c5"
pCTSD/p
/entry
entry colname="c6"
pcathepsin D/p
/entry
/row
row rowsep="1"
entry colname="c1"
p528/p
/entry
entry colname="c2"
p0.0009734/p
/entry
entry colname="c3"
p1.41/p
/entry
entry colname="c4"
p231844_at/p
/entry
entry colname="c5"
pMGC27345/p
/entry
entry colname="c6"
phypothetical protein MGC27345/p
/entry
/row
row rowsep="1"
entry colname="c1"
p529/p
/entry
entry colname="c2"
p0.0009738/p
/entry
entry colname="c3"
p1.29/p
/entry
entry colname="c4"
p202634_at/p
/entry
entry colname="c5"
pPOLR2K/p
/entry
entry colname="c6"
ppolymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa/p
/entry
/row
row rowsep="1"
entry colname="c1"
p530/p
/entry
entry colname="c2"
p0.0009760/p
/entry
entry colname="c3"
p1.58/p
/entry
entry colname="c4"
p224938_at/p
/entry
entry colname="c5"
pNUFIP2/p
/entry
entry colname="c6"
pnuclear fragile X mental retardation protein interacting protein 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p531/p
/entry
entry colname="c2"
p0.0009764/p
/entry
entry colname="c3"
p2.26/p
/entry
entry colname="c4"
p204089_x_at/p
/entry
entry colname="c5"
pMAP3K4/p
/entry
entry colname="c6"
pmitogen-activated protein kinase kinase kinase 4/p
/entry
/row
row rowsep="1"
entry colname="c1"
p532/p
/entry
entry colname="c2"
p0.0009776/p
/entry
entry colname="c3"
p1.93/p
/entry
entry colname="c4"
p211985_s_at/p
/entry
entry colname="c5"
pCALM1/p
/entry
entry colname="c6"
pcalmodulin 1 (phosphorylase kinase, delta)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p533/p
/entry
entry colname="c2"
p0.0009778/p
/entry
entry colname="c3"
p2.65/p
/entry
entry colname="c4"
p213280_at/p
/entry
entry colname="c5"
pGARNL4/p
/entry
entry colname="c6"
pGTPase activating RapRanGAP domain-like 4/p
/entry
/row
row rowsep="1"
entry colname="c1"
p534/p
/entry
entry colname="c2"
p0.0009805/p
/entry
entry colname="c3"
p1.48/p
/entry
entry colname="c4"
p236016_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p535/p
/entry
entry colname="c2"
p0.0009828/p
/entry
entry colname="c3"
p1.84/p
/entry
entry colname="c4"
p217394_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p536/p
/entry
entry colname="c2"
p0.0009900/p
/entry
entry colname="c3"
p1.58/p
/entry
entry colname="c4"
p201030_x_at/p
/entry
entry colname="c5"
pLDHB/p
/entry
entry colname="c6"
plactate dehydrogenase B/p
/entry
/row
row rowsep="1"
entry colname="c1"
p537/p
/entry
entry colname="c2"
p0.0009925/p
/entry
entry colname="c3"
p1.81/p
/entry
entry colname="c4"
p227379_at/p
/entry
entry colname="c5"
pMBOAT1/p
/entry
entry colname="c6"
pmembrane bound O-acyltransferase domain containing 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p538/p
/entry
entry colname="c2"
p0.0009997/p
/entry
entry colname="c3"
p-1.19/p
/entry
entry colname="c4"
p236663_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p539/p
/entry
entry colname="c2"
p0.0009983/p
/entry
entry colname="c3"
p-1.6/p
/entry
entry colname="c4"
p219766_at/p
/entry
entry colname="c5"
pB9D2/p
/entry
entry colname="c6"
pB9 protein domain 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p540/p
/entry
entry colname="c2"
p0.0009949/p
/entry
entry colname="c3"
p-1.71/p
/entry
entry colname="c4"
p204157_s_at/p
/entry
entry colname="c5"
pKIAA0999/p
/entry
entry colname="c6"
pKIAA0999 protein/p
/entry
/row
row rowsep="1"
entry colname="c1"
p541/p
/entry
entry colname="c2"
p0.0009891/p
/entry
entry colname="c3"
p-1.23/p
/entry
entry colname="c4"
p214060_at/p
/entry
entry colname="c5"
pSSBP1/p
/entry
entry colname="c6"
psingle-stranded DNA binding protein 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p542/p
/entry
entry colname="c2"
p0.0009868/p
/entry
entry colname="c3"
p-1.47/p
/entry
entry colname="c4"
p226276_at/p
/entry
entry colname="c5"
pTMEM167A/p
/entry
entry colname="c6"
ptransmembrane protein 167A/p
/entry
/row
row rowsep="1"
entry colname="c1"
p543/p
/entry
entry colname="c2"
p0.0009825/p
/entry
entry colname="c3"
p-1.75/p
/entry
entry colname="c4"
p203596_s_at/p
/entry
entry colname="c5"
pIFIT5/p
/entry
entry colname="c6"
pinterferon-induced protein with tetratricopeptide repeats 5/p
/entry
/row
row rowsep="1"
entry colname="c1"
p544/p
/entry
entry colname="c2"
p0.0009805/p
/entry
entry colname="c3"
p-1.64/p
/entry
entry colname="c4"
p226310_at/p
/entry
entry colname="c5"
pRICTOR/p
/entry
entry colname="c6"
prapamycin-insensitive companion of mTOR/p
/entry
/row
row rowsep="1"
entry colname="c1"
p545/p
/entry
entry colname="c2"
p0.0009772/p
/entry
entry colname="c3"
p-2.29/p
/entry
entry colname="c4"
p218986_s_at/p
/entry
entry colname="c5"
pDDX60/p
/entry
entry colname="c6"
pDEAD (Asp-Glu-Ala-Asp) box polypeptide 60/p
/entry
/row
row rowsep="1"
entry colname="c1"
p546/p
/entry
entry colname="c2"
p0.0009758/p
/entry
entry colname="c3"
p-1.52/p
/entry
entry colname="c4"
p217618_x_at/p
/entry
entry colname="c5"
pHUS1/p
/entry
entry colname="c6"
pHUS1 checkpoint homolog (S. pombe)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p547/p
/entry
entry colname="c2"
p0.0009746/p
/entry
entry colname="c3"
p-2.4/p
/entry
entry colname="c4"
p219017_at/p
/entry
entry colname="c5"
pETNK1/p
/entry
entry colname="c6"
pethanolamine kinase 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p548/p
/entry
entry colname="c2"
p0.0009745/p
/entry
entry colname="c3"
p-1.24/p
/entry
entry colname="c4"
p201957_at/p
/entry
entry colname="c5"
pPPP1R12B/p
/entry
entry colname="c6"
pprotein phosphatase 1, regulatory (inhibitor) subunit 12B/p
/entry
/row
row rowsep="1"
entry colname="c1"
p549/p
/entry
entry colname="c2"
p0.0009737/p
/entry
entry colname="c3"
p-1.26/p
/entry
entry colname="c4"
p240887_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p550/p
/entry
entry colname="c2"
p0.0009681/p
/entry
entry colname="c3"
p-1.33/p
/entry
entry colname="c4"
p209514_s_at/p
/entry
entry colname="c5"
pRAB27A/p
/entry
entry colname="c6"
pRAB27A, member RAS oncogene family/p
/entry
/row
row rowsep="1"
entry colname="c1"
p551/p
/entry
entry colname="c2"
p0.0009661/p
/entry
entry colname="c3"
p-2.54/p
/entry
entry colname="c4"
p219026_s_at/p
/entry
entry colname="c5"
pRASAL2/p
/entry
entry colname="c6"
pRAS protein activator like 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p552/p
/entry
entry colname="c2"
p0.0009592/p
/entry
entry colname="c3"
p-1.49/p
/entry
entry colname="c4"
p211395_x_at/p
/entry
entry colname="c5"
pFCGR2C/p
/entry
entry colname="c6"
pFc fragment of IgG, low affinity IIc, receptor for (CD32)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p553/p
/entry
entry colname="c2"
p0.0009568/p
/entry
entry colname="c3"
p-3.72/p
/entry
entry colname="c4"
p205126_at/p
/entry
entry colname="c5"
pVRK2/p
/entry
entry colname="c6"
pvaccinia related kinase 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p554/p
/entry
entry colname="c2"
p0.0009560/p
/entry
entry colname="c3"
p-1.22/p
/entry
entry colname="c4"
p1556514_at/p
/entry
entry colname="c5"
pLOC338809/p
/entry
entry colname="c6"
phypothetical protein LOC338809/p
/entry
/row
row rowsep="1"
entry colname="c1"
p555/p
/entry
entry colname="c2"
p0.0009506/p
/entry
entry colname="c3"
p-2.66/p
/entry
entry colname="c4"
p206991_s_at/p
/entry
entry colname="c5"
pCCR5/p
/entry
entry colname="c6"
pchemokine (C-C motif) receptor 5/p
/entry
/row
row rowsep="1"
entry colname="c1"
p556/p
/entry
entry colname="c2"
p0.0009500/p
/entry
entry colname="c3"
p-1.47/p
/entry
entry colname="c4"
p212840_at/p
/entry
entry colname="c5"
pUBXN7/p
/entry
entry colname="c6"
pUBX domain protein 7/p
/entry
/row
row rowsep="1"
entry colname="c1"
p557/p
/entry
entry colname="c2"
p0.0009443/p
/entry
entry colname="c3"
p-1.25/p
/entry
entry colname="c4"
p244496_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p558/p
/entry
entry colname="c2"
p0.0009406/p
/entry
entry colname="c3"
p-1.21/p
/entry
entry colname="c4"
p236108_at/p
/entry
entry colname="c5"
pKIAA1632/p
/entry
entry colname="c6"
pKIAA1632/p
/entry
/row
row rowsep="1"
entry colname="c1"
p559/p
/entry
entry colname="c2"
p0.0009366/p
/entry
entry colname="c3"
p-1.2/p
/entry
entry colname="c4"
p203654_s_at/p
/entry
entry colname="c5"
pCOIL/p
/entry
entry colname="c6"
pcoilin/p
/entry
/row
row rowsep="1"
entry colname="c1"
p560/p
/entry
entry colname="c2"
p0.0009338/p
/entry
entry colname="c3"
p-2.95/p
/entry
entry colname="c4"
p236156_at/p
/entry
entry colname="c5"
pLIPA/p
/entry
entry colname="c6"
plipase A, lysosomal acid, cholesterol esterase/p
/entry
/row
row rowsep="1"
entry colname="c1"
p561/p
/entry
entry colname="c2"
p0.0009309/p
/entry
entry colname="c3"
p-1.3/p
/entry
entry colname="c4"
p212462_at/p
/entry
entry colname="c5"
pMYST4/p
/entry
entry colname="c6"
pMYST histone acetyltransferase (monocytic leukemia) 4/p
/entry
/row
row rowsep="1"
entry colname="c1"
p562/p
/entry
entry colname="c2"
p0.0009278/p
/entry
entry colname="c3"
p-2.58/p
/entry
entry colname="c4"
p219403_s_at/p
/entry
entry colname="c5"
pHPSE/p
/entry
entry colname="c6"
pheparanase/p
/entry
/row
row rowsep="1"
entry colname="c1"
p563/p
/entry
entry colname="c2"
p0.0009220/p
/entry
entry colname="c3"
p-1.58/p
/entry
entry colname="c4"
p1554747_a_at/p
/entry
entry colname="c5"
p2-Sep/p
/entry
entry colname="c6"
pseptin 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p564/p
/entry
entry colname="c2"
p0.0009134/p
/entry
entry colname="c3"
p-1.08/p
/entry
entry colname="c4"
p203291_at/p
/entry
entry colname="c5"
pCNOT4/p
/entry
entry colname="c6"
pCCR4-NOT transcription complex, subunit 4/p
/entry
/row
row rowsep="1"
entry colname="c1"
p565/p
/entry
entry colname="c2"
p0.0009077/p
/entry
entry colname="c3"
p-1.25/p
/entry
entry colname="c4"
p243772_at/p
/entry
entry colname="c5"
pSDCCAG8/p
/entry
entry colname="c6"
pserologically defined colon cancer antigen 8/p
/entry
/row
row rowsep="1"
entry colname="c1"
p566/p
/entry
entry colname="c2"
p0.0009071/p
/entry
entry colname="c3"
p-1.7/p
/entry
entry colname="c4"
p201656_at/p
/entry
entry colname="c5"
pITGA6/p
/entry
entry colname="c6"
pintegrin, alpha 6/p
/entry
/row
row rowsep="1"
entry colname="c1"
p567/p
/entry
entry colname="c2"
p0.0009063/p
/entry
entry colname="c3"
p-3.06/p
/entry
entry colname="c4"
p201325_s_at/p
/entry
entry colname="c5"
pEMP1/p
/entry
entry colname="c6"
pepithelial membrane protein 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p568/p
/entry
entry colname="c2"
p0.0009031/p
/entry
entry colname="c3"
p-1.27/p
/entry
entry colname="c4"
p209531_at/p
/entry
entry colname="c5"
pGSTZ1/p
/entry
entry colname="c6"
pglutathione transferase zeta 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p569/p
/entry
entry colname="c2"
p0.0008974/p
/entry
entry colname="c3"
p-1.42/p
/entry
entry colname="c4"
p208779_x_at/p
/entry
entry colname="c5"
pDDR1/p
/entry
entry colname="c6"
pdiscoidin domain receptor tyrosine kinase 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p570/p
/entry
entry colname="c2"
p0.0008959/p
/entry
entry colname="c3"
p-1.19/p
/entry
entry colname="c4"
p242654_at/p
/entry
entry colname="c5"
pFANCC/p
/entry
entry colname="c6"
pFanconi anemia, complementation group C/p
/entry
/row
row rowsep="1"
entry colname="c1"
p571/p
/entry
entry colname="c2"
p0.0008945/p
/entry
entry colname="c3"
p-1.16/p
/entry
entry colname="c4"
p220386_s_at/p
/entry
entry colname="c5"
pEML4/p
/entry
entry colname="c6"
pechinoderm microtubule associated protein like 4/p
/entry
/row
row rowsep="1"
entry colname="c1"
p572/p
/entry
entry colname="c2"
p0.0008922/p
/entry
entry colname="c3"
p-1.32/p
/entry
entry colname="c4"
p227003_at/p
/entry
entry colname="c5"
pRAB28/p
/entry
entry colname="c6"
pRAB28, member RAS oncogene family/p
/entry
/row
row rowsep="1"
entry colname="c1"
p573/p
/entry
entry colname="c2"
p0.0008910/p
/entry
entry colname="c3"
p-3.14/p
/entry
entry colname="c4"
p224009_x_at/p
/entry
entry colname="c5"
pDHRS9/p
/entry
entry colname="c6"
pdehydrogenasereductase (SDR family) member 9/p
/entry
/row
row rowsep="1"
entry colname="c1"
p574/p
/entry
entry colname="c2"
p0.0008877/p
/entry
entry colname="c3"
p-1.67/p
/entry
entry colname="c4"
p32069_at/p
/entry
entry colname="c5"
pN4BP1/p
/entry
entry colname="c6"
pNEDD4 binding protein 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p575/p
/entry
entry colname="c2"
p0.0008870/p
/entry
entry colname="c3"
p-1.29/p
/entry
entry colname="c4"
p232141_at/p
/entry
entry colname="c5"
pU2AF1/p
/entry
entry colname="c6"
pU2 small nuclear RNA auxiliary factor 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p576/p
/entry
entry colname="c2"
p0.0008761/p
/entry
entry colname="c3"
p-1.35/p
/entry
entry colname="c4"
p240468_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p577/p
/entry
entry colname="c2"
p0.0008698/p
/entry
entry colname="c3"
p-1.32/p
/entry
entry colname="c4"
p204367_at/p
/entry
entry colname="c5"
pSP2/p
/entry
entry colname="c6"
pSp2 transcription factor/p
/entry
/row
row rowsep="1"
entry colname="c1"
p578/p
/entry
entry colname="c2"
p0.0008616/p
/entry
entry colname="c3"
p-1.87/p
/entry
entry colname="c4"
p225076_s_at/p
/entry
entry colname="c5"
pZNFX1/p
/entry
entry colname="c6"
pzinc finger, NFX1-type containing 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p579/p
/entry
entry colname="c2"
p0.0008599/p
/entry
entry colname="c3"
p-1.25/p
/entry
entry colname="c4"
p225056_at/p
/entry
entry colname="c5"
pSIPA1L2/p
/entry
entry colname="c6"
psignal-induced proliferation-associated 1 like 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p580/p
/entry
entry colname="c2"
p0.0008580/p
/entry
entry colname="c3"
p-1.13/p
/entry
entry colname="c4"
p207070_at/p
/entry
entry colname="c5"
pRGR/p
/entry
entry colname="c6"
pretinal G protein coupled receptor/p
/entry
/row
row rowsep="1"
entry colname="c1"
p581/p
/entry
entry colname="c2"
p0.0008574/p
/entry
entry colname="c3"
p-1.28/p
/entry
entry colname="c4"
p217129_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p582/p
/entry
entry colname="c2"
p0.0008537/p
/entry
entry colname="c3"
p-1.22/p
/entry
entry colname="c4"
p225268_at/p
/entry
entry colname="c5"
pKPNA4/p
/entry
entry colname="c6"
pkaryopherin alpha 4 (importin alpha 3)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p583/p
/entry
entry colname="c2"
p0.0008463/p
/entry
entry colname="c3"
p-1.07/p
/entry
entry colname="c4"
p232295_at/p
/entry
entry colname="c5"
pGFM1/p
/entry
entry colname="c6"
pG elongation factor, mitochondrial 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p584/p
/entry
entry colname="c2"
p0.0008408/p
/entry
entry colname="c3"
p-1.33/p
/entry
entry colname="c4"
p211975_at/p
/entry
entry colname="c5"
pARFGAP2/p
/entry
entry colname="c6"
pADP-ribosylation factor GTPase activating protein 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p585/p
/entry
entry colname="c2"
p0.0008385/p
/entry
entry colname="c3"
p-1.24/p
/entry
entry colname="c4"
p244625_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p586/p
/entry
entry colname="c2"
p0.0008384/p
/entry
entry colname="c3"
p-1.49/p
/entry
entry colname="c4"
p202083_s_at/p
/entry
entry colname="c5"
pSEC14L1/p
/entry
entry colname="c6"
pSEC14-like 1 (S. cerevisiae)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p587/p
/entry
entry colname="c2"
p0.0008274/p
/entry
entry colname="c3"
p-1.34/p
/entry
entry colname="c4"
p232987_at/p
/entry
entry colname="c5"
pARL17/p
/entry
entry colname="c6"
pADP-ribosylation factor-like 17/p
/entry
/row
row rowsep="1"
entry colname="c1"
p588/p
/entry
entry colname="c2"
p0.0008198/p
/entry
entry colname="c3"
p-1.33/p
/entry
entry colname="c4"
p1570541_s_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p589/p
/entry
entry colname="c2"
p0.0008196/p
/entry
entry colname="c3"
p-2.91/p
/entry
entry colname="c4"
p201324_at/p
/entry
entry colname="c5"
pEMP1/p
/entry
entry colname="c6"
pepithelial membrane protein 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p590/p
/entry
entry colname="c2"
p0.0008172/p
/entry
entry colname="c3"
p-1.42/p
/entry
entry colname="c4"
p222408_s_at/p
/entry
entry colname="c5"
pYPEL5/p
/entry
entry colname="c6"
pyippee-like 5 (Drosophila)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p591/p
/entry
entry colname="c2"
p0.0008164/p
/entry
entry colname="c3"
p-1.3/p
/entry
entry colname="c4"
p201585_s_at/p
/entry
entry colname="c5"
pSFPQ/p
/entry
entry colname="c6"
psplicing factor prolineglutamine-rich (polypyrimidine tract binding protein associated)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p592/p
/entry
entry colname="c2"
p0.0008160/p
/entry
entry colname="c3"
p-1.35/p
/entry
entry colname="c4"
p243492_at/p
/entry
entry colname="c5"
pTHEM4/p
/entry
entry colname="c6"
pthioesterase superfamily member 4/p
/entry
/row
row rowsep="1"
entry colname="c1"
p593/p
/entry
entry colname="c2"
p0.0008023/p
/entry
entry colname="c3"
p-1.53/p
/entry
entry colname="c4"
p222537_s_at/p
/entry
entry colname="c5"
pCDC42SE1/p
/entry
entry colname="c6"
pCDC42 small effector 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p594/p
/entry
entry colname="c2"
p0.0007993/p
/entry
entry colname="c3"
p-1.38/p
/entry
entry colname="c4"
p223225_s_at/p
/entry
entry colname="c5"
pSEH1L/p
/entry
entry colname="c6"
pSEH1-like (S. cerevisiae)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p595/p
/entry
entry colname="c2"
p0.0007951/p
/entry
entry colname="c3"
p-1.4/p
/entry
entry colname="c4"
p231139_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p596/p
/entry
entry colname="c2"
p0.0007921/p
/entry
entry colname="c3"
p-3.08/p
/entry
entry colname="c4"
p206911_at/p
/entry
entry colname="c5"
pTRIM25/p
/entry
entry colname="c6"
ptripartite motif-containing 25/p
/entry
/row
row rowsep="1"
entry colname="c1"
p597/p
/entry
entry colname="c2"
p0.0007824/p
/entry
entry colname="c3"
p-1.55/p
/entry
entry colname="c4"
p1554390_s_at/p
/entry
entry colname="c5"
pACTR2/p
/entry
entry colname="c6"
pARP2 actin-related protein 2 homolog (yeast)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p598/p
/entry
entry colname="c2"
p0.0007777/p
/entry
entry colname="c3"
p-1.32/p
/entry
entry colname="c4"
p208824_x_at/p
/entry
entry colname="c5"
pPCTK1/p
/entry
entry colname="c6"
pPCTAIRE protein kinase 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p599/p
/entry
entry colname="c2"
p0.0007732/p
/entry
entry colname="c3"
p-1.36/p
/entry
entry colname="c4"
p214258_x_at/p
/entry
entry colname="c5"
pKAT5/p
/entry
entry colname="c6"
pK(lysine) acetyltransferase 5/p
/entry
/row
row rowsep="1"
entry colname="c1"
p600/p
/entry
entry colname="c2"
p0.0007729/p
/entry
entry colname="c3"
p-1.47/p
/entry
entry colname="c4"
p208751_at/p
/entry
entry colname="c5"
pNAPA/p
/entry
entry colname="c6"
pN-ethylmaleimide-sensitive factor attachment protein, alpha/p
/entry
/row
row rowsep="1"
entry colname="c1"
p601/p
/entry
entry colname="c2"
p0.0007690/p
/entry
entry colname="c3"
p-1.16/p
/entry
entry colname="c4"
p238337_s_at/p
/entry
entry colname="c5"
pDNAJC21/p
/entry
entry colname="c6"
pDnaJ (Hsp40) homolog, subfamily C, member 21/p
/entry
/row
row rowsep="1"
entry colname="c1"
p602/p
/entry
entry colname="c2"
p0.0007673/p
/entry
entry colname="c3"
p-1.31/p
/entry
entry colname="c4"
p211314_at/p
/entry
entry colname="c5"
pCACNA1G/p
/entry
entry colname="c6"
pcalcium channel, voltage-dependent, T type, alpha 1G subunit/p
/entry
/row
row rowsep="1"
entry colname="c1"
p603/p
/entry
entry colname="c2"
p0.0007657/p
/entry
entry colname="c3"
p-1.53/p
/entry
entry colname="c4"
p217834_s_at/p
/entry
entry colname="c5"
pSYNCRIP/p
/entry
entry colname="c6"
psynaptotagmin binding, cytoplasmic RNA interacting protein/p
/entry
/row
row rowsep="1"
entry colname="c1"
p604/p
/entry
entry colname="c2"
p0.0007625/p
/entry
entry colname="c3"
p-1.85/p
/entry
entry colname="c4"
p208653_s_at/p
/entry
entry colname="c5"
pCD164/p
/entry
entry colname="c6"
pCD164 molecule, sialomucin/p
/entry
/row
row rowsep="1"
entry colname="c1"
p605/p
/entry
entry colname="c2"
p0.0007608/p
/entry
entry colname="c3"
p-1.45/p
/entry
entry colname="c4"
p209091_s_at/p
/entry
entry colname="c5"
pSH3GLB1/p
/entry
entry colname="c6"
pSH3-domain GRB2-like endophilin B1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p606/p
/entry
entry colname="c2"
p0.0007426/p
/entry
entry colname="c3"
p-1.25/p
/entry
entry colname="c4"
p1557533_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p607/p
/entry
entry colname="c2"
p0.0007405/p
/entry
entry colname="c3"
p-2.01/p
/entry
entry colname="c4"
p1555785_a_at/p
/entry
entry colname="c5"
pXRN1/p
/entry
entry colname="c6"
p5@#$%&-3@#$%& exoribonuclease 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p608/p
/entry
entry colname="c2"
p0.0007371/p
/entry
entry colname="c3"
p-1.41/p
/entry
entry colname="c4"
p236961_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p609/p
/entry
entry colname="c2"
p0.0007346/p
/entry
entry colname="c3"
p-1.14/p
/entry
entry colname="c4"
p204080_at/p
/entry
entry colname="c5"
pTOE1/p
/entry
entry colname="c6"
ptarget of EGR1, member 1 (nuclear)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p610/p
/entry
entry colname="c2"
p0.0007341/p
/entry
entry colname="c3"
p-1.29/p
/entry
entry colname="c4"
p243852_at/p
/entry
entry colname="c5"
pLUC7L2/p
/entry
entry colname="c6"
pLUC7-like 2 (S. cerevisiae)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p611/p
/entry
entry colname="c2"
p0.0007227/p
/entry
entry colname="c3"
p-1.29/p
/entry
entry colname="c4"
p210317_s_at/p
/entry
entry colname="c5"
pYWHAE/p
/entry
entry colname="c6"
ptyrosine 3-monooxygenasetryptophan 5-monooxygenase activation protein, epsilon polypeptide/p
/entry
/row
row rowsep="1"
entry colname="c1"
p612/p
/entry
entry colname="c2"
p0.0007183/p
/entry
entry colname="c3"
p-1.4/p
/entry
entry colname="c4"
p209284_s_at/p
/entry
entry colname="c5"
pC3orf63/p
/entry
entry colname="c6"
pchromosome 3 open reading frame 63/p
/entry
/row
row rowsep="1"
entry colname="c1"
p613/p
/entry
entry colname="c2"
p0.0007169/p
/entry
entry colname="c3"
p-3.19/p
/entry
entry colname="c4"
p227361_at/p
/entry
entry colname="c5"
pHS3ST3B1/p
/entry
entry colname="c6"
pheparan sulfate (glucosamine) 3-O-sulfotransferase 3B1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p614/p
/entry
entry colname="c2"
p0.0007139/p
/entry
entry colname="c3"
p-1.19/p
/entry
entry colname="c4"
p211066_x_at/p
/entry
entry colname="c5"
pPCDHGC3/p
/entry
entry colname="c6"
pprotocadherin gamma subfamily C, 3/p
/entry
/row
row rowsep="1"
entry colname="c1"
p615/p
/entry
entry colname="c2"
p0.0006984/p
/entry
entry colname="c3"
p-1.09/p
/entry
entry colname="c4"
p202814_s_at/p
/entry
entry colname="c5"
pHEXIM1/p
/entry
entry colname="c6"
phexamethylene bis-acetamide inducible 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p616/p
/entry
entry colname="c2"
p0.0006943/p
/entry
entry colname="c3"
p-1.35/p
/entry
entry colname="c4"
p226710_at/p
/entry
entry colname="c5"
pC8orf82/p
/entry
entry colname="c6"
pchromosome 8 open reading frame 82/p
/entry
/row
row rowsep="1"
entry colname="c1"
p617/p
/entry
entry colname="c2"
p0.0006932/p
/entry
entry colname="c3"
p-3.2/p
/entry
entry colname="c4"
p209969_s_at/p
/entry
entry colname="c5"
pSTAT1/p
/entry
entry colname="c6"
psignal transducer and activator of transcription 1, 91kDa/p
/entry
/row
row rowsep="1"
entry colname="c1"
p618/p
/entry
entry colname="c2"
p0.0006882/p
/entry
entry colname="c3"
p-1.56/p
/entry
entry colname="c4"
p225242_s_at/p
/entry
entry colname="c5"
pCCDC80/p
/entry
entry colname="c6"
pcoiled-coil domain containing 80/p
/entry
/row
row rowsep="1"
entry colname="c1"
p619/p
/entry
entry colname="c2"
p0.0006875/p
/entry
entry colname="c3"
p-1.5/p
/entry
entry colname="c4"
p214121_x_at/p
/entry
entry colname="c5"
pPDLIM7/p
/entry
entry colname="c6"
pPDZ and LIM domain 7 (enigma)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p620/p
/entry
entry colname="c2"
p0.0006868/p
/entry
entry colname="c3"
p-1.41/p
/entry
entry colname="c4"
p203916_at/p
/entry
entry colname="c5"
pNDST2/p
/entry
entry colname="c6"
pN-deacetylaseN-sulfotransferase (heparan glucosaminyl) 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p621/p
/entry
entry colname="c2"
p0.0006826/p
/entry
entry colname="c3"
p-1.32/p
/entry
entry colname="c4"
p208901_s_at/p
/entry
entry colname="c5"
pTOP1/p
/entry
entry colname="c6"
ptopoisomerase (DNA) I/p
/entry
/row
row rowsep="1"
entry colname="c1"
p622/p
/entry
entry colname="c2"
p0.0006769/p
/entry
entry colname="c3"
p-2.95/p
/entry
entry colname="c4"
p206028_s_at/p
/entry
entry colname="c5"
pMERTK/p
/entry
entry colname="c6"
pc-mer proto-oncogene tyrosine kinase/p
/entry
/row
row rowsep="1"
entry colname="c1"
p623/p
/entry
entry colname="c2"
p0.0006749/p
/entry
entry colname="c3"
p-1.35/p
/entry
entry colname="c4"
p205724_at/p
/entry
entry colname="c5"
pPKP1/p
/entry
entry colname="c6"
pplakophilin 1 (ectodermal dysplasiaskin fragility syndrome)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p624/p
/entry
entry colname="c2"
p0.0006737/p
/entry
entry colname="c3"
p-1.23/p
/entry
entry colname="c4"
p228121_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p625/p
/entry
entry colname="c2"
p0.0006701/p
/entry
entry colname="c3"
p-1.04/p
/entry
entry colname="c4"
p226928_x_at/p
/entry
entry colname="c5"
pSLC25A37/p
/entry
entry colname="c6"
psolute carrier family 25, member 37/p
/entry
/row
row rowsep="1"
entry colname="c1"
p626/p
/entry
entry colname="c2"
p0.0006700/p
/entry
entry colname="c3"
p-1.37/p
/entry
entry colname="c4"
p1555301_a_at/p
/entry
entry colname="c5"
pDIP2A/p
/entry
entry colname="c6"
pDIP2 disco-interacting protein 2 homolog A (Drosophila)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p627/p
/entry
entry colname="c2"
p0.0006616/p
/entry
entry colname="c3"
p-1.27/p
/entry
entry colname="c4"
p1566301_at/p
/entry
entry colname="c5"
pPPP1R11/p
/entry
entry colname="c6"
pprotein phosphatase 1, regulatory (inhibitor) subunit 11/p
/entry
/row
row rowsep="1"
entry colname="c1"
p628/p
/entry
entry colname="c2"
p0.0006570/p
/entry
entry colname="c3"
p-1.46/p
/entry
entry colname="c4"
p234519_at/p
/entry
entry colname="c5"
pNOBOX/p
/entry
entry colname="c6"
pNOBOX oogenesis homeobox/p
/entry
/row
row rowsep="1"
entry colname="c1"
p629/p
/entry
entry colname="c2"
p0.0006553/p
/entry
entry colname="c3"
p-1.24/p
/entry
entry colname="c4"
p218520_at/p
/entry
entry colname="c5"
pTBK1/p
/entry
entry colname="c6"
pTANK-binding kinase 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p630/p
/entry
entry colname="c2"
p0.0006552/p
/entry
entry colname="c3"
p-1.55/p
/entry
entry colname="c4"
p201878_at/p
/entry
entry colname="c5"
pARIH1/p
/entry
entry colname="c6"
pariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p631/p
/entry
entry colname="c2"
p0.0006495/p
/entry
entry colname="c3"
p-1.3/p
/entry
entry colname="c4"
p1564131_a_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p632/p
/entry
entry colname="c2"
p0.0006472/p
/entry
entry colname="c3"
p-1.49/p
/entry
entry colname="c4"
p209102_s_at/p
/entry
entry colname="c5"
pHBP1/p
/entry
entry colname="c6"
pHMG-box transcription factor 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p633/p
/entry
entry colname="c2"
p0.0006450/p
/entry
entry colname="c3"
p-1.18/p
/entry
entry colname="c4"
p238586_at/p
/entry
entry colname="c5"
pLOC731489/p
/entry
entry colname="c6"
phypothetical protein LOC731489/p
/entry
/row
row rowsep="1"
entry colname="c1"
p634/p
/entry
entry colname="c2"
p0.0006425/p
/entry
entry colname="c3"
p-1.03/p
/entry
entry colname="c4"
p216231_s_at/p
/entry
entry colname="c5"
pB2M/p
/entry
entry colname="c6"
pbeta-2-microglobulin/p
/entry
/row
row rowsep="1"
entry colname="c1"
p635/p
/entry
entry colname="c2"
p0.0006398/p
/entry
entry colname="c3"
p-1.79/p
/entry
entry colname="c4"
p1552772_at/p
/entry
entry colname="c5"
pCLEC4D/p
/entry
entry colname="c6"
pC-type lectin domain family 4, member D/p
/entry
/row
row rowsep="1"
entry colname="c1"
p636/p
/entry
entry colname="c2"
p0.0006384/p
/entry
entry colname="c3"
p-1.42/p
/entry
entry colname="c4"
p201586_s_at/p
/entry
entry colname="c5"
pSFPQ/p
/entry
entry colname="c6"
psplicing factor prolineglutamine-rich (polypyrimidine tract binding protein associated)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p637/p
/entry
entry colname="c2"
p0.0006373/p
/entry
entry colname="c3"
p-1.74/p
/entry
entry colname="c4"
p41644_at/p
/entry
entry colname="c5"
pSASH1/p
/entry
entry colname="c6"
pSAM and SH3 domain containing 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p638/p
/entry
entry colname="c2"
p0.0006346/p
/entry
entry colname="c3"
p-1.11/p
/entry
entry colname="c4"
p216652_s_at/p
/entry
entry colname="c5"
pDR1/p
/entry
entry colname="c6"
pdown-regulator of transcription 1, TBP-binding (negative cofactor 2)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p639/p
/entry
entry colname="c2"
p0.0006313/p
/entry
entry colname="c3"
p-1.3/p
/entry
entry colname="c4"
p212436_at/p
/entry
entry colname="c5"
pTRIM33/p
/entry
entry colname="c6"
ptripartite motif-containing 33/p
/entry
/row
row rowsep="1"
entry colname="c1"
p640/p
/entry
entry colname="c2"
p0.0006284/p
/entry
entry colname="c3"
p-1.57/p
/entry
entry colname="c4"
p212264_s_at/p
/entry
entry colname="c5"
pWAPAL/p
/entry
entry colname="c6"
pwings apart-like homolog (Drosophila)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p641/p
/entry
entry colname="c2"
p0.0006259/p
/entry
entry colname="c3"
p-1.2/p
/entry
entry colname="c4"
p226481_at/p
/entry
entry colname="c5"
pVPRBP/p
/entry
entry colname="c6"
pVpr (HIV-1) binding protein/p
/entry
/row
row rowsep="1"
entry colname="c1"
p642/p
/entry
entry colname="c2"
p0.0006104/p
/entry
entry colname="c3"
p-1.35/p
/entry
entry colname="c4"
p217490_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p643/p
/entry
entry colname="c2"
p0.0006091/p
/entry
entry colname="c3"
p-1.29/p
/entry
entry colname="c4"
p1557463_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p644/p
/entry
entry colname="c2"
p0.0005929/p
/entry
entry colname="c3"
p-1.35/p
/entry
entry colname="c4"
p238273_at/p
/entry
entry colname="c5"
pPL-5283/p
/entry
entry colname="c6"
pPL-5283 protein/p
/entry
/row
row rowsep="1"
entry colname="c1"
p645/p
/entry
entry colname="c2"
p0.0005927/p
/entry
entry colname="c3"
p-1.77/p
/entry
entry colname="c4"
p203840_at/p
/entry
entry colname="c5"
pBLZF1/p
/entry
entry colname="c6"
pbasic leucine zipper nuclear factor 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p646/p
/entry
entry colname="c2"
p0.0005896/p
/entry
entry colname="c3"
p-1.17/p
/entry
entry colname="c4"
p237604_at/p
/entry
entry colname="c5"
pLOC415056/p
/entry
entry colname="c6"
phypothetical gene LOC415056/p
/entry
/row
row rowsep="1"
entry colname="c1"
p647/p
/entry
entry colname="c2"
p0.0005883/p
/entry
entry colname="c3"
p-1.9/p
/entry
entry colname="c4"
p222881_at/p
/entry
entry colname="c5"
pHPSE/p
/entry
entry colname="c6"
pheparanase/p
/entry
/row
row rowsep="1"
entry colname="c1"
p648/p
/entry
entry colname="c2"
p0.0005855/p
/entry
entry colname="c3"
p-1.25/p
/entry
entry colname="c4"
p220634_at/p
/entry
entry colname="c5"
pTBX4/p
/entry
entry colname="c6"
pT-box 4/p
/entry
/row
row rowsep="1"
entry colname="c1"
p649/p
/entry
entry colname="c2"
p0.0005853/p
/entry
entry colname="c3"
p-1.3/p
/entry
entry colname="c4"
p200669_s_at/p
/entry
entry colname="c5"
pUBE2D3/p
/entry
entry colname="c6"
pubiquitin-conjugating enzyme E2D 3 (UBC45 homolog, yeast)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p650/p
/entry
entry colname="c2"
p0.0005801/p
/entry
entry colname="c3"
p-1.05/p
/entry
entry colname="c4"
p232017_at/p
/entry
entry colname="c5"
pTJP2/p
/entry
entry colname="c6"
ptight junction protein 2 (zona occludens 2)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p651/p
/entry
entry colname="c2"
p0.0005772/p
/entry
entry colname="c3"
p-1.35/p
/entry
entry colname="c4"
p213918_s_at/p
/entry
entry colname="c5"
pNIPBL/p
/entry
entry colname="c6"
pNipped-B homolog (Drosophila)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p652/p
/entry
entry colname="c2"
p0.0005770/p
/entry
entry colname="c3"
p-1.62/p
/entry
entry colname="c4"
p215357_s_at/p
/entry
entry colname="c5"
pPOLDIP3/p
/entry
entry colname="c6"
ppolymerase (DNA-directed), delta interacting protein 3/p
/entry
/row
row rowsep="1"
entry colname="c1"
p653/p
/entry
entry colname="c2"
p0.0005750/p
/entry
entry colname="c3"
p-1.4/p
/entry
entry colname="c4"
p1561354_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p654/p
/entry
entry colname="c2"
p0.0005678/p
/entry
entry colname="c3"
p-1.08/p
/entry
entry colname="c4"
p206516_at/p
/entry
entry colname="c5"
pAMH/p
/entry
entry colname="c6"
panti-Mullerian hormone/p
/entry
/row
row rowsep="1"
entry colname="c1"
p655/p
/entry
entry colname="c2"
p0.0005652/p
/entry
entry colname="c3"
p-2.05/p
/entry
entry colname="c4"
p211030_s_at/p
/entry
entry colname="c5"
pSLC6A6/p
/entry
entry colname="c6"
psolute carrier family 6 (neurotransmitter transporter, taurine), member 6/p
/entry
/row
row rowsep="1"
entry colname="c1"
p656/p
/entry
entry colname="c2"
p0.0005634/p
/entry
entry colname="c3"
p-2.18/p
/entry
entry colname="c4"
p222651_s_at/p
/entry
entry colname="c5"
pTRPS1/p
/entry
entry colname="c6"
ptrichorhinophalangeal syndrome I/p
/entry
/row
row rowsep="1"
entry colname="c1"
p657/p
/entry
entry colname="c2"
p0.0005618/p
/entry
entry colname="c3"
p-2.05/p
/entry
entry colname="c4"
p57703_at/p
/entry
entry colname="c5"
pSENP5/p
/entry
entry colname="c6"
pSUMO1sentrin specific peptidase 5/p
/entry
/row
row rowsep="1"
entry colname="c1"
p658/p
/entry
entry colname="c2"
p0.0005604/p
/entry
entry colname="c3"
p-11.89/p
/entry
entry colname="c4"
p211372_s_at/p
/entry
entry colname="c5"
pIL1R2/p
/entry
entry colname="c6"
pinterleukin 1 receptor, type II/p
/entry
/row
row rowsep="1"
entry colname="c1"
p659/p
/entry
entry colname="c2"
p0.0005547/p
/entry
entry colname="c3"
p-1.2/p
/entry
entry colname="c4"
p1567246_at/p
/entry
entry colname="c5"
pOR5H1/p
/entry
entry colname="c6"
polfactory receptor, family 5, subfamily H, member 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p660/p
/entry
entry colname="c2"
p0.0005488/p
/entry
entry colname="c3"
p-1.85/p
/entry
entry colname="c4"
p205003_at/p
/entry
entry colname="c5"
pDOCK4/p
/entry
entry colname="c6"
pdedicator of cytokinesis 4/p
/entry
/row
row rowsep="1"
entry colname="c1"
p661/p
/entry
entry colname="c2"
p0.0005371/p
/entry
entry colname="c3"
p-2.37/p
/entry
entry colname="c4"
p222262_s_at/p
/entry
entry colname="c5"
pETNK1/p
/entry
entry colname="c6"
pethanolamine kinase 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p662/p
/entry
entry colname="c2"
p0.0005358/p
/entry
entry colname="c3"
p-1.38/p
/entry
entry colname="c4"
p201684_s_at/p
/entry
entry colname="c5"
pTOX4/p
/entry
entry colname="c6"
pTOX high mobility group box family member 4/p
/entry
/row
row rowsep="1"
entry colname="c1"
p663/p
/entry
entry colname="c2"
p0.0005357/p
/entry
entry colname="c3"
p-1.85/p
/entry
entry colname="c4"
p206011_at/p
/entry
entry colname="c5"
pCASP1/p
/entry
entry colname="c6"
pcaspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p664/p
/entry
entry colname="c2"
p0.0005349/p
/entry
entry colname="c3"
p-1.16/p
/entry
entry colname="c4"
p211505_s_at/p
/entry
entry colname="c5"
pSTAU1/p
/entry
entry colname="c6"
pstaufen, RNA binding protein, homolog 1 (Drosophila)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p665/p
/entry
entry colname="c2"
p0.0005342/p
/entry
entry colname="c3"
p-1.47/p
/entry
entry colname="c4"
p1554049_s_at/p
/entry
entry colname="c5"
pWDR42A/p
/entry
entry colname="c6"
pWD repeat domain 42A/p
/entry
/row
row rowsep="1"
entry colname="c1"
p666/p
/entry
entry colname="c2"
p0.0005321/p
/entry
entry colname="c3"
p-1.36/p
/entry
entry colname="c4"
p225978_at/p
/entry
entry colname="c5"
pFAM80B/p
/entry
entry colname="c6"
pfamily with sequence similarity 80, member B/p
/entry
/row
row rowsep="1"
entry colname="c1"
p667/p
/entry
entry colname="c2"
p0.0005228/p
/entry
entry colname="c3"
p-1.15/p
/entry
entry colname="c4"
p215056_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p668/p
/entry
entry colname="c2"
p0.0005162/p
/entry
entry colname="c3"
p-1.38/p
/entry
entry colname="c4"
p202066_at/p
/entry
entry colname="c5"
pPPFIA1/p
/entry
entry colname="c6"
pprotein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p669/p
/entry
entry colname="c2"
p0.0005087/p
/entry
entry colname="c3"
p-1.13/p
/entry
entry colname="c4"
p226128_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p670/p
/entry
entry colname="c2"
p0.0005005/p
/entry
entry colname="c3"
p-1.17/p
/entry
entry colname="c4"
p1562449_s_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p671/p
/entry
entry colname="c2"
p0.0004997/p
/entry
entry colname="c3"
p-1.51/p
/entry
entry colname="c4"
p217847_s_at/p
/entry
entry colname="c5"
pTHRAP3/p
/entry
entry colname="c6"
pthyroid hormone receptor associated protein 3/p
/entry
/row
row rowsep="1"
entry colname="c1"
p672/p
/entry
entry colname="c2"
p0.0004992/p
/entry
entry colname="c3"
p-1.6/p
/entry
entry colname="c4"
p229845_at/p
/entry
entry colname="c5"
pMAPKAP1/p
/entry
entry colname="c6"
pmitogen-activated protein kinase associated protein 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p673/p
/entry
entry colname="c2"
p0.0004955/p
/entry
entry colname="c3"
p-2.82/p
/entry
entry colname="c4"
p211806_s_at/p
/entry
entry colname="c5"
pKCNJ15/p
/entry
entry colname="c6"
ppotassium inwardly-rectifying channel, subfamily J, member 15/p
/entry
/row
row rowsep="1"
entry colname="c1"
p674/p
/entry
entry colname="c2"
p0.0004947/p
/entry
entry colname="c3"
p-2.32/p
/entry
entry colname="c4"
p217503_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p675/p
/entry
entry colname="c2"
p0.0004946/p
/entry
entry colname="c3"
p-1.2/p
/entry
entry colname="c4"
p221147_x_at/p
/entry
entry colname="c5"
pWWOX/p
/entry
entry colname="c6"
pWW domain containing oxidoreductase/p
/entry
/row
row rowsep="1"
entry colname="c1"
p676/p
/entry
entry colname="c2"
p0.0004897/p
/entry
entry colname="c3"
p-1.26/p
/entry
entry colname="c4"
p1552684_a_at/p
/entry
entry colname="c5"
pSENP8/p
/entry
entry colname="c6"
pSUMOsentrin specific peptidase family member 8/p
/entry
/row
row rowsep="1"
entry colname="c1"
p677/p
/entry
entry colname="c2"
p0.0004707/p
/entry
entry colname="c3"
p-1.17/p
/entry
entry colname="c4"
p206251_s_at/p
/entry
entry colname="c5"
pAVPR1A/p
/entry
entry colname="c6"
parginine vasopressin receptor 1A/p
/entry
/row
row rowsep="1"
entry colname="c1"
p678/p
/entry
entry colname="c2"
p0.0004609/p
/entry
entry colname="c3"
p-1.24/p
/entry
entry colname="c4"
p223546_x_at/p
/entry
entry colname="c5"
pLUC7L/p
/entry
entry colname="c6"
pLUC7-like (S. cerevisiae)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p679/p
/entry
entry colname="c2"
p0.0004595/p
/entry
entry colname="c3"
p-1.33/p
/entry
entry colname="c4"
p208576_s_at/p
/entry
entry colname="c5"
pHIST1H3B/p
/entry
entry colname="c6"
phistone cluster 1, H3b/p
/entry
/row
row rowsep="1"
entry colname="c1"
p680/p
/entry
entry colname="c2"
p0.0004582/p
/entry
entry colname="c3"
p-1.97/p
/entry
entry colname="c4"
p202684_s_at/p
/entry
entry colname="c5"
pRNMT/p
/entry
entry colname="c6"
pRNA (guanine-7-) methyltransferase/p
/entry
/row
row rowsep="1"
entry colname="c1"
p681/p
/entry
entry colname="c2"
p0.0004567/p
/entry
entry colname="c3"
p-1.36/p
/entry
entry colname="c4"
p201378_s_at/p
/entry
entry colname="c5"
pUBAP2L/p
/entry
entry colname="c6"
pubiquitin associated protein 2-like/p
/entry
/row
row rowsep="1"
entry colname="c1"
p682/p
/entry
entry colname="c2"
p0.0004553/p
/entry
entry colname="c3"
p-1.15/p
/entry
entry colname="c4"
p202178_at/p
/entry
entry colname="c5"
pPRKCZ/p
/entry
entry colname="c6"
pprotein kinase C, zeta/p
/entry
/row
row rowsep="1"
entry colname="c1"
p683/p
/entry
entry colname="c2"
p0.0004545/p
/entry
entry colname="c3"
p-1.13/p
/entry
entry colname="c4"
p1555139_a_at/p
/entry
entry colname="c5"
pOTUD7B/p
/entry
entry colname="c6"
pOTU domain containing 7B/p
/entry
/row
row rowsep="1"
entry colname="c1"
p684/p
/entry
entry colname="c2"
p0.0004543/p
/entry
entry colname="c3"
p-1.47/p
/entry
entry colname="c4"
p244595_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p685/p
/entry
entry colname="c2"
p0.0004511/p
/entry
entry colname="c3"
p-1.32/p
/entry
entry colname="c4"
p210592_s_at/p
/entry
entry colname="c5"
p040112/p
/entry
entry colname="c6"
pspermidinespermine N1-acetyltransferase 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p686/p
/entry
entry colname="c2"
p0.0004444/p
/entry
entry colname="c3"
p-1.21/p
/entry
entry colname="c4"
p1554327_a_at/p
/entry
entry colname="c5"
pCANT1/p
/entry
entry colname="c6"
pcalcium activated nucleotidase 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p687/p
/entry
entry colname="c2"
p0.0004435/p
/entry
entry colname="c3"
p-1.41/p
/entry
entry colname="c4"
p223430_at/p
/entry
entry colname="c5"
pSNF1LK2/p
/entry
entry colname="c6"
pSNF1-like kinase 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p688/p
/entry
entry colname="c2"
p0.0004430/p
/entry
entry colname="c3"
p-1.42/p
/entry
entry colname="c4"
p232437_at/p
/entry
entry colname="c5"
pCPSF3L/p
/entry
entry colname="c6"
pcleavage and polyadenylation specific factor 3-like/p
/entry
/row
row rowsep="1"
entry colname="c1"
p689/p
/entry
entry colname="c2"
p0.0004418/p
/entry
entry colname="c3"
p-1.11/p
/entry
entry colname="c4"
p202230_s_at/p
/entry
entry colname="c5"
pCHERP/p
/entry
entry colname="c6"
pcalcium homeostasis endoplasmic reticulum protein/p
/entry
/row
row rowsep="1"
entry colname="c1"
p690/p
/entry
entry colname="c2"
p0.0004358/p
/entry
entry colname="c3"
p-1.8/p
/entry
entry colname="c4"
p211782_at/p
/entry
entry colname="c5"
pIDS/p
/entry
entry colname="c6"
piduronate 2-sulfatase/p
/entry
/row
row rowsep="1"
entry colname="c1"
p691/p
/entry
entry colname="c2"
p0.0004288/p
/entry
entry colname="c3"
p-1.63/p
/entry
entry colname="c4"
p208869_s_at/p
/entry
entry colname="c5"
pGABARAPL1/p
/entry
entry colname="c6"
pGABA(A) receptor-associated protein like 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p692/p
/entry
entry colname="c2"
p0.0004258/p
/entry
entry colname="c3"
p-1.14/p
/entry
entry colname="c4"
p1554646_at/p
/entry
entry colname="c5"
pOSBPL1A/p
/entry
entry colname="c6"
poxysterol binding protein-like 1A/p
/entry
/row
row rowsep="1"
entry colname="c1"
p693/p
/entry
entry colname="c2"
p0.0004189/p
/entry
entry colname="c3"
p-1.29/p
/entry
entry colname="c4"
p224410_s_at/p
/entry
entry colname="c5"
pLMBR1/p
/entry
entry colname="c6"
plimb region 1 homolog (mouse)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p694/p
/entry
entry colname="c2"
p0.0004130/p
/entry
entry colname="c3"
p-1.09/p
/entry
entry colname="c4"
p201698_s_at/p
/entry
entry colname="c5"
pSFRS9/p
/entry
entry colname="c6"
psplicing factor, arginineserine-rich 9/p
/entry
/row
row rowsep="1"
entry colname="c1"
p695/p
/entry
entry colname="c2"
p0.0004109/p
/entry
entry colname="c3"
p-1.57/p
/entry
entry colname="c4"
p218578_at/p
/entry
entry colname="c5"
pCDC73/p
/entry
entry colname="c6"
pcell division cycle 73, Paf1RNA polymerase II complex component, homolog (S. cerevisiae)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p696/p
/entry
entry colname="c2"
p0.0003904/p
/entry
entry colname="c3"
p-1.3/p
/entry
entry colname="c4"
p1566456_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p697/p
/entry
entry colname="c2"
p0.0003884/p
/entry
entry colname="c3"
p-2.78/p
/entry
entry colname="c4"
p226026_at/p
/entry
entry colname="c5"
pDIRC2/p
/entry
entry colname="c6"
pdisrupted in renal carcinoma 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p698/p
/entry
entry colname="c2"
p0.0003884/p
/entry
entry colname="c3"
p-1.49/p
/entry
entry colname="c4"
p222035_s_at/p
/entry
entry colname="c5"
pPAPOLA/p
/entry
entry colname="c6"
ppoly(A) polymerase alpha/p
/entry
/row
row rowsep="1"
entry colname="c1"
p699/p
/entry
entry colname="c2"
p0.0003882/p
/entry
entry colname="c3"
p-1.25/p
/entry
entry colname="c4"
p240313_at/p
/entry
entry colname="c5"
pDMRTB1/p
/entry
entry colname="c6"
pDMRT-like family B with proline-rich C-terminal, 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p700/p
/entry
entry colname="c2"
p0.0003880/p
/entry
entry colname="c3"
p-1.65/p
/entry
entry colname="c4"
p242943_at/p
/entry
entry colname="c5"
pST8SIA4/p
/entry
entry colname="c6"
pST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4/p
/entry
/row
row rowsep="1"
entry colname="c1"
p701/p
/entry
entry colname="c2"
p0.0003868/p
/entry
entry colname="c3"
p-2.87/p
/entry
entry colname="c4"
p243271_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p702/p
/entry
entry colname="c2"
p0.0003850/p
/entry
entry colname="c3"
p-1.43/p
/entry
entry colname="c4"
p234173_s_at/p
/entry
entry colname="c5"
pNXF2/p
/entry
entry colname="c6"
pnuclear RNA export factor 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p703/p
/entry
entry colname="c2"
p0.0003839/p
/entry
entry colname="c3"
p-1.93/p
/entry
entry colname="c4"
p211368_s_at/p
/entry
entry colname="c5"
pCASP1/p
/entry
entry colname="c6"
pcaspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p704/p
/entry
entry colname="c2"
p0.0003823/p
/entry
entry colname="c3"
p-1.24/p
/entry
entry colname="c4"
p227712_at/p
/entry
entry colname="c5"
pLYRM2/p
/entry
entry colname="c6"
pLYR motif containing 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p705/p
/entry
entry colname="c2"
p0.0003803/p
/entry
entry colname="c3"
p-1.63/p
/entry
entry colname="c4"
p201377_at/p
/entry
entry colname="c5"
pUBAP2L/p
/entry
entry colname="c6"
pubiquitin associated protein 2-like/p
/entry
/row
row rowsep="1"
entry colname="c1"
p706/p
/entry
entry colname="c2"
p0.0003785/p
/entry
entry colname="c3"
p-1.4/p
/entry
entry colname="c4"
p204858_s_at/p
/entry
entry colname="c5"
pTYMP/p
/entry
entry colname="c6"
pthymidine phosphorylase/p
/entry
/row
row rowsep="1"
entry colname="c1"
p707/p
/entry
entry colname="c2"
p0.0003695/p
/entry
entry colname="c3"
p-1.53/p
/entry
entry colname="c4"
p205415_s_at/p
/entry
entry colname="c5"
pATXN3/p
/entry
entry colname="c6"
pataxin 3/p
/entry
/row
row rowsep="1"
entry colname="c1"
p708/p
/entry
entry colname="c2"
p0.0003684/p
/entry
entry colname="c3"
p-2.46/p
/entry
entry colname="c4"
p209237_s_at/p
/entry
entry colname="c5"
pSLC23A2/p
/entry
entry colname="c6"
psolute carrier family 23 (nucleobase transporters), member 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p709/p
/entry
entry colname="c2"
p0.0003661/p
/entry
entry colname="c3"
p-1.25/p
/entry
entry colname="c4"
p235833_at/p
/entry
entry colname="c5"
pPPAT/p
/entry
entry colname="c6"
pphosphoribosyl pyrophosphate amidotransferase/p
/entry
/row
row rowsep="1"
entry colname="c1"
p710/p
/entry
entry colname="c2"
p0.0003575/p
/entry
entry colname="c3"
p-1.29/p
/entry
entry colname="c4"
p209590_at/p
/entry
entry colname="c5"
pBMP7/p
/entry
entry colname="c6"
pbone morphogenetic protein 7/p
/entry
/row
row rowsep="1"
entry colname="c1"
p711/p
/entry
entry colname="c2"
p0.0003529/p
/entry
entry colname="c3"
p-3.5/p
/entry
entry colname="c4"
p215966_x_at/p
/entry
entry colname="c5"
pGK3P/p
/entry
entry colname="c6"
pglycerol kinase 3 pseudogene/p
/entry
/row
row rowsep="1"
entry colname="c1"
p712/p
/entry
entry colname="c2"
p0.0003527/p
/entry
entry colname="c3"
p-1.22/p
/entry
entry colname="c4"
p202807_s_at/p
/entry
entry colname="c5"
pTOM1/p
/entry
entry colname="c6"
ptarget of myb1 (chicken)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p713/p
/entry
entry colname="c2"
p0.0003455/p
/entry
entry colname="c3"
p-1.18/p
/entry
entry colname="c4"
p201198_s_at/p
/entry
entry colname="c5"
pPSMD1/p
/entry
entry colname="c6"
pproteasome (prosome, macropain) 26S subunit, non-ATPase, 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p714/p
/entry
entry colname="c2"
p0.0003409/p
/entry
entry colname="c3"
p-3.97/p
/entry
entry colname="c4"
p202068_s_at/p
/entry
entry colname="c5"
pLDLR/p
/entry
entry colname="c6"
plow density lipoprotein receptor/p
/entry
/row
row rowsep="1"
entry colname="c1"
p715/p
/entry
entry colname="c2"
p0.0003389/p
/entry
entry colname="c3"
p-1.07/p
/entry
entry colname="c4"
p200914_x_at/p
/entry
entry colname="c5"
pKTN1/p
/entry
entry colname="c6"
pkinectin 1 (kinesin receptor)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p716/p
/entry
entry colname="c2"
p0.0003355/p
/entry
entry colname="c3"
p-1.77/p
/entry
entry colname="c4"
p225395_s_at/p
/entry
entry colname="c5"
pFAM120AOS/p
/entry
entry colname="c6"
pfamily with sequence similarity 120A opposite strand/p
/entry
/row
row rowsep="1"
entry colname="c1"
p717/p
/entry
entry colname="c2"
p0.0003300/p
/entry
entry colname="c3"
p-1.17/p
/entry
entry colname="c4"
p216306_x_at/p
/entry
entry colname="c5"
pPTBP1/p
/entry
entry colname="c6"
ppolypyrimidine tract binding protein 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p718/p
/entry
entry colname="c2"
p0.0003300/p
/entry
entry colname="c3"
p-1.38/p
/entry
entry colname="c4"
p208985_s_at/p
/entry
entry colname="c5"
pEIF3J/p
/entry
entry colname="c6"
peukaryotic translation initiation factor 3, subunit J/p
/entry
/row
row rowsep="1"
entry colname="c1"
p719/p
/entry
entry colname="c2"
p0.0003231/p
/entry
entry colname="c3"
p-1.15/p
/entry
entry colname="c4"
p1569932_at/p
/entry
entry colname="c5"
pNHSL2/p
/entry
entry colname="c6"
pNHS-like 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p720/p
/entry
entry colname="c2"
p0.0003229/p
/entry
entry colname="c3"
p-1.41/p
/entry
entry colname="c4"
p204781_s_at/p
/entry
entry colname="c5"
pFAS/p
/entry
entry colname="c6"
pFas (TNF receptor superfamily, member 6)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p721/p
/entry
entry colname="c2"
p0.0003210/p
/entry
entry colname="c3"
p-2/p
/entry
entry colname="c4"
p209593_s_at/p
/entry
entry colname="c5"
pTOR1B/p
/entry
entry colname="c6"
ptorsin family 1, member B (torsin B)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p722/p
/entry
entry colname="c2"
p0.0003206/p
/entry
entry colname="c3"
p-1.3/p
/entry
entry colname="c4"
p237285_at/p
/entry
entry colname="c5"
pSORBS2/p
/entry
entry colname="c6"
psorbin and SH3 domain containing 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p723/p
/entry
entry colname="c2"
p0.0003169/p
/entry
entry colname="c3"
p-1.19/p
/entry
entry colname="c4"
p202550_s_at/p
/entry
entry colname="c5"
pVAPB/p
/entry
entry colname="c6"
pVAMP (vesicle-associated membrane protein)-associated protein B and C/p
/entry
/row
row rowsep="1"
entry colname="c1"
p724/p
/entry
entry colname="c2"
p0.0003084/p
/entry
entry colname="c3"
p-1.34/p
/entry
entry colname="c4"
p201461_s_at/p
/entry
entry colname="c5"
pMAPKAPK2/p
/entry
entry colname="c6"
pmitogen-activated protein kinase-activated protein kinase 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p725/p
/entry
entry colname="c2"
p0.0003068/p
/entry
entry colname="c3"
p-1.11/p
/entry
entry colname="c4"
p1563069_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p726/p
/entry
entry colname="c2"
p0.0002955/p
/entry
entry colname="c3"
p-1.14/p
/entry
entry colname="c4"
p218382_s_at/p
/entry
entry colname="c5"
pU2AF2/p
/entry
entry colname="c6"
pU2 small nuclear RNA auxiliary factor 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p727/p
/entry
entry colname="c2"
p0.0002940/p
/entry
entry colname="c3"
p-1.11/p
/entry
entry colname="c4"
p205570_at/p
/entry
entry colname="c5"
pPIP4K2A/p
/entry
entry colname="c6"
pphosphatidylinositol-5-phosphate 4-kinase, type II, alpha/p
/entry
/row
row rowsep="1"
entry colname="c1"
p728/p
/entry
entry colname="c2"
p0.0002921/p
/entry
entry colname="c3"
p-1.28/p
/entry
entry colname="c4"
p208642_s_at/p
/entry
entry colname="c5"
pXRCC5/p
/entry
entry colname="c6"
pX-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p729/p
/entry
entry colname="c2"
p0.0002910/p
/entry
entry colname="c3"
p-1.24/p
/entry
entry colname="c4"
p221603_at/p
/entry
entry colname="c5"
pPEX16/p
/entry
entry colname="c6"
pperoxisomal biogenesis factor 16/p
/entry
/row
row rowsep="1"
entry colname="c1"
p730/p
/entry
entry colname="c2"
p0.0002863/p
/entry
entry colname="c3"
p-1.21/p
/entry
entry colname="c4"
p231211_s_at/p
/entry
entry colname="c5"
pLOC541469/p
/entry
entry colname="c6"
phypothetical protein LOC541469/p
/entry
/row
row rowsep="1"
entry colname="c1"
p731/p
/entry
entry colname="c2"
p0.0002857/p
/entry
entry colname="c3"
p-2.02/p
/entry
entry colname="c4"
p219062_s_at/p
/entry
entry colname="c5"
pZCCHC2/p
/entry
entry colname="c6"
pzinc finger, CCHC domain containing 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p732/p
/entry
entry colname="c2"
p0.0002808/p
/entry
entry colname="c3"
p-1.2/p
/entry
entry colname="c4"
p218570_at/p
/entry
entry colname="c5"
pKBTBD4/p
/entry
entry colname="c6"
pkelch repeat and BTB (POZ) domain containing 4/p
/entry
/row
row rowsep="1"
entry colname="c1"
p733/p
/entry
entry colname="c2"
p0.0002799/p
/entry
entry colname="c3"
p-1.16/p
/entry
entry colname="c4"
p223545_at/p
/entry
entry colname="c5"
pFANCD2/p
/entry
entry colname="c6"
pFanconi anemia, complementation group D2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p734/p
/entry
entry colname="c2"
p0.0002764/p
/entry
entry colname="c3"
p-1.34/p
/entry
entry colname="c4"
p1555614_at/p
/entry
entry colname="c5"
pSUGT1P/p
/entry
entry colname="c6"
psuppressor of G2 allele of SKP1 pseudogene (S. cerevisiae)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p735/p
/entry
entry colname="c2"
p0.0002736/p
/entry
entry colname="c3"
p-1.53/p
/entry
entry colname="c4"
p1556283_s_at/p
/entry
entry colname="c5"
pFGFR1OP2/p
/entry
entry colname="c6"
pFGFR1 oncogene partner 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p736/p
/entry
entry colname="c2"
p0.0002703/p
/entry
entry colname="c3"
p-1.66/p
/entry
entry colname="c4"
p226022_at/p
/entry
entry colname="c5"
pSASH1/p
/entry
entry colname="c6"
pSAM and SH3 domain containing 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p737/p
/entry
entry colname="c2"
p0.0002699/p
/entry
entry colname="c3"
p-1.87/p
/entry
entry colname="c4"
p214838_at/p
/entry
entry colname="c5"
pSFT2D2/p
/entry
entry colname="c6"
pSFT2 domain containing 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p738/p
/entry
entry colname="c2"
p0.0002674/p
/entry
entry colname="c3"
p-1.26/p
/entry
entry colname="c4"
p206307_s_at/p
/entry
entry colname="c5"
pFOXD1/p
/entry
entry colname="c6"
pforkhead box D1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p739/p
/entry
entry colname="c2"
p0.0002668/p
/entry
entry colname="c3"
p-1.41/p
/entry
entry colname="c4"
p208108_s_at/p
/entry
entry colname="c5"
pAVPR2/p
/entry
entry colname="c6"
parginine vasopressin receptor 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p740/p
/entry
entry colname="c2"
p0.0002633/p
/entry
entry colname="c3"
p-1.21/p
/entry
entry colname="c4"
p239949_at/p
/entry
entry colname="c5"
pTHNSL2/p
/entry
entry colname="c6"
pthreonine synthase-like 2 (S. cerevisiae)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p741/p
/entry
entry colname="c2"
p0.0002619/p
/entry
entry colname="c3"
p-1.76/p
/entry
entry colname="c4"
p1554096_a_at/p
/entry
entry colname="c5"
pRBM33/p
/entry
entry colname="c6"
pRNA binding motif protein 33/p
/entry
/row
row rowsep="1"
entry colname="c1"
p742/p
/entry
entry colname="c2"
p0.0002577/p
/entry
entry colname="c3"
p-1.25/p
/entry
entry colname="c4"
p203039_s_at/p
/entry
entry colname="c5"
pNDUFS1/p
/entry
entry colname="c6"
pNADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p743/p
/entry
entry colname="c2"
p0.0002569/p
/entry
entry colname="c3"
p-3.7/p
/entry
entry colname="c4"
p1563541_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p744/p
/entry
entry colname="c2"
p0.0002547/p
/entry
entry colname="c3"
p-1.33/p
/entry
entry colname="c4"
p210569_s_at/p
/entry
entry colname="c5"
pSIGLEC9/p
/entry
entry colname="c6"
psialic acid binding Ig-like lectin 9/p
/entry
/row
row rowsep="1"
entry colname="c1"
p745/p
/entry
entry colname="c2"
p0.0002484/p
/entry
entry colname="c3"
p-1.44/p
/entry
entry colname="c4"
p203922_s_at/p
/entry
entry colname="c5"
pCYBB/p
/entry
entry colname="c6"
pcytochrome b-245, beta polypeptide/p
/entry
/row
row rowsep="1"
entry colname="c1"
p746/p
/entry
entry colname="c2"
p0.0002482/p
/entry
entry colname="c3"
p-1.33/p
/entry
entry colname="c4"
p220012_at/p
/entry
entry colname="c5"
pERO1LB/p
/entry
entry colname="c6"
pERO1-like beta (S. cerevisiae)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p747/p
/entry
entry colname="c2"
p0.0002373/p
/entry
entry colname="c3"
p-2.41/p
/entry
entry colname="c4"
p236106_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p748/p
/entry
entry colname="c2"
p0.0002362/p
/entry
entry colname="c3"
p-1.34/p
/entry
entry colname="c4"
p242834_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p749/p
/entry
entry colname="c2"
p0.0002316/p
/entry
entry colname="c3"
p-1.2/p
/entry
entry colname="c4"
p220498_at/p
/entry
entry colname="c5"
pACTL7B/p
/entry
entry colname="c6"
pactin-like 7B/p
/entry
/row
row rowsep="1"
entry colname="c1"
p750/p
/entry
entry colname="c2"
p0.0002303/p
/entry
entry colname="c3"
p-1.44/p
/entry
entry colname="c4"
p240873_x_at/p
/entry
entry colname="c5"
pDAB2/p
/entry
entry colname="c6"
pdisabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p751/p
/entry
entry colname="c2"
p0.0002296/p
/entry
entry colname="c3"
p-1.19/p
/entry
entry colname="c4"
p221471_at/p
/entry
entry colname="c5"
pSERINC3/p
/entry
entry colname="c6"
pserine incorporator 3/p
/entry
/row
row rowsep="1"
entry colname="c1"
p752/p
/entry
entry colname="c2"
p0.0002267/p
/entry
entry colname="c3"
p-1.74/p
/entry
entry colname="c4"
p213236_at/p
/entry
entry colname="c5"
pSASH1/p
/entry
entry colname="c6"
pSAM and SH3 domain containing 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p753/p
/entry
entry colname="c2"
p0.0002262/p
/entry
entry colname="c3"
p-1.62/p
/entry
entry colname="c4"
p213988_s_at/p
/entry
entry colname="c5"
p040112/p
/entry
entry colname="c6"
pspermidinespermine N1-acetyltransferase 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p754/p
/entry
entry colname="c2"
p0.0002220/p
/entry
entry colname="c3"
p-1.2/p
/entry
entry colname="c4"
p239372_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p755/p
/entry
entry colname="c2"
p0.0002208/p
/entry
entry colname="c3"
p-1.35/p
/entry
entry colname="c4"
p240079_at/p
/entry
entry colname="c5"
pZNF81/p
/entry
entry colname="c6"
pzinc finger protein 81/p
/entry
/row
row rowsep="1"
entry colname="c1"
p756/p
/entry
entry colname="c2"
p0.0002182/p
/entry
entry colname="c3"
p-1.65/p
/entry
entry colname="c4"
p205227_at/p
/entry
entry colname="c5"
pIL1RAP/p
/entry
entry colname="c6"
pinterleukin 1 receptor accessory protein/p
/entry
/row
row rowsep="1"
entry colname="c1"
p757/p
/entry
entry colname="c2"
p0.0002149/p
/entry
entry colname="c3"
p-1.5/p
/entry
entry colname="c4"
p223751_x_at/p
/entry
entry colname="c5"
pTLR10/p
/entry
entry colname="c6"
ptoll-like receptor 10/p
/entry
/row
row rowsep="1"
entry colname="c1"
p758/p
/entry
entry colname="c2"
p0.0002132/p
/entry
entry colname="c3"
p-1.35/p
/entry
entry colname="c4"
p1553677_a_at/p
/entry
entry colname="c5"
pTIPRL/p
/entry
entry colname="c6"
pTIP41, TOR signaling pathway regulator-like (S. cerevisiae)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p759/p
/entry
entry colname="c2"
p0.0002103/p
/entry
entry colname="c3"
p-1.44/p
/entry
entry colname="c4"
pAFFX-HUMISGF3AM97935_5_at/p
/entry
entry colname="c5"
pSTAT1/p
/entry
entry colname="c6"
psignal transducer and activator of transcription 1, 91kDa/p
/entry
/row
row rowsep="1"
entry colname="c1"
p760/p
/entry
entry colname="c2"
p0.0002103/p
/entry
entry colname="c3"
p-1.11/p
/entry
entry colname="c4"
p202240_at/p
/entry
entry colname="c5"
pPLK1/p
/entry
entry colname="c6"
ppolo-like kinase 1 (Drosophila)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p761/p
/entry
entry colname="c2"
p0.0002099/p
/entry
entry colname="c3"
p-1.28/p
/entry
entry colname="c4"
p1556281_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p762/p
/entry
entry colname="c2"
p0.0002093/p
/entry
entry colname="c3"
p-1.53/p
/entry
entry colname="c4"
p222989_s_at/p
/entry
entry colname="c5"
pUBQLN1/p
/entry
entry colname="c6"
pubiquilin 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p763/p
/entry
entry colname="c2"
p0.0002070/p
/entry
entry colname="c3"
p-1.16/p
/entry
entry colname="c4"
p204682_at/p
/entry
entry colname="c5"
pLTBP2/p
/entry
entry colname="c6"
platent transforming growth factor beta binding protein 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p764/p
/entry
entry colname="c2"
p0.0002018/p
/entry
entry colname="c3"
p-1.37/p
/entry
entry colname="c4"
p225830_at/p
/entry
entry colname="c5"
pPDZD8/p
/entry
entry colname="c6"
pPDZ domain containing 8/p
/entry
/row
row rowsep="1"
entry colname="c1"
p765/p
/entry
entry colname="c2"
p0.0002016/p
/entry
entry colname="c3"
p-1.34/p
/entry
entry colname="c4"
p229208_at/p
/entry
entry colname="c5"
pCEP27/p
/entry
entry colname="c6"
pcentrosomal protein 27kDa/p
/entry
/row
row rowsep="1"
entry colname="c1"
p766/p
/entry
entry colname="c2"
p0.0002006/p
/entry
entry colname="c3"
p-1.38/p
/entry
entry colname="c4"
p202211_at/p
/entry
entry colname="c5"
pARFGAP3/p
/entry
entry colname="c6"
pADP-ribosylation factor GTPase activating protein 3/p
/entry
/row
row rowsep="1"
entry colname="c1"
p767/p
/entry
entry colname="c2"
p0.0001969/p
/entry
entry colname="c3"
p-1.21/p
/entry
entry colname="c4"
p208696_at/p
/entry
entry colname="c5"
pCCT5/p
/entry
entry colname="c6"
pchaperonin containing TCP1, subunit 5 (epsilon)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p768/p
/entry
entry colname="c2"
p0.0001905/p
/entry
entry colname="c3"
p-1.71/p
/entry
entry colname="c4"
p219207_at/p
/entry
entry colname="c5"
pEDC3/p
/entry
entry colname="c6"
penhancer of mRNA decapping 3 homolog (S. cerevisiae)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p769/p
/entry
entry colname="c2"
p0.0001804/p
/entry
entry colname="c3"
p-1.31/p
/entry
entry colname="c4"
p221248_s_at/p
/entry
entry colname="c5"
pWHSC1L1/p
/entry
entry colname="c6"
pWolf-Hirschhorn syndrome candidate 1-like 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p770/p
/entry
entry colname="c2"
p0.0001758/p
/entry
entry colname="c3"
p-1.59/p
/entry
entry colname="c4"
p211781_x_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p771/p
/entry
entry colname="c2"
p0.0001730/p
/entry
entry colname="c3"
p-1.36/p
/entry
entry colname="c4"
p226037_s_at/p
/entry
entry colname="c5"
pTAF9B/p
/entry
entry colname="c6"
pTAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa/p
/entry
/row
row rowsep="1"
entry colname="c1"
p772/p
/entry
entry colname="c2"
p0.0001724/p
/entry
entry colname="c3"
p-1.14/p
/entry
entry colname="c4"
p200901_s_at/p
/entry
entry colname="c5"
pM6PR/p
/entry
entry colname="c6"
pmannose-6-phosphate receptor (cation dependent)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p773/p
/entry
entry colname="c2"
p0.0001713/p
/entry
entry colname="c3"
p-1.67/p
/entry
entry colname="c4"
p213173_at/p
/entry
entry colname="c5"
pPCNX/p
/entry
entry colname="c6"
ppecanex homolog (Drosophila)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p774/p
/entry
entry colname="c2"
p0.0001667/p
/entry
entry colname="c3"
p-2.06/p
/entry
entry colname="c4"
p206038_s_at/p
/entry
entry colname="c5"
pNR2C2/p
/entry
entry colname="c6"
pnuclear receptor subfamily 2, group C, member 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p775/p
/entry
entry colname="c2"
p0.0001616/p
/entry
entry colname="c3"
p-1.24/p
/entry
entry colname="c4"
p225397_at/p
/entry
entry colname="c5"
pC15orf57/p
/entry
entry colname="c6"
pchromosome 15 open reading frame 57/p
/entry
/row
row rowsep="1"
entry colname="c1"
p776/p
/entry
entry colname="c2"
p0.0001297/p
/entry
entry colname="c3"
p-2.14/p
/entry
entry colname="c4"
p211367_s_at/p
/entry
entry colname="c5"
pCASP1/p
/entry
entry colname="c6"
pcaspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p777/p
/entry
entry colname="c2"
p0.0001209/p
/entry
entry colname="c3"
p-1.66/p
/entry
entry colname="c4"
p222810_s_at/p
/entry
entry colname="c5"
pRASAL2/p
/entry
entry colname="c6"
pRAS protein activator like 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p778/p
/entry
entry colname="c2"
p0.0001196/p
/entry
entry colname="c3"
p-1.23/p
/entry
entry colname="c4"
p231718_at/p
/entry
entry colname="c5"
pSLU7/p
/entry
entry colname="c6"
pSLU7 splicing factor homolog (S. cerevisiae)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p779/p
/entry
entry colname="c2"
p0.0001187/p
/entry
entry colname="c3"
p-1.32/p
/entry
entry colname="c4"
p223905_at/p
/entry
entry colname="c5"
pCCDC135/p
/entry
entry colname="c6"
pcoiled-coil domain containing 135/p
/entry
/row
row rowsep="1"
entry colname="c1"
p780/p
/entry
entry colname="c2"
p0.0001127/p
/entry
entry colname="c3"
p-1.28/p
/entry
entry colname="c4"
p211672_s_at/p
/entry
entry colname="c5"
pARPC4/p
/entry
entry colname="c6"
pactin related protein 23 complex, subunit 4, 20kDa/p
/entry
/row
row rowsep="1"
entry colname="c1"
p781/p
/entry
entry colname="c2"
p0.0001127/p
/entry
entry colname="c3"
p-1.38/p
/entry
entry colname="c4"
p200828_s_at/p
/entry
entry colname="c5"
pZNF207/p
/entry
entry colname="c6"
pzinc finger protein 207/p
/entry
/row
row rowsep="1"
entry colname="c1"
p782/p
/entry
entry colname="c2"
p0.0001073/p
/entry
entry colname="c3"
p-1.29/p
/entry
entry colname="c4"
p244211_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p783/p
/entry
entry colname="c2"
p0.0001070/p
/entry
entry colname="c3"
p-12.04/p
/entry
entry colname="c4"
p205403_at/p
/entry
entry colname="c5"
pIL1R2/p
/entry
entry colname="c6"
pinterleukin 1 receptor, type II/p
/entry
/row
row rowsep="1"
entry colname="c1"
p784/p
/entry
entry colname="c2"
p0.0001065/p
/entry
entry colname="c3"
p-1.83/p
/entry
entry colname="c4"
p209970_x_at/p
/entry
entry colname="c5"
pCASP1/p
/entry
entry colname="c6"
pcaspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p785/p
/entry
entry colname="c2"
p0.0001034/p
/entry
entry colname="c3"
p-6.35/p
/entry
entry colname="c4"
p217502_at/p
/entry
entry colname="c5"
pIFIT2/p
/entry
entry colname="c6"
pinterferon-induced protein with tetratricopeptide repeats 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p786/p
/entry
entry colname="c2"
p0.0001029/p
/entry
entry colname="c3"
p-2.07/p
/entry
entry colname="c4"
p237867_s_at/p
/entry
entry colname="c5"
pPID1/p
/entry
entry colname="c6"
pphosphotyrosine interaction domain containing 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p787/p
/entry
entry colname="c2"
p0.0001028/p
/entry
entry colname="c3"
p-1.26/p
/entry
entry colname="c4"
p218516_s_at/p
/entry
entry colname="c5"
pIMPAD1/p
/entry
entry colname="c6"
pinositol monophosphatase domain containing 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p788/p
/entry
entry colname="c2"
p9.94E-005/p
/entry
entry colname="c3"
p-1.64/p
/entry
entry colname="c4"
p226312_at/p
/entry
entry colname="c5"
pRICTOR/p
/entry
entry colname="c6"
prapamycin-insensitive companion of mTOR/p
/entry
/row
row rowsep="1"
entry colname="c1"
p789/p
/entry
entry colname="c2"
p9.41E-005/p
/entry
entry colname="c3"
p-1.2/p
/entry
entry colname="c4"
p210940_s_at/p
/entry
entry colname="c5"
pGRM1/p
/entry
entry colname="c6"
pglutamate receptor, metabotropic 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p790/p
/entry
entry colname="c2"
p9.02E-005/p
/entry
entry colname="c3"
p-1.36/p
/entry
entry colname="c4"
p1554556_a_at/p
/entry
entry colname="c5"
pATP11B/p
/entry
entry colname="c6"
pATPase, class VI, type 11B/p
/entry
/row
row rowsep="1"
entry colname="c1"
p791/p
/entry
entry colname="c2"
p8.89E-005/p
/entry
entry colname="c3"
p-1.14/p
/entry
entry colname="c4"
p226735_at/p
/entry
entry colname="c5"
pTAPT1/p
/entry
entry colname="c6"
ptransmembrane anterior posterior transformation 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p792/p
/entry
entry colname="c2"
p8.70E-005/p
/entry
entry colname="c3"
p-3.84/p
/entry
entry colname="c4"
p213006_at/p
/entry
entry colname="c5"
pCEBPD/p
/entry
entry colname="c6"
pCCAATenhancer binding protein (CEBP), delta/p
/entry
/row
row rowsep="1"
entry colname="c1"
p793/p
/entry
entry colname="c2"
p8.35E-005/p
/entry
entry colname="c3"
p-1.31/p
/entry
entry colname="c4"
p207787_at/p
/entry
entry colname="c5"
pKRT33B/p
/entry
entry colname="c6"
pkeratin 33B/p
/entry
/row
row rowsep="1"
entry colname="c1"
p794/p
/entry
entry colname="c2"
p8.34E-005/p
/entry
entry colname="c3"
p-1.29/p
/entry
entry colname="c4"
p207410_s_at/p
/entry
entry colname="c5"
pTLX2/p
/entry
entry colname="c6"
pT-cell leukemia homeobox 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p795/p
/entry
entry colname="c2"
p8.21E-005/p
/entry
entry colname="c3"
p-1.6/p
/entry
entry colname="c4"
p223596_at/p
/entry
entry colname="c5"
pSLC12A6/p
/entry
entry colname="c6"
psolute carrier family 12 (potassiumchloride transporters), member 6/p
/entry
/row
row rowsep="1"
entry colname="c1"
p796/p
/entry
entry colname="c2"
p7.98E-005/p
/entry
entry colname="c3"
p-1.23/p
/entry
entry colname="c4"
p231859_at/p
/entry
entry colname="c5"
pC14orf132/p
/entry
entry colname="c6"
pchromosome 14 open reading frame 132/p
/entry
/row
row rowsep="1"
entry colname="c1"
p797/p
/entry
entry colname="c2"
p7.81E-005/p
/entry
entry colname="c3"
p-1.25/p
/entry
entry colname="c4"
p228277_at/p
/entry
entry colname="c5"
pFBXL19/p
/entry
entry colname="c6"
pF-box and leucine-rich repeat protein 19/p
/entry
/row
row rowsep="1"
entry colname="c1"
p798/p
/entry
entry colname="c2"
p7.75E-005/p
/entry
entry colname="c3"
p-1.35/p
/entry
entry colname="c4"
p210470_x_at/p
/entry
entry colname="c5"
pNONO/p
/entry
entry colname="c6"
pnon-POU domain containing, octamer-binding/p
/entry
/row
row rowsep="1"
entry colname="c1"
p799/p
/entry
entry colname="c2"
p7.52E-005/p
/entry
entry colname="c3"
p-1.29/p
/entry
entry colname="c4"
p222432_s_at/p
/entry
entry colname="c5"
pCCDC47/p
/entry
entry colname="c6"
pcoiled-coil domain containing 47/p
/entry
/row
row rowsep="1"
entry colname="c1"
p800/p
/entry
entry colname="c2"
p7.19E-005/p
/entry
entry colname="c3"
p-1.8/p
/entry
entry colname="c4"
p238496_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p801/p
/entry
entry colname="c2"
p7.11E-005/p
/entry
entry colname="c3"
p-1.38/p
/entry
entry colname="c4"
p208698_s_at/p
/entry
entry colname="c5"
pNONO/p
/entry
entry colname="c6"
pnon-POU domain containing, octamer-binding/p
/entry
/row
row rowsep="1"
entry colname="c1"
p802/p
/entry
entry colname="c2"
p7.08E-005/p
/entry
entry colname="c3"
p-4.66/p
/entry
entry colname="c4"
p203946_s_at/p
/entry
entry colname="c5"
pARG2/p
/entry
entry colname="c6"
parginase, type II/p
/entry
/row
row rowsep="1"
entry colname="c1"
p803/p
/entry
entry colname="c2"
p7.03E-005/p
/entry
entry colname="c3"
p-1.17/p
/entry
entry colname="c4"
p1559952_x_at/p
/entry
entry colname="c5"
pLOC100132923/p
/entry
entry colname="c6"
psimilar to hCG1993470/p
/entry
/row
row rowsep="1"
entry colname="c1"
p804/p
/entry
entry colname="c2"
p6.19E-005/p
/entry
entry colname="c3"
p-2.35/p
/entry
entry colname="c4"
p220104_at/p
/entry
entry colname="c5"
pZC3HAV1/p
/entry
entry colname="c6"
pzinc finger CCCH-type, antiviral 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p805/p
/entry
entry colname="c2"
p5.57E-005/p
/entry
entry colname="c3"
p-2.43/p
/entry
entry colname="c4"
p203595_s_at/p
/entry
entry colname="c5"
pIFIT5/p
/entry
entry colname="c6"
pinterferon-induced protein with tetratricopeptide repeats 5/p
/entry
/row
row rowsep="1"
entry colname="c1"
p806/p
/entry
entry colname="c2"
p5.53E-005/p
/entry
entry colname="c3"
p-1.33/p
/entry
entry colname="c4"
p1569859_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p807/p
/entry
entry colname="c2"
p5.31E-005/p
/entry
entry colname="c3"
p-1.5/p
/entry
entry colname="c4"
p224359_s_at/p
/entry
entry colname="c5"
pHOOK3/p
/entry
entry colname="c6"
phook homolog 3 (Drosophila)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p808/p
/entry
entry colname="c2"
p4.19E-005/p
/entry
entry colname="c3"
p-2.51/p
/entry
entry colname="c4"
p205921_s_at/p
/entry
entry colname="c5"
pSLC6A6/p
/entry
entry colname="c6"
psolute carrier family 6 (neurotransmitter transporter, taurine), member 6/p
/entry
/row
row rowsep="1"
entry colname="c1"
p809/p
/entry
entry colname="c2"
p3.18E-005/p
/entry
entry colname="c3"
p-2.18/p
/entry
entry colname="c4"
p205749_at/p
/entry
entry colname="c5"
pCYP1A1/p
/entry
entry colname="c6"
pcytochrome P450, family 1, subfamily A, polypeptide 1/p
/entry
/row
row rowsep="1"
entry colname="c1"
p810/p
/entry
entry colname="c2"
p2.93E-005/p
/entry
entry colname="c3"
p-1.38/p
/entry
entry colname="c4"
p1566136_at/p
/entry
entry colname="c5"
pNA/p
/entry
entry colname="c6"
pNA/p
/entry
/row
row rowsep="1"
entry colname="c1"
p811/p
/entry
entry colname="c2"
p2.02E-005/p
/entry
entry colname="c3"
p-1.51/p
/entry
entry colname="c4"
p210992_x_at/p
/entry
entry colname="c5"
pFCGR2C/p
/entry
entry colname="c6"
pFc fragment of IgG, low affinity IIc, receptor for (CD32)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p812/p
/entry
entry colname="c2"
p1.61E-005/p
/entry
entry colname="c3"
p-1.22/p
/entry
entry colname="c4"
p207801_s_at/p
/entry
entry colname="c5"
pRNF10/p
/entry
entry colname="c6"
pring finger protein 10/p
/entry
/row
row rowsep="1"
entry colname="c1"
p813/p
/entry
entry colname="c2"
p1.32E-005/p
/entry
entry colname="c3"
p-2.03/p
/entry
entry colname="c4"
p222816_s_at/p
/entry
entry colname="c5"
pZCCHC2/p
/entry
entry colname="c6"
pzinc finger, CCHC domain containing 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p814/p
/entry
entry colname="c2"
p1.29E-005/p
/entry
entry colname="c3"
p-1.25/p
/entry
entry colname="c4"
p211884_s_at/p
/entry
entry colname="c5"
pCIITA/p
/entry
entry colname="c6"
pclass II, major histocompatibility complex, transactivator/p
/entry
/row
row rowsep="1"
entry colname="c1"
p815/p
/entry
entry colname="c2"
p8.60E-006/p
/entry
entry colname="c3"
p-1.68/p
/entry
entry colname="c4"
p212664_at/p
/entry
entry colname="c5"
pTUBB4/p
/entry
entry colname="c6"
ptubulin, beta 4/p
/entry
/row
row rowsep="1"
entry colname="c1"
p816/p
/entry
entry colname="c2"
p4.60E-006/p
/entry
entry colname="c3"
p-1.16/p
/entry
entry colname="c4"
p212081_x_at/p
/entry
entry colname="c5"
pBAT2/p
/entry
entry colname="c6"
pHLA-B associated transcript 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p817/p
/entry
entry colname="c2"
p3.60E-006/p
/entry
entry colname="c3"
p-1.21/p
/entry
entry colname="c4"
p1554177_a_at/p
/entry
entry colname="c5"
pATP5S/p
/entry
entry colname="c6"
pATP synthase, H+ transporting, mitochondrial F0 complex, subunit s (factor B)/p
/entry
/row
row rowsep="1"
entry colname="c1"
p818/p
/entry
entry colname="c2"
p7.00E-007/p
/entry
entry colname="c3"
p-1.82/p
/entry
entry colname="c4"
p224783_at/p
/entry
entry colname="c5"
pFAM100B/p
/entry
entry colname="c6"
pfamily with sequence similarity 100, member B/p
/entry
/row
row rowsep="1"
entry colname="c1"
p819/p
/entry
entry colname="c2"
p6.00E-007/p
/entry
entry colname="c3"
p-1.57/p
/entry
entry colname="c4"
p208840_s_at/p
/entry
entry colname="c5"
pG3BP2/p
/entry
entry colname="c6"
pGTPase activating protein (SH3 domain) binding protein 2/p
/entry
/row
row rowsep="1"
entry colname="c1"
p820/p
/entry
entry colname="c2"
p4.00E-007/p
/entry
entry colname="c3"
p-1.59/p
/entry
entry colname="c4"
p206717_at/p
/entry
entry colname="c5"
pMYH8/p
/entry
entry colname="c6"
pmyosin, heavy chain 8, skeletal muscle, perinatal/p
/entry
/row
/tbody
/tgroup
/table
fig id="F3"titlepFigure 3/p/titlecaptionpSupervised microarray analysis. A.) Hierarchical cluster analysis showing the 820 probe sets which were differentially expressed at the 0.001 significance level/p/captiontext
pbSupervised microarray analysis. A.)/b Hierarchical cluster analysis showing the 820 probe sets which were differentially expressed at the 0.001 significance level. The arrays clustering on the left are from control samples, whereas the cluster on the right shows the LT treated samples. Up-regulated genes are shown in red and down-regulated genes are shown in blue. bB.)/b Biocarta pathway analysis showing the pathways most significantly affected by LT, along with the number of genes and p-value within each pathway that were affected. bC.)/b Correlation of genes altered after treatment with anthrax LT using microarray analysis versus RT-PCR. Spearman correlation coefficient = 0.885./p
/textgraphic file="1471-2172-13-33-3"//fig
pUsing the Gene Set Expression Comparison Analysis, as implemented in BRB Array tools, the Biocarta pathways that were associated with the differentially regulated genes were identified. Over 60 differentially regulated pathways were discovered in monocytes in response to LT treatment. As expected, the most significant pathway affected by LT treatment was the MAPK signaling pathway, with the p38 MAPK signaling pathway being most impacted with 103 genes affected (Figure 
figr fid="F3"3/figrB). Additional pathways altered by LT at the p < 0.001 significance level included the IL-18, Toll-Like Receptor, IFN alpha, and G-Protein Family signaling pathways. It is interesting to note that a previous study measuring the transcriptional response of human alveolar macrophages to anthrax spores detected an activation of the TLR pathways
abbrgrp
abbr bid="B22"22/abbr
/abbrgrp, and our results indicated anthrax LT targets 87 genes within the TLR signaling pathway (Figure 
figr fid="F3"3/figrB)./p
pRGS14 is a protein involved in the regulation of G-protein signaling through attenuation of G-protein heterotrimer signaling, thereby inactivating this signaling cascade. The Affymetrix microarrays revealed that RGS14 expression in LT treated monocytes showed a 6 fold increase in expression (Table 
tblr tid="T2"2/tblr). This is a potentially significant finding in that RGS14 inhibits G-proteins important for chemotaxis. Therefore LT could be impairing chemotaxis not only by blocking Hsp27 phosphorylation through disruption of the p38 pathway
abbrgrp
abbr bid="B23"23/abbr
/abbrgrp, but also by causing over-expression of RGS14, thereby inhibiting G-protein mediated signaling required for actin-based motility./p
table id="T2"
title
pTable 2/p
/title
caption
p
bPredicted effects of LT on monocyte function.1/b
/p
/caption
tgroup align="left" cols="3"
colspec align="left" colname="c1" colnum="1" colwidth="1*"/
colspec align="left" colname="c2" colnum="2" colwidth="1*"/
colspec align="left" colname="c3" colnum="3" colwidth="1*"/
thead valign="top"
row rowsep="1"
entry colname="c1"
p
bGene/b
/p
/entry
entry colname="c2"
p
bMicroarray/b
/p
/entry
entry colname="c3"
p
bEffects/b
/p
/entry
/row
/thead
tfoot
p1 Calculated fold changes compared to mock treated samples./p
/tfoot
tbody valign="top"
row rowsep="1"
entry colname="c1"
pRGS-14/p
/entry
entry colname="c2"
p5.61/p
/entry
entry colname="c3"
pBlockade of monocyte maturation to dendritic cells, inhibition of chemotaxis/p
/entry
/row
row rowsep="1"
entry colname="c1"
pCXCR2/p
/entry
entry colname="c2"
p5.04/p
/entry
entry colname="c3"
pIncreased monocyte transendothelial migration into tissues/p
/entry
/row
row rowsep="1"
entry colname="c1"
pHPSE/p
/entry
entry colname="c2"
p-2.58/p
/entry
entry colname="c3"
pDiminished inflammatory response/p
/entry
/row
row rowsep="1"
entry colname="c1"
pCCR5/p
/entry
entry colname="c2"
p-2.33/p
/entry
entry colname="c3"
pReduced responsiveness to the inflammatory mediators RANTES, MIP1 beta/p
/entry
/row
row rowsep="1"
entry colname="c1"
pILIR2/p
/entry
entry colname="c2"
p-12.5/p
/entry
entry colname="c3"
pIncreased IL1 alpha responsiveness and increased fever/p
/entry
/row
/tbody
/tgroup
/table
pRGS14 expression is down-regulated during the maturation of monocytes to dendritic cells
abbrgrp
abbr bid="B24"24/abbr
/abbrgrp and over-expression of this G-protein regulator would be expected to block monocyte maturation. RGS14 levels are also known to decrease in dendritic cells exposed to itLeishmania major/it or itToxoplasma gondii/it, suggesting that RGS14 downregulation may be an important step in a normal immune response, and up-regulation of RGS14 by LT could be contributing to LT’s immunosuppressive effects
abbrgrp
abbr bid="B25"25/abbr
/abbrgrp./p
pThree chemokine receptors were also altered after LT treatment, suggesting that LT may be inducing functional defects in monocyte response signaling. IL-8 receptor beta (CXCR2) was up-regulated after LT treatment (Table 
tblr tid="T2"2/tblr). CXCR2 transduces signaling through a G-protein activated second messenger system. This receptor is important for monocyte transendothelial migration, and up-regulation of CXCR2 could serve to enhance the delivery of monocytes to tissues. Anthrax spores must be phagocytosed by macrophages in order to germinate into viable bacteria. An increase in the macrophage pool may aid in a reservoir for increased germination of viable bacteria. IL-1 receptor type II (IL-1R2), was found to be markedly down-regulated. IL-1R2 is a decoy receptor for IL-1 that functions either at the cell surface or in a soluble form
abbrgrp
abbr bid="B26"26/abbr
/abbrgrp. The decreased expression of the decoy receptor would presumably increase IL-1a levels and increase the febrile response of the host potentially at least in part explaining the high fever that commonly accompanies systemic anthrax
abbrgrp
abbr bid="B27"27/abbr
/abbrgrp. CCR5 is a receptor for the monocyte chemokines RANTES and MIP. The down-regulation of CCR5 by LT could reflect an inability of toxin-treated monocytes to differentiate into macrophages
abbrgrp
abbr bid="B28"28/abbr
/abbrgrp (Table 
tblr tid="T2"2/tblr). During the early stages of infection, macrophages play a critical role in assisting itB. anthracis/it pathogenesis by providing a place for bacteria germination from their spore form to viable bacteria. An increase in monocyte trafficking to allow an increase in spore uptake and subsequent germination would prove beneficial for itB. anthracis/it. During later stages of infection, after release of viable bacteria, limiting monocyte differentiation to macrophages would assist in preventing clearance of viable bacteria./p
pIn addition to an alteration in the chemokine response by LT, an additional enzyme, heparanase (HPSE), was found to be decreased in LT-treated human monocytes. This enzyme is an endoglycosidase that degrades heparin sulfate, resulting in disassembly of extracellular barriers required for cell migration
abbrgrp
abbr bid="B29"29/abbr
/abbrgrp. Heparanase has also been postulated to play a role in inflammation
abbrgrp
abbr bid="B30"30/abbr
/abbrgrp and our results showed a 2.6 fold decrease in heparanase gene expression (Table 
tblr tid="T2"2/tblr). One study has concluded that an itin vivo/it siRNA against heparanase, along with an inhibitor of its enzymatic activity, results in a diminished inflammatory response
abbrgrp
abbr bid="B31"31/abbr
/abbrgrp. Thus LT- mediated inhibition of heparanase expression could also contribute to the inhibition of the host immune response during an anthrax infection./p
pAn external verification method using quantitative real-time PCR was utilized to confirm the microarray data. The eight genes corresponding to RGS14, IL8RB, TLR5, PPM1H, CD47, SYK, CCR5, and IL1R2 were chosen for microarray confirmation in monocytes. CCR5 and IL1R2 were confirmed to be down-regulated at 4 h after LT treatment, reinforcing the microarray data, while the other six genes were up-regulated, again confirming the microarray data (Table 
tblr tid="T3"3/tblr). A correlation curve was plotted (Figure 
figr fid="F3"3/figrC) and analyzed, showing a linear relationship between the microarray results and RT-PCR with a correlation coefficient of 0.885. Results were performed in duplicates and fold values were normalized to GAPDH. To exclude the possibility the lymphocyte contamination might be contributing to our microarray findings, a higher purity monocyte population (98% purity), obtained by adherence followed by washing off non-adherent lymphocytes, was treated with 500 ngmL LT for 4 h and gene expression was assessed using real-time PCR. These experiments verified 3 genes to be increased after LT treatment: RGS14, TLR5, and CD47 (1.21-1.70), as observed by the microarray of suspended cells. These findings suggest that the changes in messenger RNA observed are primarily contributed by monocytes, but we cannot entirely exclude a contribution by lymphocytes./p
table id="T3"
title
pTable 3/p
/title
caption
p
bq-RTPCR confirmation of LT-induced genes.1/b
/p
/caption
tgroup align="left" cols="5"
colspec align="left" colname="c1" colnum="1" colwidth="1*"/
colspec align="left" colname="c2" colnum="2" colwidth="1*"/
colspec align="left" colname="c3" colnum="3" colwidth="1*"/
colspec align="left" colname="c4" colnum="4" colwidth="1*"/
colspec align="left" colname="c5" colnum="5" colwidth="1*"/
thead valign="top"
row rowsep="1"
entry colname="c1"
p
bProbe/b
/p
/entry
entry colname="c2"
p
bMicroarray/b
/p
/entry
entry colname="c3"
p
bq-RT-PCR/b
/p
/entry
entry colname="c4"
p
bGene name/b
/p
/entry
entry colname="c5"
p
bPrimer sequence/b
/p
/entry
/row
/thead
tfoot
p1 Calculated fold changes comparedtomock treated samples./p
/tfoot
tbody valign="top"
row rowsep="1"
entry colname="c1"
p38290_at/p
/entry
entry colname="c2"
p5.61/p
/entry
entry colname="c3"
p7.40/p
/entry
entry colname="c4"
pRGS14-F/p
/entry
entry colname="c5"
pCAGGGATCTGTGAGAAACGAG/p
/entry
/row
row rowsep="1"
entry colname="c1"/
entry colname="c2"/
entry colname="c3"/
entry colname="c4"
pRGS14-R/p
/entry
entry colname="c5"
pAGGTGATCCTGTTTTCCAGC/p
/entry
/row
row rowsep="1"
entry colname="c1"
p207008_at/p
/entry
entry colname="c2"
p5.04/p
/entry
entry colname="c3"
p7.50/p
/entry
entry colname="c4"
pIL8RB-F/p
/entry
entry colname="c5"
pGTCTAACAGCTCTGACTACCAC/p
/entry
/row
row rowsep="1"
entry colname="c1"/
entry colname="c2"/
entry colname="c3"/
entry colname="c4"
pL8RB-R/p
/entry
entry colname="c5"
pTTAAATCCTGACTGGGTCGC/p
/entry
/row
row rowsep="1"
entry colname="c1"
p210166_at/p
/entry
entry colname="c2"
p3.90/p
/entry
entry colname="c3"
p2.24/p
/entry
entry colname="c4"
pTLR5-F/p
/entry
entry colname="c5"
pTTTTCAGGAGCCCGAGC/p
/entry
/row
row rowsep="1"
entry colname="c1"/
entry colname="c2"/
entry colname="c3"/
entry colname="c4"
pTLR5-R/p
/entry
entry colname="c5"
pAGCCGAGATTGTGTCACTG/p
/entry
/row
row rowsep="1"
entry colname="c1"
p212686_at/p
/entry
entry colname="c2"
p2.65/p
/entry
entry colname="c3"
p3.85/p
/entry
entry colname="c4"
pPPM1H-F/p
/entry
entry colname="c5"
pGAGTACAGAGAAAGGAGCTTGG/p
/entry
/row
row rowsep="1"
entry colname="c1"/
entry colname="c2"/
entry colname="c3"/
entry colname="c4"
pPPM1H-R/p
/entry
entry colname="c5"
pTCCAATAGTTGCCATTACCCG/p
/entry
/row
row rowsep="1"
entry colname="c1"
p226016_at/p
/entry
entry colname="c2"
p2.38/p
/entry
entry colname="c3"
p1.60/p
/entry
entry colname="c4"
pCD47-F/p
/entry
entry colname="c5"
pTTTGCTATACTCCTGTTCTGGG/p
/entry
/row
row rowsep="1"
entry colname="c1"/
entry colname="c2"/
entry colname="c3"/
entry colname="c4"
pCD47-R/p
/entry
entry colname="c5"
pTGGGACGAAAAGAATGGCTC/p
/entry
/row
row rowsep="1"
entry colname="c1"
p209269_at/p
/entry
entry colname="c2"
p2.15/p
/entry
entry colname="c3"
p1.60/p
/entry
entry colname="c4"
pSYK-F/p
/entry
entry colname="c5"
pCAAGTTCTCCAGCAAAAGCG/p
/entry
/row
row rowsep="1"
entry colname="c1"/
entry colname="c2"/
entry colname="c3"/
entry colname="c4"
pSYK-R/p
/entry
entry colname="c5"
pCATCCGCTCTCCTTTCTCTAAC/p
/entry
/row
row rowsep="1"
entry colname="c1"
p206991_at/p
/entry
entry colname="c2"
p-2.66/p
/entry
entry colname="c3"
p-2.33/p
/entry
entry colname="c4"
pCCR5-F/p
/entry
entry colname="c5"
pCCAAAAGCACATTGCCAAACG/p
/entry
/row
row rowsep="1"
entry colname="c1"/
entry colname="c2"/
entry colname="c3"/
entry colname="c4"
pCCR5-R/p
/entry
entry colname="c5"
pACTTGAGTCCGTGTCACAAGCC/p
/entry
/row
row rowsep="1"
entry colname="c1"
p205403_at/p
/entry
entry colname="c2"
p-12.5/p
/entry
entry colname="c3"
p-28.0/p
/entry
entry colname="c4"
pIL1R2-F/p
/entry
entry colname="c5"
pTGGCACCTACGTCTGCACTACT/p
/entry
/row
row rowsep="1"
entry colname="c1"/
entry colname="c2"/
entry colname="c3"/
entry colname="c4"
pIL1R2-R/p
/entry
entry colname="c5"
pTTGCGGGTATGAGATGAACG/p
/entry
/row
/tbody
/tgroup
/table
/sec
/sec
sec
st
pConclusions/p
/st
pOur investigations show human peripheral monocytes are susceptible to the actions of anthrax LT and do not undergo LT-mediated cytotoxicity after a four hour toxin treatment. We also find that LT induces changes in several genes involved in previously unidentified pathways including the TLR pathway, IFN alpha pathway, and G-Protein family signaling pathways. The identification of several previously unappreciated gene products including RGS14, IL8 receptor beta, CD47, TNF ligand, IL-16, Syk, CCR5, and IL-1 receptor II adds to our understanding of how LT impacts the immune response. Our pathway analysis reveals that anthrax LT targets multiple normal immune-regulatory pathways that would be expected to protect the host against anthrax infection. The increase in RGS14 levels and decrease in CCR5, along with IL-1R2, would likely impair monocyte functions and help to facilitate bacteria survival. itB. anthracis/it maintains a selective advantage by impairing the host immune responses, thereby allowing for invasion and dissemination of the highly fatal bacilli. Our findings encourage further investigations into how these pathways converge functionally to impair normal monocyte function, along with providing new insights into the regulation of the host defense system and inflammation./p
/sec
sec
st
pMethods/p
/st
sec
st
pMonocyte isolation and toxin treatment/p
/st
pWhole blood was collected by venous puncture from healthy human volunteers into 8 mL vacutainer tubes containing Ficoll (BD Biosciences). The study followed US Department of Health and Human Services guidelines and was approved by the University of Florida Institutional Review Board. Whole blood was incubated with a monocyte negative selection antibody (Stem Cell Technologies) for 20 min., centrifuged 1700 × g for 25 min at RT, no brake over Ficoll, re-suspended in 10 mL RPMI (Mediatech) complete media, centrifuged at 250 × g for 9 min. to remove platelets, and re-suspended to 7-9 × 10sup5/sup cellsmL in RPMI. Monocytes were inverted at 37°C with 500 ngmL LF and 500 ngmL PA for 4 h. Additional qRT-PCR experiments were performed using higher monocyte purities (98%), obtained by first using a negative selection antibody cocktail (Stem Cell Technologies) isolation technique, followed by plastic adherence for 4 h, as described previously
abbrgrp
abbr bid="B32"32/abbr
/abbrgrp./p
/sec
sec
st
pToxin purification/p
/st
pLF and PA were purified as previously described
abbrgrp
abbr bid="B33"33/abbr
/abbrgrp. Briefly, itBacillus anthracis/it culture media was filtered through a 0.22 uM filter, followed by diethylaminoethyl cellulose (DEAE) anion exchange chromatography. The toxins were then subjected to gel filtration and hydrophobic interaction fast protein liquid chromatography (FPLC) and highly purified toxin components were confirmed by Coomassie Blue staining./p
/sec
sec
st
pMonocyte purity and apoptosis analysis/p
/st
pMonocytes were inverted at 37°C with 500 ngmL LF and 500 ngmL PA for 4 h, stained with CD-14 Pac Blue (BD Biosciences), Annexin-V-Fluorescein and propidium iodide (Roche). The cell population was gated first for CD14-Pac-Blue followed by analysis of the relative amount of Annexin (FL1) and PI (FL2) using flow cytometry FACScan (BD), and analyzed by FCS Express (De Novo)./p
/sec
sec
st
pMEK cleavage/p
/st
pPurified monocytes were incubated at 37°C with 500 ngmL lethal toxin for 4 h. Cells were lysed, ran on a 10% SDS-PAGE gel (Pierce), transferred to a PVDF membrane (Bio-rad) and probed for MEK1 (Upstate). Membranes were then stripped and probed for MEK3 (Santa Cruz). β-actin (Sigma) was used to check consistent loading amounts./p
/sec
sec
st
pRNA isolation/p
/st
pPurified monocytes from 4 healthy volunteers were incubated at 37°C with media alone or with 500 ngmL LT for 4 h. Total RNA was collected using RNAeasy mini kit (Qiagen) and RNA quantity and quality was assessed using NanoDrop (Thermo Scientific) technology./p
/sec
sec
st
pMicroarray procedure/p
/st
p100 ng total RNA was labeled using Affymetrix GeneChip® 3' IVT Express Kit for each replicate. Amplified labeled RNA was purified, fragmented, then hybridized for 16 h on Affymetrix GeneChips® (HG U133 plus 2.0) representing approximately 22,000 well-characterized human genes. Arrays were washed using Affymetrix GeneChip® Fluidics Station FS450 and scanned using GeneChip® Scanner 3000 7 G./p
/sec
sec
st
pMicroarray analysis/p
/st
pLow-level analysis was performed using dChipmodeled-based expression matrix (dChip 2007 (DNA-Chip Analyzer), Build date: Jan 4, 2008). Unsupervised analysis probes sets whose hybridization signal intensity exhibited a coefficient of variation of greater than 0.5 were analyzed by unsupervised hierarchical cluster analysis using algorithms implemented in dChip. Supervised analysis significant probe sets between the treatment groups were identified using a paired itt/it-test (by donor) at a significance threshold of p < 0.001. Leave-one-out-cross-validation using 4 prediction models was used to test the ability of probe sets significant at p < 0.001 to distinguish between the treatment groups. Microarray analyses were done using dCHIP and BRB-ArrayTools by Richard Simon (
urlhttp:linus.nci.nih.govBRB-ArrayTools.html/url). The microarray data for this study was deposited in the National Center for Biotechnology Information (NCBI) Gene Expression Omnibus (GEO)
abbrgrp
abbr bid="B30"30/abbr
/abbrgrp with accession numbersGSM848717 through GSM 848724. The microarray data is also available in a series with accession number GSE34407./p
/sec
sec
st
pQuantitative real time-PCR (qRT-PCR)/p
/st
pRNA was collected using RNAeasy mini kit (Qiagen), quantitated using a Nanodrop system (Thermo Scientific), and 233 μg total RNA was used for cDNAsynthesis using SuperScript III First-Strand Synthesis (Invitrogen). cDNA was quantitated using SYBR Green JumpStart TaqReadyMix (Sigma) and 10 mM forward and 10 mM reverse primers were used for each indicated reaction. Primers used were as follows ACTB-F TCACCGAGCGCGGCT,ACTB-R TAATGTCACGCACGATTTCCC,GAPDH-F GGTGAAGGTCGGAGTCAACG, and GAPDH-R AGAGTTAAAAGCAGCCCTGGTG. All other primers are listed in Table 
tblr tid="T2"2/tblr. Reactions were run on the MJR Opticon Continuous Fluorescence detector (Bio-Rad) and analyzed with Opticon Monitor Software 1.08 (Bio-Rad)./p
/sec
/sec
sec
st
pAuthors’ contributions/p
/st
pKC performed the experiments, analyzed data, interpreted study, drafted, and wrote the manuscript. CL performed the gene expression profiling, biostatistical analysis, and helped design the study. SZ participated in the study design and assisted with experiments. GS participated in the design and interpretation of the study, as well as edited the manuscript. HB participated in the design and analyses of the study. CQ supplied the purified toxin and assisted in data interpretation. FS conceived the study and participated in the design and coordination, as well as edited the manuscript. All authors read and approved the final manuscript./p
/sec
/bdy
bm
ack
sec
st
pAcknowledgements/p
/st
pWe thank Dr. Lyle Moldawer for his guidance and assistance in the flow cytometry analysis. The study was supported by the National Institutes of Health RO1AI064891. Publication of this article was funded in part by the University of Florida Open-Access Publishing Fund./p
/sec
/ack
refgrpbibl id="B1"titlepImmune system paralysis by anthrax lethal toxin: the roles of innate and adaptive immunity/p/titleaugausnmFukao/snmfnmT/fnm/au/augsourceLancet Infect Dis/sourcepubdate2004/pubdatevolume4/volumefpage166/fpagelpage170/lpagexrefbibpubidlistpubid idtype="doi"10.1016S1473-3099(04)00940-5/pubidpubid idtype="pmpid" link="fulltext"14998502/pubid/pubidlist/xrefbib/biblbibl id="B2"titlepAnthrax/p/titleaugausnmMock/snmfnmM/fnm/auausnmFouet/snmfnmA/fnm/au/augsourceAnnu Rev Microbiol/sourcepubdate2001/pubdatevolume55/volumefpage647/fpagelpage671/lpagexrefbibpubidlistpubid idtype="doi"10.1146annurev.micro.55.1.647/pubidpubid idtype="pmpid" link="fulltext"11544370/pubid/pubidlist/xrefbib/biblbibl id="B3"titlepAnthrax toxin/p/titleaugausnmCollier/snmfnmRJ/fnm/auausnmYoung/snmfnmJA/fnm/au/augsourceAnnu Rev Cell Dev Biol/sourcepubdate2003/pubdatevolume19/volumefpage45/fpagelpage70/lpagexrefbibpubidlistpubid idtype="doi"10.1146annurev.cellbio.19.111301.140655/pubidpubid idtype="pmpid" link="fulltext"14570563/pubid/pubidlist/xrefbib/biblbibl id="B4"titlepLethal factor of Bacillus anthracis cleaves the N-terminus of MAPKKs: analysis of the intracellular consequences in macrophages/p/titleaugausnmPellizzari/snmfnmR/fnm/auausnmGuidi-Rontani/snmfnmC/fnm/auausnmVitale/snmfnmG/fnm/auausnmMock/snmfnmM/fnm/auausnmMontecucco/snmfnmC/fnm/au/augsourceInt J Med Microbiol/sourcepubdate2000/pubdatevolume290/volumefpage421/fpagelpage427/lpagexrefbibpubidlistpubid idtype="doi"10.1016S1438-4221(00)80056-9/pubidpubid idtype="pmpid"11111921/pubid/pubidlist/xrefbib/biblbibl id="B5"titlepProteolytic inactivation of MAP-kinase-kinase by anthrax lethal factor/p/titleaugausnmDuesbery/snmfnmNS/fnm/auausnmWebb/snmfnmCP/fnm/auausnmLeppla/snmfnmSH/fnm/auausnmGordon/snmfnmVM/fnm/auausnmKlimpel/snmfnmKR/fnm/auausnmCopeland/snmfnmTD/fnm/auausnmAhn/snmfnmNG/fnm/auausnmOskarsson/snmfnmMK/fnm/auausnmFukasawa/snmfnmK/fnm/auausnmPaull/snmfnmKD/fnm/auetal//augsourceScience/sourcepubdate1998/pubdatevolume280/volumefpage734/fpagelpage737/lpagexrefbibpubidlistpubid idtype="doi"10.1126science.280.5364.734/pubidpubid idtype="pmpid" link="fulltext"9563949/pubid/pubidlist/xrefbib/biblbibl id="B6"titlepAnthrax toxin edema factor: a bacterial adenylate cyclase that increases cyclic AMP concentrations of eukaryotic cells/p/titleaugausnmLeppla/snmfnmSH/fnm/au/augsourceProc Natl Acad Sci U S A/sourcepubdate1982/pubdatevolume79/volumefpage3162/fpagelpage3166/lpagexrefbibpubidlistpubid idtype="doi"10.1073pnas.79.10.3162/pubidpubid idtype="pmcid"346374/pubidpubid idtype="pmpid" link="fulltext"6285339/pubid/pubidlist/xrefbib/biblbibl id="B7"titlepOn the role of macrophages in anthrax/p/titleaugausnmHanna/snmfnmPC/fnm/auausnmAcosta/snmfnmD/fnm/auausnmCollier/snmfnmRJ/fnm/au/augsourceProc Natl Acad Sci U S A/sourcepubdate1993/pubdatevolume90/volumefpage10198/fpagelpage10201/lpagexrefbibpubidlistpubid idtype="doi"10.1073pnas.90.21.10198/pubidpubid idtype="pmcid"47741/pubidpubid idtype="pmpid" link="fulltext"8234277/pubid/pubidlist/xrefbib/biblbibl id="B8"titlepRole of macrophage oxidative burst in the action of anthrax lethal toxin/p/titleaugausnmHanna/snmfnmPC/fnm/auausnmKruskal/snmfnmBA/fnm/auausnmEzekowitz/snmfnmRA/fnm/auausnmBloom/snmfnmBR/fnm/auausnmCollier/snmfnmRJ/fnm/au/augsourceMol Med/sourcepubdate1994/pubdatevolume1/volumefpage7/fpagelpage18/lpagexrefbibpubidlistpubid idtype="pmcid"2229935/pubidpubid idtype="pmpid"8790597/pubid/pubidlist/xrefbib/biblbibl id="B9"titlepEffect of Bacillus anthracis lethal toxin on human peripheral blood mononuclear cells/p/titleaugausnmPopov/snmfnmSG/fnm/auausnmVillasmil/snmfnmR/fnm/auausnmBernardi/snmfnmJ/fnm/auausnmGrene/snmfnmE/fnm/auausnmCardwell/snmfnmJ/fnm/auausnmPopova/snmfnmT/fnm/auausnmWu/snmfnmA/fnm/auausnmAlibek/snmfnmD/fnm/auausnmBailey/snmfnmC/fnm/auausnmAlibek/snmfnmK/fnm/au/augsourceFEBS Lett/sourcepubdate2002/pubdatevolume527/volumefpage211/fpagelpage215/lpagexrefbibpubidlistpubid idtype="doi"10.1016S0014-5793(02)03228-3/pubidpubid idtype="pmpid" link="fulltext"12220662/pubid/pubidlist/xrefbib/biblbibl id="B10"titlepDifferentiation of human monocytic cell lines confers susceptibility to Bacillus anthracis lethal toxin/p/titleaugausnmKassam/snmfnmA/fnm/auausnmDer/snmfnmSD/fnm/auausnmMogridge/snmfnmJ/fnm/au/augsourceCell Microbiol/sourcepubdate2005/pubdatevolume7/volumefpage281/fpagelpage292/lpagexrefbibpubid idtype="pmpid" link="fulltext"15659071/pubid/xrefbib/biblbibl id="B11"titlepSepsis and pathophysiology of anthrax in a nonhuman primate model/p/titleaugausnmStearns-Kurosawa/snmfnmDJ/fnm/auausnmLupu/snmfnmF/fnm/auausnmTaylor/snmfnmFB/fnmsufJr/suf/auausnmKinasewitz/snmfnmG/fnm/auausnmKurosawa/snmfnmS/fnm/au/augsourceAm J Pathol/sourcepubdate2006/pubdatevolume169/volumefpage433/fpagelpage444/lpagexrefbibpubidlistpubid idtype="doi"10.2353ajpath.2006.051330/pubidpubid idtype="pmcid"1698797/pubidpubid idtype="pmpid" link="fulltext"16877346/pubid/pubidlist/xrefbib/biblbibl id="B12"titlepPathology and pathogenesis of bioterrorism-related inhalational anthrax/p/titleaugausnmGuarner/snmfnmJ/fnm/auausnmJernigan/snmfnmJA/fnm/auausnmShieh/snmfnmWJ/fnm/auausnmTatti/snmfnmK/fnm/auausnmFlannagan/snmfnmLM/fnm/auausnmStephens/snmfnmDS/fnm/auausnmPopovic/snmfnmT/fnm/auausnmAshford/snmfnmDA/fnm/auausnmPerkins/snmfnmBA/fnm/auausnmZaki/snmfnmSR/fnm/au/augsourceAm J Pathol/sourcepubdate2003/pubdatevolume163/volumefpage701/fpagelpage709/lpagexrefbibpubidlistpubid idtype="doi"10.1016S0002-9440(10)63697-8/pubidpubid idtype="pmcid"1868222/pubidpubid idtype="pmpid" link="fulltext"12875989/pubid/pubidlist/xrefbib/biblbibl id="B13"titlepPathology of inhalational anthrax infection in the african green monkey/p/titleaugausnmTwenhafel/snmfnmNA/fnm/auausnmLeffel/snmfnmE/fnm/auausnmPitt/snmfnmML/fnm/au/augsourceVet Pathol/sourcepubdate2007/pubdatevolume44/volumefpage716/fpagelpage721/lpagexrefbibpubidlistpubid idtype="doi"10.1354vp.44-5-716/pubidpubid idtype="pmpid" link="fulltext"17846250/pubid/pubidlist/xrefbib/biblbibl id="B14"titlepResistance of human alveolar macrophages to Bacillus anthracis lethal toxin/p/titleaugausnmWu/snmfnmW/fnm/auausnmMehta/snmfnmH/fnm/auausnmChakrabarty/snmfnmK/fnm/auausnmBooth/snmfnmJL/fnm/auausnmDuggan/snmfnmES/fnm/auausnmPatel/snmfnmKB/fnm/auausnmBallard/snmfnmJD/fnm/auausnmCoggeshall/snmfnmKM/fnm/auausnmMetcalf/snmfnmJP/fnm/au/augsourceJ Immunol/sourcepubdate2009/pubdatevolume183/volumefpage5799/fpagelpage5806/lpagexrefbibpubidlistpubid idtype="doi"10.4049jimmunol.0803406/pubidpubid idtype="pmcid"2770336/pubidpubid idtype="pmpid" link="fulltext"19812208/pubid/pubidlist/xrefbib/biblbibl id="B15"titlepGeneChip analyses of global transcriptional responses of murine macrophages to the lethal toxin of Bacillus anthracis/p/titleaugausnmComer/snmfnmJE/fnm/auausnmGalindo/snmfnmCL/fnm/auausnmChopra/snmfnmAK/fnm/auausnmPeterson/snmfnmJW/fnm/au/augsourceInfect Immun/sourcepubdate2005/pubdatevolume73/volumefpage1879/fpagelpage1885/lpagexrefbibpubidlistpubid idtype="doi"10.1128IAI.73.3.1879-1885.2005/pubidpubid idtype="pmcid"1064962/pubidpubid idtype="pmpid" link="fulltext"15731093/pubid/pubidlist/xrefbib/biblbibl id="B16"titlepIncrease of plasminogen activator inhibitor levels predicts outcome of leukocytopenic patients with sepsis/p/titleaugausnmMesters/snmfnmRM/fnm/auausnmFlorke/snmfnmN/fnm/auausnmOstermann/snmfnmH/fnm/auausnmKienast/snmfnmJ/fnm/au/augsourceThromb Haemost/sourcepubdate1996/pubdatevolume75/volumefpage902/fpagelpage907/lpagexrefbibpubid idtype="pmpid"8822584/pubid/xrefbib/biblbibl id="B17"titlepTranscriptional and apoptotic responses of THP-1 cells to challenge with toxigenic, and non-toxigenic Bacillus anthracis/p/titleaugausnmBradburne/snmfnmC/fnm/auausnmChung/snmfnmMC/fnm/auausnmZong/snmfnmQ/fnm/auausnmSchlauch/snmfnmK/fnm/auausnmLiu/snmfnmD/fnm/auausnmPopova/snmfnmT/fnm/auausnmPopova/snmfnmA/fnm/auausnmBailey/snmfnmC/fnm/auausnmSoppet/snmfnmD/fnm/auausnmPopov/snmfnmS/fnm/au/augsourceBMC Immunol/sourcepubdate2008/pubdatevolume9/volumefpage67/fpagexrefbibpubidlistpubid idtype="doi"10.11861471-2172-9-67/pubidpubid idtype="pmcid"2613145/pubidpubid idtype="pmpid" link="fulltext"19014542/pubid/pubidlist/xrefbib/biblbibl id="B18"titlepMonocyte-mediated defense against microbial pathogens/p/titleaugausnmSerbina/snmfnmNV/fnm/auausnmJia/snmfnmT/fnm/auausnmHohl/snmfnmTM/fnm/auausnmPamer/snmfnmEG/fnm/au/augsourceAnnu Rev Immunol/sourcepubdate2008/pubdatevolume26/volumefpage421/fpagelpage452/lpagexrefbibpubidlistpubid idtype="doi"10.1146annurev.immunol.26.021607.090326/pubidpubid idtype="pmcid"2921669/pubidpubid idtype="pmpid" link="fulltext"18303997/pubid/pubidlist/xrefbib/biblbibl id="B19"titlepThe many faces of macrophage activation/p/titleaugausnmMosser/snmfnmDM/fnm/au/augsourceJ Leukoc Biol/sourcepubdate2003/pubdatevolume73/volumefpage209/fpagelpage212/lpagexrefbibpubidlistpubid idtype="doi"10.1189jlb.0602325/pubidpubid idtype="pmpid" link="fulltext"12554797/pubid/pubidlist/xrefbib/biblbibl id="B20"titlepRapid lipopolysaccharide-induced differentiation of CD14(+) monocytes into CD83(+) dendritic cells is modulated under serum-free conditions by exogenously added IFN-gamma and endogenously produced IL-10/p/titleaugausnmKoski/snmfnmGK/fnm/auausnmLyakh/snmfnmLA/fnm/auausnmRice/snmfnmNR/fnm/au/augsourceEur J Immunol/sourcepubdate2001/pubdatevolume31/volumefpage3773/fpagelpage3781/lpagexrefbibpubidlistpubid idtype="doi"10.10021521-4141(200112)31:12<3773::AID-IMMU3773>3.0.CO;2-W/pubidpubid idtype="pmpid" link="fulltext"11745398/pubid/pubidlist/xrefbib/biblbibl id="B21"titlepOrigin and turnover of monocytes and macrophages/p/titleaugausnmvan Furth/snmfnmR/fnm/au/augsourceCurr Top Pathol/sourcepubdate1989/pubdatevolume79/volumefpage125/fpagelpage150/lpagexrefbibpubidlistpubid idtype="doi"10.1007978-3-642-73855-5_6/pubidpubid idtype="pmpid"2644082/pubid/pubidlist/xrefbib/biblbibl id="B22"titlepGene expression profiling of human alveolar macrophages infected by B. anthracis spores demonstrates TNF-alpha and NF-kappab are key components of the innate immune response to the pathogen/p/titleaugausnmDozmorov/snmfnmM/fnm/auausnmWu/snmfnmW/fnm/auausnmChakrabarty/snmfnmK/fnm/auausnmBooth/snmfnmJL/fnm/auausnmHurst/snmfnmRE/fnm/auausnmCoggeshall/snmfnmKM/fnm/auausnmMetcalf/snmfnmJP/fnm/au/augsourceBMC Infect Dis/sourcepubdate2009/pubdatevolume9/volumefpage152/fpagexrefbibpubidlistpubid idtype="doi"10.11861471-2334-9-152/pubidpubid idtype="pmcid"2752459/pubidpubid idtype="pmpid" link="fulltext"19744333/pubid/pubidlist/xrefbib/biblbibl id="B23"titlepAnthrax lethal toxin paralyzes actin-based motility by blocking Hsp27 phosphorylation/p/titleaugausnmDuring/snmfnmRL/fnm/auausnmGibson/snmfnmBG/fnm/auausnmLi/snmfnmW/fnm/auausnmBishai/snmfnmEA/fnm/auausnmSidhu/snmfnmGS/fnm/auausnmLandry/snmfnmJ/fnm/auausnmSouthwick/snmfnmFS/fnm/au/augsourceEMBO J/sourcepubdate2007/pubdatevolume26/volumefpage2240/fpagelpage2250/lpagexrefbibpubidlistpubid idtype="doi"10.1038sj.emboj.7601687/pubidpubid idtype="pmcid"1864983/pubidpubid idtype="pmpid" link="fulltext"17446863/pubid/pubidlist/xrefbib/biblbibl id="B24"titlepToll-like receptor signaling alters the expression of regulator of G protein signaling proteins in dendritic cells: implications for G protein- coupled receptor signaling/p/titleaugausnmShi/snmfnmGX/fnm/auausnmHarrison/snmfnmK/fnm/auausnmHan/snmfnmSB/fnm/auausnmMoratz/snmfnmC/fnm/auausnmKehrl/snmfnmJH/fnm/au/augsourceJ Immunol/sourcepubdate2004/pubdatevolume172/volumefpage5175/fpagelpage5184/lpagexrefbibpubid idtype="pmpid" link="fulltext"15100254/pubid/xrefbib/biblbibl id="B25"titlepUnique gene expression profiles of human macrophages and dendritic cells to phylogenetically distinct parasites/p/titleaugausnmChaussabel/snmfnmD/fnm/auausnmSemnani/snmfnmRT/fnm/auausnmMcDowell/snmfnmMA/fnm/auausnmSacks/snmfnmD/fnm/auausnmSher/snmfnmA/fnm/auausnmNutman/snmfnmTB/fnm/au/augsourceBlood/sourcepubdate2003/pubdatevolume102/volumefpage672/fpagelpage681/lpagexrefbibpubidlistpubid idtype="doi"10.1182blood-2002-10-3232/pubidpubid idtype="pmpid" link="fulltext"12663451/pubid/pubidlist/xrefbib/biblbibl id="B26"titlepInterleukin-1 type II receptor: a decoy target for IL-1 that is regulated by IL-4/p/titleaugausnmColotta/snmfnmF/fnm/auausnmRe/snmfnmF/fnm/auausnmMuzio/snmfnmM/fnm/auausnmBertini/snmfnmR/fnm/auausnmPolentarutti/snmfnmN/fnm/auausnmSironi/snmfnmM/fnm/auausnmGiri/snmfnmJG/fnm/auausnmDower/snmfnmSK/fnm/auausnmSims/snmfnmJE/fnm/auausnmMantovani/snmfnmA/fnm/au/augsourceScience/sourcepubdate1993/pubdatevolume261/volumefpage472/fpagelpage475/lpagexrefbibpubidlistpubid idtype="doi"10.1126science.8332913/pubidpubid idtype="pmpid" link="fulltext"8332913/pubid/pubidlist/xrefbib/biblbibl id="B27"titlepInvestigation of bioterrorism-related anthrax, United States, 2001: epidemiologic findings/p/titleaugausnmJernigan/snmfnmDB/fnm/auausnmRaghunathan/snmfnmPL/fnm/auausnmBell/snmfnmBP/fnm/auausnmBrechner/snmfnmR/fnm/auausnmBresnitz/snmfnmEA/fnm/auausnmButler/snmfnmJC/fnm/auausnmCetron/snmfnmM/fnm/auausnmCohen/snmfnmM/fnm/auausnmDoyle/snmfnmT/fnm/auausnmFischer/snmfnmM/fnm/auetal//augsourceEmerg Infect Dis/sourcepubdate2002/pubdatevolume8/volumefpage1019/fpagelpage1028/lpagexrefbibpubidlistpubid idtype="doi"10.3201eid0810.020353/pubidpubid idtype="pmcid"2730292/pubidpubid idtype="pmpid" link="fulltext"12396909/pubid/pubidlist/xrefbib/biblbibl id="B28"titlepExpression of CCR5 increases during monocyte differentiation and directly mediates macrophage susceptibility to infection by human immunodeficiency virus type 1/p/titleaugausnmTuttle/snmfnmDL/fnm/auausnmHarrison/snmfnmJK/fnm/auausnmAnders/snmfnmC/fnm/auausnmSleasman/snmfnmJW/fnm/auausnmGoodenow/snmfnmMM/fnm/au/augsourceJ Virol/sourcepubdate1998/pubdatevolume72/volumefpage4962/fpagelpage4969/lpagexrefbibpubidlistpubid idtype="pmcid"110058/pubidpubid idtype="pmpid" link="fulltext"9573265/pubid/pubidlist/xrefbib/biblbibl id="B29"titlepExpression of heparanase by platelets and circulating cells of the immune system: possible involvement in diapedesis and extravasation/p/titleaugausnmVlodavsky/snmfnmI/fnm/auausnmEldor/snmfnmA/fnm/auausnmHaimovitz-Friedman/snmfnmA/fnm/auausnmMatzner/snmfnmY/fnm/auausnmIshai-Michaeli/snmfnmR/fnm/auausnmLider/snmfnmO/fnm/auausnmNaparstek/snmfnmY/fnm/auausnmCohen/snmfnmIR/fnm/auausnmFuks/snmfnmZ/fnm/au/augsourceInvasion Metastasis/sourcepubdate1992/pubdatevolume12/volumefpage112/fpagelpage127/lpagexrefbibpubid idtype="pmpid"1399400/pubid/xrefbib/biblbibl id="B30"titlepExtracellular matrix moieties, cytokines, and enzymes: dynamic effects on immune cell behavior and inflammation/p/titleaugausnmVaday/snmfnmGG/fnm/auausnmLider/snmfnmO/fnm/au/augsourceJ Leukoc Biol/sourcepubdate2000/pubdatevolume67/volumefpage149/fpagelpage159/lpagexrefbibpubid idtype="pmpid" link="fulltext"10670574/pubid/xrefbib/biblbibl id="B31"titlepRole of endothelial heparanase in delayed-type hypersensitivity/p/titleaugausnmEdovitsky/snmfnmE/fnm/auausnmLerner/snmfnmI/fnm/auausnmZcharia/snmfnmE/fnm/auausnmPeretz/snmfnmT/fnm/auausnmVlodavsky/snmfnmI/fnm/auausnmElkin/snmfnmM/fnm/au/augsourceBlood/sourcepubdate2006/pubdatevolume107/volumefpage3609/fpagelpage3616/lpagexrefbibpubidlistpubid idtype="doi"10.1182blood-2005-08-3301/pubidpubid idtype="pmcid"1444937/pubidpubid idtype="pmpid" link="fulltext"16384929/pubid/pubidlist/xrefbib/biblbibl id="B32"titlepHuman monocyte isolation methods influence cytokine production from in vitro generated dendritic cells/p/titleaugausnmElkord/snmfnmE/fnm/auausnmWilliams/snmfnmPE/fnm/auausnmKynaston/snmfnmH/fnm/auausnmRowbottom/snmfnmAW/fnm/au/augsourceImmunology/sourcepubdate2005/pubdatevolume114/volumefpage204/fpagelpage212/lpagexrefbibpubidlistpubid idtype="doi"10.1111j.1365-2567.2004.02076.x/pubidpubid idtype="pmcid"1782075/pubidpubid idtype="pmpid" link="fulltext"15667565/pubid/pubidlist/xrefbib/biblbibl id="B33"titlepPurification of anthrax-toxin components by high- performance anion-exchange, gel-filtration and hydrophobic-interaction chromatography/p/titleaugausnmQuinn/snmfnmCP/fnm/auausnmShone/snmfnmCC/fnm/auausnmTurnbull/snmfnmPC/fnm/auausnmMelling/snmfnmJ/fnm/au/augsourceBiochem J/sourcepubdate1988/pubdatevolume252/volumefpage753/fpagelpage758/lpagexrefbibpubidlistpubid idtype="pmcid"1149211/pubidpubid idtype="pmpid" link="fulltext"3138975/pubid/pubidlist/xrefbib/bibl/refgrp
/bm
/art