Identification of genes expressed in cultures of E. coli lysogens carrying the Shiga toxin-encoding prophage Φ24B

MISSING IMAGE

Material Information

Title:
Identification of genes expressed in cultures of E. coli lysogens carrying the Shiga toxin-encoding prophage Φ24B
Series Title:
BMC Microbiology
Physical Description:
Book
Language:
English
Creator:
Riley, Laura M.
Veses-Garcia, Marta
Hillman, Jeffrey D.
Handfield, Martin
McCarthy, Alan J.
Allison, Heather E.
Publisher:
BioMed Central
Publication Date:

Notes

Abstract:
Background: Shigatoxigenic E. coli are a global and emerging health concern. Shiga toxin, Stx, is encoded on the genome of temperate, lambdoid Stx phages. Genes essential for phage maintenance and replication are encoded on approximately 50% of the genome, while most of the remaining genes are of unknown function nor is it known if these annotated hypothetical genes are even expressed. It is hypothesized that many of the latter have been maintained due to positive selection pressure, and that some, expressed in the lysogen host, have a role in pathogenicity. This study used Change Mediated Antigen Technology (CMAT)™ and 2D-PAGE, in combination with RT-qPCR, to identify Stx phage genes that are expressed in E. coli during the lysogenic cycle. Results: Lysogen cultures propagated for 5-6 hours produced a high cell density with a low proportion of spontaneous prophage induction events. The expression of 26 phage genes was detected in these cultures by differential 2D-PAGE of expressed proteins and CMAT. Detailed analyses of 10 of these genes revealed that three were unequivocally expressed in the lysogen, two expressed from a known lysogenic cycle promoter and one uncoupled from the phage regulatory network. Conclusion: Propagation of a lysogen culture in which no cells at all are undergoing spontaneous lysis is impossible. To overcome this, RT-qPCR was used to determine gene expression profiles associated with the growth phase of lysogens. This enabled the definitive identification of three lambdoid Stx phage genes that are expressed in the lysogen and seven that are expressed during lysis. Conservation of these genes in this phage genome, and other Stx phages where they have been identified as present, indicates their importance in the phage/lysogen life cycle, with possible implications for the biology and pathogenicity of the bacterial host.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
All rights reserved by the source institution.
Resource Identifier:
doi - 10.1186/1471-2180-12-42
System ID:
AA00012385:00001

Full Text

PAGE 1

RESEARCHARTICLE OpenAccessIdentificationofgenesexpressedinculturesof E. coli lysogenscarryingtheShigatoxin-encoding prophage F 24BLauraMRiley1,2 ,MartaVeses-Garcia1,JeffreyDHillman3,MartinHandfield3,AlanJMcCarthy1and HeatherEAllison1*AbstractBackground: Shigatoxigenic E.coli areaglobalandemerginghealthconcern.Shigatoxin,Stx,isencodedonthe genomeoftemperate,lambdoidStxphages.Genesessentialforphagemaintenanceandreplicationareencoded onapproximately50%ofthegenome,whilemostoftheremaininggenesareofunknownfunctionnorisit knowniftheseannotatedhypotheticalgenesareevenexpressed.Itishypothesizedthatmanyofthelatterhave beenmaintainedduetopositiveselectionpressure,andthatsome,expressedinthelysogenhost,havearolein pathogenicity.ThisstudyusedChangeMediatedAntigenTechnology(CMAT) and2D-PAGE,incombinationwith RT-qPCR,toidentifyStxphagegenesthatareexpressedin E.coli duringthelysogeniccycle. Results: Lysogenculturespropagatedfor5-6hoursproducedahighcelldensitywithalowproportionof spontaneousprophageinductionevents.Theexpressionof26phagegeneswasdetectedintheseculturesby differential2D-PAGEofexpressedproteinsandCMAT.Detailedanalysesof10ofthesegenesrevealedthatthree wereunequivocallyexpressedinthelysogen,twoexpressedfromaknownlysogeniccyclepromoterandone uncoupledfromthephageregulatorynetwork. Conclusion: Propagationofalysogencultureinwhichnocellsatallareundergoingspontaneouslysisis impossible.Toovercomethis,RT-qPCRwasusedtodeterminegeneexpressionprofilesassociatedwiththegrowth phaseoflysogens.ThisenabledthedefinitiveidentificationofthreelambdoidStxphagegenesthatareexpressed inthelysogenandseventhatareexpressedduringlysis.Conservationofthesegenesinthisphagegenome,and otherStxphageswheretheyhavebeenidentifiedaspresent,indicatestheirimportanceinthephage/lysogenlife cycle,withpossibleimplicationsforthebiologyandpathogenicityofthebacterialhost.BackgroundShigatoxigenic Escherichiacoli (STEC)causediseasein humansfollowingcolonisationoftheintestinaltract[1]. Theseinfectionsareoftenserious,presentingwith severediarrhoeaaccompaniedbyhaemorrhagiccolitis. Downstreamsequelaesuchashaemolyticuraemicsyndrome(HUS)andthromboticthrombocytopenicpurpura(TTP)canbefatal[2,3]. Theprincipledefiningvirulencedeterminantofall STECstrainsistheproductionofShigatoxin(Stx),also knownasverocytotoxin(VT)orShiga-liketoxin(SLT) (1),ofwhichtherearetwodistinctforms,Stx1andStx2 [4].TwovariantsofStx1havebeenidentified[5,6], whilstStx2isheterogeneous,withsomevariantsmore frequentlyassociatedwithseriousSTECoutbreaks[1,7]. The stx genesarecarriedbytemperatelambdoidbacteriophages,whichentereithe rthelyticorthelysogenic pathwaysuponinfectionofabacterialcell[8-10].Any bacteriophageencodingStxistermedanStxphage,and thereismuchgenotypicandphenotypicdiversitywithin thisloosely-definedgroup[11].IntegratedStxphages mayexistinthebacterialchromosomeasinducibleprophages,ortheirresidencewithinahostcellmayfacilitaterecombinationeventsleadingtothelossof prophagesequences,resultinginuninducible,remnant *Correspondence:hallison@liv.ac.uk Contributedequally1MicrobiologyResearchGroup,InstituteofIntegrativeBiology,Universityof Liverpool,BioSciencesBuilding,CrownStreet,LiverpoolL697ZB,UK FulllistofauthorinformationisavailableattheendofthearticleRiley etal BMCMicrobiology 2012, 12 :42 http://www.biomedcentral.com/1471-2180/12/42 2012Rileyetal;licenseeBioMedCentralLtd.ThisisanOpenAccessarticledistributedunderthetermsoftheCreativeCommons AttributionLicense(http://creativecommons.org/licenses/by/2.0),whichpermitsunrestricteduse,distribution,andreproductionin anymedium,providedtheoriginalworkisproperlycited.

PAGE 2

Stxprophageswithinthelysogenchromosome[12].The stx genesarelocatedwithgenesinvolvedinthelytic cycle;henceShigatoxinexpressionoccurswhenStx phagesareinducedintothispathway[11,13]. Stxphagespossessgenomesthataregenerally~50% largerthanthatofthefirstdescribedlambdoidphage, l itself,and~74%ofStxphagegeneshavenotbeendefinitivelyassignedafunction[11].Genesthatareessential fortheStxphagelifestylearecarriedonapproximately 30kbofDNA[14],whilsttheentiregenomeisca60kb insizeinmostcases[11,15,16].TheimpactofStx prophagecarriageonthepathogenicityprofileorbiologyofthehost,beyondconferringtheabilitytoproduce Shigatoxin,hasremainedlargelyunexploredanditcan besuggestedthattheaccessorygenomeofStxphagesis likelytoencodefunctionsforwhichtherehasbeen positiveselection[11]. Inthispaper,wedescribetheuseofproteomic-based proteinprofilecomparisonsandChangeMediatedAntigenTechnology (CMAT)(OragenicsInc.)[17]to identifyStxphagegenesthatareexpressedduringthe lysogenicpathway.An E.coli lysogenof F 24B::Kan,in whichakanamycin-resistancecassetteinterruptsthe stx2A gene[18]ofaphageisolatedfroman E.coli O157:H7diseaseoutbreakstrain,wassubjectedtoboth CMATandtwodimensionalpolyacrylamidegelelectrophoresis(2D-PAGE)analy sesoftheexpressedproteome.The F 24B::Kangenomeis57.6kbinsizeandis identicalinallaspectstoitswild-typeparentalphage otherthanthe stxA geneinterruption[14,18].The majorityofgenesandcodingsequences(CDS)carried by F 24Baresimplyannotatedashypothetical[GenBank: HM_208303].Bacteriophagestightlyregulateexpression oftheirgenesinvolvedinmaintenanceoflysogenyversusreplicationofviralprogeny,andthedifferentiation ofgeneexpressionassociatedwitheachstateneededto becarefullydeterminedinordertodefinitivelyassociate expressedproteinsandtheirgeneswitheitherthetemperateorthelyticcycle.ResultsTherateofspontaneouslysisinan E.coli MC1061( F 24B) cultureatdifferentstagesofgrowthSpontaneousinduction,definedastheinductionofprophagesfromlysogensintheabsenceofanappliedstimulus[19],occursconstantlyinaproportionofthe lysogenpopulationinanyculture,andthiscouldseriouslyinterferewiththedifferentiationofgeneexpressionbetweenlyticandlysogenicstates.Inthisstudy,it wasnecessarytodeterminecultureconditionsunder whichthenumberofspontaneousinductioneventswas lowwhilstthecelldensitywashigh,enablingtheconsistentharvestingofsufficientamountsofcell-associated proteinfordownstreamanalyses.Lysogencultureswere sampledathourlyintervalsbeginningtwohourspost inoculation,andthec.f.u.ml-1andp.f.u.ml-1determined.Thelowestratioofinfectivephagestocells, 1:50,occurredatboth2hand3hoflysogengrowth. Howeverthec.f.u.ml-1duringthesetimeswasrelatively low;OD600=0.184(0.003)andOD600=0.651( 0.008),respectively.Theratioofphagetohostcells increasedsharplyafter4hofgrowth,beforedropping after5hto1:33(OD600=1.192[.011]).Theratio ofphagetocellsinthecultureremainedstableat1:33 throughto6hoursofgrowth.LysogengrowthconditionswerethereforestandardisedforMC1061( F 24B)at 5-6hourswhenthecellsweregrowntoanOD600of 1.2-1.3.Phage-encoded,lysogen-culturegeneexpression identifiedbyCMATAtotalof13,519clonesweresubjectedtoCMATprimaryscreening,andtakingefficiencyofthelibraryinto account,thisequatestoa3.3xcoverageofthephage genome.Ofthese,330wereidentifiedbythelysogenspecificantiserumandchosenforfurtheranalysesand secondaryscreening.Aftertworoundsofsecondary screening,250cloneswereremovedfromthestudyand PCRanalysisoftheremaining80clonesdemonstrated that46possessedvectorDNAonly.Theremaining34 recombinanttransformantsproducedapeptiderecognisedbyantibodiesinthelysogenspecificantiserum. Theclonedinsertsweresequenced,andtheDNA sequencestranslatedinallsixpossiblereadingframes. Twenty-threeoftheclonespossessedsequencesfrom twentydifferent F 24BCDS(Table1,Figure1).The remainingelevenclonesdidnotalignwithany F 24B-encodedCDS,althoughsixdidpossessnon-coding regionsofthephagegenome.TheotherfiveclonescontainedplasmidDNAonly.Phage-encoded,lysogen-culturegeneexpression identifiedby2D-PAGEReproduciblesetsofgelsfrom2D-PAGEanalyseswere obtainedthroughtheutilisationofIPGstripsinthepH rangesof3.5-5.6and5.3-6.5.Theoptimalproteinconcentrationloadedonthegelswasfoundtobe200 gof totalcellularproteinfromcr udecelllysates.Atotalof 42proteinspotswerefoundonlyinthelysogengelsets (datanotshown);thesewereexcisedfromthegelsand analysedbyMALDI-TOF.Twenty-fourofthesespots (Figure2)containedenoughproteinforthegeneration ofmassspectraldata.Whenthesespectraweresearched againsttheUniversityofLiverpoolMASCOTdatabase, whichincludedallofthe F 24Bgenomepredictedproteins,sixsamplesmatchedpredictedphageproteins(P1 toP6,Table2,Figure1).Theremaining20spotswere identifiedas E.coli proteins(Table2);theseareRiley etal BMCMicrobiology 2012, 12 :42 http://www.biomedcentral.com/1471-2180/12/42 Page2of14

PAGE 3

potentiallylysogenspecificbutwerenotinvestigated furtherhere.AnalysesofgeneexpressionpatternsGenerally,lambdoidphager egulatorycircuitstightly controltheexpressionofgenes,yetsomeofthegenes identifiedintheCMATlibraryandthe2D-PAGEanalysesabovewerephagegeneswhoseexpressionshould belinkedtoprophageinduction(Figure1)andnotthe stableprophagestate, e.g.thegeneencodingthetail spikeprotein.Itwasassumedthatgeneexpressionnormallylinkedtothelyticreplicationcyclemustbeata veryhighlevelinasmallsubsetofthecellsandthat lysogen-restrictedgeneexpressionpatternsofthese genesmightbeverylow,especiallyasneitherCMAT nor2D-PAGEidentifiedtheexpressionofrepressor,the productofthe cI gene,inthelysogenculture.Therefore itwasessentialtodeviseamethodthatwoulddeterminewhetherphagegeneswerebeingexpressedbythe majorityofthestablelysogenpopulation,orthesmall Table1CDSidentifiedbyCMATandlocationonthe F 24BgenomeCloneAlignmentto F 24Bgenome AlignedCDSPossible gene CM139370-3977238090-40027 tspS CM2+ CM14 17489-1810417559-18086 dam CM32523-2185a:2378-2286 b:2507-2379 CM43025-2375a:2545-2375 b:2812-2711 c:2911-2840 CM554385-5386653693-53866 CM653690-5323553482-53297 CM7+ CM13 55160-5566749148-57571 CM838754-3924838460-38954 CM92542-29402248-2646 CM1035049-3459833695-34702 CM11+ CM12 39573-4001640189-39355 CM1540137-4050640345-40626 CM1638041-3762338000-37698 CM1752465-5214752191-52514 CM1845227-4587744818-45552 lom CM1945610-4610045981-46382 CM204098-36764333-4052 CM2139305-3991939405-39650 CM2239875-4052639909-40298 CM2345713-46232a:4578445921 b:4607246239 Figure1 Schematicrepresentationofthe F 24Bgenome SquaressymbolisethelocationsoftheCMATandPAGECDS identifiedaswellassomeoftheessentialgenesinvolvedinthelife cycleofthephage.-represents5kb.Forfurtherdetailsonthe geneidentitiesseeTables1&2. Riley etal BMCMicrobiology 2012, 12 :42 http://www.biomedcentral.com/1471-2180/12/42 Page3of14

PAGE 4

subsetofthepopulationundergoingspontaneousinductionevents.AstrategyinvolvingqPCRwasdevelopedto providethisimportantinformation,andavarietyof geneswerechosenascontrolsforthisstudy(Additional file1:TableS1,Figure1).CalibrationcurvesforquantitationandcomparisonoftheqRT-PCRdatawereproducedforeverysetofprimersused;R2valuesfrom linearregressionanalysesofthesestandardsranged from0.990to0.999withslopesrangingbetween-3.72 and-3.10(Additionalfile1:TableS1). ThedatafromtheqPCRassaywereanalysedbycomparingtheshapeoftheexpressiondataforanygiven genefromalysogenculturethroughouttheprophage inductionprocesswheretime0isthepointofnorfloxacin(inducer)addition(Figure3).Lysogen-restricted geneexpressionshouldbenegativelyaffectedafter induction(Figure3A,CI),andifexpressionisactually linkedtothesmallproportionofcellsundergoingspontaneousinduction,thentheexpressionlevelsshouldrise duringtheinductionprocess.Thisisindeedthecaseas expectedforQ,Cro,Capsid&Terminase,whichdisplay asignificantincreaseafter50minofrecovery,Figure3; Additionalfile2:TableS2). Fourgenesidentifiedby2D-PAGE,P1,P4,P5andP6, visiblyfollowthesameexpressionpatternasthegenes expressedduringthelyticcycleandaccordinglythe increaseingenecopynumberissignificant(p-value< 0.05)after50or60minofrecoveryfromexposureto norfloxacin(Figure3;Additionalfile2:TableS2).P3 andP2appeartohaveasimilarpatternto cI ,i.e.their levelsofexpressioninthelysogenarehigherthanthe levelsafterinduction;howevertheANOVAanalysisdid notidentifythesedifferencesassignificant,probablydue tothehighvariabilityamongstthereplicates.Ofthefive CDSidentifiedbyCMAT,whichweresubsequently selectedforexpressionanalysisbaseduponeithertheir putativefunctionorlocationwithinthephagegenome, fourhadexpressionpatternslinkedtothelyticcycle. CM18wasshownbyqPCRtobestronglyexpressedin lysogencultures,butwhenthecellsareinduced,high Figure2 2D-PAGEimagesoftotal cellproteinfromMC1061/ F 24B::Kan .IEFonpHrange4-7(A,C),5.3-6.5(B)and3-5.6(D).Arrows representproteinsidentifiedasphageencoded;circlesrepresentproteinsidentifiedasencodedby E.coli ,butnotpresentoncorresponding naveMC1061gels(datanotshown). Riley etal BMCMicrobiology 2012, 12 :42 http://www.biomedcentral.com/1471-2180/12/42 Page4of14

PAGE 5

Table2ProteinidentitiesaccordingtotheMASCOTdatabaseP GenenameAccessNo.pI/ MW (Da) DescriptionSequenceaCoverage (%) MASCOTbScore Peptidescmatches Estimated pI/MW(Da) MASCOT Database Identifiedin 1 P1 5.28/ 33860 Identicaltohypothetical proteinp78from933Wd3263*65.50/400001 2 P2 5.27/ 17096 Similartohypotheticalprotein p23from933W 423955.00/150001 3 P3 5.09/ 13472 Similartohypotheticalprotein p24from933W 335535.6/80001 4 P4 5.14/ 25800 Identicaltoexoof933W295255.5/400001 5 P5 5.29/ 7336 Notknownhomologue834127.00/70001 6 P6 5.22/ 13628 Identicaltohypothetical proteinStx2Ip064e383047.00/100001 7 nanA2 Q6KD265.77/ 34077 N-acetylneuraminatelyse2214745.3/350002 8 gadB CAQ319815.29/ 52634 Glutamatedecarboxylasebeta235775.3/350002 9 sodB P0AGD55.58/ 21121 Superoxidedismutase[Fe]405364.00/1000002 10 napA AAC752668.23/ 92983 Nitratereductase144975.5/1000002 11 tig AAA627914.73/ 47994 Triggerfactor2458*73.5/60002 12 UTI89_C3021Q1R8374.70/ 6971 Hypotheticalprotein704225.5/70002 13 2FPKAZP_048732245.24/ 32497 6-phosphofructokinase234655.3/500002 14 gcpE S230585.87/ 40658 1-hydroxy-2-methyl-2-(E)butenyl4-diphosphate synthase 163845.5/800002 15 aceE P0AFG95.46/ 99475 PyruvatedehydrogenaseE1 component 1060*75.4/1000002 16 bfpK Q9S1417.63/ 18294 BfpK 544936.4/250002 17 ychN P0AB535.02/ 12685 ychN 463825.3/1000002 18 UTI89_C1147Q1RDD5.57/ 24945 Hypotheticalprotein 153845.7/300002 19 ompC Q9RH854.55/ 40474 Outermembraneprotein184445.5/400002 20 ECs1247G907844.74/ 25144 Hypotheticalprotein 263956.5/350002 21 UTI89_C2748Q1R8V610.19/ 10724 Hypotheticalprotein 445046.4/8000 2 22 nirB E860015.79/ 93112 Nitratereductase(NAD(P)H) Subunit 105385.3/1000002 23 yagP CAQ307615.65/ 15401 yagPprotein 364335.3/100002 24 rhsF Q472845.69/ 23342 RhsF 184245.69/80002Tablerepresentsmatchesto E.coli proteinsintheMASCOTdatabaseandmatchesto F 24BproteinsintheUniversityofLiverpoollocalMASCOTdatabaseapercentageofsequenceofthematchedproteinthatiscoveredbytheexperimentalMS.blogarithmoftheprobabilitythatthematchbetweentheexperimentaldataandaproteinsequenceinthedatabaseisarandomevent.cnumberofpeptidesthatmatchtheproteininthedatabased933WisanStx2phagedescribedbyPlunkett etal. [16].eStx2isanStx2phagedescribedbySato etal. [20]. *representssignificantmatches(p-value<0.05) 1UniversityofLiverpoollocalMASCOTdatabase;2generalMASCOTdatabaseRiley etal BMCMicrobiology 2012, 12 :42 http://www.biomedcentral.com/1471-2180/12/42 Page5of14

PAGE 6

expressionlevelsaremaintained,suggestingthatexpressionofthisgenehasbeenuncoupledfromthephage regulatorycircuits.Theoutcomeofone-wayANOVA analysistodeterminetheimpactofprophageinduction ongeneexpressionwasfoundtobesignificantin11 cases(p-value<0.05):cI,cro,terminase,capsid,Q, CM1,CM2,CM5,CM7,P1andP5.Theother7genes studieddidnotpresentsign ificantchangesinexpression:P2,P3,P4,P6,CM18,16S,andgyraseB.Thefull setofp-valuesforthedatainFigure3arepresentedin Additionalfile2:TableS2.DiscussionTemperatephages,maintainedasprophagesintheir lysogens,havebeenthesubjectofspeculationconcerningtheirbenefittothehost:selectiveadvantage, increasedvirulence,andothertraitswithvarying degreesofdirectand/orindirectimpactonthehost havebeenidentified[11,21-27].Thechallengeinthis areahasbeenhowtoidentifyphage-encodedgenesthat directlyaffecttheirlysogen,becausemany/mostphage genesareannotatedasencodinghypotheticalproteins. Inaddition,therewillalwaysbeasmallbackground populationundergoingspontaneousinductioninthe absenceofdiscerniblestimuli[19],potentiallyconfoundingtheidentificationoflysogen-restrictedprophage geneexpression.Inaspecific E.coli lysogenofStx2phage933W,aphageverycloselyrelatedto F 24B,the spontaneousinductionratewascalculatedas0.014% [28],whichmeansthatinalysogenculturefourteen cellsper100,000areundergoingprophageinduction. Otherrecentworkwasdem onstratedthatvarious inductionagentsandgrowthconditionsdifferentially effectsinductioninaprophage-dependentmanner[29]. Assumingaburstsizesimilartothatofbacteriophage Lambda(17010virionscell-1)[27],asignificant amountofphagestructuralproteinproductioncan occurinanuninducedlysogenculture. Inordertomitigatethiseffect,thegrowthphaseat whichtheratiooflysogenstofreephagewashigh(two tothreehourspostinoculation)wastargeted.However, thecelldensityatthispointwasverylowand5-6hours waschosenasthestandardisedincubationtimeasa compromise.Inthisstudy,26genesfromthebacteriophage F 24BwereidentifiedbyeitherCMATor2DPAGEasbeingexpressedin E.coli lysogenculture.No geneswereidentifiedbybothCMATand2D-PAGE methods,perhapsdueinparttothelowabsolutenumberof F 24Bgenesidentifiedbythelatterapproach. However,thelevelofredundancyinthegenesidentified bytheCMATcloneswaslowerthanexpected,given thenumberofclonesscreenedandthecalculatedphage genomecoverage;however,putativepositivecloneswere selectedconservativelyinanattempttolimitthenumberoffalsepositives.Additionally,CMAT-basedidentificationmayalsointroducebiasintolibraryscreening duetodifferencesinproteinimmunogenicityandantigenicity.Itisimportanttonotethatthebestcharacterisedlysogen-restrictedgene, cI (encodinglambdoid phagerepressor),wasnotidentifiedusingeitherCMAT Figure3 Graphdepictinggeneexpressionprofilesbeforeandfollowingnorfloxacininduction .PanelA:ControlGenes.CI,markergene forlysogeny-restrictedexpression; CroandQ,markergenesforearlyinductionresponse; TerandCap ,markergenesforlategeneexpression; GyrBand16S ,markergenesforthecellularresponse. PanelB: ExpressionprofilesoftheprophagegenesidentifiedbyCMAT. PanelC: Expressionprofilesofthegenesidentifiedby2D-PAGEanalysesofthelysogen.TheYaxisrepresentsgenecopynumberper300ngofRNA;the Xaxisrepresentstime(min).Time-60referstothesamplestakenbeforeinductionandrepresentsthelysogenpopulation,Time0represents samplestakenatthebeginningoftherecoverytime,Time10,10minafterrecovery, etc .Theexperimentwasrunusingbiologicalreplicates,but duetotheasynchronicityofinductionacrosstheseexperimentsthedatafromarepresentativesinglebiologicalreplicateareshown. Riley etal BMCMicrobiology 2012, 12 :42 http://www.biomedcentral.com/1471-2180/12/42 Page6of14

PAGE 7

or2D-PAGE,indicatingthatthisstudywasnotexhaustive.Nevertheless,thepaucityofinformationonlysogen-restrictedgeneexpressionissuchthatthesedata representasignificantstepforwardinourunderstandingofphage/hostinteractionsandlysogenbiology. Ofthe26phagegenesidentifiedinthisstudy,Tsp, encodingthecharacterisedtailspikeproteinof F 24B[30,31]wasaknownstructuralproteinandtherefore notexpectedtobeexpressedbyastablelysogen (Tables1&3),whiletheexpressionprofilesofthe other25proteinswereunknown.Thereforetheresultingchallengewastoidentifythefractionoftheculture (lysogensorcellsundergoinglysis)thatwereresponsibleforexpressionofthese26phagegenesaswellas determiningtestablehypothesestoassignfunctionto theidentifiedgeneproducts.FivegenesidentifiedduringtheCMATscreeningwerechosenforgeneexpressionprofilingduetotheirgenomelocation,potential functionordegreeofconservationacrossarangeof phages(Table3).TheCDSCM18encodesaLom orthologue,whichwasexpectedtobeexpressedinthe lysogenasthelambda lom geneisassociatedwiththe alterationofthelysogen spathogenicprofileafterlocationofLomintheoutermembrane[32-34].However, expressionof lom inthe F 24Blysogenunexpectedly appearstobeuncoupledfromthephageregulatory pathways,becauseitisexpressedatsimilarlevelsinan infectedcellregardlessofwhetherthatcellexistsasa stablelysogenorisundergoingprophageinduction. TheCDSCM2encodesaputativeDammethyltransferase.Bacterial-encodedDammethyltransferasehasbeen showntobeessentialformaintenanceoflysogenyin E. coli infectedwithStx-phage933W[35].Theexpressionpatternofthe F 24B-encodedDammethyltransferasecouldindicatethatitisfulfillingasimilarrole,or supplementingthefunctionofthehost-encodedDam methylaseinlysogensinfectedwiththisphage.The functionsofCM5andCM7areunknown.CM7isan ORFof8kb,andastheamountofDNAthatcanbe packagedbyaphageislimited,suchalargegeneis likelytobeconservedonlyifitconfersanadvantageto thephageoritslysogen;itmaybesignificantthatthis largegeneisassociatedwithseveralotherphages (Table3).CM5isasmallCDSlocatedonthecomplementarystrandtotheoneencodingCM7,inaregion withfewotherCDS,thoughitisdirectlyupstreamof anotherCMAT-identifiedCDS,CM6.Thedata(Figure 3)indicatethattheexpressionofthese3genesis linkedtoprophageinduction,asurprisingoutcomeas CM7doesnotappeartobeaphagestructuralgene, hasbeenindicatedbybioinformaticanalyses(datanot shown)tobeaprobableoutermembraneprotein,and isdownstreamofCM18,whoseregulationisuncoupled fromexpressionofthelategenes. TheqPCRexpressionprofileforthephagegenesidentifiedasbeingexpressedinthelysogenby2D-PAGE, P1,P2,P3,P4,P5andP6,indicatedthatonlythe expressionofP2andP3wererestrictedtolysogencultureswithastableprophage.ThegenesforbothP2and P3liedownstreamofthe cI gene.However,their expressionlevelsareoneandfiveordersofmagnitude greater,respectively,thantheexpressionlevelsof cI ,the lambdoidphagerepressorgene.Itisknownthatin Lambdaphage,the cI genetranscriptisleaderless,possessingnoribosomebindingsiteforinitiationoftranslation,withtranscriptionandtranslationbeginningatthe AUGstartcodon[36].Ifthiscausesthe5 endofthe transcripttobelessstableandmoreeasilysubjectto degradation,thehigherlevelofP3transcriptcouldsimplybeduetopossessionofalongerhalflifethanthose genesatthe5 endofthetranscript. ThegenesencodingP2andP3areconservedinmany otherphages(Table3).They havenobioinformatically identifiablepromotersoftheirown,soarelikelytobe drivenby pRM or pRE like cI (see[37]foracogent reviewoftherelatedlambdaphage),butdifferencesin thelevelsoftranscriptionbetweenthese3genesimplies thatthereisstillmoretodiscoverabouttherightoperatorregionofthisphage.TheproteinsP1,P4,P5andP6 allexhibitgeneexpressionprofilesthatsuggesttheyare expressedfollowingpropha geinduction.Thesegenes arescatteredacrossthephagegenome(Figure1)and aresharedbyvariousphages(Table3).TheproteinP4 appearstobepartofthelambdaRedrecombinasesystem[38-40]andthedatapresentedheresuggestthat thisismostactiveuponprophageinduction.Thiscould berelevanttothemechanismsthatunderpindiversification,evolutionandproductionofnewphagesbylysogenscarryinganinducibleprophagealongwithoneor moreinducibleorremnantpr ophages[11,41,42].The proteinsP1,P5andP6arescatteredacrossthegenome onthestrandtypicallyassociatedwithexpressionof geneslinkedtolysogenicinfection( e.g.cIII,N,cI ).Two genesencodingproteinsP1,P5andP6arefoundin otherphages,buthavenoknownfunction. Insummary,genomesequencingofprophagesand bacteriophageshasidentifiedthattheseviralelements encodehighernumbersofhypotheticalgenesthanthose towhichwecancurrentlyassignafunction.These genesareoftenconservedacrossmanybacteriophages, butdonotappeartoencodestructuralproteins.For thesegenestoremainpresentinthephagegenome, especiallyconsideringthefluidityofthegeneticcompositionoflambdoidphages[43],theymustsurelyprovide animportantfunctionineitherthephagelifecycleor thatofthelysogenitself.Inattemptingtoidentify prophagegeneswhoseexpressionwasrestrictedtothe stableprophagestate,ourgoalwastoidentifyprophageRiley etal BMCMicrobiology 2012, 12 :42 http://www.biomedcentral.com/1471-2180/12/42 Page7of14

PAGE 8

Table3DistributionoftheproteinsidentifiedbyCMATand2D-PAGEacrossphagegenomesGeneOtherStxphagescarryingtheproteinsinthestudy(identity)Accession number OtherphagesAccession number CM1Stx2convertingphageII(99%)YP_003828920.1 phageVT2-Sakai(99%)NP_050557.1 phage933W(99%)NP_049519.1 Stx1convertingphage(99%)YP_003848832 phageBP-933W(99%)YP_003848832.1 phageVT2phi_272(99%)ADU03741.1 phageMin27(100%)ADU03741 CM2Stx2convertingphageII(100%)BAC78116 phageVT2-Sakai(100%)NP_050531.1 phageMin27(100%)YP_001648926 phageHK97(99%)AAF31137 phageLahn2(99%)CAJ26400 phageLahn3(98%)CAC95062.1 phage2851(99%)CAQ82016 phageCP-1639(99%)CAC83142 prophageCP-933V(99%)AAG57233 PhageNil2(99%)(99%)CAC95095 Stx1convertingphage(99%)YP_003848889.1 PhageCP-1639(99%)CAC83142.1 PhageYYZ-2088(99%)YP_002274170.1 Stx2-convertingphage1717(99%)YP_002274244.1 CM5phageMin27(100%)YP_001648966.1 Stx2convertingphageII(100%)YP_00388933.1 Stx2convertingphageI(100%)NP_612929.1 phageVT2-Sakai(100%)NP_050570.1 phage933W(100%)NP_049532.1 phageVT2phi_272(100%)ADU03756 CM7phageVT2-Sakai(99%)NP_050570 Stx1convertingphage(99%)BAC77866.1 PhageVT2phi_272(97%)ADU03756.1 Phage933W(97%)NP_049532.1 Stx2convertingphageI(97%)NP_612929.1 Stx2convertingphageII(97%)BAC78032.1 PhageBP-933W(97%)AAG55616.1 Stx2convertingphage86(91%)YP_794082.1 PhageMin27(97%)YP_001648966.1 CM18phageVT2-Sakai(100%)NP_050564.1 Stx1convertingphage(100%)YP_003848839.1 Phage933W(100%)NP_049526.1 Stx2convertingphageI(100%)ZP_02785836.1 Stx2convertingphageII(100%)YP_003828926.1 PhageBP-933W(100%)NP_286999.1 Stx2convertingphage86(97%) YP_794076.1 PhageMin27(100%) YP_001648959.1 P1 Stx2convertingphageII(99%) YP_003828937.1PhagephiV10(78%)YP_512303.1 Stx2convertingphageI(99%) NP_612952.1 Phage933W(99%) NP_049538.1 PhageBP-933W(99%) AAG55619.1 phageVT2-Sakai(99%) NP_050575.1 PhageMin27(96%) YP_001648901.1 Riley etal BMCMicrobiology 2012, 12 :42 http://www.biomedcentral.com/1471-2180/12/42 Page8of14

PAGE 9

genesthatwerecandidatesforinfluencingthefitnessof thebacterialhost.However,thestudywashamperedby thefactthatlysogen-restrictedgeneexpressioncanbe atverylowlevels,andphagegenesassociatedwith phagereplicationareexpressedatveryhighlevels.ConclusionsTwodifferentexperimentalstrategieswereemployedto identifyprophagegenesexpressedbytheirlysogen,and itisinterestingtonotethatlysogen-specificantibody recognitionofapeptideexpressionlibraryanddifferential2D-PAGEwithsubsequentproteinidentificationby peptidemassspectrometry,didnotidentifythesame genesorproteins.Thefailureofbothtoidentify expressionofthe cI geneencodingthephagerepressor wasshownbyRT-qPCRtobeduetotheverylow expressionlevelspeculiartothisphagegene(Figure4); theCIproteinisalsoverysusceptibletoautocatalysis andthereforeelusive.BothCMATand2DPAGEidentifiedsomephagegenesthatwereassociatedwithlytic induction,andtheqPCRstrategywasusefulfordiscriminatinglowlevelexpressioninstablelysogensfrom high-levelgeneexpressionintheminorityoflysogens thatwereundergoingspontaneousinduction.Improving ourunderstandingoftheSTECdiseaseprocessisever moreurgentinlightoftherecentemergenceofanew Shiga-toxinproducing E.coli pathotype[44],anddeterminingthefunctionandexpressionpatternsofthe Table3DistributionoftheproteinsidentifiedbyCMATand2D-PAGEacrossphagegenomes (Continued)Stx2-convertingphage86(96%) YP_794094.1 PhageBP-4795(96%) YP_001449244.1 phageCP-1639(74%) CAC83133.1 P2 Stx2convertingphageI(100%) NP_612997.1 Salmonellaenteric YP_002455860.1 Phage933W(100%) NP_049484.1bacteriophageSE1(86%) PhageBP-933W(100%) AAG55573.1 Salmonella phageST160(86%)YP_004123782.1 PhageMin27(100%) ABY49878.1 Stx2-convertingphage86(100%) YP_794109.1 P3 Stx2convertingphageI(100%) NP_612995.1 Phage933W(100%) NP_049483.1 Stx2-convertingphage86(100%) YP_794108.1 PhageMin27(100%) YP_001648915.1 PhageBP-933W(100%) AAG55572.1 P4 Phage933W(100%) NP_049473.1Phagelambda(98%)NP_040616.1 PhageBP-933W(100%) NP_286952.1 ProphageCP-933V(100%) NP_288695.1 Stx2convertingphageI(100%) NP_612980.1 PhageVT1-Sakai(100%) BAB19617.1 PhageYYZ-2008(99%) YP_002274150.1 Stx2-convertingphage1717(98%) YP_002274221.1 prophageCP-933K(98%) YP_003500773.1 phageBP-4795(98%) YP_001449249.1 phageMin27(99%) YP_001648905.1 P5 Stx2convertingphageI(100%) NP_613032.1 Phage933W(100%) NP_049503.1 Stx2convertingphageII(100%) BAC78139.1 Stx2-convertingphage1717(98%) YP_002274255.1 phage2851(98%) CAE53952.1 PhageBP-4795(97%) YP_0014419282.1 P6 Stx2convertingphageI(99%) NP_612943.1 Stx2convertingphageII(99%) BAC78046.1 phageVT2phi_272(99%) ADU03756.1 phageMin27(99%) YP_001648966.1 phageVT2-Sakai(99%) NP_050570.1 Stx1convertingphage(99%) BAC77866.1 Stx2-convertingphage86(96%) BAF34067.1 Riley etal BMCMicrobiology 2012, 12 :42 http://www.biomedcentral.com/1471-2180/12/42 Page9of14

PAGE 10

genesinStxphagegenomesisveryimportantinthat context.MethodsBacterialstrainsandcultureThe E.coli K-12strain,MC1061,wasusedasthebacterialhostfortheproductionoflysogens.MC1061 ( F 24B)referstothe F 24BlysogenofMC1061;nave MC1061referstocellsthathavenotbeeninfectedby F 24B. E.coli K-12strainDM1187wasusedastheindicatorhoststraininplaqueassayexperiments[18]. BL21-AIcells(Invitrogen,Paisley,U.K.)wereusedas theexpressionhostforgeneticconstructs.Bacterial strains,plasmidsandphagesusedinthisstudyarelisted inTable4. Allcultures,unlessotherwisestated,werepropagated fromanovernight(~16h)starterculture(0.5%v/v inoculum)inLuriaBertani(LB)broth(MerckKGaA, Darmstadt,Germany)containing0.01MCaCl2,incubatedat37Cwithshakingat200r.p.m.Lysogenculturesweregrowninthepresenceofkanamycin(Kan,50 gml-1).InductionofproteinexpressioninBL21-AI cellstookplaceinBHIbrothwith0.2%arabinoseand1 mMIPTG.InductionofphagelysogensCulturesofMC1061( F 24B)cellswereincubatedwith norfloxacin(1 gmL-1)for1hat37Cwithshakingat 200r.p.m.Cultureswerethendiluted1:10infreshLB andthebacteriaallowedtorecoverfromthegrowth inhibitoryeffectsoftheantibioticfor1hat37C(the recoveryperiod),withshakingat200r.p.m.AntiseraproductionforuseinCMATA2LcultureofMC1061( F 24B)waspropagatedfor6 hours.Thecellswerepelletedandresuspendedin1ml ofretainedsupernatantplus1mlofLBbroth.Protease inhibitors(20 L)(RocheCompleteMiniEDTAFree proteaseinhibitorcocktailtablets,Bath,U.K.)and10 L oflysisbuffer(7Murea,2Mthiourea,2%CHAPS,1% DTT,RocheCompleteMiniEDTA-freeproteaseinhibitorcocktailtablets)wereaddedtoeach.Thesamples weresonicatedat15-18 for610sbursts.Absolute methanol(1.5ml)wasadded,andthesampleswere incubatedat-20Cfor60min.Proteinwasharvestedby centrifugationat16,000 g for5min,andtheresultant proteinpelletswereair-driedandsuspendedin0.5ml phosphatebufferedsaline(PBS).Thesampleswere pooled;theproteincontentwasmeasuredbyBradford Assay[46]andadjustedto1mgml-1.Atotalof4mg ofthelysogenproteinwassenttoEurogentec(Seraing, Belgium)forantiseraproductioninrabbits,usingthe Ribiadjuvantsystem.Tworabbitswereimmunisedwith theproteinsampleondays0,14,28and56oftheprogram.Bleedswerecarriedoutondays0(pre-immune sera),38,66and87(finalbleed).Pre-immuneserafrom thetworabbitsusedwerereceivedandtestedforcrossreactivitybywesternblotanalysis. CMATwascarriedoutasperinstructionsfromthe licenseholder,OragenicsInc.,FL.,U.S.A.[17,47],with theexceptionthatBL21-AIw asusedastheexpression strainforthephagelibrary.Therecommendedexpressionhost,BL21[DE3],isan E.coli l lysogen,andthereforeaninappropriatestraintouseinphageprotein expressionstudies[48].Theexpressionlibrarywascreatedfrom F 24B::KanDNA.Therabbitantiserawere depletedofantibodiesreactiveto E.coli proteinsbya seriesofadsorptionstonaveMC1061wholecellsand cellularlysate,andtoBL21-AI+pET30c(emptyvector) wholecellsandcellularlysate.Thedepletedantisera werecomparedtoundepletedantiserabywesternblot. Adsorptionswererepeateduntilnobandsweredetectablebywesternblotprobingof6 gofnaveMC1061 proteins.PeptideexpressionlibraryconstructionSemi-confluentplaqueassayplates[18]wereoverlaid with3mlSMbuffer(100mMNaCl,8mMMgSO4,50 mMTris-HCl,pH7.5)andincubatedat4Cfor16h, withgentleagitation.TheSMbufferandtopagarwere transferredtoseparate50mlcentrifugetubesthatwere vortexedwith10%(v/v)freshSMbufferandsubjected tocentrifugationat10,000 g for10min.Thesupernatantwaspooledand30 lofchloroformwereaddedto each10mlofbuffer.DNase(5 gml-1)andRNase(1 mgml-1)wereadded,andthesampleswereincubated at37Cfor1h.PEG8000(33%[w/v])wasadded,and thesampleswereincubatedonicefor30min. Table4Bacterialstrains,plasmidandphagesusedinthestudyE.coli strains,plasmidsandphagesRelevantGenotypeReference BL21-AI FompThsdSB (rB-,mB-) galdcm (DE3),arabinoseinducibleT7RNApolymeraseInvitrogen,Paisley,U.K. MC1061 F( ara leu )7697 ( codB lacI )3 galK16 l-mcrA0rpsL 150(strR) mcrB1 [18] DM1187 Fdam -13::Tn9(CmR) dcm mcrBhsdR -M+ gal1ara lac thr leu tsxR [45] TOP10 FmcrA F 80 lacZ M15 recA+Invitrogen,Paisley,U.K. pCR-Blunt lacZ a ,KanR, ccdB Invitrogen,Paisley,U.K. pET30c ExpressionvectorwithT7promoter,KanR,TetR, Novagen,Notts,UK F 24BStx2-phage, stxA2:: aph3 [14] Riley etal BMCMicrobiology 2012, 12 :42 http://www.biomedcentral.com/1471-2180/12/42 Page10of14

PAGE 11

Precipitatedphageparticleswereharvestedbycentrifugationfor10minat10,000 g ,andthepelletswere resuspendedin500 lSMbufferper30mlstarting volume.SamplesweretreatedwithDNaseandRNase, asbefore.PhageDNAwaspurifiedbyphenol:chloroform:isoamylalcoholextractionandisopropanolprecipitation[49]andresuspendedin100 lddH2O.The F 24BDNA(15 gml-1inTE)wasfragmentedusinga HydroShear(GeneMachines,MI,USA),atspeedcode6 for30cycles,followedby30cyclesatspeedcode2. DNAoftherequiredsizerange(300-900bp)wasisolatedbygelpurification.pET30cplasmid(EMDBiosciences)DNAwasdigestedwith Eco RVand dephosphorylatedwithcalfintestinalphosphatase(New EnglandBiolabs)accordingtothemanufacturer s recommendations.Thesizefractionated F 24BDNA fragmentswereclonedintothepreparedpET30cDNA (50ng)vectorinamolarratioof25:1(inserttovector). ChemicallycompetentBL21-AIexpressionhostcells (Invitrogen)weretransformedwiththeplasmidDNA accordingtothemanufacturer srecommendations.PrimaryscreeningTransformedBL21-AIcellswereplatedontoLBKan platesandincubatedat37C(11h).Nitrocellulose membrane(0.2 mporesize,BioTraceTM)waslaid ontothetopofeachplateforapproximately1min.The membranesweretransferredcolony-sideuptoLBKan agarplatessupplementedwitharabinose(0.2%)and IPTG(1mM),andincubatedat37Cfor3h.Themasterplateswereincubatedforafurther3-5hat37C, untilthecoloniesreachedadiameterof1-2mm.The membraneswereliftedfromtheagarplatesandplaced onchloroform-saturatedfilt erpaper,colony-sidedown, for1min,afterwhichthechloroformwasallowedto evaporatecompletely.Themembraneswerethengently agitatedinblockingsolution(PBSplus0.5%Tween20 and5%skimmedmilkpowder)for1hatambienttemperature,washedinPBST(PBSplus0.5%Tween20;4 10min)withgentleagitationandprobedwiththeprimaryantibodies(depletedantisera)in10mlPBST (1:1,250)for16hat4Cwithgentleagitation.The membraneswerethenwashedfourtimesinPBSTand agitatedfor1.5hinsecondar yantibodysolution(HRP conjugatedtogoatanti-rabbitIgG[Sigma])(1:30,000). ThemembraneswerewashedfourtimesinPBST, rinsedtwiceinPBSandwashedfor10mininPBS, undergentleagitation.Enhancedchemiluminescent (ECL)reagentwasusedtodevelopthemembranesand thechemiluminescencewasvisualisedbyexposureof RocheLumi-FilmChemiluminescentDetectionFilmto themembranes.Putativepositivecloneswereidentified onthemasterplatesandeachonewastransferredto freshLBKanagar.PCRverificationofinsertForverificationofthepresenceofclonedDNA,putative positivecolonieswereusedasthetemplatesourcefora colonyPCRandtheT7promoterandT7terminator primers(Novagen,Notts,U.K.).ThermalcyclingconditionsusingTaqpolymerasecomprisedaninitialdenaturationof5minat94C,35cyclesofdenaturationat 94Cfor30s,annealingat55Cfor30s,extensionat 72Cfor30skb-1product,followedbyafinalextension at72Cfor7min.SecondaryscreeningPutativepositivecolonies wereculturedovernightin BHIKan(1ml),at37C,withoutshaking.Thecells wereharvestedbycentrifugationat16,000 g .Thesupernatantwasdecantedandthecellsresuspendedin20l BHIKan.Eachsuspensionwasspottedintriplicate(1 l)ontoduplicatenitrocellulosemembranesandplaced onaBHIKanagarplate.Theplatesandmembranes wereincubatedfor3hat37C,themembranesremoved andoneoftheduplicatemembranesoverlaidontoaLB Kanagarplatesupplementedwith0.2%arabinoseand1 mMIPTGwhiletheothermembranewasplacedontoa LBKanagarplate.Thesewereincubatedfor3hat37 C.Themembraneswereremovedfromtheplates,and placedonchloroform-saturatedfilterpaperfor1min. Oncedry,1 lofthelysogen-specificantiserumwas spottedontothebottomofthemembrane,asapositive control.Antibodyreactivitywasdeterminedasdescribed aboveforprimaryscreening.DNAsequencingPlasmidDNAwassequencedbyGATCBiotech(Konstanz,Germany),usingtheT7promoterandterminator primers.SequencesweretranslatedusingExPASY s Translate toolhttp://www.expasy.ch/tools/#proteome. Thesequenceswerealignedtotheannotated F 24Bgenome[GenBank:HM_208303]andCDSin-framewiththe expressionvectorweredocumented.qPCRInductionofMC1061( F 24B)cultureswasperformedas describedabove.A1mlsamplewastakenbeforeadditionofnorfloxacintothecultures,andfurther1mlaliquotsremovedat10-15minintervalsthroughoutthe60 minrecoverytime.RNAwasimmediatelyextractedand DNAsetreatedwithTURBO DNAse(Ambion,TX, USA)accordingtothemanufacturer sinstructions. AbsenceofDNAwasverifiedbyqPCR.EachRNAsample(300ng)wasreversetranscribedusingrandomhexameroligonucleotides(Bioline,London,UK).Specific primersweredesignedtoamplifyanapproximately100 bpregionofeachgeneinthestudy(Additionalfile1: TableS1).qPCRwasperformedusingaStepOnePlus Riley etal BMCMicrobiology 2012, 12 :42 http://www.biomedcentral.com/1471-2180/12/42 Page11of14

PAGE 12

Real-TimePCRSystem(AppliedBiosystems);eachreactionconsistedof1 lofcDNA,1xSensiMix Plus SYBR (Quantace,London,U.K.),200nMofspecificprimersin a25 lreaction.Theamplificationcyclingconditions were:initialdenaturation at95Cfor10min;39cycles ofdenaturationat95Cfor10s;annealingat60Cfor 30s;extensionat72Cfor5s.Ameltingcurveanalysis wasperformedforeachamplificationreaction,witha temperaturegradientof0.1Cfrom55Cto95C.Notemplatecontrolsandacalibrationcurve,consistingof 6dilutionsofthePCRampliconofeachgenecloned intoPCR-Bluntvector(Invitrogen,Paisley,U.K.)linearisedwith Nco I(NEB,Herts,U.K.),wereincludedin everyexperiment(Additionalfile1:TableS1).Statistical analysiswasperformedusingaone-wayANOVAcomparinggenecopynumbersatdifferenttimepointsin eachexperimenttotestthehypothesisthatthereisno variationingenecopynumberduringtherecoveryperiod.A post-hoc Dunnett stestwasemployed,usingthe samplecorrespondingtothelysogenculture(-60)asthe referencegroup,toassesswhetherornottimepoints differedfromthereference.P<0.05valueswereconsideredtobestatisticallysignificant.Proteinextractionfor2D-PAGECulturesofMC1061andMC1061( F 24B)wereincubated for6hat37C.Cellswereharvestedandpelletswashedin 1mlofwashsolution(10mMTris-HCl,pH8.0;1.5mM KH2PO4;68mMNaCl;9mMNaH2PO4).Cellswere resuspendedin1mlofresuspensionbuffer(10mMTrisHCl,pH8.0;1.5mMMgCl2;10mMKCl;0.5mMDTT; 0.1%SDS;20 lofproteaseinhibitor[RocheCompleteMiniEDTAFreeproteaseinhibitorcocktailtablets])and eachsamplewassonicatedfor510s.DNasewasadded (5 gml-1)andsampleswereincubatedfor1hat37C. Sampleswerecentrifugedfor1hat12,000g,thesupernatantrecoveredandproteinconcentrationdetermined usingtheBradfordAssay.Aliquots(110 gprotein)ofthe sampleweretakenandprecipitatedin10%TCAinacetonecontaining20mMDTTfor45minutesat-20C.Pelletswerewashedtwiceinether.2D-PAGEIsoelectricfocussingwascarriedouton18cmIPG strips(pH4-7,3-5.6and5.3-6.5;GEHealthcare),at3,500 Vfor7h.Proteinswereseparatedintheseconddimensionon1.5mm4%stacking/15%resolvingSDS-PAGE gels,for6.5hat20Wpergel(uptomaximumof180 W).Proteinsweresilverstained[50].In-geldigestionofproteinsamplesThiswascarriedoutaccordingtotheprotocoldescribed byCourchesne&Patterson[51]withthefollowing modifications:pr oteinspotswereexcisedfromthegel anddestainedwith50 lofdestainingsolution(30mM potassiumferricyanide,100mMsodiumthiosulphate) untilthesilverstaindisappeared;proteindigestionproceededin25mMammoniumcarbonate/trypsin(5ng l-1)at37Cfor16h.Matrix-assistedlaserdesorption/ionisation-time-of-flight (MALDI-TOF)massspectrometryTrypsin-digestedproteinsampleswereaddedtoan alpha-cyano4-hydroxycinnamicacidmatrix(LaserBioLabs,France)ataconcentrationof10mgml-1in50% ethanol:50%acetonitrile:0.1%TFA.SampleswereanalysedbyMALDI-TOFonanABIVoyagerDEPro (MALDI-TOF).ThemassspectrageneratedwereprocessedusingDataExplorertocleanthespectraandisolatemonoisotopicpeaks(allAppliedBiosystems).The MascotPeptideMassFingerprintDatabasewasusedto searchforhomologues.AdditionalmaterialAdditionalfile1:TableS1 .PCRamplificationprimersusedinthisstudy. Acompilationofalloftheamplificationprimersusedinthisstudyalong withamplificationefficiencyinformation. Additionalfile2:TableS2 .SignificanceofDunnett stestresultsfor geneexpressiondatainFigure3:ResultsoftheDunnett stestto determinesignificanceofgeneexpressionprofiledifferencesbeforeand afterprophageinduction. Acknowledgements ThisworkwasfundedbytheBiotechnologyandBiologicalResearchCouncil (BBSRC)oftheUnitedKingdomthroughaStrategicStudentshiptoHEAand aresearchgranttoHEAandAJM(BB/I013431/1).Theauthorswouldalsolike toacknowledgetheexperimentalsupportforthisworkprovidedbySteven HootonandDr.JamesE.McDonald. Authordetails1MicrobiologyResearchGroup,InstituteofIntegrativeBiology,Universityof Liverpool,BioSciencesBuilding,CrownStreet,LiverpoolL697ZB,UK.2PrograminMolecularStructure&Function,TheHospitalforSickChildren, 555UniversityAvenue,Toronto,ONM5G1X8,Canada.3Oragenics,13700 ProgressBlvd,Alachua,FL32615,USA. Authors contributions LMRcarriedouttheCMATanalysesanddeterminedthegrowthand samplingtimesforthelysogencultures.MV-Gcarriedoutthe2D-PAGE analyses,developedandperformedtheqRT-PCRassaysandproducedthe figures.MHpreparedallDNAsamplesforCMATlibraryproduction.JDHand MHdesignedCMATandwereinvolvedintechnicalcritiquingofthese experiments.AJMandHEAdesignedthestudyandwereinvolvedinthe interpretationofalldata.Allauthorswereinvolvedinthewritingand editingofthismanuscriptincludingthereadingandapprovalofthefinal version. Received:15November2011Accepted:22March2012 Published:22March2012 References1.EthelbergS,OlsenK,ScheutzF,JensenC,SchiellerupP,EnbergJ, PetersenA,OlesenB,Gerner-SmidtP,MlbakK: Virulencefactorsfor hemolyticuremicsyndrome,Denmark. EmergInfectDis 2004, 10 :842-847.Riley etal BMCMicrobiology 2012, 12 :42 http://www.biomedcentral.com/1471-2180/12/42 Page12of14

PAGE 13

2.GriffinP,OstroffS,TauxeR,GreeneK,WellsJ,LewisJ,BlakeP: Illnesses associatedwith Escherichiacoli O157:H7infections.Abroadclinical spectrum. AnnInternMed 1988, 109 :705-712. 3.KarmaliM,PetricM,LimC,FlemingP,SteeleB: Escherichiacoli cytotoxin, haemolytic-uraemicsyndrome,andhaemorrhagiccolitis. Lancet 1983, 2 :1299-1300. 4.KaperJ,NataroJ,MobleyH: Pathogenic Escherichiacoli NatRevMicrobiol 2004, 2 :123-140. 5.SuzukiM,KondoF,ItoY,MatsumotoM,HataM,OkaH,TakahashiM, SakaeK: IdentificationofaShiga-toxintypeIvariantcontainingan IS1203-likeelement,fromShiga-toxinproducing Escherichiacoli O157: H7. FEMSMicrobiolLett 2004, 234 :63-67. 6.ZhangW,BielaszewskaM,KucziusT,KarchH: Identification, characterization,anddistributionofaShigatoxin1genevariant(stx (1c))in Escherichiacoli strainsisolatedfromhumans. JClinMicrobiol 2002, 40 :1441-1446. 7.O LoughlinE,Robins-BrowneR: EffectofShigatoxinandShiga-liketoxins oneukaryoticcells. MicrobesInfect 2001, 3 :493-507. 8.O BrienA,LivelyT,ChangT,GorbachS: Purificationof Shigelladysenteriae 1(Shiga)-liketoxinfrom Escherichiacoli O157:H7strainassociatedwith haemorrhagiccolitis. Lancet 1983, 2 :573. 9.SmithH,GreenP,ParsellZ: Verocelltoxinsin Escherichiacoli andrelated bacteria:transferbyphageandconjugationandtoxicactionin laboratoryanimals,chickensandpigs. JGenMicrobiol 1983, 129 :3121-3137. 10.SmithHR,DayNP,ScotlandSM,GrossRJ,RoweB: Phage-determined productionofverocytotoxininstrainsof Escherichiacoli serogroup O157. Lancet 1984, 1 :1242-1243. 11.AllisonH: Stx-phages:driversandmediatorsoftheevolutionofSTEC andSTEC-likepathogens. FutureMicrobiol 2007, 2 :165-174. 12.HayashiT,MakinoK,OhnishiM,KurokawaK,IshiiK,YokoyamaK,HanCG, OhtsuboE,NakayamaK,MurataT, etal : Completegenomesequenceof enterohemorrhagic Escherichiacoli O157:H7andgenomiccomparison with alaboratorystrainK-12. DNARes 2001, 8 :11-22. 13.LosJM,LosM,WegrzynG: BacteriophagescarryingShigatoxingenes: genomicvariations,detectionandpotentialtreatmentofpathogenic bacteria. FutureMicrobiol 2011, 6 :909-924. 14.AllisonHE,SergeantMJ,JamesCE,SaundersJR,SmithDL,SharpRJ, MarksTS,McCarthyAJ: Immunityprofilesofwild-typeandrecombinant shiga-liketoxin-encodingbacteriophagesandcharacterizationofnovel doublelysogens. InfectImmun 2003, 71 :3409-3418. 15.MiyamotoH,NakaiW,YajimaN,FujibayashiA,HiguchiT,SatoK, MatsushiroA: SequenceanalysisofStx2-convertingphageVT2-Sashows agreatdivergenceinearlyregulationandreplicationregions. DNARes 1999, 6 :235-240. 16.PlunkettG,RoseDJ,DurfeeTJ,BlattnerFR: SequenceofShigatoxin2 phage933Wfrom Escherichiacoli O157:H7:Shigatoxinasaphagelategeneproduct. JBacteriol 1999, 181 :1767-1778. 17.HandfieldM,HillmanJ: Invivo inducedantigentechnology(IVIAT)and changemediatedantigentechnology(CMAT). InfectDisordDrugTargets 2006, 6 :327-334. 18.JamesCE,StanleyKN,AllisonHE,FlintHJ,StewartCS,SharpRJ,SaundersJR, McCarthyAJ: Lyticandlysogenicinfectionofdiverse Escherichiacoli and Shigellastrainswithaverocytotoxigenicbacteriophage. ApplEnviron Microbiol 2001, 67 :4335-4337. 19.LwoffA: Lysogeny. BacteriolRev 1953, 17 :269-337. 20.SatoT,ShimizuT,WataraiM,KobayashiM,KanoS,HamabataT,TakedaY, YamasakiS: DistinctivenessofthegenomicsequenceofShigatoxin2convertingphageisolatedfrom Escherichiacoli O157:H7Okayamastrain ascomparedtootherShigatoxin2-convertingphages. Gene 2003, 309 :35-48. 21.ArraianoCM,BamfordJ,BrussowH,CarpousisAJ,PelicicV,PflugerK, PolardP,VogelJ: Recentadvancesintheexpression,evolution,and dynamicsofprokaryoticgenomes. JBacteriol 2007, 189 :6093-6100. 22.BrussowH: Bacteriabetweenprotistsandphages:fromantipredation strategiestotheevolutionofpathogenicity. MolMicrobiol 2007, 65 :583-589. 23.BrussowH,CanchayaC,HardtWD: Phagesandtheevolutionofbacterial pathogens:fromgenomicrearrangementstolysogenicconversion. MicrobiolMolBiolRev 2004, 68 :560-602. 24.MavrodiDV,LoperJE,PaulsenIT,ThomashowLS: Mobilegeneticelements inthegenomeofthebeneficialrhizobacterium Pseudomonasfluorescens Pf-5. BMCMicrobiol 2009, 9 :8. 25.PerkinsTT,KingsleyRA,FookesMC,GardnerPP,JamesKD,YuL,AssefaSA, HeM,CroucherNJ,PickardDJ, etal : Astrand-specificRNA-Seqanalysisof thetranscriptomeofthetyphoidbacillus Salmonellatyphi PLoSGenet 2009, 5 :e1000569. 26.SuLK,LuCP,WangY,CaoDM,SunJH,YanYX: Lysogenicinfectionofa Shigatoxin2-convertingbacteriophagechangeshostgeneexpression, enhanceshostacidresistanceandmotility. MolBiol(Mosk) 2010, 44 :60-73. 27.WangX,KimY,MaQ,HongSH,PokusaevaK,SturinoJM,WoodTK: Cryptic prophageshelpbacteriacopewithadverseenvironments. NatCommun 2010, 1 :147. 28.LivnyJ,FriedmanD: CharacterizingspontaneousinductionofStx encodingphagesusingaselectablereportersystem. MolMicrobiol 2004, 51 :1691-1704. 29.LosJM,LosM,WegrzynG,WegrzynA: Differentialefficiencyofinduction ofvariouslambdoidprophagesresponsibleforproductionofShiga toxinsinresponsetodifferentinductionagents. MicrobPathog 2009, 47 :289-298. 30.SmithDL,JamesCE,SergeantMJ,YaxianY,SaundersJR,McCarthyAJ, AllisonHE: Short-tailedStxphagesexploittheconservedYaeTproteinto disseminateShigatoxingenesamongenterobacteria. JBacteriol 2007, 189 :7223-7233. 31.SmithDL,WareingBM,FoggPC,RileyLM,SpencerM,CoxMJ,SaundersJR, McCarthyAJ,AllisonHE: MultilocuscharacterizationschemeforShiga toxin-encodingbacteriophages. ApplEnvironMicrobiol 2007, 73 :8032-8040. 32.BarondessJJ,BeckwithJ: Abacterialvirulencedeterminantencodedby lysogeniccoliphagelambda. Nature 1990, 346 :871-874. 33.ReeveJN,ShawJE: Lambdaencodesanoutermembraneprotein:the lom gene. MolGenGenet 1979, 172 :243-248. 34.VicaPachecoS,GarciaGonzalezO,PaniaguaContrerasGL: The lom gene ofbacteriophagelambdaisinvolvedin Escherichiacoli K12adhesionto humanbuccalepithelialcells. FEMSMicrobiolLett 1997, 156 :129-132. 35.MurphyKC,RitchieJM,WaldorMK,Lobner-OlesenA,MarinusMG: Dam methyltransferaseisrequiredforstablelysogenyoftheShigatoxin (Stx2)-encodingbacteriophage933Wofenterohemorrhagic Escherichia coli O157:H7. JBacteriol 2008, 190 :438-441. 36.MollI,GrillS,GualerziCO,BlasiU: LeaderlessmRNAsinbacteria:surprises inribosomalrecruitmentandtranslationalcontrol. Mol Microbiol 2002, 43 :239-246. 37.OppenheimAB,KobilerO,StavansJ,CourtDL,AdhyaS: Switchesin bacteriophagelambdadevelopment. AnnRevGenet 2005, 39 :409-429. 38.LesicB,RahmeLG: UseofthelambdaRedrecombinasesystemto rapidlygeneratemutantsin Pseudomonasaeruginosa. BMCMolBiol 2008, 9 :20. 39.MosbergJA,LajoieMJ,ChurchGM: Lambdaredrecombineeringin Escherichiacoli occursthroughafullysingle-strandedintermediate. Genetics 2010, 186 :791-799. 40.MuniyappaK,RaddingCM: Thehomologousrecombinationsystemof phagelambda.Pairingactivitiesofbetaprotein. JBiolChem 1986, 261 :7472-7478. 41.FoggP,GossageS,SmithD,SaundersJ,McCarthyA,AllisonH: IdentificationofmultipleintegrationsitesforStx-phagePhi24Binthe Escherichiacoli genome,descriptionofanovelintegraseandevidence forafunctionalanti-repressor. Microbiology 2007, 153 :4098-4110. 42.FoggPC,RigdenDJ,SaundersJR,McCarthyAJ,AllisonHE: Characterization oftherelationshipbetweenintegrase,excisionaseandantirepressor activitiesassociatedwithasuperinfectingShigatoxinencoding bacteriophage. NucleicAcidsRes 2011, 39 :2116-2129. 43.JuhalaRJ,FordME,DudaRL,YoultonA,HatfullGF,HendrixRW: Genomic sequencesofbacteriophagesHK97andHK022:pervasivegenetic mosaicisminthelambdoidbacteriophages. JMolBiol 2000, 299 :27-51. 44.RaskoDA,WebsterDR,SahlJW,BashirA,BoisenN,ScheutzF,PaxinosEE, SebraR,ChinCS,IliopoulosD, etal : Originsofthe E.coli straincausingan outbreakofhemolytic-uremicsyndromeinGermany. NewEngJMed 2011, 365 :709-717. 45.MountDW: Amutantof Escherichiacoli showingconstitutiveexpression ofthelysogenicinductionanderror-proneDNArepairpathways. Proc NatlAcadSciUSA 1977, 74 :300-304.Riley etal BMCMicrobiology 2012, 12 :42 http://www.biomedcentral.com/1471-2180/12/42 Page13of14

PAGE 14

46.BradfordM: Arapidandsensitivemethodforthequantitationof microgramquantitiesofproteinutilizingtheprincipleofprotein-dye binding. AnalBiochem 1976, 72 :248-254. 47.HandfieldM,Progulske-FoxA,HillmanJ: Invivo inducedgenesinhuman diseases. Periodontol2000 2005, 38 :123-134. 48.HeroldS,SiebertJ,HuberA,SchmidtH: Globalexpressionofprophage genesin Escherichiacoli O157:H7strainEDL933inresponseto norfloxacin. AntimicrobAgentsChemother 2005, 49 :931-944. 49.SambrookJ,FritschEF,ManiatisT: Molecularcloning:alaboratorymanual. 2 edition.ColdSpringHarbor,N.Y:ColdSpringHarborLaboratory;1989. 50.YanJX,WaitR,BerkelmanT,HarryRA,WestbrookJA,WheelerCH,DunnMJ: Amodifiedsilverstainingprotocolforvisualizationofproteins compatiblewithmatrix-assistedlaserdesorption/ionizationand electrosprayionization-massspectrometry. Electrophoresis 2000, 21 :3666-3672. 51.CourchesnePL,LuethyR,PattersonSD: Comparisonofin-gelandonmembranedigestionmethodsatlowtosub-pmollevelforsubsequent peptideandfragment-ionmassanalysisusingmatrix-assistedlaserdesorption/ionizationmassspectrometry. Electrophoresis 1997, 18 :369-381.doi:10.1186/1471-2180-12-42 Citethisarticleas: Riley etal .: Identificationofgenesexpressedin culturesof E.coli lysogenscarryingtheShigatoxin-encodingprophage F 24B. BMCMicrobiology 2012 12 :42. Submit your next manuscript to BioMed Central and take full advantage of: Convenient online submission Thorough peer review No space constraints or color gure charges Immediate publication on acceptance Inclusion in PubMed, CAS, Scopus and Google Scholar Research which is freely available for redistribution Submit your manuscript at www.biomedcentral.com/submit Riley etal BMCMicrobiology 2012, 12 :42 http://www.biomedcentral.com/1471-2180/12/42 Page14of14

PAGE 15

Supplementary Table 1 PCR amplification p rimers used in this study Primer Sequence (5' 3') Dilution range in gene copy number R 2 Slope Proposed function Term qPCR F CGGTTTGTTCATTGCCTTCTCAACCG 5.08 x10 5 2540 0.990 3.22 Cleaves concatemeric phage DN A expressed during the lytic cycle Term qPCR R CCTAAATACAGCGCCAGAGTGC Q qPCR F GTAAAATCACGTCCACAGTGC 4.47 x10 5 1830 0.992 3.27 Antiterminator, expressed during the lytic cycle Q qPCR R AACACGTAATAATCAACCAGC Cro qPCR F AAAGGGCTGTCTATAAGTGG 7 .61x10 5 1520 0.992 3.07 Transcription repressor, expressed during the lytic cycle Cro qPCR R GCCACCAGAAATCTCTTCG Capsid qPCR F AGGTGCCTGCGAAGCTATTC 4.47 x10 5 1830 0.991 3.10 Structural gene, Antiterminator, expressed during the lytic cycle Cap sid qPCR R GCTCTCCTGGTCACGACG cI qPCR F GTGAGGGAACGGAGCTACAG 3.55 x10 6 1550 0.998 3.17 Transcription repressor necessary to establish lysogeny, expressed in the lysogen cI qPCR R GCGGCCTTATGCTTTCAATG 16s qPCR F CATCGAGGAACGGTACGAGA 6.35 x10 5 1270 0.995 3.66 Cell marker 16s qPCR R CGATCTCGGTAAAGTCGTCGAT GyrB qPCR F GTCGAAGTGGCGTTGCAGTG 7.12 x10 5 4060 0.996 3.12 Target of norfloxacin, used as induction marker GyrB qPCR R AGCCTGCCAGGTGAGTACCG P1 qPCR F CAGCGTTTGCATAAGCC 3.55x 10 5 1730 0.997 3.21 Phage gene of unknown function P1 qPCR R CGTGAAAAGGCAGAGAAAGC P2 qPCR F CGGATACCATGCGGACG 3.55 x10 5 1730 0.996 3.68 Putative RuvC resolvase

PAGE 16

P2 qPCR R CGTTTTGCCGTTCTTTTTGG TGG P3 qPCR F GCGGTGTGACTTCAATATTT C 5.51 x10 5 2360 0.990 3.50 Phage gene of unknown function P3 qPCR R GCTGCCATACGCGTTACTGA ATC P4 qPCR F GGATTCAGTAACATTCACGC CG 5.51 x10 5 2360 0.991 3.25 Putative lambda like exonuclease P4 qPCR R GCAAAACCCCGATCAGGAAA GAAG P5 qPCR F GCAGAGAG CGGTGAAGTTCAGC 4.47 x10 5 1830 0.998 3.28 Phage gene of unknown function P5 qPCR R CGTCTCCGTCACTTCCTGCAG P6 qPCR F GCAAAACGGCAAGAAAAACC ACC 5.51 x10 5 2360 0.998 3.36 Phage gene of unknown function P6 qPCR R GCCTATGGTACGCCTGC CM1 qPC R F GAAATCTCCTGATGGTGAGG 3.55 x10 5 1730 0.996 3.70 Tail spike protein CM1 qPCR R GATCCATCGTCATTCC CM2 qPCR F AAGGACTGCTGGCAAACG 5.85 x10 5 4560 0.990 3.25 Putative Dam methylase CM2 qPCR R GTCGGCCTCAGTTAGC CM5 qPCR F TTATCACCGTCACAATTTGC 7.12 x10 5 1620 0.997 3.45 Phage gene of unknown function CM5 qPCR R CTGCTTACACTGTAAGAACG CM7 qPCR F TATGGCCTATTCAGAGG 3.55 x10 5 1730 0.996 3.37 Phage gene of unknown function CM7 qPCR R AACGACGTACTGTTATCC CM18 qPCR F TGAAAGCAACAGCACG 3.55 x10 6 1550 0.990 3.16 Homologous to Lambda lom gene CM18 qPCR R CCAATGCCAGCAGTAACG

PAGE 17

Supplementary Table 2 Significance of results for gene expression data in Fig. 3. Time point p value cI Q Cro Ter Capsid GyrB 16s P1 P2 P3 P4 P5 P6 0 0.013 1.000 0.997 1.000 1.000 0.717 0.084 1.000 0.183 0.341 1.000 1.000 1.000 10 0 .999 1.000 0.996 1.000 1.000 0.753 1.000 0.960 0.879 0.272 0.645 1.000 1.000 20 0.002 0.999 0.994 1.000 1.000 1.000 0.772 0.999 0.171 0.185 0.485 1.000 1.000 30 0.097 0.085 0.076 0.999 0.999 0.230 0.285 0.241 0.163 0.193 0.065 0.904 0.972 40 0.007 0.097 0.003 0.805 0.995 1.000 0.138 0.475 0.163 0.204 0.437 0.125 1.000 50 0.012 0.006 0.007 0.002 0.007 0.998 0.121 0.035 0.170 0.201 0.945 0.001 0.270 60 0.003 0.789 0.796 0.293 0.890 0.731 0.080 0.998 0.179 0.184 0.922 1.000 1.000 Time point p value CM1 CM2 CM 5 CM 7 CM18 0 1.000 0.912 1.000 0.999 0.225 15 1.000 1.000 1.000 0.999 0.727 30 1.000 1.000 1.000 0.999 0.603 45 0.114 0.002 0.594 0.000 0.894 60 0.000 0.001 0.001 0.000 0.324


xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID EYERPWR9G_OJLZUB INGEST_TIME 2012-10-02T13:58:56Z PACKAGE AA00012385_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES


xml version 1.0 encoding utf-8 standalone no
mets ID sort-mets_mets OBJID sword-mets LABEL DSpace SWORD Item PROFILE METS SIP Profile xmlns http:www.loc.govMETS
xmlns:xlink http:www.w3.org1999xlink xmlns:xsi http:www.w3.org2001XMLSchema-instance
xsi:schemaLocation http:www.loc.govstandardsmetsmets.xsd
metsHdr CREATEDATE 2012-05-02T16:09:30
agent ROLE CUSTODIAN TYPE ORGANIZATION
name BioMed Central
dmdSec sword-mets-dmd-1 GROUPID sword-mets-dmd-1_group-1
mdWrap SWAP Metadata MDTYPE OTHER OTHERMDTYPE EPDCX MIMETYPE textxml
xmlData
epdcx:descriptionSet xmlns:epdcx http:purl.orgeprintepdcx2006-11-16 xmlns:MIOJAVI
http:purl.orgeprintepdcxxsd2006-11-16epdcx.xsd
epdcx:description epdcx:resourceId sword-mets-epdcx-1
epdcx:statement epdcx:propertyURI http:purl.orgdcelements1.1type epdcx:valueURI http:purl.orgeprintentityTypeScholarlyWork
http:purl.orgdcelements1.1title
epdcx:valueString Identification of genes expressed in cultures of E. coli lysogens carrying the Shiga toxin-encoding prophage Phi24B
http:purl.orgdctermsabstract
Abstract
Background
Shigatoxigenic E. coli are a global and emerging health concern. Shiga toxin, Stx, is encoded on the genome of temperate, lambdoid Stx phages. Genes essential for phage maintenance and replication are encoded on approximately 50% of the genome, while most of the remaining genes are of unknown function nor is it known if these annotated hypothetical genes are even expressed. It is hypothesized that many of the latter have been maintained due to positive selection pressure, and that some, expressed in the lysogen host, have a role in pathogenicity. This study used Change Mediated Antigen Technology (CMAT)™ and 2D-PAGE, in combination with RT-qPCR, to identify Stx phage genes that are expressed in E. coli during the lysogenic cycle.
Results
Lysogen cultures propagated for 5-6 hours produced a high cell density with a low proportion of spontaneous prophage induction events. The expression of 26 phage genes was detected in these cultures by differential 2D-PAGE of expressed proteins and CMAT. Detailed analyses of 10 of these genes revealed that three were unequivocally expressed in the lysogen, two expressed from a known lysogenic cycle promoter and one uncoupled from the phage regulatory network.
Conclusion
Propagation of a lysogen culture in which no cells at all are undergoing spontaneous lysis is impossible. To overcome this, RT-qPCR was used to determine gene expression profiles associated with the growth phase of lysogens. This enabled the definitive identification of three lambdoid Stx phage genes that are expressed in the lysogen and seven that are expressed during lysis. Conservation of these genes in this phage genome, and other Stx phages where they have been identified as present, indicates their importance in the phage/lysogen life cycle, with possible implications for the biology and pathogenicity of the bacterial host.
http:purl.orgdcelements1.1creator
Riley, Laura M
Veses-Garcia, Marta
Hillman, Jeffrey D
Handfield, Martin
McCarthy, Alan J
Allison, Heather E
http:purl.orgeprinttermsisExpressedAs epdcx:valueRef sword-mets-expr-1
http:purl.orgeprintentityTypeExpression
http:purl.orgdcelements1.1language epdcx:vesURI http:purl.orgdctermsRFC3066
en
http:purl.orgeprinttermsType
http:purl.orgeprinttypeJournalArticle
http:purl.orgdctermsavailable
epdcx:sesURI http:purl.orgdctermsW3CDTF 2012-03-22
http:purl.orgdcelements1.1publisher
BioMed Central Ltd
http:purl.orgeprinttermsstatus http:purl.orgeprinttermsStatus
http:purl.orgeprintstatusPeerReviewed
http:purl.orgeprinttermscopyrightHolder
Riley et al.; licensee BioMed Central Ltd.
http:purl.orgdctermslicense
http://creativecommons.org/licenses/by/2.0
http:purl.orgdctermsaccessRights http:purl.orgeprinttermsAccessRights
http:purl.orgeprintaccessRightsOpenAccess
http:purl.orgeprinttermsbibliographicCitation
BMC Microbiology. 2012 Mar 22;12(1):42
http:purl.orgdcelements1.1identifier
http:purl.orgdctermsURI http://dx.doi.org/10.1186/1471-2180-12-42
fileSec
fileGrp sword-mets-fgrp-1 USE CONTENT
file sword-mets-fgid-0 sword-mets-file-1
FLocat LOCTYPE URL xlink:href 1471-2180-12-42.xml
sword-mets-fgid-1 sword-mets-file-2 applicationpdf
1471-2180-12-42.pdf
sword-mets-fgid-3 sword-mets-file-3 applicationmsword
1471-2180-12-42-S2.DOC
sword-mets-fgid-4 sword-mets-file-4
1471-2180-12-42-S1.DOC
structMap sword-mets-struct-1 structure LOGICAL
div sword-mets-div-1 DMDID Object
sword-mets-div-2 File
fptr FILEID
sword-mets-div-3
sword-mets-div-4
sword-mets-div-5



PAGE 1

Supplementary Table 2 Significance of results for gene expression data in Fig. 3. Time point p value cI Q Cro Ter Capsid GyrB 16s P1 P2 P3 P4 P5 P6 0 0.013 1.000 0.997 1.000 1.000 0.717 0.084 1.000 0.183 0.341 1.000 1.000 1.000 10 0 .999 1.000 0.996 1.000 1.000 0.753 1.000 0.960 0.879 0.272 0.645 1.000 1.000 20 0.002 0.999 0.994 1.000 1.000 1.000 0.772 0.999 0.171 0.185 0.485 1.000 1.000 30 0.097 0.085 0.076 0.999 0.999 0.230 0.285 0.241 0.163 0.193 0.065 0.904 0.972 40 0.007 0.097 0.003 0.805 0.995 1.000 0.138 0.475 0.163 0.204 0.437 0.125 1.000 50 0.012 0.006 0.007 0.002 0.007 0.998 0.121 0.035 0.170 0.201 0.945 0.001 0.270 60 0.003 0.789 0.796 0.293 0.890 0.731 0.080 0.998 0.179 0.184 0.922 1.000 1.000 Time point p value CM1 CM2 CM 5 CM 7 CM18 0 1.000 0.912 1.000 0.999 0.225 15 1.000 1.000 1.000 0.999 0.727 30 1.000 1.000 1.000 0.999 0.603 45 0.114 0.002 0.594 0.000 0.894 60 0.000 0.001 0.001 0.000 0.324


!DOCTYPE art SYSTEM 'http:www.biomedcentral.comxmlarticle.dtd'
ui 1471-2180-12-42
ji 1471-2180
fm
dochead Research article
bibl
title p Identification of genes expressed in cultures of it E. coli lysogens carrying the Shiga toxin-encoding prophage Φ24sub B
aug
au id A1 ce yes snm Rileymi Mfnm Laurainsr iid I1 I2 email laura.riley@sickkids.ca
A2 Veses-GarciaMartamartavg@liv.ac.uk
A3 HillmanDJeffreyI3 jhillman44@gmail.com
A4 HandfieldMartinmhand@ufl.edu
A5 McCarthyJAlanaj55m@liv.ac.uk
A6 ca AllisonEHeatherhallison@liv.ac.uk
insg
ins Microbiology Research Group, Institute of Integrative Biology, University of Liverpool, BioSciences Building, Crown Street, Liverpool L69 7ZB, UK
Program in Molecular Structure & Function, The Hospital for Sick Children, 555 University Avenue, Toronto, ON M5G 1X8, Canada
Oragenics, 13700 Progress Blvd, Alachua, FL 32615, USA
source BMC Microbiology
issn 1471-2180
pubdate 2012
volume 12
issue 1
fpage 42
url http://www.biomedcentral.com/1471-2180/12/42
xrefbib pubidlist pubid idtype doi 10.1186/1471-2180-12-42pmpid 22439817
history rec date day 15month 11year 2011acc 2232012pub 2232012cpyrt 2012collab Riley et al; licensee BioMed Central Ltd.note This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
abs
sec st Abstract
Background
Shigatoxigenic E. coli are a global and emerging health concern. Shiga toxin, Stx, is encoded on the genome of temperate, lambdoid Stx phages. Genes essential for phage maintenance and replication are encoded on approximately 50% of the genome, while most of the remaining genes are of unknown function nor is it known if these annotated hypothetical genes are even expressed. It is hypothesized that many of the latter have been maintained due to positive selection pressure, and that some, expressed in the lysogen host, have a role in pathogenicity. This study used Change Mediated Antigen Technology (CMAT)™ and 2D-PAGE, in combination with RT-qPCR, to identify Stx phage genes that are expressed in E. coli during the lysogenic cycle.
Results
Lysogen cultures propagated for 5-6 hours produced a high cell density with a low proportion of spontaneous prophage induction events. The expression of 26 phage genes was detected in these cultures by differential 2D-PAGE of expressed proteins and CMAT. Detailed analyses of 10 of these genes revealed that three were unequivocally expressed in the lysogen, two expressed from a known lysogenic cycle promoter and one uncoupled from the phage regulatory network.
Conclusion
Propagation of a lysogen culture in which no cells at all are undergoing spontaneous lysis is impossible. To overcome this, RT-qPCR was used to determine gene expression profiles associated with the growth phase of lysogens. This enabled the definitive identification of three lambdoid Stx phage genes that are expressed in the lysogen and seven that are expressed during lysis. Conservation of these genes in this phage genome, and other Stx phages where they have been identified as present, indicates their importance in the phage/lysogen life cycle, with possible implications for the biology and pathogenicity of the bacterial host.
bdy
Background
Shigatoxigenic Escherichia coli (STEC) cause disease in humans following colonisation of the intestinal tract abbrgrp abbr bid B1 1. These infections are often serious, presenting with severe diarrhoea accompanied by haemorrhagic colitis. Downstream sequelae such as haemolytic uraemic syndrome (HUS) and thrombotic thrombocytopenic purpura (TTP) can be fatal B2 2B3 3.
The principle defining virulence determinant of all STEC strains is the production of Shiga toxin (Stx), also known as verocytotoxin (VT) or Shiga-like toxin (SLT) (1), of which there are two distinct forms, Stx1 and Stx2 B4 4. Two variants of Stx1 have been identified B5 5B6 6, whilst Stx2 is heterogeneous, with some variants more frequently associated with serious STEC outbreaks 1B7 7. The stx genes are carried by temperate lambdoid bacteriophages, which enter either the lytic or the lysogenic pathways upon infection of a bacterial cell B8 8B9 9B10 10. Any bacteriophage encoding Stx is termed an Stx phage, and there is much genotypic and phenotypic diversity within this loosely-defined group B11 11. Integrated Stx phages may exist in the bacterial chromosome as inducible prophages, or their residence within a host cell may facilitate recombination events leading to the loss of prophage sequences, resulting in uninducible, remnant Stx prophages within the lysogen chromosome B12 12. The stx genes are located with genes involved in the lytic cycle; hence Shiga toxin expression occurs when Stx phages are induced into this pathway 11B13 13.
Stx phages possess genomes that are generally ~50% larger than that of the first described lambdoid phage, λ itself, and ~74% of Stx phage genes have not been definitively assigned a function 11. Genes that are essential for the Stx phage lifestyle are carried on approximately 30 kb of DNA B14 14, whilst the entire genome is ca 60 kb in size in most cases 11B15 15B16 16. The impact of Stx prophage carriage on the pathogenicity profile or biology of the host, beyond conferring the ability to produce Shiga toxin, has remained largely unexplored and it can be suggested that the accessory genome of Stx phages is likely to encode functions for which there has been positive selection 11.
In this paper, we describe the use of proteomic-based protein profile comparisons and Change Mediated Antigen Technology™ (CMAT) (Oragenics Inc.) B17 17 to identify Stx phage genes that are expressed during the lysogenic pathway. An E. coli lysogen of Φ24B::Kan, in which a kanamycin-resistance cassette interrupts the stx2A gene B18 18 of a phage isolated from an E. coli O157:H7 disease outbreak strain, was subjected to both CMAT and two dimensional polyacrylamide gel electrophoresis (2D-PAGE) analyses of the expressed proteome. The Φ24B ::Kan genome is 57.6 kb in size and is identical in all aspects to its wild-type parental phage other than the stxA gene interruption 1418. The majority of genes and coding sequences (CDS) carried by Φ24B are simply annotated as hypothetical [GenBank: ext-link ext-link-id HM_208303 ext-link-type gen HM_208303]. Bacteriophages tightly regulate expression of their genes involved in maintenance of lysogeny versus replication of viral progeny, and the differentiation of gene expression associated with each state needed to be carefully determined in order to definitively associate expressed proteins and their genes with either the temperate or the lytic cycle.
Results
The rate of spontaneous lysis in an E. coli MC1061(Φ24B) culture at different stages of growth
Spontaneous induction, defined as the induction of prophages from lysogens in the absence of an applied stimulus B19 19, occurs constantly in a proportion of the lysogen population in any culture, and this could seriously interfere with the differentiation of gene expression between lytic and lysogenic states. In this study, it was necessary to determine culture conditions under which the number of spontaneous induction events was low whilst the cell density was high, enabling the consistent harvesting of sufficient amounts of cell-associated protein for downstream analyses. Lysogen cultures were sampled at hourly intervals beginning two hours post inoculation, and the c.f.u. mlsup -1 and p.f.u. ml-1 determined. The lowest ratio of infective phages to cells, 1:50, occurred at both 2 h and 3 h of lysogen growth. However the c.f.u. ml-1 during these times was relatively low; OD600 = 0.184 (± 0.003) and OD600 = 0.651 (± 0.008), respectively. The ratio of phage to host cells increased sharply after 4 h of growth, before dropping after 5 h to 1:33 (OD600 = 1.192 [± 0.011]). The ratio of phage to cells in the culture remained stable at 1:33 through to 6 hours of growth. Lysogen growth conditions were therefore standardised for MC1061 (Φ24B) at 5-6 hours when the cells were grown to an OD600 of 1.2-1.3.
Phage-encoded, lysogen-culture gene expression identified by CMAT
A total of 13,519 clones were subjected to CMAT primary screening, and taking efficiency of the library into account, this equates to a 3.3x coverage of the phage genome. Of these, 330 were identified by the lysogen-specific antiserum and chosen for further analyses and secondary screening. After two rounds of secondary screening, 250 clones were removed from the study and PCR analysis of the remaining 80 clones demonstrated that 46 possessed vector DNA only. The remaining 34 recombinant transformants produced a peptide recognised by antibodies in the lysogen specific antiserum. The cloned inserts were sequenced, and the DNA sequences translated in all six possible reading frames. Twenty-three of the clones possessed sequences from twenty different Φ24B CDS (Table tblr tid T1 1, Figure figr fid F1 1). The remaining eleven clones did not align with any Φ24B -encoded CDS, although six did possess non-coding regions of the phage genome. The other five clones contained plasmid DNA only.
tbl Table 1caption CDS identified by CMAT and location on the Φ24B genometblbdy cols 4
r
c center
b Clone
Alignment to Φ24B genome
Aligned CDS
Possible gene
cspan
hr
CM1
39370-39772
38090-40027
tspS
CM2 + CM14
17489-18104
17559-18086
dam
CM3
2523-2185
a: 2378-2286
b: 2507-2379
CM4
3025-2375
a: 2545-2375
b: 2812-2711
c: 2911-2840
CM5
54385-53866
53693-53866
CM6
53690-53235
53482-53297
CM7 + CM13
55160-55667
49148-57571
CM8
38754-39248
38460-38954
CM9
2542-2940
2248-2646
CM10
35049-34598
33695-34702
CM11 + CM12
39573-40016
40189-39355
CM15
40137-40506
40345-40626
CM16
38041-37623
38000-37698
CM17
52465-52147
52191-52514
CM18
45227-45877
44818-45552
lom
CM19
45610-46100
45981-46382
CM20
4098-3676
4333-4052
CM21
39305-39919
39405-39650
CM22
39875-40526
39909-40298
CM23
45713-46232
a: 45784-45921
b: 46072-46239
fig Figure 1Schematic representation of the Φ24B genometext
Schematic representation of the Φ24B genome. Squares symbolise the locations of the CMAT and PAGE CDS identified as well as some of the essential genes involved in the life cycle of the phage. represents 5 kb. For further details on the gene identities see Tables 1 & 2.
graphic file 1471-2180-12-42-1 hint_layout single
Phage-encoded, lysogen-culture gene expression identified by 2D-PAGE
Reproducible sets of gels from 2D-PAGE analyses were obtained through the utilisation of IPG strips in the pH ranges of 3.5-5.6 and 5.3-6.5. The optimal protein concentration loaded on the gels was found to be 200 μg of total cellular protein from crude cell lysates. A total of 42 protein spots were found only in the lysogen gel sets (data not shown); these were excised from the gels and analysed by MALDI-TOF. Twenty-four of these spots (Figure F2 2) contained enough protein for the generation of mass spectral data. When these spectra were searched against the University of Liverpool MASCOT database, which included all of the Φ24B genome predicted proteins, six samples matched predicted phage proteins (P1 to P6, Table T2 2, Figure 1). The remaining 20 spots were identified as E. coli proteins (Table 2); these are potentially lysogen specific but were not investigated further here.
Figure 22D-PAGE images of total cell protein from MC1061/Φ24B::Kan
2D-PAGE images of total cell protein from MC1061/Φ24B::Kan. IEF on pH range 4-7 (A, C), 5.3-6.5 (B) and 3-5.6 (D). Arrows represent proteins identified as phage encoded; circles represent proteins identified as encoded by E. coli, but not present on corresponding naïve MC1061 gels (data not shown).
1471-2180-12-42-2 double
Table 2Protein identities according to the MASCOT database10
P♯
Gene name
Access No.
pI/MW (Da)
Description
Sequencea Coverage (%)
MASCOTb Score
Peptidesc matches
Estimated pI/MW (Da)
MASCOT Database Identified in
1
P1
5.28/33860
Identical to hypothetical protein p78 from 933 Wd
32
63*
6
5.50/40000
1
2
P2
5.27/17096
Similar to hypothetical protein p23 from 933 W
42
39
5
5.00/15000
1
3
P3
5.09/13472
Similar to hypothetical protein p24 from 933 W
33
55
3
5.6/8000
1
4
P4
5.14/25800
Identical to exo of 933 W
29
52
5
5.5/40000
1
5
P5
5.29/7336
Not known homologue
83
41
2
7.00/7000
1
6
P6
5.22/13628
Identical to hypothetical protein Stx2Ip064e
38
30
4
7.00/10000
1
7
nanA2
Q6KD26 Q6KD26
5.77/34077
N-acetylneuraminate lyse 2
21
47
4
5.3/35000
2
8
gadB
CAQ31981 CAQ31981
5.29/52634
Glutamate decarboxylase beta
23
57
7
5.3/35000
2
9
sodB
P0AGD5 P0AGD5
5.58/21121
Superoxide dismutase [Fe]
40
53
6
4.00/100000
2
10
napA
AAC75266 AAC75266
8.23/92983
Nitrate reductase
14
49
7
5.5/100000
2
11
tig
AAA62791 AAA62791
4.73/47994
Trigger factor
24
58*
7
3.5/6000
2
12
UTI89_C3021
Q1R837 Q1R837
4.70/6971
Hypothetical protein
70
42
2
5.5/7000
2
13
2FPKA
ZP_04873224 ZP_04873224
5.24/32497
6-phosphofructokinase
23
46
5
5.3/50000
2
14
gcpE
S23058 S23058
5.87/40658
1-hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate synthase
16
38
4
5.5/80000
2
15
aceE
P0AFG9 P0AFG9
5.46/99475
Pyruvate dehydrogenase E1 component
10
60*
7
5.4/100000
2
16
bfpK
Q9S141 Q9S141
7.63/18294
BfpK
54
49
3
6.4/25000
2
17
ychN
P0AB53 P0AB53
5.02/12685
ychN
46
38
2
5.3/100000
2
18
UTI89_C1147
Q1RDD Q1RDD
5.57/24945
Hypothetical protein
15
38
4
5.7/30000
2
19
ompC
Q9RH85 Q9RH85
4.55/40474
Outer membrane protein
18
44
4
5.5/40000
2
20
ECs1247
G90784 G90784
4.74/25144
Hypothetical protein
26
39
5
6.5/35000
2
21
UTI89_C2748
Q1R8V6 Q1R8V6
10.19/10724
Hypothetical protein
44
50
4
6.4/8000
2
22
nirB
E86001 E86001
5.79/93112
Nitrate reductase (NAD(P)H) Subunit
10
53
8
5.3/100000
2
23
yagP
CAQ30761 CAQ30761
5.65/15401
yagP protein
36
43
3
5.3/10000
2
24
rhsF
Q47284 Q47284
5.69/23342
RhsF
18
42
4
5.69/8000
2
tblfn
Table represents matches to E. coli proteins in the MASCOT database and matches to Φ24B proteins in the University of Liverpool local MASCOT database
a percentage of sequence of the matched protein that is covered by the experimental MS.
b logarithm of the probability that the match between the experimental data and a protein sequence in the database is a random event.
c number of peptides that match the protein in the database
d 933 W is an Stx2 phage described by Plunkett et al. 16.
e Stx2 is an Stx2 phage described by Sato et al. B20 20.
*represents significant matches (p-value < 0.05)
1 University of Liverpool local MASCOT database; 2 general MASCOT database
Analyses of gene expression patterns
Generally, lambdoid phage regulatory circuits tightly control the expression of genes, yet some of the genes identified in the CMAT library and the 2D-PAGE analyses above were phage genes whose expression should be linked to prophage induction (Figure 1) and not the stable prophage state, e.g. the gene encoding the tail spike protein. It was assumed that gene expression normally linked to the lytic replication cycle must be at a very high level in a small subset of the cells and that lysogen-restricted gene expression patterns of these genes might be very low, especially as neither CMAT nor 2D-PAGE identified the expression of repressor, the product of the cI gene, in the lysogen culture. Therefore it was essential to devise a method that would determine whether phage genes were being expressed by the majority of the stable lysogen population, or the small subset of the population undergoing spontaneous induction events. A strategy involving qPCR was developed to provide this important information, and a variety of genes were chosen as controls for this study (Additional file supplr sid S1 1: Table S1, Figure 1). Calibration curves for quantitation and comparison of the qRT-PCR data were produced for every set of primers used; R2 values from linear regression analyses of these standards ranged from 0.990 to 0.999 with slopes ranging between -3.72 and -3.10 (Additional file 1: Table S1).
suppl
Additional file 1
Table S1. PCR amplification primers used in this study. A compilation of all of the amplification primers used in this study along with amplification efficiency information.
name 1471-2180-12-42-S1.DOC
Click here for file
The data from the qPCR assay were analysed by comparing the shape of the expression data for any given gene from a lysogen culture throughout the prophage induction process where time 0 is the point of norfloxacin (inducer) addition (Figure F3 3). Lysogen-restricted gene expression should be negatively affected after induction (Figure 3A, CI), and if expression is actually linked to the small proportion of cells undergoing spontaneous induction, then the expression levels should rise during the induction process. This is indeed the case as expected for Q, Cro, Capsid & Terminase, which display a significant increase after 50 min of recovery, Figure 3; Additional file S2 2: Table S2).
Figure 3Graph depicting gene expression profiles before and following norfloxacin induction
Graph depicting gene expression profiles before and following norfloxacin induction. Panel A: Control Genes. CI, marker gene for lysogeny-restricted expression; Cro and Q, marker genes for early induction response; Ter and Cap, marker genes for late gene expression; GyrB and 16S, marker genes for the cellular response. Panel B: Expression profiles of the prophage genes identified by CMAT. Panel C: Expression profiles of the genes identified by 2D-PAGE analyses of the lysogen. The Y axis represents gene copy number per 300 ng of RNA; the X axis represents time (min). Time -60 refers to the samples taken before induction and represents the lysogen population, Time 0 represents samples taken at the beginning of the recovery time, Time 10, 10 min after recovery, etc. The experiment was run using biological replicates, but due to the asynchronicity of induction across these experiments the data from a representative single biological replicate are shown.
1471-2180-12-42-3
Additional file 2
Table S2. Significance of Dunnett's test results for gene expression data in Figure 3: Results of the Dunnett's test to determine significance of gene expression profile differences before and after prophage induction.
1471-2180-12-42-S2.DOC
Click here for file
Four genes identified by 2D-PAGE, P1, P4, P5 and P6, visibly follow the same expression pattern as the genes expressed during the lytic cycle and accordingly the increase in gene copy number is significant (p-value < 0.05) after 50 or 60 min of recovery from exposure to norfloxacin (Figure 3; Additional file 2: Table S2). P3 and P2 appear to have a similar pattern to cI, i.e. their levels of expression in the lysogen are higher than the levels after induction; however the ANOVA analysis did not identify these differences as significant, probably due to the high variability amongst the replicates. Of the five CDS identified by CMAT, which were subsequently selected for expression analysis based upon either their putative function or location within the phage genome, four had expression patterns linked to the lytic cycle. CM18 was shown by qPCR to be strongly expressed in lysogen cultures, but when the cells are induced, high expression levels are maintained, suggesting that expression of this gene has been uncoupled from the phage regulatory circuits. The outcome of one-way ANOVA analysis to determine the impact of prophage induction on gene expression was found to be significant in 11 cases (p-value < 0.05): cI, cro, terminase, capsid, Q, CM1, CM2, CM5, CM7, P1 and P5. The other 7 genes studied did not present significant changes in expression: P2, P3, P4, P6, CM18, 16S, and gyraseB. The full set of p-values for the data in Figure 3 are presented in Additional file 2: Table S2.
Discussion
Temperate phages, maintained as prophages in their lysogens, have been the subject of speculation concerning their benefit to the host: selective advantage, increased virulence, and other traits with varying degrees of direct and/or indirect impact on the host have been identified 11B21 21B22 22B23 23B24 24B25 25B26 26B27 27. The challenge in this area has been how to identify phage-encoded genes that directly affect their lysogen, because many/most phage genes are annotated as encoding hypothetical proteins. In addition, there will always be a small background population undergoing spontaneous induction in the absence of discernible stimuli 19, potentially confounding the identification of lysogen-restricted prophage gene expression. In a specific E. coli lysogen of Stx2-phage 933W, a phage very closely related to Φ24B, the spontaneous induction rate was calculated as 0.014% B28 28, which means that in a lysogen culture fourteen cells per 100,000 are undergoing prophage induction. Other recent work was demonstrated that various induction agents and growth conditions differentially effects induction in a prophage-dependent manner B29 29. Assuming a burst size similar to that of bacteriophage Lambda (170 ± 10 virions cell-1) 27, a significant amount of phage structural protein production can occur in an uninduced lysogen culture.
In order to mitigate this effect, the growth phase at which the ratio of lysogens to free phage was high (two to three hours post inoculation) was targeted. However, the cell density at this point was very low and 5-6 hours was chosen as the standardised incubation time as a compromise. In this study, 26 genes from the bacteriophage Φ24B were identified by either CMAT or 2D-PAGE as being expressed in E. coli lysogen culture. No genes were identified by both CMAT and 2D-PAGE methods, perhaps due in part to the low absolute number of Φ24B genes identified by the latter approach. However, the level of redundancy in the genes identified by the CMAT clones was lower than expected, given the number of clones screened and the calculated phage genome coverage; however, putative positive clones were selected conservatively in an attempt to limit the number of false positives. Additionally, CMAT-based identification may also introduce bias into library screening due to differences in protein immunogenicity and antigenicity. It is important to note that the best characterised lysogen-restricted gene, cI (encoding lambdoid phage repressor), was not identified using either CMAT or 2D-PAGE, indicating that this study was not exhaustive. Nevertheless, the paucity of information on lysogen-restricted gene expression is such that these data represent a significant step forward in our understanding of phage/host interactions and lysogen biology.
Of the 26 phage genes identified in this study, Tsp, encoding the characterised tail spike protein of Φ24B B30 30B31 31 was a known structural protein and therefore not expected to be expressed by a stable lysogen (Tables 1 & T3 3), while the expression profiles of the other 25 proteins were unknown. Therefore the resulting challenge was to identify the fraction of the culture (lysogens or cells undergoing lysis) that were responsible for expression of these 26 phage genes as well as determining testable hypotheses to assign function to the identified gene products. Five genes identified during the CMAT screening were chosen for gene expression profiling due to their genome location, potential function or degree of conservation across a range of phages (Table 3). The CDS CM18 encodes a Lom orthologue, which was expected to be expressed in the lysogen as the lambda lom gene is associated with the alteration of the lysogen's pathogenic profile after location of Lom in the outer membrane B32 32B33 33B34 34. However, expression of lom in the Φ24B lysogen unexpectedly appears to be uncoupled from the phage regulatory pathways, because it is expressed at similar levels in an infected cell regardless of whether that cell exists as a stable lysogen or is undergoing prophage induction. The CDS CM2 encodes a putative Dam methyltransferase. Bacterial-encoded Dam methyltransferase has been shown to be essential for maintenance of lysogeny in E. coli infected with Stx-phage 933 W B35 35. The expression pattern of the Φ24B-encoded Dam methyltransferase could indicate that it is fulfilling a similar role, or supplementing the function of the host-encoded Dam methylase in lysogens infected with this phage. The functions of CM5 and CM7 are unknown. CM7 is an ORF of 8 kb, and as the amount of DNA that can be packaged by a phage is limited, such a large gene is likely to be conserved only if it confers an advantage to the phage or its lysogen; it may be significant that this large gene is associated with several other phages (Table 3). CM5 is a small CDS located on the complementary strand to the one encoding CM7, in a region with few other CDS, though it is directly upstream of another CMAT-identified CDS, CM6. The data (Figure 3) indicate that the expression of these 3 genes is linked to prophage induction, a surprising outcome as CM7 does not appear to be a phage structural gene, has been indicated by bioinformatic analyses (data not shown) to be a probable outer membrane protein, and is downstream of CM18, whose regulation is uncoupled from expression of the late genes.
Table 3Distribution of the proteins identified by CMAT and 2D-PAGE across phage genomes5
Gene
Other Stx phages carrying the proteins in the study (identity)
Accession number
Other phages
Accession number
CM1
Stx2 converting phage II (99%)
YP_003828920.1 YP_003828920.1
phage VT2-Sakai (99%)
NP_050557.1 NP_050557.1
phage 933 W (99%)
NP_049519.1 NP_049519.1
Stx1 converting phage (99%)
YP_003848832 YP_003848832
phage BP-933 W (99%)
YP_003848832.1 YP_003848832.1
phage VT2phi_272 (99%)
ADU03741.1 ADU03741.1
phage Min27(100%)
ADU03741 ADU03741
CM2
Stx2 converting phage II (100%)
BAC78116 BAC78116
phage VT2-Sakai (100%)
NP_050531.1 NP_050531.1
phage Min27 (100%)
YP_001648926 YP_001648926
phage HK97 (99%)
AAF31137 AAF31137
phage Lahn2 (99%)
CAJ26400 CAJ26400
phage Lahn3 (98%)
CAC95062.1 CAC95062.1
phage 2851 (99%)
CAQ82016 CAQ82016
phage CP-1639(99%)
CAC83142 CAC83142
prophage CP-933 V(99%)
AAG57233 AAG57233
Phage Nil2 (99%)(99%)
CAC95095 CAC95095
Stx1 converting phage (99%)
YP_003848889.1 YP_003848889.1
Phage CP-1639 (99%)
CAC83142.1 CAC83142.1
Phage YYZ-2088 (99%)
YP_002274170.1 YP_002274170.1
Stx2-converting phage 1717 (99%)
YP_002274244.1 YP_002274244.1
CM5
phage Min27 (100%)
YP_001648966.1 YP_001648966.1
Stx2 converting phage II(100%)
YP_00388933.1 YP_00388933.1
Stx2 converting phage I(100%)
NP_612929.1 NP_612929.1
phage VT2-Sakai (100%)
NP_050570.1 NP_050570.1
phage 933 W (100%)
NP_049532.1 NP_049532.1
phage VT2phi_272 (100%)
ADU03756 ADU03756
CM7
phage VT2-Sakai (99%)
NP_050570 NP_050570
Stx1 converting phage (99%)
BAC77866.1 BAC77866.1
Phage VT2phi_272 (97%)
ADU03756.1 ADU03756.1
Phage 933 W (97%)
NP_049532.1
Stx2 converting phage I (97%)
NP_612929.1
Stx2 converting phage II(97%)
BAC78032.1 BAC78032.1
Phage BP-933 W (97%)
AAG55616.1 AAG55616.1
Stx2 converting phage 86 (91%)
YP_794082.1 YP_794082.1
Phage Min27 (97%)
YP_001648966.1
CM18
phage VT2-Sakai (100%)
NP_050564.1 NP_050564.1
Stx1 converting phage (100%)
YP_003848839.1 YP_003848839.1
Phage 933 W (100%)
NP_049526.1 NP_049526.1
Stx2 converting phage I (100%)
ZP_02785836.1 ZP_02785836.1
Stx2 converting phage II (100%)
YP_003828926.1 YP_003828926.1
Phage BP-933 W (100%)
NP_286999.1 NP_286999.1
Stx2 converting phage 86 (97%)
YP_794076.1 YP_794076.1
Phage Min27 (100%)
YP_001648959.1 YP_001648959.1
P1
Stx2 converting phage II (99%)
YP_003828937.1 YP_003828937.1
Phage phiV10 (78%)
YP_512303.1 YP_512303.1
Stx2 converting phage I (99%)
NP_612952.1 NP_612952.1
Phage 933 W (99%)
NP_049538.1 NP_049538.1
Phage BP-933 W (99%)
AAG55619.1 AAG55619.1
phage VT2-Sakai (99%)
NP_050575.1 NP_050575.1
Phage Min27 (96%)
YP_001648901.1 YP_001648901.1
Stx2-converting phage 86 (96%)
YP_794094.1 YP_794094.1
Phage BP-4795 (96%)
YP_001449244.1 YP_001449244.1
phage CP-1639 (74%)
CAC83133.1 CAC83133.1
P2
Stx2 converting phage I (100%)
NP_612997.1 NP_612997.1
Salmonella enteric
YP_002455860.1 YP_002455860.1
Phage 933 W (100%)
NP_049484.1 NP_049484.1
bacteriophage SE1 (86%)
Phage BP-933 W (100%)
AAG55573.1 AAG55573.1
Salmonella phage ST160 (86%)
YP_004123782.1 YP_004123782.1
Phage Min27 (100%)
ABY49878.1 ABY49878.1
Stx2-converting phage 86 (100%)
YP_794109.1 YP_794109.1
P3
Stx2 converting phage I (100%)
NP_612995.1 NP_612995.1
Phage 933 W (100%)
NP_049483.1 NP_049483.1
Stx2-converting phage 86 (100%)
YP_794108.1 YP_794108.1
Phage Min27 (100%)
YP_001648915.1 YP_001648915.1
Phage BP-933 W (100%)
AAG55572.1 AAG55572.1
P4
Phage 933 W (100%)
NP_049473.1 NP_049473.1
Phage lambda (98%)
NP_040616.1 NP_040616.1
Phage BP-933 W (100%)
NP_286952.1 NP_286952.1
Prophage CP-933 V (100%)
NP_288695.1 NP_288695.1
Stx2 converting phage I (100%)
NP_612980.1 NP_612980.1
Phage VT1-Sakai (100%)
BAB19617.1 BAB19617.1
Phage YYZ-2008 (99%)
YP_002274150.1 YP_002274150.1
Stx2-converting phage 1717 (98%)
YP_002274221.1 YP_002274221.1
prophage CP-933 K (98%)
YP_003500773.1 YP_003500773.1
phage BP-4795 (98%)
YP_001449249.1 YP_001449249.1
phage Min27 (99%)
YP_001648905.1 YP_001648905.1
P5
Stx2 converting phage I (100%)
NP_613032.1 NP_613032.1
Phage 933 W (100%)
NP_049503.1 NP_049503.1
Stx2 converting phage II (100%)
BAC78139.1 BAC78139.1
Stx2-converting phage 1717 (98%)
YP_002274255.1 YP_002274255.1
phage 2851 (98%)
CAE53952.1 CAE53952.1
Phage BP-4795 (97%)
YP_0014419282.1 YP_0014419282.1
P6
Stx2 converting phage I (99%)
NP_612943.1 NP_612943.1
Stx2 converting phage II (99%)
BAC78046.1 BAC78046.1
phage VT2phi_272 (99%)
ADU03756.1
phage Min27 (99%)
YP_001648966.1
phage VT2-Sakai (99%)
NP_050570.1
Stx1 converting phage (99%)
BAC77866.1
Stx2-converting phage 86 (96%)
BAF34067.1 BAF34067.1
The qPCR expression profile for the phage genes identified as being expressed in the lysogen by 2D-PAGE, P1, P2, P3, P4, P5 and P6, indicated that only the expression of P2 and P3 were restricted to lysogen cultures with a stable prophage. The genes for both P2 and P3 lie downstream of the cI gene. However, their expression levels are one and five orders of magnitude greater, respectively, than the expression levels of cI, the lambdoid phage repressor gene. It is known that in Lambda phage, the cI gene transcript is leaderless, possessing no ribosome binding site for initiation of translation, with transcription and translation beginning at the AUG start codon B36 36. If this causes the 5' end of the transcript to be less stable and more easily subject to degradation, the higher level of P3 transcript could simply be due to possession of a longer half life than those genes at the 5' end of the transcript.
The genes encoding P2 and P3 are conserved in many other phages (Table 3). They have no bioinformatically identifiable promoters of their own, so are likely to be driven by pRM or pRE like cI (see B37 37 for a cogent review of the related lambda phage), but differences in the levels of transcription between these 3 genes implies that there is still more to discover about the right operator region of this phage. The proteins P1, P4, P5 and P6 all exhibit gene expression profiles that suggest they are expressed following prophage induction. These genes are scattered across the phage genome (Figure 1) and are shared by various phages (Table 3). The protein P4 appears to be part of the lambda Red recombinase system B38 38B39 39B40 40 and the data presented here suggest that this is most active upon prophage induction. This could be relevant to the mechanisms that underpin diversification, evolution and production of new phages by lysogens carrying an inducible prophage along with one or more inducible or remnant prophages 11B41 41B42 42. The proteins P1, P5 and P6 are scattered across the genome on the strand typically associated with expression of genes linked to lysogenic infection (e.g. cIII, N, cI). Two genes encoding proteins P1, P5 and P6 are found in other phages, but have no known function.
In summary, genome sequencing of prophages and bacteriophages has identified that these viral elements encode higher numbers of hypothetical genes than those to which we can currently assign a function. These genes are often conserved across many bacteriophages, but do not appear to encode structural proteins. For these genes to remain present in the phage genome, especially considering the fluidity of the genetic composition of lambdoid phages B43 43, they must surely provide an important function in either the phage life cycle or that of the lysogen itself. In attempting to identify prophage genes whose expression was restricted to the stable prophage state, our goal was to identify prophage genes that were candidates for influencing the fitness of the bacterial host. However, the study was hampered by the fact that lysogen-restricted gene expression can be at very low levels, and phage genes associated with phage replication are expressed at very high levels.
Conclusions
Two different experimental strategies were employed to identify prophage genes expressed by their lysogen, and it is interesting to note that lysogen-specific antibody recognition of a peptide expression library and differential 2D-PAGE with subsequent protein identification by peptide mass spectrometry, did not identify the same genes or proteins. The failure of both to identify expression of the cI gene encoding the phage repressor was shown by RT-qPCR to be due to the very low expression levels peculiar to this phage gene (Figure 4); the CI protein is also very susceptible to autocatalysis and therefore elusive. Both CMAT and 2D PAGE identified some phage genes that were associated with lytic induction, and the qPCR strategy was useful for discriminating low level expression in stable lysogens from high-level gene expression in the minority of lysogens that were undergoing spontaneous induction. Improving our understanding of the STEC disease process is ever more urgent in light of the recent emergence of a new Shiga-toxin producing E. coli pathotype B44 44, and determining the function and expression patterns of the genes in Stx phage genomes is very important in that context.
Methods
Bacterial strains and culture
The E. coli K-12 strain, MC1061, was used as the bacterial host for the production of lysogens. MC1061(Φ24B) refers to the Φ24B lysogen of MC1061; naïve MC1061 refers to cells that have not been infected by Φ24B. E. coli K-12 strain DM1187 was used as the indicator host strain in plaque assay experiments 18. BL21-AI cells (Invitrogen, Paisley, U.K.) were used as the expression host for genetic constructs. Bacterial strains, plasmids and phages used in this study are listed in Table T4 4.
Table 4Bacterial strains, plasmid and phages used in the study3
E.coli strains, plasmids and phages
Relevant Genotype
Reference
BL21-AI
F- ompT hsdSB(rB-, mB-) gal dcm (DE3), arabinose inducible T7 RNA polymerase
Invitrogen, Paisley, U.K.
MC1061
F- Δ(ara-leu)7697 Δ(codB-lacI)3 galK16 λ- mcrA0 rpsL150(strR) mcrB1
18
DM1187
F- dam-13::Tn9(CmR) dcm- mcrB hsdR-M + gal1 ara- lac- thr- leu- tsxR
B45 45
TOP10
F- mcrA Φ80lacZΔM15 recA+
Invitrogen, Paisley, U.K.
pCR®-Blunt
lacZ α, KanR, ccdB
Invitrogen, Paisley, U.K.
pET30c
Expression vector with T7 promoter, KanR, TetR,
Novagen, Notts, UK
Φ24B
Stx2-phage, ΔstxA2::aph3
14
All cultures, unless otherwise stated, were propagated from an overnight (~16 h) starter culture (0.5% v/v inoculum) in Luria Bertani (LB) broth (Merck KGaA, Darmstadt, Germany) containing 0.01 M CaCl2, incubated at 37°C with shaking at 200 r.p.m. Lysogen cultures were grown in the presence of kanamycin (Kan, 50 μg ml-1). Induction of protein expression in BL21-AI cells took place in BHI broth with 0.2% arabinose and 1 mM IPTG.
Induction of phage lysogens
Cultures of MC1061(Φ24B) cells were incubated with norfloxacin (1 μg mL-1) for 1 h at 37°C with shaking at 200 r.p.m. Cultures were then diluted 1:10 in fresh LB and the bacteria allowed to recover from the growth inhibitory effects of the antibiotic for 1 h at 37°C (the recovery period), with shaking at 200 r.p.m.
Antisera production for use in CMAT
A 2 L culture of MC1061(Φ24B) was propagated for 6 hours. The cells were pelleted and resuspended in 1 ml of retained supernatant plus 1 ml of LB broth. Protease inhibitors (20 μL) (Roche Complete Mini EDTA Free protease inhibitor cocktail tablets, Bath, U.K.) and 10 μL of lysis buffer (7 M urea, 2 M thiourea, 2% CHAPS, 1% DTT, Roche Complete Mini EDTA-free protease inhibitor cocktail tablets) were added to each. The samples were sonicated at 15-18 μ for 6 × 10 s bursts. Absolute methanol (1.5 ml) was added, and the samples were incubated at -20°C for 60 min. Protein was harvested by centrifugation at 16,000 g for 5 min, and the resultant protein pellets were air-dried and suspended in 0.5 ml phosphate buffered saline (PBS). The samples were pooled; the protein content was measured by Bradford Assay B46 46 and adjusted to 1 mg ml-1. A total of 4 mg of the lysogen protein was sent to Eurogentec (Seraing, Belgium) for antisera production in rabbits, using the Ribi adjuvant system. Two rabbits were immunised with the protein sample on days 0, 14, 28 and 56 of the program. Bleeds were carried out on days 0 (pre-immune sera), 38, 66 and 87 (final bleed). Pre-immune sera from the two rabbits used were received and tested for cross-reactivity by western blot analysis.
CMAT was carried out as per instructions from the license holder, Oragenics Inc., FL., U.S.A. 17B47 47, with the exception that BL21-AI was used as the expression strain for the phage library. The recommended expression host, BL21[DE3], is an E. coli-λ lysogen, and therefore an inappropriate strain to use in phage protein expression studies B48 48. The expression library was created from Φ24B::Kan DNA. The rabbit antisera were depleted of antibodies reactive to E. coli proteins by a series of adsorptions to naïve MC1061 whole cells and cellular lysate, and to BL21-AI + pET30c (empty vector) whole cells and cellular lysate. The depleted antisera were compared to undepleted antisera by western blot. Adsorptions were repeated until no bands were detectable by western blot probing of 6 μg of naïve MC1061 proteins.
Peptide expression library construction
Semi-confluent plaque assay plates 18 were overlaid with 3 ml SM buffer (100 mM NaCl, 8 mM MgSO4, 50 mM Tris-HCl, pH 7.5) and incubated at 4°C for 16 h, with gentle agitation. The SM buffer and top agar were transferred to separate 50 ml centrifuge tubes that were vortexed with 10% (v/v) fresh SM buffer and subjected to centrifugation at 10,000 g for 10 min. The supernatant was pooled and 30 μl of chloroform were added to each 10 ml of buffer. DNase (5 μg ml-1) and RNase (1 mg ml-1) were added, and the samples were incubated at 37°C for 1 h. PEG 8000 (33% [w/v]) was added, and the samples were incubated on ice for 30 min. Precipitated phage particles were harvested by centrifugation for 10 min at 10,000 g, and the pellets were resuspended in 500 μl SM buffer per 30 ml starting volume. Samples were treated with DNase and RNase, as before. Phage DNA was purified by phenol:chloroform:isoamyl alcohol extraction and isopropanol precipitation B49 49 and resuspended in 100 μl ddH2O. The Φ24B DNA (15 μg ml-1 in TE) was fragmented using a HydroShear (GeneMachines, MI, USA), at speed code 6 for 30 cycles, followed by 30 cycles at speed code 2. DNA of the required size range (300-900 bp) was isolated by gel purification. pET30c plasmid (EMD Biosciences) DNA was digested with EcoR V and dephosphorylated with calf intestinal phosphatase (New England Biolabs) according to the manufacturer's recommendations. The size fractionated Φ24B DNA fragments were cloned into the prepared pET30c DNA (50 ng) vector in a molar ratio of 25:1 (insert to vector). Chemically competent BL21-AI expression host cells (Invitrogen) were transformed with the plasmid DNA according to the manufacturer's recommendations.
Primary screening
Transformed BL21-AI cells were plated onto LBKan plates and incubated at 37°C (11 h). Nitrocellulose membrane (0.2 μm pore size, BioTraceTM) was laid onto the top of each plate for approximately 1 min. The membranes were transferred colony-side up to LBKan agar plates supplemented with arabinose (0.2%) and IPTG (1 mM), and incubated at 37°C for 3 h. The master plates were incubated for a further 3 5 h at 37°C, until the colonies reached a diameter of 1-2 mm. The membranes were lifted from the agar plates and placed on chloroform-saturated filter paper, colony-side down, for 1 min, after which the chloroform was allowed to evaporate completely. The membranes were then gently agitated in blocking solution (PBS plus 0.5% Tween 20 and 5% skimmed milk powder) for 1 h at ambient temperature, washed in PBST (PBS plus 0.5% Tween 20; 4 × 10 min) with gentle agitation and probed with the primary antibodies (depleted antisera) in 10 ml PBST (1:1,250) for 16 h at 4°C with gentle agitation. The membranes were then washed four times in PBST and agitated for 1.5 h in secondary antibody solution (HRP conjugated to goat anti-rabbit IgG [Sigma]) (1:30,000). The membranes were washed four times in PBST, rinsed twice in PBS and washed for 10 min in PBS, under gentle agitation. Enhanced chemiluminescent (ECL) reagent was used to develop the membranes and the chemiluminescence was visualised by exposure of Roche Lumi-Film Chemiluminescent Detection Film to the membranes. Putative positive clones were identified on the master plates and each one was transferred to fresh LBKan agar.
PCR verification of insert
For verification of the presence of cloned DNA, putative positive colonies were used as the template source for a colony PCR and the T7 promoter and T7 terminator primers (Novagen, Notts, U.K.). Thermal cycling conditions using Taq polymerase comprised an initial denaturation of 5 min at 94°C, 35 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s kb-1 product, followed by a final extension at 72°C for 7 min.
Secondary screening
Putative positive colonies were cultured overnight in BHI Kan (1 ml), at 37°C, without shaking. The cells were harvested by centrifugation at 16,000 g. The supernatant was decanted and the cells resuspended in 20 l BHI Kan. Each suspension was spotted in triplicate (1 μl) onto duplicate nitrocellulose membranes and placed on a BHI Kan agar plate. The plates and membranes were incubated for 3 h at 37°C, the membranes removed and one of the duplicate membranes overlaid onto a LB Kan agar plate supplemented with 0.2% arabinose and 1 mM IPTG while the other membrane was placed onto a LB Kan agar plate. These were incubated for 3 h at 37°C. The membranes were removed from the plates, and placed on chloroform- saturated filter paper for 1 min. Once dry, 1 μl of the lysogen-specific antiserum was spotted onto the bottom of the membrane, as a positive control. Antibody reactivity was determined as described above for primary screening.
DNA sequencing
Plasmid DNA was sequenced by GATC Biotech (Konstanz, Germany), using the T7 promoter and terminator primers. Sequences were translated using ExPASY's Translate tool http://www.expasy.ch/tools/#proteome. The sequences were aligned to the annotated Φ24B genome [GenBank:HM_208303] and CDS in-frame with the expression vector were documented.
qPCR
Induction of MC1061(Φ24B) cultures was performed as described above. A 1 ml sample was taken before addition of norfloxacin to the cultures, and further 1 ml aliquots removed at 10-15 min intervals throughout the 60 min recovery time. RNA was immediately extracted and DNAse treated with TURBO™ DNAse (Ambion, TX, USA) according to the manufacturer's instructions. Absence of DNA was verified by qPCR. Each RNA sample (300 ng) was reverse transcribed using random hexamer oligonucleotides (Bioline, London, UK). Specific primers were designed to amplify an approximately 100 bp region of each gene in the study (Additional file 1: Table S1). qPCR was performed using a StepOnePlus™ Real-Time PCR System (Applied Biosystems); each reaction consisted of 1 μl of cDNA, 1 x SensiMixPlus SYBR (Quantace, London, U.K.), 200 nM of specific primers in a 25 μl reaction. The amplification cycling conditions were: initial denaturation at 95°C for 10 min; 39 cycles of denaturation at 95°C for 10 s; annealing at 60°C for 30 s; extension at 72°C for 5 s. A melting curve analysis was performed for each amplification reaction, with a temperature gradient of 0.1°C from 55°C to 95°C. No-template controls and a calibration curve, consisting of 6 dilutions of the PCR amplicon of each gene cloned into PCR-Blunt vector (Invitrogen, Paisley, U.K.) linearised with Nco I (NEB, Herts, U.K.), were included in every experiment (Additional file 1: Table S1). Statistical analysis was performed using a one-way ANOVA comparing gene copy numbers at different time points in each experiment to test the hypothesis that there is no variation in gene copy number during the recovery period. A post-hoc Dunnett's test was employed, using the sample corresponding to the lysogen culture (-60) as the reference group, to assess whether or not time points differed from the reference. P < 0.05 values were considered to be statistically significant.
Protein extraction for 2D-PAGE
Cultures of MC1061 and MC1061(Φ24B) were incubated for 6 h at 37°C. Cells were harvested and pellets washed in 1 ml of wash solution (10 mM Tris-HCl, pH 8.0; 1.5 mM KH2PO4; 68 mM NaCl; 9 mM NaH2PO4). Cells were resuspended in 1 ml of resuspension buffer (10 mM Tris-HCl, pH 8.0; 1.5 mM MgCl2; 10 mM KCl; 0.5 mM DTT; 0.1% SDS; 20 μl of protease inhibitor [Roche CompleteMini EDTA Free protease inhibitor cocktail tablets]) and each sample was sonicated for 5 × 10 s. DNase was added (5 μg ml-1) and samples were incubated for 1 h at 37°C. Samples were centrifuged for 1 h at 12,000 g, the supernatant recovered and protein concentration determined using the Bradford Assay. Aliquots (110 μg protein) of the sample were taken and precipitated in 10% TCA in acetone containing 20 mM DTT for 45 minutes at -20°C. Pellets were washed twice in ether.
2D-PAGE
Isoelectric focussing was carried out on 18 cm IPG strips (pH 4-7,3-5.6 and 5.3-6.5;GE Healthcare), at 3,500 V for 7 h. Proteins were separated in the second dimension on 1.5 mm 4% stacking/15% resolving SDS-PAGE gels, for 6.5 h at 20 W per gel (up to maximum of 180 W). Proteins were silver stained B50 50.
In-gel digestion of protein samples
This was carried out according to the protocol described by Courchesne & Patterson B51 51 with the following modifications: protein spots were excised from the gel and destained with 50 μl of destaining solution (30 mM potassium ferricyanide, 100 mM sodium thiosulphate) until the silver stain disappeared; protein digestion proceeded in 25 mM ammonium carbonate/trypsin (5 ng μl-1) at 37°C for 16 h.
Matrix-assisted laser desorption/ionisation-time-of-flight (MALDI-TOF) mass spectrometry
Trypsin-digested protein samples were added to an alpha-cyano 4-hydroxycinnamic acid matrix (LaserBioLabs, France) at a concentration of 10 mg ml-1 in 50% ethanol: 50% acetonitrile: 0.1% TFA. Samples were analysed by MALDI-TOF on an ABI Voyager DE Pro (MALDI-TOF). The mass spectra generated were processed using Data Explorer to clean the spectra and isolate monoisotopic peaks (all Applied Biosystems). The Mascot Peptide Mass Fingerprint Database was used to search for homologues.
Authors' contributions
LMR carried out the CMAT analyses and determined the growth and sampling times for the lysogen cultures. MV-G carried out the 2D-PAGE analyses, developed and performed the qRT-PCR assays and produced the figures. MH prepared all DNA samples for CMAT library production. JDH and MH designed CMAT and were involved in technical critiquing of these experiments. AJM and HEA designed the study and were involved in the interpretation of all data. All authors were involved in the writing and editing of this manuscript including the reading and approval of the final version.
bm
ack
Acknowledgements
This work was funded by the Biotechnology and Biological Research Council (BBSRC) of the United Kingdom through a Strategic Studentship to HEA and a research grant to HEA and AJM (BB/I013431/1). The authors would also like to acknowledge the experimental support for this work provided by Steven Hooton and Dr. James E. McDonald.
refgrp Virulence factors for hemolytic uremic syndrome, DenmarkEthelbergSOlsenKScheutzFJensenCSchiellerupPEnbergJPetersenAOlesenBGerner-SmidtPMølbakKEmerg Infect Dis200410842lpage 847pmcid 3323205link fulltext 15200817Illnesses associated with Escherichia coli O157:H7 infections. A broad clinical spectrumGriffinPOstroffSTauxeRGreeneKWellsJLewisJBlakePAnn Intern Med19881097057123056169Escherichia coli cytotoxin, haemolytic-uraemic syndrome, and haemorrhagic colitisKarmaliMPetricMLimCFlemingPSteeleBLancet19832129913006139632Pathogenic Escherichia coliKaperJNataroJMobleyHNat Rev Microbiol2004212314010.1038/nrmicro81815040260Identification of a Shiga-toxin type I variant containing an IS1203-like element, from Shiga-toxin producing Escherichia coli O157:H7SuzukiMKondoFItoYMatsumotoMHataMOkaHTakahashiMSakaeKFEMS Microbiol Lett2004234636710.1111/j.1574-6968.2004.tb09513.x15109720Identification, characterization, and distribution of a Shiga toxin 1 gene variant (stx(1c)) in Escherichia coli strains isolated from humansZhangWBielaszewskaMKucziusTKarchHJ Clin Microbiol2002401441144610.1128/JCM.40.4.1441-1446.200214039011923370Effect of Shiga toxin and Shiga-like toxins on eukaryotic cellsO'LoughlinERobins-BrowneRMicrobes Infect2001349350710.1016/S1286-4579(01)01405-811377211Purification of Shigella dysenteriae 1 (Shiga)-like toxin from Escherichia coli O157:H7 strain associated with haemorrhagic colitisO'BrienALivelyTChangTGorbachSLancet198325736136724Vero cell toxins in Escherichia coli and related bacteria: transfer by phage and conjugation and toxic action in laboratory animals, chickens and pigsSmithHGreenPParsellZJ Gen Microbiol1983129312131376418852Phage-determined production of vero cytotoxin in strains of Escherichia coli serogroup O157SmithHRDayNPScotlandSMGrossRJRoweBLancet19841124212436144957Stx-phages: drivers and mediators of the evolution of STEC and STEC-like pathogensAllisonHFuture Microbiol2007216517410.2217/17460913.2.2.16517661653Complete genome sequence of enterohemorrhagic Escherichia coli O157:H7 and genomic comparison with a laboratory strain K-12HayashiTMakinoKOhnishiMKurokawaKIshiiKYokoyamaKHanCGOhtsuboENakayamaKMurataTetal DNA Res20018112210.1093/dnares/8.1.1111258796Bacteriophages carrying Shiga toxin genes: genomic variations, detection and potential treatment of pathogenic bacteriaLosJMLosMWegrzynGFuture Microbiol2011690992410.2217/fmb.11.7021861621Immunity profiles of wild-type and recombinant shiga-like toxin-encoding bacteriophages and characterization of novel double lysogensAllisonHESergeantMJJamesCESaundersJRSmithDLSharpRJMarksTSMcCarthyAJInfect Immun2003713409341810.1128/IAI.71.6.3409-3418.200315574512761125Sequence analysis of Stx2-converting phage VT2-Sa shows a great divergence in early regulation and replication regionsMiyamotoHNakaiWYajimaNFujibayashiAHiguchiTSatoKMatsushiroADNA Res1999623524010.1093/dnares/6.4.23510492170Sequence of Shiga toxin 2 phage 933W from Escherichia coli O157:H7: Shiga toxin as a phage late-gene productPlunkettGRoseDJDurfeeTJBlattnerFRJ Bacteriol1999181176717789357410074068In vivo induced antigen technology (IVIAT) and change mediated antigen technology (CMAT)HandfieldMHillmanJInfect Disord Drug Targets2006632733410.2174/18715260677824990816918490Lytic and lysogenic infection of diverse Escherichia coli and Shigella strains with a verocytotoxigenic bacteriophageJamesCEStanleyKNAllisonHEFlintHJStewartCSSharpRJSaundersJRMcCarthyAJAppl Environ Microbiol2001674335433710.1128/AEM.67.9.4335-4337.20019316511526041LysogenyLwoffABacteriol Rev19531726933718077713105613Distinctiveness of the genomic sequence of Shiga toxin 2-converting phage isolated from Escherichia coli O157:H7 Okayama strain as compared to other Shiga toxin 2-converting phagesSatoTShimizuTWataraiMKobayashiMKanoSHamabataTTakedaYYamasakiSGene2003309354810.1016/S0378-1119(03)00487-612727356Recent advances in the expression, evolution, and dynamics of prokaryotic genomesArraianoCMBamfordJBrussowHCarpousisAJPelicicVPflugerKPolardPVogelJJ Bacteriol20071896093610010.1128/JB.00612-07195189017601780Bacteria between protists and phages: from antipredation strategies to the evolution of pathogenicityBrussowHMol Microbiol20076558358910.1111/j.1365-2958.2007.05826.x17608793Phages and the evolution of bacterial pathogens: from genomic rearrangements to lysogenic conversionBrussowHCanchayaCHardtWDMicrobiol Mol Biol Rev20046856060210.1128/MMBR.68.3.560-602.200451524915353570Mobile genetic elements in the genome of the beneficial rhizobacterium Pseudomonas fluorescens Pf-5MavrodiDVLoperJEPaulsenITThomashowLSBMC Microbiol20099810.1186/1471-2180-9-8264793019144133A strand-specific RNA-Seq analysis of the transcriptome of the typhoid bacillus Salmonella typhiPerkinsTTKingsleyRAFookesMCGardnerPPJamesKDYuLAssefaSAHeMCroucherNJPickardDJPLoS Genet20095e100056910.1371/journal.pgen.1000569270436919609351Lysogenic infection of a Shiga toxin 2-converting bacteriophage changes host gene expression, enhances host acid resistance and motilitySuLKLuCPWangYCaoDMSunJHYanYXMol Biol (Mosk)2010446073Cryptic prophages help bacteria cope with adverse environmentsWangXKimYMaQHongSHPokusaevaKSturinoJMWoodTKNat Commun2010114710.1038/ncomms1146310529621266997Characterizing spontaneous induction of Stx encoding phages using a selectable reporter systemLivnyJFriedmanDMol Microbiol2004511691170410.1111/j.1365-2958.2003.03934.x15009895Differential efficiency of induction of various lambdoid prophages responsible for production of Shiga toxins in response to different induction agentsLosJMLosMWegrzynGWegrzynAMicrob Pathog20094728929810.1016/j.micpath.2009.09.00619761828Short-tailed Stx phages exploit the conserved YaeT protein to disseminate Shiga toxin genes among enterobacteriaSmithDLJamesCESergeantMJYaxianYSaundersJRMcCarthyAJAllisonHEJ Bacteriol20071897223723310.1128/JB.00824-07216844017693515Multilocus characterization scheme for Shiga toxin-encoding bacteriophagesSmithDLWareingBMFoggPCRileyLMSpencerMCoxMJSaundersJRMcCarthyAJAllisonHEAppl Environ Microbiol2007738032804010.1128/AEM.01278-07216813417951439A bacterial virulence determinant encoded by lysogenic coliphage lambdaBarondessJJBeckwithJNature199034687187410.1038/346871a02144037Lambda encodes an outer membrane protein: the lom geneReeveJNShawJEMol Gen Genet197917224324810.1007/BF0027172345607The lom gene of bacteriophage lambda is involved in Escherichia coli K12 adhesion to human buccal epithelial cellsVica PachecoSGarcia GonzalezOPaniagua ContrerasGLFEMS Microbiol Lett199715612913210.1016/S0378-1097(97)00415-19368371Dam methyltransferase is required for stable lysogeny of the Shiga toxin (Stx2)-encoding bacteriophage 933W of enterohemorrhagic Escherichia coli O157:H7MurphyKCRitchieJMWaldorMKLobner-OlesenAMarinusMGJ Bacteriol200819043844110.1128/JB.01373-07222373017981979Leaderless mRNAs in bacteria: surprises in ribosomal recruitment and translational controlMollIGrillSGualerziCOBlasiUMol Microbiol20024323924610.1046/j.1365-2958.2002.02739.x11849551Switches in bacteriophage lambda developmentOppenheimABKobilerOStavansJCourtDLAdhyaSAnn Rev Genet20053940942910.1146/annurev.genet.39.073003.11365616285866Use of the lambda Red recombinase system to rapidly generate mutants in Pseudomonas aeruginosaLesicBRahmeLGBMC Mol Biol200892010.1186/1471-2199-9-20228718718248677Lambda red recombineering in Escherichia coli occurs through a fully single-stranded intermediateMosbergJALajoieMJChurchGMGenetics201018679179910.1534/genetics.110.120782297529820813883The homologous recombination system of phage lambda. Pairing activities of beta proteinMuniyappaKRaddingCMJ Biol Chem1986261747274782940241Identification of multiple integration sites for Stx-phage Phi24B in the Escherichia coli genome, description of a novel integrase and evidence for a functional anti-repressorFoggPGossageSSmithDSaundersJMcCarthyAAllisonHMicrobiology20071534098411010.1099/mic.0.2007/011205-018048923Characterization of the relationship between integrase, excisionase and antirepressor activities associated with a superinfecting Shiga toxin encoding bacteriophageFoggPCRigdenDJSaundersJRMcCarthyAJAllisonHENucleic Acids Res2011392116212910.1093/nar/gkq923306480721062824Genomic sequences of bacteriophages HK97 and HK022: pervasive genetic mosaicism in the lambdoid bacteriophagesJuhalaRJFordMEDudaRLYoultonAHatfullGFHendrixRWJ Mol Biol2000299275110.1006/jmbi.2000.372910860721Origins of the E. coli strain causing an outbreak of hemolytic-uremic syndrome in GermanyRaskoDAWebsterDRSahlJWBashirABoisenNScheutzFPaxinosEESebraRChinCSIliopoulosDNew Eng J Med201136570971710.1056/NEJMoa1106920316894821793740A mutant of Escherichia coli showing constitutive expression of the lysogenic induction and error-prone DNA repair pathwaysMountDWProc Natl Acad Sci USA19777430030410.1073/pnas.74.1.300393247319458A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye bindingBradfordMAnal Biochem19767224825410.1016/0003-2697(76)90527-3942051In vivo induced genes in human diseasesHandfieldMProgulske-FoxAHillmanJPeriodontol 200020053812313410.1111/j.1600-0757.2005.00110.x15853939Global expression of prophage genes in Escherichia coli O157:H7 strain EDL933 in response to norfloxacinHeroldSSiebertJHuberASchmidtHAntimicrob Agents Chemother20054993194410.1128/AAC.49.3.931-944.200554922915728886SambrookJFritschEFManiatisTMolecular cloning: a laboratory manualpublisher Cold Spring Harbor, N.Y: Cold Spring Harbor Laboratoryedition 21989A modified silver staining protocol for visualization of proteins compatible with matrix-assisted laser desorption/ionization and electrospray ionization-mass spectrometryYanJXWaitRBerkelmanTHarryRAWestbrookJAWheelerCHDunnMJElectrophoresis2000213666367210.1002/1522-2683(200011)21:17<3666::AID-ELPS3666>3.0.CO;2-611271485Comparison of in-gel and on-membrane digestion methods at low to sub-pmol level for subsequent peptide and fragment-ion mass analysis using matrix-assisted laser-desorption/ionization mass spectrometryCourchesnePLLuethyRPattersonSDElectrophoresis19971836938110.1002/elps.11501803119150915



PAGE 1

Supplementary Table 1 PCR amplification p rimers used in this study Primer Sequence (5' 3') Dilution range in gene copy number R 2 Slope Proposed function Term qPCR F CGGTTTGTTCATTGCCTTCTCAACCG 5.08 x10 5 2540 0.990 3.22 Cleaves concatemeric phage DN A expressed during the lytic cycle Term qPCR R CCTAAATACAGCGCCAGAGTGC Q qPCR F GTAAAATCACGTCCACAGTGC 4.47 x10 5 1830 0.992 3.27 Antiterminator, expressed during the lytic cycle Q qPCR R AACACGTAATAATCAACCAGC Cro qPCR F AAAGGGCTGTCTATAAGTGG 7 .61x10 5 1520 0.992 3.07 Transcription repressor, expressed during the lytic cycle Cro qPCR R GCCACCAGAAATCTCTTCG Capsid qPCR F AGGTGCCTGCGAAGCTATTC 4.47 x10 5 1830 0.991 3.10 Structural gene, Antiterminator, expressed during the lytic cycle Cap sid qPCR R GCTCTCCTGGTCACGACG cI qPCR F GTGAGGGAACGGAGCTACAG 3.55 x10 6 1550 0.998 3.17 Transcription repressor necessary to establish lysogeny, expressed in the lysogen cI qPCR R GCGGCCTTATGCTTTCAATG 16s qPCR F CATCGAGGAACGGTACGAGA 6.35 x10 5 1270 0.995 3.66 Cell marker 16s qPCR R CGATCTCGGTAAAGTCGTCGAT GyrB qPCR F GTCGAAGTGGCGTTGCAGTG 7.12 x10 5 4060 0.996 3.12 Target of norfloxacin, used as induction marker GyrB qPCR R AGCCTGCCAGGTGAGTACCG P1 qPCR F CAGCGTTTGCATAAGCC 3.55x 10 5 1730 0.997 3.21 Phage gene of unknown function P1 qPCR R CGTGAAAAGGCAGAGAAAGC P2 qPCR F CGGATACCATGCGGACG 3.55 x10 5 1730 0.996 3.68 Putative RuvC resolvase

PAGE 2

P2 qPCR R CGTTTTGCCGTTCTTTTTGG TGG P3 qPCR F GCGGTGTGACTTCAATATTT C 5.51 x10 5 2360 0.990 3.50 Phage gene of unknown function P3 qPCR R GCTGCCATACGCGTTACTGA ATC P4 qPCR F GGATTCAGTAACATTCACGC CG 5.51 x10 5 2360 0.991 3.25 Putative lambda like exonuclease P4 qPCR R GCAAAACCCCGATCAGGAAA GAAG P5 qPCR F GCAGAGAG CGGTGAAGTTCAGC 4.47 x10 5 1830 0.998 3.28 Phage gene of unknown function P5 qPCR R CGTCTCCGTCACTTCCTGCAG P6 qPCR F GCAAAACGGCAAGAAAAACC ACC 5.51 x10 5 2360 0.998 3.36 Phage gene of unknown function P6 qPCR R GCCTATGGTACGCCTGC CM1 qPC R F GAAATCTCCTGATGGTGAGG 3.55 x10 5 1730 0.996 3.70 Tail spike protein CM1 qPCR R GATCCATCGTCATTCC CM2 qPCR F AAGGACTGCTGGCAAACG 5.85 x10 5 4560 0.990 3.25 Putative Dam methylase CM2 qPCR R GTCGGCCTCAGTTAGC CM5 qPCR F TTATCACCGTCACAATTTGC 7.12 x10 5 1620 0.997 3.45 Phage gene of unknown function CM5 qPCR R CTGCTTACACTGTAAGAACG CM7 qPCR F TATGGCCTATTCAGAGG 3.55 x10 5 1730 0.996 3.37 Phage gene of unknown function CM7 qPCR R AACGACGTACTGTTATCC CM18 qPCR F TGAAAGCAACAGCACG 3.55 x10 6 1550 0.990 3.16 Homologous to Lambda lom gene CM18 qPCR R CCAATGCCAGCAGTAACG