Identification of both structural and functional domains of the Sendai virus nucleocapsid protein required for viral RNA...

MISSING IMAGE

Material Information

Title:
Identification of both structural and functional domains of the Sendai virus nucleocapsid protein required for viral RNA replication
Physical Description:
xiv, 163 leaves : ill. ; 29 cm.
Language:
English
Creator:
Myers, Tina Marie
Publication Date:

Subjects

Subjects / Keywords:
Viral Proteins -- physiology   ( mesh )
Viral Proteins -- ultrastructure   ( mesh )
Viral Proteins -- genetics   ( mesh )
Capsid -- physiology   ( mesh )
Capsid -- ultrastructure   ( mesh )
Capsid -- genetics   ( mesh )
Genre:
bibliography   ( marcgt )
theses   ( marcgt )
non-fiction   ( marcgt )

Notes

Thesis:
Thesis (Ph. D.)--University of Florida, 1996.
Bibliography:
Includes bibliographical references (leaves 150-162).
Statement of Responsibility:
by Tina Marie Myers.
General Note:
Typescript.
General Note:
Vita.

Record Information

Source Institution:
University of Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
oclc - 48771099
ocm48771099
System ID:
AA00012903:00001


This item is only available as the following downloads:


Full Text












IDENTIFICATION OF BOTH STRUCTURAL AND FUNCTIONAL DOMAINS OF
THE SENDAI VIRUS NUCLEOCAPSID PROTEIN REQUIRED FOR VIRAL RNA
REPLICATION
















By

TINA MARIE MYERS



















A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

1996















ACKNOWLEDGMENTS


I would like to thank Dr. Sue Moyer for giving me the

opportunity to work on such an interesting virus and for her

unerring guidance and support during my graduate training. I

would also like to thank the members of my committee, Drs.

Thomas O'Brien, Richard Condit, and James B. Flanegan, for

their participation and helpful advice. I would like to

express my appreciation to the Flanegan group for the many

useful suggestions I received during our combined laboratory

meetings. Also, I want to thank the other faculty members

and graduate students for the suggestions I received during

research presentations.

I would like to acknowledge both Sandra Horikami and

Sherin Smallwood for making me feel welcome and for their

expert advice. I am grateful to all members of the

laboratory, past and present, for making the lab an enjoyable

and exciting place to work. For her valuable technical

assistance in cloning and sequencing the central conserved

region (CCR) NP mutants, I want to thank Cheryl Zack. I

would also like to thank Ami Pieters for continuing the

cloning, sequencing, and initial characterization of the CCR

mutants during her laboratory rotation. I would particularly









like to thank Sherin Smallwood for her superb technical

assistance in the characterization of the CCR NP mutants,

including protein expression, GST-P binding, and in vitro

replication assays.

Special thanks go to my mother, Shirley, for her love,

encouragement, and most importantly, friendship, throughout

my entire life. Likewise, I thank my brother, Scott, for

being a wonderful friend and always willing to lend an ear.

Their unending love and support has made this possible.


iii

















TABLE OF CONTENTS


ACKNOWLEDGMENTS .

LIST OF FIGURES .

LIST OF TABLES .

KEY TO SYMBOLS .

ABSTRACT .

CHAPTERS

1 INTRODUCTION


11

vi

. ix

x
.
. xiii


AND BACKGROUND ...


Viral Taxonomy .. ........
Genomic Structure ......
The Virion and the Viral Lifecycle ..
Deletion Mutants of the Paramyxoviruses
RNA Synthesis .......
The NP Protein .. ........

2 MATERIALS AND METHODS ......

Cells and Viruses ......
Plasmids, Antibodies, and Probes .. ...
Construction of NP Mutants .. .....
Infection and Transfection .. .....
RNA Replication .......
Protein Analysis .. .......

3 TEMPLATE FUNCTION .......

Introduction .. ........
Results .........
Discussion . .


4 IDENTIFICATION OF A PUTATIVE RNA

Introduction .. ....
Results .....
Discussion .. .....


BINDING SITE










CHAPTERS

5 IDENTIFICATION OF THE NP SELF-ASSEMBLY DOMAIN 114

Introduction .. .114
Results . .. 115
Discussion ... 140

6 CONCLUDING REMARKS .... 147

LIST OF REFERENCES ..... .150

BIOGRAPHICAL SKETCH ............... .163













































v















LIST OF FIGURES

Figure Pane

1. A schematic of the NP protein and the amino acid
sequences (aa) from 107 to 130 of the charge-to-alanine
NP mutants . 59

2. Pulse-chase analysis and in vitro replication with the
mutant NP107 . ... 62

3. In vitro DI-H RNA synthesis with the charge-to-alanine
mutant NP proteins ... 64

4. Cobinding of the NP protein with the GST-P protein to
glutathione Sepharose beads ... 68

5. CsC1 step gradient centrifugation of the self-assembled
wt and mutant nucleocapsidlike particles .... 72

6. Template function of the (+)DI-H RNA-NPs assembled in
vivo with wt or mutant NP proteins .. 75

7. Northern analysis of DI-H RNA replication in vivo 77

8. Binding of the viral polymerase to the wt and mutant
self-assembled nucleocapsidlike particles .... 81

9. A summary of the protein-protein interactions and in
vitro DI-H RNA replication data of the wt and mutant NP
proteins . ... 83

10. A schematic of the NP protein and the amino acid
sequences (aa) from 361 to 377 of the alanine-scanning
NP mutants .. .. 90

11. Pulse-chase analysis of the alanine-scanning mutants
described in Fig. 10 92

12. In vitro DI-H RNA replication with the mutant NP362,
NP370, and NP373 proteins ... 95

13. Cobinding of the mutant NP proteins with the GST-P
protein to glutathione Sepharose beads .. 97









Figure Paoe

14. Electron microscopy of the wt NP and NP370 proteins
and CsC1 gradient analysis of the wt NP, NP370, and
NP362 proteins . 101

15. CsC1 step gradient centrifugation of the self-assembled
wt and mutant nucleocapsidlike particles .. .105

16. A summary of the wt and mutant NP protein-protein
interactions and in vitro DI-H RNA replication data 108

17. Amino acid alignment of selected NP sequences 111

18. Amino acid alignment of selected NP sequences and a
schematic representation of the NP protein 117

19. Glycerol gradient analysis of the wt NP protein, the
MBP protein, the MBP.NP1 fusion protein, and a DI-H
nucleocapsid. . ... 120

20. Sedimentation analysis of the MBP fusion proteins
containing region 1 (CCR) of both the MV N protein
(MBP.N1) and the SV NP protein (MBP.NP1) and their
derivatives .. .124

21. Sedimentation analysis of the in vitro synthesized
MBP fusion protein containing region 2 (N-terminus)
of the NP protein (MBP.NP2) and truncations of the
MBP.NP2 fusion protein ... .127

22. Sedimentation analysis of the in vitro synthesized
MBP fusion proteins containing regions 3A, 3B, and 4
of the NP protein (MBP.NP3A, MBP.NP3B, and MBP.NP4,
respectively) . ... 129

23. A summary of the sedimentation data of the MBP fusion
proteins . 131

24. Inhibition of in vitro DI-H RNA replication by the
MBP.NP1 fusion protein 133

25. Amino acid sequence of the CCR (aa 258-357) of the
NP protein and the random-primed site-directed NP
mutants . ... 135

26. Analysis of the wt NP and mutant NP proteins by CsC1
step gradient centrifugation .. 137

27. In vitro DI-H RNA synthesis with the CCR mutant NP
proteins . ... 139


vii









Figure Page

28. A combined summary of the wt and mutant NP
protein-protein interactions and in vitro DI-H RNA
replication data from the CCR NP mutants Fig. 16 142

29. A schematic of the NP protein and the domains required
for NP-NP interaction, template function, and NP-RNA
binding . 145


viii
















LIST OF TABLES

Table Paae

1. Oligonucleotide primers 29

2. Site-directed mutations in the central conserved
region . 37

3. MBP-NP fusion protein primers and plasmids .... .39
















KEY TO SYMBOLS


aa amino acid

ATP adenosine 5'-triphosphate

bp base pair

C- carboxy

'C degrees centigrade

CCR central conserved region

cfu colony forming units

Ci curie

cm centimeter

cpm counts per minute

cs cold sensitive

CTP cytidine 5'-triphosphate

dCTP deoxycytidine 5'-triphosphate

DI defective interfering particle

DNA deoxyribonucleic acid

ds double stranded

GTP guanosine 5'-triphosphate

h hour

I.U. international unit

kb kilobase

kDa kilodalton










ig or mcg

RCi

R1

lim

IM

mCi

mg

ml

mm

mM

min

m.o.i.

mRNA

(-)

ng

nt

OD

32p

pfu

(+)

RNA

rpm

rt

35S

ss

TCA


microgram

microcurie

microliter

micrometer

micromolar

millicurie

milligram

milliliter

millimeter

millimolar

minute

multiplicity of infection

messenger ribonucleic acid

minus sense

nanogram

nucleotide

optical density

phosphorus 32

plaque-forming units

plus sense

ribonucleic acid

revolutions per minute

room temperature

sulfur 35

single stranded

trichloroacetic acid









ts temperature sensitive

TTP thymidine 5'-triphosphate

tRNA transfer ribonucleic acid

U units

UV ultraviolet

UTP uridine 5'-triphosphate

v/v volume per volume

w/v weight per volume

w/w weight per weight















Abstract of Dissertation Presented to the Graduate School of
the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy


IDENTIFICATION OF BOTH STRUCTURAL AND FUNCTIONAL DOMAINS OF
THE SENDAI VIRUS NUCLEOCAPSID PROTEIN REQUIRED FOR VIRAL RNA
REPLICATION

By

Tina Marie Myers

May 1996




Chairperson: Sue A. Moyer
Major Department: Molecular Genetics and Microbiology

The nucleocapsid protein (NP) of Sendai virus

encapsidates the genome RNA during viral replication forming

a helical nucleocapsid (Nuc), which is the template for RNA

synthesis by the viral polymerase. Consequently, the NP

protein has both structural and functional roles and it is an

essential component of the NP-P (P, phosphoprotein), NP-NP,

Nuc-P/L (L, large protein), and NP-RNA complexes required

during viral RNA replication. To identify domains in the NP

protein, six mutants were constructed using charge-to-alanine

mutagenesis in a highly charged region from amino acids (aa)

107 to 129. All the mutants were active in the first round

of RNA replication; however, the product nucleocapsids formed

with three mutants, NP114, NP121, and NP126, did not serve as









templates for amplification. The template defect was not due

to a lack of protein-protein interactions or polymerase

binding to the nucleocapsid.

Further alanine substitutions at conserved hydrophobic

residues in the mutants NP362 and NP364 disrupted the NP-NP

interaction, suggesting these aa are required for NP-NP

complex formation. Another charge-to-alanine mutant, NP370,

was completely inactive in replication in vitro. Since this

mutant formed all the essential protein-protein complexes, we

propose that the mutant NP370 is defective in the NP-RNA

interaction.

Sedimentation analysis of fusions between the maltose-

binding protein (MBP) and portions of the NP protein (MBP.NP)

identified the central conserved region (CCR, aa 258-357)

(MBP.NP1) as containing a NP-NP binding domain. The MBP.NP1

fusion protein, but not the MBP alone, was also shown to

inhibit viral RNA replication. Site-directed mutagenesis of

the CCR in the full-length NP protein showed that the mutants

NP260-1, NP324-1, and NP324-5, like NP362 and NP364, were

defective in the NP-NP interaction. Mutants NP299-5 and

NP313-2, like NP370, formed protein-protein complexes, but

were inactive in replication, suggesting the NP-RNA

interaction was disrupted. These results show that although

the NP-NP and NP-RNA domains may overlap they can be

separated genetically, suggesting the residues required for

each interaction are discrete.


xiv















CHAPTER 1
INTRODUCTION AND BACKGROUND

Viral Taxonomy

Sendai virus is a member of the family Paramyxoviridae.

The Paramyxoviridae, Rhabdoviridae, and Filoviridae families

contain viruses with nonsegmented single-stranded (ss)

negative sense RNA genomes. One of the characteristic

features of these viruses is that the genome is tightly

associated with the nucleocapsid protein, forming a helical

nucleocapsid, which is the template for RNA synthesis (for a

review see Kingsbury, 1991). The ss negative sense (-) RNA

viruses are similar in terms of genomic size, organization,

and content (Pringle, 1991). The family Paramyxoviridae

includes three genera, the Paramyxovirus, Morbillivirus, and

Pneumovirus. The paramyxoviruses and morbilliviruses are

closely related in both genomic content and structure, as

well as viral morphology, as compared to the pneumoviruses

(Pringle, 1991). The genetic content of the vesicular

stomatitis viruses of the Rhabdoviridae family is also quite

similar to the paramyxoviruses (Galinski and Wechsler, 1991).

Members of the Paramyxovirus genus include the human, bovine,

and avian parainfluenza viruses (PIV), Newcastle disease

virus (NDV), mumps virus (MuV), simian virus 5 and 41 (SV5

and SV41), and Sendai virus (SV). The Morbillivirus genus










contains the measles (MV), canine distemper (CDV),

rinderpest, and peste des petits ruminants viruses, while the

respiratory syncytial viruses (RSV; human and bovine) and

pneumonia virus of mice are members of the Pneumovirus genus.

Several of these viruses including the human

parainfluenza viruses, mumps virus, measles virus, and

respiratory syncytial viruses are communicable human

pathogens that often result in acute childhood illnesses.

Even with the availability of vaccines for some of the

diseases, such as measles and mumps, these viruses continue

to be associated with significant morbidity and mortality

worldwide (Black, 1991; Huber et al., 1991; Collins et al.,

1993; Fooks et al., 1993). Subacute sclerosing

panencephalitis (SSPE), which is almost always fatal, has

unequivocally been shown to be due to persistence of a

measles virus infection (Billeter and Cattaneo, 1991; Huber

et al., 1991). In addition, several chronic human diseases,

including multiple sclerosis, autoimmune chronic active

hepatitis, and Paget's disease have been tentatively

associated with the presence of persistent infections

established by these viruses (Billeter and Cattaneo, 1991;

Randall and Russell, 1991). The significance of these

diseases is sufficient to justify continued research on these

viruses, but when combined with the limited understanding of

how these viruses regulate RNA synthesis, it is evident they

deserve our investigation.











Genomic Structure

Sendai virus is a murine pathogen that produces an

illness in mice (pneumonia) similar to that seen with human

parainfluenza I (in humans) and it is used as a model

paramyxovirus (Parker and Richter, 1986). The complete

nucleotide (nt) sequence (15,384 nt) of Sendai virus has been

determined and the genes for the six major proteins have been

mapped in the following order: 3' NP-P/C/V-M-Fo-HN-L 5'

(Galinski and Wechsler, 1991; Moyer and Horikami, 1991). The

P gene is unique in that it also codes for several

nonstructural proteins C, C', Y1, Y2, and X from overlapping

reading frames (Curran et al., 1991a; Lamb and Paterson,

1991), as well as the V and W proteins from polymerase

editing (Vidal et al., 1990b; Horikami and Moyer, 1991; Lamb

and Paterson, 1991). The viral genome contains

extracistronic leader sequences (54 nt) at the 3' and 5'

ends. In VSV these sequences have been shown to contain the

promoter and encapsidation signals (Blumberg et al., 1983;

Kolakofsky et al., 1991; Moyer et al., 1991, Smallwood and

Moyer, 1993).

Sequence analysis of all the known paramyxoviruses has

shown the first 11 nucleotides of the genome (-) and

antigenome (+) 3' ends are highly conserved, suggesting they

may act as similar recognition sequences (Blumberg et al.,

1991). Conserved sequences are also found at each of the

gene junctions and in Sendai virus the consensus sequences

are 3'-gene-UNAUUCUUUUU GA UCCCANUUUC-gene-5' (Galinski and











Wechsler, 1991; Moyer and Horikami, 1991). The first 11

nucleotides following a gene are believed to contain the

putative polyadenylation signal. It is followed by a

nontranscribed intergenic sequence of 3 nt, which is followed

by the start signal for the next.

The Virion and the Viral Lifecvcle

The virion of the paramyxoviruses is composed of the

nucleocapsid, which is surrounded by the viral envelope (for

a review see Kingsbury, 1991). The viral glycoproteins, the

hemagglutinin-neuraminidase (HN) and the fusion (F1 and F2)

proteins are inserted into the host-derived virion envelope

and are the proteins that mediate attachment and fusion of

the virus to the cellular receptor during infection (Pringle,

1991). The matrix protein (M) is associated with the inner

surface of the viral envelope and it is believed to function

as a bridge between the nucleocapsid core and the plasma

membrane during virus budding (Galinski and Wechsler, 1991).

Support for this theory is based on the possible interaction

of the basic matrix protein (+14 to +17 at neutral pH) with

the acidic NP protein (Morgan et al., 1984; Galinski and

Wechsler, 1991).

Approximately, 2600 molecules of the nucleocapsid (NP,

524 aa) protein are tightly associated with the genomic RNA,

resulting in the formation of a nuclease resistant helical

nucleocapsid (RNA-NP) (Heggeness et al., 1980; Galinski and

Wechsler, 1991). The nucleocapsid is roughly 15 nm in

diameter and 1 pm in length (Galinski and Wechsler, 1991).











The viral RNA-dependent RNA polymerase is composed of two

subunits, the phosphoprotein (P, 568 aa) and the large

protein (L, 2228 aa) (Hamaguchi et al., 1983; Gotoh et al.,

1989; Galinski and Wechsler, 1991). Approximately 300

molecules of the P protein and 30 molecules of the L protein

are loosely associated with the nucleocapsid (P/L-Nuc)

(Galinski and Wechsler, 1991). Electron microscopy and

biochemical data suggest that the L protein is associated

with the nucleocapsid through its interaction with the P

protein (Portner and Murti, 1986; Portner et al., 1988;

Morgan, 1991; Horikami and Moyer, 1995). The presence of the

P-L complex on the nucleocapsid could increase the rapidity

with which viral RNA synthesis is initiated following

infection.

Following attachment and fusion of the virus with the

cell membrane the nucleocapsid is released directly into the

cytoplasm, unlike the togaviruses, orthoviruses,

rhabdoviruses, and retroviruses, which enter through

endocytotic vesicles (Galinski and Wechsler, 1991). The

viral polymerase initiates transcription and the viral mRNAs

are translated by the cellular translational machinery.

Transcription and translation are followed by the replication

of the negative sense (-) viral genome producing a positive

strand (+) intermediate (antigenome), which then serves as

the template for (-) strand replication. The genome and

antigenome are each encapsidated by the NP protein, forming

nuclease-resistant nucleocapsids (Kolakofsky et al., 1991).










Both transcription and replication are discussed in more

detail below. The association of the nucleocapsid with the

matrix protein and the association of the matrix protein with

the plasma membrane is not clearly understood, but it is

believed the matrix protein positions the nucleocapsid with

the HN and F containing plasma membrane (Galinski and

Wechsler, 1991). The final step of virion maturation is

accomplished by budding through the plasma membrane.

Both the NP and P proteins are the primary

phosphorylated proteins in the virion (Hsu and Kingsbury,

1982). Since the NP protein will be discussed in depth

below, it will be not be included in this section. The

majority of phosphate residues in the P protein are located

in a N-terminal 18 kDa fragment (Hsu and Kingsbury, 1982).

While the role of phosphorylation of the P protein is not

known, the N-terminal 18 kDa fragment does not appear to be

required for transcription (Kolakofsky et al., 1991).

Recently, Gao and Lenard (1995) reported that for the VSV P

protein, phosphorylation at the S60 and T62 residues was

linked to oligomerization of the VSV P protein as well as

transcriptional activation. The data indicated that

phosphorylation was required for VSV P protein

oligomerization and that the multimeric VSV P protein was the

transcriptionally active form.

The L protein is presumed to contain all the enzymatic

activities of the viral polymerase, including mRNA capping,

methylation, and polyadenylation, analogous to the VSV L











protein in which these enzymatic activities have been

identified (Hammond and Lesnaw, 1987; Hercyk et al., 1988;

Moyer and Horikami, 1991; Hunt and Hutchinson, 1993). The

identification of six conserved regions in the L proteins of

the paramyxoviruses and rhabdoviruses has led to the

suggestion that they represent functional domains (Poch et

al., 1990; Sidhu et al., 1993; Horikami and Moyer, 1995).

Deletion Mutants of the Paramvxoviruses

Defective interfering particles (DI) of the

paramyxoviruses are shorter versions of the genome that

require the presence of nondefective homologous helper virus

to replicate (Kolakofsky, 1976; Re, 1991; Calain et al.,

1992; Engelhorn et al., 1993). Analogous to wt virus, both

the plus and minus sense DI RNAs are encapsidated by the NP

protein provided by the helper virus and share the

ribonuclease-resistant property of the nondefective

nucleocapsid (Kolakofsky, 1976; Re, 1991). DI particles are

produced spontaneously during infection and can be amplified

by repeated high multiplicity passage in animal cells or in

embryonated eggs. The smaller size and conservation of the

viral RNA sequences required for replication lead to their

selective replication over the helper virus (Kolakofsky,

1976; Re, 1991; Calain et al., 1992).

Two types of DI genomes have been identified and both

can be isolated from Sendai virus infections (Kolakofsky,

1976; Hsu et al., 1985; Re, 1991). Internal deletion DI

genomes preserve the genomic 3' and 5' ends, but the coding










sequence is extensively deleted (Hsu et al., 1985; Re, 1991).

The internal deletion DI genomes contain the signals for both

transcription and replication and have been shown to produce

authentic mRNAs (Engelhorn et al., 1993). Another form of a

DI genome is the copy-back, which contains the C-terminal

portion of the L gene including the polyadenylation signal,

the intergenic trinucleotide, and the 54 base leader sequence

of the 5' genomic end (Re, 1991). From 50-210 nt of the 3'

end is complementary to the 5' end; therefore, it is

identical to the 3' end of the antigenome. This sequence

complementarity is responsible for the characteristic

panhandle structures observed when copy-back DI RNAs are

analyzed by electron microscopy (Kolakofsky, 1976; Leppert et

al., 1977). Because the copy-back DI genomes lack the

regulatory transcriptional sequences found at the wt genomic

3' end they do not express functional mRNAs (Engelhorn et

al., 1993). The generation of the DI genomes can be

explained by the polymerase dissociating from template with

the nascent RNA and either reinitiating downstream of the

dissociation point (internal deletions) or reinitiating on

the nascent strand (copy-back) (Re, 1991).

The internal deletion and copy-back DI particles have

been used to study the regulatory cis-acting sequences at the

termini. The copyback DI nucleocapsids have been shown to

inhibit the replication of internal deletion DI particles

(Re, 1991). This is not surprising since the copy-back DI

particles are templates for replication only. Because the










copyback 3' end promoter is identical to the antigenome 3'

end, it may be preferred because it is the promoter for the

production of minus genomicc) strands. The DI particle used

in the experiments described here is the copy-back type (DI-

H). The DI-H genome is 1410 nt in length with 110 nt of

terminal complementarity (Leppert et al., 1977, Calain et

al., 1992).

RNA Synthesis

Transcription initiates at the exact 3' end of the

genome producing a 54 nt leader RNA that is neither capped

nor polyadenylated and six or more (depending on the number

of mRNAs generated from the P gene) monocistronic, capped,

and polyadenylated mRNAs (Kolakofsky et al., 1991; Horikami

and Moyer, 1995). The viral polymerase is thought to

terminate transcription after the leader RNA has been

synthesized, skip three nucleotides, and reinitiate

transcription at the NP gene. A termination signal following

the leader has not been identified, but some sequence

similarity does exist between the end of the leader sequence

and the intergenic sequences at the gene junctions, which may

serve as a termination signal (Galinski and Wechsler, 1991).

Starting with transcription of the NP gene the polymerase

subsequently recognizes the consensus termination and

initiation sequences at each gene junction (Kolakofsky et

al., 1991).

Occasionally, polycistronic transcripts containing the

three base intergenic sequence but lacking polyadenosine have











been detected. Although these readthrough products can

happen at any one of the gene junctions, the leader-NP

junction readthroughs have been well studied (Perrault et

al., 1983, Kolakofsky et al., 1991). Both the Z strain of

Sendai virus and a VSV PolR mutant produce a much higher

proportion of leader-NP transcripts than the H strain of

Sendai virus or wt VSV, respectively, and these mutations

have been mapped to the NP component of the nucleocapsid

template (Curran et al., 1993). The lack of polyadenosine in

the readthrough transcripts suggests that polyadenylation and

termination of transcription are coordinately regulated

(Galinski and Wechsler, 1991).

Transcription of the mRNAs is polar, such that the NP

mRNA is the most abundant message and the L mRNA is the least

abundant (Kolakofsky et al., 1991). The observed attenuation

in transcription is probably due to some release of the viral

polymerase after termination at each gene junction.

Transcription, unlike replication does not require de novo

protein synthesis as demonstrated by the lack of

transcriptional inhibition in the presence cycloheximide

(Carlsen et al., 1985; Collins, 1991). The current model for

the regulation of transcription and replication is based on

the availability of the NP protein (Leppart et al., 1977;

Kolakofsky et al., 1991).

It is thought that the viral polymerase is responsive to

the transcription initiation and termination signals until

there is sufficient NP protein available to encapsidate the










nascent RNA genome. Once the critical concentration of NP is

present, encapsidation of the nascent RNA is initiated and

continues, concurrent with RNA synthesis. It has been

proposed that encapsidation prevents the viral polymerase

from responding to the start and stop signals at each gene

junction (Baker and Moyer, 1988; Kolakofsky et al., 1991).

The first replicative product is the (+) strand complement

(antigenome) of the viral genome and the antigenome serves as

the template for the production of the progeny (-) strand

genomes (Kolakofsky et al., 1991). Both the genome and

antigenome are encapsidated by the NP protein and resistant

to ribonuclease. Once initiated, encapsidation of the

nascent RNA appears to be a highly cooperative process,

because even when a low concentration of the VSV N protein

was incubated with the VSV leader RNA (47 nt) for short

periods, only the full-length encapsidated leader was

detected (Blumberg et al., 1983).

Replication can be thought to occur as follows: First

is initiation of RNA synthesis and encapsidation, which

occurs at the 3' end by the viral polymerase and the NP

protein, respectively; second is elongation and concurrent

encapsidation of the nascent RNA; and the final step is

termination at the precise 5' end (Moyer and Horikami, 1991).

It is not known whether the NP protein recognizes a specific

sequence or structure for initiation of encapsidation, nor is

it clear if the P protein is required for recognition. As

discussed below, the P protein forms an NP-P complex that is











required for in vitro replication, and the data suggest that

the NP-P complex, like the VSV N-NS complex, is the substrate

for encapsidation (Peluso and Moyer, 1988; Horikami et al.,

1992).

One of the least understood aspects of RNA synthesis is

how the viral polymerase copies the genome in the presence of

the NP protein on the template. Minimally, two models can be

proposed. One is that the template "breathes" during RNA

synthesis resulting in the local displacement of the NP

protein (Hudson et al., 1986; Curran et al., 1993). Another

possibility is that the bases are exposed in the nucleocapsid

and only the phosphate backbone of the RNA is protected by

the NP protein.

Initially, viral replication of the ss negative-sense

RNA viruses was measured either in vivo or in vitro utilizing

intracellular templates produced by wt virus infections. At

this time is was not possible to produce infectious virus from

a recombinant clone. Replication was assayed in vivo by

radiolabeling wt SV infected or wt SV plus DI-H coinfected

cells (Carlsen et al., 1985). In vitro replication was

measured by preparing cytoplasmic cell extracts from wt SV

infected or wt SV plus DI-H coinfected cells and incubating

the extracts with radioactive uridine to detect newly

synthesized RNA. These replication assays showed that

coinfection with SV DI-H, as compared to SV infection alone,

produced full-length SV genome RNA (50S) at a higher

frequency and full-length SV DI-H RNA (14S). Purified










detergent disrupted SV DI-H (dd DI-H) was also shown to be

replicated in vitro by incubation with the soluble protein

fraction from SV infected cells (Carlsen et al., 1985).

Subsequently, purified soluble NP protein alone was shown to

support replication of intracellular nucleocapsids (Baker and

Moyer, 1988).

An in vitro replication assay that measures initiation,

elongation, and termination was subsequently designed using a

transient mammalian expression system and SV genes cloned

downstream of the phage T7 promoter (Peluso and Moyer, 1983;

Pattnaik and Wertz, 1990; Curran et al., 1991a; Horikami et

al., 1992). The plasmids containing the SV genes are

expressed in cells by a recombinant vaccinia virus that

expresses the phage T7 polymerase (VVT7) (Fuerst et al.,

1986). Using this cell-free system, it was shown that

cytoplasmic cell extracts containing the Sendai virus NP, P,

and L proteins could replicate purified dd DI-H virus,

polymerase-free DI-H templates (RNA-NP), and intracellular

nucleocapsids in vitro. DI-H RNA replication was dependent

on the coexpression and complex formation of the NP and P

(encapsidation substrate) proteins and the P and L

(polymerase) proteins. Similarly, an analogous NP-P complex

(N-NS) was shown to support VSV RNA replication in vitro

(Peluso and Moyer, 1988; Howard and Wertz, 1989).

The differences in the requirement for the P protein

during replication of intracellular nucleocapsids when the

proteins are expressed from plasmids, versus biochemically











purified NP protein, is likely due to the amount of soluble

NP available in the purified NP preparation (Horikami et al.,

1992). Expression of the plasmid-encoded NP results in the

formation of primarily large oligomeric complexes as shown by

sedimentation assays and little, if any, soluble monomeric

protein is observed (Horikami et al., 1992; Buchholz et al.,

1993). A cosedimentation assay showed that the coexpression

of the P protein with the NP protein inhibited the formation

of the large oligomeric NP complexes and maintained the NP

protein in a soluble form (Horikami et al., 1992; Curran et

al., 1995). Similarly, coexpression of both the MV P or VSV

NS proteins with their homologous N protein resulted in an N-

P or N-NS complex, respectively. These complex formations

also prevented oligomerization of the MV and VSV N proteins

(Howard and Wertz, 1989; Huber et al., 1991; Gombart et al.,

1993; Chandrika et al., 1995). It has also been shown that

in SV infected cells the NP protein enters nucleocapsids

through a soluble protein pool (Kingsbury et al., 1978).

Although the substrate for encapsidation in the SV infected

cell is not currently known these data strongly suggests it

is the NP-P complex.

The in vitro replication assay uses an excess of input

templates and it is believed to measure just one round of

synthesis and encapsidation of the nascent RNA (Curran et

al., 1993). An attractive feature of this expression system

is that other plasmids (containing the gene of interest) can

be added to, or substituted for, the wt NP, P, and L plasmids











to study the effects) on biological function. For example,

the measles virus N protein has been shown to replicate SV

DI-H, but at a reduced level (30%) compared to NP (Chandrika

et al., 1995). This activity was not dependent on the

coexpression of SV P and MV N since MV N does not form a

complex with SV P.

The more recent reports of generating nucleocapsids

using recombinant DNA technology is a significant achievement

for the study of the negative strand viruses. For the first

time, it has been possible to use reverse genetics to study

replication and transcription. The first report was of RNA

transcripts containing a reporter gene flanked by influenza A

termini that were encapsidated in vitro. The newly assembled

nucleocapsid could be transfected into cells and amplified

using proteins provided by wt influenza helper virus (Luytjes

et al., 1989). Since then many reports using minigenomes of

different viruses have followed, some using a reporter gene

and helper virus infection to provide the viral proteins

required for replication (Collins et al., 1991, 1993; Park et

al., 1991; De and Banerjee, 1993; Dimock and Collins, 1993).

Others have utilized RNA expressed from cDNA and plasmid-

encoded viral proteins (Ball, 1992; Calain et al., 1992;

Pattnaik et al., 1992, 1995; Conzelmann and Schnell, 1994; Yu

et al., 1995).

Infectious virus obtained from a cDNA clone containing

the entire viral genome has only been reported for two of the

ss negative sense viruses, VSV and rabies (Lawson et al.,











1995; Schnell et al., 1994). A disadvantage of this system

is that the initial encapsidation event for both minigenomes

and full-length genomes occurs at a very low frequency of -1

in 102 to 1 in 107 transfected cells, respectively (Lawson et

al., 1995; Schnell et al., 1994). Consequently, the

detection of mutant viruses in which encapsidation has been

compromised may require multiple transfections and will of

necessity give a negative rescue.

To assay Sendai virus replication in vivo, a plasmid

containing the cDNA of the (-) DI-H genome is cotransfected

with the plasmids containing the genes for the NP,.P, and L

proteins into mammalian cells. The DI-H cDNA is transcribed

by VVT7 polymerase and the (+) DI-H RNA is encapsidated by

the expressed NP protein (Calain et al., 1992; Calain and

Roux, 1993). The encapsidated DI-H RNA serves as the

template for replication by the expressed NP, P, and L

proteins in vivo. Formation of the correct 3' and 5' ends of

the RNA has been most important to the success of these model

systems (Ball, 1992; Pattnaik et al., 1992; Calain and Roux,

1993).

In the Sendai DI-H clone, precise positioning of the T7

promoter before the first nucleotide of the viral RNA and the

insertion of the hepatitis delta ribozyme downstream of the

coding sequence at the genomic end to cleave the RNA has led

to the generation of T7 transcripts containing the correct 5'

and 3' ends, respectively (Calain et al., 1992; Calain and

Roux, 1993). Detection of the replicative products in cell











extracts is possible only after several rounds of

amplification have occurred, and this can be used as a

measure of the nucleocapsid to function as a template (Curran

et al., 1993). Another important aspect in cloning the

genomic cDNA is whether the (+) or (-), would be utilized.

The formation of RNA-RNA hybrids between the (-) strand and

the mRNAs transcribed from the plasmid-encoded viral proteins

would inhibit encapsidation (Schnell et al., 1994). This

could be the reason that a VSV genomic cDNA clone that

directed the synthesis of a (-) strand T7 transcript did not

yield infectious VSV (Lawson et al., 1995). Yet, cDNA clones

of VSV and rabies that directed the synthesis of a (+) strand

T7 transcript did produce infectious virus (Schnell et al.,

1994; Lawson et al., 1995)

The NP Protein

The data presented above have established the importance

of the Sendai virus NP protein in viral RNA synthesis. One

can surmise that the NP protein is an essential component of

both protein-protein and protein-RNA interactions required

for viral RNA replication, including the NP-NP, NP-P, P/L-Nuc

and NP-RNA interactions (Horikami et al., 1992; Buchholz et

al., 1993; Curran et al., 1993). In addition to the

phenotype of the VSV polR mutant mapping to the N protein in

the nucleocapsid, the fact that unencapsidated RNA is not

recognized by the viral polymerase is evidence that the NP

protein has functional as well as structural roles in RNA

replication (Emerson and Wagner, 1972; Buchholz et al.,











1993). The majority of the information on the structure of

the NP protein has come from biochemical studies, such as

epitope mapping with monoclonal antibodies, trypsin digestion

of nucleocapsids, phoshorylation studies, and mutagenesis of

the NP gene (Heggeness et al., 1980, 1981; Hsu and Kingsbury,

1982; Deshpande and Portner, 1984; Gill et al., 1988; Fisher,

1990; Homann et al., 1991; Buchholz et al., 1993, 1994; Ryan

et al., 1993; Curran et al., 1993).

Examination of paramyxovirus and rhabdovirus

nucleocapsids, including SV, SV5, and VSV by electron

microscopy has revealed that the nucleocapsids could be

tightly coiled (1.0 M NaC1) or loosely coiled (0.01 M sodium

phosphate buffer) depending on the salt concentration

(Heggeness et al., 1980, 1981). Digestion of the tightly

coiled nucleocapsids with trypsin identified a major N-

terminal cleavage product of NP (48 kDa) that remained

associated with the RNA. The 12 kDa cleavage product was not

identified, but it did not remain associated with the

nucleocapsid (Heggeness et al., 1981). Additional cleavage

of the 48 kDa product was observed in loosely coiled

nucleocapsids, generating N-terminal 34 kDa and 15 kDa

products, both associated with the template. A 12 kDa could

be identified and it was shown to be derived from the 15 kDa

product. None of the digested nucleocapsids appeared

morphologically different from the native nucleocapsids when

viewed with the electron microscope. The RNA in the native










and trypsin-digested nucleocapsids, in either conformation,

was shown to be resistant to ribonuclease.

Taken together these data suggested that the domains of

the NP protein responsible for assembling into ribonuclease

resistant helical nucleocapsids, including the NP-NP and NP-

RNA domains, are in the N-terminal 48 kDa fragment. Also

these results indicated that the C-terminal -100 aa are

exposed to the surface and are not required for these

interactions. Sequence analysis of the NP gene has

identified aa 410 as a probable site for the first cleavage

that generates the N-terminal 48 kDa fragment (Shioda et al.,

1983; Morgan et al., 1984; Mountcastle et al., 1970; Buchholz

et al., 1993), and aa 295 or 297 as possible sites for the

cleavage that produces the N-terminal 34 kDa and 15 kDa

fragments. Epitope mapping with monoclonal antibodies has

identified four domains on the NP protein consisting of aa

289-295, aa 295-425, aa 425-455, and aa 455-524, with the

majority of the antibodies tested recognizing epitopes in the

two C-terminal domains (aa 425-524) (Deshpande and Portner,

1984; Gill et al.; 1988, Fisher, 1990). These results also

suggested that the C-terminal -100 aa are on the surface of

the NP protein.

The NP protein expressed alone from a cDNA

self-assembles into nucleocapsidlike particles in the absence

of any additional SV proteins or RNA (Buchholz et al., 1993).

Except for being shorter and heterogeneous in length the

nucleocapsidlike particles were identical in morphology to wt











nucleocapsids. The data also suggested that the

nucleocapsidlike particles contained nonspecific RNA

(Buchholz et al., 1993). Analogous results have been

reported for the MV nucleocapsid protein (N) expressed in

animal cells (Spehner et al., 1991). In contrast, self-

assembled MV N isolated from insect cells did not appear to

contain RNA, based on their density (1.28 gm/cc), yet they

appeared morphologically identical to wt MV nucleocapsids

(Fooks et al., 1993). These results unambiguously identified

NP-NP interactions and we would propose, as one model, that

there are two binding faces, one which binds to the preceding

NP protein and another which binds to the following NP

protein.

A panel of 22 NP deletion mutants which covered the

entire NP protein were assayed for both self-assembly and RNA

replication (Buchholz et al., 1993; Curran et al., 1993).

The data suggested that the first 400 aa were required for

both self-assembly of the NP protein and DI-H replication in

vitro (Buchholz et al., 1993; Curran et al., 1993). All

deletion mutants except those of aa 400-415, 414-439, 426-

497, or 456-524 were inactive in RNA replication (Curran et

al., 1993), whereas the latter mutants all supported self-

assembly and replication.

While the C-terminal 124 aa of the NP protein were not

required for self-assembly or encapsidation of the nascent

RNA, they were required for in vivo replication (Curran et

al., 1993). Mutant NP proteins with deletions of aa 400-415,











414-439, or 456-524 were completely inactive in replication

in vivo and deletion of aa 497-524 reduced the level of

replication to 30% of wt NP protein. These data showed that

the residues between 400-496 were required for the progeny

nucleocapsids, with mutant proteins encapsidating the RNA, to

serve as a template during amplification of the RNA genome

and that removal of just the C-terminal 28 aa severely

inhibited template function (Curran et al., 1993).

Mapping the domain for the NP-P interaction is not as

straightforward since two types of NP-P complexes are formed,

the soluble NP-P complex and the P-nucleocapsid (P-Nuc)

complex. As discussed earlier, the NP protein requires

coexpression of the P protein to provide the NP-P complex for

activity for RNA replication. Of the 22 NP deletion mutants,

only the deletion mutant with aa 456-524 removed was tested

for dependence on the coexpression of the P protein and shown

to be dependent on the coexpression of P for activity in RNA

replication. These data suggest that this deletion mutant

was capable of forming the soluble NP-P complex, which was

used as the substrate for encapsidation. We would propose

the three remaining C-terminal deletion mutants are also

dependent on the coexpression of the P protein for activity

in replication in vitro, suggesting that the N-terminal 400

residues contain the binding site required for the soluble

NP-P complex.

To identify the P-Nuc binding site on the NP protein

Buchholz et al. (1994) expressed the four NP mutants with the











deletions from aa 400 to 524. Nucleocapsidlike particles

were formed by each of these mutants, which were isolated and

tested for P binding. The NP proteins containing deletions

of aa 400-415 or 414-439 bound the P protein, but deletion of

aa 426-496 or 456-524 abolished the P-Nuc interaction. These

data suggest that while the residues between 400-439 are

required for template function they are not required to bind

the P protein. The Nuc binding site for the P protein is

within aa 439-524, but the exact boundaries are not clear,

since replacing aa 426-496 restored 30% of the template

function.

In summary, these data suggested that the domains for

NP-NP, NP-RNA, and the soluble NP-P complexes are within the

N-terminal 400 aa. The P-Nuc domain partially overlaps with

the region of NP required for template function in the C-

terminal 124 aa, suggesting other interactions or functions

may map to this region of the NP protein (Buchholz et al.,

1994). The N-terminal 400 aa are largely hydrophobic in

character with a few clusters of charged residues (aa 60-71,

107-116, 121-129, 391-400) (Shioda et al., 1983; Morgan et

al., 1984; Buchholz et al., 1993; Curran et al., 1993). Two

of the charged clusters have been postulated to be RNA-

binding domains (aa 60-72 and 107-115), although there is no

data to support this assignment. However, the basic nature

of the majority of these charges could lead to an interaction

with the phosphates of the RNA (Morgan et al., 1984).











We propose that individual domains exist in the N-

terminal 400 aa of the NP protein for the NP-P, NP-NP, and

NP-RNA interactions. In order to map these domains two

approaches will be taken. One utilizes a modified charge-to-

alanine site-directed mutagenesis approach to target residues

likely to be on the surface of the protein; therefore,

potential sites for protein-protein or protein-RNA

interactions (Cunningham and Wells, 1989; Bass et al., 1991;

Bennett et al., 1991; Wertman et al., 1992). Two, to

identify the domain of the NP protein required for self-

assembly into nucleocapsidlike particles, regions of the NP

protein will be isolated and fused to a monomeric soluble

protein. Sedimentation analysis of the fusion proteins will

identify protein-protein interactions as rapidly sedimenting

complexes.















CHAPTER 2
MATERIALS AND METHODS

Cells and Viruses

Human lung carcinoma cells (A549 cells, American Type

Culture collection) were maintained in a monolayer at 37'C

with 5% CO2 in Fll medium (GIBCO BRL) supplemented with 1 mM

sodium pyruvate (100 mM, Mediatech), 2 mM L-glutamine (200

mM, Mediatech), 1% non-essential amino acid solution (100X,

Mediatech), 1% penicillin-streptomycin (5000 I.U./ml and 5000

mcg/ml, respectively, penicillin-streptomycin, Mediatech),

and 8% fetal bovine serum (FBS, GIBCO BRL). Vero cells

(American Type Culture collection) were maintained as for

A549 cells except the FBS was reduced to 5%.

Wild type (wt) Sendai virus (SV, Harris strain) was

propagated in the allantoic fluid of 9-day old embryonated

chicken eggs. The eggs were maintained at 37.4'C in an egg

incubator and automatically turned every 30 min. The amount

of Sendai virus that was used to inoculate the eggs was

empirically determined, and the virus was grown at 33'C at

85% humidity for 3 days. The allantoic fluid was collected

after placing the eggs at 4'C for 16 h then at -10'C for 10

min before harvesting and clarified by centrifugation at 2000

rpm for 10 min at 4C. The virus was aliquoted and stored at

-700C. Sendai virus defective interfering particle, DI-H,











(Harris strain) was grown as described above and the amount

of WT SV and DI-H used for co-infection was empirically

determined for each infection.

The viruses were purified by pelleting through 15 ml 25%

(v/v) glycerol in HNE buffer (10 mM HEPES, [N-2-hydroxyethyl-

piperazine-N'-2-ethanesulfonic acid], pH 7.4, 100 mM NaCI, 1

mM ethylenediamine tetraacetate [EDTA]) in an SW28 rotor at

26,000 rpm for 5 h at 4'C. The virus pellet was resuspended

in 900 pi ET buffer (10 mM Tris-hydrochloride [Tris-HCL], pH

7.4, 1 mM EDTA) containing 10% dimethylsulfoxide (DMSO)

(ET/DMSO). The virus was sonicated twice for 20 sec each and

purified by banding on 7-60% (w/w) sucrose gradients in HNE

buffer in an SW41 rotor at 24,000 rpm for 17 h at 4'C. The

virus bands were collected, diluted with ET buffer, and

pelleted in an SW41 rotor at 30,000 rpm for 2 h at 4'C. The

virus pellet was collected in 200 l1 ET/DMSO and stored at -

70'C. The protein concentration of purified virus was

determined by the Bradford method (Bradford, 1976) as

outlined in Current Protocols in Molecular Biology (Ausubel

et al., 1987).

Recombinant vaccinia virus containing the gene for phage

T7 RNA polymerase (VVT7) (Fuerst et al., 1986) was kindly

provided by Dr. Edward Niles (Suny; Buffalo, N.Y.) and grown

in Vero cells. Briefly, a monolayer of Vero cells was grown

in twenty 10 cm dishes (approximately 4 x 107 cells) at 370C

and the cells were infected with VVT7 at an multiplicity of

infection (m.o.i.) of 0.05 pfu/cell. The cells were











harvested at 3-4 days post-infection (p.i.) by scraping the

cells and medium with a rubber policeman. The cells and free

virus were pelleted in a J10 rotor at 7000 rpm for 30 min at

40C. The pellets were resuspended in 20 ml phosphate

buffered saline (1.5 mM potassium phosphate monobasic, 4.3 mM

sodium phosphate, 137 mM NaC1, 2.7 mM KC1, pH 7.2)

supplemented with 1% penicillin-streptomycin (PBS + P/S) and

the cells were disrupted by 2 freeze/thaw cycles followed by

sonication for 60 sec. The virus titer was determined by a

plaque assay on A549 cells and the virus was stored at -70'C.

Plasmids. Antibodies, and Probes

The plasmids pGEMSV-NP, pGEMSV-P, and pGEMSV-L,

containing the SV nucleocapsid (NP), phosphoprotein (P), and

large (L) genes, respectively, were provided by Dr. D.

Kolakofsky (Geneva, Switzerland) (Curran et al., 1991). The

plasmid pGSTSV-P containing the glutathione S-transferase

(GST) gene fused in frame to the SV P gene (Horikami et al.,

submitted) was subcloned into pBSKS+ by S. Smallwood. The

plasmids pBSMV-N and pBSMV-P containing the measles virus

(MV) nucleocapsid (N) and phosphoprotein (P) genes,

respectively, were provided by Dr. W. Bellini (CDC; Atlanta,

GA). The plasmid pBSSV-NP (Chandrika et al., 1995) was

constructed by subcloning the SV NP gene into pBSKS+ by Dr.

R. Chandrika. All of the viral genes were cloned downstream

of the phage T7 promoter.

The SV DI-H cDNA was cloned by C. Zack and S. Horikami

into pSP65 (Promega). A cDNA of SV DI-H was obtained by










reverse transcription of nucleocapsid RNA isolated from A549

cells coinfected with SV and SV DI-H. The cDNA was amplified

using recombinant polymerase chain reaction (PCR) and the

amplification was done in two parts creating two arms (A and

B) as previously described (Calain et al., 1992). The B arm

was cloned into the plasmid vector pSP65 (Promega) using the

XbaI and BamHI sites (pSP65-DIB). The hepatitis delta virus

ribozyme and T7 terminator were provided by A. Ball

(University of Alabama) and subcloned downstream of the B arm

using the SmaI site (pSPDIB/Ribo/Term) (Calain and Roux,

1993). A full length DI-H clone (pSPDI-H) was created by

subcloning the A arm (containing the T7 promoter) upstream of

the B arm in pSPDIB/Ribo/Term using the XbaI site. The

sequence of the DI-H clone was confirmed by restriction

endonuclease mapping and double stranded (ds) dideoxy

sequencing (Sequenase version 2.0 DNA sequencing kit, United

States Biochemical).

Immunoprecipitation and immunoblotting utilized the

following antibodies: a rabbit anti-Sendai virus antibody (a-

SV) (Carlsen et al., 1985), a rabbit anti-SV L (a-L) antibody

which is specific for the SV L protein (Horikami et al.,

1992), and a rabbit anti-maltose-binding protein antibody (a-

MBP) (Horikami et al., 1994).

A [a32p]dCTP (50 LCi, 3000 Ci/mmole, Dupont, NEN Research

Products) labeled random-primed SV DI-H DNA probe was

produced using random hexamers (pd(N)6, Pharmacia) based on

the methodology of Feinberg and Vogelstein (1983).











Construction of NP Mutants

Site-Directed Mutaaenesis using Recombinant PCR

Charge-to-alanine mutagenesis targeted two regions 6f

the NP gene, from amino acid (aa) 107 to 129 and aa 362 to

375, generating 10 mutant NP genes containing 1 to 3 alanine

substitutions each as shown in Figures 1 and 10. Recombinant

polymerase chain reaction (PCR) was used to create the

mutants NP108, NP111, NP114, NP121, NP126, NP362, NP364,

NP370, and NP373 using two overlapping complementary

mutagenic oligonucleotide primers and two standard outside

oligonucleotide primers by the method of Higuchi et al.

(1988). For screening of possible mutant clones, each

mutagenic primer introduced a restriction endonuclease site

that was created by two or more adjacent alanine

substitutions or by the introduction of a separate silent

mutation. The mutagenic oligonucleotides (restriction sites

are underlined) used are shown in Table 1.

The mutants were created using two step PCR

amplification with pGEMSV-NP as template. Except for the

mutant NP370, the template for the first amplification was

circular plasmid DNA and for NP370, the template was

linearized to reduce mispriming. Each standard outside

primer was paired with one of the mutagenic primers and PCR

amplification generated a right and left arm that were gel

purified (see below). The right and left arms were denatured

separately for 3 min at 94'C then mixed while maintaining a

temperature of 50"C or greater, and reannealed for at least












Table 1. Oligonucleotide primers


Mutant Mutacenic primers Enzyme

NP108 SM212(+)-CATAGAGGCGGCGCTAAGAGGACG Narl
SM213(-)-CCTCTTAGCGCCGCCTCTATGTTG
NP111 SM214(+)-GACCCTGCGQGACGAAGACAGAC BsoFI
SM215(-)-TGTCTTCGTCCCGCAGGGTCTTTCTC
NP114 SM216(+)-AGGACGGCGACAGCCGGCTTCATTGTGAAGACG NaeI
SM217(-)-AATGAAGCCGGCTGTCGCCGTCCTCTTAGG
NP121 SM218(+)-GTGGCGACCGCGGTATGGAATATGAGAGG SacII
SM219 (-)-TTCCATAGCCGCGQTCGCCACAATGAATCCGTC
NP126 SM22 0(+)-GATATGGCATATGCGGCGACCACAGAATGG NdeI
SM221(-)-TGTGGTCGCCGCATATGCCATATCTCTGC
NP362 SM291(+)-GGAAATGGCCTTACTTIGCAAGCC Ball
SM294(-)-GGCTTGGfQAAGTAAGGCCATTTCC
NP364 SM290(+)-GTTCTTAQCAGCACAAGCCGTG BsoFI
SM293 (-) -CGGCTTGTGTCTAAGAAC
NP370 SM209(+)-CGTGGCCQCGCTGCTGAATCG SacII
SM208 (-) -CAGCAGCCCGCCACGGCTTG
NP373 SM289(+)-GATGCT GCTAGCGATCACGAGTGCC NheI
SM292 (-) -CGTGATCGCGCTAGCAGCATCC
NPA334-339 SM084(+)-ATTATCCTGCACTATGGGCCGTCGTACAGAACAA none
SM085(-)-TTGTTCTGTACGACGGCCCATAGTGCAGGATAAT
NP146-6 SM146(+)-CTACAACATAGCGAAAGACCC none


Mutant Standard outside orimersb

NP108, NP111, NP114, SM030(+)-TAATACGACTCACTATAG
NP121, and NP126 SM123(-)-GGGAGCTCTGGGGCC

NP370 SM180(+)-GCCATGGCTTACAGTAG
SM089(-)-CCCCTAGCGTCCTGGTCC

NP362, NP364, SM090(+)-GGTTGAGACCCTTGTGAC
NP373, and NPA334-339 SM089(-)-CCCCTAGCGTCCTGGTCC
..................................................................
a,bThe plus and minus symbols in parentheses following the primer
number refers to the messenger sense (+) or genomic sense (-) of
the oligonucleotide and the sequences are written 5'-3'. The
restriction sites used for cloning and/or screening are
underlined.










3 h at 50'C. The reannealed DNA was then PCR amplified using

the two standard outside primers.

All PCR amplifications were done using the GeneAmp PCR

System 9600 (Perkin Elmer) and 26 cycles of denaturation (50

sec, 94'C), annealing (50 sec, 42'C for all mutants except

NP362, NP364, and NP373, which required 45'C to reduce

mispriming), and extension (1 min 20 sec, for DNA products >

1000 base pairs (bp) or 60 sec for DNA products < 1000 bp,

72*C). The reactions (100 il) contained 10 mM Tris-HCl, pH

9.0, 50 mM KC1, 0.1% Triton X-100, 200 gM deoxynucleoside

triphosphates, 1.5 mM MgCl2, 2 gM primer, and 0.5 U of Tag

polymerase (Promega). The final PCR fragment was

precipitated in 0.83 M ammonium acetate and 2 volumes 95%

ethanol. The precipitated DNA was pelleted at 13,000 rpm for

15 min at 4'C and dried in a Speedvac (Savant).

The PCR products were cloned such that the PCR generated

DNA sequences containing the mutations were substituted for

the wild type sequence in pGEMSV-NP as follows. The PCR

products for NP108, NP111, NP114, NP121, and NP126 were

digested with EcoRI and AflII (nucleotides [nts] 1 to 629 of

the NP sequence, strain Fushimi [F strain], accession number

X17218) and the PCR products for NP362, NP364, NP370, and

NP373 were digested with BstXI and EcoRV (nts 833 to 1339).

The pGEMSV-NP plasmid was digested with both sets of enzymes

in separate reactions followed by dephosphorylation with

shrimp alkaline phosphatase (United States Biochemical), per

manufacturer's protocol. The digested DNAs were separated on










a 1% (w/v) agarose gel (Seakem LE agarose) in TBE buffer (89

mM Tris-HC1, 2 mM EDTA, 89 mM boric acid) and the DNA was

stained by adding ethidium bromide (0.1 ig/ml) to the running

buffer. The DNA was visualized using a long wave UV lamp-366

NM (model UVL-56, Ultra-violet products, Inc.) and the DNA

was excised using a #11 scalpel blade. The DNA was purified

using a glassmilk silica matrix (The GENECLEAN II Kit, BIO

101 Inc.), per manufacturer's protocol.

The purified PCR products were subcloned into pGEMSV-NP

at the same restriction sites by lighting the DNA for 12-16 h

at 16'C. High concentration T4 DNA Ligase (2000 U, New

England Biolabs) was used for all the ligation reactions in

50 mM Tris-HCl, pH 7.8, 10 mM MgC12, 10 mM DTT, 1 mM ATP, and

25 gg/ml bovine serum albumin (BSA). The ligated products

were transformed into competent (CaC12) E. coli TG1 cells (K12

A(lac-ProAB) Sup E thi hsdA5/F' traD36 proAB+ lacIq lacZAM15)

(Maniatis et al., 1989) and the transformation mix was plated

on Luria broth (1% bacto-tryptone, 0.5% bacto-yeast extract,

1% NaCl, 1.5% bacto-agar) plates containing ampicillin (100

gg/ml) (LB + amp) at 37'C. The ampicillin-resistant colonies

were screened by direct PCR amplification using the standard

outside primers in a reaction volume of 25 l. A portion of

the colony was spotted onto a LB + amp replica plate before

resuspending in the PCR reaction buffer. The PCR

amplification was as above with an additional 5 min

denaturation at 94'C before beginning the three step

amplification cycle. The PCR products containing the correct











size fragment were precipitated in 0.83 M ammonium acetate

and 2 volumes 95% ethanol.

The precipitated DNA was pelleted, dried, and digested

with the appropriate restriction enzyme for screening. The

digests, except the BsoFI digests, were separated on a 1%

(w/v) agarose gel in TBE buffer. The BsoFI digests were

separated on a 2.5% (w/v) Metaphor agarose gel (FMC

BioProducts) in TBE buffer for resolution of the smaller

fragments. Alkaline lysis plasmid preparations and CsC1

purification (Maniatis et al., 1989) of the colonies that

contained the proper size PCR product and restriction

endonuclease pattern were done. Each clone was confirmed by

the presence of the new restriction endonuclease site and by

ds dideoxy sequencing of the entire fragment that was

subcloned into pGEMSV-NP.

Oliaonucleotide-Directed Mutacenesis using Phaaemid DNA

The mutant NP107 containing a single charge-to-alanine

substitution at aa 107 of SV NP was created using the

Oligonucleotide-directed in vitro mutagenesis system version

2.1 kit (Amersham) per manufacturer's protocol. The protocol

requires single-stranded phagemid DNA that can be isolated

using Bluescript (pBSKS, Stratagene) vectors, but not pGEM

(Promega) vectors. Therefore, the pBSSV-NP plasmid was used

to generate the NP mutant at aa 107 (pNP146-6) and a DNA

fragment containing the mutation was subsequently subcloned

into pGEMSV-NP (NP107).










The methodology for growing the helper phage and

producing single-stranded DNA was adapted from the protocols

outlined by Vieira and Messing (1987). An aliquot of M13K07

helper phage, kindly provided by D. Hassett (University of

Florida), was used to generate a high titer stock of M13K07

(2.2 x 1010 pfu/ml). The helper phage M13K07 was streaked

onto a B plate (1% bacto-tryptone, 0.8% NaC1, 20% glucose, 1%

thiamine, 1.5% bacto-agar) and overlaid with 4 ml soft top B

agar (bacto-agar decreased to 0.6%) containing 0.5 ml of an

E. coli JM101 (A(lac-ProAB)Sup E thi F' traD36 ProAB+ lacIq

lacZAM15) culture (OD00oo >0.8) in LB and incubated at 37"C for

6.5 h. The top agar was poured from the most dilute side of

the streak to the most concentrated side. Single small

plaques were picked and inoculated into 3 ml LB containing

kanamycin (70 gg/ml) and incubated for 16 h at 37'C. The

culture was pelleted at 14,000 rpm for 5 min at 4"C and the

supernatant was collected and repelleted as above. The final

supernatant (M13K07 stock) was stored at 4"C. The M13K07

stock was titered on B plates using 100 jl of serially

diluted M13K07, 200 gl log phase (OD600oo = 0.430, -1 x 108

cfu/ml) JM101 cells, and overlaid with 4 ml of soft top B

agar. The plaques produced at 37'C were counted following a

7.5 h incubation.

Single-stranded DNA was produced as follows: early log

phase cultures (6 ml, ODG6o 0.200) of bacteria containing

pBSSV-NP LB + amp were superinfected with M13K07 at an m.o.i.

of 10 and incubated in a shaker at 200 rpm for 1.25 h at










37'C. The cells were diluted (OD600 < 0.2) with LB + amp

supplemented with kanamycin (70 Ig/ml) and incubated in a

shaker at 300 rpm for 14-18 h at 37'C. The cells were

pelleted at 11,000 rpm for 10 min at 4'C. The phage

particles in the supernatant were precipitated with 0.25

volume of 20% PEG/NaCl (20% (w/v) polyethylene glycol 8000,

2.5 M NaCl) and incubated for 30 min at 4'C. The phage

particles were pelleted at 11,000 rpm for 10 min at 4'C. The

pellet was resuspended in 200 il TE buffer (10 mM Tris-HC1,

pH 8.0, 1 mM EDTA), extracted twice with 200 1l Tris-HC1-

saturated phenol, pH 7.5, and chloroform (3:1), and once with

200 1l chloroform. The single-stranded DNA was precipitated

in 0.3 M sodium acetate and 2 volumes of 95% ethanol.

The precipitated DNA was pelleted in a microfuge at

13,000 rpm for 15 min at 4'C, and the pellet was dried in a

Speedvac. The pellet was resuspended in TE buffer and stored

at -20'C. The yield of ss pBSSV-NP was approximately 60 Jg.

The mutagenic oligonucleotide is shown in Table 1 and the

mutants and a plasmid preparation of the pNP146-6 mutant was

made as described above. The mutation was confirmed by ds

dideoxy sequencing.

For subcloning pNP146-6 to create NP107, a KpnI-AflII

DNA fragment containing nt 1-629 of the mutant pNP146-6 was

substituted for the wild type sequence in pGEMSV-NP at the

same restriction sites. The KpnI-AflII cut pGEMSV-NP was

dephosphorylated with shrimp alkaline phosphatase and the

digested DNAs were gel purified, ligated, and transformed











into E. coli TGI cells, as described above. The mutation in

pNP107 was confirmed by ds dideoxy sequencing.

Insertion and Deletion Mutants

Two NP mutants, NPHIII and NPA334-339, were created by

C. Zack using either linker insertion (SalI linkers) or by

recombinant PCR mutagenesis as follows: each mutant was

created by first subcloning the complete 1.7-kb KpnI-BamHI

gene fragment (nt 1-1639) of SV-NP from pGEMSV-NP into a

KpnI-BamHI cut pGEM3ZF(+) vector that had been modified such

that the SacI, SalI, AccI, HincII, PstI, SphI, and HindIII

sites were deleted in the multiple cloning region

(p*GEM3ZFSV-NP). For pNPHIII, the p*GEM3ZFSV-NP plasmid was

cut with HindIII at nt 947 in the NP gene, blunt ended by

filling in with T4 polymerase, followed by ligation of the

SalI linkers(GGTACC). This insertion created a mutant NP

gene that codes for an additional 4 aa (V, D, Q, and L)

inserted between aa 296 and aa 297.

The deletion mutant pNPA334-339 was created by

recombinant PCR as described previously using p*GEM3ZFSV-NP

as template and the primers SM084 and SM089 to make the right

arm and SM085 and SM090 to make the left arm (see Table 1 for

primer sequences). The two arms were hybridized and

amplified using the outside primers. The PCR product was cut

with SacI and XbaI and gel purified. The purified 0.3-kb

SacI-XbaI cut PCR fragment was cloned into a gel purified,

SAP treated, and SacI-XbaI cut p*GEM3ZFSV-NP. This created a

mutant NP gene that was missing nts 1064 to 1081; therefore,










had deleted the codons for the residues from 334 to 339 (S,

Y, A, M, G, and V).

The mutant DNAs were transformed into E. coli UT481

(met- thy- A(lacPro)r-m- Sup D TN10/F' traD36 proAB+ lacIq

lacZAMl5) cells and plasmid preparations made as outlined

above. The insertion mutation at aa 296 was confirmed by

digestion at the new SalI restriction site in pNPHIII and

both the insertion and deletion mutations were confirmed by

ds dideoxy sequencing of individual clones.

Random-Primed Site-Directed Mutaaenesis

The mutants NP260-1, NP299-5, NP313-2, NP324-1 and

NP324-5 were constructed by C. Zack using PCR-directed

mutagenesis and cloning the PCR fragment into the pCR II

vector (TA Cloning Kit, Invitrogen). The mutation was

randomly introduced at one or two conserved hydrophobic aa

downstream of a unique restriction site in the NP gene and

the primer was designed to include the restriction site as

well as the mutation (see Table 2). The same standard

downstream primer (SM089) was paired with each of the

mutagenic primers for amplification and after cloning the PCR

fragment into pCR II (pCRIINP) the mutations were identified

by ds dideoxy sequencing. The mutant NP fragment in the pCR

II vector was subsequently subcloned by A. Pieters into

p*GEM3ZFSV-NP. This was done by replacing the wt NP sequence

in p*GEM3ZFSV-NP with the corresponding fragment from the

mutant pCRIINP plasmids (Table 2) and the ligated DNAs were

transformed into E.coli UT481 cells. Alkaline lysis







Table 2. Site-directed mutations in the central conserved region


Mutagenic Drimera

SM112(+)-CATCCAGATAGTTGGGAACNACNTCCGAGA
SM110(+)-TAATAAGCTAGAAGCNTCNTAGAGACC
SM109(+)-CCCAAGCCCCTTTNTCTGTTCCTC
SM108(+)-CTCAAGGACCCTGTTCATGGTGAANTTGCT
SM108(+)-CTCAAGGACCCTGTTCATGGTGAANTTGCT


Mutant

NP260-1, NP299-5, NP313-2, NP324-1, and NP324-5


Mutant


Nucleotide changes Amino acid changes


Standard outside Drimerb

SM089(-)-CCCCTAGCGTCCTGGTCC


Gene fragments subclonedc


NP260-1 T842--G Y260D 0.506-kb BstXI-EcoRV (nts 833-1339
NP299-5 C959-4A, A962--G L299I and I300V 0.392-kb HindIII-EcoRV (nts 947-1339)
NP313-2 A1001--T I313F 0.400-kb SacI-EcoRV (nts 994-1339)
NP324-1 T1034->G F324V 0.324-kb PpuMI-EcoRV (nts 1015-1339)
NP324-5 T1034-*A F324I 0.324-kb PpuMI-EcoRV (nts 1015-1339)

a,bThe plus and minus symbols in parentheses following the primer number refers to the
messenger sense (+) or genomic sense (-) of the oligonucleotide and the sequences are
written 5'-3'. The bold nucleotide, N, was randomized during primer synthesis,
incorporating an A, C, G, or T at that position. The restriction sites used for cloning
and/or screening are underlined.
cAll gene fragments were subcloned into the identical sites in p*GEM3ZFSV-NP.


Mutant

NP260-1
NP299-5
NP313-2
NP324-1
NP324-5


Enzyme

BstXI
HindIII
SacI
PpuMI
PpuMI










preparations of each clone were made and the entire fragment

that was subcloned into p*GEM3ZFSV-NP was sequenced as

described above.

Maltose-Binding Protein-Viral Fusion Proteins

The plasmid pMBP containing the MalE gene (maltose

binding protein, (MBP) was created by cloning a PCR fragment

from the pMal-c2 vector into a pGEM3 vector missing the EcoRI

site in the multiple cloning sequence (see Table 3). The PCR

fragment contained the complete MalE gene other than it was

lacking the signal sequence. The pMal-c2 vector was kindly

provided by the R. Condit lab (University of Florida) and the

sequence for the SM236 primer that contains a KpnI

restriction site and the eukaryotic translational start

sequence (AAAATGA) was kindly provided by the M. Swanson lab

(University of Florida) (Anderson et al., 1993).

The fusions were created by cloning, in frame, PCR

products of SV-NP gene fragments downstream of the MBP-coding

region as described in Table 3. The digested DNAs were gel

purified, ligated, and transformed into E. coli TG1 cells as

described above and in Table 3. The ampicillin resistant

colonies were screened by PCR amplification using the above

primers and plasmid preparations of positive clones were made

(Maniatis et al., 1989). The size and orientation of the NP

inserts in the fusion constructs were confirmed by

restriction endonuclease mapping and apparent molecular

weight on SDS-PAGE.









Table 3. MBP-NP fusion protein primers and plasmids


Oliaonucleotide and Sequencea Enzyme

SM236(+) -CCCGGTACCAAAATGAAAATCGAAGAAGGTAA KpnI
RM251(-) -GAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGG none
SM204 (+) -CCAGGAATGGGAACTACATCCG EcoRI
SM222 (-) -ACATGGATCCTCAAAGGTATGTCCTCCCTG BamHI
SM336(+) -CGATGAATTCAAGCTTAGAAGCCTC EcoRI
SM273(+) -GTTCGATCCGCCGGGTTGTTGAGC BamHI
SM089 (-) -CCCCTAGCGTCCTGGTCC none
SM272(+) -GACAGGATCQGATATGGAAATGTTCTTACTAGG BamHI
SM240 (-)-TTGTCGTTAGAACGC none
SM210(-)-AATAGGATCCTCAAAGTAAGATCGGCC BamHI
SM211(+) -ATGTAATTGATACATATATCGTAGAGGCAGG EcoRI


Plasmid Description

pMBP A 1.2-kb KpnI-HindIII cut PCR fragment of pMal-c2
(primers SM236 and RM251) was subcloned into KpnI-
HindIII cut pGEM3ARI.
pMBP.NP1 A 0.3-kb EcoRI-BamHI cut PCR fragment of SV-NP
(primers SM204 and SM222) was cloned into EcoRI-
BamHI cut pMBP.
pMBP.NPl-C A 0.190-kb EcoRI-BamHI cut PCR fragment of SV-
NP (primers SM336 and SM222) was cloned into
EcoRI-BamHI cut pMBP.
pMBP.NP2 A 0.770-kb BstXI, blunt ended, BamHI cut
fragment of SV-NP (primers SM273 and SM089) was
cloned into PstI, blunt ended, BamHI cut pMBP.
pMBP.NP3A A 0.880-kb BamHI-HindIII cut PCR fragment of
SV-NP (primers SM273 and SM089) was cloned into
BamHI-HindIII cut pMBP.
pMBP.NP3B A 1.1-kb BamHI cut PCR fragment of SV-NP (primers
SM273 and SM222) was cloned into a BamHI cut pMBP.
pMBP.NP4 A 0.52-kb BamHI cut PCR fragment of SV-NP (primers
SM272 and SM240) was cloned into a BamHI cut pMBP.
pMBP.NP295N A 0.3-kb EcoRI-BamHI cut PCR fragment of
pSV295MV (primers SM204 and SM210) was cloned into
EcoRI-BamHI cut pMBP.
pMBP.N295NP A 0.3-kb EcoRI-BamHI cut PCR fragment of
pMV295SV (primers SM211 and SM222) was cloned into
EcoRI-BamHI cut pMBP.
pMBP.Nl A 0.3-kb EcoRI-BamHI cut PCR fragment of
pBSMV-N (primers SM211 and SM210) was cloned into
EcoRI-BamHI cut pMBP.
................................................................
aThe plus and minus symbols in parentheses following the primer
number refers to the messenger sense (+) or genomic sense (-) of
the oligonucleotide and the sequences are written 5'- 3'. Stop
codons are indicated by bold lettering. The restriction sites
used for cloning and/or screening are underlined.










Infection and Transfection

Subconfluent A549 cells in 60 mm dishes (approximately

4.8 x 106 cells) were infected with VVT7 at a m.o.i. of 2.5

pfu/cell for 1 h at 370C in 0.5 ml Fll medium (GIBCO BRL)

supplemented with 1% penicillin-streptomycin, 2 mM glutamine,

14 mM HEPES, pH 7.4 (Fll adsorption medium). At 1 h p.i. the

inoculum was removed, the cells washed with unsupplemented

Opti-MEM (GIBCO BRL) and replaced with 2 ml Opti-MEM

supplemented as above. As indicated in the Figure legends,

cells were transfected at 370C with one or more CsCl purified

plasmids containing individual genes cloned downstream of the

phage T7 promoter using 10 il lipofectin (Bethesda Research

Laboratories) per 2.5 ig plasmid DNA in 1 ml Opti-MEM

adsorption medium.

RNA Replication

In Vitro Replication

At 18 h post transfection (p.t.) cytoplasmic cell

extracts were prepared at 40C using lysolecithin (L-a-

lysophosphatidylcholine, palmitoyl; Sigma Chemical Company)

permeabilization (Peluso and Moyer, 1983). The dishes were

placed on ice and the cells washed with 3 ml wash solution

(150 mM sucrose, 30 mM HEPES, pH 7.4, 33 mM NH4C1, 7 mM KC1,

4.5 mM magnesium acetate) and permeabilized with lysolecithin

(250 jg/ml in wash solution, 1 ml) for 1 min with rocking.

Wash solution (3 ml) was added, the liquid aspirated, and the

cells drained for 3-4 minutes. The cells were then scraped

with a rubber policeman into 100 p1 Sendai virus reaction mix










(SV RM) containing 0.1 M HEPES, pH 8.5, 0.05 M NH4C1, 7 mM

KC1, 4.5 mM magnesium acetate, 10% glycerol, 0.5 U/il RNasin,

1 mM each dithiothreitol (DTT), spermidine, ATP, GTP, UTP and

10 pM CTP (Horikami et al., 1992). For unlabeled, that is

cold reactions, the CTP concentration was increased to 1 mM.

The cells were lysed by pipeting 20X and the nuclei pelleted

at 1600 rpm for 5 min at 4C in a microfuge.

The supernatant (cytoplasmic cell extract) was collected

and the volume adjusted to 100 gl with additional SV RM, if

necessary. Dactinomycin (20 ig/ml) was added to the cell

extract after 10% of the cell volume was removed for

immunoblot analysis. The remaining cell extract was mixed

with 2.2 gg purified DI-H disrupted with 0.1% Triton X-100

(dd DI-H) for 10 min at 4'C and 50 gCi [a-32P]CTP (3000

Ci/mmol; Amersham) and then incubated for 2 h at 300C.

Unencapsidated product RNA was digested with micrococcal

nuclease (MN, 10 gg/ml) in the presence of 1 mM CaC12 for 30

minutes at 37C, and the MN was inactivated by the addition

of 7.5 mM ethylene glycol-bis(B-aminoethyl ether)-N,N-

tetraacetic acid, pH 8.0, (EGTA).

The nuclease resistant replication products were

purified by banding on 5 ml cesium chloride (CsCl) gradients

prepared by layering from the bottom 2 ml 40% (w/w) CsC1 in

TNE (25 mM Tris-HCl, pH 7.5, 50 mM NaC1, 2 mM EDTA), 2 ml 20%

(w/w) CsC1 in TNE, and 0.9 ml 30% (v/v) glycerol in 10 mM

HEPES, pH 8.5, in an SW55 rotor at 36,000 rpm for 16 h at

4C. It has been shown previously that the SV nucleocapsids










band at the 20-40% interface, i.e., at a density of 1.29

gm/cc to 1.33 gm/cc (Carlsen et al., 1985; Chandrika et al.,

1995; Buchholz et al., 1993; Kolakofsky, 1976). This

nucleocapsid containing region of the individual gradients

was collected, diluted in ET buffer, and pelleted in an SW55

rotor at 50,000 rpm for 2 h at 40C (Horikami et al., 1992).

The pellet was collected in 300 1 1X NENSH (100 mM NaC1, 50

mM magnesium acetate, pH 5.2, 10 mM EDTA, 0.5% sodium dodecyl

sulfate [SDS]), containing 250 gg/ml proteinase K (Merck),

250 U/ml heparin, 16 gg/ml tRNA and incubated for 1 h at

370C. The sample was extracted twice with 10 mM HEPES-

saturated phenol, pH 7.4, and chloroform (1:1), followed by

precipitation of the RNA in 0.3 M NaCl and 2.5 volumes 95%

ethanol.

The RNA was pelleted in a microfuge at 13,000 rpm for 15

min at 4C and the pelleted RNA was dried in a Speedvac. The

RNA was resuspended in 45 Ll sample buffer (2.5 mM citrate

buffer, pH 3.5, 6 M urea, 20% sucrose, 5 mM EDTA, 0.012%

bromphenol blue), denatured by boiling for 2 min and

quenching on ice. The RNA was analyzed by electrophoresis on

a horizontal (22 cm/180 ml) 1.5% agarose-6 M urea gel (Wertz

and Davis, 1979). Electrophoresis was set at 150 volts (V)

until the RNA samples had entered the gel and then the

voltage was decreased to 90-100 V overnight at 40C (1760 V-

h). The gel was processed for fluorography by washing 5

times in 400 ml 7% acetic acid at 20 min intervals,

dehydrating 2 times in 400 ml 95% ethanol at 30 min










intervals, impregnating with 400 ml 5% PPO (2,5

diphenyloxazole; Sigma Chemical Co.) in acetone for 45 min,

and hydrating the gel in water for at least 1 h (Baker and

Moyer, 1988). The gel was dried for 1.5 h at 600C followed

by 1.5 h at 720C and exposed to Kodak X-Omat film. A

phosphorimager (Molecular Dynamics) was used to quantitate

the replication products.

In Vivo Replication

In vivo replication was measured by cotransfecting

pSPDI-H with the plasmids containing genes for the NP, P, and

L proteins (see Figure legends). Transcription of the DI-H

clone by T7 polymerase generated a full-length plus-sense

DI-H RNA and the (+) DI-H RNA was encapsidated by the

expressed NP protein. The (+)DI-H RNA-NP was then replicated

by the expressed NP, P, and L proteins (Curran et al., 1993).

DI-H RNA replication with the in vivo assembled templates was

measured either by making cell extracts and assaying

replication by in vitro DI-H RNA synthesis or by northern

analysis of the RNA extracted from the cell.

For in vitro DI-H RNA synthesis, infection and

transfection were at 37'C and cell extract preparation was as

described for in vitro replication. RNA synthesis was

detected by adding 50 pCi [a-32P]CTP and incubating for 2 h at

30'C. The nuclease resistant replication products were

banded on CsCl, the RNA was purified, analyzed by gel

electrophoresis, and the product DI-H RNA quantitated as

described for in vitro replication.










For northern analysis, the infection and transfection

was as described above except 100 mm dishes (approximately

1.8 x 107 cells) were used and the volumes adjusted as

follows: VVT7 infection was in 2.5 ml Fl1 adsorption medium,

transfection was in 4 ml Opti-MEM adsorption medium, and the

lipofectin/DNA mix remained in 1 ml Opti-MEM. Following

transfection, the cells were incubated at 320C or 370C for 36

h or 22 h, respectively. Cell extracts were prepared as

described above except the lysolecithin and the wash solution

were increased to 2 ml and 5 ml, respectively, and the cells

were scraped into 200 jl HNDG (0.1 M HEPES, pH 8.5, 0.05 M

NH4C1, 1 mM DTT, 10% glycerol). The replication products were

digested with MN, banded on CsC1 gradients, proteinase K

treated, phenol-chloroform extracted and ethanol precipitated

as described for in vitro replication.

The precipitated product RNAs were pelleted in a

microfuge at 13,000 rpm for 15 min at 4'C and dried in a

Speedvac. The dried pellets were resuspended separately in

15 il sample buffer, denatured and separated on a horizontal

(10 cm/40 ml) 1.5% agarose-6 M urea gel for 200 V-h at room

temperature. The gel was washed 5 times at 20 min intervals

in 2X SSC (0.3 M NaC1, 30 mM sodium citrate) and the RNA was

transferred by capillary action for 24 h at room temperature

onto Hybond-N nitrocellulose paper (Amersham). The RNA was

UV crosslinked (Stratalinker UV Crosslinker 1800, Stratagene)

to the nitrocellulose and the nitrocellulose was kept moist










during the crosslinking by placing it on filter paper

premoistened with 5X SSC.

The blot was incubated for 4.5 h at 42'C in 5 ml of

boiled and quenched prehybridization buffer (50% formamide,

4X Denhardts, 0.05% SDS, 2.5X SSPE [0.9 M NaCl, 2.5 N NaOH, 5

mM EDTA, 50 mM sodium phosphate, pH 7.4], 200 gg/ml salmon

sperm DNA) in a plastic bag. Denatured [a-32P]dCTP (3000

ICi/mmole, Dupont, NEN Research Products) labeled DI-H probe

(3-6 x 106 cpm) was added to the prehybridization solution and

incubated for 16 h at 42'C. The blot was washed 3 times in

1X SSC/0.5% SDS for 5 min at room temperature, followed by 2

washes in 0.1X SSC/0.1% SDS for 15 min at 50'C. The blot was

exposed to Kodak X-Omat film and the product RNA quantitated

on the phosphorimager.

Protein Analysis

Protein Synthesis In Vivo

For steady state labeling, A549 cells (4.8 x 106) were

infected with VVT7 and transfected with the plasmids as

indicated in the Figure legends. At 5.5 h p.t. the medium

was removed and the proteins labeled for various times, as

indicated in the Figure legends, with 66 .Ci/ml Tran35S-label

(ICN Pharmaceuticals, Inc.) in Dulbecco's minimal essential

medium without L-glutamine, methionine, and cysteine (DMEM,

Mediatech), containing one-tenth the normal methionine and

cysteine (10% (v/v) Fll, 1% penicillin-streptomycin, 2 mM L-

glutamine, and 14 mM HEPES, pH 7.4). Cell extracts were

prepared in 300 il SV RM salts (0.1 M HEPES, pH 8.5, 0.05 M











NH4C1 7 M KC1, 4.5 mM magnesium acetate) containing 0.25% NP40

and 1 pg/ml aprotinin and incubated for 20 min with rocking

at 4'C. The cells were scraped using a rubber policeman,

vortexed, and pelleted at 13,000 rpm for 30 min at 4C. The

supernatant was collected and analyzed by sedimentation on

glycerol or CsCl gradients, by bead binding, and by

immunoprecipitation.

For pulse-chase analysis of proteins, the infected and

transfected cells were pulse-labeled for 30 min with Tran35S-

label (66 pCi/ml) at 5.5 h p.t. in methionine- and cysteine-

free DMEM (1% penicillin-streptomycin, 2 mM L-glutamine, and

14 mM HEPES, pH 7.4). The medium was removed and cell

extracts prepared immediately or at various times (see Figure

legends) p.t. after a chase with medium containing 10-fold

excess methionine and cysteine (0.5% 2X Fll, 0.2% 50X MEM

amino acids solution without L-glutamine [Mediatech], 48 mM

NaOH, 1% penicillin-streptomycin, 2 mM glutamine, 14 mM

HEPES, pH 7.4). The cell extracts were stored at -70'C or

the proteins were analyzed by immunoprecipitation and SDS-

PAGE.

The cells were Tran35S-labeled for all assays except

electron microscopy and immunoblot analysis of discontinuous

CsC1 gradients of wt and mutant NP proteins. In these cases

the cells were infected and transfected as above and

incubated for 18 h or 20 h at 37'C in the Opti-MEM adsorption

medium.










Protein Synthesis In Vitro

The plasmids containing the genes coding for the MBP-

viral fusion proteins were linearized downstream of the

protein-coding region as follows: pMBP, pMBP.Nl, pMBP.NP2

pMBP.NP3A, and pMBP.NP4 were cut with HindIII; pMBP.NPl was

cut with BamHI and pMBP.NP3B was cut with XbaI. The fusions

truncated within the NP or N protein coding regions were

digested as follows: pMBP.NPl-H was cut with HindIII,

pMBP.NPl-B was cut with BsgI; pMBP.NP2-A was cut with AflII,

pMBP.NP2-B was cut with BbsI, pMBP.NP2-P and pMBP.Nl-P were

cut with PflMI. The linearized DNAs were transcribed in

vitro with purified recombinant T7 polymerase. The T7

transcripts were translated in a rabbit reticulocyte lysate

(Promega) in the presence of 35S-Methionine (NEN Dupont)

according to the manufacturer's protocol. The following

circular plasmids, pMBP, pMBP.NPl-C, pMBP.NP4, pMBP.NP1A334-

339, and pMBP.NPl-HIII, were transcribed and translated in

vitro using the TNT T7 Coupled Reticulocyte Lysate System

(Promega) in the presence of 35S-Methionine (NEN Dupont)

according to the manufacturer's protocol.

Glycerol Gradient Analysis

One half of the Tran35S-labeled cell extracts and a [a-

32p]CTP labeled DI-H nucleocapsid product (RNA-NP) from an in

vitro replication reaction were analyzed by sedimentation on

separate 5-30% (v/v) glycerol gradients (12 ml, in SV RM

salts) in an SW41 rotor at 36,000 rpm for 105 min at 4C.

Fractions (0.5 ml) were collected from the top and stored at










-70C. The trichloroacetic acid-precipitable activity of the

gradient fractions containing [a-32P]CTP labeled DI-H product

was determined. The Tran35S-labeled proteins from each

fraction (0.25 ml of each) were immunoprecipitated with an a-

SV antibody as described below, separated by 9% SDS-PAGE

(Laemmli, 1970), and quantitated on the phosphorimager. All

of the protein gels were processed for fluorography by

dehydrating in two washes of DMSO (200 ml) for 20 min at rt,

impregnated with 20% PPO in DMSO for 45 min at rt, and

hydrated in water for one hour at room temperature (rt).

Cesium Chloride Gradient Analysis

For CsC1 gradient analysis of the proteins SV-NP, NP362,

and NP370, A549 cells (4.8 x 106) were infected with VVT7 and

transfected in duplicate. The duplicate Tran35S-labeled cell

extracts of each protein were combined and analyzed by

sedimentation on separate linear 20%-40% (w/v) CsC1 gradients

(12 ml) in an SW41 rotor at 36,000 rpm for 16 h at 40C.

Fractions (0.5 ml) were collected from the top and stored at

-700C. The density of each fraction was determined with a

refractometer and the proteins in each fraction (0.2 ml of

each) were immunoprecipitated with an a-SV antibody as

described below. The proteins were analyzed by 9% SDS-PAGE

and the protein bands were quantitated on the phosphorimager.

For analysis of the amount of self-assembled wt and

mutant NP proteins, all of the Tran35S-labeled or unlabeled

cell extracts were analyzed by sedimentation on separate CsCl

step gradients (layered from the bottom; 1.4 ml 40% CsC1, 1.4










ml 30% CsC1, 1.4 ml 20% CsC1, 0.6 ml 30% glycerol in 10 mM

HEPES, pH 8.5) in an SW55 rotor at 36,000 rpm for 16 h at 4C

(Buchholz et al., 1993). Fractions (0.714 ml) were collected

from the top and stored at -700C. The unlabeled or

radiolabeled proteins in each fraction were analyzed by

immunoblotting with an a-SV antibody (25 p1 of each fraction)

or by immunoprecipitation (0.2 ml of each fraction),

respectively, and the density of individual fractions was

determined with a refractometer. The immunoprecipitated

proteins were separated by 9% SDS-PAGE and quantitated on the

phosphorimager.

Glutathione-Sepharose Bead Binding

A549 cells (4.8 x 106) were infected as above and wt or

mutant NP plasmids were transfected singly or together with

pGSTSV-P. Cell extracts were prepared as described above in

SV salts containing 0.25% NP 40 and one-fourth (75 p1) of the

cell extract was used for bead binding and an identical

aliquot (75 1l) was used for immunoprecipitation as described

below. Glutathione-Sepharose 4B beads (15 1l per reaction,

Pharmacia Biotech) were prepared by washing in SV RM salts

two times followed by blocking for 15 min at 40C in 1 ml of

SV RM salts containing 0.1% NP40, 0.5% nonfat dry milk

(NFDM), and 10 mg/ml BSA. The blocked beads were washed two

times in SV RM salts and the final volume of the beads was

adjusted with SV RM salts to 50 pl beads per reaction.

The Tran35S-labeled cell extracts (75 1l) were incubated

with the blocked beads (50 il) for 15 min at 40C. The beads










were washed three times with SV RM salts containing 0.25%

NP40 and lg/ml aprotinin. All centrifugation was done in a

mini-centrifuge (Costar). The beads were resuspended in 45

il 2X lysis buffer (4% SDS, 55 mM Tris-HCl, pH 6.8, 185 mM

DTT, 37% (v/v) glycerol, 0.01% bromphenol blue) and denatured

by boiling for 2 min. The beads were pelleted for 3 min at

rt and the supernatant was analyzed by 9% SDS-PAGE.

ImmunooreciDitation

Cell extracts or glycerol gradient fractions were

brought up to a final volume of 300 il with SV RM salts

containing 0.25% NP40 and 1 Vg/ml aprotinin and preadsorbed

with 100 gl Staphylococcus aureus (Cowan strain) (Carlsen et

al., 1985) for 30 min at 40C. The bacteria were pelleted at

13,000 rpm for 3 min at rt and the supernatant transferred to

a new microfuge tube. The supernatant (antigen) was

incubated with the appropriate antibody (see Figure legends)

for 1.25 h at 40C. The antigen-antibody complexes were

collected with 100 gl Staphylococcus aureus (Cowan strain)

for 30 min at 40C. The precipitate was pelleted at 13,000

rpm for 1 min and 20 sec and the supernatant was removed

using a fine-tipped pasteur pipet. The pellet was washed by

resuspending in 800 il of SV RM salts supplemented as above,

pelleted 1 min and 20 sec, and the wash repeated. The pellet

was resuspended in 45 1l of 1X lysis buffer, boiled for 2

min, and repelleted at 13,000 rpm for 3 min at rt. The

supernatant was analyzed by 9% SDS-PAGE and the proteins

quantitated on the phosphorimager.










For the CsCl gradient fractions, the following changes

were made to the above protocol. The individual fractions

were brought up to a final volume of 1 ml in 1% NP40 lysis

buffer (150 mM NaC1, 50 mM Tris-HCl, pH 8.0, 1% NP40, 1 gg/ml

aprotinin) (Huber et al., 1991). The preadsorption

incubation was increased to 45 min, the antibody incubation

was increased to 2.5 h, and the washes were with 1% NP40

lysis buffer (800 gl).

Sedimentation through 30% Glycerol

To determine the total protein, 1 ll (4%) of the in

vitro transcription and translation reaction (25 gl total

volume) was removed, diluted in 30 il 2X lysis buffer, and

stored at 4'C. To analyze protein-protein complex formation,

8 Il (32%) of the in vitro transcription and translation

reaction was diluted in 132 il of SV RM salts containing

0.25% NP40, and analyzed by pelleting separately through 30%

(v/v) glycerol (5 ml) in an SW55 rotor at 50,000 rpm for 90

min at 4'C. The pellets were collected in 50 il 2X lysis

buffer and analyzed with the total protein samples by 9% SDS-

PAGE and the proteins quantitated on the phosphorimager.

Immunoblot Analysis

For immunoblots of CsC1 gradient fractions, equal

volumes of 2X lysis buffer and the CsCl gradient fractions

(25 Il) were mixed and denatured by boiling for 2 min. The

proteins were separated on 10% mini-protean polyacrylamide-

SDS gels and then transferred to nitrocellulose (nc)

(Schleicher & Schuell) at 45 V for 16 h at 4'C using the










Mini-PROTEAN electrophoresis system (BioRad). The gel and nc

were prepared for transfer by equilibration in two washes of

transfer buffer (25 mM Tris base, 192 mM glycine, 20% (v/v)

methanol) for 10 min at rt. Following transfer, the nc was

incubated in blocking buffer (10% Newborn Calf Serum

[GibcoBRL], 5% BSA in TBS plus Tween 20 [0.02 M Tris base,

0.5 M NaCl, 0.05% (v/v) Tween 20]) for 1 h at 45'C.

The proteins were identified with an a-SV antibody

(1:250 dilution) for 1 h at rt followed by an alkaline

phosphatase-conjugated goat anti-rabbit antibody (1:3000

dilution in TBS, FisherBiotech, 0.2 mg/ml) for 1 h at rt.

The nc was washed two times in TBS plus Tween 20 for 15 min

at rt before and after each antibody incubation. The nc was

incubated with the substrate solution NBT/BCIP (220 1l,

nitroblue tetrazolium, 50 mg/ml in 70% dimethyl formamide,

Promega/ll0 ~l, 5-Bromo-4-Chloro-3-Indolyl Phosphate p-

Toluidine Salt, 50 mg/ml in 100% dimethyl formamide, Fisher)

in alkaline phosphatase buffer (20 ml, 100 mM Tris, pH 9.0,

100 mM NaC1, 5 mM MgCl2), until color development was seen

(approximately 1-2 min) and the reaction was stopped with

water.

For the immunoblots on the in vitro and in vivo

replication extracts, the above protocol was followed except

in Figure 24. The MBP-NP fusion proteins were detected with

an a-MBP antibody (1:250 dilution) following the a-SV

antibody incubation. The washes were repeated between the











two primary antibody incubations and before adding the

alkaline phosphatase-conjugated secondary antibody.

For the immunoblots on the extracts used in the northern

analysis (Fig. 7B) the electrophoresis and transfer were as

outlined above, but the antigen was detected using enhanced

chemiluminescence (ECL, Amersham Life Science) per

manufacturers protocol. Briefly, the nc was blocked in 5%

(w/v) NFDM in PBS for 2 h at rt and incubated with an a-SV

antibody (1:250) for 1 h at rt. The nc was washed twice for

5 min each and once for 15 min in PBS, and then incubated

with horse radish peroxidase (HRPO)-conjugated goat anti-

rabbit antibody (1:5000 dilution in PBS containing 0.5% NFDM,

FisherBiotech, 0.5 mg/ml) for 1 h at rt. The blot was washed

three times as above in PBS. The ECL reagents were mixed

(1:1) and incubated with the nc for 1 min at rt (in the

dark). The nc was wrapped in plastic wrap and exposed to

Kodak X-Omat film for 2-3 sec.

SV Polymerase Bindino to Self-Assembled Nucleocapsids

A549 (4.8 x 106) cells were infected with VVT7 and

either transfected with no plasmids (mock), or with the wt or

mutant NP plasmid (self-assembled nucleocapsids), or

cotransfected with the SV-P and SV-L plasmids (polymerase)

such that there was one P and L cotransfected dish for each

mock, wt and mutant NP transfected dish. At 5.5 h p.t. the

cells were pulse-labeled for 1 h (P and L co-transfections)

or for 3 h (mock and self-assembled nucleocapsid

transfections) with Tran35S-label (66 gCi/ml) in 10%











methionine and cysteine DMEM supplemented as described for

protein synthesis in vivo. The cells cotransfected with SV-P

and SV-L were harvested using lysolecithin permeabilization

and collected in 100 pL SV RM salts containing 1 mM ATP and 1

gg/ml aprotinin (Horikami and Moyer, 1995). The duplicate

extracts containing the P and L proteins were combined after

the nuclei were pelleted.

The cells mock transfected or transfected with wt or

mutant NP were harvested in SV salts containing 0.25% NP40

and 1 gg/ml aprotinin (300 pl). The mock cell extract and

the self-assembled wt or mutant nucleocapsids were purified

by pelleting separately through 30% (v/v) glycerol (5 ml) in

an SW55 rotor at 50,000 rpm for 90 min at 40C and the pellets

were collected in 75 il SV RM salts. Equal aliquots (100 l)

of the polymerase extract were mixed with the purified mock

or nucleocapsid preparations and incubated for 1 h at 300C.

As a positive control the polymerase extract was also

incubated with polymerase-free purified DI-H. The reactions

were pelleted through a step gradient containing 2.5 ml of

30% and 50% (v/v) glycerol in 10 mM HEPES, pH 8.5, in an SW55

rotor at 50,000 rpm for 90 min at 40C. The pellets were

resuspended in 1% NP40 lysis buffer (250 .l) and the proteins

were immunoprecipitated with the a-SV and a-L antibodies and

separated on a 7.5% polyacrylamide-SDS gel.

Electron Microscopy

For electron microscopy of the self-assembled wt and

mutant NP370 proteins, A549 cells (4.8 x 106) were infected








55

with VVT7 and transfected in duplicate. The duplicate

unlabeled cell extracts for each protein were combined and

pelleted through 30% (v/v) glycerol (5 ml) in an SW55 rotor

at 50,000 rpm for 90 min at 4'C. The pellets were collected

in 75 l ET buffer and analyzed by negative staining with 2%

uranyl acetate by the Electron Microscopy Core Laboratory in

the Interdisciplinary Center for Biotechnology Research at

the University of Florida.















CHAPTER 3
TEMPLATE FUNCTION

Introduction


The nucleocapsid protein (NP, 524 aa) of Sendai virus is

an essential component of both protein-protein and protein-

RNA interactions (NP-NP, NP-P, NP-RNA, and P/L-Nuc) required

for viral RNA replication (Horikami et al., 1992; Buchholz et

al., 1993; Curran et al., 1993). Only encapsidated RNA is

recognized by the viral polymerase (Emerson and Wagner, 1972,

Buchholz et al., 1993) suggesting that the NP protein has

functional as well as structural roles in RNA replication

(Buchholz et al., 1993). Approximately 2600 molecules of the

NP protein encapsidate the viral RNA genome and encapsidation

of the viral RNA also renders the RNA nuclease resistant

(Galinski and Wechsler, 1991; Moyer and Horikami, 1991).

Evidence presented by Curran et al. (1993) suggested

that the N-terminal 400 aa of the NP protein are required for

RNA replication in vitro since any deletion, even one as

small as 7 aa, within the first 400 aa abolished activity.

They found that the C-terminal tail (ca. 124 aa) of the NP

protein was not required for encapsidation of the nascent

RNA, but was required for replication in vivo suggesting that












the C-terminal amino acids were required for the progeny

nucleocapsids to serve as a template during amplification of

the RNA genome.

To identify residues within the first 400 aa of the NP

protein required for various aspects of viral RNA

replication, we selected clustered charge-to-alanine

mutagenesis because of the likelihood of targeting surface

residues and producing a number of stable mutant proteins

which would exhibit a mutant phenotype (Cunningham and Wells,

1989; Bass et al., 1991; Bennett et al., 1991; Wertman et

al., 1992). Alanine-scanning mutagenesis was first used by

Cunningham and Wells (1989) to identify side chains on the

human growth hormone that are involved in binding to the

human growth hormone receptor. The majority of their mutants

(81%) were expressed as stable proteins and of these 24% had

significantly altered binding affinities for the receptor.

Clustered charge-to-alanine mutagenesis has since been used

to identify residues on the surface of proteins important for

protein-protein interactions (Bass et al., 1991; Bennett et

al., 1991; Wells et al., 1993), catalytic activities (Diamond

and Kirkegaard, 1994), and to create a number of mutants

having temperature sensitive (ts) phenotypes (Wertman et al.,

1992; Hassett and Condit, 1994). We will present evidence

that the charged residues from aa 114 to 129 of the NP

protein are required for the nucleocapsid to function as a

template in RNA replication in vivo. This defect is not due












to the lack of NP-P, NP-NP, or nucleocapsid-polymerase (P/L-

Nuc) interactions in these mutants.

Results

Effect of Charce-to-Alanine Mutacenesis of the NP Protein on
Sendai Virus RNA Replication In Vitro

We constructed six charge-to-alanine mutants in the

charged region from aa 107 to 129 as described in Materials

and Methods (Fig. 1). Within this charged region, aa 107 to

115 have been proposed as a putative RNA binding site (Morgan

et al., 1984; Buchholz et al., 1993). The in vitro

replication assay, described in Materials and Methods, was

used to test the activity of the mutant NP proteins

synthesized in cells cotransfected with the mutant NP

plasmids (in place of the wt NP plasmid) and the P and L

plasmids.

Initially, a single charge-to-alanine mutation (Glu to

Ala, E107A) at aa 107 (NP107) was constructed. The mutant

was expressed in VVT7-infected A549 cells that were

transfected in duplicate with either the plasmid containing

the gene for wt NP or NP107 as described in Materials and

Methods. The cells were Tran35S-labeled at 5.5 h p.t. for 30

min and extracts prepared immediately (pulse) or at 24 h p.t.

following a chase in medium containing 10-fold excess

methionine and cysteine (chase). The proteins were

immunoprecipitated with an a-SV antibody and separated by

SDS-PAGE as described in Materials and Methods. The wt and














1 107 130 524 aa
SV-NP



NP107 EKDP KRTKTDGFIV KTRDMEYERT

NP108 EKDP KRTKTDGFIV KTRDMEYERT

NP111 EKDP KRTKTDGFIV KTRDMEYERT

NP114 EKDP KRTKTDGFIV KTRDMEYERT

NP121 EKDP KRTKTDGFIV KTRDMEYERT

NP126 EKDP KRTKTDGFIV KTRDMEYERT





Figure 1. A schematic of the NP protein and the amino acid
sequences (aa) from 107 to 130 of the charge-to-alanine NP
mutants. Alanine was substituted for one, two, or three
charged residues in the mutant NP proteins and these residues
are highlighted by bold lettering and underlined.












the mutant NP proteins were found to be equally expressed in

the pulse (Fig. 2B, lanes 3 and 5) and both proteins were

stable to an overnight chase (Fig. 2B, lanes 4 and 6). The

other bands in the gel are vaccinia virus proteins that were

nonspecifically immunoprecipitated with the a-SV antibody as

seen in the VVT7-infected, but not transfected cell extracts

(Fig. 2B, lanes 1 and 2).

To test the biological activity of the mutant, extracts

of cells expressing wt NP or NP107 with the P and L proteins

were incubated with detergent disrupted SV DI-H and assayed

for RNA genome replication in vitro as described in Materials

and Methods. This assay measures one round of replication,

i.e., the ability of the expressed NP protein to encapsidate

the nascent RNA. The 32p-labeled nuclease resistant product

nucleocapsids were purified by banding on CsC1 gradients, the

RNA extracted, and analyzed by gel electrophoresis.

Replication with the mutant protein, NP107, was somewhat

better than replication with the wt NP protein (Fig. 2C,

lanes 3 and 2, respectively). Replication of SV DI-H RNA was

dependent on the expression of the SV NP, P, and L proteins

since no activity was observed in an extract of VVT7-

infected, but not transfected cells (Fig. 2C, lane 1). This

mutant gave a phenotype indistinguishable from that of wt NP

so this charged amino acid is not essential for activity.

Based on these results we decided to change clustered

groups of charged residues to alanine in the remaining five






















Figure 2. Pulse-chase analysis and in vitro replication with
the mutant NP107. A) Amino acid sequences (aa 107-130) of
the wt NP and the mutant NP107 protein as described in Fig.
1. In vitro replication (%) with the mutant is shown
relative to wt NP (100%). B) A549 cells (4.8 x 106) were
infected with VVT7 and transfected in duplicate with no
plasmids (-), the wt (WT) or mutant NP (107) (2 gg) plasmid,
as indicated at the top. At 5.5 h p.t. the cells were
labeled for 30 min with Tran35S-label and extracts prepared
immediately (pulse, P) or at 24 h p.t. following a chase (C).
The proteins were immunoprecipitated with an a-SV antibody
and analyzed by 9% SDS-PAGE. The position of the NP protein
is indicated. C) A549 cells (4.8 x 106) were infected with
VVT7 and transfected with no plasmids (-), or cotransfected
with the P (5 gg) and L (0.5 gg) plasmids together with the
wt or mutant NP (2 jg) plasmid, as indicated at the top.
Cytoplasmic cell extracts were prepared at 18 h p.t. and
incubated with detergent disrupted purified DI-H (dd DI-H) in
the presence of [a-32P]CTP. The nuclease resistant product
nucleocapsids were banded on CsCl gradients and the purified
RNAs were analyzed by gel electrophoresis as described in
Materials and Methods. The position of the DI-H RNA is
indicated and the amount of product DI-H RNA (as indicated in
A) was quantitated on a phosphorimager.


















% REPLICATION
in vitro
A
WT NP EKDP KRTKTDGFIV KTRDMEYERT 100
NP107 EKDP KRTKTDGFIV KTRDMEYERT 141

B C
NP WIWT11 107 07 -wT




JIS -NP i -



1 2 3 4 5 6 1 2 3
P C P C PC












mutants (Fig. 1) with the hope that we would produce a stable

protein with a mutant phenotype. Each of the mutant NP

proteins, NP108, NP111, NP114, NP121, and NP126, were shown

to be expressed as stable proteins by pulse-chase analysis as

described in Materials and Methods (data not shown) and

immunoblot analysis (Fig. 3D and E).

The mutant proteins were then tested for activity in SV

DI-H RNA replication in vitro as described in Materials and

Methods (Fig. 3). Replication of the detergent disrupted SV

DI-H template with the wt NP protein was set at 100% (Figs.

3B and C, lanes 2 and 1, respectively). The level of

replication with the mutants NP108, NP114, and NP121, was

nearly equal or equivalent to wt NP replication at 80%, 104%,

and 89%, respectively (Fig. 3B, lanes 3, 5, and 6).

Replication with the mutants NP111 and NP126 was somewhat

reduced, but was still significant with levels at 50% of wt

NP (Fig. 3B, lane 4 and Fig. 3C, lane 2, respectively). The

wt and mutant NP proteins were equally expressed in these

extracts as shown by immunoblot analysis on a portion of the

extracts (10%) with an a-SV antibody as described in

Materials and Methods (Fig. 3D, lanes 2 to 6 and Fig. 3E,

lanes 1 and 2). The P protein was also equally expressed,

although the level of P protein detected by this antibody is

less than that of the NP protein. These data show that the

charged residues encompassing aa 107 to 129 in the NP protein

can be changed in clusters to alanine without significantly













% REPLICATION
in vitro
A
WTNP EKDP KRTKTDGFIV KTRDMEYERT 100
NP108 EKDP KRTKTDGFIV KTRDMEYERT 80
NP111 EKDP KRTKTDGFIV KTRDMEYERT 50
NP114 EKDP KRTKTDGFIV KTRDMEYERT 104
NP121 EKDP KRTKTDGFIV KTRDMEYERT 89
NP126 EKDP KRTKTDGFIV KTRDMEYERT 50

B C D E
NP WT 108|1111 1121 Iw 126




-DI H -EP-


1 2 3 4 5 6 1 2
1 2 3 4 5 6 1 2



Figure 3. In vitro DI-H RNA synthesis with the charge-to-
alanine mutant NP proteins. A) Amino acid sequence (aa 107-
130) of the wt NP and the five mutant NP proteins (NP108,
NP111, NP114, NP121, and NP126) and the level of replication
(%) with these mutants as described in Fig. 2. B) and C)
A549 cells were WT7-infected and transfected with no
plasmids (-), or cotransfected with the P and L plasmids
together with the wt or mutant NP plasmid as indicated at the
top and described in Fig. 2. Cytoplasmic cell extracts were
prepared at 18 h p.t. and in vitro replication was assayed as
described in Fig. 2. The position of the DI-H RNA is
indicated and the amount of product DI-H RNA was quantitated
on a phosphorimager. D) and E) Immunoblot analysis on
samples (10%) of the cytoplasmic cell extracts used for in
vitro replication with an a-SV antibody as described in
Materials and Methods. The positions of the NP and P
proteins are indicated. The sample numbers in B) and C)
correspond to those in D) and E), respectively.












affecting ( 50%) the ability of the proteins to encapsidate

nascent RNA in vitro.

Protein-Protein Interactions

NP-P complex formation is conserved in the mutant NP

proteins. One of the requirements for in vitro SV RNA

replication is the formation of the encapsidation substrate,

the NP-P complex (Horikami et al., 1992). Since each of the

mutant proteins was active in replication in vitro to some

degree, we expected that they were forming NP-P complexes,

but this needed to be confirmed based on previous results

with the measles virus nucleocapsid protein (MV N) (Chandrika

et al., 1995). In this case, we showed that the MV N protein

supported Sendai virus in vitro replication and yet this

activity did not depend on complex formation between the MV N

and SV P proteins. To measure NP-P complex formation we

utilized a fusion protein containing the glutathione S-

transferase protein fused to the N-terminus of the full-

length Sendai virus P protein (GST-P). The wt or mutant NP

proteins were expressed individually or together with the

GST-P protein using the mammalian expression system in the

presence of Tran35S-label as described in Materials and

Methods. Cell extracts were prepared at 18 h p.t. and

identical aliquots were incubated with either glutathione

Sepharose beads or an a-SV antibody as described in Materials

and Methods. The bound and immunoprecipitated proteins were

analyzed by SDS-PAGE.












Significant levels of the wt NP and GST-P proteins were

expressed in the cell extracts as shown by

immunoprecipitation with an a-SV antibody (Fig. 4A, lanes 2

through 4). The GST-P protein expressed alone bound to the

beads (Fig. 4B, lane 4) as expected and the additional bands

are apparently proteolysis products of the GST-P fusion

protein, which still retain GST and, thus, bind to the beads.

Proteins from VVT7-infected, but not transfected cell

extracts did not bind to the beads (Fig. 4B, lane 1). The wt

NP protein forms a complex with the GST-P protein as

demonstrated by the NP protein cobinding to the beads when NP

is coexpressed with GST-P (Fig. 4B, lane 3), but not when it

is expressed alone (Fig. 4B, lane 2). The amount of the

transfected pGEMSV-NP and pGST-P plasmids (2:1) was adjusted

from the usual NP-P amounts (2:4) because the GST-P gene is

overexpressed relative to the P gene in the mammalian

expression system due to an internal ribosome binding site in

the fusion protein mRNA. We showed that the NP protein does

not form a complex with the GST protein alone (data not

shown); therefore, the cobinding of NP with GST-P is specific

for NP and P complex formation. Previously, NP-P complex

formation had been demonstrated by coimmunoprecipitation and

cosedimentation (Horikami et al., 1992).

Each of the mutant NP proteins NP107, NP108, NP111,

NP114, NP121, and NP126, formed complexes with the P protein

as well as evidenced by their cobinding with GST-P to the



























Figure 4. Cobinding of the NP protein with the GST-P protein
to glutathione Sepharose beads. A549 cells (4.8 x 106) were
infected with VVT7 and transfected with no plasmids (-), the
wt or mutant NP (2 lg) plasmid alone or together with the
GST-P (1 ig) plasmid, or with the GST-P (1 gg) plasmid alone,
as indicated. From 6-18 h p.t. the cells were labeled with
Tran35S-label as described in Materials and Methods. Cell
extracts were prepared and samples were immunoprecipitated
with an a-SV antibody and analyzed by 9% SDS-PAGE as
described in Materials and Methods (A). Identical sample
portions were incubated with glutathione Sepharose beads and
the bound proteins were analyzed by 9% SDS-PAGE as described
in Materials and Methods (B and C). The position of the NP
and GST-P proteins are indicated.


























A B
NP WT WT WTWT
GST-P --++ ++


sl P -GST-P







NP -NP


1 2 3 4 1 2 3 4
IP Beads


C


NP |- 0707nl08l08 |llllllll4l4 1112122626
GST-P --










1 2 3 4 5 6 7 8 9 10 11 12 13
Beads


-GST-P







-NP








69


beads


(Fig.


4C, lanes


3, 5,


7, 9, 11, and 13).


In the


absence


of the GST-P


protein


none


of the NP proteins


bound


the beads

simplicity


(Fig.

only


4C, lanes


the bead


2, 4, 6, 8, 10, and 12)


binding


data


are shown,


For


but all the


proteins


were


synthesized


to significant


levels as


detected


by immunoprecipitation


with


an a-SV


antibody


(data


shown).


The mutant


NP proteins can self-assemble


and form


nucleocapsidlike


articles.


In addition


to the NP-P


complex,


an NP-NP interaction is also

genome RNA replication since


presumed


to be required


RNA synthesis


during


is coincident


with


cooperative

al., 1991).


shown


encapsidation


Additional


by self-assembly


by


the NP protein


evidence


for


an NP-NP


of the NP protein


(Kolakofsky


interaction


expressed


alone


nucleocapsidlike


particles,


which


were


identical


morphology


to authentic


nucleocapsids


from


virus


infected


cells


(Buchholz


et al.,


1993) .


Self-assembly


of the NP


protein


occurred


in the absence


of


any


additional


SV proteins


or SV RNA.

was determine


The density

Led by bandin


of the self-assembled

.a the radiolabeled nu(


wt NP protein

cleocapsidlike


particles


synthesized


in vivo


on CsCl


gradients


as described


in Materials


and Methods.


The majority of


the self-assembled


NP protein

authentic


banded


at the density


SV nucleocapsids


(data


of 1.30


gm/cc


not shown;


identi


see Fig.


cal to

14C).


The individual


wt or mutant


NP proteins


were


expressed


expression system and


to


not


et


was


into


in


using the mammalian


banded on CsC1


--- ----~ ~


II


I .- --- ...


- zi









70

gradients as described in Materials and Methods. Fractions

were collected from the top, separated by SDS-PAGE, and

analyzed by immunoblotting with an a-SV antibody as described

in Materials and Methods (Fig. 5). Consistent with previous

data (Buchholz et al., 1993) the majority of the wt NP

protein self-assembled into nucleocapsidlike particles as

shown by its banding in fraction 5 at the 30-40% interface

(Fig. 5B) like that of authentic nucleocapsids (Kolakofsky,

1976; Buchholz et al., 1993;). Cells VVT7-infected, but not

transfected showed no viral protein (Fig. 5A) as expected.

Analysis of the self-assembly of the mutants NP108,

NP111, NP114, NP121, and NP126 showed that the majority of

each protein banded in fraction five identically to wt NP

protein. These results show that all the mutant proteins

self-assembled into nucleocapsidlike particles. In summary,

these data show that substitution of alanine for the charged

residues between aa 107 and 129 did not significantly disrupt

DI-H RNA replication in vitro or NP-P or NP-NP protein

complex formation

Charae-to-Alanine Mutacenesis of the NP Protein Disrupts In
Vivo Replication

One limitation of the in vitro replication assay is that

it does not measure if the genome RNA encapsidated by the

mutant protein can then be used as a template for further

rounds of replication (Curran et al., 1993). To measure this

template function we have utilized a SV DI-H clone (pSPDI-H)



























Figure 5. CsC1 step gradient centrifugation of the self-
assembled wt and mutant nucleocapsidlike particles. A549
cells (4.8 x 106) were VVT7-infected and transfected with no
plasmids (mock), the wt (NP) or mutant NP (2 gg) plasmid, as
indicated. At 20 h p.t. unlabeled cell extracts were
prepared and analyzed by banding on separate CsCl step
gradients as described in Materials and Methods. Fractions
were collected from the top of the gradient and the pellet
was resuspended in the last fraction (sedimentation is from
left to right). Samples were analyzed by immunoblotting with
an a-SV antibody as described in Materials and Methods. The
positions of the wt or mutant NP proteins are indicated.























A B


-Mock -NP



1 2 3 4 5 6 7 1 2 3 4 5 6 7

C D


X -NP108 -NPll1



1 2 3 4 5 6 7 1 2 3 4 5 6 7

E F



S-NP114 -NP121



1 2 3 4 5 6 7 1 2 3 4 5 6 7

G


St -NP126



12 3 4 5 6 7












that was constructed to contain the DI-H genomic sequence

cloned downstream of the T7 promoter with the hepatitis delta

virus ribozyme at the 3' end to generate authentic viral ends

as described in Materials and Methods. In the mammalian

expression system when the DI-H clone is cotransfected with

the NP, P, and L plasmids into VVT7-infected A549 cells, the

plus strand (+)DI-H RNA is transcribed by the T7 polymerase

and encapsidated by the expressed NP protein. The (+)DI-H

RNA-NP is then replicated by the expressed NP, P, and L

proteins to amplify the template. Using this assay we can

determine if the RNA encapsidated by the mutant NP proteins,

where the mutant NP plasmid is substituted for the wt NP

plasmid, can be used as a template for replication.

Replication can be measured either by and assaying the amount

of DI-H RNA produced by in vitro RNA synthesis or by northern

analysis of the RNA extracted directly from the cells as

described in Materials and Methods.

The cells were infected and transfected as described in

Materials and Methods and after 18 h at 370C lysolecithin

cell extracts were prepared. Replication was detected first

by direct labeling with [a-32p]CTP at 30C for 2 h and the

replication products were purified and analyzed by gel

electrophoresis as described in Materials and Methods. The

DI-H RNA is not replicated in the absence of SV proteins

(Fig. 6B, lane 1) as expected. Compared to replication with

wt NP set at 100% (Fig. 6B, lane 2), the RNAs encapsidated by












the mutant proteins NP107, NP108, and NP111, showed somewhat

reduced, but still significant levels of RNA replication of

71%, 68%, and 69%, respectively (Fig. 6B, lanes 3, 4, and 5).

RNAs encapsidated by the mutant proteins NP114 and NP126,

however, were significantly impaired in template function

(Fig. 6B, lanes 6 and 8; 28% and 18%, respectively) and the

RNA encapsidated by NPl21 was completely inactive (Fig. 6B,

lane 7; 0%). Immunoblot analysis on samples of the cell

extracts (10%) with an a-SV antibody demonstrated that the wt

and mutant NP proteins were equally expressed (Fig. 6C, lanes

2 to 8) as described in Materials and Methods. These results

indicate that while the mutants NP114, NP121, and NP126, are

capable of encapsidating the nascent RNA during the first

round of replication using DI-H encapsidated with wt NP as a

template (Fig. 3), the product RNAs encapsidated by these

mutant proteins do not function as templates for further

rounds of replication.

Clustered charge-to-alanine mutations in a variety of

proteins have been shown to yield a proportion of ts mutants

(Wertman et al., 1992; Hassett and Condit, 1994; Diamond and

Kirkegaard, 1994). We asked whether the NP mutants were ts

and if we could rescue the template function of the mutants

NP114, NP121, and NP126, by lowering the temperature of

incubation. This was done by measuring the product

nucleocapsid RNA synthesized in vivo by northern analysis and









75


% REPLICATION


WTNP
NP107
NP108
NP111
NP114
NP121
NP126


EKDP KRTKTDGFIV KTRDMEYERT
EKDP KRTKTDGFIV KTRDMEYERT
EKDP KRTKTDGFIV KTRDMEYERT
EKDP KRTKTDGFIV KTRDMEYERT
EKDP KRTKTDGFIV KTRDMEYERT
EKDP KRTKTDGFIV KTRDMEYERT
EKDP KRTKTDGFIV KTRDMEYERT


NP WT 107 108 111 114 121 126
DI-H clone + + + + + + +"


1 2 3 4 5 6 7 R


Figure 6. Template function of
in vivo with wt or mutant NP pro
(aa 107-130) of the wt NP and t
the level of replication in


1 -DI-H


100
71
68
69
28
0
18


-p
-NP


the (+)DI-H RNA-NPs assembled
teins. A) Amino acid sequence
he six NP mutant proteins and
vitro (%) with each mutant


template as described in Fig. 1. B) VVT7-infected A549 cells
were transfected with the DI-H (2.5 jg) plasmid, or
cotransfected with the DI-H plasmid (2.5 gg), the P (5 ig) and
L (0.5 gg) plasmids together with the wt or the mutant NP (2
ig) plasmid, as indicated. Cytoplasmic cell extracts were
prepared at 18 h p.t. and in vitro replication was assayed as
described in Fig. 2. The position of the DI-H RNA is
indicated and the amount of product DI-H RNA was quantitated
on a phosphorimager. C) Immunoblot analysis on a portion
(10%) of the cytoplasmic cell extracts as described in Fig. 3.


a


_ _-_-_ m-


I


1 2 3 4 5 6 7 8


**:Xf:..XfX.:: ...... '^S. *::












does not require the temperature shift between expression and

the assay that was necessitated by the experiments above.

A549 cells were infected with VVT7 at 370C, transfected

in duplicate and then incubated either at 320C for 36 h or at

370C for 22 h. Nuclease resistant RNA was banded on CsC1

gradients and the RNA extracted as described in Materials and

Methods. The purified RNA was separated by gel

electrophoresis and transferred to nitrocellulose. An

unlabeled in vitro DI-H reaction was included to provide a

marker replication product (Fig. 7B, lane 10) and DI-H RNA

was detected by northern blotting with a randomly labeled DI-

H probe. There was no replication in VVT7-infected cells

transfected with only the DI-H plasmid, showing that

replication was dependent on expression of the NP, P, and L

proteins (Fig. 7B, lane 1). The nucleocapsid RNA produced

with wt NP at 320C (Fig. 7B, lane 2; 100%) was reproducibly

greater than at 370C (Fig. 7B, lane 3; 29%). Replication

with NP114, however, was greater at 370C (Fig. 7B, lane 5;

47%) than at 320C (Fig. 7B, lanes 4; 17%), suggesting that

this mutant has a cold sensitive (cs) phenotype. The

template function of NP126 also appeared to be cold sensitive

(Fig. 7B, lanes 8 and 9; 5 and 20%), but at these low levels

of replication this remains speculative. The mutant NP121

was completely inactive in replication at both temperatures

(Fig. 7B, lanes 6 and 7; 0%), and is evidence that the RNA

encapsidated by the mutant NP121 is not used as a template















% REPLICATION
in vivo

A
WTNP EKDP KRTKTDGFIV KTRDMEYERT 100 29
NP114 EKDP KRTKTDGFIV KTRDMEYERT 17 47
NP121 EKDP KRTKTDGFIV KTRDMEYERT 0 0
NP126 EKDP KRTKTDGFIV KTRDMEYERT 5 20

B C


I 137 37323737


-DI-H P
RNA NP


1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10




Figure 7. Northern analysis of DI-H RNA replication in vivo.
A) Amino acid sequence (aa 107-130) of the wt and the mutant
NP proteins as described in Fig. 1. In vivo replication (%)
with the wt and mutant NP proteins at 320C and 370C are shown
relative to wt NP at 320C (100%). B) A549 cells (1.8 x 107)
were VVT7-infected and transfected as described in Fig. 6,
with following amount of plasmids: 7.5 ig DI-H plasmid, 15
gg P plasmid, 1.5 lg L plasmid, and 6 gg wt or mutant NP
plasmid, and incubated at either 320C or 370C, as indicated.
Cytoplasmic cell extracts were prepared at 36 h or 22 h (32C
and 370C, respectively) and analyzed by northern blotting as
described in Materials and Methods. The product DI-H RNA was
identified with a randomly labeled 32P-DI-H probe. An
unlabeled in vitro DI-H reaction was included to provide a
marker replication product (lane 10). The position of the
DI-H RNA is indicated. C) Immunoblot analysis on a portion
(10%) of the cell extracts using enhanced chemiluminescence
with an a-SV antibody as described in Materials and Methods.
The positions of the NP and P proteins are indicated.












for RNA replication under any of the conditions tested.

Immunoblot analysis with an a-SV antibody showed that the wt

and mutant NP proteins and the P protein were equally

expressed in these cell extracts (Fig. 7C, lanes 2 through

10). The other bands in the blot represent vaccinia proteins

nonspecifically staining in this particular blot.

Binding of the SV Polvmerase to the Wild-Type and Mutant
Self-Assembled Nucleocaosidlike Particles

One requirement for viral RNA replication is the

recognition of and binding of the viral polymerase through

the P moiety to the template (P/L-Nuc protein complex). To

determine if the template defects identified in the in vivo

replication assays were due the inability of the polymerase

to bind to the mutant nucleocapsids, we tested binding with

self-assembled nucleocapsidlike particles as described

previously (Horikami and Moyer, 1995). The wt and mutant NP

proteins representing each defective phenotype seen in

replication in vivo (significant, reduced, and no activity)

were self-assembled by the expression of each protein in

VVT7-infected and transfected A549 cells in the presence of

Tran35S-label. The radiolabeled nucleocapsidlike particles

were purified by sedimentation through glycerol and

resuspended as described in Materials and Methods. Equal

aliquots of the extracts expressing the radiolabeled viral

polymerase proteins were incubated with the nucleocapsidlike

particles. As a positive control, purified polymerase-free












SV DI-H (RNA-NP template) was also incubated with the viral

polymerase extract. The reactions were then sedimented

through glycerol, the pellets collected, and

immunoprecipitated with the a-SV and a-L antibodies to

monitor the proteins associated with the nucleocapsids.

We showed that the P and L proteins copellet (i.e.,

bind) in the presence of both the SV RNA-NP template and the

wt nucleocapsidlike particles (Fig. 8, lanes 6 and 1,

respectively), but only a small amount of the polymerase

proteins pelleted in the absence of nucleocapsid template

(Fig. 8, lane 5), in agreement with previous data. The

polymerase proteins bound to the three mutant self-assembled

nucleocapsidlike particles (Fig. 8, lanes 2 to 4) at levels

equal to wt nucleocapsids as indicated by their copelleting.

The additional bands on the gel are vaccinia virus proteins

that pelleted and were nonspecifically immunoprecipitated in

this assay. Thus, the mutant nucleocapsidlike particles

still have the binding sites for the viral polymerase. These

results show that the template defect in the mutant

nucleocapsids manifested during replication in vivo is not

due to lack of binding of the viral RNA polymerase to the

templates.

Discussion
A summary of the properties of the charge-to-alanine NP

mutants from aa 107-129 is presented in Fig. 9. This

approach identified a region of the NP protein from aa 114





















Figure 8. Binding of the viral polymerase to the wt and
mutant self-assembled nucleocapsidlike particles. As a
source of nucleocapsidlike particles, VVT7-infected A549
cells (4.8 x 106) were transfected with no plasmids (-), or
the wt or the mutant NP plasmid (2 gg), as indicated. As a
source of the viral polymerase, VVT7-infected A549 cells were
cotransfected with the P (5 gg) and L (5 gg) plasmids. At 6
h p.t. the cells were Tran35S-labeled for 3 h
(nucleocapsidlike particles) or 1 h (viral polymerase) and
cell extracts were prepared as described in Materials and
Methods. The mock cell extract (-) and the nucleocapsidlike
particles were purified by pelleting separately through
glycerol. An equal aliquot of the viral polymerase extract
was incubated separately with the purified mock extract (lane
5), each of the purified nucleocapsidlike particles (lanes 1
to 4), and purified polymerase-free SV DI-H (RNA-NP, lane 6).
The samples were pelleted through glycerol as described in
Materials and Methods. The pellets were resuspended and the
bound proteins were immunoprecipitated with the a-SV and a-L
antibodies and analyzed by 7.5% SDS-PAGE. The positions of
the NP, P, and L proteins are indicated.












NUC WT+111211126 -I-B



0 -L









-P




NP


1 2 3 4 5 6









82

and 129 that was required for the nucleocapsid to function as

a template, but was not required for RNA encapsidation. It

was surprising that changing a total of 13 charged aa to

alanine in these six mutant proteins had little effect on

replication in vitro, i.e., encapsidation (Fig. 9). Previous

analysis of a set of 22 NP deletion mutants by Curran et al.

(1993) found that the entire region from aa 1-400 was

required for in vitro replication. These apparently

conflicting results are likely due to the different effects

on protein structure by the alanine substitutions versus the

deletions.

Alanine substitutions generally have minimal effects on

protein folding or conformation (Cunningham and Wells, 1989;

Bennett et al., 1991; Bass et al., 1991; Wertman et al.,

1992). In contrast, deletions are more likely to affect

protein folding leading to multiple alterations in protein

domains downstream of the deletion. Furthermore, misfolded

proteins are subject to proteolysis in vivo and this may be

the reason that synthesis of two mutant NP proteins

containing deletions between aa 107-130 or 167-187 was not

sufficient for biochemical analysis (Buchholz et al., 1993).

Additional evidence that the mutant proteins encompassing aa

107-129 are folded correctly was that each of the six mutants

formed both NP-P and NP-NP complexes (Fig. 9) (Predki et

al.,1995).


















COMPLEX FORMATION


NP PROTEIN NP:P NP:NP


P/L:NUC


VIRAL RNA REPLICATION (%)
In Vitro In Vivo
a32P Label a32P Label Northern


+ + +

+ ND ND

+ + ND

+ + +

+ + ND

+ + +

+ + +


100 100 +


71 ND

68 ND

69 ND

28 CS

0 0

18 CS


Figure 9. A summary of the protein-protein interactions and
in vitro DI-H RNA replication data of the wt and mutant NP
proteins. The data for the NP:P, NP:NP, and P/L:NUC
interactions are from Figs. 4, 5, and 8 and the data for (%)
RNA replication are from Figs. 2, 3, 6, and 7.


NP107

NP108

NP111

NP114

NP121

NP126












One possibility for the observation that the

nucleocapsids formed with the mutants NP114, NP121, and

NP126, did not function as templates for replication (Fig. 9)

could be that the RNA polymerase could not bind. Binding of

the polymerase to the template is mediated through the P

protein (Portner and Murti, 1986; Portner et al., 1988;

Morgan, 1991; Horikami and Moyer, 1995). We showed that the

viral polymerase, i.e., the P and L proteins, bound to the

mutant self-assembled nucleocapsids at wild-type levels (Fig.

9) suggesting that the template defect is not due to lack of

polymerase binding to the template. Clearly, polymerase

binding does not require these charged residues of NP.

Interestingly, it has been shown that any NP mutant

containing deletions within the C-terminal tail (aa 400-524)

had phenotypes similar to those exhibited by NP114, NP121,

and NP126 (Curran et al., 1993). That is, deletions of aa

400-415, 414-439, 426-497, and 456-524 formed NP-NP

complexes, encapsidated RNA in vitro, but were inactive in

replication in vivo. More recently, a P (polymerase) binding

site has been mapped within the C-terminal tail of the self-

assembled NP protein between aa 440-524 (Buchholz et al.,

1994). Therefore, the mutants containing deletions of aa

426-497 or 456-524 could not replicate in vivo because the

polymerase could not bind. However, the mutants with

deletions of aa 400-415 or 414-439, like the mutants NP114,

NP121, and NP126, could not replicate either, yet bound the P












protein. In combination these data suggest that at least two

sites are required for template function not related to

polymerase binding. One is located in the C-terminal aa 400-

439 and the other from aa 114-129 and that these two form a

single domain in the mature protein. Alternatively, the

evidence does not preclude the possibility that each of these

sites act as a separate domain with unique functions.

Several models can be envisioned for the role of aa 114-

129 and aa 400-439 in template function, depending on whether

these sites form one domain or two, and if the bases of the

RNA are exposed or buried in the nucleocapsid. The first

three models are based on the hypothesis that the bases are

covered by the NP protein, and that aa 114-129 and 400-439

form a single domain in the NP protein. In the first model,

this domain would be required for the temporary displacement

of NP to allow the viral polymerase access to the bases

during RNA synthesis (Curran et al., 1993). As described

previously, the temporary displacement of NP does not change

the nuclease-resistant character of the template; therefore,

the displacement of NP must be minimal and/or something else

must take the place of the displaced NP (Curran et al.,

1993). To accomplish this the NP protein may be displaced by

its binding to the P subunit of the RNA polymerase, via aa

114-129 and aa 400-439, and the L subunit of the polymerase

filling the gap (Curran et al., 1993). Following

replication, the displaced NP protein would be returned. In











VSV, it has been proposed that the NS (P protein) protein may

mimic the template RNA and act as a binding site for the N

protein (Hudson et al., 1986).

In models two and three, the mutations have resulted in

an increased affinity for either the RNA (NP-RNA interaction)

or the adjacent NP proteins (NP-NP interaction),

respectively. The increased affinity would prevent the

temporary displacement of the mutant NP protein from the RNA

or adjacent mutant NP proteins. This increased affinity

would not affect in vitro replication since the RNA template

is encapsidated by wt NP protein. A fourth model would

propose that the aa 114-129 and 400-439 represent individual

domains responsible for the separate functions described

above or some other unidentified function of the NP protein.

When RNA encapsidation and amplification were all

assayed at 370C (northern) as compared to encapsidation and

amplification at 370C followed by an in vitro assay at 30C

(direct labeling), a degree of template function was restored

to the mutant nucleocapsid containing NP114 (Figs. 7 and 9).

Comparison of the two assays (direct labeling and northern

blot) for template amplification showed that for NP114

shifting the temperature from 37'C to 30'C inhibited template

function of the nucleocapsids, suggesting that this mutant

has a cold sensitive (cs) phenotype. Both ts and cs mutants

have been described previously in alanine-scanning mutants

(Wertman et al., 1992; Hasset and Condit, 1994). In




Full Text
xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E1LFYVJPE_0Q5EPX INGEST_TIME 2013-01-23T14:35:52Z PACKAGE AA00012903_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES