LRRK2 knockout mice have an intact dopaminergic system but display alterations in exploratory and motor co-ordination be...


Material Information

LRRK2 knockout mice have an intact dopaminergic system but display alterations in exploratory and motor co-ordination behaviors
Physical Description:
BioMed Central
Publication Date:


Mutations in the LRRK2 gene are the most common cause of genetic Parkinson’s disease. Although the mechanisms behind the pathogenic effects of LRRK2 mutations are still not clear, data emerging from in vitro and in vivo models suggests roles in regulating neuronal polarity, neurotransmission, membrane and cytoskeletal dynamics and protein degradation. We created mice lacking exon 41 that encodes the activation hinge of the kinase domain of LRRK2. We have performed a comprehensive analysis of these mice up to 20 months of age, including evaluation of dopamine storage, release, uptake and synthesis, behavioral testing, dendritic spine and proliferation/neurogenesis analysis. Our results show that the dopaminergic system was not functionally comprised in LRRK2 knockout mice. However, LRRK2 knockout mice displayed abnormal exploratory activity in the open-field test. Moreover, LRRK2 knockout mice stayed longer than their wild type littermates on the accelerated rod during rotarod testing. Finally, we confirm that loss of LRRK2 caused degeneration in the kidney, accompanied by a progressive enhancement of autophagic activity and accumulation of autofluorescent material, but without evidence of biphasic changes. Keywords: Parkinson’s disease, Knockout, Dopamine, Microdialysis, Neuropathology, Open-field, Motor coordination, Kidney, Autophagy
General Note:
Hinkle et al. Molecular Neurodegeneration 2012, 7:25; pgs:1-17
General Note:
© 2012 Hinkle et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
General Note:
Publication of this article was funded in part by the University of Florida Open-Access publishing Fund. In addition, requestors receiving funding through the UFOAP project are expected to submit a post-review, final draft of the article to UF's institutional repository, IR@UF, ( at the time of funding. The Institutional Repository at the University of Florida community, with research, news, outreach, and educational materials.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
All rights reserved by the source institution.
Resource Identifier:
System ID:

This item is only available as the following downloads:

Full Text

IIlIll m

& e 0# /

& e 4 pp /



#&e 4 j /

* Joe 0

* 1st column is WT, 2ndcolumn HET, 3rd column KO



Dopamine Uptake





- 100-


, 25-


DOPAC/DA turnover

HVA/DA turnover

~(4# ~
~s# ~




D1 binding 18 months)

D2 binding (10 months)

D1 binding 10 months)

D2 binding (18 months)





50 -
40 -


60 -
50 -




mam m iminm

60 -
50 -
40 -





tau-1 (dephos)

me -


2 .

le D. 0% 70.2" 10 0 0% 49465
0 42906 x00 17xl07 0 42x 0 13x00 1U107

10(% 21 1 0 0 0% 33.50%

21% 78 81 0 I0% 66 50
0 42x10 1 7 17X1 0 42x10 13' 1710


10 10% 37.40% 1o' T.% 61.17%
10 10 D

10 10"
:1 0 0% 62.601 10 .% 3883%
0 42x1e 12410' 11C 0 4210' 12I10' 140

M 15min 30min 60min N
kD. AO +r- +-- +

150 2.0 C3 -mlL-4


50- 15in 30min

37- actin
37- ci

Supplementary Figure 5 Golde

Full Text


Real time quantitative reverse transcriptase PCR Mice were sacrificed by cervical dislocation and brains were separated into different regions (olfactory bulb, hippocampus, striatum, cortex, mid brain, brainstem, cerebellum) and frozen on dry ice. RNA was isolated using TRIzol (Invitrogen) according to Real time PCR assays were performed in triplicate on a 384 well plate using an ABI 7900 detection system to assess the rel ative level of murine LRRK1 (Mm00713303_ml), SNCA (Mm00447333_ml) and MAPT (Mm00521988_ml) and PRKN (Mm00450186_m1). In all instances murine GAPDH (Mm99999915_ml) was used as the endogenous reference gene. Dopamine Uptake Assay Preparation of striatal syn aptosomal fractions. Synaptosomes were pr epared as previously described [ 26 ] with slight modifications. For each experiment N=3 mice per genotype were assayed in triplicate and the experiment was repeated three times. The mice were killed by cervical dislo cation/decapitation, their brains rapidly removed and then dissected on a cooled dish. Striata were homogenized in 10 vol. of ice cold 0.32 M sucrose/0.01M HEPES, pH 7.4 using a Potter Elvehjem homogenizer by 10 up and down strokes with a Teflon pestle. T he lysates were centrifuged for 10 min/1000 x g at 4C, then the resulting crude supernatant (S1) was transferred to a new tube, discarding the pellet. The S1 lysate was centrifuged for 20 min/10,000 x g at 4C. The resulting supernatant was discarded, and the synaptosomal pellet was resuspended in 20 vol. of ice cold Krebs Ringer buffer, pH 7.6 (120mM NaCl, 4.8mM KCl, 1.2mM MgSO4, 1.3mM CaCl2, KH2PO4 1.2mM, 6mM glucose, 10mM HEPES) and stored on ice. Protein was measured [ 61 ] using bovine serum albumin as a standard.


Measurement of DA uptake in striatal synaptosomes. DA uptake assay was performed essentially as previously described [ 62 ] with 2uM [2,5,6,7,8 3 H] DA (139 Ci/mmol, Perkin Elmer). Each experiment was performed using striatal synaptosomes prepare d from freshly harvested brain tissue from three mice per genotype and was repeated three times on different days. The synaptosomes in Krebs Ringer buffer with 1uM pargyline hydrochloride were pre incubated for 30 min at 37C in the presence and absence of 100uM nomifensine maleate (to determine non specific and total DA uptake, respectively). The assay was initiated by adding 50 80ug synaptosomes (protein/assay) to [ 3 H] DA in ice cold Krebs Ringer buffer and incubated for 5 minutes at 37C. Uptake was stop ped by the addition of ice cold 0.9% saline followed by vacuum filtration (with Whatman GF/C filters presoaked in cold 0.1% polyethylenimine) using a Brandel cell harvester. The filters were rinsed 3x3mL with 0.9% saline and then transferred to scintillati on vials containing 5 mL Ecoscint (National Diagnostics ). Radioactive CPM values were determined by liquid scintillation spectrometry (Beckman LS6500), and specific DA uptake value s (pmol/mg/min; calculated by subtracting non specific uptake from total upt ake) w ere averaged and per group expressed as % of the WT control. D2 Autoceptor analysis Mice aged 2 month were treated with the D2 receptor antagonist raclopride (1.0mg/kg, i.p.; Sigma) (KO n=3 WT, HET n=7, KO n= 5) or saline (WT n=3, HET n=7, KO n=4) and killed by cervical dislocation 30 minutes later. Striatal tissue punches were processed for HPLC and western blotting analysis with TH and pTH antibodies. D1 and D2 receptor analysis Dopamine D1 and D2 receptors were quantified by autoradiography with tritiated ligands as previously described (Melrose et al 2010). WT and KO mice were analyzed in striatal


hemi sections from mice aged 10 months KO (n=14; 6 males, 8 females) and WT (n=13; 7 males, 6 females) and 18 months KO (n=7; 4 males, 3 males) and WT controls (n=8; 4 males, 4 females). Dendritic spine analysis KO and WT (n=4 each) mice aged 18 months were perfused with PBS by transcardial perfusion and drop fixed in 10% buffered formalin for 24 hours. Impregnation and staining was performed using the R apid Golgi Kit (FD Neurotechnologies) according to m thickness and mounted onto gelatin coated slides. Golgi impregnated striatal images were collected at 63x magnification usin g a Zeiss AxioImager Z1 microscope To ensure selection of only medium spiny neurons (MSN), a dendrite was only counted when it was clearly associated with an MSN cell body At least five neurons were imaged per section, and at least 6 sections were analyz ed per mouse. For each neuron, a series of Z stack images were collected and compressed into one single image using the extended focus module, to allow visualization of an entire dendrite. Dendritic spines were counted using Metamorph program (Molecular De vices) Counts were performed along the length of a dendrite, which was traced along in segments corresponding to 150 arbitrary units each and expressed as spines per unit Neurogenesis Proliferation was compared in KO mice and WT littermate controls age d four months (N=4 each) Mice received a single injection of BrdU, (100 mg/kg), and were perfused with ice cold PB S then 4% paraformaldehyde 24 h ours after the injection Brains were processed and sections stained free floating for BrdU and doublecortin as previously described [ 63 ] References


26. Winner B, Melrose HL, Zhao C, Hinkle KM, Yue M, Kent C, Braithwaite AT, Ogholikhan S, Aigner R, Winkler J, Farrer MJ, Gage FH (2011) Adult neurogenesis and neurite outgrowth are impaired in LRRK2 G2019S mice. N eurobiol Dis 41:706 716. 61. Morel P, Fauconneau B, Page G, Mirbeau T, Huguet F (1998) Inhibitory effects of ascorbic acid on dopamine uptake by rat striatal synaptosomes: relationship to lipid peroxidation and oxidation of protein sulfhydryl groups. Neuro sci Res 32:171 179. 62. Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein dye binding. Anal Biochem 72:248 254. 63. Moron JA, Perez V, Fernandez Alvarez E, Marco JL, U nzeta M (1998) "In vitro" effect of some 5 hydroxy indolalkylamine derivatives on monoamine uptake system. J Neural Transm Suppl 52:343 349


Windows User


W i n d o w s U s e r M i c r o s o f t W o r d

xml version 1.0 encoding utf-8 standalone no
mets ID sort-mets_mets OBJID sword-mets LABEL DSpace SWORD Item PROFILE METS SIP Profile xmlns http:www.loc.govMETS
xmlns:xlink http:www.w3.org1999xlink xmlns:xsi http:www.w3.org2001XMLSchema-instance
xsi:schemaLocation http:www.loc.govstandardsmetsmets.xsd
metsHdr CREATEDATE 2012-09-12T20:16:18
name BioMed Central
dmdSec sword-mets-dmd-1 GROUPID sword-mets-dmd-1_group-1
epdcx:descriptionSet xmlns:epdcx http:purl.orgeprintepdcx2006-11-16 xmlns:MIOJAVI
epdcx:description epdcx:resourceId sword-mets-epdcx-1
epdcx:statement epdcx:propertyURI http:purl.orgdcelements1.1type epdcx:valueURI http:purl.orgeprintentityTypeScholarlyWork
epdcx:valueString LRRK2 knockout mice have an intact dopaminergic system but display alterations in exploratory and motor co-ordination behaviors
AbstractMutations in the LRRK2 gene are the most common cause of genetic Parkinson’s disease. Although the mechanisms behind the pathogenic effects of LRRK2 mutations are still not clear, data emerging from in vitro and in vivo models suggests roles in regulating neuronal polarity, neurotransmission, membrane and cytoskeletal dynamics and protein degradation.We created mice lacking exon 41 that encodes the activation hinge of the kinase domain of LRRK2. We have performed a comprehensive analysis of these mice up to 20 months of age, including evaluation of dopamine storage, release, uptake and synthesis, behavioral testing, dendritic spine and proliferation/neurogenesis analysis.Our results show that the dopaminergic system was not functionally comprised in LRRK2 knockout mice. However, LRRK2 knockout mice displayed abnormal exploratory activity in the open-field test. Moreover, LRRK2 knockout mice stayed longer than their wild type littermates on the accelerated rod during rotarod testing. Finally, we confirm that loss of LRRK2 caused degeneration in the kidney, accompanied by a progressive enhancement of autophagic activity and accumulation of autofluorescent material, but without evidence of biphasic changes.
Hinkle, Kelly M
Yue, Mei
Behrouz, Bahareh
Dächsel, Justus C
Lincoln, Sarah J
Bowles, Erin E
Beevers, Joel E
Dugger, Brittany
Winner, Beate
Prots, Iryna
Kent, Caroline B
Nishioka, Kenya
Lin, Wen-Lang
Dickson, Dennis W
Janus, Christopher J
Farrer, Matthew J
Melrose, Heather L
http:purl.orgeprinttermsisExpressedAs epdcx:valueRef sword-mets-expr-1
http:purl.orgdcelements1.1language epdcx:vesURI http:purl.orgdctermsRFC3066
epdcx:sesURI http:purl.orgdctermsW3CDTF 2012-05-30
BioMed Central Ltd
http:purl.orgeprinttermsstatus http:purl.orgeprinttermsStatus
Kelly M Hinkle et al.; licensee BioMed Central Ltd.
http:purl.orgdctermsaccessRights http:purl.orgeprinttermsAccessRights
Molecular Neurodegeneration. 2012 May 30;7(1):25
fileGrp sword-mets-fgrp-1 USE CONTENT
file sword-mets-fgid-0 sword-mets-file-1
FLocat LOCTYPE URL xlink:href 1750-1326-7-25.xml
sword-mets-fgid-1 sword-mets-file-2 applicationpdf
sword-mets-fgid-3 sword-mets-file-3 imagetiff
sword-mets-fgid-4 sword-mets-file-4
sword-mets-fgid-5 sword-mets-file-5
sword-mets-fgid-6 sword-mets-file-6
sword-mets-fgid-7 sword-mets-file-7
sword-mets-fgid-8 sword-mets-file-8 applicationmsword
sword-mets-fgid-9 sword-mets-file-9
structMap sword-mets-struct-1 structure LOGICAL
div sword-mets-div-1 DMDID Object
sword-mets-div-2 File


RESEARCHARTICLEOpenAccessLRRK2 knockoutmicehaveanintact dopaminergicsystembutdisplayalterationsin exploratoryandmotorco-ordinationbehaviorsKellyMHinkle1 †,MeiYue1 †,BaharehBehrouz1,JustusCDchsel1,SarahJLincoln1,ErinEBowles1,JoelEBeevers1, BrittanyDugger1,BeateWinner2,IrynaProts2,CarolineBKent1,KenyaNishioka1,Wen-LangLin1, DennisWDickson1,ChristopherJJanus3,MatthewJFarrer1,4andHeatherLMelrose1*AbstractMutationsinthe LRRK2 genearethemostcommoncauseofgeneticParkinson ’ sdisease.Althoughthemechanisms behindthepathogeniceffectsof LRRK2 mutationsarestillnotclear,dataemergingfrom invitro and invivo models suggestsrolesinregulatingneuronalpolarity,neurotransmission,membraneandcytoskeletaldynamicsandprotein degradation. Wecreatedmicelackingexon41thatencodestheactivationhingeofthekinasedomainofLRRK2.Wehave performedacomprehensiveanalysisofthesemiceupto20monthsofage,includingevaluationofdopamine storage,release,uptakeandsynthesis,behavioraltesting,dendriticspineandproliferation/neurogenesisanalysis. Ourresultsshowthatthedopaminergicsystemwasnotfunctionallycomprisedin LRRK2 knockoutmice.However, LRRK2 knockoutmicedisplayedabnormalexploratoryactivityintheopen-fieldtest.Moreover, LRRK2 knockoutmice stayedlongerthantheirwildtypelittermatesontheacceleratedrodduringrotarodtesting.Finally,weconfirmthat lossofLRRK2causeddegenerationinthekidney,accompaniedbyaprogressiveenhancementofautophagic activityandaccumulationofautofluorescentmaterial,butwithoutevidenceofbiphasicchanges. Keywords: Parkinson ’ sdisease,Knockout,Dopamine,Microdialysis,Neuropathology,Open-field,Motorcoordination,Kidney,AutophagyBackgroundMutationsinthe LRRK2 gene,originallydescribedin2004, havenowemergedasthemostimportantgeneticfindingin Parkinson ’ sdisease(PD)[1,2].Incredibly,themostcommonmutationLRRK2G2019Saccountsforupto40%of Parkinsonisminpopulationsofcertainethnicdescent[3-5]. LRRK2 mutationsalsoaccountforaround2%ofsporadic Parkinsonismandtworiskfactorshavebeenidentifiedin Asianpopulations[6-9]. LRRK2 -associatedPDisalate onsetdiseaseandingeneralthediseaseresemblesidiopathicPDbothclinicallyandpathologically. LRRK2hasbeenlinkedtoneuriteoutgrowth,vesicular trafficking,proteintranslationandautophagy[10].Analysisofmutanttransgenicandknock-inmodels expressingphysiologicallevelsofLRRK2hasledtoan emergingthemethataberrantLRRK2leadstosubtle alterationsindopamineneurotransmission,albeitinthe absenceofdopaminergicneuronalloss[11].Imaging studiesinasymptomaticPDpatientsshowtheearliest detectablechangesoccurinthedopaminetransporter andthesameholdstrueforasymptomatic LRRK2 [12,13]and SNCA ( alpha-synuclein )patients[14-16]. NeurotransmissionalterationsinmutantLRRK2models maybesimilartoearlypreclinicalevents,suggestingan earlyinvolvementindopaminedysfunction. Theexpressionprofileof LRRK2 mRNAsuggeststhat LRRK2isunlikelytobeanessentialdevelopmentalprotein[17].Inadultrodentbrain, LRRK2 mRNAisfound athighestlevelsindopaminereceptiveareasparticularly thestriatum[18-22].However,proteinexpressionof LRRK2isabundantthroughoutthebrainincludingthe substantianigra,striatum,hippocampus,thalamus, *Correspondence:†Equalcontributors1DepartmentofNeuroscience,MayoClinic,Jacksonville,Florida32224,USA Fulllistofauthorinformationisavailableattheendofthearticle 2012Hinkleetal.;licenseeBioMedCentralLtd.ThisisanOpenAccessarticledistributedunderthetermsoftheCreative CommonsAttributionLicense(,whichpermitsunrestricteduse,distribution,and reproductioninanymedium,providedtheoriginalworkisproperlycited.Hinkle etal.MolecularNeurodegeneration 2012, 7 :25


cerebellumandcortex[23]suggestingitmayhavearole inmultiplebrainfunctions(i.e.memory,sensory,emotion)andnotjustthoseinvolvedinmotorcontrol. TofurtherstudytheroleofLRRK2inthebrain,wehave developed LRRK2 knockoutmicebyablatingexon41in thekinasedomainofLRRK2.WehaveperformedacomprehensiveanalysistostudytheeffectoflossofLRRK2; thisincludesathoroughinvestigationofthedopaminergic system,extensivebehavioralteststoexaminemotor,coordinationandemotionalbehavior,aswellasneuropathologicalanalyses.WefindlittleevidencethatlossofLRRK2 impactsdopaminergicneurotransmissionorstriatalbehaviors,howeverwepresentdatashowingchangesintheexploratoryandmotorco-ordinationbehaviorsinthese mice.Thesefindingsmaybeanimportantconsideration forfutureanti-LRRK2therapies.ResultsGenerationofmurine LRRK2 knockoutmiceThetargetingstrategyforgenerationof LRRK2 knockout (KO)miceisshowninFigure1A.Homozygousmice receivedfromOzgenePLCwerebredtoJacksonC57BL6/ Jmiceandsubsequentheterozygousoffspringwerebred togethertoobtainwildtype(WT),heterozygous(HET) andKOanimals.Northernblottinganalysiswithaprobe designedto LRRK2 exon24 – 27confirmedtheabsenceof the~9kbLRRK2mRNAtranscriptinKOmiceanda reducedtranscriptsignalintheHETmice(Figure1B). Similarly,immunoblotting confirmedabsenceofLRRK2 proteinbandintheKOmiceandadiminishedsignalin HETmice(Figure1C).Immunohistochemistryalso revealedspecificsignalintheWTcomparedtoKO (Figure1D). TodetermineifanycompensatorymRNAchangesoccurredintheparalog LRRK1 ,weusedquantitativeTaqman assaywithaprobetomurine LRRK1 tocompareWT,HET andKOmice.Nosignificantalterationsin LRRK1 mRNA levelswereobservedinanyofthebrainregionstested.We alsocheckedmRNAlevelsof SNCA MAPT or PARKIN andfoundnodifferences(Additionalfile1:FigureS1). LRRK2 KOmicewerefertileandappearedtobehealthy frombirth,withbodyweights comparabletoWTlittermateswithinthestudyperiod.HETxHETbreedings yieldedMendelianratiosinlinewithexpectedinheritance (fromover70litters24.4%WT,51.6%HET,24%KO). Subsequentcharacterization experimentswereperformed tocompareKOandWTmiceatdifferentagingtime points.Duetoanimalcostsandspacerestraints,we includedaHETgroupinsome,butnotall,ofthese analyses.DopaminergicsystemcharacterizationLRRK2 expressionisnormallyfoundinhighlevelsinthe striatumsowereasonedthatlossof LRRK2 mayimpact thefunctionalintegrityofthenigro-striataldopaminergicpathway.Todetermineifdopamineneuronsor theirprocesseswerealteredinthesubstantianigra,we performedstereologicalcountsoftyrosinehydroxylase (TH)positiveneuronsanddendritesinKOandWT miceaged18 – 20months.NodifferencesinneuronalestimateswereobservedbetweenKOmice(meanestimate SEM;13,766471)comparedtotheirWTlittermates (12,267481)(Figure2A).Similarly,therewerenodifferencesbetweendendriticestimatesforWT(149,763 6213)andKO(153,8734351)(Figure2B).Next,we examineddopamineaxonalne urochemistrybyanalyzing totaldopaminecontentinstriatallysatesbyHPLCfrom 10monthand18monthKOmiceandWTlittermates (Figure2C-G,datashownonlyfor18months)andfound dopamineanditsmetabolite3,4-dihydroxyphenylacetic acid(DOPAC),andhomovanillicacid(HVA)levelswere equivalentinKOandWTanimalsatbothtimepoints. Sincetotalstriataldopamineincludesdopaminethatis stored,synthesized,releasedandtakenup,wehypothesizedthatwemayobservedifferencesinKOmiceby investigatingthesemechanismsindependently.First,we performedmicrodialysistomeasureextracellularrelease ofdopamine invivo .Extracellulardopaminelevelswere measuredbeforeandafterKCl-evokeddopamineresponse inWT,HETandKOmiceaged3 – 4monthsofage (Figure2H).Baselinelevelsofdopaminewerenotfound todifferbetweenWT(0.130.06pg/ l),HET(0.15 0.06pg/ l)orKOmice(0.160.07pg/ l).WhenpostKCldopaminelevelswerenormalizedtotheaverageof theirindividualbasaldopaminelevels(i.e.%response)no significantdifferenceswereobserved(Figure2I).Next,we examineddopamineuptakeintheWT,HETandKOmice usingaradioactiveuptakeassaywith[3H]dopamine.Uptakewascomparableacrossthethreegroupssuggestinga functionallyintactdopaminetransporter(Additionalfile 2:FigureS2A).Concludingthatrelease,storageanduptakeofdopamineappeartobenormal,wethenexamined D2-autoreceptormediatedsynthesisandrelease,whichis oneofthefeedbackmechanismsinthestriatum.Itiswell knownthatantagonizingpre-synapticD2autoreceptors canremovethisfeedbackinhibitionandcauseincreased synthesisaswellasreleaseofdopamine[24].WT,HET andKOmiceweretreatedwiththeD2receptorantagonistraclopride,sacrificed30minlaterandHPLCanalysis performedtoquantifydopamineandmetabolites.As expected,dopamineturnover,asmeasuredbytheratioof dopaminemetabolitestostoresofdopamineincreased dramatically[OnewayANOVA ps < 0.0001forDOPAC/ dopamineandHVA/dopamine]followingtreatmentwith raclopride(Additionalfile2:FigureS2B,C).However, Tukey ’ sposthoccomparisonsdidnotrevealdifferencesin thisresponsebetweenWT,HETorKOmice,suggesting thatautoreceptor-mediatedfeedbackisnormalintheHinkle etal.MolecularNeurodegeneration 2012, 7 :25 Page2of17


absenceofLRRK2.Asign ificantincreaseinlevelsofserine40phosphorylatedTHafterraclopridetreatmentwasalso observed(indicatingincreasedsynthesis),butthisresponse wasnotdifferentbetweenWT,HETorKOmice(datanot shown).Finally,weexaminedstriatalreceptordensityfor bothdopamineD1andD2receptorsbyautoradiographyin 10and18montholdWTandKOmiceandnodifferences wereobserved(Additionalfile3:FigureS3A-D).AnalysisofstriataldendriticspinesWehavepreviouslyshownthatLRRK2G2019Stransgenicmicehaveimpairedneuriteoutgrowth invitro [25] and invivo [26]aswellasareducednumberofmature spinesinthehippocampus[26].Wehavealsoreported thatneuriteoutgrowthwasincreasedinbothmidbrain andhippocampalculturesderivedfrom LRRK2 KOmice [25].AsLRRK2haspreviouslybeenlinkedtoERMproteinsandtheactincytoskeleton[27-31]wehypothesized thatthelossofLRRK2inthestriatuminKOmice,an areawhereitisnormallyhighlyexpressed,mayimpact onstriataldendriticspines.Wecountedspinenumber inGolgi-Coxlabeledmediumspinyneurons(MSN)of brainsfromaged(18+months)KOandWTmice. Spineswereclassifiedintodifferentmorphologicaltypes [32].Nodifferenceswerefoundinspinenumbers betweeninKOandWTmicesuggestingthatlackof LRRK2hasnoeffectonMSNspinedynamics invivo (Additionalfile4:FigureS4).Proliferation/NeurogenesisstudiesAsLRRK2isnormallyexpressedinthehippocampaldentategyrusandproliferation,neurogenesisandmigration areimpairedinG2019SBACmice[26],wesoughttoascertainwhetherlossofexpressionhasanimpactoncell proliferation.WeanalyzedtheeffectoflossofLRRK2on newlygeneratedcellsinthehippocampaldentategyrus afterasingleinjectionofBrdU.Unbiasedstereological countingmethodswereappliedtoestimatethenumberof Figure1 Generationandexpressioncharacterizationof LRRK2 KOmice.(a) Schematicdiagram(courtesyofOzgenePLC)showingtargeted locus.Exon41wasflankedwithLoxPsitestoallowdeletionwithCrerecombinase.PKG-Neo-pA-SD-ISisOzgene ’ sstandardselectioncassetteand wasinserteddownstreamofexon41.ThePKG-neocassettewasalsoflankedbyFRTsitestoallowFLPerecombinasedeletion.Thetargeting vectorwasconstructedfromthreefragments,the5 ’ homologyarm,the3 ’ homologyarmandtheloxParm,whichweregeneratedbyPCR. Splicingofexon40to42causesaframeshiftmutation,withtheintroductionofanearlystopcodon(TGA). (b) Northernblothybridizedwitha probeto LRRK2 exon24 – 27showingabsenceoftranscriptinKOanddiminishedtranscriptinHET.A histone probewasusedasloadingcontrol. (c) ImmunoblotwithLRRK2antibody1182E,raisedtoaminoacids841 – 960showingtheabsenceofLRRK2proteininKOanddiminishedsignal inHET.GAPDHwasusedasaloadingcontrol. (d) ImmunohistochemistrywithMJFF2c41-2antibodyshowingWTandKObrainsectionsatthe levelofthestriatum.SpecificsignalisseenintheWTcomparedtoKO.RabbitIgGwasusedasanisotypecontrol.Boxesdepictenlargedimages totheright.Scalebar50microns. Hinkle etal.MolecularNeurodegeneration 2012, 7 :25 Page3of17


BrdU-labeledcells.Nodifferenceswereobservedin proliferationbetweenKOandWTmice(Additionalfile5: FigureS5A).Sincedoublecortin(DCX)expressionlevels inadultbrainreflectneurogenesis[33],wealsoperformed countsonDCXlabeledneuronsinthehippocampusand thesewerealsofoundtobecomparableinKOandWT mice(Additionalfile5:FigureS5B)suggestingnormal neurogenesisoccursinKOmice.NeuropathologyHameotoxylinandeosinrevealedmorphologyofKO mousebrainstobenormalupto20monthsofage.To assessmiceforneuropathologicalalterationsweexamined young(3 – 6months),middleaged(10 – 13months)and aged(18+months)WT,HETandKOmiceforavarietyof markersassociatedwithParkinson ’ sdiseasepathologyincludingalpha-synuclein,tauandIba-1.Inagreementwitha previousreport[34],noovertdifferenceswereobserved withanyofthesemarkersbetweenWT,HETandKOmice. Aswehavepreviouslyshownalterationsintauregulation inourBACmutantLRRK2G2019Smodel,weperformed quantitativeimmunoblottingwithtauantibodies(tau-5, CP-13andtau-1)inlysatesfromagedWTandKOmice. Ourresultsindicatethattau regulationisnormalinKO mice(Additionalfile6:FigureS6).BehavioralAnalysis Open-fieldTestIntheinitialcharacterization,wefocusedontheanalysisof spontaneousexploratorylocomotorbehaviorevaluatedin theopen-fieldtest.Theopen-fieldtestassessesspontaneous explorationofmiceaswellastheiremotionalresponse afterbeingexposedtomuchlargerthanahomecageand brightlyilluminatedunfamiliarenvironment[35-37].The rationalebehindthisapproachwasbasedonevidencethat anxietydisorders,whichaffectabout40%ofPDpatients Figure2 Dopaminergiccharacterizationin LRRK2 KOmice.(a,b) UnbiasedsterologicalestimatesforTH-positive (a) neuronsand (b) dendritesinthesubstantianigrarevealnodifferencebetweenWTand LRRK2 KOmice.Countingwasperformedusingopticalfractionatorprobes inTHstainedsectionsfrom18montholdWTandKOmice. (c-e) Dopamineaxonterminalneurochemistryisnormalin LRRK2 KOmice.HPLC analysisoftotalstriatalcontentofdopamine (da) anditsmetabolites3,4-dihydroxyphenylaceticacid(DOPAC)andhomovanillicacid(HVA). (f-g) MeanofindividualanimalturnoverratiosofDAtometabolitesDOPACandHVA. (h-i) Invivo microdialysisrevealssimilarbaselineandKCl-evoked levelsofextracellularDAinWT,HETandKOmice (i) .DAlevelswereplottedasapercentageofeachindividualanimal ’ smeanbaselinelevelsto compareresponseovertime (h) %ResponsedidnotdifferbetweenWT,HETandKOmice.DopaminelevelsweremeasuredbyHPLCfrom dialysatescollectedfromthestriatum.AlldataarepresentedasmeanSEM. Hinkle etal.MolecularNeurodegeneration 2012, 7 :25 Page4of17


[38,39]andotherpsychiatr icsymptomscanprecedethe onsetofmotorsymptoms,suchasbradykinesia,rigidity, restingtremorandposturalinstabilityinPDbydecades [39].Theopen-fieldtest,whi chcombinestheevaluationof anxietyaswellasspontaneouslo comotoractivity,therefore presentsanappropriatepar adigmforthephenotyping characterizationoftheKOmice.ThetesthasbeensuccessfullyusedwithotherfamilialParkinsondiseasemouse models,forexamplemicedeficientinparkingene[40]. WecharacterizedthebehaviorofKOandWTmicein theopen-fieldtest,adoptinglongitudinalexperimentaldesign,atayoung(7months)andolder(16months)time point.Theevaluationwasdoneinone5-minsessionat eachageinordertominimizethesavingeffectandhabituationtothetestduetorepeatedtesting.Datawasanalyzed byrepeatedmeasuresANOVAfollowedbyStudent ’ st-tests forindependentsamples(toassessthegenotypeeffectat eachtestingage)andmatched-pairssamples(toassessthe ageeffectwithineachgenotype). Overallanalysisoftheexplorationoftheopen-fieldarena byKOandWTmicerevealednodifferencesinthelength ofwalkingdistance,walkingspeedoronsetofexploration betweenthegenotypes.TheKOmicetendedtospend moretimeonlonger( > 5s)reststhanWTmiceduring theirexploration(p < 0.05,ANOVA,genotypeeffect),however,highvariabilityofthisbehaviordidnotyieldsignificantdifferencesat =0.05ateachageoftesting (Figure3A).Thenumberofrestsandshorter( < 5s)stops didnotdifferbetweenthegenotypes. Miceofbothgenotypesexploredthecenterofthearena lessat16monthsthanat7monthstest(15.9s1.6for16monthand25.0s3.5for7-monthmicerespectively,p < 0.001,ANOVA,ageeffect).However,KOmiceexplored thecenteroftheopen-fieldar enasignificantlylessthanthe WTmice(15.0%2.4and25.9%2.8oftimeaveraged acrossageforKOandWTmicerespectively,p < 0.01, ANOVA,genotypeeffect).Thedifferencewassignificantat bothat7(p < 0.05,t-test)and16(p < 0.01,t-test)months ofage(Figure3B). Thisshortertimeofexplorationoftheinnerarea ofthefieldbytheKOmicewaslikelyduetotheir increasedthigmotaxic(wallhugging)behavior(p < 0.001,ANOVA,genotypeeffect).TheKOmicespent between18%to87%and53%to91%oftheirexploratoryactivitymovingwithincloseproximityof thewallduring7-and16-monthtestsrespectively.In contrast,theWTcontrolsshowedthigmotaxicbehaviorwithinarangeof9%to48%and36%to66% duringrespectivetests.Representativeexamplesof theexploratorypaths,reflec tingthedifferencesinthe thigmotaxicbehavior,arepresentedinFigure4.Overall,thethigmotaxicbehaviorincreasedwithage(p < 0.001, ANOVAageeffect),withnosignificantinteractionbetween thegenotypeandagefactors.Thedifferencesin thigmotaxicbehaviorbetween thegenotypesweresignificantatboth7(p < 0.01,t-test)andat16(p < 0.001,t-test) monthsofage(Figure3C). Ouranalysisalsorevealedthatoverall,theexploratory pathsofKOmicewerelesscurvyandtortuousascomparedtothepathsoftheWTcounterparts(p < 0.001, ANOVA,genotypeeffect)andpathtortousitywaslower inmiceofbothgenotypesduringtestsat16months (p < 0.001,ANOVA,ageeffect).Thespecificcomparisonsrevealedasignificantgenotypeeffectonpath tortuosityonlyat16months(p < 0.001,t-test, Figure3D). Lastly,theKOmiceapproachedanobjectplacedinthe centerofthearenawithlongerlatenciesthanWTmice(p < 0.05,ANOVA,genotypeeffect).Ingeneral,KOmice tendedtospendlesstimeexploringtheobjectthanWT mice(averagedacrossage4.960.09and9.450.15secondsrespectively,p=0.06,ANOVA,genotypeeffect).Theborderlinesignificanceofthegenotypeeffectwasdueto highvariabilityinthisbehaviorat7-months(Figure3E).At 16months,however,theKOmiceexploredtheobjectsignificantlyless(p < 0.05,t-test,Figure3E).TheKOmicealso approachedtheobjectlessfrequently(p < 0.05,ANOVA, genotypeeffect),withsignificantdifferencesateachageof testing(p s < 0.05,t-testfor7and16months,Figure3F). Allmiceapproachedtheobjectlessfrequentlywhentested attheolderage(p < 0.05,ANOVA,ageeffect). Insummary,ourresultsindicatethattheKOmice showedabnormalspontaneousexploratorybehaviorin theopen-fieldtest,whichwascharacterizedbysignificantlyhigherthigmotaxicexplorationofthearena.This resultmightbeindicativeofincreasedanxietyintheKO mice.Thigmotaxicbehaviorhasbeenpreviously reportedasareliablemeasureofanxietyinthepre-clinicalstudiestestinganxiolyticdrugs[41].Inspiteofthe observeddifferences,weinterprettheseresultscautiously,sincemostoftheopen-fieldtestmeasuresare interdependent[37].Wefocusedouremphasisonthigmotaxicbehaviorsinceitislikelythattheinitialprevalentengagementinthisbehavioraffectsothermeasures, liketheexplorationofinnerarea(r2=0.49,andr2=0.72 for7and16monthsrespectively,p s =0.001),andpath tortuosity(r2=0.38 – 7months,andr2=0.45 – 16months,p s < 0.001).MotortestsNext,inaseparate7montholdcohort,weexamined motorbehaviorinKOmiceandcomparedthistoboth WTandHETlittermates.Motorco-ordination/balance wasexaminedbyrotarodperformanceandgaitwas examinedbydigigaitfootprintanalysis.Sincethe weightsofthemiceineachgenotypedidnotdiffersignificantly(p > 0.2,ANOVA),bodyweightwasnotused asacovariateintheanalysis[42].AnalysisofHinkle etal.MolecularNeurodegeneration 2012, 7 :25 Page5of17


performanceonanacceleratingrodrevealedsignificant differencesbetweenthegroups(p < 0.02,ANOVA).Subsequent,post-hocanalysisrevealedthatKOmiceperformedsignificantlybetterthantheirWTlittermates, spending~20%(p < 0.01,Tukey ’ stest)longerontherod (Figure5). Thegaitanalysiswasperformedatthreedifferent speeds(14,18and24cm/sec)andcomparedanumberofspatialandtemporalindicesbetweenWT,HET andKOmice.Overall,therewerenosignificantdifferencesbetweenthegenotypesforstridelengthsor anyotheroftherecordedindices(Table1)suggesting gaitandthusstriatalfunctionremainsintact.Inflammatoryanddegenerativealterationsinkidneyof LRRK2 KOmiceTwogroupshavepreviouslyidentifiedabnormalitiesinthe kidneysof LRRK2 KOmiceincludingmorphological changes,lysosomalandautoph agicalterations,vacuolizationandaccumulationofpigment[34,43].Weexamined kidneysfrommiceaged3to20monthsandalsoobserved coloration(darkening)changesbeginningasearlyas 3months(Figure6A).Significantenlargementwas observedinthekidneysfromtheoldestmice(mean SEM;forKOfemale0.230.01gandfemaleWT0.19 0.01g,p < 0.05t-test;maleKO0.350.02gandmaleWT 0.220.01g,p < 0.001t-test).Atthegrosslevel,kidneys Figure3 Open-fieldtestrevealsabnormalexploratorybehaviorin LRRK2 KOmiceatboth7and16monthsofage.(a) KOmicetended tospendlongertimeonreststopslongerthan5seconds. (b) KOmicespentsignificantlylesstimeexploringtheinnerareaoftheopen-fieldat bothtestingages. (c) KOmicedisplayedsignificantlygreaterthigmotaxic(wallhugging)behavioratbothtestingages. (d) KOmicetakeless turnsandtheirtravelpathislesscurvythanWTmice,thiswassignificantat16months. (e) AgedKOmicespendlesstimeexploringtheobject thantheirWTcounterparts. (f) KOmiceofbothagetimepointsapproachtheobjectlessfrequently.DatapresentedasmeanSEM.Datawas analyzedbyrepeatedmeasuresANOVA(seeresultssectionforfulldetails)followedbyStudent ’ st-testsforindependentsamples(toassessthe genotypeeffectateachtestingage)andmatched-pairssamples(toassesstheageeffectwithineachgenotype).Thep-valuesonthegraphs reflecttheindependentsamplet-testresults.**p < 0.01,***p < 0.001. Hinkle etal.MolecularNeurodegeneration 2012, 7 :25 Page6of17


fromHETmicedidnotdifferfromWTcounterparts (Figure6A)thereforewelimit edsubsequentanalysistoKO andWT.Hematoxylinandeosinstainingrevealedinflammatoryabnormalities,vacuolizationandpigmentationin KOkidneysasyoungas3months,whichwasprogressive withage(Figure6B).Weperformedhistologicalstaining foranumberofdifferentmarkersincludingp62(an ubiquitin-bindingproteininvolvedincellsignaling,oxidativestressandautophagy,foundtobeupregulatedinmany neurodegenerativediseases),P eriodicacid-Schiff(PAS)stain forglycoproteins,iron(Gomo ri'sPrussianblue)andmelanin(Fontana-Masson)stainingforpigmentandimmunohistochemistryforPDrelated proteinsalpha-synucleinand ubiquitin.TheKOkidneypigmentwasnegativeforiron andmelanin.PASstainingrevealedabnormalgranular stainingreminiscentoflipofus cinintheproxim altubulesof KOmiceasyoungas3monthsofage,progressingat 12monthsandbecomingsevereby18months(datanot shown).Thesegranularinclusionswerealsoautofluorescent,theintensityin creasingwithage(Figure6B). Increasedp62immunostaininginthesamecellsinKO micewasobservedasearlyas3monthsofage,although quantitativedifferenceswerenotdetectablebyimmunoblot atthisage(Figure7).Theintensityofp62immunostainingprogressedwithage,andby12monthsquantitativedifferenceswereevident.By18monthstheKOmicehadon averagea15-foldincrease(p < 0.01,t-test)inimmunoblot relativebanddensitycomparedtoWTcontrols(Figure7). Wewereunabletocorroboratethepreviousreportsof increasesinalpha-synucleinorubiquitin[34,44]in KOmiceneitherbyimmunohistochemistrynorby immunoblotting. Tofurtherexaminethegranularpathologyattheultrastructurallevel,weperformedelectronmicroscopyin kidneysfrom18monthsoldKOandWTmice(Figure6C). TubularepithelialcellsintherenalcortexofKOkidney werefoundtocontaindegeneratingdebrisandaccumulationofpigmentresemblinglipofuscin,bothabsentfrom Figure5 Alterationsinmotorco-ordinationbehaviorin LRRK2 KOmice. Motorco-ordinationandbalancewastestedby acceleratingrotarodanalysisina7-monthcohortofWT,HETandKO mice.Thespeedoftherodwassetto4-40rpmacceleration, increasing1rpmevery5seconds.KOmicesignificantly outperformedtheirWTlittermates.DataareplottedasmeanSEM andwereanalyzedbyANOVAwithTukey ’ spost-hoccomparisons.** p < 0.01. Figure4 LRRK2 KOmiceexhibitthigmotaxicbehaviorinthe open-fieldtest. Examplesofmovementtracesfromopen-fieldtrials showtherangeofthigmotaxicbehaviorfrom (a) 7monthsand (b) 16monthsoldWTandKOmice.Thisthigmotaxicbehaviorwas typicalof LRRK2 KOmice,althoughafewdisplayednormal explorationpatterns. Hinkle etal.MolecularNeurodegeneration 2012, 7 :25 Page7of17


WTkidney.Althoughthedebri swassignificant,somenormaltubularepithelialcellswerestillpresentandnoevidenceofabnormalmitochondriawasfound.Followingon fromconflictingreportsofimpaired/biphasicornochange autophagyin LRRK2 KOmice[34,43,44]weperformedimmunoblottingwithLC-3antibodyinkidneylysatesfrom miceaged3,12and18monthsold.Nosignificantdifferenceswereseenatthe3and12monthtime-point.HoweverinKOmiceaged18monthsweobservedasignificant 2.8foldincreaseinintensityoftheLC-3IIband(p < 0.05, t-test)indicatinganincrease,ratherthanthepreviously reporteddecrease.DiscussionInthisreportwepresentdopaminergic,behavioraland pathogeniccharacterizationofmicelackingLRRK2to 20monthsofage.Ourmostsignificantfindingsare observedatthebehaviorallevel,whichrevealnormal motorgaitbutalteredopenfieldandmotorco-ordinationbehaviorin LRRK2 KOmice.Intheopen-fieldtest KOmicedisplayedanincreasedthigmotaxicbehavior, walkingalongthewalloftheapparatus,whichresulted inreducedpathtortuousity.Thisphenotypingprofile wascharacteristicbothat7and16monthofage,with noindicationofprogressingdeteriorationinthisphenotype.Ithasbeenreportedthatthemeasuresobtainedin theopen-fieldtestarevariableandlabile[45],which couldaccountforthelackofsignificantinteractionsbetweenageandgenotypeinourstudy.Increasedthigmotaxicbehaviorisoftenattributedtoanincreasein anxietyduringtheexplorationofnewenvironment [35,41]orlackofflexibilityinchangingongoingbehavior[46].Followupstudiestoexamineprogressionof thesebehaviorsinKOmicewillrequirelargercohort sizesandwillfocusoncomplementarytotheopen-field testsevaluatinganxietyinmice,includingrescuewith anxiolyticagents.Interestingly,wehavepreviously reportedverysimilaropenfieldbehaviorsinourmutant G2019SBACmice[47]whichformulatestheideathis phenotypecouldbealossoffunctionbehavior.While currentthinkingfavorsagainoffunctionroleforaberrantLRRK2,thephenotypereportedin LRRK2 KOkidneys[34,43]hassomewhatchallengedthis,leadingto speculationofcell-specificLRRK2roles. Surprisingly,ourstudyrevealedthat LRRK2 KOmice stayedpersistentlylongerontherotatingrod,despiteno obviousdifferencesintheirgaitcharacteristics.Coincidentally,theMichaelJFoxfoundationrecentlypostedonline datadetailingphenotypictestingoftheir LRRK2 KO modelbeingcharacterizedatWilResearchandthisdata showedatrendforenhancedrotarodperformancein 4montholdKOmicecomparedwithWTcontrolshttp:// 20Animal%20Models%20Data%20-%20Oct%2031.pdf). Therotarodtestisknowntobesensitivetocerebellar functionanddeficitsincerebellarpurkinjeneuronsgenerallyresultinareducedrotarodperformance.Intheliteraturethereareonlyafewreportsofgeneticmousemodels exhibitingenhancedrotarodperformancecomparedwith theirwildtype/non-transgeniclittermates.ExamplesincludeamousemodelforDown ’ ssyndrome(Ts65DN) [48],heregulin(aligandfortyrosinereceptorkinase)mutantmice[49],anepilepsymodeldeficientinarepairproteinL-isoaspartate(d-aspartate)O -methyltransferase ( Pcmt1 / )[50]andHuntingtontripletdeletionmice Hdh ( Q/ Q)mice[51].BoththeTs65DNandheregulin modelhadknowncerebellarmorphologicalchanges [48,49].Morphologicalandpathologicalanalysisofthe Table1Normalgaitin LRRK2 KOmice.Mousegaitdynamicswereobtainedusingamotorizedtreadmillbyventral planevideographyandanalyzedwithDigiGaitsoftwareAveragegaitdynamicsinWT,HET&KOmice treadingataspeedof24cm/sec ParameterWT(n=9)HET(n=8)KO(n=8)p Stridelength(cm)6.420.576.380.716.090.50ns Stridefrequency(steps/sec)3.840.373.880.464.060.32ns Strideduration(sec)0.2670.0230.2650.0290.2540.020ns %Stanceduration58.5%3.3%59.5%5.5%59.1%4.4%ns %Swingduration41.5%6.2%40.5%6.0%41%3.9%ns Stepangle(deg)61.19.664.36.559.16.8ns Forepawangle(deg)9.631.6811.765.0412.514.13ns Hindpawangle(deg)18.973.1320.081.8118.432.42ns Totalsteps(No./paw)175184184ns Hindlimbsharedstance(sec)0.0470.0260.0500.0180.0360.013nsValuesaremeansStdDevandwereanalyzedbyone-wayANOVA; ns=p > 0.05. GateindiceswerenotdifferentbetweenWT,HETandKOmice.DataareplottedasmeanSDandwereanalyzedbyANOVA.Hinkle etal.MolecularNeurodegeneration 2012, 7 :25 Page8of17


cerebelluminour LRRK2 KOandHETmicedidnotrevealanyobviousstructuraldifferences,howevergiventhe highexpressionofLRRK2inthecerebellum,furtherstudiesexaminingcerebellarneurochemistry/functionmaybe warranted.Intheheregulinmutantand Pcmt1 Š / Š models, enhancedrodperformancewasalsoaccompaniedby hyperactivity[49,50]whichwedidnotobserve.However, likeour LRRK2 KOmice,the Pcmt1 Š / Š micealsodisplayedsignificantthigmotaxicbehaviorsinadditionto enhancedrotarodphenotype.Ourrotarodresulttogether withtheresultsobtainedintheopen-fieldtestmightindicateinabilityofterminationofongoingbehavior,which resultedinhigherceilingperformanceofKOmiceinthe rotarodtest. Itisalsoimportanttonotethatasidefromthecerebellum,enhancedrodperformancecouldalsobeattributedtocentral(i.e.heart)and/orperipheraleffects(i.e. muscle).SinceLRRK2isexpressedinbothheartand Figure6 LRRK2 KOmicedevelopdegenerationinthekidneyfromanearlyage.(a) ComparisonofperfusedkidneysextractedfromWT, HETandKOmiceat3,6,12and20monthsofage.Colorationchangeswereobservedasearlyas3monthsinKOmice.HETkidneyswerenot affected. (b) Histopathologyofkidneyrevealsmorphologicalchanges.H&Eat3monthsshowspigmentationinproximaltubule(arrow).H&Eat 18monthsshowsextensivevacuolization(whitearrow)andpigmentation(arrowhead).Positivep62stainingcanbeseenat3monthsinKOand isextensiveby18months.Pigmentationintubules,mostlikelytobelipofuscin,isautofluorescentinrhodaminechannelatboth3and 18monthsinKO.Scalebaris50microns. (c) ElectronmicroscopyinKOkidneyrevealsdegenerativechangesattheultrastructurallevelinrenal cortextubularepithelialcellsfrom18montholdKOmouse.(i)NormalepithelialcellinWTmouse.(N)nucleus.(ii)Degeneratingdebris (d) in tubularepithelialcellinKO.(iii)HigherpowerimagefromKOshowingnormalmitochondria(M),lipid(Lp)probablylipofuscinanddegenerative structure,probablylysosomal-containinglipid.(iv)HigherpowerimagefromKOofdegenerativestructureshowingextensivedebris. Hinkle etal.MolecularNeurodegeneration 2012, 7 :25 Page9of17


skeletalmuscle[17]acloserphysiologicalexamination ofheartandmusclemayalsoberevealing. LRRK2 KOmicehavenormallifespansanddonot haveanycompensatorychangesin LRRK1 orotherPD relatedmRNAs.Inagreementwithpreviousreports,and consistentwiththelackofstriatal-relatedmotorphenotypes,wedidnotobserveanychangesintotalstriatal dopaminelevelsnordidweobservenigralneuronalloss. Giventhatseveralmutant LRRK2 modelshavenormal totaldopaminelevels,butstillexhibitsubtledefectsin extracellularrelease,weextendedonthestudiesof others[34,43]andperformed invivo microdialysisin LRRK2 KO,HETandWTmice.EndogenousextracellularlevelsofdopaminewerefoundtobenormalinKO andHETmicecomparedwithWT,aswerepost-KCl stimulationlevels.Takentogether,ourdatasuggestthat thedopaminesystemisfunctionallyintactinLRRK2KO mice.Futurestudiestoexamineextracellularreleaseof Figure7 Quantitativedifferencesinp62levelsandLC3-II/LC3-Iratioinaged LRRK2 KOmice.(a) RepresentativeLC3andp62immunoblots ofinsolublefractionkidneylysatesfrom3-,12-and20-montholdWTandK Omice.Visiblymorep62isseeninboth12-and20-montholdmice.LC3-II levelsarealsovisiblyincreasedin20-montholdKOmice. (b) GraphicalpresentationofdensitometricquantificationofimmunoblotsfromN=5-7animals foreachgroup.Alzheimer(AD)brainlysatewasusedasacontrol.LC3dataar eexpressedasaratioofLC3-II/LC3-I.TheratioofLC3-II/LC3-Iwassigni ficantly increasedby20months,indicatinganincreasein autophagy.p62datawasexpressedas%intensity, normalizedtothelowestdensitometricbandon eachblot.AsignificantincreasewasobservedinKOmiceat12and20m onths.DataarepresentedasmeanSEMandwereanalyzedbyeither Student ’ st-testorMannWhitneynon-parametriccomparisons.**p < 0.01,***p < 0.001. Hinkle etal.MolecularNeurodegeneration 2012, 7 :25 Page10of17


otherneurotransmittersin LRRK2 KOmice,forexample serotonininthehippocampus/amygdalamaybemore informativegiventheabnormalbehaviorsintheopenfield. Curiously,unliketheG2019SBACmice, LRRK2 KO micedonotappeartohaveanydefectinneurogenesis, sinceproliferatingcellsandDCXcountsweresimilarto WTmice.Dentategyrusneurogenesisisthoughttobe involvedinregulationofemotion[52,53]andwepreviouslytheorizedthattheimpairedneurogenesisandanxietyphenotypemaybelinkedinG2019Smice[26]. However,inthisinstancetheunalteredneurogenesisin LRRK2 KOmicerulesoutthisidea. Neuropathologicalanalysisofbrainsfrom LRRK2 KO micedoesnotrevealanyPD-relatedpathologyorstriatal dendriticspinealterationsandtauregulationalso appearstobenormalinKOmice.Inagreementwith others[34,43]wedoobserveamarkedkidneyphenotype,whichinourmiceischaracterizedbydiscoloration, enlargement,inflammatoryanddegenerativechanges. Thephenotypeoccursin LRRK2 KO(butnotHET) frombothgendersandsomefeaturesareobservedas earlyas3 – 4monthsincludingdiscoloration,inflammation,increasedp62immunopositivecellsandpigmentation.Whatiscuriousisthatweobservetheopposing effectonautophagyreportedbyTongelal,inthatwe seeelevated,ratherthanadecreasedlevelsofLC3II,indicatingincreasedautophagyintheoldest(18 – 20months)mice,andnoindicationofabiphasicresponse.Herzigetalrecentlyreportedthattheysawno changesinLC3-IIintheirKOline[43],howeverthe datapresentedsuggeststheyonlyexaminedmiceupto 14monthsofageforthismarkerandweonlysawquantifiabledifferencesatthe18monthtimepoint.Ourdata pointstowardacompensatoryattempttocounteractthe degenerationandpigmentaccumulation.Althoughone wouldexpectall LRRK2 knockoutmodelstoexhibit similarphenotypes,itispossiblethatsubtledifferences instrainbackground,targetingandbreedingstrategies mayalterphenotypicprogression,andperhapsifwe wereabletoageourmicelongenough,wemaywellobserveadecreaseinautophagyandalpha-synucleinaccumulationinthekidneyasthedegenerativephenotype progresses.ConclusionsInsummary,wereportmicelacking LRRK2 viatargeted removalofthekinasedomainhaveanormaldopaminergicsystemanddonotdevelopanypathologicalfeaturesofPD.Ourdetailedbehavioralanalysishas revealedopen-fieldphenotypesinKOmice,warranting furtherstudyintotheroleofLRRK2andlimbicsystem behaviors/neurochemistry.Lossof LRRK2 hasapositive impactonrotarodperformance,implyingpossible involvementincerebellarfunctionandsensoryprocessing,althoughthemechanismsareunclearatthistime. Finally,weconfirmtheimpactoflossofLRRK2onthe kidney,whichreiteratestheimportantconsiderationof theroleofLRRK2outsidetheCNSwhendesigning therapeutics.MaterialsandMethodsAnimalsAllanimalprocedureswereapprovedbytheMayo ClinicInstitutionalAnimalCareandUseCommittee andwereinaccordancewiththeNationalInstituteof HealthGuidefortheCareandUseofLaboratoryAnimals(NIHPublicationsNo.80 – 23)revised1996.GenerationoftargetedLRRK2knockoutmiceLRRK2 knockout(KO)mice,generatedatOzgenePLC (Australia)werecreatedutilizingaconstructdesignedto ablate LRRK2 exon41.Regionsof5 ’ homology(4kb) and3 ’ homology(4.7kb)wereusedtodrivethehomologousrecombinationeventbystandardgenetargeting techniquesinC57BL/6Bruce4embryonicstem(ES) cells[54].Followingelectroporationofthetargeting construct,cellswereselectedforneomycin(Neo)resistance.TargetedEScellswereconfirmedbySouthern blottingandPCR.Euploid,targetedEScellswerethen microinjectedintoBalb/cJblastocystsandreimplanted intopseudopregnantdams.Resultantchimeraswere bredtoC57BL/6Jbreederstoestablishtransmission. Black(i.e.thosewiththeEScellgermline)progenythat wereheterozygousforthegene-targetedallelewerethen bredtoCrerecombinase “ deleter ” miceonC57BL/6J background(Ozgene)toallowexcisionoftheexon41 andNeoselectioncassette,whichwereflankedbyloxP sites.CrewasthenremovedbybreedingtoC57BL/6J wildtypemice.Resultantmicewerethentransferredto ourcolonyandbredtohomozygosity,maintainedonthe C57BL/6Jbackground.Singlenucleotidepolymorphism analysiswith124evenlyspacedmarkerscoveringthe mousegenomeindicatedthatthestrainwascongenic onC57BL/6withnoevidenceofanycontaminatinginbredstrain. RoutinegenotypingwasperformedbyaPCR-based strategyutilizingintronicprimersthatspanexon41 (forward5 ’ CTACCAGGCTTGATGCTTTA ’ 3,reverse 5 ’ TCTGTGACAGGCTATATCTC ’ 3)thatyieldeda 471bpbandinwildtype(WT),~220bpbandinKO andbothbandsinheterozygotes(HETS).NorthernBlottingTotalRNAwasextractedusingTrizolreagent(Invitrogen)accordingtomanufacturer ’ sinstructions.Twomice fromeachgenotype(WT,KO,HET)wereusedforanalysis.TotalRNA(12 g)waspreparedin1XMOPS,Hinkle etal.MolecularNeurodegeneration 2012, 7 :25 Page11of17


6.5%(v/v)formaldehydeand50%(v/v)de-ionisedformamide,denaturedat65C.Sampleswereelectrophoresedonadenaturinggel(1%(w/v)agarose0.7%,(v/v) formaldehyde,1XMOPS,0.005%(v/v)ethidiumbromide)forapproximately3 – 4hoursat100Volts.0.510kbRNAladder(Invitrogen)wasusedforsize comparison.TheRNAwasthencapillarytransferredovernightontoHybond-N+nylonmembrane(Invitrogen)and UVcross-linked.Membraneswereprobedwitha539 bpcDNAprobedesignedtoexons24 – 27ofmouse LRRK2 (generatedbyPCRusingprimersforward5 ’ ATGCCAC GTATCACCAAC ’ 3,reverse5 ’ TCTAAGGTGCTGATC TGATTC ’ 3).Probeswerelabeledwith[ -32P]dCTP (3000Ci/mmole)(PerkinElmer)usingReadytoGolabelingbeads(Invitrogen).Cross -linkedmembraneswerepreincubatedat42Cinhybridizationbuffer(1XDenhardt ’ s solution,4XSSC,50%(w/v)deionisedformamide,10% (w/v)dextransulphate,200mg/ lherringspermDNA)for atleast30minutesandthenhybridizedwithlabeledprobe overnightat42C.Membraneswerewashedwith1XSSC for20minutesatroomtemperaturetoremoveexcessprobe andthen1 – 2timesin1XSSCcontaining0.1%SDSat55C for15minutes.Tovisualizebands,membraneswereexposed toBioMaxfilm(Kodak)at Š 80Cfor5 – 48hours.A214bp histone cDNAprobewasusedasloadingcontrol(generated usingprimersforward5 ’ GCGTGCTAGCTGGATGTCTT ‘ 3andreverse5 ’ CCACTGAACTTCTGATTCGC ‘ 3).AntibodiesAntibody1182E,raisedtoaminoacids841 – 960of LRRK2(1:200)wasagiftfromDr.BenoitGiasson(Univ. Pennsylvania)wasusedforimmunoblotting.LRRK2 immunohistochemistrywasperformedwithMJFF2at 1:4000(Epitomics,c41-2)raisedtoaminoacids970 – 2527.Tyrosinehydroxylase(TH)(AffinityBioreagents) wasusedtovisualizedopamineneuronsbyimmunohistochemistry(1:200)andonimmunoblots(1:1000).Phospho-TH(Ser40)antibodywasusedforimmunoblotting only(1:1000,CellSignalling).Detectionof -synuclein waswithamousemonoclonalto -synuclein(clone42, 1:3500forimmunohistochemistryand1:500forimmunoblots)fromBDTransductionLabsandthephosphoSer129antibody(1:1000)wasagiftfromDr.Takeshi Iwatsubo,UniversityofTokyo.Activatedmicrogliawere detectedbyIba-1(1:2000,WakoChemicals).TauantibodieswereCP-13(1:1000immunohistochemistry, 1:200immunoblots),Tau-5(1:500immunoblots)and PHF-1(1:500immunoblots)allgiftsfromDr.Peter Davies,AlbertEinsteinCollegeofMedicine,12E8 (1:10,000immunohistochemistry)agiftfromDr.Peter Seubert,ElanPharmaceuticalsandTau-1(1:500immunoblots)fromMillipore.Forautophagystudiesweused LC3(1:500immunoblots)fromNovusandp62(1:500 forimmunoblotsand1:2000forimmunohistochemistry) fromProgen.Neurogenesisstudiesutilizedrat -5bromo-2-deoxyuridine(BrdU)1:500(OxfordBiotechnology)andgoat -doublecortin(DCX)1:500,(Santa CruzBiotechnology).ImmunoblottingAnalysisofLRRK2andtauproteinwasperformedas previouslydescribed[47].THandpTHimmunoblotting lysateswerepreparedinRIPAbufferwithTritonX-100 containingproteaseinhibitors.10 g(forTH)or50 g (pTH)ofproteinwasloadedonto4-12%Bis-Trisgels (Invitrogen).Forautophagystudiessampleswerepreparedaspreviouslydescribed[34],60 gofproteinwas loadedon4-20%Tris-glycinegelsforLC3and10% Tris-glycinegelsforp62.ImageJ1.42q(National InstitutesofHealth)wasusedtoquantifyblots. Densitometricvalueswereanalyzedstatisticallybyeither Student ’ st-testorMannWhitneynon-parametric comparisons.StereologyBrainsfrom18 – 20montholdKO(n=4)andlittermate WTmice(n=4)werepost-fixedin4%paraformaldehyde(PFA)for24hoursfollowedby30%sucrosecryoprotectionfor48hours.Brainsweresectioned exhaustivelyat50 mthicknessusingafreezingsledge microtome.Fordopamineneuronanddendriticestimates,afterarandomstart,everythirdsectionwas stainedfreefloatingwithTHantibody.Freefloating immunostainingwasperformedutilizingtheVECTASTAINABCSystem(Vectorlaboratories).Sectionswere mountedontoglassslides,allowedtodryovernight, lightlycounterstainedwithcresyl-violetandthendehydratedandcoverslipped.Quantificationwasperformed athighmagnification(400X)usingtheopticalfractionatornumberandlengthprobesinStereoInvestigator software(MicroBrightField).Datawasplottedasmean SEMandstatisticallyanalyzedbyStudent ’ st-test.Highperformanceliquidchromatography(HPLC)HPLCwithelectrochemicaldetectionwasperformedas previouslydescribed[47]instriataltissuepunchesfrom frozenbrainsfrommiceaged10monthsKO(n=14;6 males,8females)andWT(n=13;7males,6females) and16 – 18monthsKO(n=7;4males,3females)and WTcontrols(n=8;4males,4females).Theamountsof monoamines/metabolitesinthetissuesampleswere determinedbycomparingpeakareavalueswiththose obtainedfromexternalstandardsrunonthesameday. Neurochemicalconcentrationsweredeterminedbynormalizingsamplestoproteinconcentrationsobtained fromthepellets(BCAmethod).Datawasplotted(mean SEM)andstatisticallyanalyzedusingMannWhitney non-parametriccomparisons.Hinkle etal.MolecularNeurodegeneration 2012, 7 :25 Page12of17


MicrodialysisKO(n=10males),HET(n=6males)andWTlittermates(n=13males)aged3 – 4monthswereanesthetized with1-2%isoflurane.Guidecannulae(CMAMicrodialysis)weresurgicallyimplantedintothestriatumusinga standardstereotaxicframe(KopfInstruments,Tujunga, CA)utilizingcoordinates(fromBregmaanterior-posterior+0.1cm,lateral-medial+0.2cm,dorso-ventral Š 0.2cm)accordingtotheMouseBrainAtlas[55].Mice wereallowedtorecoverforatleast24hours.Microdialysisexperimentswerecarriedoutonconscious,freely movingmicewithsurgicallyimplantedguidecannulae. Onthedayoftheexperiment,thestyletintheguide cannulawasreplacedwiththemicrodialysisprobe (CMA/7with2mmmembrane,CMAMicrodialysis). Theprobewasperfusedat2 l/minwithartificialcerebrospinalfluid(aCSF;145mMNaCl,1.2mMCaCl2, 3mMKCl,1.0mMMgCl2)foratwohourequilibration periodbeforecollection.Dialysatesampleswereautomaticallycollectedevery15minutesintovialscontaining2 lperchloricacid(0.1%)toretardoxidationof monoamines.Fourbaselinecollectionsweretakenat15 minuteintervals,andthentheperfusatewasswitchedto highKClaCSF(103mMNaCl,1.2mMCaCl2,45mM KCl,1.0mMMgCl2).After30minutestheperfusate wasswitchedbacktotheoriginalaCSFandfoursubsequentsampleswerecollectedevery15minutes.Samples wereanalyzedbyHPLCfordopaminecontent.Datawas plotted(meanSEM)andstatisticallyanalyzedusing MannWhitneynon-parametriccomparisons.PathologicalanalysisAtleastsixmicefromeachgenotype(KO,HET,WT) wereanalyzedpertimepoint(3,6,12,18months).Formalinfixed,paraffinembeddedtissuesectionswere dewaxedinxyleneandrehydratedindescendingalcoholsandwater.Forantigenretrievalinparaffinsections, tissuewaspressurecooked(10minutes)indistilled water(allantibodies,except -synuclein).Appropriate disease/tissuepositivecontrolswereincludedforeach antibody(diffuseLewybodydiseasefor -synuclein, Alzheimerfortauantibodies,Alzheimer/vasculardementiaforIba-1).Immunohistochemistrywasperformed usingtheDakoAutostainer.Tissuewasquenchedfor endogenousperoxidasesin0.03%H2O2andblockedin DakoAll-purposeblockingsolutionfor30minutes. Primaryantibodywasincubatedfor45minatroom temperature.Allsecondaryantibodieswerefromthe Envision+SystemLabeledPolymerHRP(Dako),followedwithDABsubstrate(Dako),withtheexceptionof p62immunostainingwhichutilizedananti-guineapig secondaryandDABkit(bothVectorLabs).Sections werelightlycounterstainedinGills3hematoxylin. Standardhistologicalstaini ngwasalsoused(haemotoxylin andeosin,Gomori'sPrussianbl ue,Periodicacid-Schiffand MassonFontana).Transmissionelectronmicroscopy18montholdKOandWTmice,wereperfusedtranscardiallywith2.5%gutaraldehyde-2%PFAin0.1Mcacodylatebuffer.Kidneyswereremoved,splitinhalvesand immersedinthesamefixativefortwohoursatroom temperature.Smallpiecesofthecortexwerefurther fixedinaqueous2%OsO4and2%uranylacetate,dehydratedinethanolsandpropyleneoxide,infiltratedand embeddedinEpon812(Polysciences).Ultrathinsections werestainedwithuranylacetateandleadcitrate,and examinedwithaPhilips208Selectronmicroscope(FEI) fittedwithaGatan831OriusCCDcamera(Gatan). DigitalimageswereprocessedwithAdobePhotoshop CS2software.Behavioralstudies Open-field(OF)testTwentyeightlittermatemice(N=8KOmalesKO;8 KOfemales,andN=6WTmales;6WTfemales) wereusedfortheevaluationoftheexploratoryactivityintheopen-fieldtest.Open-fieldbehaviorofthe micewasevaluatedinalongitudinalexperiment,with thefirsttestappliedattheageof7monthsandthe secondattheageof16months.Micewerehabituatedtothebehavioralroomforoneweekbeforetesting.TheOFapparatusconsistedofacirculararena, 120cmindiameter,surroundedbya30cmhigh wall.Theapparatus,buildofwhiteplastic,waselevated86cmoffthefloorlevel.Thearenawasilluminatedby4setsofinceilingfluorescentlights availableinatestingroomandnoadditionalilluminationwasused.Anobject(aplasticwaterbottle, 10cmindiameter,25cmhigh)paintedwithblack andwhitehorizontalstripeswasplacedinthecentre ofthearena.Allmicewereindividuallyexposedto thearenainone5-minsession.Attheonsetofthe session,amousewasplacednearthewallofthe arenaanditsmovementonthearenathroughoutthe durationofthesessionwasrecordedbyavideo trackingsystem(HVSImageAdvancedTracker VP200,HVSImage,Buckingham,UK).Thedatawere extractedoff-lineusingaWintrackprogram[56]. XInouranalysiswefocusedonmeasuresofmotoractivityinthearenaandtheexplorationofanovelobject. Thefollowingbehavioralcategorieswereusedtoevaluatetheexploratorymotoractivityofmiceintheopenfield: walkingpathlength (m) – thedistanceamouse coveredduringtheexplorationofthearena, walking speed (m/s) – averagedspeedofactivewalking,excludingperiodofrests, latencytomove – theonset(s)ofactivelocomotorexplorationafterplacingamouseintheHinkle etal.MolecularNeurodegeneration 2012, 7 :25 Page13of17


arena, numberofstops – astopwasdefinedasaperiod ofinactivitylastingbetween1and5swhichwasseparatedbyatleast1soflocomotion, numberofrests – a restwasdefinedasaperiodofinactivitylastinglonger than5swhichwasseparatedbyatleast1soflocomotion, timespentresting – totaltime(s)spentbymiceon resting, %timeinthecentralzone – thepercentoftime spendinthecentralzoneofthearena(50cmradius fromthecentre), thigmotaxis – percentoftimeamouse continuouslywalkedwithintheclosevicinity(7.5cm)of thewalloftheapparatus, pathtortuosity (/m) – the measurewasderivedbydividingthepathintostraight segmentsandcurveswithconsistentchangeindirection. Following,absolutechangesindirectionofallcurves weresummedanddividedbytotalpathlength.The novelobjectexplorationwasevaluatedbythe latency(s)of thefirstapproach totheobject,the totaltimeofobjectexploration – amousewasconsideredexploringanobjectif itsnosewaswithinadirectcontactor1cmfromanobjectandthebodyofamousewaswithinadistanceof 5cmfromtheobjectperimeter,andbythe numberof crossesofanobjectzone – a5cmvirtualzonesurrounding anobject. Afactorialmodelanalysisofvariance(ANOVA)withthe genotypeasbetweensubject,andageoftesting(7and 16months)aswithinsubject(repeatedmeasure)factors wasusedintheanalysisofopen-fielddata.WhileperformingallrepeatedmeasuresANOVAs,departuresfromthe assumptionofcompoundsphericitywereevaluatedby Mauchlytest[SPSSstatisticalpackage(SPSSInc.Chicago) v.19runonaMacintoshcomputer]with levelsetto 0.05.Incaseswhensphericityw assignificantlyviolated, degreesoffreedomwereadjustedbyGreenhouse-Geisser -correction.Duetoconsiderablevariabilityofthemeasuresobtainedintheopen-field[45]andrelativelysmall samplesizeofmice,theinteractioneffectinour22factorialdesignoftendidnotreachsignificanceat =0.05. Consequently,wefollowedtheoverallANOVA s bythe a priori identifiedanalysisfocusedongenotypeeffectateach testingage,utilizingStudent ’ st-testsforindependentand matched-pairssamples.Correlationsbetweenthevariables obtainedintheopen-fieldtestweredoneusingPearson product – momentcorrelation.Thecritical levelforall analyseswassetto0.05.Duetospacelimitation,onlysignificantresultspertainingto thehypothesestestingtheeffectofthegenotypeandagearereported.RotarodMotorco-ordinationwasmeasuredusinganautomated rotarodsystem(Rotamex-5Columbusinstruments).Followinga3dayhabituationperiodinthebehavioralsuite, littermatemice(7monthsKOn=9;HETn=8andWTn =12)weretrainedfortwodayspriortotesting.Thespindle dimensionswere3.0cmx9.5cmandthespeedoftherod wassetto4-40rpmacceleration,increasing1rpmevery5 seconds.Theequipmentwasequippedwithasensorthat automaticallystopsthetimerifthemiceclingandroll aroundontherod.Onthethirdday,miceweretestedfor4 consecutivetrials,allowing 10minutesrestpertrail.Data fromthetestingdaywasplottedasmeantrailtimeand datawasstatisticallyanalyzedusingonewayANOVAfollowedbyTukey ’ smultiplecomparisons.GaitdynamicsMice(KOn=8;HETn=8andWTn=9)wereselected fromthesamegroupofanimalsdescribedabovefor rotarodtesting.Mousegaitdynamicswereobtainedusinga motorizedtreadmill(withatransparentbeltanddigital videocameramountedunderneath)byventralplanevideography[57-59]andanalyzedw ithDigiGaitVersion9software(MouseSpecifics,Inc).Eachmousewasindividually placedinthetreadmillcompartmentforafewsecondsand thenthebeltwasturnedonatalowspeed(4cm/sec)just priortotesting[previousstudiesshowthatC57BL/6Jmice donotrequireextendedacclimatizationtothetreadmill [57-59]].Themotorspeedwasthensetto14cm/sandat least4secondsofvideographywascollectedforeach mousetoobtainatleast8sequentialstepimages.The speedwasthenincreasedto18cm/s,andthen24cm/sec, collectinganaverage4secondsofvideographytoobtainat least12or15sequentialstepimages,respectively.Mice thatdidnothavestrideregula rityindices(alternatestep sequences)at100%[58,60]werestillincludedinthestudy toevaluateinter-limbcoordination. Eachindividualgaitsignalperlimbconsistsofastance duration(timeincontactwithsurface)andswingduration (timenotincontactwithsurface)whichtogetherarethe strideduration.Stridefrequencyiscalculatedbymeasuring thenumberofstridesovertime.Stridelengthiscalculated bydividingthebeltspeedoverthestridefrequency.Paw anglesandstepanglesatfullstancearedeterminedbysoftwaregeometrycalculations(fittingellipsestothepaws)of ellipsecenters,majoraxesandvertices.Theleftandright gaitmeasurementswerecombinedforallforelimband hindlimbdataanalysis.Gaitindiceswereplottedasmean standarddeviationandanalyzedbyonewayANOVA. SupplementalmethodologyisalsoavailableinAdditional file7.AdditionalfilesAdditionalfile1: FigureS1. Nocompensatorychangesareobservedin theexpressionlevelsofmurine LRRK1, SNCA( MAPTorPARKIN genesin LRRK2 KOmice.Real-timePCRwasperformedwithABITaqManprobes tomurine(A) LRRK1 (Mm00713303_m1),(B)murine SNCA (Mm00447333_m1),(C) MAPT (Mm00521988_m1)and(D) PARKIN (Mm00450187_m1).Mouse GAPDH (Mm99999915_m1)asthe endogenousreferencegene.DataplottedasmeanSEM.Ineach graph/regionthefirstcolumnisWT,secondcolumnHETandthird columnisKO.Hinkle etal.MolecularNeurodegeneration 2012, 7 :25 Page14of17


Additionalfile2: FigureS2. DopamineuptakeandD2autoreceptor functionisnormalinLRRK2KOmice.(A)Dopamineuptakewas measuredinfreshlypreparedsynaptosomesusing[2,5,6,7,8-3H]-DA.Each experimentincludedN=3micepergenotype(8monthsofage)and threeindependentexperimentswereperformed.SpecificDAuptake values(pmol/mg/min)wereaveragedandexpressedas%ofWTcontrol. DataplottedasmeanSEM.(B,C)ToexamineD2autoreceptor function,miceweretreatedwithD2receptorantagonistracloprideand sacrificed30minuteslater.Dopamineanddopaminemetabolitelevels weremeasuredbyHPLC.Dopamineturnover,definedbytheratioof(B) DOPAC/DAor(C)HVA/DAsignificantlyincreased,asexpected,inallthree groups(p < 0.001ANOVAforbothratios)howeverpost-hoc comparisonsrevealedtheextentofthisturnoverincreasedidnotdiffer betweenWT,HETandKOgroups.DataplottedasmeanSEM. Additionalfile3: Figure3. PostsynapticD1andD2receptordensityis comparablein LRRK2 KOandWTmice.Quantitativeautoradiographywas performedwithD1receptorligand[3H]SCH23390andD2receptor ligand[3H]methylspiperoneinserialstriatalsectionsinmiceaged10 months(A,B)and18month(C,D).D1andD2bindingwasequivalentin KOandWTmiceatbothagepoints.DataplottedasmeanSEM. Additionalfile4: Figure4. Lossof LRRK2 doesnotimpactonstriatal dendriticspinedensity.Dendriticspineswerevisualizedin18monthold WTandKOmicebyGolgi-Coximpregnantionandcountedusing Metamorphsoftware.(A)Representativelowermagnificationimageofa typicalMSNselectedforquantification-onlydendritesclearlyassociated withanMSN-likecellbodywerequantified(B)Highmagnificationofa dendritescapturedbyZ-stackshowsthatKOandWTspinesappearto becomparable(C)Quantificationofspines,classifiedbymorphological type,revealednodifferencebetweenWTandKOdendrites.Dataplotted asmeanSEM. Additionalfile5: Figure5. Subgranularzoneproliferationand neurogenesisareunaffectedin LRRK2 KOmice.(A)Proliferationwas measuredbycountingBrdUpositivecellsinsectionspreparedfrommice aged4months(N=4pergroup)sacrificed24hoursafterIPBrdU injection(100mg/kg)(B)Neurogenesiswasquantifiedinthesame sectionsbycountingdoublecortin(DCX)positiveneurons.Dataplotted asmeanSEM. Additionalfile6: Figure6. Tauregulationin LRRK2 KOmicedoesnot differfromWT.Corticalandhippocampallysateswerepreparedfrom18 montholdWTandKOmiceandimmunoblotsprobedwithtau antibodies.GraphshowsrepresentativeblotsforTau-5tau,CP-13 (pSer202)andTau-1inalkalinephosphatase(dephosphorylated)treated lysates.DensitometricquantificationofN=6micepergroup(notshown) didnotrevealanysignificantdifferencesineitherregionforKOversus WTmice. Additionalfile7: SupplementalMethodology[26,47,61-63]. Abbreviations LRRK2/ LRRK2:leucinerichrepeatkinase2;PD:Parkinson ’ sdisease;WT:Wild type;HET:Heterozygous;KO:Knockout;BAC:Bacterialartificialchromosome; PCR:Polymerasechainreaction;TH:Tyrosinehydroxylase;DCX:Doublecortin; HPLC:Highperformanceliquidchromatography;DA:Dopamine;DOPAC:3,4dihydroxyphenylaceticacid;HVA:Homovanillicacid;MSN:Mediumspiny neurons. Competinginterests HLM,SJLandMJFhavereceivedroyaltiesfromcommerciallicensingof LRRK2 KOmice.Allotherauthorsdeclaretheyhavenocompetinginterests. Authors ’ contributions KMHandMYperformedthebulkofthehusbandryandtechnical(molecular characterization,behavior,microdialysissurgeriesandcollections,HPLC,DA uptake,receptorbinding,immunoblottingetc)workandcontributedto manuscriptwriting.HLMperformedmicrodialysisanddialysateHPLC.BBand JEBperformedtissueHPLCanddendritestereology.JCDperformed immunoblotting.BBandJCDprovidedintellectualinputtoexperimentsand manuscript.SJLcontributedintellectuallytotargetingdesignandmolecular characterization.EEBperformedHPLCandGolgiimpregnationandanalysis. CBKperformedimmunohistochemistry.KNperformedtaqmanstudies.IP andBWperformedneurogenesisstudies.CJperformedandanalyzedopenfieldbehaviorandcontributedtomanuscriptwriting.WLLandDWD performedEMandpathologicalinterpretation.HLMandMJFconceivedthe study.HLMdesignedexperiments,interpreteddataandwrotethe manuscript.Allauthorsreadandapprovedthefinalmanuscript. Acknowledgements WewouldliketothankPeterAsh,JohnFryer,JohnHoward,Monica Castanedes-Casey,LindaRousseauandVirginiaPhilipsfortechnical assistance.FundingsupportwasprovidedbytheMayoClinic,NIHGrants NINDSNS065860(HLM),NINDSNS40256andNS072187(DWD,MJF), LundbeckA/S(MJF,HLM,JCD),theMichaelJFoxFoundation(MJF,JCD, HLM)andInterdisziplinresZentrumfrKlinischeForschung(BW). Authordetails1DepartmentofNeuroscience,MayoClinic,Jacksonville,Florida32224,USA.2JuniorGroupIII,InterdisciplinaryCenterforClinicalResearch,NikolausFiebigerCenterforMolecularMedicine,FAU,Erlangen-Nrnberg,Germany.3DepartmentofNeuroscience,CenterforTranslationalResearchin NeurodegenerativeDisease,UniversityofFlorida,Gainesville,Florida32610, USA.4DepartmentofMedicalGenetics,UniversityofBritishColumbia, VancouverV6T285,Canada. Received:06February2012Accepted:27April2012 Published:30May2012 References1.ZimprichA, etal : MutationsinLRRK2causeautosomal-dominant parkinsonismwithpleomorphicpathology. Neuron 2004, 44: 601 – 607. 2.Paisan-RuizC,EvansEW,JainS,XiromerisiouG,GibbsJR,EerolaJ,Gourbali V,HellstromO,DuckworthJ,PapadimitriouA,TienariPJ,HadjigeorgiouGM, SingletonAB: TestingassociationbetweenLRRK2andParkinson'sdisease andinvestigatinglinkagedisequilibrium. JMedGenet 2006, 43: e9. 3.KachergusJ,MataIF,HulihanM,TaylorJP,LincolnS,AaslyJ,GibsonJM, RossOA,LynchT,WileyJ,PayamiH,NuttJ,MaraganoreDM,CzyzewskiK, StyczynskaM,WszolekZK,FarrerMJ,ToftM: Identificationofanovel LRRK2mutationlinkedtoautosomaldominantparkinsonism:evidence ofacommonfounderacrossEuropeanpopulations. AmJHumGenet 2005, 76: 672 – 680. 4.OzeliusLJ,SenthilG,Saunders-PullmanR,OhmannE,DeligtischA,Tagliati M,HuntAL,KleinC,HenickB,HailpernSM,LiptonRB,Soto-ValenciaJ,Risch N,BressmanSB: LRRK2G2019SasacauseofParkinson'sdiseasein AshkenaziJews. NEnglJMed 2006, 354: 424 – 425. 5.IshiharaL, etal : ScreeningforLrrk2G2019Sandclinicalcomparisonof TunisianandNorthAmericanCaucasianParkinson'sdiseasefamilies. MovDisord 2007, 22: 55 – 61. 6.DiFonzoA,Wu-ChouYH,LuCS,vanDoeselaarM,SimonsEJ,RoheCF, ChangHC,ChenRS,WengYH,VanacoreN,BreedveldGJ,OostraBA, BonifatiV: AcommonmissensevariantintheLRRK2gene,Gly2385Arg, associatedwithParkinson'sdiseaseriskinTaiwan. Neurogenetics 2006, 7: 133 – 138. 7.TanEK: Identificationofacommongeneticriskvariant(LRRK2 Gly2385Arg)inParkinson'sdisease. AnnAcadMedSingapore 2006, 35: 840 – 842. 8.FarrerMJ,StoneJT,LinCH,DachselJC,HulihanMM,HaugarvollK,RossOA, WuRM: Lrrk2G2385RisanancestralriskfactorforParkinson'sdiseasein Asia. Parkinsonism&relateddisorders 2007, 13: 89 – 92. 9.RossOA,WuYR,LeeMC,FunayamaM,ChenML,SotoAI,MataIF,Lee-Chen GJ,ChenCM,TangM,ZhaoY,HattoriN,FarrerMJ,TanEK,WuRM: Analysis ofLrrk2R1628PasariskfactorforParkinson'sdisease. AnnNeurol 2008, 64: 88 – 92. 10.DanielsV,BaekelandtV,TaymansJM: Ontheroadtoleucine-richrepeat kinase2signalling:evidencefromcellularandinvivostudies. Neurosignals 2011, 19: 1 – 15. 11.YueZ,LachenmayerML:GeneticLRRK2modelsofParkinson'sdisease: Dissectingthepathogenicpathwayandexploringclinicalapplications. MovDisord 2011, 26: 1386 – 1397. 12.NandhagopalR,MakE,SchulzerM,McKenzieJ,McCormickS,SossiV,Ruth TJ,StrongoskyA,FarrerMJ,WszolekZK,StoesslAJ: Progressionof dopaminergicdysfunctioninaLRRK2kindred:amultitracerPETstudy. Neurology 2008, 71: 1790 – 1795.Hinkle etal.MolecularNeurodegeneration 2012, 7 :25 Page15of17


13.SossiV,delaFuente-FernandezR,NandhagopalR,SchulzerM,McKenzieJ, RuthTJ,AaslyJO,FarrerMJ,WszolekZK,StoesslJA: Dopamineturnover increasesinasymptomaticLRRK2mutationscarriers. MovDisord 2010, 25: 2717 – 2723. 14.BostantjopoulouS,KatsarouZ,GerasimouG,CostaDC,Gotzamani-Psarrakou A: (123)I-FP-CITSPETstriataluptakeinparkinsonianpatientswiththe alpha-synuclein(G209A)mutationA. HellJNuclMed 2008, 11: 157 – 159. 15.PeraniD,GaribottoV,HadjigeorgiouGM,PapadimitriouD,FazioF, PapadimitriouA: PositronemissiontomographychangesinPARK1 mutation. MovDisord 2006, 21: 127 – 130. 16.SamiiA,MarkopoulouK,WszolekZK,SossiV,DobkoT,MakE,CalneDB, StoesslAJ: PETstudiesofparkinsonismassociatedwithmutationinthe alpha-synucleingene. Neurology 1999, 53: 2097 – 2102. 17.BiskupS,MooreDJ,ReaA,Lorenz-DeperieuxB,CoombesCE,DawsonVL, DawsonTM,WestAB: DynamicandredundantregulationofLRRK2and LRRK1expression. BMCNeurosci 2007, 8: 102. 18.BiskupS,MooreDJ,CelsiF,HigashiS,WestAB,AndrabiSA,KurkinenK,Yu SW,SavittJM,WaldvogelHJ,FaullRL,EmsonPC,TorpR,OttersenOP, DawsonTM,DawsonVL: LocalizationofLRRK2tomembranousand vesicularstructuresinmammalianbrain. AnnNeurol 2006, 60: 557 – 569. 19.GalterD,WesterlundM,CarmineA,LindqvistE,SydowO,OlsonL: LRRK2 expressionlinkedtodopamine-innervatedareas. AnnNeurol 2006, 59: 714 – 719. 20.MelroseH,LincolnS,TyndallG,DicksonD,FarrerM: Anatomical localizationofleucine-richrepeatkinase2inmousebrain. Neuroscience 2006, 139: 791 – 794. 21.Simon-SanchezJ,Herranz-PerezV,Olucha-BordonauF,Perez-TurJ: LRRK2is expressedinareasaffectedbyParkinson'sdiseaseintheadultmouse brain. EurJNeurosci 2006, 23: 659 – 666. 22.TaymansJM,VandenHauteC,BaekelandtV: DistributionofPINK1and LRRK2inratandmousebrain. JNeurochem 2006, 98: 951 – 961. 23.MelroseHL,KentCB,TaylorJP,DachselJC,HinkleKM,LincolnSJ,MokSS, CulvenorJG,MastersCL,TyndallGM,BassDI,AhmedZ,AndorferCA,Ross OA,WszolekZK,DelldonneA,DicksonDW,FarrerMJ: Acomparative analysisofleucine-richrepeatkinase2(Lrrk2)expressioninmousebrain andLewybodydisease. Neuroscience2007, 147: 1047 – 1058. 24.ShiWX,PunCL,SmithPL,BunneyBS: EndogenousDA-mediatedfeedback inhibitionofDAneurons:involvementofbothD(1)-andD(2)-like receptors. Synapse 2000, 35: 111 – 119. 25.DachselJC,BehrouzB,YueM,BeeversJE,MelroseHL,FarrerMJ: A comparativestudyofLrrk2functioninprimaryneuronalcultures. ParkinsonismRelatDisord 2010, 16: 650 – 655. 26.WinnerB,MelroseHL,ZhaoC,HinkleKM,YueM,KentC,BraithwaiteAT, OgholikhanS,AignerR,WinklerJ,FarrerMJ,GageFH: Adultneurogenesis andneuriteoutgrowthareimpairedinLRRK2G2019Smice. NeurobiolDis 2011, 41: 706 – 716. 27.ParisiadouL,XieC,ChoHJ,LinX,GuXL,LongCX,LobbestaelE,Baekelandt V,TaymansJM,SunL,CaiH: Phosphorylationofezrin/radixin/moesin proteinsbyLRRK2promotestherearrangementofactincytoskeletonin neuronalmorphogenesis. JNeurosci 2009, 29: 13971 – 13980. 28.ParisiadouL,CaiH: LRRK2functiononactinandmicrotubuledynamicsin Parkinsondisease. CommunIntegrBiol 2010, 3: 396 – 400. 29.ChanD,CitroA,CordyJM,ShenGC,WolozinB: Rac1proteinrescues neuriteretractioncausedbyG2019Sleucine-richrepeatkinase2 (LRRK2). JBiolChem 2011, 286: 16140 – 16149. 30.KickaS,ShenZ,AnnesleySJ,FisherPR,LeeS,BriggsS,FirtelRA: The LRRK2-relatedRocokinaseRoco2isregulatedbyRab1Aandcontrols theactincytoskeleton. MolBiolCell 2011, 22: 2198 – 2211. 31.MeixnerA,BoldtK,VanTroysM,AskenaziM,GloecknerCJ,BauerM,Marto JA,AmpeC,KinklN,UeffingM: AQUICKscreenforLrrk2interaction partners – leucine-richrepeatkinase2isinvolvedinactincytoskeleton dynamics. MolCellProteomics 2011, 10 (M110):001172. 32.JedynakJP,UslanerJM,EstebanJA,RobinsonTE: Methamphetamineinducedstructuralplasticityinthedorsalstriatum. EurJNeurosci 2007, 25: 847 – 853. 33.Couillard-DespresS,WinnerB,SchaubeckS,AignerR,VroemenM, WeidnerN,BogdahnU,WinklerJ,KuhnHG,AignerL: Doublecortin expressionlevelsinadultbrainreflectneurogenesis. EurJNeurosci 2005, 21:1 – 14. 34.TongY,YamaguchiH,GiaimeE,BoyleS,KopanR,KelleherRJ3rd,ShenJ: Lossofleucine-richrepeatkinase2causesimpairmentofprotein degradationpathways,accumulationofalpha-synuclein,andapoptotic celldeathinagedmice. ProcNatlAcadSciUSA 2010, 107: 9879 – 9884. 35.HallC,BallacheyEL: AStudyoftheRat'sbehaviorinafield:A ContributiontoMethodinComparativePsychology. UnivCalifPublPsych 1932, 6: 1 – 12. 36.CormanCD,ShaferJN: Open-fieldactivityandexploratorybehavior. PsychonomicScience 1968, 13: 55 – 56. 37.RoyceJR: Ontheconstructvalidityofopen-fieldmeasures. PsychologicalBulletin 1977, 84: 1098 – 1106. 38.LauterbachEC,DuvoisinRC: Anxietydisordersinfamilialparkinsonism. AmJPsychiatry 1991, 148: 274. 39.NilssonFM,KessingLV,BolwigTG: Increasedriskofdeveloping Parkinson'sdiseaseforpatientswithmajoraffectivedisorder:aregister study. ActaPsychiatrScand 2001, 104: 380 – 386. 40.ZhuXR,MaskriL,HeroldC,BaderV,StichelCC,GunturkunO,LubbertH: Non-motorbehaviouralimpairmentsinparkin-deficientmice. EurJNeurosci 2007, 26: 1902 – 1911. 41.TreitD,FundytusM: Thigmotaxisasatestforanxiolyticactivityinrats. PharmacolBiochemBehav 1988, 31: 959 – 962. 42.BrownRE: Behaviouralphenotypingoftransgenicmice. CanJExpPsychol 2007, 61: 328 – 344. 43.HerzigMC: LRRK2proteinlevelsaredeterminedbykinasefunctionand arecrucialforkidneyandlunghomeostasisinmice. HumMolGenet 2011, 40: 4209 – 4223. 44.TongY,GiaimeE,YamaguchiH,Ichimur aT,LiuY,SiH,CaiH,BonventreJV,Shen J: Lossofleucine-richrepeatkinase2causesage-dependent bi-phasicalterationsoftheautophagypathway. MolNeurodegener 2012, 7: 2. 45.WahlstenD,MettenP,PhillipsTJ,BoehmSL2nd,Burkhart-KaschS,DorowJ, DoerksenS,DowningC,FogartyJ,Rodd-HenricksK,HenR,McKinnonCS, MerrillCM,NolteC,SchalomonM,SchlumbohmJP,SibertJR,WengerCD, DudekBC,CrabbeJC: Differentdatafromdifferentlabs:lessonsfrom studiesofgene-environmentinteraction.JNeurobiol 2003, 54: 283 – 311. 46.LippHP,WolferDP: Geneticallymodifiedmiceandcognition. CurrOpin Neurobiol 1998, 8: 272 – 280. 47.MelroseHL, etal : Impaireddopaminergicneurotransmissionand microtubule-associatedproteintaualterationsinhumanLRRK2 transgenicmice. NeurobiolDis 2010, 40: 503 – 517. 48.HydeLA,CrnicLS,PollockA,BickfordPC: MotorlearninginTs65Dnmice, amodelforDownsyndrome. DevPsychobiol 2001, 38: 33 – 45. 49.GerlaiR,PisacaneP,EricksonS: Heregulin,butnotErbB2orErbB3, heterozygousmutantmiceexhibithyperactivityinmultiplebehavioral tasks. BehavBrainRes 2000, 109: 219 – 227. 50.VitaliR,ClarkeS: Improvedrotorodperformanceandhyperactivityin micedeficientinaproteinrepairmethyltransferase. BehavBrainRes 2004, 153: 129 – 141. 51.ClaboughEB,ZeitlinSO: Deletionofthetripletrepeatencoding polyglutaminewithinthemouseHuntington'sdiseasegeneresultsin subtlebehavioral/motorphenotypesinvivoandelevatedlevelsofATP withcellularsenescenceinvitro. HumMolGenet 2006, 15: 607 – 623. 52.SahayA,DrewMR,HenR: Dentategyrusneurogenesisanddepression. ProgBrainRes 2007, 163: 697 – 722. 53.SahayA,HenR: Adulthippocampalneurogenesisindepression. Nat Neurosci 2007, 10: 1110 – 1115. 54.KontgenF,SussG,StewartC,SteinmetzM,BluethmannH: Targeted disruptionoftheMHCclassIIAageneinC57BL/6mice. IntImmunol 1993, 5: 957 – 964. 55.PaxinosG,FranklinK: TheMouseBraininStereotaxicCoordinates .2nd edition.SanDiego:Academic;2001. 56.WolferDP,MadaniR,ValentiP,LippHP: Extendedanalysisofpathdata frommutantmiceusingthepublicdomainsoftwareWintrack. Physiol Behav 2001, 73: 745– 753. 57.KaleA,AmendeI,MeyerGP,CrabbeJC,HamptonTG: Ethanol'seffectson gaitdynamicsinmiceinvestigatedbyventralplanevideography. Alcohol ClinExpRes 2004, 28: 1839 – 1848. 58.AmendeI,KaleA,McCueS,GlazierS,MorganJP,HamptonTG: Gait dynamicsinmousemodelsofParkinson'sdiseaseandHuntington's disease. JNeuroengRehabil 2005, 2: 20. 59.GoldbergNR,HamptonT,McCueS,KaleA,MeshulCK: Profilingchangesin gaitdynamicsresultingfromprogressive1-methyl-4-phenyl-1,2,3,6tetrahydropyridine-inducednigrostriatallesioning. JNeurosciRes 2011, 89: 1698 – 1706.Hinkle etal.MolecularNeurodegeneration 2012, 7 :25 Page16of17


60.HamersFP,LankhorstAJ,vanLaarTJ,VeldhuisWB,GispenWH: Automated quantitativegaitanalysisduringovergroundlocomotionintherat:its applicationtospinalcordcontusionandtransectioninjuries. JNeurotrauma 2001, 18: 187 – 201. 61.MorelP,FauconneauB,PageG,MirbeauT,HuguetF: Inhibitoryeffectsof ascorbicacidondopamineuptakebyratstriatalsynaptosomes: relationshiptolipidperoxidationandoxidationofproteinsulfhydryl groups. NeurosciRes 1998, 32: 171 – 179. 62.BradfordMM: Arapidandsensitivemethodforthequantitationof microgramquantitiesofproteinutilizingtheprincipleofprotein-dye binding. AnalBiochem 1976, 72: 248 – 254. 63.MoronJA,PerezV,Fernandez-AlvarezE,MarcoJL,UnzetaM: "Invitro" effectofsome5-hydroxy-indolalkylaminederivativesonmonoamine uptakesystem. JNeuralTransmSuppl 1998, 52: 343 – 349.doi:10.1186/1750-1326-7-25 Citethisarticleas: Hinkle etal. : LRRK2 knockoutmicehaveanintact dopaminergicsystembutdisplayalterationsinexploratoryandmotor co-ordinationbehaviors. MolecularNeurodegeneration 2012 7 :25. Submit your next manuscript to BioMed Central and take full advantage of: € Convenient online submission € Thorough peer review € No space constraints or color “gure charges € Immediate publication on acceptance € Inclusion in PubMed, CAS, Scopus and Google Scholar € Research which is freely available for redistribution Submit your manuscript at Hinkle etal.MolecularNeurodegeneration 2012, 7 :25 Page17of17