HER3 and downstream pathways are involved in colonization of brain metastases from breast cancer

MISSING IMAGE

Material Information

Title:
HER3 and downstream pathways are involved in colonization of brain metastases from breast cancer
Series Title:
Breast Cancer Research
Physical Description:
Book
Language:
English
Creator:
da Silva, Leonard
Simpson, Peter T.
Smart, Chanel E.
Cocciardi, Sibylle
Waddell, Nic
Lane, Annette
Morrison, Brian J.
Vargas, Ana Cristina
Healey, Sue
Beesley, Jonathan
Pakkiri, Pria
Parry, Suzanne
Kurniawan, Nyoman
Reid, Lynne
Keith, Patricia
Faria, Paulo
Pereira, Emilio
Skalova, Alena
Bilous, Michael
Balleine, Rosemary L.
Do, Hongdo
Dobrovic, Alexander
Fox, Stephen
Franco, Marcello
Reynolds, Brent
Khanna, Kum Kum
Cummings, Margaret
Chenevix-Trench, Georgia
Lakhani, Sunil R.
Publisher:
BioMed Central
Publication Date:

Notes

Abstract:
Introduction: Metastases to the brain from breast cancer have a high mortality, and basal-like breast cancers have a propensity for brain metastases. However, the mechanisms that allow cells to colonize the brain are unclear. Methods: We used morphology, immunohistochemistry, gene expression and somatic mutation profiling to analyze 39 matched pairs of primary breast cancers and brain metastases, 22 unmatched brain metastases of breast cancer, 11 non-breast brain metastases and 6 autopsy cases of patients with breast cancer metastases to multiple sites, including the brain. Results: Most brain metastases were triple negative and basal-like. The brain metastases over-expressed one or more members of the HER family and in particular HER3 was significantly over-expressed relative to matched primary tumors. Brain metastases from breast and other primary sites, and metastases to multiple organs in the autopsied cases, also contained somatic mutations in EGFR, HRAS, KRAS, NRAS or PIK3CA. This paralleled the frequent activation of AKT and MAPK pathways. In particular, activation of the MAPK pathway was increased in the brain metastases compared to the primary tumors. Conclusions: Deregulated HER family receptors, particularly HER3, and their downstream pathways are implicated in colonization of brain metastasis. The need for HER family receptors to dimerize for activation suggests that tumors may be susceptible to combinations of anti-HER family inhibitors, and may even be effective in the absence of HER2 amplification (that is, in triple negative/basal cancers). However, the presence of activating mutations in PIK3CA, HRAS, KRAS and NRAS suggests the necessity for also specifically targeting downstream molecules.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
All rights reserved by the source institution.
Resource Identifier:
doi - 10.1186/bcr2603
System ID:
AA00012630:00001

Full Text

PAGE 1

Additional file 1 Morphological review & TMA creation Haematoxylin & eosin (H&E) sections were reviewed by three pathologists (LDS, MC, SRL) to confirm the diagnosis, assess morphology and grade the tumours according to the World Health Organization c rite ria [55] Tissue microarrays (TMA) were built using the tissue arrayer, model MTAI (Beecher Instruments, Inc, Sun Prairie, WI 53590 USA) to facilitate screening of clinical samples using immunohistochemistry and in situ hybridization. H&E slides were dotted by LDS in order to take representative 0.6mm diameter cores of each tumour for analysis. Two cores were taken from each tumour. Two sets of TMAs were built. The first TMA set comprised 29 primary breast cancers and their matched brain metastases and 22 un matched brain metastases. The second TMA set comprised 10 primary breast cancers and their matched brain metastases, as well as the 11 non breast brain metastases. Slides and paraffin blocks from 38 tumor samples (primary breast cancer and metastases to m ultipl e sites, including brain) from 8 autopsy cases of patients who died of metastatic breast cancer were also available. Immunohistochemistry and chromogenic in situ hybridization Four micron thick sections of the paraffin blocks were cut on to silane c oated slides. Immunohistochemistry was performed using the Envision dual link system (Dakocytomation, all antibody details. Antigenic retrieval for all antibodies ( except smooth muscle actin (SMA) which did not require any antigen retrieval and EGFR 5 minutes chymotrypsin digestion) required two minutes pressure cooking (105 o C) in EDTA (pH8.0) buffer. Positive and negative

PAGE 2

controls were included in all runs and all slides were analysed by at least two pathologists (LDS, PP or SRL) using double headed optical light microscope. HER2 staining and scoring used a minimum 30% percent cut off of positivity with strong complete membrane staining to regard a case as HER2 ove rexpressed (3+). The same criteria were used for EGFR, HER3 and HER4 and assessed in the periphery of the tumors. For all other antibodies, samples were considered positive if more than 10% of tumor cells were stained in one or both cores on the TMA. Cellu lar localization (membrane, cytoplasm, nuclear), staining intensity (negative, weak/1+, moderate/2+, strong/3+) and percentage/number of positively stained neoplastic cells was recorded. A tumor positive (CK5/6, CK14, CK17, p 63, SMA, EGFR). The EGFR, HER3, HER4, CD44 and CD24 were assessed on whole sections and not as double stain. Digital slide images are available at http://aperio.qimr.edu.au/ The usernam e in situ hybridization was performed following instructions of the Zymed Spot LightHER2 CISH TM Kit (Zymed, California, USA). Bri efly, the paraffin embedded sections were dewaxed and subjected to heat and enzyme digestion treatments followed by denaturation and hybridization to labelled nucleic acid probes. Immunodetection Diaminobenzidine tetrachloride was u sed for visualization. Slides were counterstained with haematoxylin. A positive control for HER2 amplification was included in each run. Signals were counted under a brightfield microscope and results were classified into diploid, polysomy, low amplificati recommendation. Immunohistochemistry using an antibody raised against the E746_A750del mutated EGFR protein was performed to validate Oncocarta data Myoepithelial cells of

PAGE 3

normal breast tissue whi ch are normally positive for wild type EGFR, were also used as negative control for the E746_A750del mutation antibody Supplementary Table 1 Details of Antibodies Used in Immunohistochemistry Antibody Company Clone Dilution ER Novocastra 6F11 1: 100 PR Novocastra 1A6 1:500 HER2 DAKO Herceptest HER3 Novus Biologicals RTJ2 1:80 HER4 Santa Cruz C 18 1:100 EGFR Zymed 31G7 1:100 p63 DAKO 4A4 1:400 SMA DAKO 1A4 1:100 p53 DAKO D07 1:100 CD44 DAKO DF1485 1:100 CD24 Serotec SN3 1:200 CK5/6 DAKO D5/16B4 1:50 CK14 Neomarkers LL002 1:50 E cadherin Zymed HECD 1 1:20 CK19 DAKO RCK108 1:25 CK7 DAKO OV TL 12/30 1:500 CK17 DAKO E3 1:100 CK8/18 Novocastra 5D3 1:100 Phospho HER3 Cell Signalling Tyr 1289 (21D3) 1:300 Phospho AKT Invitrogen pT 308 1:300 Phospho ERK1/ERK2 Invitrogen pTpY 185/187 1:300 Phospho JNK1/2 Invitrogen pTpY 183/185 1:300 Phospho ERK5 Invitrogen pTpY 180/182 1:300 p38 Invitrogen pTpY 218/220 1:300 Mutated EGFR Cell Signalling E746 A750del( 6b6) 1:100 Ki 67 Dako MIB1 1:100 GRB2 Cell Signalling 1:100 HI F1 alfa Cell Signalling 1:100 RNA extraction and Real Time RT PCR waxed in two lots of xylene and two lots of 100% ethanol, 10 minutes each. RNA was extracted using the High Pure RNA

PAGE 4

Paraffin Kit (Roche Applied Science, Mannheim, Germany) according to the protocol. RNA was quantified using the NanoDrop ND 1000 (NanoDrop Technologies, DE, USA). Relative expression levels of HER3, HER2, EGFR, HER4, HIF1 alfa and CCNH was assessed using RT PCR. Complementary DNA (cDNA) was synthesized from 240 ng of total RNA using random hexamers and the SuperScript TM III Reverse Transcriptase kit (Invitrogen, Carsbald, CA, USA). TaqMan One Step UniversalMaster Mix (Applied Biosystems) was used for all reactions. TaqMan reaction was done in a standard 96 well p late format with ABI 7500 OneStepPlus PCR system. For data analysis, raw deltaCt (dCt) was first normalized to an endogenous control gene (RPL13a) for each sample to generate normalized dCt. The normalized dCt was then calibrated to a cell line pool refere nce (MCF 7, SKBR 3 and MDA MB 231) to generate a ddCt. In the final step of data analysis, the ddCt was converted to fold change (2 ddCt ) relative to the reference allowing comparison between samples. DASL gene expression profiling Gene expression profili ng was performed using the DASL assay (cDNA mediated annealing, selection extension and ligation, Illumina Inc., California, USA) to interrogate the DASL Cancer Panel that contained 512 cancer related genes [56 58] All protocols were as specified by Illu mina Inc. Briefly, RNA (250ng) was converted to cDNA through a reverse transcription reaction with biotinylated oligo d(T) 18 and random nonamers. Gene specific oligonucleotides (three unique pairs for each of the 512 genes) were annealed to the biotinylate d cDNA, the duplexes were bound to streptavidin conjugated paramagnetic particles to remove non hybridized oligos. The annealed oligos were then extended and ligated (to incorporate an address sequence and primer site) to generate amplifiable products. The se products were subjected to

PAGE 5

PCR amplification using fluorescently labeled (Cy3 and Cy5) primers. The labeled PCR products were hybridized to a Sentrix array or Beadchip. Following hybridization, the arrays were scanned with a BeadArray Reader (Illumina) and data was extracted usin g BeadStudio version 3 software ( Illumina). Samples exhibiting a median hybridization intensity across all probes of <600 (background corrected) were excluded from analysis. Individual probes with a BeadStudio detection score gre ater than 0.99 in more than 15 conditions were included which left 1234 probes in the analysis. Array data transformation and normalization (per chip normalized to 50th percentile and per gene normalized to median) was done in Genespring version 7.0 softw are (Agilent Technologies, Santa Clara, USA). Hierarchical clustering was performed using Pearson Correlation and Average Linkage clustering algorithm. Principal component analysis was also performed. A linear model was fitted (limma) and a moderated t sta tistic wa s performed for differential expression. DASL data is available from Gene Expression Omnibus ( http://www.ncbi.nlm.nih.gov/geo/ Accession number GSE14690). Cell lines SUM159 and BT20 m a m mospheres wer e grown in 5 ml of serum free DMEM/F12 (NSA) medium containing freshly added 20 ng/ml rhEGF (R&D Systems), 10 ng/ml rhFGF (R&D Systems), 4 ug/ml heparin, 10% proliferation supplement (NeuroCult, Stem Cell Technologies Inc.), 2% BSA (Sigma). Breast cancer cell lines MCF 7, MDA MB 231 and SKBR 3 were inactivated fetal bovine serum (FBS), 2 mmol/L glutamine, and 1% penicillin G streptomycin solution. OncoCarta somatic mutation analysis

PAGE 6

Onco genic mutations in tumour samples were profiled using the OncoCarta Assay Panel v1.0, which offers rapid, parallel analysis of 238 mutations across 19 common oncogenes. All n Diego, CA). PCR amplification was carried out using 20 ng DNA as a template for each Assay. Post PCR treatment by shrimp alkaline phosphatase was followed by the TypePLEX Extend Reaction. Following this step, CLEAN Resin (Sequenom) was added to the mixtu re to remove extraneous salts that could interfere with the MALDI TOF analysis. Allelotyping was determined by robotically spotting 15 nl of each extension product onto a SpectroCHIP II, which was subsequently read by the MassARRAY Compact Analyzer. Some mutations were validated with a second OncoCarta analysis, using just a subset of primers that detect the relevant EGFR mutations. Poor quality samples were identified by evaluating the primer extension rates. All samples in which more than 10% of assays h ad less than 50% primer extension were defined as poor quality and removed from further analysis. High Resolution Melt Analysis For cases with sufficient DNA available, we carried out High Resolution Mel t (HRM) a nalysis to validate mutations in KRAS, HR AS, NRAS and PIK3CA identifi ed with the OncoCarta Assay. Primers used for HRM Analysis were the same as those used in the OncoCarta Assay Panel and are shown in Supplementary Table 2. PCR reactions for HRM for KRAS, HRAS, NRAS and PIK3CA were performed on a LightCycler 480 (Roche Diagnostics, Mannheim, Germany) in 10ul final volume containing 1x LightCycler 480 High Resolution Melting Master Mix (Roche Diagnostics), 500 nM forward primer, 500 nM reverse primer, 30 mM MgCl 2 and 10 ng genomic DNA. The cycling conditions were as follows: Pre incubation at 95C for 5min, followed by 26

PAGE 7

cycles of 95C for 10 s, touchdown from 65C to 53C ( 0.5C/cycle) for 10 s and 72C for 10 s, followed by a further 19 cycles at 53C annealing temperature. The melting program consisted of one cycle at 95C for 1 min, 40C for 1 min and then continuous fluorescent reading from 65 to 95C at 25 acquisitions per C. HRM data were analysed using the LightCycler 480 Gene Scanning Software (Roche Diagnostics) as previously described [59] Supplementary Table 2 Primers used for HRM Analysis Primer name Targeted Mutation Primer Sequence Product Size NRAS_6 1st Primer Q61R ACGTTGGATGTCGCCTGTCCTCATGTATTG 99 NRAS_6 2nd Primer ACGTTGGATGCCTGTTTGTTGGACATACTG PIK3CA_6 1st Pri mer E545K ACGTTGGATGTACACGAGATCCTCTCTCTG 90 PIK3CA_6 2nd Primer ACGTTGGATGTAGCACTTACCTGTGACTCC Sequencing For cases with sufficient DNA available, and an OncoCarta Assay result of > 30% mutant allele proportion (MAP) for KRAS, HRAS, NRAS and PIK3CA we used direct sequencing for validation. Primers for sequencing (Supplementary Table 3) were designed using the web based programme Primer 3 ( http://frodo.wi.mit.edu/primer3/ ). PCR reactions were performed i n a final volume of 20 l and contained 15 ng DNA, 200 nM of each primer, 250 M dNTPs, 1 PCR buffer with 2 mM MgCl 2 and 1 U i STAR Taq polymerase (Scientifix, Clayton, Australia ). Touchdown amplification was as follows : 94 o C for 12 min, followed by fou r sets of four cycles of 94 o C for 30 s, 61 o C to 55 o C for 45 s and 72 o C for 30 s, with the annealing temperature dropping 2 o C after each set of four cycles, followed by 30 cycles of 94 o C for 30 s, 55 o C for 45 s and 72 o C for 30 s, and a final extension of 7 2 o C for 7 min. PCR reactions were purified with the QIAGEN PCR purification kit and sequenced using Big Dye (version 3.1) sequencing chemistry

PAGE 8

and the PE Applied Biosystems 377 sequencer. The resulting chromatograms were compared with wild type samples whi ch were sequenced as controls. Supplementary Table 3 Primers for sequencing Primer name Targeted Mutation Primer Sequence Product Size KRAS1 2/4_(G12C/G13D) F G12C and G13D TTAACCTTATGTGTGACATGTTCTAA 171 KRAS1 2/4_(G12C/G13D) R TGGATCATATTCGTCCACAAA A NRAS2_(G12C) F G12C GATGTGGCTCGCCAATTAAC 175 NRAS2_(G12C) R CTCACCTCTATGGTGGGATCA NRAS6_(Q61R) F Q61R CACCCCCAGGATTCTTACAG 173 NRAS6_(Q61R) R TCCGCAAATGACTTGCTATT PIK3CA9_(H1047L) F H1047L TGAGCAAGAGGCTTTGGAGT 190 PIK3CA9_(H1047L) R GGTCTTT GCCTGCTGAGAGT iPLEX genotpying For cases with sufficient DNA available we us ed technology to validate mutations in NRAS, PIK3CA and EGFR identifi ed with the OncoCarta Assay The design of oligonucleotides was carr ied out according to the guidelines of Sequenom Inc. and performed using MassARRAY Assay Design software (version 1.0). Four P lex PCR amplification of amplicons containing variants of interest was performed using Qiagen HotStart Taq Polymerase on a Perkin Elmer GeneAmp 2400 thermal cycler with 5 ng genomic DNA in a 2.5 l reaction. instructions for iPLEX chemistry. Assay data were analysed using Sequenom TYPER software (Version 3.4).

PAGE 9

Supplementary Table 4 Primers for iPLEX Primer name Mutation Primer Sequence Product Size NRAS_Q61R_q1 Q61R ACGTTGGATGCCTGTTTGTTGGACATACTG NRAS_Q61R_q2 ACGTTGGATGTCGCCTGTCCTCATGTATTG NRAS_Q61R_q3 TGGCACTGTACTCTTCT PIK3CA_E545K_q1 E545K ACGTTGGATGTACACGAGATCCTCTCTCTG PIK3CA_E545K_q2 ACGTTGGATGTAGCACTTACCTGTGACTCC PIK3CA_E545K_q3 AGAAAATCTTTCTCCTGCT PIK3CA_H1047R_iPlex F H1047R ACGTTGGATGAACTGAGCAAGAGGCTTTGG PIK3CA_H1047R_iPlex R ACGTTGGATGTCCATTTTTGTTGTCCAGCC PIK3CA_H1047R_iPlex Ext ATGAAACAAATGAATGATGCAC HRAS_G13S_iPlex F G13S ACGTTGGATGAATGGTTCTGGATCAGCTGG HRAS_G13S_iPlex R ACGTTGGATGGACGGAATATAAGCTGGTGG HRAS_G13S_iPlex Ext CGCACTCTTGCCCACAC NRAS_G12C_iPlex F G12C ACGTTGGATGAGTGGTTCTGGATTAGCTGG NRAS_G12C_iPlex R ACGTTGGATGGACTGAGTACAAACTGGTGG NRAS_G12C_iPlex Ext GCTTTTCCCAACACCAC EGFR_E746_A750del_iPlex F E746_A750del ACGTTGGATGGATCCCAGAAGGTGAGAAAG EGFR_E746_A750del_iPlex R ACGTTGGATGTCGAGGATTTCCTTGTTGGC EGFR_E746_A750del_iPlex Ext AATTCCCGTCGCTATCAA PIK3CA_R38H_iPlex F R38H ACGTTGGATGGGGGTATTTTCTTGCTTCTT PIK3CA_R38H_iPlex R ACGTTGGATGCCAAATGGAATGATAGTGAC PIK3CA_R38H_iPlex Ext ATGGTTATTAATGTAGCCTCA



PAGE 1

RESEARCHARTICLEOpenAccess HER3anddownstreampathwaysareinvolved incolonizationofbrainmetastasesfrom breastcancer LeonardDaSilva 1,2,3 ,PeterTSimpson 1,2 ,ChanelESmart 1,2 ,SibylleCocciardi 2 ,NicWaddell 2 ,AnnetteLane 1 BrianJMorrison 2,4 ,AnaCristinaVargas 1 ,SueHealey 2 ,JonathanBeesley 2 ,PriaPakkiri 1 ,SuzanneParry 1,2 NyomanKurniawan 5 ,LynneReid 1,2 ,PatriciaKeith 1,2 ,PauloFaria 7,6 ,EmilioPereira 8 ,AlenaSkalova 9 ,MichaelBilous 10 RosemaryLBalleine 11 ,HongdoDo 12 ,AlexanderDobrovic 12 ,StephenFox 12 ,MarcelloFranco 3 ,BrentReynolds 13,16 KumKumKhanna 14 ,MargaretCummings 1,14 ,GeorgiaChenevix-Trench 2 ,SunilRLakhani 1,2,15* Abstract Introduction: Metastasestothebrainfrombreastcancerhaveahighmortality,andbasal-likebreastcancershave apropensityforbrainmetastases.However,themechanismsthatallowcellstocolonizethebrainareunclear. Methods: Weusedmorphology,immunohistochemistry,geneexpressionandsomaticmutationprofilingto analyze39matchedpairsofprimarybreastcancersandbrainmetastases,22unmatchedbrainmetastasesofbreast cancer,11non-breastbrainmetastasesand6autopsycasesofpatientswithbreastcancermetastasestomultiple sites,includingthebrain. Results: Mostbrainmetastasesweretriplenegativeand basal-like .Thebrainmetastasesover-expressedoneor moremembersoftheHERfamilyandinparticularHER3wassignificantlyover-expressedrelativetomatched primarytumors.Brainmetastasesfrombreastandotherprimarysites,andmetastasestomultipleorgansinthe autopsiedcases,alsocontainedsomaticmutationsin EGFR,HRAS,KRAS NRAS or PIK3CA .Thisparalleledthe frequentactivationofAKTandMAPKpathways.Inparticular,activationoftheMAPKpathwaywasincreasedinthe brainmetastasescomparedtotheprimarytumors. Conclusions: DeregulatedHERfamilyreceptors,particularlyHER3,andtheirdownstreampathwaysareimplicated incolonizationofbrainmetastasis.TheneedforHERfamilyreceptorstodimerizeforactivationsuggeststhat tumorsmaybesusceptibletocombinationsofanti-HERfamilyinhibitors,andmayevenbeeffectiveinthe absenceof HER2 amplification(thatis,intriplenegative/basalcancers).However,thepresenceofactivating mutationsin PIK3CA HRAS,KRAS and NRAS suggeststhenecessityforalsospecificallytargetingdownstream molecules. Introduction Amongwomenwithbreastcancer,30%to40%will developmetastaticdisease.Thenaturalhistoryofmetastaticbreastcancertothebr ainisofsymptomaticdiseasein10%to20%ofthesepatientsandadismalmean survivalofsixmonthsfollowingdiagnosis[1,2].Associationswithyoungerage,p53positivity,estrogenreceptor (ER)negativeandepidermalgrowthfactorreceptor1 (EGFR)andtwo(HER2)positivecancershavebeen reported[3-5].Theepidermalgrowthfactorreceptor familycomprisesfourreceptors,HER1to4.Uponactivation,heteroorhomo-dimerizationoccurs,followedby phosphorylationofspecifictyrosineresiduesinthe intracellulardomain,stim ulatingsignalingcascades mediatedmainlybyAKTandMAPKandtheregulation ofcellproliferation,angiogenesis,migrationandsurvival [6,7]. *Correspondence:s.lakhani@uq.edu.au 1 Molecular&CellularPathology,TheUniversityofQueenslandCentrefor ClinicalResearch,&SchoolofMedicine,Building918/B71,RBWHcomplex, Brisbane,4029,Australia DaSilva etal BreastCancerResearch 2010, 12 :R46 http://breast-cancer-research.com/content/12/4/R46 2010DaSilvaetal.;licenseeBioMedCentralLtd.ThisisanopenaccessarticledistributedunderthetermsoftheCreativeCommons AttributionLicense(http://creativecommons.org/licenses/by/2.0),whichpermitsunrestricteduse,distribution,andreproductionin anymedium,providedtheoriginalworkisproperlycited.

PAGE 2

Basal-liketumorsaregenerallyhighgrade,negativefor ER,progesteronereceptors(PgR)andHER2(thatis, triplenegative )[8].Thecurrentdogmawouldpredictthat thesetumorsareunlikelytorespondtoendocrineand trastuzumab-basedtherapyandnotargetedtherapyis currentlyavailable,althoughclinicaltrialsareongoing [8].Despitebeingnodenegative,aproportionof patientssubsequentlypresentwithdistantmetastases, particularlytothebrain[9,10] Usingautopsyrecordsofbreastcancerpatients,Paget [11]demonstratedanon-randompatternofmetastatic spread.Thissuggestedthattumorcells(the seed )could haveaspecificaffinityforthemicroenvironmentofcertain organs(the soil ).Inagreement,animalmodelsdemonstrate thatparticularsetsofgenescanincreasethepotentialof breastcancercelllinestocolonizespecificdistantsites,for example,bone,lung[12, 13];andbrain[14,15]. Thecancer mutatome isverycomplex,withmore than140CANgenesidentifiedwhicharemutatedata significantfrequencyincancer[16,17].Thegenomic landscapeofbreastcancerisalsoverycomplexandheterogeneous,withdifferentsubgroupsoftumours(luminal,basal,HER2)harboringdifferenttypesandpatterns ofmutations[18].Thereisalsoevidencethatbreast cancercelllineswithabasalphenotypehaveahigher frequencyofmutationsin BRAF,KRAS ,and HRAS than luminalbreastcancercelllines[19-21]. Wehaveanalyzedarelativelylargeandraresetof humantumorstoelucidatethemechanismsinvolvedin colonizationofthebrain.Samplesstudiedinvolved matchedpairsofprimarybreastcancerandbrainmetastases,unmatchedbrainmetastases,non-breastbrain metastasesandautopsycasesofbreastcancerpatients withmetastasestomultiplesites,includingthebrain.We provideevidenceofincreasedactivationofHER3and downstreampathwaymoleculesinbrainmetastasesfrom breastcancerandsuggestthattheinhibitionofHER familyreceptors,evenintheabsenceof HER2 gene amplification(forexample,triplenegative/basalcancers), couldplayasignificantroleinthemanagementof patientswithbrainmetastasesfrombreastcancer.In addition,wedemonstratedthepossiblefallaciesofthis approachwithoutconsideringthepresenceofsomatic activatingmutationsindownstreammolecules[22-24].MaterialsandmethodsAdditionaldetailedmethodologies(seeAdditionalfile 1).Thestudywasapprovedbythelocalresearchethics committeesundertheprojectnumberUQ2005000785 andRBHW2005/22.ClinicalsamplesAllhumanclinicalsamplesstudiedwereavailableasformalinfixed-paraffinembe dded(FFPE)tumorblocks. Cohortscollectedwere:i)39matchedpairsofprimary breastcancerandbrainmetastases;ii)22unmatched brainmetastasesfrombreastcancer;iii)11brainmetastasesfromnon-breastsites(onemelanoma,onecolorectal,sixlung,oneprostateandtworenalcell carcinomas);andiv)26tumorsamples(primarybreast cancerandmetastasestomultiplesites,includingbrain) fromsixautopsycasesofpatientswhodiedofmetastaticbreastcancer(theprimarybreastcancerfromone casewasnotavailable).Thetumorswerereviewedby threepathologists(LDS,MCandSRL)andanalyzedby immunohistochemistryandchromogenic insitu hybridization(CISH)ontissuemicroarrays.ImmunohistochemistryforEGFR,HER2,HER3,HER4,CD44andCD24 wasalsodoneonwholesections.GeneexpressionanalysisRNAwasextractedfromFFPEsamplesandtheexpressionof512cancerrelatedgeneswasanalyzedusingthe DASLassay(cDNA-mediatedannealing,selectionextensionandligation,IlluminaInc.,SanDiego,California, USA)[25].AlldataandprotocolsforDASLanalysiscan befoundattheGeneExpressionOmnibusrepository (AccessionnumberGSE14690)(seealsoadditionalfile 1).Real-timePCRusingTaqMangeneexpression assays(AppliedBiosystems,Inc,Carlsbad,California, USA)andimmunohistochem istrywereperformedto validatetheexpressionofspecificgenes.SomaticmutationanalysisTwelvematchedpairsofprimarybreasttumorsandcorrespondingbrainmetastases,ninenon-breastbrain metastasesand26tumorsamplesfromthesixautopsy casesweresubjectedtoprimerextensionandMALDITOFmassspectrometryusingtheOncoCartaPanel Assayv1.0(SequenomInc.,SanDiego,California,USA) of238mutationsin19oncogenes[26].Allmutationsin samplesforwhichtherewassufficientDNAremaining werevalidatedbyHighResolutionMelt(HRM)[27] analysis,iPLEX(usingnewlydesignedPCRandextensionprimersthatdifferedfromtheOncoCartaprimers), repeatOncoCartaanalysis,and/ordirectsequencingif theMutantAlleleProportion(MAP)was>30%(Table1 andAdditionalfile2,TableS2).Inaddition,wewere abletovalidatethe EGFR E746_A750delmutationin fourcaseswithamutation-specificantibody[28].ResultsClinicalandpathologicalfeaturesThemedianageatdiagnosiswas48.5yearsandthe mediantimeforthedevelopmentofbrainmetastasis was3.5years.Allbutoneoftheseriesofprimarybreast cancersandallbrainmetastasesweregrade3invasive ductalcarcinomas-nospecifictype(IDC-NST)[29].TheDaSilva etal BreastCancerResearch 2010, 12 :R46 http://breast-cancer-research.com/content/12/4/R46 Page2of13

PAGE 3

Table1SomaticmutationsidentifiedbyOncoCartaandER,PgRandHERfamilyofreceptorsassessmentMatchedbreastprimary-brainmetastasispairs CaseID#SiteER-PgR-HER1-2-3-4 EGFRNRASPIK3CA MutationMAPMutationMAPMutationMAP 1brain ER-,PgR-,HER1-,HER2+,HER3-,HER4breast ER-,PgR-,HER1-,HER2+,HER3-,HER42brain ER-,PgR-,HER1-,HER2-,HER3+,HER4-Q61RO,H,I,S39.50% breast ER-,PgR-,HER1-,HER2-,HER3+,HER4-Q61RO,H,I,S38.30% 4brain ER-,PgR+,HER1+,HER2-,HER3-,HER4breast ER-,PgR+,HER1+,HER2-,HER3-,HER46brain ER-,PgR+,HER1+,HER2-,HER3-,HER4breast ER-,PgR+,HER1+,HER2-,HER3-,HER47brain ER-,PgR-,HER1+,HER2-,HER3-,HER4-Q61RI,S34.4% breast ER-,PgR-,HER1+,HER2-,HER3-,HER4-Q61RI,S34.1% 8brain ER-,PgR-,HER1-,HER2+,HER3+,HER4breast ER-,PgR-,HER1-,HER2+,HER3-,HER49brain ER-,PgR-,HER1-,HER2+,HER3-,HER4-H1047RS79.50% breast ER-,PgR-,HER1-,HER2+,HER3-,HER4-H1047RS79.50% 10brain ER-,PgR-,HER1+,HER2-,HER3+,HER4-E545KH,NVP23.40% breast ER-,PgR-,HER1+,HER2-,HER3-,HER4-E545KH,NVP18.20% 11brain ER-,PgR-,HER1-,HER2+,HER3-,HER4+ breast ER-,PgR-,HER1-,HER2+,HER3-,HER4+ 12brain ER-,PgR+,HER1-,HER2-,HER3+,HER4breast ER-,PgR+,HER1-,HER2-,HER3+,HER413brain ER-,PgR-,HER1+,HER2-,HER3-,HER4breast ER-,PgR-,HER1+,HER2-,HER3-,HER4-N771_P772>SVDNR12.10% 14brain ER-,PgR-,HER1+,HER2-,HER3-,HER4breast ER-,PgR-,HER1+,HER2-,HER3-,HER4Unmatchedbrainmetastasesfromprimarylung,colon,melanomaandkidneytumours CaseID#SiteER-PgR-HER1-2-3-4 EGFRHRASKRASNRASPIK3CA MutationMAPMutationMAPMutationMAPMutationMAPMutationMAP D2melanoma n.a. E545KH,I,Y30.80% D3colon n.a. G12CS38.90% D4lung n.a.E746_A750delA21.00% D5lung n.a.DaSilva etal BreastCancerResearch 2010, 12 :R46 http://breast-cancer-research.com/content/12/4/R46 Page3of13

PAGE 4

remainingtumorpairwasagrade2mucinouscarcinoma.Theautopsysamplescomprisedfourgrade3and onegrade2IDC-NST.ER,PgR,HER2, ‘ Basal ’ markersandstemcellmarkers (non-autopsycases)ImmunohistochemistrydataaresummarizedinFigure 1A,B(seealsoadditionalfile2,TableS1andFigure S1).Itwasnoteworthythat60%and76%ofthetumors werenegativeforERandPR,respectively,withcompleteconcordancebetweenprimaryandmetastases. Seventy-sevenpercent(77%)and81%oftheunmatched brainmetastaseswerealsoERandPRnegative,respectively.Twentypercent(20%)and19%oftheprimary breasttumorsandmetastases,respectively,hadcorrelatedover-expressionofHER2(3+staining)andallof theseshowedgeneamplificationusingCISH.Twenty percent(20%)oftheunmatchedmetastaseswerealso HER2+.Fifty-sixpercent(56%)oftheprimarytumors and48%ofthematchedmetastasesweretriplenegative andofthese,60%werepositiveforatleastoneofthe basalmarkersrespectively(CK14,CK5/6,CK17,EGFR andSMA).Overall,54%oftheprimaryand60%ofthe metastaseswereof basal phenotype(irrespectiveofER, PRandHER2status),confirmingenrichmentinthis cohortoverthenormaldistributioninbreastcancer[8]. Noteworthy,EGFRstainingwasseenmainlyintheperipheryofthetumorwheretherewascontactwithnonneoplasticbrainparenchyma[30].Ahigherproportion ofbrainmetastaseshadaputativestemcell-likephenotype(CD44+/CD24-)comparedtotheprimaries,55% versus25%,(Figure1A).Fifty-onepercent(51%)ofthe primarytumorshadaKi-67indexhigherthan10%in contrasttomatchedandunmatchedmetastases thathad86%and85%ofsampleswithindexhigher than10%.GeneexpressionprofilingTheavailabilityofgoodqualityRNAandstringentfilteringoftheDASLdatayieldedgeneexpressionprofiling dataon37/61brainmetastasesfrombreastcancer(15/ 39frommatchedpairsand22/22fromunmatched metastases)and15matchedp rimaries.Unsupervised analysishighlightedastrongsimilaritybetweenprimary tumorsandtheirmatchedmetastases(Figure2A).Only 20genesweredifferentiallyexpressedbetweenthe matchedprimariesandmetastases.Thismaybeaconsequenceoftheoverallstrongsimilaritybetweenprimariesandmetastases[31]coupledwiththesamplesize (n=30)andnumberofgenesanalyzed(n=512cancer genesintheDASLpanel)[32].Comparisonbetween primariesandallmetastases(matchedandunmatched) identified27statisticallysi gnificant,differentially expressedgenes(Figure2B).SupplementaryFigure2 Table1SomaticmutationsidentifiedbyOncoCartaandER,PgRandHERfamilyofreceptorsassessment (Continued)D6lung n.a.E746_A750delA,NVI14.40%G13SI17.30%G12CI;S35.70% D7lung n.a. G12CO;I9.70% D8lung n.a. G12CS39.90% D9lung n.a. E545KH13.30% D10kidney n.a.E746_A750delA,I9.10%G12CI,S35.20%A,validatedbyimmunohistochemistryusingamutation-specificantibody;ER,estrogenreceptor;H,validatedbyHighResolutionMeltanalysis;I, validatedbyiPLEX;ID,casenumberidentification;MAP,MutantAllele ProportionestimatedbyOncoCarta;NVI,notvalidatedbyiPLEX;NVP,nofurthervalidationpossiblebecausenoDNAremained;O,validatedbyrepeatO ncoCarta;PgR,progesteronereceptor;S,validatedby sequencing;Y,sequencingdidnotworkforthissample;n.a.,notaccessed.DaSilva etal BreastCancerResearch 2010, 12 :R46 http://breast-cancer-research.com/content/12/4/R46 Page4of13

PAGE 5

Figure1 Immunohistochemicalprofileofprimarybreastandbrainmetastases A -Immunohistochemicalanalysisofmatchedprimary breastandbrainmetastases.Thegraphdepictspercentagesofpositivecasesineachcategory.ERandPRwereconsideredpositivewhen>10% cellsshowedstaining,HER2wasconsideredpositivewhenIHCshowed3+staining(>30%positivecells)orCISHshowedgeneamplification. TriplenegativetumorswerenegativeforER,PRandHER2.CD44+/CD24-immunohistochemistrywasassessedonserialsectionsandpositivity wasexpressionin>10%cells. B -Breakdownofbasalmarkers.Atumorwasregardedas basal ifanyofthefollowingmarkerswerepositive (CK5/6,CK14,CK17,p63,SMA,andEGFR)with>10%cellsshowedstaining. DaSilva etal BreastCancerResearch 2010, 12 :R46 http://breast-cancer-research.com/content/12/4/R46 Page5of13

PAGE 6

Figure2 Geneexpressionprofilingofbrainmetastases A -UnsupervisedhierarchicalclusteringofDASLgeneexpressiondatafrom22 unmatched(blackcolorbar)and15matchedprimaryandbrainmetastases(othercolorsbars).Thirteenoutof15matchedsamplesare clusteringtogether. B -Heatmapanddendogramshowingclusteringofthesamplesbasedonthe27genesdifferentiallyexpressedbetween primarytumors(bluelinebar)andbrainmetastases(redlinebar). DaSilva etal BreastCancerResearch 2010, 12 :R46 http://breast-cancer-research.com/content/12/4/R46 Page6of13

PAGE 7

(seeAdditionalfile2,FigureS2)depictsprincipalcomponentanalysisshowinggoodseparationoftheprimariesandmetastasesusingthis27-genelist.All20 genesidentifiedinthematchedpairanalysiswerepart ofthis27-geneset.Amongthis20-geneset,were HER3 andoneofitsdownstreamtargetmolecules GRB2 [33], hypoxiarelatedmolecule HIF1-alfa ,MAPKinasecascade relatedprotein CREBBP ,cellcycleregulatorRB1and proliferationrelatedgenes CCNH,CDK7 and CDC25B Sincethebrainisrichinneuregulin1[34,35]andthisis aligandforHER3,wehypothesizedthattheneuregulinHER3activationwasimportantinallowingbreastcancercellstocolonizethebrain.HERfamilyreceptorsanddownstreammolecules expressionHER3,EGFR,HER2,HER4 and HIF1-alfa expression wasassessedusingquantitativeRT-PCR(seeAdditional file2,FigureS3)in12matchedbreast/brainsamplesfor whichDASLdataandRNAwereavailable.Similarto theDASLdata,10casesshowedincreasedfoldchange byRT-PCRof HER3 geneexpressionrelativetotheir matchedprimariesrangingfrom1.12to5.8andwithan averageof2.4.ImmunohistochemistryforHER3was similar,showingpositivityin11/37(29.7%)oftheprimarytumors,22/37(59%)ofthematchedmetastases and13/21(62%)oftheunmatchedbrainmetastases ( P =0.019).Inagreement,phosphorylatedHER3confirmedmorefrequentactivationinthebrainmetastases, withpositivityin14/37(37%)oftheprimarytumors, 24/37(64%)ofthematchedmetastasesand18/21(85%) oftheunmatchedbrainmetastases( P =0.046)(see Additionalfile2,TableS1andFigureS1). ImmunohistochemistryforGRB2,HIF1-alfaandphosphorylatedERK1/2,JNK1/2,ERK5andp38alsodemonstratedincreasedactivationinthemetastasescompared totheprimarytumors;(seeAdditionalfile2,TableS1 andFigureS1).Incontrast,phosphorylatedAKTwas equallyhighinboththeprimariesandmetastases(see Additionalfile2,TableS1).Interestingly,thenon-breast derivedbrainmetastasesshowedsimilarlyhighactivation oftheMAPKpathwaytogetherwithover-expression(3+ stain)ofEGFR(in9/11(81%)metastases(aprostateand onecoloncarcinomadidnot)butintheabsenceof HER3activation(0/11)(seeAdditionalfile2,TableS1).SomaticmutationanalysisOncoCartaanalysisidentifiedmutationsinthebrain metastasesfromprimarybre astcancers(non-autopsy cases)in NRAS (2/12-17%),and PIK3CA (2/12-17%) (Table1andFigure3).Mutationswerealsoidentifiedin brainmetastasesfromnon-breastprimariesin EGFR (3/ 9-33%;twolungandonekidney), HRAS (1/9-11%; lung), KRAS (2/9-22%;onecolonandonelung), NRAS (3/9-33%;twolungandonekidney)and PIK3CA (2/9 -22%;onemelanomaandonelung). MutantAlleleProportions(MAPs)rangedfrom9%to 80%.Allthesemutationswerevalidatedbyimmunohistochemistry(usingaspecificantibodyraisedagainstthe proteinwiththe EGFR E746_A750delmutation)or sequencingexceptforoneeachin EGFR,HRAS (validatedbyiPLEX), NRAS and PIC3CA ( validated by HRM),wheretheestimatedmutantalleleproportion waslessthan15%,andtwoin PIK3CA inwhichthere wasinsufficientgoodqualityDNAremainingtoobtain sequencedata. EGFR G719SappearedtobefoundfrequentlybyOncoCartabutcouldnotbedetectedby iPLEX,usingindependentPCRandextensionprimers. TheOncoCartafalse-positiveresultappearedtobedue tohairpinformationoftheextensionprimerthat occurredfrequentlywhenarchivalDNAwasusedasa template,andtheyieldwaslow. Exceptforone EGFR mutation(Case#13;Table1),the samesomaticmutationswereobservedinthebrain metastaseswithsimilarMAPsasinthematchedprimary breasttumors.Itwasnoteworthythatthefourmatched pairsharboringsomaticmutationin NRAS or PIK3CA alsooverexpressedamemberoftheHERfamily.For example,matchedpair#2hadamutationin NRAS and showedover-expressionofHER3,matchedpair#7hada mutationin NRAS andshowedover-expressionofHER1, matchedpair#9hadamutationin PIK3CA andamplificationofHER2andmatchedpair#10hadamutationin PIK3CA andoverexpressionofHER1(Table1). Amongtheautopsysamplesofcaseswithprimary breastcancer,wefoundmutationsin EGFR inoneliver andonelymphnodemetastases,andamutationin PIK3CA inallthesamplesfromonecase,andinaliver metastasisfromanother(seeAdditionalfile2,Table S2).One EGFR andone PIK3CA mutationcouldbeverifiedbysequencingorimmunohistochemistrybutlack ofgoodqualityDNA,andadditionalmutation-specific antibodies,prohibitedvalid ationoftheothers.Allthe samplesfromonecasehadthesamemutationatsimilar MAPs( PIK3CA H1074RinPatient#2). Weidentified HRAS and PIK3CA mutationsinthe basalbreastcancercelllinesSUM159andBT20.The mutationswithMAPs>25%havebeenreportedbefore [19,20]: HRAS G12D(MAP53.2%inSUM159)and PIK3CA H1047L(MAP50.0%inSUM159)andP539R (MAP43.8%inBT20)butwealsoidentified HRAS Q61KatMAP24.6%inSUM159and HRAS Q61Kat MAP14.1%,and PIK3CAH1047RatMAP44.4%in BT20.Inaddition,wewerealsoabletoshowthatallof themutationswithMAPs>25%werepresentinmammospheresderivedfromthesecelllines.DaSilva etal BreastCancerResearch 2010, 12 :R46 http://breast-cancer-research.com/content/12/4/R46 Page7of13

PAGE 8

DiscussionWehavecollectedauniquesetofclinicalmaterial throughcollaborationswithmultipleinstitutionsaround theworldandinvolvingbrainmetastaseswhichare rarelyexcised.Theanalysisofthisresourcehasledto thedevelopmentofhypothesesregardingthemechanismsofbreastcancercolonizationofthebrain(Figure4). Thesetoftumorsamplesisenrichedfortriplenegative/ basalbreastcancerswhichisconsistentwiththefindingsofanincreasedpropensityforbasalbreastcancers tometastasizetothebrain[3,9,36].Anassociation betweenCD44+/CD24-frequencyandabasaltumor phenotypehasalreadybeenreported[37]andinterestinglyweobservedanincreasedfrequencyofCD44 +/CD24-cellsinthebrainmetastasescomparedtotheir matchedprimaries.CD44+/CD24-cellshavebeen reportedtohavestemcellpropertiesandincreased in vivo tumorigenicity[38]andt heincreasedfrequency seeninbrainmetastasesmaysupportthis.Alternatively, thismayreflectselectionasaresultofahighcontentof hyaluron,theligandforCD44,withinthebrainmicroenvironment[39,40].Hence,thiscouldbeanimportant factorinbreastcancercolonizationofthebrainand thereforeapotentialaxisforfuturetherapeuticintervention[41]. Inthisstudy,brainmetastasesofbreastcancer expressedallmembersoftheHERfamilyoftyrosine kinasereceptors.HER2wasamplifiedandoverexpressed in20%ofbrainmetastases,EGFRwasoverexpressedin 21%ofbrainmetastases,HER3wasoverexpressedin 60%ofbrainmetastasesandHER4wasoverexpressedin 22%ofbrainmetastasesandgenerallymutuallyexclusive(Table1).Interesti ngly,HER3expressionwas increasedinbreastcancercellsresidinginthebrain. Neuregulin1,theligandforthisreceptor,isabundantly expressedinthebrain[34,35]andisreleasedbyavarietyofmechanismsincludingthepresenceofhypoxia [42].Consistentwiththis,weobservedtheincreased expressionof HIF-1alfa inthebrainmetastases,likelyto reflectthelocalhypoxicenvironment[43].Increased Figure3 Oncocartaandvalidationmutationanalyses A) .Exampleof NRAS Q61RmutationidentifiedbyOncoCartainmatchedpairsample #7showingrepresentativespectraandclusterplot. B) Sequencevalidationof NRAS G12C,sampleD6-lungmetastasis. C) Sequencevalidation of NRAS Q61R,breastandbrainmetastasisfromsample#2. D) Immunohistochemistryofbrainmetastasis(sampleD4)withantibodyspecificto EGFR E746_A750delshowingstaininginthetumorbutnotthesurroundingbraintissue. DaSilva etal BreastCancerResearch 2010, 12 :R46 http://breast-cancer-research.com/content/12/4/R46 Page8of13

PAGE 9

activationofbothHER3anddownstreammolecules (GRB2,ERK5,ERK1/2,JNK1/2,p38)wasalsoobserved inthebrainmetastases.Thesefindingspromptedusto hypothesizethatneuregulin/HER3activationisan importantmechanismforbreastcancercellcolonization ofthebrain(Figure4).Asafurthersupporttothis hypothesis,increasedHER3expressionhasalsobeen reportedinbrainmetastasesoflungcancer[44]. Weinvestigatedwhetherthisassociationwasgeneric toallbrainmetastasesandfoundactivationofthe MAPKpathwayinall11non-breastmetastasestothe brain.WhilstHER3wasnotactivatedinthesetumors, 9/11tumorsshowedover-expressionofEGFR.Ithas recentlybeenshown,usinganimalmodels,thatEGFR ligandsmediatebreastcancermetastasistothebrain andthatthiswasabrogatedbytheuseofEGFRinhibitorcetuximab[14].Thecombinationoflapatiniband trastuzumabhasbeenshowntohaveasynergistic, antiproliferativeeffectagainstErbB2-positivebreastcancercells invitro [45].Itispossible,therefore,thata combinationofanti-HERtherapiescouldbeeffectivein thetreatmentofbothbreastandnon-breastmetastases tothebrain. Inordertoactivatedownstreamsignalingpathways, HER3requiresheterodimerizationwithothermembers oftheHERfamilyfollowingbindingbyneuregulin[46] andevenbasallevelsoftheotherHERproteinsmaybe sufficienttoparticipateintheactivationofthesepathways.Hence,combinationtherapyagainsttheHER family,evenintheabsenceofover-expressionoramplificationofHER2,maybeofclinicalbenefitforalarger proportionofbreastcancerpatientssuchasthosewith HER2negativedisease.Recently,astudyshowedbenefitsforasmallgroupofHER2-negativepatientsinthe phaseIIINationalSurgicalAdjuvantBreastandBowel Project(NSABP)B-31trialthatwereHER2negativeby Figure4 Hypotheticalmechanismofbreastcancercellcolonizationofthebrainparenchyma .Hypoxicconditions,(HIF1a)canmediate theeleaseofneuregulin1fromneuronalcells.Neuregulin1istheligandforHER3andonbindingactivatestheheterodimerisationofHER3HER2,HER3-HER4and/orHER3-HER1,leadingtodownstreamactivationoftheMAPKandAKTpathways.MAPK/AKTpathwaysactivationis relatedtosurvival,invasion,proliferationandangiogenesis.AsecondmechanismofcolonizationmayrelatetotheenrichedexpressionofCD44 breastcancercellsinthebrain.Thebrainmicroenvironmentisrichinhyaluron,theligandforCD44,andsouponactivationaseriesof responsesmaybetriggered,includingcellmotility. DaSilva etal BreastCancerResearch 2010, 12 :R46 http://breast-cancer-research.com/content/12/4/R46 Page9of13

PAGE 10

FISHandhadlessthan3+stainingintensitybyHercepTest(Dako,Carpinteria,CA,USA)[47].Furthermore,anotherstudysuggestedthatthespectrumof patientswhomaybenefitfromtrastuzumab-basedtherapiescouldbeexpandedtoincludepatientswithmetastaticbreastcancerwithoutHER-2amplificationbut whoexpresstransmembraneneuregulin,theligandof HER3[48].Ithasalsobeenreportedinnon-HER2overexpressingxenograftmodelsofprostateandbreastcancerthatpertuzumab,aninh ibitorofHER3/HER2heterodimerization,caninhibittumorgrowth[49]. Forthefirsttime,wehaveidentifiedsomaticmutationsingenesrelatedtotheAKT/MAPKsignalingpathways,suchas EGFR PIK3CA KRAS HRAS and NRAS inbrainmetastasesofbreastcancerandothertypesof cancer.Inaddition,wehaveanalyzedmultipleautopsy samplesfromsixcasesthathadaprimarybreastcancer, andfoundadditional EGFR and PIK3CA mutationsin breastcancersthatmetastasizedtovarioussitesincludingthebrain.Thus,simplytargetingtheHERfamilyof receptorsmaynotbesufficientforcompletetreatment response.Thisanalysishighlightsadditional actionable targets[50]thatmayproveeffectiveforthetreatmentof somebrainmetastasis,suchasPI3kinaseinhibitors. Takentogether,thesefindingsarestrikingandshow anotherfacetofthecellevolutionlandscape[51],highlightingthepossibilityofcance rcellsresistingtargeted treatmenttomoleculessuchasHER2orEGFRby acquiringoncogenicmutationsindownstreampathways. Thishasbeenshown invitro withactivatingPIK3CA mutation[23]andhereinwedemonstratean invivo exampleofthispossiblescenariousinghumantumors. Inanotherclinicalangle,patientscurrentlytreatedwith theanti-EGFRmonoclonalantibodiescetuximaband panitumumabcanalsoacquireresistancetothistherapy duetodownstreammutationsinthe ras gene[24]. Interestingly,animalmodelshavesuggestedthatdownstreamNF-kappaBinhibitorydrugsmayplayarolein thetreatmentofpatientswithdefinedmutationsin KRAS [52]. InterestinglytheMutantAlleleProportion(MAP)was sometimesaslowas10%.Suchlowproportionmutations,whichwouldoftenbemissedbydirectsequencing couldreflectthepresenceofstromal(orbrain)contaminationinthesamples,tumorheterogeneityandamplificationordeletionofthemutantorwildtypealleles. However,thefactthatthesameMAPwasoften observedinboththeprimaryandthebrainmetastasis, andinthemultiplesamplesfromanautopsycase, mightsuggestthatthesemetastaseswerenotseededby asinglecellbutbygroupsofcellsfromtheprimary tumor.Thishasalsobeenshownbynextgeneration sequencing,wherebythemutantallelefrequencyfor somemutationswassimila rbetweenabasal-like primarybreastcanceranditsmatchedbrainmetastasis [53].However,itisalsoevidentthatsignificantgenomic evolutionoccursduringmetastasis,sincemostmutationsidentifiedinthismetastasis,andonefromaprimarylobularbreastcancer,weremoreprevalentinthe metastasisthanintherespectiveprimarytumours [53,54]ConclusionsInconclusion,weprovideevidencetosupportaroleof HER3andotherHERfamilyreceptorsintheabilityof cancercellstocolonizethebrain.Thedataareintriguingandsupportthepossibilitythattumorswithlow expressionofHER2mayrespondtotrastuzumab,lapitiniborcombinationsofHERfamilyreceptorinhibitors sinceevenbasallevelsmayenhancethesignaling throughhomo/hetero-dimer izationoftheotherreceptors.However,cautionshouldbeexercisedbecauseof thepossiblepresenceofdow nstreamoncogenicmutationsthatmaydrivetreatmentresistance.Thesetherapeuticmodalitiesmaythereforeaddanotherdimension tothetreatmentoftriplenegativeandbasal-likecancers wherecurrently,notargetedtherapyisavailable.AcknowledgementsLeonardDaSilvaandAnaCristinaVargasarerecipients ofPhDFellowshipsfromtheLudwigInstituteofCancer Research.LeonardDaSilvaisenrolledwiththe “ UniversidadeFederaldeSoPaulo,EscolaPaulistadeMedicina, CursodePs-Graduao,Doutorado,Departamentode AnatomiaPatolgica,SoPaulo,Brazil ” .PeterSimpsonis arecipientofafellowshipfromtheNationalBreastCancer Foundation.GeorgiaChenevix-TrenchandKumKum KhannaareSeniorPrincipalResearchFellowsofthe NHMRC.RLBisaCancerInstituteNSWFellow.Wealso acknowledgethehelpofstaffwithinanatomicalpathology, RBWH,Brisbane,theanimalhousefacilityatUQAIBN, Brisbane,CaseyWrightfromtheThoracicResearch Laboratory,SchoolofMedicine,attheUQ,andClayWinterfordandhisstafffromtheUQ/QIMRHistotechnology facility,andMackyEdmundsoninthesequencingfacility atQIMR.WewouldliketothankSequenomInc.forprovidingtheprimersequencesusedforHRM,and,inparticular,wethankDarrylIrwinforhishelp.AdditionalmaterialAdditionalfile1:Supplementarymethodologies .Thisfilecontains informationofhowthemorphologicalreviewandTMAcreationwere performed.Italsocontainsinformationonprotocolsfor immunohistochemistryandchromogenic insitu hybridization,RNA extractionandReal-TimeRT-PCR,DASLgeneexpressionprofiling,cell lineanalysisandculture,oncoCartasomaticmutationanalysisprotocols, highresolutionmeltanalysisandiPLEXgenotypingprotocols.DaSilva etal BreastCancerResearch 2010, 12 :R46 http://breast-cancer-research.com/content/12/4/R46 Page10of13

PAGE 11

Additionalfile2:Supplementaryresults .Thisfilecontainstablesand figuresregardingallimmunohistochemistrydata,extrageneexpression andmutationresults,andHERfamilygeneexpressionbyRT-PCR. Abbreviations CISH:chromogenic insitu hybridization;DASL:cDNA-mediatedAnnealing, Selection,extension,andLigation;EGFR:epidermalgrowthfactorreceptor; ER:estrogenreceptor;FFPE:formalinfixed-paraffinembedded;GEO:Gene ExpressionOmnibus;HER:humanepidermalgrowthfactorreceptor;HRM: HighResolutionMelt;IDC:invasiveductalcarcinoma;MAPs:MutantAllele Proportions;NSABP:NationalSurgicalAdjuvantBreastandBowelProject; NST:non-specifictype;PgR:progesteronereceptors. Authordetails1Molecular&CellularPathology,TheUniversityofQueenslandCentrefor ClinicalResearch,&SchoolofMedicine,Building918/B71,RBWHcomplex, Brisbane,4029,Australia.2CancerGeneticsandMolecularPathology,The QueenslandInstituteofMedicalResearch,300HerstonRoad,Brisbane,4006, Australia.3DepartamentodeAnatomiaPatolgica,UniversidadeFederalde SoPaulo,EPM,754RuaNapoleodeBarros,SoPaulo,04024-000,Brazil.4BiomolecularandBiomedicalScience,GriffithUniversity,170KesselsRoad, Brisbane,4011,Australia.5CentreforMagneticResonance,TheUniversityof Queensland,StLucia,Brisbane,4072,Australia.6LembagaEijkman,Eijkman Institute,Diponegoro69,Jakarta,10430,Indonesia.7Departamentode Patologia,InstitutoNacionaldeCncer,23PraaCruzVermelha,Riode Janeiro,20230-130,Brazil.8DepartamentodePatologia,LaboratrioSalomo &Zoppi,48RuaCorreiaDias,SoPaulo,04104-000,Brazil.9Departmentof Pathology,MedicalFacultyofCharlesUniversityinPlzen,Husova3,30605, CzechRepublic.10SydneyWestAreaHealthService,InstituteofClinical PathologyandMedicalResearch,UniversityofSydney,DarcyRoad,Sydney, 2145,Australia.11TranslationalOncology,SydneyWestAreaHealthService, WestmeadMillenniumInstitute,UniversityofSydney,DarcyRoad,Sydney, 2145,Australia.12DepartmentofPathology,PeterMacCallumCancerCentre, StAndrewsPl,EastMelbourne,3002,Australia.13QueenslandBrainInstitute, TheUniversityofQueensland,StLucia,Brisbane,4072,Australia.14Signal Transduction,TheQueenslandInstituteofMedicalResearch,300Herston Road,Brisbane,4006,Australia.15PathologyQueensland:TheRoyalBrisbane &Women ’ sHospital,HerstonRoad,Brisbane,4029,Australia.16Current address-UniversityofFlorida,McKnightBrainInstitute,100S.NewellDrive, Gainesville,32611,USA. Authors ’ contributions LDSanalysedtheimmunohistochemicalmarkers,accruedandcollatedthe data,carriedoutstatisticalandgeneexpressionanalysisanddraftedthe manuscript.PKandACVanalysedimmunohistochemicalmarkers,and accruedandcollatedthedata.NW,CESandPTSsupervisedgeneexpression analysesanddraftedthemanuscript.EP,PF,AS,MF,RB,MBandMC identifiedpatientswithbrainmetastasesintheirinstitutions,collected samplesandperformedinitialtumorclassification.LR,SP,PKandAL performedimmunohistochemistryandparticipatedintheconstructionof TMAs.KK,NK,BJMandBRparticipatedinthestudydesign.SB,SHandJB performedmutationanalyses.HD,ADandSFperformedvalidationofEGFR mutations.GCTandSRLconceivedthestudy,supervisedtheexperiments anddraftedthemanuscript. Competinginterests LeonardDaSilvaandSunilLakhaniholdanUSAregisteredpatentrelating tothedatainthismanuscript.Alltheotherauthorsdeclarenoconflictof interest. Received:14March2010Revised:15June2010Accepted:6July2010 Published:6July2010 References1.LinNU,BellonJR,WinerEP: CNSmetastasesinbreastcancer. JClinOncol 2004, 22 :3608-3617. 2.WeilRJ,PalmieriDC,BronderJL,StarkAM,SteegPS: Breastcancer metastasistothecentralnervoussystem. AmJPathol 2005, 167 :913-920. 3.HicksDG,ShortSM,PrescottNL,TarrSM,ColemanKA,YoderBJ,CroweJP, ChoueiriTK,DawsonAE,BuddGT,TubbsRR,CaseyG,WeilRJ: Breast cancerswithbrainmetastasesaremorelikelytobeestrogenreceptor negative,expressthebasalcytokeratinCK5/6,andoverexpressHER2or EGFR. AmJSurgPathol 2006, 30 :1097-1104. 4.ShmueliE,WiglerN,InbarM: Centralnervoussystemprogressionamong patientswithmetastaticbreastcancerrespondingtotrastuzumab treatment. EurJCancer 2004, 40 :379-382. 5.ThamYL,SextonK,KramerR,HilsenbeckS,ElledgeR: Primarybreast cancerphenotypesassociatedwithpropensityforcentralnervous systemmetastases. Cancer 2006, 107 :696-704. 6.ArteagaCL: ErbB-targetedtherapeuticapproachesinhumancancer. Exp CellRes 2003, 284 :122-130. 7.HudisCA: Trastuzumab – mechanismofactionanduseinclinicalpractice. NEnglJMed 2007, 357 :39-51. 8.RakhaEA,Reis-FilhoJS,EllisIO: Basal-likebreastcancer:acriticalreview. J ClinOncol 2008, 26 :2568-2581. 9.FulfordLG,Reis-FilhoJS,RyderK,JonesC,GillettCE,HanbyA,EastonD, LakhaniSR: Basal-likegradeIIIinvasiveductalcarcinomaofthebreast: patternsofmetastasisandlong-termsurvival. BreastCancerRes 2007, 9 : R4. 10.LuckAA,EvansAJ,GreenAR,RakhaEA,PaishC,EllisIO: Theinfluenceof basalphenotypeonthemetastaticpatternofbreastcancer. ClinOncol (RCollRadiol) 2008, 20 :40-45. 11.PagetS: Thedistributionofsecondarygrowthsincancerofthebreast. CancerMetastasisRev 1989, 8 :98-101. 12.MinnAJ,GuptaGP,SiegelPM,BosPD,ShuW,GiriDD,VialeA,OlshenAB, GeraldWL,MassagueJ: Genesthatmediatebreastcancermetastasisto lung. Nature 2005, 436 :518-524. 13.MinnAJ,KangY,SerganovaI,GuptaGP,GiriDD,DoubrovinM, PonomarevV,GeraldWL,BlasbergR,MassagueJ: Distinctorgan-specific metastaticpotentialofindividualbreastcancercellsandprimary tumors. JClinInvest 2005, 115 :44-55. 14.BosPD,ZhangXH,NadalC,ShuW,GomisRR,NguyenDX,MinnAJ,vande VijverMJ,GeraldWL,FoekensJA,MassaguJ:Genesthatmediatebreast cancermetastasistothebrain. Nature 2009, 459 :1005-1009. 15.PalmieriD,BronderJL,HerringJM,YonedaT,WeilRJ,StarkAM,KurekR, Vega-ValleE,FeigenbaumL,HalversonD,VortmeyerAO,SteinbergSM, AldapeK,SteegPS: Her-2overexpressionincreasesthemetastatic outgrowthofbreastcancercellsinthebrain. CancerRes 2007, 67 :4190-4198. 16.WoodLD,ParsonsDW,JonesS,LinJ,SjblomT,LearyRJ,ShenD, BocaSM,BarberT,PtakJ,SillimanN,SzaboS,DezsoZ,UstyankskyV, NikolskayaT,NikolskyY,KarchinR,WilsonPA,KaminkerJS,ZhangZ, CroshawR,WillisJ,DawsonD,ShipitsinM,WillsonJK,SukumarS,PolyakK, ParkBH,PethiyagodaCL,PantPV, etal : Thegenomiclandscapesof humanbreastandcolorectalcancers. Science 2007, 318 :1108-1113. 17.LinJ,GanCM,ZhangX,JonesS,SjblomT,WoodLD,ParsonsDW, PapadopoulosN,KinzlerKW,VogelsteinB,ParmigianiG,VelculescuVE: A multidimensionalanalysisofgenesmutatedinbreastandcolorectal cancers. GenomeRes 2007, 17 :1304-1318. 18.StephensPJ,McBrideDJ,LinML,VarelaI,PleasanceED,SimpsonJT, StebbingsLA,LeroyC,EdkinsS,MudieLJ,GreenmanCD,JiaM,LatimerC, TeagueJW,LauKW,BurtonJ,QuailMA,SwerdlowH,ChurcherC, NatrajanR,SieuwertsAM,MartensJW,SilverDP,LangerdA,RussnesHE, FoekensJA,Reis-FilhoJS,van ’ tVeerL,RichardsonAL,Brresen-DaleAL, etal : Complexlandscapesofsomaticrearrangementinhumanbreast cancergenomes. Nature 2009, 462 :1005-1010. 19.HollestelleA,NagelJH,SmidM,LamS,ElstrodtF,WasielewskiM,NgSS, FrenchPJ,PeetersJK,RozendaalMJ,RiazM,KoopmanDG,TenHagenTL, deLeeuwBH,ZwarthoffEC,TeunisseA,vanderSpekPJ,KlijnJG, DinjensWN,EthierSP,CleversH,JochemsenAG,denBakkerMA, FoekensJA,MartensJW,SchutteM: Distinctgenemutationprofiles amongluminal-typeandbasal-typebreastcancercelllines. BreastCancer ResTreat 2010, 121 :53-64. 20. COSMIC-CatalogueofSomaticMutationsinCancer. [http://www.sanger. ac.uk/genetics/CGP/cosmic/].DaSilva etal BreastCancerResearch 2010, 12 :R46 http://breast-cancer-research.com/content/12/4/R46 Page11of13

PAGE 12

21.HuX,SternHM,GeL,O ’ BrienC,HayduL,HonchellCD,HavertyPM, PetersBA,WuTD,AmlerLC,ChantJ,StokoeD,LacknerMR,CavetG: Geneticalterationsandoncogenicpathwaysassociatedwithbreast cancersubtypes. MolCancerRes 2009, 7 :511-522. 22.HynesNE,DeyJH: PI3Kinhibitionovercomestrastuzumabresistance: blockadeofErbB2/ErbB3isnotalwaysenough. CancerCell 2009, 15 :353-355. 23.JunttilaTT,AkitaRW,ParsonsK,FieldsC,LewisPhillipsGD,FriedmanLS, SampathD,SliwkowskiMX: Ligand-independentHER2/HER3/PI3K complexisdisruptedbytrastuzumabandiseffectivelyinhibitedbythe PI3KinhibitorGDC-0941. CancerCell 2009, 15 :429-440. 24.NormannoN,TejparS,MorgilloF,DeLucaA,VanCutsemE,CiardielloF: ImplicationsforKRASstatusandEGFR-targetedtherapiesinmetastatic CRC. NatRevClinOncol 2009, 6 :519-527. 25.FanJB,YeakleyJM,BibikovaM,ChudinE,WickhamE,ChenJ,DoucetD, RigaultP,ZhangB,ShenR,McBrideC,LiHR,FuXD,OliphantA,BarkerDL, CheeMS: Aversatileassayforhigh-throughputgeneexpression profilingonuniversalarraymatrices. GenomeRes 2004, 14 :878-885. 26.ThomasRK,BakerAC,DebiasiRM,WincklerW,LaframboiseT,LinWM, WangM,FengW,ZanderT,MacConaillL,LeeJC,NicolettiR,HattonC, GoyetteM,GirardL,MajmudarK,ZiaugraL,WongKK,GabrielS, BeroukhimR,PeytonM,BarretinaJ,DuttA,EmeryC,GreulichH,ShahK, SasakiH,GazdarA,MinnaJ,ArmstrongSA, etal : High-throughput oncogenemutationprofilinginhumancancer. NatGenet 2007, 39 :347-351. 27.KrypuyM,NewnhamGM,ThomasDM,ConronM,DobrovicA: High resolutionmeltinganalysisfortherapidandsensitivedetectionof mutationsinclinicalsamples:KRAScodon12and13mutationsinnonsmallcelllungcancer. BMCCancer 2006, 6 :295. 28.YuJ,KaneS,WuJ,BenedettiniE,LiD,ReevesC,InnocentiG,WetzelR, CrosbyK,BeckerA,FerranteM,CheungWC,HongX,ChirieacLR,ShollLM, HaackH,SmithBL,PolakiewiczRD,TanY,GuTL,LodaM,ZhouX, CombMJ: Mutation-specificantibodiesforthedetectionofEGFR mutationsinnon-small-celllungcancer. ClinCancerRes 2009, 15 :3023-3028. 29.EllisIO,SchnittSJ,Sastre-GarauX,BussolatiG,TavassoliFA,EusebiV, PeterseJL,MukaiK,TabarL,JacquemierJ, etal : Invasivebreast carcinomas. PathologyandGeneticsofTumoursoftheBreastandFemale GenitalOrgans Lyon:IARCPressTavassoliFA,DevileeP2003,13-59. 30.DiGiovannaMP,LermanMA,CoffeyRJ,MullerWJ,CardiffRD,SternDF: ActivesignalingbyNeuintransgenicmice. Oncogene 1998, 17 :1877-1884. 31.WeigeltB,HuZ,HeX,LivasyC,CareyLA,EwendMG,GlasAM,PerouCM, Van ’ tVeerLJ: Molecularportraitsand70-geneprognosissignatureare preservedthroughoutthemetastaticprocessofbreastcancer. Cancer Res 2005, 65 :9155-9158. 32.KaoLS,GreenCE: Analysisofvariance:isthereadifferenceinmeansand whatdoesitmean? JSurgRes 2008, 144 :158-170. 33.SchulzeWX,DengL,MannM: PhosphotyrosineinteractomeoftheErbBreceptorkinasefamily. MolSystBiol 2005,1 :2005. 34.LawAJ,ShannonWeickertC,HydeTM,KleinmanJE,HarrisonPJ: Neuregulin-1(NRG-1)mRNAandproteinintheadulthumanbrain. Neuroscience 2004, 127 :125-136. 35.Pinkas-KramarskiR,EilamR,SpieglerO,LaviS,LiuN,ChangD,WenD, SchwartzM,YardenY: BrainneuronsandglialcellsexpressNeu differentiationfactor/heregulin:asurvivalfactorforastrocytes. ProcNatl AcadSciUSA 1994, 91 :9387-9391. 36.GaedckeJ,TraubF,MildeS,WilkensL,StanA,OstertagH,ChristgenM,von WasielewskiR,KreipeHH: PredominanceofthebasaltypeandHER-2/neu typeinbrainmetastasisfrombreastcancer. ModPathol 2007, 20 :864-870. 37.HonethG,BendahlPO,RingnerM,SaalLH,Gruvberger-SaalSK,LovgrenK, GrabauD,FernoM,BorgA,HegardtC: TheCD44+/CD24-phenotypeis enrichedinbasal-likebreasttumors. BreastCancerRes 2008, 10 :R53. 38.Al-HajjM,WichaMS,Benito-HernandezA,MorrisonSJ,ClarkeMF: Prospectiveidentificationoftumorigenicbreastcancercells. ProcNatl AcadSciUSA 2003, 100 :3983-3988. 39.NandiA,EstessP,SiegelmanMH: Hyaluronananchoringandregulation onthesurfaceofvascularendothelialcellsismediatedthroughthe functionallyactiveformofCD44. JBiolChem 2000, 275 :14939-14948. 40.AlQteishatA,GaffneyJJ,KrupinskiJ,SlevinM: Hyaluronanexpression followingmiddlecerebralarteryocclusionintherat. Neuroreport 2006, 17 :1111-1114. 41.MarangoniE,LecomteN,DurandL,dePinieuxG,DecaudinD, ChomienneC,Smadja-JoffeF,PouponMF: CD44targetingreduces tumourgrowthandpreventspost-chemotherapyrelapseofhuman breastcancersxenografts. BrJCancer 2009, 100 :918-922. 42.ParkerMW,ChenY,HallenbeckJM,FordBD: Neuregulinexpressionafter focalstrokeintherat. NeurosciLett 2002, 334 :169-172. 43.WangGL,SemenzaGL: Characterizationofhypoxia-induciblefactor1 andregulationofDNAbindingactivitybyhypoxia. JBiolChem 1993, 268 :21513-21518. 44.SunM,BehrensC,FengL,OzburnN,TangX,YinG,KomakiR,VarellaGarciaM,HongWK,AldapeKD,WistubaII: HERfamilyreceptor abnormalitiesinlungcancerbrainmetastasesandcorresponding primarytumors. ClinCancerRes 2009, 15 :4829-4837. 45.KonecnyGE,PegramMD,VenkatesanN,FinnR,YangG,RahmehM, UntchM,RusnakDW,SpeharG,MullinRJ,KeithBR,GilmerTM,BergerM, PodratzKC,SlamonDJ: Activityofthedualkinaseinhibitorlapatinib (GW572016)againstHER-2-overexpressingandtrastuzumab-treated breastcancercells. CancerRes 2006, 66 :1630-1639. 46.BergerMB,MendrolaJM,LemmonMA: ErbB3/HER3doesnot homodimerizeuponneuregulinbindingatthecellsurface. FEBSLett 2004, 569 :332-336.47.SPaikCK,JeongJ,GeyerCE,RomondEH,Mejia-MejiaO,MamounasEP: Benefitfromadjuvanttrastuzumabmaynotbeconfinedtopatients withIHC3+and/orFISH-positivetumors:Centraltestingresultsfrom NSABPB-31. ASCOAnnualMeetingProceedings(Post-MeetingEdition), JournalofClinicalOncology 2007, 25(18S) :511. 48.deAlavaE,OcanaA,AbadM,MonteroJC,Esparis-OgandoA,RodriguezCA, OteroAP,HernandezT,CruzJJ,PandiellaA: Neuregulinexpression modulatesclinicalresponsetotrastuzumabinpatientswithmetastatic breastcancer. JClinOncol 2007, 25 :2656-2663. 49.AgusDB,AkitaRW,FoxWD,LewisGD,HigginsB,PisacanePI,LofgrenJA, TindellC,EvansDP,MaieseK,ScherHI,SliwkowskiMX: TargetingligandactivatedErbB2signalinginhibitsbreastandprostatetumorgrowth. CancerCell 2002, 2 :127-137. 50.MacConaillLE,CampbellCD,KehoeSM,BassAJ,HattonC,NiuL,DavisM, YaoK,HannaM,MondalC,LuongoL,EmeryCM,BakerAC,PhilipsJ, GoffDJ,FiorentinoM,RubinMA,PolyakK,ChanJ,WangY,FletcherJA, SantagataS,CorsoG,RovielloF,ShivdasaniR,KieranMW,LigonKL, StilesCD,HahnWC,MeyersonML, etal : Profilingcriticalcancergene mutationsinclinicaltumorsamples. PLoSOne 2009, 4 :e7887. 51.RomeroPA,ArnoldFH: Exploringproteinfitnesslandscapesbydirected evolution. NatRevMolCellBiol 2009, 10 :866-876. 52.MeylanE,DooleyAL,FeldserDM,ShenL,TurkE,OuyangC,JacksT: RequirementforNF-kappaBsignallinginamousemodeloflung adenocarcinoma. Nature 2009, 462 :104-107. 53.DingL,EllisMJ,LiS,LarsonDE,ChenK,WallisJW,HarrisCC,McLellanMD, FultonRS,FultonLL,AbbottRM,HoogJ,DoolingDJ,KoboldtDC, SchmidtH,KalickiJ,ZhangQ,ChenL,LinL,WendlMC,McMichaelJF, MagriniVJ,CookL,McGrathSD,VickeryTL,AppelbaumE,DeschryverK, DaviesS,GuintoliT,LinL, etal : Genomeremodellinginabasal-like breastcancermetastasisandxenograft. Nature 2010, 464 :999-1005. 54.ShahSP,MorinRD,KhattraJ,PrenticeL,PughT,BurleighA,DelaneyA, GelmonK,GulianyR,SenzJ,SteidlC,HoltRA,JonesS,SunM,LeungG, MooreR,SeversonT,TaylorGA,TeschendorffAE,TseK,TurashviliG, VarholR,WarrenRL,WatsonP,ZhaoY,CaldasC,HuntsmanD,HirstM, MarraMA,AparicioS: Mutationalevolutioninalobularbreasttumour profiledatsinglenucleotideresolution. Nature 2009, 461 :809-813. 55.EllisIO,SchnittSJ,Sastre-GarauX, etal : Invasivebreastcarcinomas. PathologyandGeneticsofTumoursoftheBreastandFemaleGenitalOrgans Lyon:IARCPressTavassoliFA,DevileeP2003,13-59. 56.BibikovaM,TalantovD,ChudinE,YeakleyJM,ChenJ,DoucetD, WickhamE,AtkinsD,BarkerD,CheeM,WangY,FanJB: Quantitativegene expressionprofilinginformalin-fixed,paraffin-embeddedtissuesusing universalbeadarrays. AmJPathol 2004, 165 :1799-1807. 57.FanJB,YeakleyJM,BibikovaM,ChudinE,WickhamE,ChenJ,DoucetD, RigaultP,ZhangB,ShenR,McBrideC,LiHR,FuXD,OliphantA,BarkerDL,DaSilva etal BreastCancerResearch 2010, 12 :R46 http://breast-cancer-research.com/content/12/4/R46 Page12of13

PAGE 13

CheeMS: Aversatileassayforhigh-throughputgeneexpression profilingonuniversalarraymatrices. GenomeRes 2004, 14 :878-885. 58.DaSilvaL,ParryS,ReidL,KeithP,WaddellN,KossaiM,ClarkeC, LakhaniSR,SimpsonPT: AberrantexpressionofE-cadherininlobular carcinomasofthebreast. AmJSurgPathol 2008, 32 :773-783. 59.KramerD,ThunnissenFB,Gallegos-RuizMI,SmitEF,PostmusPE,MeijerCJ, SnijdersPJ,HeidemanDA: Afast,sensitiveandaccuratehighresolution melting(HRM)technologybasedassaytoscreenforcommonK-ras mutations. CellularOncology 2009, 31 :161-167. doi:10.1186/bcr2603 Citethisarticleas: DaSilva etal .: HER3anddownstreampathwaysare involvedincolonizationofbrainmetastasesfrombreastcancer. Breast CancerResearch 2010 12 :R46. Submit your next manuscript to BioMed Central and take full advantage of: Convenient online submission Thorough peer review No space constraints or color gure charges Immediate publication on acceptance Inclusion in PubMed, CAS, Scopus and Google Scholar Research which is freely available for redistribution Submit your manuscript at www.biomedcentral.com/submit DaSilva etal BreastCancerResearch 2010, 12 :R46 http://breast-cancer-research.com/content/12/4/R46 Page13of13

PAGE 14

Additional file 1 Morphological review & TMA creation Haematoxylin & eosin (H&E) sections were reviewed by three pathologists (LDS, MC, SRL) to confirm the diagnosis, assess morphology and grade the tumours according to the World Health Organization c rite ria [55] Tissue microarrays (TMA) were built using the tissue arrayer, model MTAI (Beecher Instruments, Inc, Sun Prairie, WI 53590 USA) to facilitate screening of clinical samples using immunohistochemistry and in situ hybridization. H&E slides were dotted by LDS in order to take representative 0.6mm diameter cores of each tumour for analysis. Two cores were taken from each tumour. Two sets of TMAs were built. The first TMA set comprised 29 primary breast cancers and their matched brain metastases and 22 un matched brain metastases. The second TMA set comprised 10 primary breast cancers and their matched brain metastases, as well as the 11 non breast brain metastases. Slides and paraffin blocks from 38 tumor samples (primary breast cancer and metastases to m ultipl e sites, including brain) from 8 autopsy cases of patients who died of metastatic breast cancer were also available. Immunohistochemistry and chromogenic in situ hybridization Four micron thick sections of the paraffin blocks were cut on to silane c oated slides. Immunohistochemistry was performed using the Envision dual link system (Dakocytomation, all antibody details. Antigenic retrieval for all antibodies ( except smooth muscle actin (SMA) which did not require any antigen retrieval and EGFR 5 minutes chymotrypsin digestion) required two minutes pressure cooking (105 o C) in EDTA (pH8.0) buffer. Positive and negative

PAGE 15

controls were included in all runs and all slides were analysed by at least two pathologists (LDS, PP or SRL) using double headed optical light microscope. HER2 staining and scoring used a minimum 30% percent cut off of positivity with strong complete membrane staining to regard a case as HER2 ove rexpressed (3+). The same criteria were used for EGFR, HER3 and HER4 and assessed in the periphery of the tumors. For all other antibodies, samples were considered positive if more than 10% of tumor cells were stained in one or both cores on the TMA. Cellu lar localization (membrane, cytoplasm, nuclear), staining intensity (negative, weak/1+, moderate/2+, strong/3+) and percentage/number of positively stained neoplastic cells was recorded. A tumor positive (CK5/6, CK14, CK17, p 63, SMA, EGFR). The EGFR, HER3, HER4, CD44 and CD24 were assessed on whole sections and not as double stain. Digital slide images are available at http://aperio.qimr.edu.au/ The usernam e in situ hybridization was performed following instructions of the Zymed Spot LightHER2 CISH TM Kit (Zymed, California, USA). Bri efly, the paraffin embedded sections were dewaxed and subjected to heat and enzyme digestion treatments followed by denaturation and hybridization to labelled nucleic acid probes. Immunodetection Diaminobenzidine tetrachloride was u sed for visualization. Slides were counterstained with haematoxylin. A positive control for HER2 amplification was included in each run. Signals were counted under a brightfield microscope and results were classified into diploid, polysomy, low amplificati recommendation. Immunohistochemistry using an antibody raised against the E746_A750del mutated EGFR protein was performed to validate Oncocarta data Myoepithelial cells of

PAGE 16

normal breast tissue whi ch are normally positive for wild type EGFR, were also used as negative control for the E746_A750del mutation antibody Supplementary Table 1 Details of Antibodies Used in Immunohistochemistry Antibody Company Clone Dilution ER Novocastra 6F11 1: 100 PR Novocastra 1A6 1:500 HER2 DAKO Herceptest HER3 Novus Biologicals RTJ2 1:80 HER4 Santa Cruz C 18 1:100 EGFR Zymed 31G7 1:100 p63 DAKO 4A4 1:400 SMA DAKO 1A4 1:100 p53 DAKO D07 1:100 CD44 DAKO DF1485 1:100 CD24 Serotec SN3 1:200 CK5/6 DAKO D5/16B4 1:50 CK14 Neomarkers LL002 1:50 E cadherin Zymed HECD 1 1:20 CK19 DAKO RCK108 1:25 CK7 DAKO OV TL 12/30 1:500 CK17 DAKO E3 1:100 CK8/18 Novocastra 5D3 1:100 Phospho HER3 Cell Signalling Tyr 1289 (21D3) 1:300 Phospho AKT Invitrogen pT 308 1:300 Phospho ERK1/ERK2 Invitrogen pTpY 185/187 1:300 Phospho JNK1/2 Invitrogen pTpY 183/185 1:300 Phospho ERK5 Invitrogen pTpY 180/182 1:300 p38 Invitrogen pTpY 218/220 1:300 Mutated EGFR Cell Signalling E746 A750del( 6b6) 1:100 Ki 67 Dako MIB1 1:100 GRB2 Cell Signalling 1:100 HI F1 alfa Cell Signalling 1:100 RNA extraction and Real Time RT PCR waxed in two lots of xylene and two lots of 100% ethanol, 10 minutes each. RNA was extracted using the High Pure RNA

PAGE 17

Paraffin Kit (Roche Applied Science, Mannheim, Germany) according to the protocol. RNA was quantified using the NanoDrop ND 1000 (NanoDrop Technologies, DE, USA). Relative expression levels of HER3, HER2, EGFR, HER4, HIF1 alfa and CCNH was assessed using RT PCR. Complementary DNA (cDNA) was synthesized from 240 ng of total RNA using random hexamers and the SuperScript TM III Reverse Transcriptase kit (Invitrogen, Carsbald, CA, USA). TaqMan One Step UniversalMaster Mix (Applied Biosystems) was used for all reactions. TaqMan reaction was done in a standard 96 well p late format with ABI 7500 OneStepPlus PCR system. For data analysis, raw deltaCt (dCt) was first normalized to an endogenous control gene (RPL13a) for each sample to generate normalized dCt. The normalized dCt was then calibrated to a cell line pool refere nce (MCF 7, SKBR 3 and MDA MB 231) to generate a ddCt. In the final step of data analysis, the ddCt was converted to fold change (2 ddCt ) relative to the reference allowing comparison between samples. DASL gene expression profiling Gene expression profili ng was performed using the DASL assay (cDNA mediated annealing, selection extension and ligation, Illumina Inc., California, USA) to interrogate the DASL Cancer Panel that contained 512 cancer related genes [56 58] All protocols were as specified by Illu mina Inc. Briefly, RNA (250ng) was converted to cDNA through a reverse transcription reaction with biotinylated oligo d(T) 18 and random nonamers. Gene specific oligonucleotides (three unique pairs for each of the 512 genes) were annealed to the biotinylate d cDNA, the duplexes were bound to streptavidin conjugated paramagnetic particles to remove non hybridized oligos. The annealed oligos were then extended and ligated (to incorporate an address sequence and primer site) to generate amplifiable products. The se products were subjected to

PAGE 18

PCR amplification using fluorescently labeled (Cy3 and Cy5) primers. The labeled PCR products were hybridized to a Sentrix array or Beadchip. Following hybridization, the arrays were scanned with a BeadArray Reader (Illumina) and data was extracted usin g BeadStudio version 3 software ( Illumina). Samples exhibiting a median hybridization intensity across all probes of <600 (background corrected) were excluded from analysis. Individual probes with a BeadStudio detection score gre ater than 0.99 in more than 15 conditions were included which left 1234 probes in the analysis. Array data transformation and normalization (per chip normalized to 50th percentile and per gene normalized to median) was done in Genespring version 7.0 softw are (Agilent Technologies, Santa Clara, USA). Hierarchical clustering was performed using Pearson Correlation and Average Linkage clustering algorithm. Principal component analysis was also performed. A linear model was fitted (limma) and a moderated t sta tistic wa s performed for differential expression. DASL data is available from Gene Expression Omnibus ( http://www.ncbi.nlm.nih.gov/geo/ Accession number GSE14690). Cell lines SUM159 and BT20 m a m mospheres wer e grown in 5 ml of serum free DMEM/F12 (NSA) medium containing freshly added 20 ng/ml rhEGF (R&D Systems), 10 ng/ml rhFGF (R&D Systems), 4 ug/ml heparin, 10% proliferation supplement (NeuroCult, Stem Cell Technologies Inc.), 2% BSA (Sigma). Breast cancer cell lines MCF 7, MDA MB 231 and SKBR 3 were inactivated fetal bovine serum (FBS), 2 mmol/L glutamine, and 1% penicillin G streptomycin solution. OncoCarta somatic mutation analysis

PAGE 19

Onco genic mutations in tumour samples were profiled using the OncoCarta Assay Panel v1.0, which offers rapid, parallel analysis of 238 mutations across 19 common oncogenes. All n Diego, CA). PCR amplification was carried out using 20 ng DNA as a template for each Assay. Post PCR treatment by shrimp alkaline phosphatase was followed by the TypePLEX Extend Reaction. Following this step, CLEAN Resin (Sequenom) was added to the mixtu re to remove extraneous salts that could interfere with the MALDI TOF analysis. Allelotyping was determined by robotically spotting 15 nl of each extension product onto a SpectroCHIP II, which was subsequently read by the MassARRAY Compact Analyzer. Some mutations were validated with a second OncoCarta analysis, using just a subset of primers that detect the relevant EGFR mutations. Poor quality samples were identified by evaluating the primer extension rates. All samples in which more than 10% of assays h ad less than 50% primer extension were defined as poor quality and removed from further analysis. High Resolution Melt Analysis For cases with sufficient DNA available, we carried out High Resolution Mel t (HRM) a nalysis to validate mutations in KRAS, HR AS, NRAS and PIK3CA identifi ed with the OncoCarta Assay. Primers used for HRM Analysis were the same as those used in the OncoCarta Assay Panel and are shown in Supplementary Table 2. PCR reactions for HRM for KRAS, HRAS, NRAS and PIK3CA were performed on a LightCycler 480 (Roche Diagnostics, Mannheim, Germany) in 10ul final volume containing 1x LightCycler 480 High Resolution Melting Master Mix (Roche Diagnostics), 500 nM forward primer, 500 nM reverse primer, 30 mM MgCl 2 and 10 ng genomic DNA. The cycling conditions were as follows: Pre incubation at 95C for 5min, followed by 26

PAGE 20

cycles of 95C for 10 s, touchdown from 65C to 53C ( 0.5C/cycle) for 10 s and 72C for 10 s, followed by a further 19 cycles at 53C annealing temperature. The melting program consisted of one cycle at 95C for 1 min, 40C for 1 min and then continuous fluorescent reading from 65 to 95C at 25 acquisitions per C. HRM data were analysed using the LightCycler 480 Gene Scanning Software (Roche Diagnostics) as previously described [59] Supplementary Table 2 Primers used for HRM Analysis Primer name Targeted Mutation Primer Sequence Product Size NRAS_6 1st Primer Q61R ACGTTGGATGTCGCCTGTCCTCATGTATTG 99 NRAS_6 2nd Primer ACGTTGGATGCCTGTTTGTTGGACATACTG PIK3CA_6 1st Pri mer E545K ACGTTGGATGTACACGAGATCCTCTCTCTG 90 PIK3CA_6 2nd Primer ACGTTGGATGTAGCACTTACCTGTGACTCC Sequencing For cases with sufficient DNA available, and an OncoCarta Assay result of > 30% mutant allele proportion (MAP) for KRAS, HRAS, NRAS and PIK3CA we used direct sequencing for validation. Primers for sequencing (Supplementary Table 3) were designed using the web based programme Primer 3 ( http://frodo.wi.mit.edu/primer3/ ). PCR reactions were performed i n a final volume of 20 l and contained 15 ng DNA, 200 nM of each primer, 250 M dNTPs, 1 PCR buffer with 2 mM MgCl 2 and 1 U i STAR Taq polymerase (Scientifix, Clayton, Australia ). Touchdown amplification was as follows : 94 o C for 12 min, followed by fou r sets of four cycles of 94 o C for 30 s, 61 o C to 55 o C for 45 s and 72 o C for 30 s, with the annealing temperature dropping 2 o C after each set of four cycles, followed by 30 cycles of 94 o C for 30 s, 55 o C for 45 s and 72 o C for 30 s, and a final extension of 7 2 o C for 7 min. PCR reactions were purified with the QIAGEN PCR purification kit and sequenced using Big Dye (version 3.1) sequencing chemistry

PAGE 21

and the PE Applied Biosystems 377 sequencer. The resulting chromatograms were compared with wild type samples whi ch were sequenced as controls. Supplementary Table 3 Primers for sequencing Primer name Targeted Mutation Primer Sequence Product Size KRAS1 2/4_(G12C/G13D) F G12C and G13D TTAACCTTATGTGTGACATGTTCTAA 171 KRAS1 2/4_(G12C/G13D) R TGGATCATATTCGTCCACAAA A NRAS2_(G12C) F G12C GATGTGGCTCGCCAATTAAC 175 NRAS2_(G12C) R CTCACCTCTATGGTGGGATCA NRAS6_(Q61R) F Q61R CACCCCCAGGATTCTTACAG 173 NRAS6_(Q61R) R TCCGCAAATGACTTGCTATT PIK3CA9_(H1047L) F H1047L TGAGCAAGAGGCTTTGGAGT 190 PIK3CA9_(H1047L) R GGTCTTT GCCTGCTGAGAGT iPLEX genotpying For cases with sufficient DNA available we us ed technology to validate mutations in NRAS, PIK3CA and EGFR identifi ed with the OncoCarta Assay The design of oligonucleotides was carr ied out according to the guidelines of Sequenom Inc. and performed using MassARRAY Assay Design software (version 1.0). Four P lex PCR amplification of amplicons containing variants of interest was performed using Qiagen HotStart Taq Polymerase on a Perkin Elmer GeneAmp 2400 thermal cycler with 5 ng genomic DNA in a 2.5 l reaction. instructions for iPLEX chemistry. Assay data were analysed using Sequenom TYPER software (Version 3.4).

PAGE 22

Supplementary Table 4 Primers for iPLEX Primer name Mutation Primer Sequence Product Size NRAS_Q61R_q1 Q61R ACGTTGGATGCCTGTTTGTTGGACATACTG NRAS_Q61R_q2 ACGTTGGATGTCGCCTGTCCTCATGTATTG NRAS_Q61R_q3 TGGCACTGTACTCTTCT PIK3CA_E545K_q1 E545K ACGTTGGATGTACACGAGATCCTCTCTCTG PIK3CA_E545K_q2 ACGTTGGATGTAGCACTTACCTGTGACTCC PIK3CA_E545K_q3 AGAAAATCTTTCTCCTGCT PIK3CA_H1047R_iPlex F H1047R ACGTTGGATGAACTGAGCAAGAGGCTTTGG PIK3CA_H1047R_iPlex R ACGTTGGATGTCCATTTTTGTTGTCCAGCC PIK3CA_H1047R_iPlex Ext ATGAAACAAATGAATGATGCAC HRAS_G13S_iPlex F G13S ACGTTGGATGAATGGTTCTGGATCAGCTGG HRAS_G13S_iPlex R ACGTTGGATGGACGGAATATAAGCTGGTGG HRAS_G13S_iPlex Ext CGCACTCTTGCCCACAC NRAS_G12C_iPlex F G12C ACGTTGGATGAGTGGTTCTGGATTAGCTGG NRAS_G12C_iPlex R ACGTTGGATGGACTGAGTACAAACTGGTGG NRAS_G12C_iPlex Ext GCTTTTCCCAACACCAC EGFR_E746_A750del_iPlex F E746_A750del ACGTTGGATGGATCCCAGAAGGTGAGAAAG EGFR_E746_A750del_iPlex R ACGTTGGATGTCGAGGATTTCCTTGTTGGC EGFR_E746_A750del_iPlex Ext AATTCCCGTCGCTATCAA PIK3CA_R38H_iPlex F R38H ACGTTGGATGGGGGTATTTTCTTGCTTCTT PIK3CA_R38H_iPlex R ACGTTGGATGCCAAATGGAATGATAGTGAC PIK3CA_R38H_iPlex Ext ATGGTTATTAATGTAGCCTCA

PAGE 23

Additional file 2 Table 1 Immunohistochemistry results Antibody Primary breast tumor N/T (%) Matched brain metastases N/T (%) Unmatched brain metastases N/T (%) Non breast brain metastases N/T (%) E R 15/37(40%) 15/37 (40%) 4/21 (23%) NP P R 9/37 ( 24%) 9/37 (24%) 5/21 (19%) NP HER2 7/34 (20%) 7/35 (19%) 5/24 (20%) NP Triple negative 19/29(56%) 20/35(48%) 10/22(45%) NP CK5/6 9/26 (34%) 9/26 (34%) 2/16 (12%) NP CK14 15/35 (42%) 16/36 (44%) 8/16 (50%) NP CK17 5/26 (19%) 5/26 (19%) 5/16 (30%) NP EGFR 6/26 (23%) 6/26 (23%) 3/16 (18%) 9/11 (81%) p63 0/26 0/26 1/15 (5%) NP SMA 6/26 (23%) 6/26 (23%) 2/15 (13%) NP Basal like 20/37 (54%) 21/35 (60%) 11/22 (50%) NP CD44 5/20 (25%) 13/20 (65%) 10/22 (45%) NP CD24 5/22 (22%) 2/22 (9%) 3/22 (14%) NP CD44 + CD24 5/20(25%) 11/20 (55%) 10/22(45%) NP p53 16/26 (61%) 19/26 (73%) 14/20 (70%) NP KI 67 19/37(51%) 32/37 (86%) 18/21 (85%) NP CK19 24/26 (92%) 24/26 (92%) 15/15 (100%) NP CK8/18 14/26 (53%) 14/26 (53%) 15/15 (100%) NP E cadherin 19/26 (73% ) 19/23 (82%) 18/18 (100%) NP HER3 11/37 (29.7%) 22/37 (59%) 13/21 (62%) NP HER4 7/35(20%) 6/26 (23%) 5/24 (20%) NP Phospho HER3 14/37 (38 %) 24/37 (64%) 18/21 (85%) 0/11 Phospho AKT 32/37 (86%) 32/37 (86%) 15/21 (71%) 11/11 (100%) Phospho ERK1/2 28 /37 (75%) 36/37 (97%) 20/21(95%) 11/11 (100%) Phospho JNK1/2 26/37 (70 %) 34/37 (91%) 19/21 (90%) 11/11 (100%) Phospho ERK5 2 9/37 (78%) 36/37 (97%) 20/21 (95%) 11/11 (100%) p38 29 /37 (78 %) 37/37 (100%) 21/21 (100%) 11/11(100%) GRB2 13/36 (36%) 16/36 ( 44%) 11/22 (50%) NP HIF1 alfa 9/37 (24%) 20/35(48%) 8/16 (50%) NP Legend: N = number of tumor cases showing positivity; T = total number of cases assessable for the antibody specified; % = percentage of cases showing positivity; NP = not performed; A tu CK14, CK17, p 63, SMA, EGFR,) in more than 10% of cells Triple negative tumors were negative for ER, PR and HER2. CD44+/CD24 immunohistochemistry was assessed on serial sect ions and positivity was expression in >10% cells. X 2 test with Yates correction (95% confidence interval ) showed significant differences between matched primaries and metastases as follow: phospho Her3 p =0.046 phosphor ERK 1 /2 p= 0.0 17, phosphor ERK5 p=0. 032, phosphor JNK p= 0.037 p38 p=0.00 8 HER3 p=0.019, HIF1 alfa p=0.009 and CD44 p=0.026. GRB2 showed a trend p=0.1

PAGE 24

Figure 1 Scatter plots showing distribution of positivity for ER, phospho HER3, phospho ERK1/2 and phospho ERK5 across matched and un matched samples Panel on left shows the correlation of immunohistochemical score between primary tumor (x axis) and the matched metastasis (y axis). The panel on the right shows the immunohistochemical score (y axis) for each marker in individual unmatche d metastases (x axis).

PAGE 25

Figure 2: Principal component analysis using the 27 gene list from figure 2B showing good separation between brain metastases (red squares) and primaries (blue squares). Table 2: Somatic mutations in autopsy samples

PAGE 26

Case ID# Site GRADE EGFR PIK3CA Mutation MAP Mutation MAP 1 Breast 3 Brain Lung Mediastinal lymph node Adrenal gland 2 Brain H1047R I, S 57.6% Liver H1047R I ,Y 54.9% Breast 3 H1047R I ,Y 54.7% Peritoneum H1047R I ,Y 65.0% Lung H1047R I ,Y 53.1% 5 Axillary lymph node Breast 3 Adrenal gland Lung 6 Ovary Brain Brain Breast 2 7 Liver E746_A750del O, I,A 12.7% R38H X, Y 20.7% Brain Axillary lymph node 8 Lymph node H773_V774insNPH NVP 27.4% Pituitary/hypothalamus Pleura Breast Pancreas M AP = Mutant Allele Proportion estimated by OncoCarta NVP = no validation possible because no DNA remained O = validated by repeat OncoCarta analysis using a subset of assays that included primers for EGFR G719S, D770_N771insG, and E746_A750del muta tions S = validated by sequencing A = validated by immunohistochemistry using a mutation specific antibody I = validated by iPLEX using diferent primers from the OncoCarta assay X = iPLEX didn't work for this sample Y = Sequencing did not work for this sample

PAGE 27

Figure 3 : RT PCR and DASL assay for HER receptors genes and HIF1 alfa summary


xml version 1.0 encoding utf-8 standalone no
mets ID sort-mets_mets OBJID sword-mets LABEL DSpace SWORD Item PROFILE METS SIP Profile xmlns http:www.loc.govMETS
xmlns:xlink http:www.w3.org1999xlink xmlns:xsi http:www.w3.org2001XMLSchema-instance
xsi:schemaLocation http:www.loc.govstandardsmetsmets.xsd
metsHdr CREATEDATE 2012-07-30T20:06:59
agent ROLE CUSTODIAN TYPE ORGANIZATION
name BioMed Central
dmdSec sword-mets-dmd-1 GROUPID sword-mets-dmd-1_group-1
mdWrap SWAP Metadata MDTYPE OTHER OTHERMDTYPE EPDCX MIMETYPE textxml
xmlData
epdcx:descriptionSet xmlns:epdcx http:purl.orgeprintepdcx2006-11-16 xmlns:MIOJAVI
http:purl.orgeprintepdcxxsd2006-11-16epdcx.xsd
epdcx:description epdcx:resourceId sword-mets-epdcx-1
epdcx:statement epdcx:propertyURI http:purl.orgdcelements1.1type epdcx:valueURI http:purl.orgeprintentityTypeScholarlyWork
http:purl.orgdcelements1.1title
epdcx:valueString HER3 and downstream pathways are involved in colonization of brain metastases from breast cancer
http:purl.orgdctermsabstract
Abstract
Introduction
Metastases to the brain from breast cancer have a high mortality, and basal-like breast cancers have a propensity for brain metastases. However, the mechanisms that allow cells to colonize the brain are unclear.
Methods
We used morphology, immunohistochemistry, gene expression and somatic mutation profiling to analyze 39 matched pairs of primary breast cancers and brain metastases, 22 unmatched brain metastases of breast cancer, 11 non-breast brain metastases and 6 autopsy cases of patients with breast cancer metastases to multiple sites, including the brain.
Results
Most brain metastases were triple negative and basal-like. The brain metastases over-expressed one or more members of the HER family and in particular HER3 was significantly over-expressed relative to matched primary tumors. Brain metastases from breast and other primary sites, and metastases to multiple organs in the autopsied cases, also contained somatic mutations in EGFR, HRAS, KRAS, NRAS or PIK3CA. This paralleled the frequent activation of AKT and MAPK pathways. In particular, activation of the MAPK pathway was increased in the brain metastases compared to the primary tumors.
Conclusions
Deregulated HER family receptors, particularly HER3, and their downstream pathways are implicated in colonization of brain metastasis. The need for HER family receptors to dimerize for activation suggests that tumors may be susceptible to combinations of anti-HER family inhibitors, and may even be effective in the absence of HER2 amplification (that is, in triple negative/basal cancers). However, the presence of activating mutations in PIK3CA, HRAS, KRAS and NRAS suggests the necessity for also specifically targeting downstream molecules.
http:purl.orgdcelements1.1creator
Da Silva, Leonard
Simpson, Peter T
Smart, Chanel E
Cocciardi, Sibylle
Waddell, Nic
Lane, Annette
Morrison, Brian J
Vargas, Ana C
Healey, Sue
Beesley, Jonathan
Pakkiri, Pria
Parry, Suzanne
Kurniawan, Nyoman
Reid, Lynne
Keith, Patricia
Faria, Paulo
Pereira, Emilio
Skalova, Alena
Bilous, Michael
Balleine, Rosemary L
Do, Hongdo
Dobrovic, Alexander
Fox, Stephen
Franco, Marcello
Reynolds, Brent
Khanna, Kum K
Cummings, Margaret
Chenevix-Trench, Georgia
Lakhani, Sunil R
http:purl.orgeprinttermsisExpressedAs epdcx:valueRef sword-mets-expr-1
http:purl.orgeprintentityTypeExpression
http:purl.orgdcelements1.1language epdcx:vesURI http:purl.orgdctermsRFC3066
en
http:purl.orgeprinttermsType
http:purl.orgeprinttypeJournalArticle
http:purl.orgdctermsavailable
epdcx:sesURI http:purl.orgdctermsW3CDTF 2010-07-06
http:purl.orgdcelements1.1publisher
BioMed Central Ltd
http:purl.orgeprinttermsstatus http:purl.orgeprinttermsStatus
http:purl.orgeprintstatusPeerReviewed
http:purl.orgeprinttermscopyrightHolder
Leonard Da Silva et al.; licensee BioMed Central Ltd.
http:purl.orgdctermslicense
http://creativecommons.org/licenses/by/2.0
http:purl.orgdctermsaccessRights http:purl.orgeprinttermsAccessRights
http:purl.orgeprintaccessRightsOpenAccess
http:purl.orgeprinttermsbibliographicCitation
Breast Cancer Research. 2010 Jul 06;12(4):R46
http:purl.orgdcelements1.1identifier
http:purl.orgdctermsURI http://dx.doi.org/10.1186/bcr2603
fileSec
fileGrp sword-mets-fgrp-1 USE CONTENT
file sword-mets-fgid-0 sword-mets-file-1
FLocat LOCTYPE URL xlink:href bcr2603.xml
sword-mets-fgid-1 sword-mets-file-2 applicationpdf
bcr2603.pdf
sword-mets-fgid-3 sword-mets-file-3 applicationmsword
BCR2603-S1.DOC
sword-mets-fgid-4 sword-mets-file-4
BCR2603-S2.DOC
structMap sword-mets-struct-1 structure LOGICAL
div sword-mets-div-1 DMDID Object
sword-mets-div-2 File
fptr FILEID
sword-mets-div-3
sword-mets-div-4
sword-mets-div-5



PAGE 2

Windows User

PAGE 3

W i n d o w s U s e r M i c r o s o f t W o r d



PAGE 2

Windows User

PAGE 3

W i n d o w s U s e r M i c r o s o f t W o r d



PAGE 1

Additional file 2 Table 1 Immunohistochemistry results Antibody Primary breast tumor N/T (%) Matched brain metastases N/T (%) Unmatched brain metastases N/T (%) Non breast brain metastases N/T (%) E R 15/37(40%) 15/37 (40%) 4/21 (23%) NP P R 9/37 ( 24%) 9/37 (24%) 5/21 (19%) NP HER2 7/34 (20%) 7/35 (19%) 5/24 (20%) NP Triple negative 19/29(56%) 20/35(48%) 10/22(45%) NP CK5/6 9/26 (34%) 9/26 (34%) 2/16 (12%) NP CK14 15/35 (42%) 16/36 (44%) 8/16 (50%) NP CK17 5/26 (19%) 5/26 (19%) 5/16 (30%) NP EGFR 6/26 (23%) 6/26 (23%) 3/16 (18%) 9/11 (81%) p63 0/26 0/26 1/15 (5%) NP SMA 6/26 (23%) 6/26 (23%) 2/15 (13%) NP Basal like 20/37 (54%) 21/35 (60%) 11/22 (50%) NP CD44 5/20 (25%) 13/20 (65%) 10/22 (45%) NP CD24 5/22 (22%) 2/22 (9%) 3/22 (14%) NP CD44 + CD24 5/20(25%) 11/20 (55%) 10/22(45%) NP p53 16/26 (61%) 19/26 (73%) 14/20 (70%) NP KI 67 19/37(51%) 32/37 (86%) 18/21 (85%) NP CK19 24/26 (92%) 24/26 (92%) 15/15 (100%) NP CK8/18 14/26 (53%) 14/26 (53%) 15/15 (100%) NP E cadherin 19/26 (73% ) 19/23 (82%) 18/18 (100%) NP HER3 11/37 (29.7%) 22/37 (59%) 13/21 (62%) NP HER4 7/35(20%) 6/26 (23%) 5/24 (20%) NP Phospho HER3 14/37 (38 %) 24/37 (64%) 18/21 (85%) 0/11 Phospho AKT 32/37 (86%) 32/37 (86%) 15/21 (71%) 11/11 (100%) Phospho ERK1/2 28 /37 (75%) 36/37 (97%) 20/21(95%) 11/11 (100%) Phospho JNK1/2 26/37 (70 %) 34/37 (91%) 19/21 (90%) 11/11 (100%) Phospho ERK5 2 9/37 (78%) 36/37 (97%) 20/21 (95%) 11/11 (100%) p38 29 /37 (78 %) 37/37 (100%) 21/21 (100%) 11/11(100%) GRB2 13/36 (36%) 16/36 ( 44%) 11/22 (50%) NP HIF1 alfa 9/37 (24%) 20/35(48%) 8/16 (50%) NP Legend: N = number of tumor cases showing positivity; T = total number of cases assessable for the antibody specified; % = percentage of cases showing positivity; NP = not performed; A tu CK14, CK17, p 63, SMA, EGFR,) in more than 10% of cells Triple negative tumors were negative for ER, PR and HER2. CD44+/CD24 immunohistochemistry was assessed on serial sect ions and positivity was expression in >10% cells. X 2 test with Yates correction (95% confidence interval ) showed significant differences between matched primaries and metastases as follow: phospho Her3 p =0.046 phosphor ERK 1 /2 p= 0.0 17, phosphor ERK5 p=0. 032, phosphor JNK p= 0.037 p38 p=0.00 8 HER3 p=0.019, HIF1 alfa p=0.009 and CD44 p=0.026. GRB2 showed a trend p=0.1

PAGE 2

Figure 1 Scatter plots showing distribution of positivity for ER, phospho HER3, phospho ERK1/2 and phospho ERK5 across matched and un matched samples Panel on left shows the correlation of immunohistochemical score between primary tumor (x axis) and the matched metastasis (y axis). The panel on the right shows the immunohistochemical score (y axis) for each marker in individual unmatche d metastases (x axis).

PAGE 3

Figure 2: Principal component analysis using the 27 gene list from figure 2B showing good separation between brain metastases (red squares) and primaries (blue squares). Table 2: Somatic mutations in autopsy samples

PAGE 4

Case ID# Site GRADE EGFR PIK3CA Mutation MAP Mutation MAP 1 Breast 3 Brain Lung Mediastinal lymph node Adrenal gland 2 Brain H1047R I, S 57.6% Liver H1047R I ,Y 54.9% Breast 3 H1047R I ,Y 54.7% Peritoneum H1047R I ,Y 65.0% Lung H1047R I ,Y 53.1% 5 Axillary lymph node Breast 3 Adrenal gland Lung 6 Ovary Brain Brain Breast 2 7 Liver E746_A750del O, I,A 12.7% R38H X, Y 20.7% Brain Axillary lymph node 8 Lymph node H773_V774insNPH NVP 27.4% Pituitary/hypothalamus Pleura Breast Pancreas M AP = Mutant Allele Proportion estimated by OncoCarta NVP = no validation possible because no DNA remained O = validated by repeat OncoCarta analysis using a subset of assays that included primers for EGFR G719S, D770_N771insG, and E746_A750del muta tions S = validated by sequencing A = validated by immunohistochemistry using a mutation specific antibody I = validated by iPLEX using diferent primers from the OncoCarta assay X = iPLEX didn't work for this sample Y = Sequencing did not work for this sample

PAGE 5

Figure 3 : RT PCR and DASL assay for HER receptors genes and HIF1 alfa summary



PAGE 1

RESEARCHARTICLEOpenAccess HER3anddownstreampathwaysareinvolved incolonizationofbrainmetastasesfrom breastcancer LeonardDaSilva 1,2,3 ,PeterTSimpson 1,2 ,ChanelESmart 1,2 ,SibylleCocciardi 2 ,NicWaddell 2 ,AnnetteLane 1 BrianJMorrison 2,4 ,AnaCristinaVargas 1 ,SueHealey 2 ,JonathanBeesley 2 ,PriaPakkiri 1 ,SuzanneParry 1,2 NyomanKurniawan 5 ,LynneReid 1,2 ,PatriciaKeith 1,2 ,PauloFaria 7,6 ,EmilioPereira 8 ,AlenaSkalova 9 ,MichaelBilous 10 RosemaryLBalleine 11 ,HongdoDo 12 ,AlexanderDobrovic 12 ,StephenFox 12 ,MarcelloFranco 3 ,BrentReynolds 13,16 KumKumKhanna 14 ,MargaretCummings 1,14 ,GeorgiaChenevix-Trench 2 ,SunilRLakhani 1,2,15* Abstract Introduction: Metastasestothebrainfrombreastcancerhaveahighmortality,andbasal-likebreastcancershave apropensityforbrainmetastases.However,themechanismsthatallowcellstocolonizethebrainareunclear. Methods: Weusedmorphology,immunohistochemistry,geneexpressionandsomaticmutationprofilingto analyze39matchedpairsofprimarybreastcancersandbrainmetastases,22unmatchedbrainmetastasesofbreast cancer,11non-breastbrainmetastasesand6autopsycasesofpatientswithbreastcancermetastasestomultiple sites,includingthebrain. Results: Mostbrainmetastasesweretriplenegativeand basal-like .Thebrainmetastasesover-expressedoneor moremembersoftheHERfamilyandinparticularHER3wassignificantlyover-expressedrelativetomatched primarytumors.Brainmetastasesfrombreastandotherprimarysites,andmetastasestomultipleorgansinthe autopsiedcases,alsocontainedsomaticmutationsin EGFR,HRAS,KRAS NRAS or PIK3CA .Thisparalleledthe frequentactivationofAKTandMAPKpathways.Inparticular,activationoftheMAPKpathwaywasincreasedinthe brainmetastasescomparedtotheprimarytumors. Conclusions: DeregulatedHERfamilyreceptors,particularlyHER3,andtheirdownstreampathwaysareimplicated incolonizationofbrainmetastasis.TheneedforHERfamilyreceptorstodimerizeforactivationsuggeststhat tumorsmaybesusceptibletocombinationsofanti-HERfamilyinhibitors,andmayevenbeeffectiveinthe absenceof HER2 amplification(thatis,intriplenegative/basalcancers).However,thepresenceofactivating mutationsin PIK3CA HRAS,KRAS and NRAS suggeststhenecessityforalsospecificallytargetingdownstream molecules. Introduction Amongwomenwithbreastcancer,30%to40%will developmetastaticdisease.Thenaturalhistoryofmetastaticbreastcancertothebr ainisofsymptomaticdiseasein10%to20%ofthesepatientsandadismalmean survivalofsixmonthsfollowingdiagnosis[1,2].Associationswithyoungerage,p53positivity,estrogenreceptor (ER)negativeandepidermalgrowthfactorreceptor1 (EGFR)andtwo(HER2)positivecancershavebeen reported[3-5].Theepidermalgrowthfactorreceptor familycomprisesfourreceptors,HER1to4.Uponactivation,heteroorhomo-dimerizationoccurs,followedby phosphorylationofspecifictyrosineresiduesinthe intracellulardomain,stim ulatingsignalingcascades mediatedmainlybyAKTandMAPKandtheregulation ofcellproliferation,angiogenesis,migrationandsurvival [6,7]. *Correspondence:s.lakhani@uq.edu.au 1 Molecular&CellularPathology,TheUniversityofQueenslandCentrefor ClinicalResearch,&SchoolofMedicine,Building918/B71,RBWHcomplex, Brisbane,4029,Australia DaSilva etal BreastCancerResearch 2010, 12 :R46 http://breast-cancer-research.com/content/12/4/R46 2010DaSilvaetal.;licenseeBioMedCentralLtd.ThisisanopenaccessarticledistributedunderthetermsoftheCreativeCommons AttributionLicense(http://creativecommons.org/licenses/by/2.0),whichpermitsunrestricteduse,distribution,andreproductionin anymedium,providedtheoriginalworkisproperlycited.

PAGE 2

Basal-liketumorsaregenerallyhighgrade,negativefor ER,progesteronereceptors(PgR)andHER2(thatis, triplenegative )[8].Thecurrentdogmawouldpredictthat thesetumorsareunlikelytorespondtoendocrineand trastuzumab-basedtherapyandnotargetedtherapyis currentlyavailable,althoughclinicaltrialsareongoing [8].Despitebeingnodenegative,aproportionof patientssubsequentlypresentwithdistantmetastases, particularlytothebrain[9,10] Usingautopsyrecordsofbreastcancerpatients,Paget [11]demonstratedanon-randompatternofmetastatic spread.Thissuggestedthattumorcells(the seed )could haveaspecificaffinityforthemicroenvironmentofcertain organs(the soil ).Inagreement,animalmodelsdemonstrate thatparticularsetsofgenescanincreasethepotentialof breastcancercelllinestocolonizespecificdistantsites,for example,bone,lung[12, 13];andbrain[14,15]. Thecancer mutatome isverycomplex,withmore than140CANgenesidentifiedwhicharemutatedata significantfrequencyincancer[16,17].Thegenomic landscapeofbreastcancerisalsoverycomplexandheterogeneous,withdifferentsubgroupsoftumours(luminal,basal,HER2)harboringdifferenttypesandpatterns ofmutations[18].Thereisalsoevidencethatbreast cancercelllineswithabasalphenotypehaveahigher frequencyofmutationsin BRAF,KRAS ,and HRAS than luminalbreastcancercelllines[19-21]. Wehaveanalyzedarelativelylargeandraresetof humantumorstoelucidatethemechanismsinvolvedin colonizationofthebrain.Samplesstudiedinvolved matchedpairsofprimarybreastcancerandbrainmetastases,unmatchedbrainmetastases,non-breastbrain metastasesandautopsycasesofbreastcancerpatients withmetastasestomultiplesites,includingthebrain.We provideevidenceofincreasedactivationofHER3and downstreampathwaymoleculesinbrainmetastasesfrom breastcancerandsuggestthattheinhibitionofHER familyreceptors,evenintheabsenceof HER2 gene amplification(forexample,triplenegative/basalcancers), couldplayasignificantroleinthemanagementof patientswithbrainmetastasesfrombreastcancer.In addition,wedemonstratedthepossiblefallaciesofthis approachwithoutconsideringthepresenceofsomatic activatingmutationsindownstreammolecules[22-24].MaterialsandmethodsAdditionaldetailedmethodologies(seeAdditionalfile 1).Thestudywasapprovedbythelocalresearchethics committeesundertheprojectnumberUQ2005000785 andRBHW2005/22.ClinicalsamplesAllhumanclinicalsamplesstudiedwereavailableasformalinfixed-paraffinembe dded(FFPE)tumorblocks. Cohortscollectedwere:i)39matchedpairsofprimary breastcancerandbrainmetastases;ii)22unmatched brainmetastasesfrombreastcancer;iii)11brainmetastasesfromnon-breastsites(onemelanoma,onecolorectal,sixlung,oneprostateandtworenalcell carcinomas);andiv)26tumorsamples(primarybreast cancerandmetastasestomultiplesites,includingbrain) fromsixautopsycasesofpatientswhodiedofmetastaticbreastcancer(theprimarybreastcancerfromone casewasnotavailable).Thetumorswerereviewedby threepathologists(LDS,MCandSRL)andanalyzedby immunohistochemistryandchromogenic insitu hybridization(CISH)ontissuemicroarrays.ImmunohistochemistryforEGFR,HER2,HER3,HER4,CD44andCD24 wasalsodoneonwholesections.GeneexpressionanalysisRNAwasextractedfromFFPEsamplesandtheexpressionof512cancerrelatedgeneswasanalyzedusingthe DASLassay(cDNA-mediatedannealing,selectionextensionandligation,IlluminaInc.,SanDiego,California, USA)[25].AlldataandprotocolsforDASLanalysiscan befoundattheGeneExpressionOmnibusrepository (AccessionnumberGSE14690)(seealsoadditionalfile 1).Real-timePCRusingTaqMangeneexpression assays(AppliedBiosystems,Inc,Carlsbad,California, USA)andimmunohistochem istrywereperformedto validatetheexpressionofspecificgenes.SomaticmutationanalysisTwelvematchedpairsofprimarybreasttumorsandcorrespondingbrainmetastases,ninenon-breastbrain metastasesand26tumorsamplesfromthesixautopsy casesweresubjectedtoprimerextensionandMALDITOFmassspectrometryusingtheOncoCartaPanel Assayv1.0(SequenomInc.,SanDiego,California,USA) of238mutationsin19oncogenes[26].Allmutationsin samplesforwhichtherewassufficientDNAremaining werevalidatedbyHighResolutionMelt(HRM)[27] analysis,iPLEX(usingnewlydesignedPCRandextensionprimersthatdifferedfromtheOncoCartaprimers), repeatOncoCartaanalysis,and/ordirectsequencingif theMutantAlleleProportion(MAP)was>30%(Table1 andAdditionalfile2,TableS2).Inaddition,wewere abletovalidatethe EGFR E746_A750delmutationin fourcaseswithamutation-specificantibody[28].ResultsClinicalandpathologicalfeaturesThemedianageatdiagnosiswas48.5yearsandthe mediantimeforthedevelopmentofbrainmetastasis was3.5years.Allbutoneoftheseriesofprimarybreast cancersandallbrainmetastasesweregrade3invasive ductalcarcinomas-nospecifictype(IDC-NST)[29].TheDaSilva etal BreastCancerResearch 2010, 12 :R46 http://breast-cancer-research.com/content/12/4/R46 Page2of13

PAGE 3

Table1SomaticmutationsidentifiedbyOncoCartaandER,PgRandHERfamilyofreceptorsassessmentMatchedbreastprimary-brainmetastasispairs CaseID#SiteER-PgR-HER1-2-3-4 EGFRNRASPIK3CA MutationMAPMutationMAPMutationMAP 1brain ER-,PgR-,HER1-,HER2+,HER3-,HER4breast ER-,PgR-,HER1-,HER2+,HER3-,HER42brain ER-,PgR-,HER1-,HER2-,HER3+,HER4-Q61RO,H,I,S39.50% breast ER-,PgR-,HER1-,HER2-,HER3+,HER4-Q61RO,H,I,S38.30% 4brain ER-,PgR+,HER1+,HER2-,HER3-,HER4breast ER-,PgR+,HER1+,HER2-,HER3-,HER46brain ER-,PgR+,HER1+,HER2-,HER3-,HER4breast ER-,PgR+,HER1+,HER2-,HER3-,HER47brain ER-,PgR-,HER1+,HER2-,HER3-,HER4-Q61RI,S34.4% breast ER-,PgR-,HER1+,HER2-,HER3-,HER4-Q61RI,S34.1% 8brain ER-,PgR-,HER1-,HER2+,HER3+,HER4breast ER-,PgR-,HER1-,HER2+,HER3-,HER49brain ER-,PgR-,HER1-,HER2+,HER3-,HER4-H1047RS79.50% breast ER-,PgR-,HER1-,HER2+,HER3-,HER4-H1047RS79.50% 10brain ER-,PgR-,HER1+,HER2-,HER3+,HER4-E545KH,NVP23.40% breast ER-,PgR-,HER1+,HER2-,HER3-,HER4-E545KH,NVP18.20% 11brain ER-,PgR-,HER1-,HER2+,HER3-,HER4+ breast ER-,PgR-,HER1-,HER2+,HER3-,HER4+ 12brain ER-,PgR+,HER1-,HER2-,HER3+,HER4breast ER-,PgR+,HER1-,HER2-,HER3+,HER413brain ER-,PgR-,HER1+,HER2-,HER3-,HER4breast ER-,PgR-,HER1+,HER2-,HER3-,HER4-N771_P772>SVDNR12.10% 14brain ER-,PgR-,HER1+,HER2-,HER3-,HER4breast ER-,PgR-,HER1+,HER2-,HER3-,HER4Unmatchedbrainmetastasesfromprimarylung,colon,melanomaandkidneytumours CaseID#SiteER-PgR-HER1-2-3-4 EGFRHRASKRASNRASPIK3CA MutationMAPMutationMAPMutationMAPMutationMAPMutationMAP D2melanoma n.a. E545KH,I,Y30.80% D3colon n.a. G12CS38.90% D4lung n.a.E746_A750delA21.00% D5lung n.a.DaSilva etal BreastCancerResearch 2010, 12 :R46 http://breast-cancer-research.com/content/12/4/R46 Page3of13

PAGE 4

remainingtumorpairwasagrade2mucinouscarcinoma.Theautopsysamplescomprisedfourgrade3and onegrade2IDC-NST.ER,PgR,HER2, ‘ Basal ’ markersandstemcellmarkers (non-autopsycases)ImmunohistochemistrydataaresummarizedinFigure 1A,B(seealsoadditionalfile2,TableS1andFigure S1).Itwasnoteworthythat60%and76%ofthetumors werenegativeforERandPR,respectively,withcompleteconcordancebetweenprimaryandmetastases. Seventy-sevenpercent(77%)and81%oftheunmatched brainmetastaseswerealsoERandPRnegative,respectively.Twentypercent(20%)and19%oftheprimary breasttumorsandmetastases,respectively,hadcorrelatedover-expressionofHER2(3+staining)andallof theseshowedgeneamplificationusingCISH.Twenty percent(20%)oftheunmatchedmetastaseswerealso HER2+.Fifty-sixpercent(56%)oftheprimarytumors and48%ofthematchedmetastasesweretriplenegative andofthese,60%werepositiveforatleastoneofthe basalmarkersrespectively(CK14,CK5/6,CK17,EGFR andSMA).Overall,54%oftheprimaryand60%ofthe metastaseswereof basal phenotype(irrespectiveofER, PRandHER2status),confirmingenrichmentinthis cohortoverthenormaldistributioninbreastcancer[8]. Noteworthy,EGFRstainingwasseenmainlyintheperipheryofthetumorwheretherewascontactwithnonneoplasticbrainparenchyma[30].Ahigherproportion ofbrainmetastaseshadaputativestemcell-likephenotype(CD44+/CD24-)comparedtotheprimaries,55% versus25%,(Figure1A).Fifty-onepercent(51%)ofthe primarytumorshadaKi-67indexhigherthan10%in contrasttomatchedandunmatchedmetastases thathad86%and85%ofsampleswithindexhigher than10%.GeneexpressionprofilingTheavailabilityofgoodqualityRNAandstringentfilteringoftheDASLdatayieldedgeneexpressionprofiling dataon37/61brainmetastasesfrombreastcancer(15/ 39frommatchedpairsand22/22fromunmatched metastases)and15matchedp rimaries.Unsupervised analysishighlightedastrongsimilaritybetweenprimary tumorsandtheirmatchedmetastases(Figure2A).Only 20genesweredifferentiallyexpressedbetweenthe matchedprimariesandmetastases.Thismaybeaconsequenceoftheoverallstrongsimilaritybetweenprimariesandmetastases[31]coupledwiththesamplesize (n=30)andnumberofgenesanalyzed(n=512cancer genesintheDASLpanel)[32].Comparisonbetween primariesandallmetastases(matchedandunmatched) identified27statisticallysi gnificant,differentially expressedgenes(Figure2B).SupplementaryFigure2 Table1SomaticmutationsidentifiedbyOncoCartaandER,PgRandHERfamilyofreceptorsassessment (Continued)D6lung n.a.E746_A750delA,NVI14.40%G13SI17.30%G12CI;S35.70% D7lung n.a. G12CO;I9.70% D8lung n.a. G12CS39.90% D9lung n.a. E545KH13.30% D10kidney n.a.E746_A750delA,I9.10%G12CI,S35.20%A,validatedbyimmunohistochemistryusingamutation-specificantibody;ER,estrogenreceptor;H,validatedbyHighResolutionMeltanalysis;I, validatedbyiPLEX;ID,casenumberidentification;MAP,MutantAllele ProportionestimatedbyOncoCarta;NVI,notvalidatedbyiPLEX;NVP,nofurthervalidationpossiblebecausenoDNAremained;O,validatedbyrepeatO ncoCarta;PgR,progesteronereceptor;S,validatedby sequencing;Y,sequencingdidnotworkforthissample;n.a.,notaccessed.DaSilva etal BreastCancerResearch 2010, 12 :R46 http://breast-cancer-research.com/content/12/4/R46 Page4of13

PAGE 5

Figure1 Immunohistochemicalprofileofprimarybreastandbrainmetastases A -Immunohistochemicalanalysisofmatchedprimary breastandbrainmetastases.Thegraphdepictspercentagesofpositivecasesineachcategory.ERandPRwereconsideredpositivewhen>10% cellsshowedstaining,HER2wasconsideredpositivewhenIHCshowed3+staining(>30%positivecells)orCISHshowedgeneamplification. TriplenegativetumorswerenegativeforER,PRandHER2.CD44+/CD24-immunohistochemistrywasassessedonserialsectionsandpositivity wasexpressionin>10%cells. B -Breakdownofbasalmarkers.Atumorwasregardedas basal ifanyofthefollowingmarkerswerepositive (CK5/6,CK14,CK17,p63,SMA,andEGFR)with>10%cellsshowedstaining. DaSilva etal BreastCancerResearch 2010, 12 :R46 http://breast-cancer-research.com/content/12/4/R46 Page5of13

PAGE 6

Figure2 Geneexpressionprofilingofbrainmetastases A -UnsupervisedhierarchicalclusteringofDASLgeneexpressiondatafrom22 unmatched(blackcolorbar)and15matchedprimaryandbrainmetastases(othercolorsbars).Thirteenoutof15matchedsamplesare clusteringtogether. B -Heatmapanddendogramshowingclusteringofthesamplesbasedonthe27genesdifferentiallyexpressedbetween primarytumors(bluelinebar)andbrainmetastases(redlinebar). DaSilva etal BreastCancerResearch 2010, 12 :R46 http://breast-cancer-research.com/content/12/4/R46 Page6of13

PAGE 7

(seeAdditionalfile2,FigureS2)depictsprincipalcomponentanalysisshowinggoodseparationoftheprimariesandmetastasesusingthis27-genelist.All20 genesidentifiedinthematchedpairanalysiswerepart ofthis27-geneset.Amongthis20-geneset,were HER3 andoneofitsdownstreamtargetmolecules GRB2 [33], hypoxiarelatedmolecule HIF1-alfa ,MAPKinasecascade relatedprotein CREBBP ,cellcycleregulatorRB1and proliferationrelatedgenes CCNH,CDK7 and CDC25B Sincethebrainisrichinneuregulin1[34,35]andthisis aligandforHER3,wehypothesizedthattheneuregulinHER3activationwasimportantinallowingbreastcancercellstocolonizethebrain.HERfamilyreceptorsanddownstreammolecules expressionHER3,EGFR,HER2,HER4 and HIF1-alfa expression wasassessedusingquantitativeRT-PCR(seeAdditional file2,FigureS3)in12matchedbreast/brainsamplesfor whichDASLdataandRNAwereavailable.Similarto theDASLdata,10casesshowedincreasedfoldchange byRT-PCRof HER3 geneexpressionrelativetotheir matchedprimariesrangingfrom1.12to5.8andwithan averageof2.4.ImmunohistochemistryforHER3was similar,showingpositivityin11/37(29.7%)oftheprimarytumors,22/37(59%)ofthematchedmetastases and13/21(62%)oftheunmatchedbrainmetastases ( P =0.019).Inagreement,phosphorylatedHER3confirmedmorefrequentactivationinthebrainmetastases, withpositivityin14/37(37%)oftheprimarytumors, 24/37(64%)ofthematchedmetastasesand18/21(85%) oftheunmatchedbrainmetastases( P =0.046)(see Additionalfile2,TableS1andFigureS1). ImmunohistochemistryforGRB2,HIF1-alfaandphosphorylatedERK1/2,JNK1/2,ERK5andp38alsodemonstratedincreasedactivationinthemetastasescompared totheprimarytumors;(seeAdditionalfile2,TableS1 andFigureS1).Incontrast,phosphorylatedAKTwas equallyhighinboththeprimariesandmetastases(see Additionalfile2,TableS1).Interestingly,thenon-breast derivedbrainmetastasesshowedsimilarlyhighactivation oftheMAPKpathwaytogetherwithover-expression(3+ stain)ofEGFR(in9/11(81%)metastases(aprostateand onecoloncarcinomadidnot)butintheabsenceof HER3activation(0/11)(seeAdditionalfile2,TableS1).SomaticmutationanalysisOncoCartaanalysisidentifiedmutationsinthebrain metastasesfromprimarybre astcancers(non-autopsy cases)in NRAS (2/12-17%),and PIK3CA (2/12-17%) (Table1andFigure3).Mutationswerealsoidentifiedin brainmetastasesfromnon-breastprimariesin EGFR (3/ 9-33%;twolungandonekidney), HRAS (1/9-11%; lung), KRAS (2/9-22%;onecolonandonelung), NRAS (3/9-33%;twolungandonekidney)and PIK3CA (2/9 -22%;onemelanomaandonelung). MutantAlleleProportions(MAPs)rangedfrom9%to 80%.Allthesemutationswerevalidatedbyimmunohistochemistry(usingaspecificantibodyraisedagainstthe proteinwiththe EGFR E746_A750delmutation)or sequencingexceptforoneeachin EGFR,HRAS (validatedbyiPLEX), NRAS and PIC3CA ( validated by HRM),wheretheestimatedmutantalleleproportion waslessthan15%,andtwoin PIK3CA inwhichthere wasinsufficientgoodqualityDNAremainingtoobtain sequencedata. EGFR G719SappearedtobefoundfrequentlybyOncoCartabutcouldnotbedetectedby iPLEX,usingindependentPCRandextensionprimers. TheOncoCartafalse-positiveresultappearedtobedue tohairpinformationoftheextensionprimerthat occurredfrequentlywhenarchivalDNAwasusedasa template,andtheyieldwaslow. Exceptforone EGFR mutation(Case#13;Table1),the samesomaticmutationswereobservedinthebrain metastaseswithsimilarMAPsasinthematchedprimary breasttumors.Itwasnoteworthythatthefourmatched pairsharboringsomaticmutationin NRAS or PIK3CA alsooverexpressedamemberoftheHERfamily.For example,matchedpair#2hadamutationin NRAS and showedover-expressionofHER3,matchedpair#7hada mutationin NRAS andshowedover-expressionofHER1, matchedpair#9hadamutationin PIK3CA andamplificationofHER2andmatchedpair#10hadamutationin PIK3CA andoverexpressionofHER1(Table1). Amongtheautopsysamplesofcaseswithprimary breastcancer,wefoundmutationsin EGFR inoneliver andonelymphnodemetastases,andamutationin PIK3CA inallthesamplesfromonecase,andinaliver metastasisfromanother(seeAdditionalfile2,Table S2).One EGFR andone PIK3CA mutationcouldbeverifiedbysequencingorimmunohistochemistrybutlack ofgoodqualityDNA,andadditionalmutation-specific antibodies,prohibitedvalid ationoftheothers.Allthe samplesfromonecasehadthesamemutationatsimilar MAPs( PIK3CA H1074RinPatient#2). Weidentified HRAS and PIK3CA mutationsinthe basalbreastcancercelllinesSUM159andBT20.The mutationswithMAPs>25%havebeenreportedbefore [19,20]: HRAS G12D(MAP53.2%inSUM159)and PIK3CA H1047L(MAP50.0%inSUM159)andP539R (MAP43.8%inBT20)butwealsoidentified HRAS Q61KatMAP24.6%inSUM159and HRAS Q61Kat MAP14.1%,and PIK3CAH1047RatMAP44.4%in BT20.Inaddition,wewerealsoabletoshowthatallof themutationswithMAPs>25%werepresentinmammospheresderivedfromthesecelllines.DaSilva etal BreastCancerResearch 2010, 12 :R46 http://breast-cancer-research.com/content/12/4/R46 Page7of13

PAGE 8

DiscussionWehavecollectedauniquesetofclinicalmaterial throughcollaborationswithmultipleinstitutionsaround theworldandinvolvingbrainmetastaseswhichare rarelyexcised.Theanalysisofthisresourcehasledto thedevelopmentofhypothesesregardingthemechanismsofbreastcancercolonizationofthebrain(Figure4). Thesetoftumorsamplesisenrichedfortriplenegative/ basalbreastcancerswhichisconsistentwiththefindingsofanincreasedpropensityforbasalbreastcancers tometastasizetothebrain[3,9,36].Anassociation betweenCD44+/CD24-frequencyandabasaltumor phenotypehasalreadybeenreported[37]andinterestinglyweobservedanincreasedfrequencyofCD44 +/CD24-cellsinthebrainmetastasescomparedtotheir matchedprimaries.CD44+/CD24-cellshavebeen reportedtohavestemcellpropertiesandincreased in vivo tumorigenicity[38]andt heincreasedfrequency seeninbrainmetastasesmaysupportthis.Alternatively, thismayreflectselectionasaresultofahighcontentof hyaluron,theligandforCD44,withinthebrainmicroenvironment[39,40].Hence,thiscouldbeanimportant factorinbreastcancercolonizationofthebrainand thereforeapotentialaxisforfuturetherapeuticintervention[41]. Inthisstudy,brainmetastasesofbreastcancer expressedallmembersoftheHERfamilyoftyrosine kinasereceptors.HER2wasamplifiedandoverexpressed in20%ofbrainmetastases,EGFRwasoverexpressedin 21%ofbrainmetastases,HER3wasoverexpressedin 60%ofbrainmetastasesandHER4wasoverexpressedin 22%ofbrainmetastasesandgenerallymutuallyexclusive(Table1).Interesti ngly,HER3expressionwas increasedinbreastcancercellsresidinginthebrain. Neuregulin1,theligandforthisreceptor,isabundantly expressedinthebrain[34,35]andisreleasedbyavarietyofmechanismsincludingthepresenceofhypoxia [42].Consistentwiththis,weobservedtheincreased expressionof HIF-1alfa inthebrainmetastases,likelyto reflectthelocalhypoxicenvironment[43].Increased Figure3 Oncocartaandvalidationmutationanalyses A) .Exampleof NRAS Q61RmutationidentifiedbyOncoCartainmatchedpairsample #7showingrepresentativespectraandclusterplot. B) Sequencevalidationof NRAS G12C,sampleD6-lungmetastasis. C) Sequencevalidation of NRAS Q61R,breastandbrainmetastasisfromsample#2. D) Immunohistochemistryofbrainmetastasis(sampleD4)withantibodyspecificto EGFR E746_A750delshowingstaininginthetumorbutnotthesurroundingbraintissue. DaSilva etal BreastCancerResearch 2010, 12 :R46 http://breast-cancer-research.com/content/12/4/R46 Page8of13

PAGE 9

activationofbothHER3anddownstreammolecules (GRB2,ERK5,ERK1/2,JNK1/2,p38)wasalsoobserved inthebrainmetastases.Thesefindingspromptedusto hypothesizethatneuregulin/HER3activationisan importantmechanismforbreastcancercellcolonization ofthebrain(Figure4).Asafurthersupporttothis hypothesis,increasedHER3expressionhasalsobeen reportedinbrainmetastasesoflungcancer[44]. Weinvestigatedwhetherthisassociationwasgeneric toallbrainmetastasesandfoundactivationofthe MAPKpathwayinall11non-breastmetastasestothe brain.WhilstHER3wasnotactivatedinthesetumors, 9/11tumorsshowedover-expressionofEGFR.Ithas recentlybeenshown,usinganimalmodels,thatEGFR ligandsmediatebreastcancermetastasistothebrain andthatthiswasabrogatedbytheuseofEGFRinhibitorcetuximab[14].Thecombinationoflapatiniband trastuzumabhasbeenshowntohaveasynergistic, antiproliferativeeffectagainstErbB2-positivebreastcancercells invitro [45].Itispossible,therefore,thata combinationofanti-HERtherapiescouldbeeffectivein thetreatmentofbothbreastandnon-breastmetastases tothebrain. Inordertoactivatedownstreamsignalingpathways, HER3requiresheterodimerizationwithothermembers oftheHERfamilyfollowingbindingbyneuregulin[46] andevenbasallevelsoftheotherHERproteinsmaybe sufficienttoparticipateintheactivationofthesepathways.Hence,combinationtherapyagainsttheHER family,evenintheabsenceofover-expressionoramplificationofHER2,maybeofclinicalbenefitforalarger proportionofbreastcancerpatientssuchasthosewith HER2negativedisease.Recently,astudyshowedbenefitsforasmallgroupofHER2-negativepatientsinthe phaseIIINationalSurgicalAdjuvantBreastandBowel Project(NSABP)B-31trialthatwereHER2negativeby Figure4 Hypotheticalmechanismofbreastcancercellcolonizationofthebrainparenchyma .Hypoxicconditions,(HIF1a)canmediate theeleaseofneuregulin1fromneuronalcells.Neuregulin1istheligandforHER3andonbindingactivatestheheterodimerisationofHER3HER2,HER3-HER4and/orHER3-HER1,leadingtodownstreamactivationoftheMAPKandAKTpathways.MAPK/AKTpathwaysactivationis relatedtosurvival,invasion,proliferationandangiogenesis.AsecondmechanismofcolonizationmayrelatetotheenrichedexpressionofCD44 breastcancercellsinthebrain.Thebrainmicroenvironmentisrichinhyaluron,theligandforCD44,andsouponactivationaseriesof responsesmaybetriggered,includingcellmotility. DaSilva etal BreastCancerResearch 2010, 12 :R46 http://breast-cancer-research.com/content/12/4/R46 Page9of13

PAGE 10

FISHandhadlessthan3+stainingintensitybyHercepTest(Dako,Carpinteria,CA,USA)[47].Furthermore,anotherstudysuggestedthatthespectrumof patientswhomaybenefitfromtrastuzumab-basedtherapiescouldbeexpandedtoincludepatientswithmetastaticbreastcancerwithoutHER-2amplificationbut whoexpresstransmembraneneuregulin,theligandof HER3[48].Ithasalsobeenreportedinnon-HER2overexpressingxenograftmodelsofprostateandbreastcancerthatpertuzumab,aninh ibitorofHER3/HER2heterodimerization,caninhibittumorgrowth[49]. Forthefirsttime,wehaveidentifiedsomaticmutationsingenesrelatedtotheAKT/MAPKsignalingpathways,suchas EGFR PIK3CA KRAS HRAS and NRAS inbrainmetastasesofbreastcancerandothertypesof cancer.Inaddition,wehaveanalyzedmultipleautopsy samplesfromsixcasesthathadaprimarybreastcancer, andfoundadditional EGFR and PIK3CA mutationsin breastcancersthatmetastasizedtovarioussitesincludingthebrain.Thus,simplytargetingtheHERfamilyof receptorsmaynotbesufficientforcompletetreatment response.Thisanalysishighlightsadditional actionable targets[50]thatmayproveeffectiveforthetreatmentof somebrainmetastasis,suchasPI3kinaseinhibitors. Takentogether,thesefindingsarestrikingandshow anotherfacetofthecellevolutionlandscape[51],highlightingthepossibilityofcance rcellsresistingtargeted treatmenttomoleculessuchasHER2orEGFRby acquiringoncogenicmutationsindownstreampathways. Thishasbeenshown invitro withactivatingPIK3CA mutation[23]andhereinwedemonstratean invivo exampleofthispossiblescenariousinghumantumors. Inanotherclinicalangle,patientscurrentlytreatedwith theanti-EGFRmonoclonalantibodiescetuximaband panitumumabcanalsoacquireresistancetothistherapy duetodownstreammutationsinthe ras gene[24]. Interestingly,animalmodelshavesuggestedthatdownstreamNF-kappaBinhibitorydrugsmayplayarolein thetreatmentofpatientswithdefinedmutationsin KRAS [52]. InterestinglytheMutantAlleleProportion(MAP)was sometimesaslowas10%.Suchlowproportionmutations,whichwouldoftenbemissedbydirectsequencing couldreflectthepresenceofstromal(orbrain)contaminationinthesamples,tumorheterogeneityandamplificationordeletionofthemutantorwildtypealleles. However,thefactthatthesameMAPwasoften observedinboththeprimaryandthebrainmetastasis, andinthemultiplesamplesfromanautopsycase, mightsuggestthatthesemetastaseswerenotseededby asinglecellbutbygroupsofcellsfromtheprimary tumor.Thishasalsobeenshownbynextgeneration sequencing,wherebythemutantallelefrequencyfor somemutationswassimila rbetweenabasal-like primarybreastcanceranditsmatchedbrainmetastasis [53].However,itisalsoevidentthatsignificantgenomic evolutionoccursduringmetastasis,sincemostmutationsidentifiedinthismetastasis,andonefromaprimarylobularbreastcancer,weremoreprevalentinthe metastasisthanintherespectiveprimarytumours [53,54]ConclusionsInconclusion,weprovideevidencetosupportaroleof HER3andotherHERfamilyreceptorsintheabilityof cancercellstocolonizethebrain.Thedataareintriguingandsupportthepossibilitythattumorswithlow expressionofHER2mayrespondtotrastuzumab,lapitiniborcombinationsofHERfamilyreceptorinhibitors sinceevenbasallevelsmayenhancethesignaling throughhomo/hetero-dimer izationoftheotherreceptors.However,cautionshouldbeexercisedbecauseof thepossiblepresenceofdow nstreamoncogenicmutationsthatmaydrivetreatmentresistance.Thesetherapeuticmodalitiesmaythereforeaddanotherdimension tothetreatmentoftriplenegativeandbasal-likecancers wherecurrently,notargetedtherapyisavailable.AcknowledgementsLeonardDaSilvaandAnaCristinaVargasarerecipients ofPhDFellowshipsfromtheLudwigInstituteofCancer Research.LeonardDaSilvaisenrolledwiththe “ UniversidadeFederaldeSoPaulo,EscolaPaulistadeMedicina, CursodePs-Graduao,Doutorado,Departamentode AnatomiaPatolgica,SoPaulo,Brazil ” .PeterSimpsonis arecipientofafellowshipfromtheNationalBreastCancer Foundation.GeorgiaChenevix-TrenchandKumKum KhannaareSeniorPrincipalResearchFellowsofthe NHMRC.RLBisaCancerInstituteNSWFellow.Wealso acknowledgethehelpofstaffwithinanatomicalpathology, RBWH,Brisbane,theanimalhousefacilityatUQAIBN, Brisbane,CaseyWrightfromtheThoracicResearch Laboratory,SchoolofMedicine,attheUQ,andClayWinterfordandhisstafffromtheUQ/QIMRHistotechnology facility,andMackyEdmundsoninthesequencingfacility atQIMR.WewouldliketothankSequenomInc.forprovidingtheprimersequencesusedforHRM,and,inparticular,wethankDarrylIrwinforhishelp.AdditionalmaterialAdditionalfile1:Supplementarymethodologies .Thisfilecontains informationofhowthemorphologicalreviewandTMAcreationwere performed.Italsocontainsinformationonprotocolsfor immunohistochemistryandchromogenic insitu hybridization,RNA extractionandReal-TimeRT-PCR,DASLgeneexpressionprofiling,cell lineanalysisandculture,oncoCartasomaticmutationanalysisprotocols, highresolutionmeltanalysisandiPLEXgenotypingprotocols.DaSilva etal BreastCancerResearch 2010, 12 :R46 http://breast-cancer-research.com/content/12/4/R46 Page10of13

PAGE 11

Additionalfile2:Supplementaryresults .Thisfilecontainstablesand figuresregardingallimmunohistochemistrydata,extrageneexpression andmutationresults,andHERfamilygeneexpressionbyRT-PCR. Abbreviations CISH:chromogenic insitu hybridization;DASL:cDNA-mediatedAnnealing, Selection,extension,andLigation;EGFR:epidermalgrowthfactorreceptor; ER:estrogenreceptor;FFPE:formalinfixed-paraffinembedded;GEO:Gene ExpressionOmnibus;HER:humanepidermalgrowthfactorreceptor;HRM: HighResolutionMelt;IDC:invasiveductalcarcinoma;MAPs:MutantAllele Proportions;NSABP:NationalSurgicalAdjuvantBreastandBowelProject; NST:non-specifictype;PgR:progesteronereceptors. Authordetails1Molecular&CellularPathology,TheUniversityofQueenslandCentrefor ClinicalResearch,&SchoolofMedicine,Building918/B71,RBWHcomplex, Brisbane,4029,Australia.2CancerGeneticsandMolecularPathology,The QueenslandInstituteofMedicalResearch,300HerstonRoad,Brisbane,4006, Australia.3DepartamentodeAnatomiaPatolgica,UniversidadeFederalde SoPaulo,EPM,754RuaNapoleodeBarros,SoPaulo,04024-000,Brazil.4BiomolecularandBiomedicalScience,GriffithUniversity,170KesselsRoad, Brisbane,4011,Australia.5CentreforMagneticResonance,TheUniversityof Queensland,StLucia,Brisbane,4072,Australia.6LembagaEijkman,Eijkman Institute,Diponegoro69,Jakarta,10430,Indonesia.7Departamentode Patologia,InstitutoNacionaldeCncer,23PraaCruzVermelha,Riode Janeiro,20230-130,Brazil.8DepartamentodePatologia,LaboratrioSalomo &Zoppi,48RuaCorreiaDias,SoPaulo,04104-000,Brazil.9Departmentof Pathology,MedicalFacultyofCharlesUniversityinPlzen,Husova3,30605, CzechRepublic.10SydneyWestAreaHealthService,InstituteofClinical PathologyandMedicalResearch,UniversityofSydney,DarcyRoad,Sydney, 2145,Australia.11TranslationalOncology,SydneyWestAreaHealthService, WestmeadMillenniumInstitute,UniversityofSydney,DarcyRoad,Sydney, 2145,Australia.12DepartmentofPathology,PeterMacCallumCancerCentre, StAndrewsPl,EastMelbourne,3002,Australia.13QueenslandBrainInstitute, TheUniversityofQueensland,StLucia,Brisbane,4072,Australia.14Signal Transduction,TheQueenslandInstituteofMedicalResearch,300Herston Road,Brisbane,4006,Australia.15PathologyQueensland:TheRoyalBrisbane &Women ’ sHospital,HerstonRoad,Brisbane,4029,Australia.16Current address-UniversityofFlorida,McKnightBrainInstitute,100S.NewellDrive, Gainesville,32611,USA. Authors ’ contributions LDSanalysedtheimmunohistochemicalmarkers,accruedandcollatedthe data,carriedoutstatisticalandgeneexpressionanalysisanddraftedthe manuscript.PKandACVanalysedimmunohistochemicalmarkers,and accruedandcollatedthedata.NW,CESandPTSsupervisedgeneexpression analysesanddraftedthemanuscript.EP,PF,AS,MF,RB,MBandMC identifiedpatientswithbrainmetastasesintheirinstitutions,collected samplesandperformedinitialtumorclassification.LR,SP,PKandAL performedimmunohistochemistryandparticipatedintheconstructionof TMAs.KK,NK,BJMandBRparticipatedinthestudydesign.SB,SHandJB performedmutationanalyses.HD,ADandSFperformedvalidationofEGFR mutations.GCTandSRLconceivedthestudy,supervisedtheexperiments anddraftedthemanuscript. Competinginterests LeonardDaSilvaandSunilLakhaniholdanUSAregisteredpatentrelating tothedatainthismanuscript.Alltheotherauthorsdeclarenoconflictof interest. Received:14March2010Revised:15June2010Accepted:6July2010 Published:6July2010 References1.LinNU,BellonJR,WinerEP: CNSmetastasesinbreastcancer. JClinOncol 2004, 22 :3608-3617. 2.WeilRJ,PalmieriDC,BronderJL,StarkAM,SteegPS: Breastcancer metastasistothecentralnervoussystem. AmJPathol 2005, 167 :913-920. 3.HicksDG,ShortSM,PrescottNL,TarrSM,ColemanKA,YoderBJ,CroweJP, ChoueiriTK,DawsonAE,BuddGT,TubbsRR,CaseyG,WeilRJ: Breast cancerswithbrainmetastasesaremorelikelytobeestrogenreceptor negative,expressthebasalcytokeratinCK5/6,andoverexpressHER2or EGFR. AmJSurgPathol 2006, 30 :1097-1104. 4.ShmueliE,WiglerN,InbarM: Centralnervoussystemprogressionamong patientswithmetastaticbreastcancerrespondingtotrastuzumab treatment. EurJCancer 2004, 40 :379-382. 5.ThamYL,SextonK,KramerR,HilsenbeckS,ElledgeR: Primarybreast cancerphenotypesassociatedwithpropensityforcentralnervous systemmetastases. Cancer 2006, 107 :696-704. 6.ArteagaCL: ErbB-targetedtherapeuticapproachesinhumancancer. Exp CellRes 2003, 284 :122-130. 7.HudisCA: Trastuzumab – mechanismofactionanduseinclinicalpractice. NEnglJMed 2007, 357 :39-51. 8.RakhaEA,Reis-FilhoJS,EllisIO: Basal-likebreastcancer:acriticalreview. J ClinOncol 2008, 26 :2568-2581. 9.FulfordLG,Reis-FilhoJS,RyderK,JonesC,GillettCE,HanbyA,EastonD, LakhaniSR: Basal-likegradeIIIinvasiveductalcarcinomaofthebreast: patternsofmetastasisandlong-termsurvival. BreastCancerRes 2007, 9 : R4. 10.LuckAA,EvansAJ,GreenAR,RakhaEA,PaishC,EllisIO: Theinfluenceof basalphenotypeonthemetastaticpatternofbreastcancer. ClinOncol (RCollRadiol) 2008, 20 :40-45. 11.PagetS: Thedistributionofsecondarygrowthsincancerofthebreast. CancerMetastasisRev 1989, 8 :98-101. 12.MinnAJ,GuptaGP,SiegelPM,BosPD,ShuW,GiriDD,VialeA,OlshenAB, GeraldWL,MassagueJ: Genesthatmediatebreastcancermetastasisto lung. Nature 2005, 436 :518-524. 13.MinnAJ,KangY,SerganovaI,GuptaGP,GiriDD,DoubrovinM, PonomarevV,GeraldWL,BlasbergR,MassagueJ: Distinctorgan-specific metastaticpotentialofindividualbreastcancercellsandprimary tumors. JClinInvest 2005, 115 :44-55. 14.BosPD,ZhangXH,NadalC,ShuW,GomisRR,NguyenDX,MinnAJ,vande VijverMJ,GeraldWL,FoekensJA,MassaguJ:Genesthatmediatebreast cancermetastasistothebrain. Nature 2009, 459 :1005-1009. 15.PalmieriD,BronderJL,HerringJM,YonedaT,WeilRJ,StarkAM,KurekR, Vega-ValleE,FeigenbaumL,HalversonD,VortmeyerAO,SteinbergSM, AldapeK,SteegPS: Her-2overexpressionincreasesthemetastatic outgrowthofbreastcancercellsinthebrain. CancerRes 2007, 67 :4190-4198. 16.WoodLD,ParsonsDW,JonesS,LinJ,SjblomT,LearyRJ,ShenD, BocaSM,BarberT,PtakJ,SillimanN,SzaboS,DezsoZ,UstyankskyV, NikolskayaT,NikolskyY,KarchinR,WilsonPA,KaminkerJS,ZhangZ, CroshawR,WillisJ,DawsonD,ShipitsinM,WillsonJK,SukumarS,PolyakK, ParkBH,PethiyagodaCL,PantPV, etal : Thegenomiclandscapesof humanbreastandcolorectalcancers. Science 2007, 318 :1108-1113. 17.LinJ,GanCM,ZhangX,JonesS,SjblomT,WoodLD,ParsonsDW, PapadopoulosN,KinzlerKW,VogelsteinB,ParmigianiG,VelculescuVE: A multidimensionalanalysisofgenesmutatedinbreastandcolorectal cancers. GenomeRes 2007, 17 :1304-1318. 18.StephensPJ,McBrideDJ,LinML,VarelaI,PleasanceED,SimpsonJT, StebbingsLA,LeroyC,EdkinsS,MudieLJ,GreenmanCD,JiaM,LatimerC, TeagueJW,LauKW,BurtonJ,QuailMA,SwerdlowH,ChurcherC, NatrajanR,SieuwertsAM,MartensJW,SilverDP,LangerdA,RussnesHE, FoekensJA,Reis-FilhoJS,van ’ tVeerL,RichardsonAL,Brresen-DaleAL, etal : Complexlandscapesofsomaticrearrangementinhumanbreast cancergenomes. Nature 2009, 462 :1005-1010. 19.HollestelleA,NagelJH,SmidM,LamS,ElstrodtF,WasielewskiM,NgSS, FrenchPJ,PeetersJK,RozendaalMJ,RiazM,KoopmanDG,TenHagenTL, deLeeuwBH,ZwarthoffEC,TeunisseA,vanderSpekPJ,KlijnJG, DinjensWN,EthierSP,CleversH,JochemsenAG,denBakkerMA, FoekensJA,MartensJW,SchutteM: Distinctgenemutationprofiles amongluminal-typeandbasal-typebreastcancercelllines. BreastCancer ResTreat 2010, 121 :53-64. 20. COSMIC-CatalogueofSomaticMutationsinCancer. [http://www.sanger. ac.uk/genetics/CGP/cosmic/].DaSilva etal BreastCancerResearch 2010, 12 :R46 http://breast-cancer-research.com/content/12/4/R46 Page11of13

PAGE 12

21.HuX,SternHM,GeL,O ’ BrienC,HayduL,HonchellCD,HavertyPM, PetersBA,WuTD,AmlerLC,ChantJ,StokoeD,LacknerMR,CavetG: Geneticalterationsandoncogenicpathwaysassociatedwithbreast cancersubtypes. MolCancerRes 2009, 7 :511-522. 22.HynesNE,DeyJH: PI3Kinhibitionovercomestrastuzumabresistance: blockadeofErbB2/ErbB3isnotalwaysenough. CancerCell 2009, 15 :353-355. 23.JunttilaTT,AkitaRW,ParsonsK,FieldsC,LewisPhillipsGD,FriedmanLS, SampathD,SliwkowskiMX: Ligand-independentHER2/HER3/PI3K complexisdisruptedbytrastuzumabandiseffectivelyinhibitedbythe PI3KinhibitorGDC-0941. CancerCell 2009, 15 :429-440. 24.NormannoN,TejparS,MorgilloF,DeLucaA,VanCutsemE,CiardielloF: ImplicationsforKRASstatusandEGFR-targetedtherapiesinmetastatic CRC. NatRevClinOncol 2009, 6 :519-527. 25.FanJB,YeakleyJM,BibikovaM,ChudinE,WickhamE,ChenJ,DoucetD, RigaultP,ZhangB,ShenR,McBrideC,LiHR,FuXD,OliphantA,BarkerDL, CheeMS: Aversatileassayforhigh-throughputgeneexpression profilingonuniversalarraymatrices. GenomeRes 2004, 14 :878-885. 26.ThomasRK,BakerAC,DebiasiRM,WincklerW,LaframboiseT,LinWM, WangM,FengW,ZanderT,MacConaillL,LeeJC,NicolettiR,HattonC, GoyetteM,GirardL,MajmudarK,ZiaugraL,WongKK,GabrielS, BeroukhimR,PeytonM,BarretinaJ,DuttA,EmeryC,GreulichH,ShahK, SasakiH,GazdarA,MinnaJ,ArmstrongSA, etal : High-throughput oncogenemutationprofilinginhumancancer. NatGenet 2007, 39 :347-351. 27.KrypuyM,NewnhamGM,ThomasDM,ConronM,DobrovicA: High resolutionmeltinganalysisfortherapidandsensitivedetectionof mutationsinclinicalsamples:KRAScodon12and13mutationsinnonsmallcelllungcancer. BMCCancer 2006, 6 :295. 28.YuJ,KaneS,WuJ,BenedettiniE,LiD,ReevesC,InnocentiG,WetzelR, CrosbyK,BeckerA,FerranteM,CheungWC,HongX,ChirieacLR,ShollLM, HaackH,SmithBL,PolakiewiczRD,TanY,GuTL,LodaM,ZhouX, CombMJ: Mutation-specificantibodiesforthedetectionofEGFR mutationsinnon-small-celllungcancer. ClinCancerRes 2009, 15 :3023-3028. 29.EllisIO,SchnittSJ,Sastre-GarauX,BussolatiG,TavassoliFA,EusebiV, PeterseJL,MukaiK,TabarL,JacquemierJ, etal : Invasivebreast carcinomas. PathologyandGeneticsofTumoursoftheBreastandFemale GenitalOrgans Lyon:IARCPressTavassoliFA,DevileeP2003,13-59. 30.DiGiovannaMP,LermanMA,CoffeyRJ,MullerWJ,CardiffRD,SternDF: ActivesignalingbyNeuintransgenicmice. Oncogene 1998, 17 :1877-1884. 31.WeigeltB,HuZ,HeX,LivasyC,CareyLA,EwendMG,GlasAM,PerouCM, Van ’ tVeerLJ: Molecularportraitsand70-geneprognosissignatureare preservedthroughoutthemetastaticprocessofbreastcancer. Cancer Res 2005, 65 :9155-9158. 32.KaoLS,GreenCE: Analysisofvariance:isthereadifferenceinmeansand whatdoesitmean? JSurgRes 2008, 144 :158-170. 33.SchulzeWX,DengL,MannM: PhosphotyrosineinteractomeoftheErbBreceptorkinasefamily. MolSystBiol 2005,1 :2005. 34.LawAJ,ShannonWeickertC,HydeTM,KleinmanJE,HarrisonPJ: Neuregulin-1(NRG-1)mRNAandproteinintheadulthumanbrain. Neuroscience 2004, 127 :125-136. 35.Pinkas-KramarskiR,EilamR,SpieglerO,LaviS,LiuN,ChangD,WenD, SchwartzM,YardenY: BrainneuronsandglialcellsexpressNeu differentiationfactor/heregulin:asurvivalfactorforastrocytes. ProcNatl AcadSciUSA 1994, 91 :9387-9391. 36.GaedckeJ,TraubF,MildeS,WilkensL,StanA,OstertagH,ChristgenM,von WasielewskiR,KreipeHH: PredominanceofthebasaltypeandHER-2/neu typeinbrainmetastasisfrombreastcancer. ModPathol 2007, 20 :864-870. 37.HonethG,BendahlPO,RingnerM,SaalLH,Gruvberger-SaalSK,LovgrenK, GrabauD,FernoM,BorgA,HegardtC: TheCD44+/CD24-phenotypeis enrichedinbasal-likebreasttumors. BreastCancerRes 2008, 10 :R53. 38.Al-HajjM,WichaMS,Benito-HernandezA,MorrisonSJ,ClarkeMF: Prospectiveidentificationoftumorigenicbreastcancercells. ProcNatl AcadSciUSA 2003, 100 :3983-3988. 39.NandiA,EstessP,SiegelmanMH: Hyaluronananchoringandregulation onthesurfaceofvascularendothelialcellsismediatedthroughthe functionallyactiveformofCD44. JBiolChem 2000, 275 :14939-14948. 40.AlQteishatA,GaffneyJJ,KrupinskiJ,SlevinM: Hyaluronanexpression followingmiddlecerebralarteryocclusionintherat. Neuroreport 2006, 17 :1111-1114. 41.MarangoniE,LecomteN,DurandL,dePinieuxG,DecaudinD, ChomienneC,Smadja-JoffeF,PouponMF: CD44targetingreduces tumourgrowthandpreventspost-chemotherapyrelapseofhuman breastcancersxenografts. BrJCancer 2009, 100 :918-922. 42.ParkerMW,ChenY,HallenbeckJM,FordBD: Neuregulinexpressionafter focalstrokeintherat. NeurosciLett 2002, 334 :169-172. 43.WangGL,SemenzaGL: Characterizationofhypoxia-induciblefactor1 andregulationofDNAbindingactivitybyhypoxia. JBiolChem 1993, 268 :21513-21518. 44.SunM,BehrensC,FengL,OzburnN,TangX,YinG,KomakiR,VarellaGarciaM,HongWK,AldapeKD,WistubaII: HERfamilyreceptor abnormalitiesinlungcancerbrainmetastasesandcorresponding primarytumors. ClinCancerRes 2009, 15 :4829-4837. 45.KonecnyGE,PegramMD,VenkatesanN,FinnR,YangG,RahmehM, UntchM,RusnakDW,SpeharG,MullinRJ,KeithBR,GilmerTM,BergerM, PodratzKC,SlamonDJ: Activityofthedualkinaseinhibitorlapatinib (GW572016)againstHER-2-overexpressingandtrastuzumab-treated breastcancercells. CancerRes 2006, 66 :1630-1639. 46.BergerMB,MendrolaJM,LemmonMA: ErbB3/HER3doesnot homodimerizeuponneuregulinbindingatthecellsurface. FEBSLett 2004, 569 :332-336.47.SPaikCK,JeongJ,GeyerCE,RomondEH,Mejia-MejiaO,MamounasEP: Benefitfromadjuvanttrastuzumabmaynotbeconfinedtopatients withIHC3+and/orFISH-positivetumors:Centraltestingresultsfrom NSABPB-31. ASCOAnnualMeetingProceedings(Post-MeetingEdition), JournalofClinicalOncology 2007, 25(18S) :511. 48.deAlavaE,OcanaA,AbadM,MonteroJC,Esparis-OgandoA,RodriguezCA, OteroAP,HernandezT,CruzJJ,PandiellaA: Neuregulinexpression modulatesclinicalresponsetotrastuzumabinpatientswithmetastatic breastcancer. JClinOncol 2007, 25 :2656-2663. 49.AgusDB,AkitaRW,FoxWD,LewisGD,HigginsB,PisacanePI,LofgrenJA, TindellC,EvansDP,MaieseK,ScherHI,SliwkowskiMX: TargetingligandactivatedErbB2signalinginhibitsbreastandprostatetumorgrowth. CancerCell 2002, 2 :127-137. 50.MacConaillLE,CampbellCD,KehoeSM,BassAJ,HattonC,NiuL,DavisM, YaoK,HannaM,MondalC,LuongoL,EmeryCM,BakerAC,PhilipsJ, GoffDJ,FiorentinoM,RubinMA,PolyakK,ChanJ,WangY,FletcherJA, SantagataS,CorsoG,RovielloF,ShivdasaniR,KieranMW,LigonKL, StilesCD,HahnWC,MeyersonML, etal : Profilingcriticalcancergene mutationsinclinicaltumorsamples. PLoSOne 2009, 4 :e7887. 51.RomeroPA,ArnoldFH: Exploringproteinfitnesslandscapesbydirected evolution. NatRevMolCellBiol 2009, 10 :866-876. 52.MeylanE,DooleyAL,FeldserDM,ShenL,TurkE,OuyangC,JacksT: RequirementforNF-kappaBsignallinginamousemodeloflung adenocarcinoma. Nature 2009, 462 :104-107. 53.DingL,EllisMJ,LiS,LarsonDE,ChenK,WallisJW,HarrisCC,McLellanMD, FultonRS,FultonLL,AbbottRM,HoogJ,DoolingDJ,KoboldtDC, SchmidtH,KalickiJ,ZhangQ,ChenL,LinL,WendlMC,McMichaelJF, MagriniVJ,CookL,McGrathSD,VickeryTL,AppelbaumE,DeschryverK, DaviesS,GuintoliT,LinL, etal : Genomeremodellinginabasal-like breastcancermetastasisandxenograft. Nature 2010, 464 :999-1005. 54.ShahSP,MorinRD,KhattraJ,PrenticeL,PughT,BurleighA,DelaneyA, GelmonK,GulianyR,SenzJ,SteidlC,HoltRA,JonesS,SunM,LeungG, MooreR,SeversonT,TaylorGA,TeschendorffAE,TseK,TurashviliG, VarholR,WarrenRL,WatsonP,ZhaoY,CaldasC,HuntsmanD,HirstM, MarraMA,AparicioS: Mutationalevolutioninalobularbreasttumour profiledatsinglenucleotideresolution. Nature 2009, 461 :809-813. 55.EllisIO,SchnittSJ,Sastre-GarauX, etal : Invasivebreastcarcinomas. PathologyandGeneticsofTumoursoftheBreastandFemaleGenitalOrgans Lyon:IARCPressTavassoliFA,DevileeP2003,13-59. 56.BibikovaM,TalantovD,ChudinE,YeakleyJM,ChenJ,DoucetD, WickhamE,AtkinsD,BarkerD,CheeM,WangY,FanJB: Quantitativegene expressionprofilinginformalin-fixed,paraffin-embeddedtissuesusing universalbeadarrays. AmJPathol 2004, 165 :1799-1807. 57.FanJB,YeakleyJM,BibikovaM,ChudinE,WickhamE,ChenJ,DoucetD, RigaultP,ZhangB,ShenR,McBrideC,LiHR,FuXD,OliphantA,BarkerDL,DaSilva etal BreastCancerResearch 2010, 12 :R46 http://breast-cancer-research.com/content/12/4/R46 Page12of13

PAGE 13

CheeMS: Aversatileassayforhigh-throughputgeneexpression profilingonuniversalarraymatrices. GenomeRes 2004, 14 :878-885. 58.DaSilvaL,ParryS,ReidL,KeithP,WaddellN,KossaiM,ClarkeC, LakhaniSR,SimpsonPT: AberrantexpressionofE-cadherininlobular carcinomasofthebreast. AmJSurgPathol 2008, 32 :773-783. 59.KramerD,ThunnissenFB,Gallegos-RuizMI,SmitEF,PostmusPE,MeijerCJ, SnijdersPJ,HeidemanDA: Afast,sensitiveandaccuratehighresolution melting(HRM)technologybasedassaytoscreenforcommonK-ras mutations. CellularOncology 2009, 31 :161-167. doi:10.1186/bcr2603 Citethisarticleas: DaSilva etal .: HER3anddownstreampathwaysare involvedincolonizationofbrainmetastasesfrombreastcancer. Breast CancerResearch 2010 12 :R46. Submit your next manuscript to BioMed Central and take full advantage of: Convenient online submission Thorough peer review No space constraints or color gure charges Immediate publication on acceptance Inclusion in PubMed, CAS, Scopus and Google Scholar Research which is freely available for redistribution Submit your manuscript at www.biomedcentral.com/submit DaSilva etal BreastCancerResearch 2010, 12 :R46 http://breast-cancer-research.com/content/12/4/R46 Page13of13


!DOCTYPE art SYSTEM 'http:www.biomedcentral.comxmlarticle.dtd'
ui bcr2603
ji BCJ
fm
dochead Research article
bibl
title
p HER3 and downstream pathways are involved in colonization of brain metastases from breast cancer
aug
au id A1
snm Da Silva
fnm Leonard
insr iid I1
I2
I3
email l.dasilva@uq.edu.au
A2
Simpson
mi T
Peter
p.simpson@uq.edu.au
A3
Smart
E
Chanel
c.smart@uq.edu.au
A4
Cocciardi
Sibylle
Sibylle.Kugler@qimr.edu.au
A5
Waddell
Nic
n.waddell@imb.uq.edu.au
A6
Lane
Annette
a.lane@uq.edu.au
A7
Morrison
J
Brian
I4
Brian.Morrison@qimr.edu.au
A8
Vargas
mnm Cristina
Ana
anacristina@uq.edu.au
A9
Healey
Sue
Sue.Healey@qimr.edu.au
A10
Beesley
Jonathan
Jonathan.Beesley@qimr.edu.au
A11
Pakkiri
Pria
p.pakkiri@uq.edu.au
A12
Parry
Suzanne
suzclare@hotmail.com
A13
Kurniawan
Nyoman
I5
n.kurniawan@uq.edu.au
A14
Reid
Lynne
l.reid@uq.edu.au
A15
Keith
Patricia
p.keith@uq.edu.au
A16
Faria
Paulo
I7
I6
pauloafaria@gmail.com
A17
Pereira
Emilio
I8
emilio@salomaoezoppi.com.br
A18
Skalova
Alena
I9
skalova@fnplzen.cz
A19
Bilous
Michael
I10
michael.bilous@swahs.health.nsw.gov.au
A20
Balleine
L
Rosemary
I11
rosemary_balleine@wmi.usyd.edu.au
A21
Do
Hongdo
I12
Hongdo.Do@petermac.org
A22
Dobrovic
Alexander
alex.dobrovic@petermac.org
A23
Fox
Stephen
stephen.fox@petermac.org
A24
Franco
Marcello
m.franco@unifesp.br
A25
Reynolds
Brent
I13
I16
brent.reynolds@neurosurgery.ufl.edu
A26
Khanna
Kum
Kum
I14
KumKum.Khanna@qimr.edu.au
A27
Cummings
Margaret
m.cummings@uq.edu.au
A28
Chenevix-Trench
Georgia
Georgia.Trench@qimr.edu.au
A29 ca yes
Lakhani
R
Sunil
I15
s.lakhani@uq.edu.au
insg
ins
Molecular & Cellular Pathology, The University of Queensland Centre for Clinical Research, & School of Medicine, Building 918/B71, RBWH complex, Brisbane, 4029, Australia
Cancer Genetics and Molecular Pathology, The Queensland Institute of Medical Research, 300 Herston Road, Brisbane, 4006, Australia
Departamento de Anatomia Patológica, Universidade Federal de São Paulo, EPM, 754 Rua Napoleão de Barros, São Paulo, 04024-000, Brazil
Biomolecular and Biomedical Science, Griffith University, 170 Kessels Road, Brisbane, 4011, Australia
Centre for Magnetic Resonance, The University of Queensland, St Lucia, Brisbane, 4072, Australia
Lembaga Eijkman, Eijkman Institute, Diponegoro 69, Jakarta, 10430, Indonesia
Departamento de Patologia, Instituto Nacional de Câncer, 23 Praça Cruz Vermelha, Rio de Janeiro, 20230-130, Brazil
Departamento de Patologia, Laboratório Salomão & Zoppi, 48 Rua Correia Dias, São Paulo, 04104-000, Brazil
Department of Pathology, Medical Faculty of Charles University in Plzen, Husova 3, 306 05, Czech Republic
Sydney West Area Health Service, Institute of Clinical Pathology and Medical Research, University of Sydney, Darcy Road, Sydney, 2145, Australia
Translational Oncology, Sydney West Area Health Service, Westmead Millennium Institute, University of Sydney, Darcy Road, Sydney, 2145, Australia
Department of Pathology, Peter MacCallum Cancer Centre, St Andrews Pl, East Melbourne, 3002, Australia
Queensland Brain Institute, The University of Queensland, St Lucia, Brisbane, 4072, Australia
Signal Transduction, The Queensland Institute of Medical Research, 300 Herston Road, Brisbane, 4006, Australia
Pathology Queensland: The Royal Brisbane & Women's Hospital, Herston Road, Brisbane, 4029, Australia
Current address University of Florida, McKnight Brain Institute,100 S. Newell Drive, Gainesville, 32611, USA
source Breast Cancer Research
issn 1465-5411
pubdate 2010
volume 12
issue 4
fpage R46
url http://breast-cancer-research.com/content/12/4/R46
xrefbib
pubidlist
pubid idtype pmpid 20604919
doi 10.1186/bcr2603
history
rec
date
day 14
month 3
year 2010
revrec
15
6
2010
acc
06
7
2010
pub
06
7
2010
cpyrt
2010
collab Da Silva et al.; licensee BioMed Central Ltd.
note This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
abs
sec
st
Abstract
Introduction
Metastases to the brain from breast cancer have a high mortality, and basal-like breast cancers have a propensity for brain metastases. However, the mechanisms that allow cells to colonize the brain are unclear.
Methods
We used morphology, immunohistochemistry, gene expression and somatic mutation profiling to analyze 39 matched pairs of primary breast cancers and brain metastases, 22 unmatched brain metastases of breast cancer, 11 non-breast brain metastases and 6 autopsy cases of patients with breast cancer metastases to multiple sites, including the brain.
Results
Most brain metastases were triple negative and it basal-like. The brain metastases over-expressed one or more members of the HER family and in particular HER3 was significantly over-expressed relative to matched primary tumors. Brain metastases from breast and other primary sites, and metastases to multiple organs in the autopsied cases, also contained somatic mutations in EGFR, HRAS, KRAS, NRAS or PIK3CA. This paralleled the frequent activation of AKT and MAPK pathways. In particular, activation of the MAPK pathway was increased in the brain metastases compared to the primary tumors.
Conclusions
Deregulated HER family receptors, particularly HER3, and their downstream pathways are implicated in colonization of brain metastasis. The need for HER family receptors to dimerize for activation suggests that tumors may be susceptible to combinations of anti-HER family inhibitors, and may even be effective in the absence of HER2 amplification (that is, in triple negative/basal cancers). However, the presence of activating mutations in PIK3CA, HRAS, KRAS and NRAS suggests the necessity for also specifically targeting downstream molecules.
bdy
Introduction
Among women with breast cancer, 30% to 40% will develop metastatic disease. The natural history of metastatic breast cancer to the brain is of symptomatic disease in 10% to 20% of these patients and a dismal mean survival of six months following diagnosis abbrgrp abbr bid B1 1B2 2. Associations with younger age, p53 positivity, estrogen receptor (ER) negative and epidermal growth factor receptor 1 (EGFR) and two (HER2) positive cancers have been reported B3 3B4 4B5 5. The epidermal growth factor receptor family comprises four receptors, HER1 to 4. Upon activation, hetero or homo-dimerization occurs, followed by phosphorylation of specific tyrosine residues in the intracellular domain, stimulating signaling cascades mediated mainly by AKT and MAPK and the regulation of cell proliferation, angiogenesis, migration and survival B6 6B7 7.
Basal-like tumors are generally high grade, negative for ER, progesterone receptors (PgR) and HER2 (that is, triple negative) B8 8. The current dogma would predict that these tumors are unlikely to respond to endocrine and trastuzumab-based therapy and no targeted therapy is currently available, although clinical trials are ongoing 8. Despite being node negative, a proportion of patients subsequently present with distant metastases, particularly to the brain B9 9B10 10
Using autopsy records of breast cancer patients, Paget B11 11 demonstrated a non-random pattern of metastatic spread. This suggested that tumor cells (the seed) could have a specific affinity for the microenvironment of certain organs (the soil). In agreement, animal models demonstrate that particular sets of genes can increase the potential of breast cancer cell lines to colonize specific distant sites, for example, bone, lung B12 12B13 13; and brain B14 14B15 15.
The cancer mutatome is very complex, with more than 140 CAN genes identified which are mutated at a significant frequency in cancer B16 16B17 17. The genomic landscape of breast cancer is also very complex and heterogeneous, with different subgroups of tumours (luminal, basal, HER2) harboring different types and patterns of mutations B18 18. There is also evidence that breast cancer cell lines with a basal phenotype have a higher frequency of mutations in BRAF, KRAS, and HRAS than luminal breast cancer cell lines B19 19B20 20B21 21.
We have analyzed a relatively large and rare set of human tumors to elucidate the mechanisms involved in colonization of the brain. Samples studied involved matched pairs of primary breast cancer and brain metastases, unmatched brain metastases, non-breast brain metastases and autopsy cases of breast cancer patients with metastases to multiple sites, including the brain. We provide evidence of increased activation of HER3 and downstream pathway molecules in brain metastases from breast cancer and suggest that the inhibition of HER family receptors, even in the absence of HER2 gene amplification (for example, triple negative/basal cancers), could play a significant role in the management of patients with brain metastases from breast cancer. In addition, we demonstrated the possible fallacies of this approach without considering the presence of somatic activating mutations in downstream molecules B22 22B23 23B24 24.
Materials and methods
Additional detailed methodologies (see Additional file supplr sid S1 1). The study was approved by the local research ethics committees under the project number UQ2005000785 and RBHW 2005/22.
suppl
Additional file 1
text
b Supplementary methodologies. This file contains information of how the morphological review and TMA creation were performed. It also contains information on protocols for immunohistochemistry and chromogenic in situ hybridization, RNA extraction and Real-Time RT-PCR, DASL gene expression profiling, cell line analysis and culture, oncoCarta somatic mutation analysis protocols, high resolution melt analysis and iPLEX genotyping protocols.
file name bcr2603-S1.doc
Click here for file
Clinical samples
All human clinical samples studied were available as formalin fixed-paraffin embedded (FFPE) tumor blocks. Cohorts collected were: i) 39 matched pairs of primary breast cancer and brain metastases; ii) 22 unmatched brain metastases from breast cancer; iii) 11 brain metastases from non-breast sites (one melanoma, one colorectal, six lung, one prostate and two renal cell carcinomas); and iv) 26 tumor samples (primary breast cancer and metastases to multiple sites, including brain) from six autopsy cases of patients who died of metastatic breast cancer (the primary breast cancer from one case was not available). The tumors were reviewed by three pathologists (LDS, MC and SRL) and analyzed by immunohistochemistry and chromogenic in situ hybridization (CISH) on tissue microarrays. Immunohistochemistry for EGFR, HER2, HER3, HER4, CD44 and CD24 was also done on whole sections.
Gene expression analysis
RNA was extracted from FFPE samples and the expression of 512 cancer related genes was analyzed using the DASL assay (cDNA-mediated annealing, selection extension and ligation, Illumina Inc., San Diego, California, USA) B25 25. All data and protocols for DASL analysis can be found at the Gene Expression Omnibus repository (Accession number GSE14690) (see also additional file 1). Real-time PCR using TaqMansup ® gene expression assays (Applied Biosystems, Inc, Carlsbad, California, USA ) and immunohistochemistry were performed to validate the expression of specific genes.
Somatic mutation analysis
Twelve matched pairs of primary breast tumors and corresponding brain metastases, nine non-breast brain metastases and 26 tumor samples from the six autopsy cases were subjected to primer extension and MALDI-TOF mass spectrometry using the OncoCarta® Panel Assay v1.0 (Sequenom Inc., San Diego, California, USA) of 238 mutations in 19 oncogenes B26 26. All mutations in samples for which there was sufficient DNA remaining were validated by High Resolution Melt (HRM) B27 27 analysis, iPLEX (using newly designed PCR and extension primers that differed from the OncoCarta primers), repeat OncoCarta analysis, and/or direct sequencing if the Mutant Allele Proportion (MAP) was 30% (Table tblr tid="T1"1/tblr and Additional file supplr sid="S2"2/supplr, Table S2). In addition, we were able to validate the itEGFR /itE746_A750del mutation in four cases with a mutation-specific antibody abbrgrpabbr bid="B28"28/abbr/abbrgrp./p
tbl id="T1" hint_layout="double"
title
pTable 1/p
/title
caption
pSomatic mutations identified by OncoCarta and ER, PgR and HER family of receptors assessment/p
/caption
tblbdy cols="13"
r
c cspan="13" ca="left"
p
bMatched breast primary-brain metastasis pairs/b
/p
/c
/r
r
c cspan="13"
hr/
/c
/r
r
c ca="center"
p
bCase ID#/b
/p
/c
c ca="center"
p
bSite/b
/p
/c
c ca="left"
p
bER PgR- HER 1-2-3-4/b
/p
/c
c cspan="2" ca="center"
p
b
itEGFR/it
/b
/p
/c
c cspan="2" ca="center"
p
b
itNRAS/it
/b
/p
/c
c cspan="2" ca="center"
p
b
itPIK3CA/it
/b
/p
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
/r
r
c cspan="13"
hr/
/c
/r
r
c
p/
/c
c
p/
/c
c
p/
/c
c ca="center"
p
bMutation/b
/p
/c
c ca="center"
p
bMAP/b
/p
/c
c ca="center"
p
bMutation/b
/p
/c
c ca="center"
p
bMAP/b
/p
/c
c ca="center"
p
bMutation/b
/p
/c
c ca="center"
p
bMAP/b
/p
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
/r
r
c cspan="13"
hr/
/c
/r
r
c ca="center"
p
b1/b
/p
/c
c ca="center"
p
bbrain/b
/p
/c
c ca="left"
pER-, PgR-, HER1-, HER2+, HER3-, HER4-/p
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
/r
r
c cspan="13"
hr/
/c
/r
r
c
p/
/c
c ca="center"
p
bbreast/b
/p
/c
c ca="left"
pER-, PgR-, HER1-, HER2+, HER3-, HER4-/p
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
/r
r
c cspan="13"
hr/
/c
/r
r
c ca="center"
p
b2/b
/p
/c
c ca="center"
p
bbrain/b
/p
/c
c ca="left"
pER-, PgR-, HER1-, HER2-, HER3+, HER4-/p
/c
c
p/
/c
c
p/
/c
c ca="left"
pQ61RsupO, H, I, S/sup/p
/c
c ca="left"
p39.50%/p
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
/r
r
c cspan="13"
hr/
/c
/r
r
c
p/
/c
c ca="center"
p
bbreast/b
/p
/c
c ca="left"
pER-, PgR-, HER1-, HER2-, HER3+, HER4-/p
/c
c
p/
/c
c
p/
/c
c ca="left"
pQ61RsupO, H, I, S/sup/p
/c
c ca="left"
p38.30%/p
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
/r
r
c cspan="13"
hr/
/c
/r
r
c ca="center"
p
b4/b
/p
/c
c ca="center"
p
bbrain/b
/p
/c
c ca="left"
pER-, PgR+, HER1+, HER2-, HER3-, HER4-/p
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
/r
r
c cspan="13"
hr/
/c
/r
r
c
p/
/c
c ca="center"
p
bbreast/b
/p
/c
c ca="left"
pER-, PgR+, HER1+, HER2-, HER3-, HER4-/p
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
/r
r
c cspan="13"
hr/
/c
/r
r
c ca="center"
p
b6/b
/p
/c
c ca="center"
p
bbrain/b
/p
/c
c ca="left"
pER-, PgR+, HER1+, HER2-, HER3-, HER4-/p
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
/r
r
c cspan="13"
hr/
/c
/r
r
c
p/
/c
c ca="center"
p
bbreast/b
/p
/c
c ca="left"
pER-, PgR+, HER1+, HER2-, HER3-, HER4-/p
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
/r
r
c cspan="13"
hr/
/c
/r
r
c ca="center"
p
b7/b
/p
/c
c ca="center"
p
bbrain/b
/p
/c
c ca="left"
pER-, PgR-, HER1+, HER2-, HER3-, HER4-/p
/c
c
p/
/c
c
p/
/c
c ca="left"
pQ61RsupI, S/sup/p
/c
c ca="left"
p34.4%/p
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
/r
r
c cspan="13"
hr/
/c
/r
r
c
p/
/c
c ca="center"
p
bbreast/b
/p
/c
c ca="left"
pER-, PgR-, HER1+, HER2-, HER3-, HER4-/p
/c
c
p/
/c
c
p/
/c
c ca="left"
pQ61RsupI, S/sup/p
/c
c ca="left"
p34.1%/p
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
/r
r
c cspan="13"
hr/
/c
/r
r
c ca="center"
p
b8/b
/p
/c
c ca="center"
p
bbrain/b
/p
/c
c ca="left"
pER-, PgR-, HER1-, HER2+, HER3+, HER4-/p
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
/r
r
c cspan="13"
hr/
/c
/r
r
c
p/
/c
c ca="center"
p
bbreast/b
/p
/c
c ca="left"
pER-, PgR-, HER1-, HER2+, HER3-, HER4-/p
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
/r
r
c cspan="13"
hr/
/c
/r
r
c ca="center"
p
b9/b
/p
/c
c ca="center"
p
bbrain/b
/p
/c
c ca="left"
pER-, PgR-, HER1-, HER2+, HER3-, HER4-/p
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c ca="left"
pH1047RsupS/sup/p
/c
c ca="left"
p79.50%/p
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
/r
r
c cspan="13"
hr/
/c
/r
r
c
p/
/c
c ca="center"
p
bbreast/b
/p
/c
c ca="left"
pER-, PgR-, HER1-, HER2+, HER3-, HER4-/p
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c ca="left"
pH1047RsupS/sup/p
/c
c ca="left"
p79.50%/p
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
/r
r
c cspan="13"
hr/
/c
/r
r
c ca="center"
p
b10/b
/p
/c
c ca="center"
p
bbrain/b
/p
/c
c ca="left"
pER-, PgR-, HER1+, HER2-, HER3+, HER4-/p
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c ca="left"
pE545KsupH, NVP/sup/p
/c
c ca="left"
p23.40%/p
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
/r
r
c cspan="13"
hr/
/c
/r
r
c
p/
/c
c ca="center"
p
bbreast/b
/p
/c
c ca="left"
pER-, PgR-, HER1+, HER2-, HER3-, HER4-/p
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c ca="left"
pE545KsupH, NVP/sup/p
/c
c ca="left"
p18.20%/p
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
/r
r
c cspan="13"
hr/
/c
/r
r
c ca="center"
p
b11/b
/p
/c
c ca="center"
p
bbrain/b
/p
/c
c ca="left"
pER-, PgR-, HER1-, HER2+, HER3-, HER4+/p
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
/r
r
c cspan="13"
hr/
/c
/r
r
c
p/
/c
c ca="center"
p
bbreast/b
/p
/c
c ca="left"
pER-, PgR-, HER1-, HER2+, HER3-, HER4+/p
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
/r
r
c cspan="13"
hr/
/c
/r
r
c ca="center"
p
b12/b
/p
/c
c ca="center"
p
bbrain/b
/p
/c
c ca="left"
pER-, PgR+, HER1-, HER2-, HER3+, HER4-/p
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
/r
r
c cspan="13"
hr/
/c
/r
r
c
p/
/c
c ca="center"
p
bbreast/b
/p
/c
c ca="left"
pER-, PgR+, HER1-, HER2-, HER3+, HER4-/p
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
/r
r
c cspan="13"
hr/
/c
/r
r
c ca="center"
p
b13/b
/p
/c
c ca="center"
p
bbrain/b
/p
/c
c ca="left"
pER-, PgR-, HER1+, HER2-, HER3-, HER4-/p
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
c
p/
/c
/r
r
c cspan="13"
hr/
/c
/r
r
c
p/
/c
c ca="center"
p
bbreast/b
/p
/c
c ca="left"
pER-, PgR-, HER1+, HER2-, HER3-, HER4-/p
/c
c ca="left"
pN771_P772SVDNRp
c
c ca="left"
p12.10%p
c
c
p
c
c
p
c
c
p
c
c
p
c
c
p
c
c
p
c
c
p
c
c
p
c
r
r
c cspan="13"
hr
c
r
r
c ca="center"
p
b14b
p
c
c ca="center"
p
bbrainb
p
c
c ca="left"
pER-, PgR-, HER1+, HER2-, HER3-, HER4-p
c
c
p
c
c
p
c
c
p
c
c
p
c
c
p
c
c
p
c
c
p
c
c
p
c
c
p
c
c
p
c
r
r
c cspan="13"
hr
c
r
r
c
p
c
c ca="center"
p
bbreastb
p
c
c ca="left"
pER-, PgR-, HER1+, HER2-, HER3-, HER4-p
c
c
p
c
c
p
c
c
p
c
c
p
c
c
p
c
c
p
c
c
p
c
c
p
c
c
p
c
c
p
c
r
r
c cspan="13"
hr
c
r
r
c cspan="13" ca="left"
p
bUnmatched brain metastases from primary lung, colon, melanoma and kidney tumoursb
p
c
r
r
c cspan="13"
hr
c
r
r
c ca="left"
p
bCase ID#b
p
c
c ca="left"
p
bSiteb
p
c
c ca="center"
p
bER PgR- HER 1-2-3-4b
p
c
c cspan="2" ca="center"
p
b
itEGFRit
b
p
c
c cspan="2" ca="center"
p
b
itHRASit
b
p
c
c cspan="2" ca="center"
p
b
itKRASit
b
p
c
c cspan="2" ca="center"
p
b
itNRASit
b
p
c
c cspan="2" ca="center"
p
b
itPIK3CAit
b
p
c
r
r
c cspan="13"
hr
c
r
r
c
p
c
c
p
c
c
p
c
c ca="center"
p
bMutationb
p
c
c ca="center"
p
bMAPb
p
c
c ca="center"
p
bMutationb
p
c
c ca="center"
p
bMAPb
p
c
c ca="center"
p
bMutationb
p
c
c ca="center"
p
bMAPb
p
c
c ca="center"
p
bMutationb
p
c
c ca="center"
p
bMAPb
p
c
c ca="center"
p
bMutationb
p
c
c ca="left"
p
bMAPb
p
c
r
r
c cspan="13"
hr
c
r
r
c ca="left"
p
bD2b
p
c
c ca="left"
p
bmelanomab
p
c
c ca="center"
pn.a.p
c
c
p
c
c
p
c
c
p
c
c
p
c
c
p
c
c
p
c
c
p
c
c
p
c
c ca="center"
pE545KsupH, I, Ysupp
c
c ca="left"
p30.80%p
c
r
r
c cspan="13"
hr
c
r
r
c ca="left"
p
bD3b
p
c
c ca="left"
p
bcolonb
p
c
c ca="center"
pn.a.p
c
c
p
c
c
p
c
c
p
c
c
p
c
c ca="center"
pG12CsupSsupp
c
c ca="center"
p38.90%p
c
c
p
c
c
p
c
c
p
c
c
p
c
r
r
c cspan="13"
hr
c
r
r
c ca="left"
p
bD4b
p
c
c ca="left"
p
blungb
p
c
c ca="center"
pn.a.p
c
c ca="center"
pE746_A750delsupAsupp
c
c ca="center"
p21.00%p
c
c
p
c
c
p
c
c
p
c
c
p
c
c
p
c
c
p
c
c
p
c
c
p
c
r
r
c cspan="13"
hr
c
r
r
c ca="left"
p
bD5b
p
c
c ca="left"
p
blungb
p
c
c ca="center"
pn.a.p
c
c
p
c
c
p
c
c
p
c
c
p
c
c
p
c
c
p
c
c
p
c
c
p
c
c
p
c
c
p
c
r
r
c cspan="13"
hr
c
r
r
c ca="left"
p
bD6b
p
c
c ca="left"
p
blungb
p
c
c ca="center"
pn.a.p
c
c ca="center"
pE746_A750delsupA, NVIsupp
c
c ca="center"
p14.40%p
c
c ca="center"
pG13SsupbIbsupp
c
c ca="center"
p17.30%p
c
c
p
c
c
p
c
c ca="center"
pG12CsupI;Ssupp
c
c ca="center"
p35.70%p
c
c
p
c
c
p
c
r
r
c cspan="13"
hr
c
r
r
c ca="left"
p
bD7b
p
c
c ca="left"
p
blungb
p
c
c ca="center"
pn.a.p
c
c
p
c
c
p
c
c
p
c
c
p
c
c
p
c
c
p
c
c ca="center"
pG12CsupbO;Ibsupp
c
c ca="center"
p9.70%p
c
c
p
c
c
p
c
r
r
c cspan="13"
hr
c
r
r
c ca="left"
p
bD8b
p
c
c ca="left"
p
blungb
p
c
c ca="center"
pn.a.p
c
c
p
c
c
p
c
c
p
c
c
p
c
c ca="center"
pG12CsupSsupp
c
c ca="center"
p39.90%p
c
c
p
c
c
p
c
c
p
c
c
p
c
r
r
c cspan="13"
hr
c
r
r
c ca="left"
p
bD9b
p
c
c ca="left"
p
blungb
p
c
c ca="center"
pn.a.p
c
c
p
c
c
p
c
c
p
c
c
p
c
c
p
c
c
p
c
c
p
c
c
p
c
c ca="center"
pE545KsupHsupp
c
c ca="left"
p13.30%p
c
r
r
c cspan="13"
hr
c
r
r
c ca="left"
p
bD10b
p
c
c ca="left"
p
bkidneyb
p
c
c ca="center"
pn.a.p
c
c ca="center"
pE746_A750delsupA, Isupp
c
c ca="center"
p9.10%p
c
c
p
c
c
p
c
c
p
c
c
p
c
c ca="center"
pG12CsupbI, Sbsupp
c
c ca="center"
p35.20%p
c
c
p
c
c
p
c
r
tblbdy
tblfn
pA, validated by immunohistochemistry using a mutation-specific antibody; ER, estrogen receptor; H, validated by High Resolution Melt analysis; I, validated by iPLEX; ID, case number identification; MAP, Mutant Allele Proportion estimated by OncoCarta; NVI, not validated by iPLEX; NVP, no further validation possible because no DNA remained; O, validated by repeat OncoCarta; PgR, progesterone receptor; S, validated by sequencing; Y, sequencing did not work for this sample; n.a., not accessed.p
tblfn
tbl
suppl id="S2"
title
pAdditional file 2p
title
text
pbSupplementary resultsb. This file contains tables and figures regarding all immunohistochemistry data, extra gene expression and mutation results, and HER family gene expression by RT-PCR.p
text
file name="bcr2603-S2.doc"
pClick here for filep
file
suppl
sec
sec
sec
st
pResultsp
st
sec
st
pClinical and pathological featuresp
st
pThe median age at diagnosis was 48.5 years and the median time for the development of brain metastasis was 3.5 years. All but one of the series of primary breast cancers and all brain metastases were grade 3 invasive ductal carcinomas-no specific type (IDC-NST) abbrgrpabbr bid="B29"29abbrabbrgrp. The remaining tumor pair was a grade 2 mucinous carcinoma. The autopsy samples comprised four grade 3 and one grade 2 IDC-NST.p
sec
sec
st
pER, PgR, HER2, 'Basal' markers and stem cell markers (non-autopsy cases)p
st
pImmunohistochemistry data are summarized in Figure figr fid="F1"1A, Bfigr (see also additional file supplr sid="S2"2supplr, Table S1 and Figure S1). It was noteworthy that 60% and 76% of the tumors were negative for ER and PR, respectively, with complete concordance between primary and metastases. Seventy-seven percent (77%) and 81% of the unmatched brain metastases were also ER and PR negative, respectively. Twenty percent (20%) and 19% of the primary breast tumors and metastases, respectively, had correlated over-expression of HER2 (3+ staining) and all of these showed gene amplification using CISH. Twenty percent (20%) of the unmatched metastases were also HER2+. Fifty-six percent (56%) of the primary tumors and 48% of the matched metastases were triple negative and of these, 60% were positive for at least one of the basal markers respectively (CK14, CK56, CK17, EGFR and SMA). Overall, 54% of the primary and 60% of the metastases were of itbasal itphenotype (irrespective of ER, PR and HER2 status), confirming enrichment in this cohort over the normal distribution in breast cancer abbrgrpabbr bid="B8"8abbrabbrgrp. Noteworthy, EGFR staining was seen mainly in the periphery of the tumor where there was contact with non-neoplastic brain parenchyma abbrgrpabbr bid="B30"30abbrabbrgrp. A higher proportion of brain metastases had a putative stem cell-like phenotype (CD44sup+supCD24sup-sup) compared to the primaries, 55% versus 25%, (Figure figr fid="F1"1Afigr). Fifty-one percent (51%) of the primary tumors had a Ki-67 index higher than 10% in contrast to matched and unmatched metastases that had 86% and 85% of samples with index higher than 10%.p
fig id="F1"
title
pFigure 1p
title
caption
pImmunohistochemical profile of primary breast and brain metastasesp
caption
text
pbImmunohistochemical profile of primary breast and brain metastasesb. bA b- Immunohistochemical analysis of matched primary breast and brain metastases. The graph depicts percentages of positive cases in each category. ER and PR were considered positive when 10% cells showed staining, HER2 was considered positive when IHC showed 3+ staining (30% positive cells) or CISH showed gene amplification. Triple negative tumors were negative for ER, PR and HER2. CD44+CD24- immunohistochemistry was assessed on serial sections and positivity was expression in 10% cells. bB b- Breakdown of basal markers. A tumor was regarded as itbasal itif any of the following markers were positive (CK56, CK14, CK17, p63, SMA, and EGFR) with 10% cells showed staining.p
text
graphic file="bcr2603-1" hint_layout="double"
fig
sec
sec
st
pGene expression profilingp
st
pThe availability of good quality RNA and stringent filtering of the DASL data yielded gene expression profiling data on 3761 brain metastases from breast cancer (1539 from matched pairs and 2222 from unmatched metastases) and 15 matched primaries. Unsupervised analysis highlighted a strong similarity between primary tumors and their matched metastases (Figure figr fid="F2"2Afigr). Only 20 genes were differentially expressed between the matched primaries and metastases. This may be a consequence of the overall strong similarity between primaries and metastases abbrgrpabbr bid="B31"31abbrabbrgrp coupled with the sample size (n = 30) and number of genes analyzed (n = 512 cancer genes in the DASL panel) abbrgrpabbr bid="B32"32abbrabbrgrp. Comparison between primaries and all metastases (matched and unmatched) identified 27 statistically significant, differentially expressed genes (Figure figr fid="F2"2Bfigr). Supplementary Figure 2 (see Additional file supplr sid="S2"2supplr, Figure S2) depicts principal component analysis showing good separation of the primaries and metastases using this 27-gene list. All 20 genes identified in the matched pair analysis were part of this 27-gene set. Among this 20-gene set, were itHER3 itand one of its downstream target molecules itGRB2 itabbrgrpabbr bid="B33"33abbrabbrgrp, hypoxia related molecule itHIF1-alfait, MAPKinase cascade related protein itCREBBPit, cell cycle regulator RB1 and proliferation related genes itCCNH, CDK7 itand itCDC25Bit. Since the brain is rich in neuregulin 1 abbrgrpabbr bid="B34"34abbrabbr bid="B35"35abbrabbrgrp and this is a ligand for HER3, we hypothesized that the neuregulin-HER3 activation was important in allowing breast cancer cells to colonize the brain.p
fig id="F2"
title
pFigure 2p
title
caption
pGene expression profiling of brain metastasesp
caption
text
pbGene expression profiling of brain metastasesb. bA b- Unsupervised hierarchical clustering of DASL gene expression data from 22 unmatched (black color bar) and 15 matched primary and brain metastases (other colors bars). Thirteen out of 15 matched samples are clustering together. bB b- Heatmap and dendogram showing clustering of the samples based on the 27 genes differentially expressed between primary tumors (blue line bar) and brain metastases (red line bar).p
text
graphic file="bcr2603-2" hint_layout="double"
fig
sec
sec
st
pHER family receptors and downstream molecules expressionp
st
pitHER3, EGFR, HER2, HER4 itand itHIF1-alfa itexpression was assessed using quantitative RT-PCR (see Additional file supplr sid="S2"2supplr, Figure S3) in 12 matched breastbrain samples for which DASL data and RNA were available. Similar to the DASL data, 10 cases showed increased fold change by RT-PCR of itHER3 itgene expression relative to their matched primaries ranging from 1.12 to 5.8 and with an average of 2.4. Immunohistochemistry for HER3 was similar, showing positivity in 1137 (29.7%) of the primary tumors, 2237 (59%) of the matched metastases and 1321 (62%) of the unmatched brain metastases (itP it= 0.019). In agreement, phosphorylated HER3 confirmed more frequent activation in the brain metastases, with positivity in 1437 (37%) of the primary tumors, 2437 (64%) of the matched metastases and 1821 (85%) of the unmatched brain metastases (itP it= 0.046) (see Additional file supplr sid="S2"2supplr, Table S1 and Figure S1).p
pImmunohistochemistry for GRB2, HIF1-alfa and phosphorylated ERK12, JNK12, ERK5 and p38 also demonstrated increased activation in the metastases compared to the primary tumors; (see Additional file supplr sid="S2"2supplr, Table S1 and Figure S1). In contrast, phosphorylated AKT was equally high in both the primaries and metastases (see Additional file supplr sid="S2"2supplr, Table S1). Interestingly, the non-breast derived brain metastases showed similarly high activation of the MAPK pathway together with over-expression (3+ stain) of EGFR (in 911 (81%) metastases (a prostate and one colon carcinoma did not) but in the absence of HER3 activation (011) (see Additional file supplr sid="S2"2supplr, Table S1).p
sec
sec
st
pSomatic mutation analysisp
st
pOncoCarta analysis identified mutations in the brain metastases from primary breast cancers (non-autopsy cases) in itNRAS it(212 17%), and itPIK3CA it(212 17%) (Table tblr tid="T1"1tblr and Figure figr fid="F3"3figr). Mutations were also identified in brain metastases from non-breast primaries in itEGFR it(39 33%; two lung and one kidney), itHRAS it(19 11%; lung), itKRAS it(29 22%; one colon and one lung), itNRAS it(39 33%; two lung and one kidney) and itPIK3CA it(29 22%; one melanoma and one lung).p
fig id="F3"
title
pFigure 3p
title
caption
pOncocarta and validation mutation analysesp
caption
text
pbOncocarta and validation mutation analysesb. bA)b. Example of itNRAS itQ61R mutation identified by OncoCarta in matched pair sample #7 showing representative spectra and cluster plot. bB) bSequence validation of itNRAS itG12C, sample D6 lung metastasis. bC) bSequence validation of itNRAS itQ61R, breast and brain metastasis from sample #2. bD) bImmunohistochemistry of brain metastasis (sample D4) with antibody specific to itEGFR itE746_A750del showing staining in the tumor but not the surrounding brain tissue.p
text
graphic file="bcr2603-3" hint_layout="double"
fig
pMutant Allele Proportions (MAPs) ranged from 9% to 80%. All these mutations were validated by immunohistochemistry (using a specific antibody raised against the protein with the itEGFR itE746_A750del mutation) or sequencing except for one each in itEGFR, HRAS it(validated by iPLEX), itNRAS itand itPIC3CA it(itvalidated itby HRM), where the estimated mutant allele proportion was less than 15%, and two in itPIK3CA itin which there was insufficient good quality DNA remaining to obtain sequence data. itEGFR itG719 S bappeared to be found frequently by OncoCarta but could not be detected by iPLEX, using independent PCR and extension primers. The OncoCarta false-positive result appeared to be due to hairpin formation of the extension primer that occurred frequently when archival DNA was used as a template, and the yield was low.p
pExcept for one itEGFR itmutation (Case #13; Table tblr tid="T1"1tblr), the same somatic mutations were observed in the brain metastases with similar MAPs as in the matched primary breast tumors. It was noteworthy that the four matched pairs harboring somatic mutation in itNRAS itor itPIK3CA italso overexpressed a member of the HER family. For example, matched pair #2 had a mutation in itNRAS itand showed over-expression of HER3, matched pair #7 had a mutation in itNRAS itand showed over-expression of HER1, matched pair #9 had a mutation in itPIK3CA itand amplification of HER2 and matched pair #10 had a mutation in itPIK3CA itand overexpression of HER1 (Table tblr tid="T1"1tblr).p
pAmong the autopsy samples of cases with primary breast cancer, we found mutations in itEGFR itin one liver and one lymph node metastases, and a mutation in itPIK3CA itin all the samples from one case, and in a liver metastasis from another (see Additional file supplr sid="S2"2supplr, Table S2). One itEGFR itand one itPIK3CA itmutation could be verified by sequencing or immunohistochemistry but lack of good quality DNA, and additional mutation-specific antibodies, prohibited validation of the others. All the samples from one case had the same mutation at similar MAPs (itPIK3CA itH1074R in Patient #2).p
pWe identified itHRAS itand itPIK3CA itmutations in the basal breast cancer cell lines SUM 159 and BT20. The mutations with MAPs 25% have been reported before abbrgrpabbr bid="B19"19abbrabbr bid="B20"20abbrabbrgrp: itHRAS itG12 D (MAP 53.2% in SUM159) and itPIK3CA itH1047L (MAP 50.0% in SUM159) and P539R (MAP 43.8% in BT20) but we also identified itHRAS itQ61K at MAP 24.6% in SUM159 and itHRAS itQ61K at MAP 14.1%, and itPIK3CA itH1047R at MAP 44.4% in BT20. In addition, we were also able to show that all of the mutations with MAPs 25% were present in mammospheres derived from these cell lines.p
sec
sec
sec
st
pDiscussionp
st
pWe have collected a unique set of clinical material through collaborations with multiple institutions around the world and involving brain metastases which are rarely excised. The analysis of this resource has led to the development of hypotheses regarding the mechanisms of breast cancer colonization of the brain (Figure figr fid="F4"4figr). The set of tumor samples is enriched for triple negativebasal breast cancers which is consistent with the findings of an increased propensity for basal breast cancers to metastasize to the brain abbrgrpabbr bid="B3"3abbrabbr bid="B9"9abbrabbr bid="B36"36abbrabbrgrp. An association between CD44+CD24- frequency and a basal tumor phenotype has already been reported abbrgrpabbr bid="B37"37abbrabbrgrp and interestingly we observed an increased frequency of CD44+CD24- cells in the brain metastases compared to their matched primaries. CD44+CD24- cells have been reported to have stem cell properties and increased itin vivo ittumorigenicity abbrgrpabbr bid="B38"38abbrabbrgrp and the increased frequency seen in brain metastases may support this. Alternatively, this may reflect selection as a result of a high content of hyaluron, the ligand for CD44, within the brain microenvironment abbrgrpabbr bid="B39"39abbrabbr bid="B40"40abbrabbrgrp. Hence, this could be an important factor in breast cancer colonization of the brain and therefore a potential axis for future therapeutic intervention abbrgrpabbr bid="B41"41abbrabbrgrp.p
fig id="F4"
title
pFigure 4p
title
caption
pHypothetical mechanism of breast cancer cell colonization of the brain parenchymap
caption
text
pbHypothetical mechanism of breast cancer cell colonization of the brain parenchymab. Hypoxic conditions, (HIF1a) can mediate the elease of neuregulin 1 from neuronal cells. Neuregulin 1 is the ligand for HER3 and on binding activates the heterodimerisation of HER3-HER2, HER3-HER4 andor HER3-HER1, leading to downstream activation of the MAPK and AKT pathways. MAPKAKT pathways activation is related to survival, invasion, proliferation and angiogenesis. A second mechanism of colonization may relate to the enriched expression of CD44 breast cancer cells in the brain. The brain microenvironment is rich in hyaluron, the ligand for CD44, and so upon activation a series of responses maybe triggered, including cell motility.p
text
graphic file="bcr2603-4" hint_layout="double"
fig
pIn this study, brain metastases of breast cancer expressed all members of the HER family of tyrosine kinase receptors. HER2 was amplified and overexpressed in 20% of brain metastases, EGFR was overexpressed in 21% of brain metastases, HER3 was overexpressed in 60% of brain metastases and HER4 was overexpressed in 22% of brain metastases and generally mutually exclusive (Table tblr tid="T1"1tblr). Interestingly, HER3 expression was increased in breast cancer cells residing in the brain. Neuregulin 1, the ligand for this receptor, is abundantly expressed in the brain abbrgrpabbr bid="B34"34abbrabbr bid="B35"35abbrabbrgrp and is released by a variety of mechanisms including the presence of hypoxia abbrgrpabbr bid="B42"42abbrabbrgrp. Consistent with this, we observed the increased expression of itHIF-1alfa itin the brain metastases, likely to reflect the local hypoxic environment abbrgrpabbr bid="B43"43abbrabbrgrp. Increased activation of both HER3 and downstream molecules (GRB2, ERK5, ERK12, JNK12, p38) was also observed in the brain metastases. These findings prompted us to hypothesize that neuregulinHER3 activation is an important mechanism for breast cancer cell colonization of the brain (Figure figr fid="F4"4figr). As a further support to this hypothesis, increased HER3 expression has also been reported in brain metastases of lung cancer abbrgrpabbr bid="B44"44abbrabbrgrp.p
pWe investigated whether this association was generic to all brain metastases and found activation of the MAPK pathway in all 11 non-breast metastases to the brain. Whilst HER3 was not activated in these tumors, 911 tumors showed over-expression of EGFR. It has recently been shown, using animal models, that EGFR ligands mediate breast cancer metastasis to the brain and that this was abrogated by the use of EGFR inhibitor cetuximab abbrgrpabbr bid="B14"14abbrabbrgrp. The combination of lapatinib and trastuzumab has been shown to have a synergistic, antiproliferative effect against ErbB2-positive breast cancer cells itin vitro itabbrgrpabbr bid="B45"45abbrabbrgrp. It is possible, therefore, that a combination of anti-HER therapies could be effective in the treatment of both breast and non-breast metastases to the brain.p
pIn order to activate downstream signaling pathways, HER3 requires heterodimerization with other members of the HER family following binding by neuregulin abbrgrpabbr bid="B46"46abbrabbrgrp and even basal levels of the other HER proteins may be sufficient to participate in the activation of these pathways. Hence, combination therapy against the HER family, even in the absence of over-expression or amplification of HER2, may be of clinical benefit for a larger proportion of breast cancer patients such as those with HER2 negative disease. Recently, a study showed benefits for a small group of HER2-negative patients in the phase III National Surgical Adjuvant Breast and Bowel Project (NSABP) B-31 trial that were HER2 negative by FISH and had less than 3+ staining intensity by HercepTestsup® sup(Dako, Carpinteria, CA, USA) abbrgrpabbr bid="B47"47abbrabbrgrp. Furthermore, another study suggested that the spectrum of patients who may benefit from trastuzumab-based therapies could be expanded to include patients with metastatic breast cancer without HER-2 amplification but who express transmembrane neuregulin, the ligand of HER3 abbrgrpabbr bid="B48"48abbrabbrgrp. It has also been reported in non-HER2 over-expressing xenograft models of prostate and breast cancer that pertuzumab, an inhibitor of HER3HER2 heterodimerization, can inhibit tumor growth abbrgrpabbr bid="B49"49abbrabbrgrp.p
pFor the first time, we have identified somatic mutations in genes related to the AKTMAPK signaling pathways, such as itEGFRit, itPIK3CAit, itKRASit, itHRAS itand itNRASit, in brain metastases of breast cancer and other types of cancer. In addition, we have analyzed multiple autopsy samples from six cases that had a primary breast cancer, and found additional itEGFR itand itPIK3CA itmutations in breast cancers that metastasized to various sites including the brain. Thus, simply targeting the HER family of receptors may not be sufficient for complete treatment response. This analysis highlights additional itactionable ittargets abbrgrpabbr bid="B50"50abbrabbrgrp that may prove effective for the treatment of some brain metastasis, such as PI3 kinase inhibitors.p
pTaken together, these findings are striking and show another facet of the cell evolution landscape abbrgrpabbr bid="B51"51abbrabbrgrp, highlighting the possibility of cancer cells resisting targeted treatment to molecules such as HER2 or EGFR by acquiring oncogenic mutations in downstream pathways. This has been shown itin vitro itwith activating PIK3CA mutation abbrgrpabbr bid="B23"23abbrabbrgrp and herein we demonstrate an itin vivo itexample of this possible scenario using human tumors. In another clinical angle, patients currently treated with the anti-EGFR monoclonal antibodies cetuximab and panitumumab can also acquire resistance to this therapy due to downstream mutations in the itras itgene abbrgrpabbr bid="B24"24abbrabbrgrp. Interestingly, animal models have suggested that downstream NF-kappaB inhibitory drugs may play a role in the treatment of patients with defined mutations in itKRAS itabbrgrpabbr bid="B52"52abbrabbrgrp.p
pInterestingly the Mutant Allele Proportion (MAP) was sometimes as low as 10%. Such low proportion mutations, which would often be missed by direct sequencing could reflect the presence of stromal (or brain) contamination in the samples, tumor heterogeneity and amplification or deletion of the mutant or wild type alleles. However, the fact that the same MAP was often observed in both the primary and the brain metastasis, and in the multiple samples from an autopsy case, might suggest that these metastases were not seeded by a single cell but by groups of cells from the primary tumor. This has also been shown by next generation sequencing, whereby the mutant allele frequency for some mutations was similar between a basal-like primary breast cancer and its matched brain metastasis abbrgrpabbr bid="B53"53abbrabbrgrp. However, it is also evident that significant genomic evolution occurs during metastasis, since most mutations identified in this metastasis, and one from a primary lobular breast cancer, were more prevalent in the metastasis than in the respective primary tumours abbrgrpabbr bid="B53"53abbrabbr bid="B54"54abbrabbrgrpp
sec
sec
st
pConclusionsp
st
pIn conclusion, we provide evidence to support a role of HER3 and other HER family receptors in the ability of cancer cells to colonize the brain. The data are intriguing and support the possibility that tumors with low expression of HER2 may respond to trastuzumab, lapitinib or combinations of HER family receptor inhibitors since even basal levels may enhance the signaling through homohetero-dimerization of the other receptors. However, caution should be exercised because of the possible presence of downstream oncogenic mutations that may drive treatment resistance. These therapeutic modalities may therefore add another dimension to the treatment of triple negative and basal-like cancers where currently, no targeted therapy is available.p
sec
sec
st
pAbbreviationsp
st
pCISH: chromogenic itin situ ithybridization; DASL: cDNA-mediated Annealing, Selection, extension, and Ligation; EGFR: epidermal growth factor receptor; ER: estrogen receptor; FFPE: formalin fixed-paraffin embedded; GEO: Gene Expression Omnibus; HER: human epidermal growth factor receptor; HRM: High Resolution Melt; IDC: invasive ductal carcinoma; MAPs: Mutant Allele Proportions; NSABP: National Surgical Adjuvant Breast and Bowel Project; NST: non-specific type; PgR: progesterone receptors.p
sec
sec
st
pCompeting interestsp
st
pLeonard Da Silva and Sunil Lakhani hold an USA registered patent relating to the data in this manuscript. All the other authors declare no conflict of interest.p
sec
sec
st
pAuthors' contributionsp
st
pLDS analysed the immunohistochemical markers, accrued and collated the data, carried out statistical and gene expression analysis and drafted the manuscript. PK and ACV analysed immunohistochemical markers, and accrued and collated the data. NW, CES and PTS supervised gene expression analyses and drafted the manuscript. EP, PF, AS, MF, RB, MB and MC identified patients with brain metastases in their institutions, collected samples and performed initial tumor classification. LR, SP, PK and AL performed immunohistochemistry and participated in the construction of TMAs. KK, NK, BJM and BR participated in the study design. SB, SH and JB performed mutation analyses. HD, AD and SF performed validation of EGFR mutations. GCT and SRL conceived the study, supervised the experiments and drafted the manuscript.p
sec
sec
st
pAcknowledgementsp
st
pLeonard Da Silva and Ana Cristina Vargas are recipients of PhD Fellowships from the Ludwig Institute of Cancer Research. Leonard Da Silva is enrolled with the it"Universidade Federal de São Paulo, Escola Paulista de Medicina, Curso de Pós-Graduação, Doutorado, Departamento de Anatomia Patológica, São Paulo, Brazil"it. Peter Simpson is a recipient of a fellowship from the National Breast Cancer Foundation. Georgia Chenevix-Trench and KumKum Khanna are Senior Principal Research Fellows of the NHMRC. RLB is a Cancer Institute NSW Fellow. We also acknowledge the help of staff within anatomical pathology, RBWH, Brisbane, the animal house facility at UQ AIBN, Brisbane, Casey Wright from the Thoracic Research Laboratory, School of Medicine, at the UQ, and Clay Winterford and his staff from the UQQIMR Histotechnology facility, and Macky Edmundson in the sequencing facility at QIMR. We would like to thank Sequenom Inc. for providing the primer sequences used for HRM, and, in particular, we thank Darryl Irwin for his help.p
sec
bdy
bm
refgrp
bibl id="B1"
title
pCNS metastases in breast cancerp
title
aug
au
snmLinsnm
fnmNUfnm
au
au
snmBellonsnm
fnmJRfnm
au
au
snmWinersnm
fnmEPfnm
au
aug
sourceJ Clin Oncolsource
pubdate2004pubdate
volume22volume
fpage3608fpage
lpage3617lpage
xrefbib
pubidlist
pubid idtype="doi"10.1200JCO.2004.01.175pubid
pubid idtype="pmpid" link="fulltext"15337811pubid
pubidlist
xrefbib
bibl
bibl id="B2"
title
pBreast cancer metastasis to the central nervous systemp
title
aug
au
snmWeilsnm
fnmRJfnm
au
au
snmPalmierisnm
fnmDCfnm
au
au
snmBrondersnm
fnmJLfnm
au
au
snmStarksnm
fnmAMfnm
au
au
snmSteegsnm
fnmPSfnm
au
aug
sourceAm J Patholsource
pubdate2005pubdate
volume167volume
fpage913fpage
lpage920lpage
xrefbib
pubidlist
pubid idtype="pmcid"1603675pubid
pubid idtype="pmpid" link="fulltext"16192626pubid
pubidlist
xrefbib
bibl
bibl id="B3"
title
pBreast cancers with brain metastases are more likely to be estrogen receptor negative, express the basal cytokeratin CK56, and overexpress HER2 or EGFRp
title
aug
au
snmHickssnm
fnmDGfnm
au
au
snmShortsnm
fnmSMfnm
au
au
snmPrescottsnm
fnmNLfnm
au
au
snmTarrsnm
fnmSMfnm
au
au
snmColemansnm
fnmKAfnm
au
au
snmYodersnm
fnmBJfnm
au
au
snmCrowesnm
fnmJPfnm
au
au
snmChoueirisnm
fnmTKfnm
au
au
snmDawsonsnm
fnmAEfnm
au
au
snmBuddsnm
fnmGTfnm
au
au
snmTubbssnm
fnmRRfnm
au
au
snmCaseysnm
fnmGfnm
au
au
snmWeilsnm
fnmRJfnm
au
aug
sourceAm J Surg Patholsource
pubdate2006pubdate
volume30volume
fpage1097fpage
lpage1104lpage
xrefbib
pubid idtype="pmpid" link="fulltext"16931954pubid
xrefbib
bibl
bibl id="B4"
title
pCentral nervous system progression among patients with metastatic breast cancer responding to trastuzumab treatmentp
title
aug
au
snmShmuelisnm
fnmEfnm
au
au
snmWiglersnm
fnmNfnm
au
au
snmInbarsnm
fnmMfnm
au
aug
sourceEur J Cancersource
pubdate2004pubdate
volume40volume
fpage379fpage
lpage382lpage
xrefbib
pubidlist
pubid idtype="doi"10.1016j.ejca.2003.09.018pubid
pubid idtype="pmpid" link="fulltext"14746856pubid
pubidlist
xrefbib
bibl
bibl id="B5"
title
pPrimary breast cancer phenotypes associated with propensity for central nervous system metastasesp
title
aug
au
snmThamsnm
fnmYLfnm
au
au
snmSextonsnm
fnmKfnm
au
au
snmKramersnm
fnmRfnm
au
au
snmHilsenbecksnm
fnmSfnm
au
au
snmElledgesnm
fnmRfnm
au
aug
sourceCancersource
pubdate2006pubdate
volume107volume
fpage696fpage
lpage704lpage
xrefbib
pubidlist
pubid idtype="doi"10.1002cncr.22041pubid
pubid idtype="pmpid" link="fulltext"16826579pubid
pubidlist
xrefbib
bibl
bibl id="B6"
title
pErbB-targeted therapeutic approaches in human cancerp
title
aug
au
snmArteagasnm
fnmCLfnm
au
aug
sourceExp Cell Ressource
pubdate2003pubdate
volume284volume
fpage122fpage
lpage130lpage
xrefbib
pubidlist
pubid idtype="doi"10.1016S0014-4827(02)00104-0pubid
pubid idtype="pmpid" link="fulltext"12648471pubid
pubidlist
xrefbib
bibl
bibl id="B7"
title
pTrastuzumab--mechanism of action and use in clinical practicep
title
aug
au
snmHudissnm
fnmCAfnm
au
aug
sourceN Engl J Medsource
pubdate2007pubdate
volume357volume
fpage39fpage
lpage51lpage
xrefbib
pubidlist
pubid idtype="doi"10.1056NEJMra043186pubid
pubid idtype="pmpid" link="fulltext"17611206pubid
pubidlist
xrefbib
bibl
bibl id="B8"
title
pBasal-like breast cancer: a critical reviewp
title
aug
au
snmRakhasnm
fnmEAfnm
au
au
snmReis-Filhosnm
fnmJSfnm
au
au
snmEllissnm
fnmIOfnm
au
aug
sourceJ Clin Oncolsource
pubdate2008pubdate
volume26volume
fpage2568fpage
lpage2581lpage
xrefbib
pubidlist
pubid idtype="doi"10.1200JCO.2007.13.1748pubid
pubid idtype="pmpid" link="fulltext"18487574pubid
pubidlist
xrefbib
bibl
bibl id="B9"
title
pBasal-like grade III invasive ductal carcinoma of the breast: patterns of metastasis and long-term survivalp
title
aug
au
snmFulfordsnm
fnmLGfnm
au
au
snmReis-Filhosnm
fnmJSfnm
au
au
snmRydersnm
fnmKfnm
au
au
snmJonessnm
fnmCfnm
au
au
snmGillettsnm
fnmCEfnm
au
au
snmHanbysnm
fnmAfnm
au
au
snmEastonsnm
fnmDfnm
au
au
snmLakhanisnm
fnmSRfnm
au
aug
sourceBreast Cancer Ressource
pubdate2007pubdate
volume9volume
fpageR4fpage
xrefbib
pubidlist
pubid idtype="pmcid"1851397pubid
pubid idtype="pmpid" link="fulltext"17217540pubid
pubid idtype="doi"10.1186bcr1636pubid
pubidlist
xrefbib
bibl
bibl id="B10"
title
pThe influence of basal phenotype on the metastatic pattern of breast cancerp
title
aug
au
snmLucksnm
fnmAAfnm
au
au
snmEvanssnm
fnmAJfnm
au
au
snmGreensnm
fnmARfnm
au
au
snmRakhasnm
fnmEAfnm
au
au
snmPaishsnm
fnmCfnm
au
au
snmEllissnm
fnmIOfnm
au
aug
sourceClin Oncol (R Coll Radiol)source
pubdate2008pubdate
volume20volume
fpage40fpage
lpage45lpage
xrefbib
pubid idtype="pmpid" link="fulltext"17981444pubid
xrefbib
bibl
bibl id="B11"
title
pThe distribution of secondary growths in cancer of the breastp
title
aug
au
snmPagetsnm
fnmSfnm
au
aug
sourceCancer Metastasis Revsource
pubdate1989pubdate
volume8volume
fpage98fpage
lpage101lpage
xrefbib
pubid idtype="pmpid"2673568pubid
xrefbib
bibl
bibl id="B12"
title
pGenes that mediate breast cancer metastasis to lungp
title
aug
au
snmMinnsnm
fnmAJfnm
au
au
snmGuptasnm
fnmGPfnm
au
au
snmSiegelsnm
fnmPMfnm
au
au
snmBossnm
fnmPDfnm
au
au
snmShusnm
fnmWfnm
au
au
snmGirisnm
fnmDDfnm
au
au
snmVialesnm
fnmAfnm
au
au
snmOlshensnm
fnmABfnm
au
au
snmGeraldsnm
fnmWLfnm
au
au
snmMassaguesnm
fnmJfnm
au
aug
sourceNaturesource
pubdate2005pubdate
volume436volume
fpage518fpage
lpage524lpage
xrefbib
pubidlist
pubid idtype="pmcid"1283098pubid
pubid idtype="pmpid" link="fulltext"16049480pubid
pubid idtype="doi"10.1038nature03799pubid
pubidlist
xrefbib
bibl
bibl id="B13"
title
pDistinct organ-specific metastatic potential of individual breast cancer cells and primary tumorsp
title
aug
au
snmMinnsnm
fnmAJfnm
au
au
snmKangsnm
fnmYfnm
au
au
snmSerganovasnm
fnmIfnm
au
au
snmGuptasnm
fnmGPfnm
au
au
snmGirisnm
fnmDDfnm
au
au
snmDoubrovinsnm
fnmMfnm
au
au
snmPonomarevsnm
fnmVfnm
au
au
snmGeraldsnm
fnmWLfnm
au
au
snmBlasbergsnm
fnmRfnm
au
au
snmMassaguesnm
fnmJfnm
au
aug
sourceJ Clin Investsource
pubdate2005pubdate
volume115volume
fpage44fpage
lpage55lpage
xrefbib
pubidlist
pubid idtype="pmcid"539194pubid
pubid idtype="pmpid" link="fulltext"15630443pubid
pubidlist
xrefbib
bibl
bibl id="B14"
title
pGenes that mediate breast cancer metastasis to the brainp
title
aug
au
snmBossnm
fnmPDfnm
au
au
snmZhangsnm
fnmXHfnm
au
au
snmNadalsnm
fnmCfnm
au
au
snmShusnm
fnmWfnm
au
au
snmGomissnm
fnmRRfnm
au
au
snmNguyensnm
fnmDXfnm
au
au
snmMinnsnm
fnmAJfnm
au
au
snmvan de Vijversnm
fnmMJfnm
au
au
snmGeraldsnm
fnmWLfnm
au
au
snmFoekenssnm
fnmJAfnm
au
au
snmMassaguésnm
fnmJfnm
au
aug
sourceNaturesource
pubdate2009pubdate
volume459volume
fpage1005fpage
lpage1009lpage
xrefbib
pubidlist
pubid idtype="pmcid"2698953pubid
pubid idtype="pmpid" link="fulltext"19421193pubid
pubid idtype="doi"10.1038nature08021pubid
pubidlist
xrefbib
bibl
bibl id="B15"
title
pHer-2 overexpression increases the metastatic outgrowth of breast cancer cells in the brainp
title
aug
au
snmPalmierisnm
fnmDfnm
au
au
snmBrondersnm
fnmJLfnm
au
au
snmHerringsnm
fnmJMfnm
au
au
snmYonedasnm
fnmTfnm
au
au
snmWeilsnm
fnmRJfnm
au
au
snmStarksnm
fnmAMfnm
au
au
snmKureksnm
fnmRfnm
au
au
snmVega-Vallesnm
fnmEfnm
au
au
snmFeigenbaumsnm
fnmLfnm
au
au
snmHalversonsnm
fnmDfnm
au
au
snmVortmeyersnm
fnmAOfnm
au
au
snmSteinbergsnm
fnmSMfnm
au
au
snmAldapesnm
fnmKfnm
au
au
snmSteegsnm
fnmPSfnm
au
aug
sourceCancer Ressource
pubdate2007pubdate
volume67volume
fpage4190fpage
lpage4198lpage
xrefbib
pubidlist
pubid idtype="doi"10.11580008-5472.CAN-06-3316pubid
pubid idtype="pmpid" link="fulltext"17483330pubid
pubidlist
xrefbib
bibl
bibl id="B16"
title
pThe genomic landscapes of human breast and colorectal cancersp
title
aug
au
snmWoodsnm
fnmLDfnm
au
au
snmParsonssnm
fnmDWfnm
au
au
snmJonessnm
fnmSfnm
au
au
snmLinsnm
fnmJfnm
au
au
snmSjöblomsnm
fnmTfnm
au
au
snmLearysnm
fnmRJfnm
au
au
snmShensnm
fnmDfnm
au
au
snmBocasnm
fnmSMfnm
au
au
snmBarbersnm
fnmTfnm
au
au
snmPtaksnm
fnmJfnm
au
au
snmSillimansnm
fnmNfnm
au
au
snmSzabosnm
fnmSfnm
au
au
snmDezsosnm
fnmZfnm
au
au
snmUstyankskysnm
fnmVfnm
au
au
snmNikolskayasnm
fnmTfnm
au
au
snmNikolskysnm
fnmYfnm
au
au
snmKarchinsnm
fnmRfnm
au
au
snmWilsonsnm
fnmPAfnm
au
au
snmKaminkersnm
fnmJSfnm
au
au
snmZhangsnm
fnmZfnm
au
au
snmCroshawsnm
fnmRfnm
au
au
snmWillissnm
fnmJfnm
au
au
snmDawsonsnm
fnmDfnm
au
au
snmShipitsinsnm
fnmMfnm
au
au
snmWillsonsnm
fnmJKfnm
au
au
snmSukumarsnm
fnmSfnm
au
au
snmPolyaksnm
fnmKfnm
au
au
snmParksnm
fnmBHfnm
au
au
snmPethiyagodasnm
fnmCLfnm
au
au
snmPantsnm
fnmPVfnm
au
etal
aug
sourceSciencesource
pubdate2007pubdate
volume318volume
fpage1108fpage
lpage1113lpage
xrefbib
pubidlist
pubid idtype="doi"10.1126science.1145720pubid
pubid idtype="pmpid" link="fulltext"17932254pubid
pubidlist
xrefbib
bibl
bibl id="B17"
title
pA multidimensional analysis of genes mutated in breast and colorectal cancersp
title
aug
au
snmLinsnm
fnmJfnm
au
au
snmGansnm
fnmCMfnm
au
au
snmZhangsnm
fnmXfnm
au
au
snmJonessnm
fnmSfnm
au
au
snmSjöblomsnm
fnmTfnm
au
au
snmWoodsnm
fnmLDfnm
au
au
snmParsonssnm
fnmDWfnm
au
au
snmPapadopoulossnm
fnmNfnm
au
au
snmKinzlersnm
fnmKWfnm
au
au
snmVogelsteinsnm
fnmBfnm
au
au
snmParmigianisnm
fnmGfnm
au
au
snmVelculescusnm
fnmVEfnm
au
aug
sourceGenome Ressource
pubdate2007pubdate
volume17volume
fpage1304fpage
lpage1318lpage
xrefbib
pubidlist
pubid idtype="pmcid"1950899pubid
pubid idtype="pmpid" link="fulltext"17693572pubid
pubid idtype="doi"10.1101gr.6431107pubid
pubidlist
xrefbib
bibl
bibl id="B18"
title
pComplex landscapes of somatic rearrangement in human breast cancer genomesp
title
aug
au
snmStephenssnm
fnmPJfnm
au
au
snmMcBridesnm
fnmDJfnm
au
au
snmLinsnm
fnmMLfnm
au
au
snmVarelasnm
fnmIfnm
au
au
snmPleasancesnm
fnmEDfnm
au
au
snmSimpsonsnm
fnmJTfnm
au
au
snmStebbingssnm
fnmLAfnm
au
au
snmLeroysnm
fnmCfnm
au
au
snmEdkinssnm
fnmSfnm
au
au
snmMudiesnm
fnmLJfnm
au
au
snmGreenmansnm
fnmCDfnm
au
au
snmJiasnm
fnmMfnm
au
au
snmLatimersnm
fnmCfnm
au
au
snmTeaguesnm
fnmJWfnm
au
au
snmLausnm
fnmKWfnm
au
au
snmBurtonsnm
fnmJfnm
au
au
snmQuailsnm
fnmMAfnm
au
au
snmSwerdlowsnm
fnmHfnm
au
au
snmChurchersnm
fnmCfnm
au
au
snmNatrajansnm
fnmRfnm
au
au
snmSieuwertssnm
fnmAMfnm
au
au
snmMartenssnm
fnmJWfnm
au
au
snmSilversnm
fnmDPfnm
au
au
snmLangerødsnm
fnmAfnm
au
au
snmRussnessnm
fnmHEfnm
au
au
snmFoekenssnm
fnmJAfnm
au
au
snmReis-Filhosnm
fnmJSfnm
au
au
snmvan't Veersnm
fnmLfnm
au
au
snmRichardsonsnm
fnmALfnm
au
au
snmBørresen-Dalesnm
fnmALfnm
au
etal
aug
sourceNaturesource
pubdate2009pubdate
volume462volume
fpage1005fpage
lpage1010lpage
xrefbib
pubidlist
pubid idtype="doi"10.1038nature08645pubid
pubid idtype="pmpid" link="fulltext"20033038pubid
pubidlist
xrefbib
bibl
bibl id="B19"
title
pDistinct gene mutation profiles among luminal-type and basal-type breast cancer cell linesp
title
aug
au
snmHollestellesnm
fnmAfnm
au
au
snmNagelsnm
fnmJHfnm
au
au
snmSmidsnm
fnmMfnm
au
au
snmLamsnm
fnmSfnm
au
au
snmElstrodtsnm
fnmFfnm
au
au
snmWasielewskisnm
fnmMfnm
au
au
snmNgsnm
fnmSSfnm
au
au
snmFrenchsnm
fnmPJfnm
au
au
snmPeeterssnm
fnmJKfnm
au
au
snmRozendaalsnm
fnmMJfnm
au
au
snmRiazsnm
fnmMfnm
au
au
snmKoopmansnm
fnmDGfnm
au
au
snmTen Hagensnm
fnmTLfnm
au
au
snmde Leeuwsnm
fnmBHfnm
au
au
snmZwarthoffsnm
fnmECfnm
au
au
snmTeunissesnm
fnmAfnm
au
au
snmvan der Speksnm
fnmPJfnm
au
au
snmKlijnsnm
fnmJGfnm
au
au
snmDinjenssnm
fnmWNfnm
au
au
snmEthiersnm
fnmSPfnm
au
au
snmCleverssnm
fnmHfnm
au
au
snmJochemsensnm
fnmAGfnm
au
au
snmden Bakkersnm
fnmMAfnm
au
au
snmFoekenssnm
fnmJAfnm
au
au
snmMartenssnm
fnmJWfnm
au
au
snmSchuttesnm
fnmMfnm
au
aug
sourceBreast Cancer Res Treatsource
pubdate2010pubdate
volume121volume
fpage53fpage
lpage64lpage
xrefbib
pubidlist
pubid idtype="doi"10.1007s10549-009-0460-8pubid
pubid idtype="pmpid" link="fulltext"19593635pubid
pubidlist
xrefbib
bibl
bibl id="B20"
title
pCOSMIC Catalogue of Somatic Mutations in Cancerp
title
urlhttp:www.sanger.ac.ukgeneticsCGPcosmicurl
bibl
bibl id="B21"
title
pGenetic alterations and oncogenic pathways associated with breast cancer subtypesp
title
aug
au
snmHusnm
fnmXfnm
au
au
snmSternsnm
fnmHMfnm
au
au
snmGesnm
fnmLfnm
au
au
snmO'Briensnm
fnmCfnm
au
au
snmHaydusnm
fnmLfnm
au
au
snmHonchellsnm
fnmCDfnm
au
au
snmHavertysnm
fnmPMfnm
au
au
snmPeterssnm
fnmBAfnm
au
au
snmWusnm
fnmTDfnm
au
au
snmAmlersnm
fnmLCfnm
au
au
snmChantsnm
fnmJfnm
au
au
snmStokoesnm
fnmDfnm
au
au
snmLacknersnm
fnmMRfnm
au
au
snmCavetsnm
fnmGfnm
au
aug
sourceMol Cancer Ressource
pubdate2009pubdate
volume7volume
fpage511fpage
lpage522lpage
xrefbib
pubidlist
pubid idtype="doi"10.11581541-7786.MCR-08-0107pubid
pubid idtype="pmpid" link="fulltext"19372580pubid
pubidlist
xrefbib
bibl
bibl id="B22"
title
pPI3K inhibition overcomes trastuzumab resistance: blockade of ErbB2ErbB3 is not always enoughp
title
aug
au
snmHynessnm
fnmNEfnm
au
au
snmDeysnm
fnmJHfnm
au
aug
sourceCancer Cellsource
pubdate2009pubdate
volume15volume
fpage353fpage
lpage355lpage
xrefbib
pubidlist
pubid idtype="doi"10.1016j.ccr.2009.04.004pubid
pubid idtype="pmpid" link="fulltext"19411062pubid
pubidlist
xrefbib
bibl
bibl id="B23"
title
pLigand-independent HER2HER3PI3K complex is disrupted by trastuzumab and is effectively inhibited by the PI3K inhibitor GDC-0941p
title
aug
au
snmJunttilasnm
fnmTTfnm
au
au
snmAkitasnm
fnmRWfnm
au
au
snmParsonssnm
fnmKfnm
au
au
snmFieldssnm
fnmCfnm
au
au
snmLewis Phillipssnm
fnmGDfnm
au
au
snmFriedmansnm
fnmLSfnm
au
au
snmSampathsnm
fnmDfnm
au
au
snmSliwkowskisnm
fnmMXfnm
au
aug
sourceCancer Cellsource
pubdate2009pubdate
volume15volume
fpage429fpage
lpage440lpage
xrefbib
pubidlist
pubid idtype="doi"10.1016j.ccr.2009.03.020pubid
pubid idtype="pmpid" link="fulltext"19411071pubid
pubidlist
xrefbib
bibl
bibl id="B24"
title
pImplications for KRAS status and EGFR-targeted therapies in metastatic CRCp
title
aug
au
snmNormannosnm
fnmNfnm
au
au
snmTejparsnm
fnmSfnm
au
au
snmMorgillosnm
fnmFfnm
au
au
snmDe Lucasnm
fnmAfnm
au
au
snmVan Cutsemsnm
fnmEfnm
au
au
snmCiardiellosnm
fnmFfnm
au
aug
sourceNat Rev Clin Oncolsource
pubdate2009pubdate
volume6volume
fpage519fpage
lpage527lpage
xrefbib
pubidlist
pubid idtype="doi"10.1038nrclinonc.2009.111pubid
pubid idtype="pmpid"19636327pubid
pubidlist
xrefbib
bibl
bibl id="B25"
title
pA versatile assay for high-throughput gene expression profiling on universal array matricesp
title
aug
au
snmFansnm
fnmJBfnm
au
au
snmYeakleysnm
fnmJMfnm
au
au
snmBibikovasnm
fnmMfnm
au
au
snmChudinsnm
fnmEfnm
au
au
snmWickhamsnm
fnmEfnm
au
au
snmChensnm
fnmJfnm
au
au
snmDoucetsnm
fnmDfnm
au
au
snmRigaultsnm
fnmPfnm
au
au
snmZhangsnm
fnmBfnm
au
au
snmShensnm
fnmRfnm
au
au
snmMcBridesnm
fnmCfnm
au
au
snmLisnm
fnmHRfnm
au
au
snmFusnm
fnmXDfnm
au
au
snmOliphantsnm
fnmAfnm
au
au
snmBarkersnm
fnmDLfnm
au
au
snmCheesnm
fnmMSfnm
au
aug
sourceGenome Ressource
pubdate2004pubdate
volume14volume
fpage878fpage
lpage885lpage
xrefbib
pubidlist
pubid idtype="pmcid"479115pubid
pubid idtype="pmpid" link="fulltext"15123585pubid
pubid idtype="doi"10.1101gr.2167504pubid
pubidlist
xrefbib
bibl
bibl id="B26"
title
pHigh-throughput oncogene mutation profiling in human cancerp
title
aug
au
snmThomassnm
fnmRKfnm
au
au
snmBakersnm
fnmACfnm
au
au
snmDebiasisnm
fnmRMfnm
au
au
snmWincklersnm
fnmWfnm
au
au
snmLaframboisesnm
fnmTfnm
au
au
snmLinsnm
fnmWMfnm
au
au
snmWangsnm
fnmMfnm
au
au
snmFengsnm
fnmWfnm
au
au
snmZandersnm
fnmTfnm
au
au
snmMacConaillsnm
fnmLfnm
au
au
snmLeesnm
fnmJCfnm
au
au
snmNicolettisnm
fnmRfnm
au
au
snmHattonsnm
fnmCfnm
au
au
snmGoyettesnm
fnmMfnm
au
au
snmGirardsnm
fnmLfnm
au
au
snmMajmudarsnm
fnmKfnm
au
au
snmZiaugrasnm
fnmLfnm
au
au
snmWongsnm
fnmKKfnm
au
au
snmGabrielsnm
fnmSfnm
au
au
snmBeroukhimsnm
fnmRfnm
au
au
snmPeytonsnm
fnmMfnm
au
au
snmBarretinasnm
fnmJfnm
au
au
snmDuttsnm
fnmAfnm
au
au
snmEmerysnm
fnmCfnm
au
au
snmGreulichsnm
fnmHfnm
au
au
snmShahsnm
fnmKfnm
au
au
snmSasakisnm
fnmHfnm
au
au
snmGazdarsnm
fnmAfnm
au
au
snmMinnasnm
fnmJfnm
au
au
snmArmstrongsnm
fnmSAfnm
au
etal
aug
sourceNat Genetsource
pubdate2007pubdate
volume39volume
fpage347fpage
lpage351lpage
xrefbib
pubidlist
pubid idtype="doi"10.1038ng1975pubid
pubid idtype="pmpid" link="fulltext"17293865pubid
pubidlist
xrefbib
bibl
bibl id="B27"
title
pHigh resolution melting analysis for the rapid and sensitive detection of mutations in clinical samples: KRAS codon 12 and 13 mutations in non-small cell lung cancerp
title
aug
au
snmKrypuysnm
fnmMfnm
au
au
snmNewnhamsnm
fnmGMfnm
au
au
snmThomassnm
fnmDMfnm
au
au
snmConronsnm
fnmMfnm
au
au
snmDobrovicsnm
fnmAfnm
au
aug
sourceBMC Cancersource
pubdate2006pubdate
volume6volume
fpage295fpage
xrefbib
pubidlist
pubid idtype="pmcid"1769510pubid
pubid idtype="pmpid" link="fulltext"17184525pubid
pubid idtype="doi"10.11861471-2407-6-295pubid
pubidlist
xrefbib
bibl
bibl id="B28"
title
pMutation-specific antibodies for the detection of EGFR mutations in non-small-cell lung cancerp
title
aug
au
snmYusnm
fnmJfnm
au
au
snmKanesnm
fnmSfnm
au
au
snmWusnm
fnmJfnm
au
au
snmBenedettinisnm
fnmEfnm
au
au
snmLisnm
fnmDfnm
au
au
snmReevessnm
fnmCfnm
au
au
snmInnocentisnm
fnmGfnm
au
au
snmWetzelsnm
fnmRfnm
au
au
snmCrosbysnm
fnmKfnm
au
au
snmBeckersnm
fnmAfnm
au
au
snmFerrantesnm
fnmMfnm
au
au
snmCheungsnm
fnmWCfnm
au
au
snmHongsnm
fnmXfnm
au
au
snmChirieacsnm
fnmLRfnm
au
au
snmShollsnm
fnmLMfnm
au
au
snmHaacksnm
fnmHfnm
au
au
snmSmithsnm
fnmBLfnm
au
au
snmPolakiewiczsnm
fnmRDfnm
au
au
snmTansnm
fnmYfnm
au
au
snmGusnm
fnmTLfnm
au
au
snmLodasnm
fnmMfnm
au
au
snmZhousnm
fnmXfnm
au
au
snmCombsnm
fnmMJfnm
au
aug
sourceClin Cancer Ressource
pubdate2009pubdate
volume15volume
fpage3023fpage
lpage3028lpage
xrefbib
pubidlist
pubid idtype="doi"10.11581078-0432.CCR-08-2739pubid
pubid idtype="pmpid" link="fulltext"19366827pubid
pubidlist
xrefbib
bibl
bibl id="B29"
title
pInvasive breast carcinomasp
title
aug
au
snmEllissnm
fnmIOfnm
au
au
snmSchnittsnm
fnmSJfnm
au
au
snmSastre-Garausnm
fnmXfnm
au
au
snmBussolatisnm
fnmGfnm
au
au
snmTavassolisnm
fnmFAfnm
au
au
snmEusebisnm
fnmVfnm
au
au
snmPetersesnm
fnmJLfnm
au
au
snmMukaisnm
fnmKfnm
au
au
snmTabarsnm
fnmLfnm
au
au
snmJacquemiersnm
fnmJfnm
au
etal
aug
sourcePathology and Genetics of Tumours of the Breast and Female Genital Organssource
publisherLyon: IARC Presspublisher
editorTavassoli FA, Devilee Peditor
pubdate2003pubdate
fpage13fpage
lpage59lpage
bibl
bibl id="B30"
title
pActive signaling by Neu in transgenic micep
title
aug
au
snmDiGiovannasnm
fnmMPfnm
au
au
snmLermansnm
fnmMAfnm
au
au
snmCoffeysnm
fnmRJfnm
au
au
snmMullersnm
fnmWJfnm
au
au
snmCardiffsnm
fnmRDfnm
au
au
snmSternsnm
fnmDFfnm
au
aug
sourceOncogenesource
pubdate1998pubdate
volume17volume
fpage1877fpage
lpage1884lpage
xrefbib
pubidlist
pubid idtype="doi"10.1038sj.onc.1202091pubid
pubid idtype="pmpid" link="fulltext"9778054pubid
pubidlist
xrefbib
bibl
bibl id="B31"
title
pMolecular portraits and 70-gene prognosis signature are preserved throughout the metastatic process of breast cancerp
title
aug
au
snmWeigeltsnm
fnmBfnm
au
au
snmHusnm
fnmZfnm
au
au
snmHesnm
fnmXfnm
au
au
snmLivasysnm
fnmCfnm
au
au
snmCareysnm
fnmLAfnm
au
au
snmEwendsnm
fnmMGfnm
au
au
snmGlassnm
fnmAMfnm
au
au
snmPerousnm
fnmCMfnm
au
au
snmVan't Veersnm
fnmLJfnm
au
aug
sourceCancer Ressource
pubdate2005pubdate
volume65volume
fpage9155fpage
lpage9158lpage
xrefbib
pubidlist
pubid idtype="doi"10.11580008-5472.CAN-05-2553pubid
pubid idtype="pmpid" link="fulltext"16230372pubid
pubidlist
xrefbib
bibl
bibl id="B32"
title
pAnalysis of variance: is there a difference in means and what does it meanp
title
aug
au
snmKaosnm
fnmLSfnm
au
au
snmGreensnm
fnmCEfnm
au
aug
sourceJ Surg Ressource
pubdate2008pubdate
volume144volume
fpage158fpage
lpage170lpage
xrefbib
pubidlist
pubid idtype="pmcid"2405942pubid
pubid idtype="pmpid" link="fulltext"17936790pubid
pubid idtype="doi"10.1016j.jss.2007.12.503pubid
pubidlist
xrefbib
bibl
bibl id="B33"
title
pPhosphotyrosine interactome of the ErbB-receptor kinase familyp
title
aug
au
snmSchulzesnm
fnmWXfnm
au
au
snmDengsnm
fnmLfnm
au
au
snmMannsnm
fnmMfnm
au
aug
sourceMol Syst Biolsource
pubdate2005pubdate
volume1volume
fpage2005fpage
xrefbib
pubidlist
pubid idtype="pmcid"1681463pubid
pubid idtype="pmpid" link="fulltext"16729043pubid
pubid idtype="doi"10.1038msb4100012pubid
pubidlist
xrefbib
bibl
bibl id="B34"
title
pNeuregulin-1 (NRG-1) mRNA and protein in the adult human brainp
title
aug
au
snmLawsnm
fnmAJfnm
au
au
snmShannon Weickertsnm
fnmCfnm
au
au
snmHydesnm
fnmTMfnm
au
au
snmKleinmansnm
fnmJEfnm
au
au
snmHarrisonsnm
fnmPJfnm
au
aug
sourceNeurosciencesource
pubdate2004pubdate
volume127volume
fpage125fpage
lpage136lpage
xrefbib
pubidlist
pubid idtype="doi"10.1016j.neuroscience.2004.04.026pubid
pubid idtype="pmpid" link="fulltext"15219675pubid
pubidlist
xrefbib
bibl
bibl id="B35"
title
pBrain neurons and glial cells express Neu differentiation factorheregulin: a survival factor for astrocytesp
title
aug
au
snmPinkas-Kramarskisnm
fnmRfnm
au
au
snmEilamsnm
fnmRfnm
au
au
snmSpieglersnm
fnmOfnm
au
au
snmLavisnm
fnmSfnm
au
au
snmLiusnm
fnmNfnm
au
au
snmChangsnm
fnmDfnm
au
au
snmWensnm
fnmDfnm
au
au
snmSchwartzsnm
fnmMfnm
au
au
snmYardensnm
fnmYfnm
au
aug
sourceProc Natl Acad Sci USAsource
pubdate1994pubdate
volume91volume
fpage9387fpage
lpage9391lpage
xrefbib
pubidlist
pubid idtype="pmcid"44817pubid
pubid idtype="pmpid" link="fulltext"7937775pubid
pubid idtype="doi"10.1073pnas.91.20.9387pubid
pubidlist
xrefbib
bibl
bibl id="B36"
title
pPredominance of the basal type and HER-2neu type in brain metastasis from breast cancerp
title
aug
au
snmGaedckesnm
fnmJfnm
au
au
snmTraubsnm
fnmFfnm
au
au
snmMildesnm
fnmSfnm
au
au
snmWilkenssnm
fnmLfnm
au
au
snmStansnm
fnmAfnm
au
au
snmOstertagsnm
fnmHfnm
au
au
snmChristgensnm
fnmMfnm
au
au
snmvon Wasielewskisnm
fnmRfnm
au
au
snmKreipesnm
fnmHHfnm
au
aug
sourceMod Patholsource
pubdate2007pubdate
volume20volume
fpage864fpage
lpage870lpage
xrefbib
pubidlist
pubid idtype="doi"10.1038modpathol.3800830pubid
pubid idtype="pmpid" link="fulltext"17541441pubid
pubidlist
xrefbib
bibl
bibl id="B37"
title
pThe CD44+CD24- phenotype is enriched in basal-like breast tumorsp
title
aug
au
snmHonethsnm
fnmGfnm
au
au
snmBendahlsnm
fnmPOfnm
au
au
snmRingnersnm
fnmMfnm
au
au
snmSaalsnm
fnmLHfnm
au
au
snmGruvberger-Saalsnm
fnmSKfnm
au
au
snmLovgrensnm
fnmKfnm
au
au
snmGrabausnm
fnmDfnm
au
au
snmFernosnm
fnmMfnm
au
au
snmBorgsnm
fnmAfnm
au
au
snmHegardtsnm
fnmCfnm
au
aug
sourceBreast Cancer Ressource
pubdate2008pubdate
volume10volume
fpageR53fpage
xrefbib
pubidlist
pubid idtype="pmcid"2481503pubid
pubid idtype="pmpid" link="fulltext"18559090pubid
pubid idtype="doi"10.1186bcr2108pubid
pubidlist
xrefbib
bibl
bibl id="B38"
title
pProspective identification of tumorigenic breast cancer cellsp
title
aug
au
snmAl-Hajjsnm
fnmMfnm
au
au
snmWichasnm
fnmMSfnm
au
au
snmBenito-Hernandezsnm
fnmAfnm
au
au
snmMorrisonsnm
fnmSJfnm
au
au
snmClarkesnm
fnmMFfnm
au
aug
sourceProc Natl Acad Sci USAsource
pubdate2003pubdate
volume100volume
fpage3983fpage
lpage3988lpage
xrefbib
pubidlist
pubid idtype="pmcid"153034pubid
pubid idtype="pmpid" link="fulltext"12629218pubid
pubid idtype="doi"10.1073pnas.0530291100pubid
pubidlist
xrefbib
bibl
bibl id="B39"
title
pHyaluronan anchoring and regulation on the surface of vascular endothelial cells is mediated through the functionally active form of CD44p
title
aug
au
snmNandisnm
fnmAfnm
au
au
snmEstesssnm
fnmPfnm
au
au
snmSiegelmansnm
fnmMHfnm
au
aug
sourceJ Biol Chemsource
pubdate2000pubdate
volume275volume
fpage14939fpage
lpage14948lpage
xrefbib
pubidlist
pubid idtype="doi"10.1074jbc.275.20.14939pubid
pubid idtype="pmpid" link="fulltext"10809739pubid
pubidlist
xrefbib
bibl
bibl id="B40"
title
pHyaluronan expression following middle cerebral artery occlusion in the ratp
title
aug
au
snmAl Qteishatsnm
fnmAfnm
au
au
snmGaffneysnm
fnmJJfnm
au
au
snmKrupinskisnm
fnmJfnm
au
au
snmSlevinsnm
fnmMfnm
au
aug
sourceNeuroreportsource
pubdate2006pubdate
volume17volume
fpage1111fpage
lpage1114lpage
xrefbib
pubidlist
pubid idtype="doi"10.109701.wnr.0000227986.69680.20pubid
pubid idtype="pmpid" link="fulltext"16837837pubid
pubidlist
xrefbib
bibl
bibl id="B41"
title
pCD44 targeting reduces tumour growth and prevents post-chemotherapy relapse of human breast cancers xenograftsp
title
aug
au
snmMarangonisnm
fnmEfnm
au
au
snmLecomtesnm
fnmNfnm
au
au
snmDurandsnm
fnmLfnm
au
au
snmde Pinieuxsnm
fnmGfnm
au
au
snmDecaudinsnm
fnmDfnm
au
au
snmChomiennesnm
fnmCfnm
au
au
snmSmadja-Joffesnm
fnmFfnm
au
au
snmPouponsnm
fnmMFfnm
au
aug
sourceBr J Cancersource
pubdate2009pubdate
volume100volume
fpage918fpage
lpage922lpage
xrefbib
pubidlist
pubid idtype="pmcid"2661796pubid
pubid idtype="pmpid" link="fulltext"19240712pubid
pubid idtype="doi"10.1038sj.bjc.6604953pubid
pubidlist
xrefbib
bibl
bibl id="B42"
title
pNeuregulin expression after focal stroke in the ratp
title
aug
au
snmParkersnm
fnmMWfnm
au
au
snmChensnm
fnmYfnm
au
au
snmHallenbecksnm
fnmJMfnm
au
au
snmFordsnm
fnmBDfnm
au
aug
sourceNeurosci Lettsource
pubdate2002pubdate
volume334volume
fpage169fpage
lpage172lpage
xrefbib
pubidlist
pubid idtype="doi"10.1016S0304-3940(02)01126-6pubid
pubid idtype="pmpid" link="fulltext"12453622pubid
pubidlist
xrefbib
bibl
bibl id="B43"
title
pCharacterization of hypoxia-inducible factor 1 and regulation of DNA binding activity by hypoxiap
title
aug
au
snmWangsnm
fnmGLfnm
au
au
snmSemenzasnm
fnmGLfnm
au
aug
sourceJ Biol Chemsource
pubdate1993pubdate
volume268volume
fpage21513fpage
lpage21518lpage
xrefbib
pubid idtype="pmpid" link="fulltext"8408001pubid
xrefbib
bibl
bibl id="B44"
title
pHER family receptor abnormalities in lung cancer brain metastases and corresponding primary tumorsp
title
aug
au
snmSunsnm
fnmMfnm
au
au
snmBehrenssnm
fnmCfnm
au
au
snmFengsnm
fnmLfnm
au
au
snmOzburnsnm
fnmNfnm
au
au
snmTangsnm
fnmXfnm
au
au
snmYinsnm
fnmGfnm
au
au
snmKomakisnm
fnmRfnm
au
au
snmVarella-Garciasnm
fnmMfnm
au
au
snmHongsnm
fnmWKfnm
au
au
snmAldapesnm
fnmKDfnm
au
au
snmWistubasnm
fnmIIfnm
au
aug
sourceClin Cancer Ressource
pubdate2009pubdate
volume15volume
fpage4829fpage
lpage4837lpage
xrefbib
pubidlist
pubid idtype="doi"10.11581078-0432.CCR-08-2921pubid
pubid idtype="pmpid" link="fulltext"19622585pubid
pubidlist
xrefbib
bibl
bibl id="B45"
title
pActivity of the dual kinase inhibitor lapatinib (GW572016) against HER-2-overexpressing and trastuzumab-treated breast cancer cellsp
title
aug
au
snmKonecnysnm
fnmGEfnm
au
au
snmPegramsnm
fnmMDfnm
au
au
snmVenkatesansnm
fnmNfnm
au
au
snmFinnsnm
fnmRfnm
au
au
snmYangsnm
fnmGfnm
au
au
snmRahmehsnm
fnmMfnm
au
au
snmUntchsnm
fnmMfnm
au
au
snmRusnaksnm
fnmDWfnm
au
au
snmSpeharsnm
fnmGfnm
au
au
snmMullinsnm
fnmRJfnm
au
au
snmKeithsnm
fnmBRfnm
au
au
snmGilmersnm
fnmTMfnm
au
au
snmBergersnm
fnmMfnm
au
au
snmPodratzsnm
fnmKCfnm
au
au
snmSlamonsnm
fnmDJfnm
au
aug
sourceCancer Ressource
pubdate2006pubdate
volume66volume
fpage1630fpage
lpage1639lpage
xrefbib
pubidlist
pubid idtype="doi"10.11580008-5472.CAN-05-1182pubid
pubid idtype="pmpid" link="fulltext"16452222pubid
pubidlist
xrefbib
bibl
bibl id="B46"
title
pErbB3HER3 does not homodimerize upon neuregulin binding at the cell surfacep
title
aug
au
snmBergersnm
fnmMBfnm
au
au
snmMendrolasnm
fnmJMfnm
au
au
snmLemmonsnm
fnmMAfnm
au
aug
sourceFEBS Lettsource
pubdate2004pubdate
volume569volume
fpage332fpage
lpage336lpage
xrefbib
pubidlist
pubid idtype="doi"10.1016j.febslet.2004.06.014pubid
pubid idtype="pmpid" link="fulltext"15225657pubid
pubidlist
xrefbib
bibl
bibl id="B47"
title
pBenefit from adjuvant trastuzumab may not be confined to patients with IHC 3+ andor FISH-positive tumors: Central testing results from NSABP B-31p
title
aug
au
snmS Paiksnm
fnmCKfnm
au
au
snmJeongsnm
fnmJfnm
au
au
snmGeyersnm
fnmCEfnm
au
au
snmRomondsnm
fnmEHfnm
au
au
snmMejia-Mejiasnm
fnmOfnm
au
au
snmMamounassnm
fnmEPfnm
au
aug
sourceASCO Annual Meeting Proceedings (Post-Meeting Edition), Journal of Clinical Oncologysource
pubdate2007pubdate
volume25volume
issue18Sissue
fpage511fpage
bibl
bibl id="B48"
title
pNeuregulin expression modulates clinical response to trastuzumab in patients with metastatic breast cancerp
title
aug
au
snmde Alavasnm
fnmEfnm
au
au
snmOcanasnm
fnmAfnm
au
au
snmAbadsnm
fnmMfnm
au
au
snmMonterosnm
fnmJCfnm
au
au
snmEsparis-Ogandosnm
fnmAfnm
au
au
snmRodriguezsnm
fnmCAfnm
au
au
snmOterosnm
fnmAPfnm
au
au
snmHernandezsnm
fnmTfnm
au
au
snmCruzsnm
fnmJJfnm
au
au
snmPandiellasnm
fnmAfnm
au
aug
sourceJ Clin Oncolsource
pubdate2007pubdate
volume25volume
fpage2656fpage
lpage2663lpage
xrefbib
pubidlist
pubid idtype="doi"10.1200JCO.2006.08.6850pubid
pubid idtype="pmpid" link="fulltext"17602072pubid
pubidlist
xrefbib
bibl
bibl id="B49"
title
pTargeting ligand-activated ErbB2 signaling inhibits breast and prostate tumor growthp
title
aug
au
snmAgussnm
fnmDBfnm
au
au
snmAkitasnm
fnmRWfnm
au
au
snmFoxsnm
fnmWDfnm
au
au
snmLewissnm
fnmGDfnm
au
au
snmHigginssnm
fnmBfnm
au
au
snmPisacanesnm
fnmPIfnm
au
au
snmLofgrensnm
fnmJAfnm
au
au
snmTindellsnm
fnmCfnm
au
au
snmEvanssnm
fnmDPfnm
au
au
snmMaiesesnm
fnmKfnm
au
au
snmSchersnm
fnmHIfnm
au
au
snmSliwkowskisnm
fnmMXfnm
au
aug
sourceCancer Cellsource
pubdate2002pubdate
volume2volume
fpage127fpage
lpage137lpage
xrefbib
pubidlist
pubid idtype="doi"10.1016S1535-6108(02)00097-1pubid
pubid idtype="pmpid" link="fulltext"12204533pubid
pubidlist
xrefbib
bibl
bibl id="B50"
title
pProfiling critical cancer gene mutations in clinical tumor samplesp
title
aug
au
snmMacConaillsnm
fnmLEfnm
au
au
snmCampbellsnm
fnmCDfnm
au
au
snmKehoesnm
fnmSMfnm
au
au
snmBasssnm
fnmAJfnm
au
au
snmHattonsnm
fnmCfnm
au
au
snmNiusnm
fnmLfnm
au
au
snmDavissnm
fnmMfnm
au
au
snmYaosnm
fnmKfnm
au
au
snmHannasnm
fnmMfnm
au
au
snmMondalsnm
fnmCfnm
au
au
snmLuongosnm
fnmLfnm
au
au
snmEmerysnm
fnmCMfnm
au
au
snmBakersnm
fnmACfnm
au
au
snmPhilipssnm
fnmJfnm
au
au
snmGoffsnm
fnmDJfnm
au
au
snmFiorentinosnm
fnmMfnm
au
au
snmRubinsnm
fnmMAfnm
au
au
snmPolyaksnm
fnmKfnm
au
au
snmChansnm
fnmJfnm
au
au
snmWangsnm
fnmYfnm
au
au
snmFletchersnm
fnmJAfnm
au
au
snmSantagatasnm
fnmSfnm
au
au
snmCorsosnm
fnmGfnm
au
au
snmRoviellosnm
fnmFfnm
au
au
snmShivdasanisnm
fnmRfnm
au
au
snmKieransnm
fnmMWfnm
au
au
snmLigonsnm
fnmKLfnm
au
au
snmStilessnm
fnmCDfnm
au
au
snmHahnsnm
fnmWCfnm
au
au
snmMeyersonsnm
fnmMLfnm
au
etal
aug
sourcePLoS Onesource
pubdate2009pubdate
volume4volume
fpagee7887fpage
xrefbib
pubidlist
pubid idtype="pmcid"2774511pubid
pubid idtype="pmpid" link="fulltext"19924296pubid
pubid idtype="doi"10.1371journal.pone.0007887pubid
pubidlist
xrefbib
bibl
bibl id="B51"
title
pExploring protein fitness landscapes by directed evolutionp
title
aug
au
snmRomerosnm
fnmPAfnm
au
au
snmArnoldsnm
fnmFHfnm
au
aug
sourceNat Rev Mol Cell Biolsource
pubdate2009pubdate
volume10volume
fpage866fpage
lpage876lpage
xrefbib
pubidlist
pubid idtype="doi"10.1038nrm2805pubid
pubid idtype="pmpid" link="fulltext"19935669pubid
pubidlist
xrefbib
bibl
bibl id="B52"
title
pRequirement for NF-kappaB signalling in a mouse model of lung adenocarcinomap
title
aug
au
snmMeylansnm
fnmEfnm
au
au
snmDooleysnm
fnmALfnm
au
au
snmFeldsersnm
fnmDMfnm
au
au
snmShensnm
fnmLfnm
au
au
snmTurksnm
fnmEfnm
au
au
snmOuyangsnm
fnmCfnm
au
au
snmJackssnm
fnmTfnm
au
aug
sourceNaturesource
pubdate2009pubdate
volume462volume
fpage104fpage
lpage107lpage
xrefbib
pubidlist
pubid idtype="pmcid"2780341pubid
pubid idtype="pmpid" link="fulltext"19847165pubid
pubid idtype="doi"10.1038nature08462pubid
pubidlist
xrefbib
bibl
bibl id="B53"
title
pGenome remodelling in a basal-like breast cancer metastasis and xenograftp
title
aug
au
snmDingsnm
fnmLfnm
au
au
snmEllissnm
fnmMJfnm
au
au
snmLisnm
fnmSfnm
au
au
snmLarsonsnm
fnmDEfnm
au
au
snmChensnm
fnmKfnm
au
au
snmWallissnm
fnmJWfnm
au
au
snmHarrissnm
fnmCCfnm
au
au
snmMcLellansnm
fnmMDfnm
au
au
snmFultonsnm
fnmRSfnm
au
au
snmFultonsnm
fnmLLfnm
au
au
snmAbbottsnm
fnmRMfnm
au
au
snmHoogsnm
fnmJfnm
au
au
snmDoolingsnm
fnmDJfnm
au
au
snmKoboldtsnm
fnmDCfnm
au
au
snmSchmidtsnm
fnmHfnm
au
au
snmKalickisnm
fnmJfnm
au
au
snmZhangsnm
fnmQfnm
au
au
snmChensnm
fnmLfnm
au
au
snmLinsnm
fnmLfnm
au
au
snmWendlsnm
fnmMCfnm
au
au
snmMcMichaelsnm
fnmJFfnm
au
au
snmMagrinisnm
fnmVJfnm
au
au
snmCooksnm
fnmLfnm
au
au
snmMcGrathsnm
fnmSDfnm
au
au
snmVickerysnm
fnmTLfnm
au
au
snmAppelbaumsnm
fnmEfnm
au
au
snmDeschryversnm
fnmKfnm
au
au
snmDaviessnm
fnmSfnm
au
au
snmGuintolisnm
fnmTfnm
au
au
snmLinsnm
fnmLfnm
au
etal
aug
sourceNaturesource
pubdate2010pubdate
volume464volume
fpage999fpage
lpage1005lpage
xrefbib
pubidlist
pubid idtype="doi"10.1038nature08989pubid
pubid idtype="pmpid" link="fulltext"20393555pubid
pubidlist
xrefbib
bibl
bibl id="B54"
title
pMutational evolution in a lobular breast tumour profiled at single nucleotide resolutionp
title
aug
au
snmShahsnm
fnmSPfnm
au
au
snmMorinsnm
fnmRDfnm
au
au
snmKhattrasnm
fnmJfnm
au
au
snmPrenticesnm
fnmLfnm
au
au
snmPughsnm
fnmTfnm
au
au
snmBurleighsnm
fnmAfnm
au
au
snmDelaneysnm
fnmAfnm
au
au
snmGelmonsnm
fnmKfnm
au
au
snmGulianysnm
fnmRfnm
au
au
snmSenzsnm
fnmJfnm
au
au
snmSteidlsnm
fnmCfnm
au
au
snmHoltsnm
fnmRAfnm
au
au
snmJonessnm
fnmSfnm
au
au
snmSunsnm
fnmMfnm
au
au
snmLeungsnm
fnmGfnm
au
au
snmMooresnm
fnmRfnm
au
au
snmSeversonsnm
fnmTfnm
au
au
snmTaylorsnm
fnmGAfnm
au
au
snmTeschendorffsnm
fnmAEfnm
au
au
snmTsesnm
fnmKfnm
au
au
snmTurashvilisnm
fnmGfnm
au
au
snmVarholsnm
fnmRfnm
au
au
snmWarrensnm
fnmRLfnm
au
au
snmWatsonsnm
fnmPfnm
au
au
snmZhaosnm
fnmYfnm
au
au
snmCaldassnm
fnmCfnm
au
au
snmHuntsmansnm
fnmDfnm
au
au
snmHirstsnm
fnmMfnm
au
au
snmMarrasnm
fnmMAfnm
au
au
snmApariciosnm
fnmSfnm
au
aug
sourceNaturesource
pubdate2009pubdate
volume461volume
fpage809fpage
lpage813lpage
xrefbib
pubidlist
pubid idtype="doi"10.1038nature08489pubid
pubid idtype="pmpid" link="fulltext"19812674pubid
pubidlist
xrefbib
bibl
bibl id="B55"
title
pInvasive breast carcinomasp
title
aug
au
snmEllissnm
fnmIOfnm
au
au
snmSchnittsnm
fnmSJfnm
au
au
snmSastre-Garausnm
fnmXfnm
au
etal
aug
sourcePathology and Genetics of Tumours of the Breast and Female Genital Organssource
publisherLyon: IARC Presspublisher
editorTavassoli FA, Devilee Peditor
pubdate2003pubdate
fpage13fpage
lpage59lpage
bibl
bibl id="B56"
title
pQuantitative gene expression profiling in formalin-fixed, paraffin-embedded tissues using universal bead arraysp
title
aug
au
snmBibikovasnm
fnmMfnm
au
au
snmTalantovsnm
fnmDfnm
au
au
snmChudinsnm
fnmEfnm
au
au
snmYeakleysnm
fnmJMfnm
au
au
snmChensnm
fnmJfnm
au
au
snmDoucetsnm
fnmDfnm
au
au
snmWickhamsnm
fnmEfnm
au
au
snmAtkinssnm
fnmDfnm
au
au
snmBarkersnm
fnmDfnm
au
au
snmCheesnm
fnmMfnm
au
au
snmWangsnm
fnmYfnm
au
au
snmFansnm
fnmJBfnm
au
aug
sourceAm J Patholsource
pubdate2004pubdate
volume165volume
fpage1799fpage
lpage1807lpage
xrefbib
pubidlist
pubid idtype="pmcid"1618650pubid
pubid idtype="pmpid" link="fulltext"15509548pubid
pubidlist
xrefbib
bibl
bibl id="B57"
title
pA versatile assay for high-throughput gene expression profiling on universal array matricesp
title
aug
au
snmFansnm
fnmJBfnm
au
au
snmYeakleysnm
fnmJMfnm
au
au
snmBibikovasnm
fnmMfnm
au
au
snmChudinsnm
fnmEfnm
au
au
snmWickhamsnm
fnmEfnm
au
au
snmChensnm
fnmJfnm
au
au
snmDoucetsnm
fnmDfnm
au
au
snmRigaultsnm
fnmPfnm
au
au
snmZhangsnm
fnmBfnm
au
au
snmShensnm
fnmRfnm
au
au
snmMcBridesnm
fnmCfnm
au
au
snmLisnm
fnmHRfnm
au
au
snmFusnm
fnmXDfnm
au
au
snmOliphantsnm
fnmAfnm
au
au
snmBarkersnm
fnmDLfnm
au
au
snmCheesnm
fnmMSfnm
au
aug
sourceGenome Ressource
pubdate2004pubdate
volume14volume
fpage878fpage
lpage885lpage
xrefbib
pubidlist
pubid idtype="pmcid"479115pubid
pubid idtype="pmpid"15123585pubid
pubid idtype="doi"10.1101gr.2167504pubid
pubidlist
xrefbib
bibl
bibl id="B58"
title
pAberrant expression of E-cadherin in lobular carcinomas of the breastp
title
aug
au
snmDa Silvasnm
fnmLfnm
au
au
snmParrysnm
fnmSfnm
au
au
snmReidsnm
fnmLfnm
au
au
snmKeithsnm
fnmPfnm
au
au
snmWaddellsnm
fnmNfnm
au
au
snmKossaisnm
fnmMfnm
au
au
snmClarkesnm
fnmCfnm
au
au
snmLakhanisnm
fnmSRfnm
au
au
snmSimpsonsnm
fnmPTfnm
au
aug
sourceAm J Surg Patholsource
pubdate2008pubdate
volume32volume
fpage773fpage
lpage783lpage
xrefbib
pubidlist
pubid idtype="doi"10.1097PAS.0b013e318158d6c5pubid
pubid idtype="pmpid" link="fulltext"18379416pubid
pubidlist
xrefbib
bibl
bibl id="B59"
title
pA fast, sensitive and accurate high resolution melting (HRM) technologybased assay to screen for common K-ras mutationsp
title
aug
au
snmKramersnm
fnmDfnm
au
au
snmThunnissensnm
fnmFBfnm
au
au
snmGallegos-Ruizsnm
fnmMIfnm
au
au
snmSmitsnm
fnmEFfnm
au
au
snmPostmussnm
fnmPEfnm
au
au
snmMeijersnm
fnmCJfnm
au
au
snmSnijderssnm
fnmPJfnm
au
au
snmHeidemansnm
fnmDAfnm
au
aug
sourceCellular Oncologysource
pubdate2009pubdate
volume31volume
fpage161fpage
lpage167lpage
xrefbib
pubid idtype="pmpid" link="fulltext"19478384pubid
xrefbib
bibl
refgrp
bm
art