Citation
Molecular interactions of the Streptococcus mutans surface protein P1

Material Information

Title:
Molecular interactions of the Streptococcus mutans surface protein P1 contributions to surface structure, stability, and translocation
Creator:
Seifert, Trevor Bryant
Publication Date:
Language:
English
Physical Description:
xi, 115 leaves : ill. ; 29 cm.

Subjects

Subjects / Keywords:
Antigens ( jstor )
DNA ( jstor )
Epitopes ( jstor )
Membrane proteins ( jstor )
Memory interference ( jstor )
Polymerase chain reaction ( jstor )
Protein transport ( jstor )
Proteins ( jstor )
Secretion ( jstor )
Streptococcus mutans ( jstor )
Antigens ( mesh )
Dental Plaque ( mesh )
Dissertations, Academic -- Immunology and Microbiology -- UF
Immunology and Microbiology thesis, Ph. D
Membrane Proteins ( mesh )
Salivary Proteins ( mesh )
Sp185 protein, Chironomus tentans ( mesh )
Streptococcus Mutans ( mesh )
Genre:
bibliography ( marcgt )
non-fiction ( marcgt )

Notes

Thesis:
Thesis (Ph.D.)--University of Florida, 2005.
Bibliography:
Includes bibliographical references (leaves 99-114).
General Note:
Typescript.
General Note:
Vita.
Statement of Responsibility:
by Trevor Bryant Seifert.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright [name of dissertation author]. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Resource Identifier:
003505772 ( ALEPH )
65288118 ( OCLC )

Downloads

This item has the following downloads:


Full Text












MOLECULAR INTERACTIONS OF THE Streptococcus mutans SURFACE PROTEIN
PI: CONTRIBUTIONS TO PROTEIN STRUCTURE, STABILITY, AND
TRANSLOCATION














By

TREVOR BRYANT SEIFERT


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA




MOLECULAR INTERACTIONS OF THE Streptococcus mutans SURFACE PROTEIN
PI: CONTRIBUTIONS TO PROTEIN STRUCTURE, STABILITY, AND
TRANSLOCATION
By
TREVOR BRYANT SEIFERT
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
2005


Copyright 2005
by
TREVOR BRYANT SEIFERT


ACKNOWLEDGMENTS
I would like to thank all of the members of the Brady lab for sharing their
knowledge and providing technical assistance during my stay in the lab. I am especially
indebted to Dr. Brady for offering to be my mentor and providing me with a new
laboratory and research project after the failure of my initial mentor. I would also like
to thank my committee members, Dr. Arnold Bleiweis, Dr. Paul Gulig, Dr. Daniel Purich,
and Dr. Robert Bume for their ideas and advice. Finally, 1 thank my parents for their
wholehearted support and encouragement during these seemingly endless years of study.


TABLE OF CONTENTS
page
ACKNOWLEDGMENTS iii
LIST OF TABLES vii
LIST OF FIGURES viii
ABSTRACT x
CHAPTER
1 INTRODUCTION 1
Streptococcus mutans and Dental Caries 1
Major Surface Protein PI 2
Proline and Proline-Rich Regions 4
Protein Translocation 7
DnaK and RopA 11
Summary and Specific Aims 12
2 MATERIALS AND METHODS 14
Bacterial Strains, Plasmids, and Growth Conditions 14
Identification of an Intramolecular Interaction Involving the Proline-Rich Region
ofPl 14
Purification of A-region and P-Region-MBP Fusion Proteins 14
Enzyme-Linked Immunosorbent Assays (ELISA) to Detect A-region and P-
Region Interaction 19
Elimination of spaP DNA Encoding the A-Region 20
Evaluation of Antibody Binding to P1AA 21
Assessment of Epitope Restoration by ELISA 21
PCR and Construction of S. mutans spaP and S. gordonii M5 sspA and sspB
Subclones 22
Purification and Confirmation of GST-Fusion Proteins 23
Competitive Inhibition ELISA to Detect A-Region and P-Region Interaction,..25
Binding Stoichiometry of the A- and P-Regions by Continuous Variation 25
Analysis of PI Translocation and the Contribution of the Alanine- and Proline-
Rich Regions 26
Introduction ofspaAA into S. mutans PC3370 26
IV


Analysis of P1AA Cell Surface Expression in PC3370 27
RNA and Dot Blotting for Confirmation of P1AA Expression in PC3370 27
Western Immunoblot Analysis of Periplasm Extracts from E. coli MC4100
and CK1953 Harboring pUC18, pDC20, pDC9, and pTS20 28
Construction of a Bicistronic spaP for Expression of a Discontinuous PI 29
Evaluation of PI Fragment Expression by Western Immunoblot 30
Evaluation of Surface Expression of Discontinuous PI in S. mutans 31
Introduction of S. gordonii SspA and SspB A-Regions into P1AA 31
Western Immunoblot Analysis of Chimeric PI Containing the A-region of S.
gordonii SspA and SspB 32
Surface Expression of SspA and SspB in S. mutans PC3370 32
Involvement of RopA (Trigger Factor) and DnaK in the Maturation and
Translocation of P1 33
Evaluation of PI Surface Expression by Whole Cell Dot Blot in the S', mutans
ropA- Mutant, TW90 33
Evaluation of PI Surface Expression by Whole Cell Dot Blot in S. mutans
SM12, a Low-Level Expresser of DnaK 34
Analysis of dnaK Message Levels by Quantitative Real-Time PCR 34
3 RESULTS 36
Expression of Recombinant PI AA and Recognition by Anti-Pi Monoclonal
Antibodies 36
Evaluation of PI AA Expression in S. mutans 37
Evaluation ofspaP-Specific mRNA in PC3370 Harboring the Deletion
Construct pTS21 38
Evaluation ofSecretion ofPl, PlAA,andPlAP infs, coli 39
Interaction of the A- and P-Regions by ELISA 39
Restoration of Epitopes by the Interaction of the A- and P-Regions 40
Inhibition of MAb 4-10A Binding to PI by an A- and P-Region Complex 40
Stoichiometry of the A- and P-Region Interaction 41
Interaction of PI, SspA, and SspB A- and P-Regions 41
Introduction of the A-Regions of SspA and SspB into P1AA 42
Stability and Translocation of Chimeric PI Containing the A-Regions of
SspA and SspB 43
Evaluation of the Involvementof SecB in the Secretion of PI, PI AA, and
PlAPin E. coli 44
Expression of Discontinuous PI and Recognition by Anti-Pi Monoclonal
Antibodies 45
Evaluation ofSurface Expression of Discontinuous PI inS. mutans 47
Surface Expression of PI in a RopA-Deficient S. mutans and Bacterial
Adherence to Salivary Agglutinin 47
Analysis of PI Surface Expression in a Low-Level DnaK Expressing S.
mutans Mutant 49
Evaluation of dnaK mRNA Expression in S. mutans PC3370 Harboring
pDL289, pMAJJ8, pMAD, and pTS21 49
v


4 DISCUSSION AND CONCLUSIONS
.78
Identification of an Intramolecular Interaction within PI 79
Analysis of PI Translocation and the Contribution of the Alanine- and Proline-
Rich Regions 85
Involvement of RopA (Trigger Factor) and DnaK in the Maturation and
Translocation of PI 93
Conclusions 97
LIST OF REFERENCES 99
BIOGRAPHICAL SKETCH 115
vi


LIST OF TABLES
Table page
1. Bacterial Strains 15
2. Plasmids 16
3. PCR Primers 18
vii


LIST OF FIGURES
Figure page
1. Schematic representation ofPl 3
2. Western blot analysis of PI and recombinant PI lacking the A-region 51
3. Lack of surface expression of PI devoid of the A-region 52
4. RNA dot blot analysis of xpaP-specific mRNA levels in the Streptococcus mutans
spaP-negative mutant PC3370 and derivatives 53
5. Western immunoblot of cytoplasm and periplasm fractions of E. coli DFI5a
harboring pUC18 derived plasmids expressing full-length PI, P1AP, P1AA, and
vector alone 54
6. Demonstration of A-region and P-region interaction by ELISA 55
7. Restoration of epitopes by A- and P-region interactions as measured by ELISA 56
8. Inhibition of anti-P 1 MAb 4-1OA binding to immobilized P1 in ELISA 57
9. Stoichiometry of the mAh 4-10A epitope 58
10. Demonstration of similar level of mAb 3-8D reactivity to A-region-GST fusion
polypeptides of SspA, SspB, and PI by Western immunoblot 59
11. Demonstration of interactions between the A- and P-regions of different antigen
I/II proteins 60
12. Evaluation of reactivity of A- and P-region dependent anti-Pl mAbs with PI,
SspA, and SspB 61
13. Restoration of epitopes by the interaction of various antigen I/II A-regions with
the immobilized P-region of Streptococcus gordonii SspA 62
14. Restoration of epitopes by the interaction of various antigen I/II A-regions with
the immobilized P-region of SspA 63
viii


15. Restoration of epitopes by the interaction of various antigen I/II A-regions with
the immobilized P-region of SspA 64
16. Restoration of epitopes by the interaction of various antigen I/II A-regions with
the immobilized A-region of SspA 65
17. Restoration of epitopes by the interaction of various antigen I/II A-regions with
the immobilized A-region of SspA 66
18. Restoration of epitopes by the interaction of various antigen I/II A-regions with
the immobilized A-region of SspA 67
20. Western immunoblot of chimeric PI containing the A-regions of SspA and SspB. ..69
21. Surface expression of S. gordonii SspA and SspB in S. mutans PC3370 70
22. Demonstration of lack of ability of heterologous A-regions to restore surface
expression of P1AA in PC3370 70
23. Western immunoblots of cell lysates of PC3370 harboring vector alone and
plasmids encoding PI, P1AA. PI AA + SspA A-region, and PI AA + SspB A-
region 71
24. Western immunoblot of cytoplasm and periplasm fractions of £ coli MC4100
(wild-type) and CK1953 (AsecB) harboring pDC20 (PI) 72
25. Schematic representation of discontinuous PI 73
26. Western immunoblot of PI fragments expressed from pTS30 in E. coli 73
27. Whole cell dot blot of S. mutans NG8 and PC3370 harboring pDL289 vector
control, pMAD encoding PI, and pTS31 encoding discontinuous PI fragments....74
28. PI surface expression levels of S. mutans UA159 and TW90 (ropA- mutant) at
early log stage traced with mAb 4-10A as measured by densitometry 75
29. PI surface expression levels of S. mutans UA159 and SM12 (DnaK-deficient) at
early log phase 76
30. Real-Time PCR quantification of dnaK mRNA from S. mutans PC3370 harboring
the pDL289 vector alone and expressing PI AP-region, full-length P1, and
PlAA-region 77
ix


Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy
MOLECULAR INTERACTIONS OF THE Streptococcus mutans SURFACE PROTEIN
PI: CONTRIBUTIONS TO SURFACE STRUCTURE, STABILITY AND
TRANSLOCATION
By
Trevor Bryant Seifert
May 2005
Chair: L. Jeannine Brady
Major Department: Oral Biology
Streptococcus mutans is considered to be the major etiologic agent of human dental
caries. Attachment of S. mutans to the tooth surface is required for the development of
caries and is mediated, in part, by the 185 kD surface protein variously known as antigen
VII, PAc, and PI. Such proteins are expressed by nearly all species of oral streptococci
and have been identified as possible antigens for vaccine development. In addition,
researchers are utilizing PI to study immune response and immunomodulation .
The goal of this research was to identify intramolecular interactions within PI and
to examine their contributions to PI structure, stability, and translocation. To that end,
this research demonstrates a) that several anti-Pl monoclonal antibodies (mAbs) require
the simultaneous presence of the alanine-rich and proline-rich regions for binding, b) that
the proline-rich region of PI interacts with the alanine-rich region, c) that like the
proline-rich region, the alanine-rich region is required for the stability and translocation
x


of PI, d) that both the proline-rich and alanine-rich regions are required for secretion of
PI in E. coli, and e) that in E. cot PI is secreted in the absence of SecB. Additionally, it
was demonstrated that the chaperone RopA (trigger factor) was not required for PI
translocation. However, its absence resulted in reduced P1 mediated adherence to
salivary agglutinin, suggesting a role in PI maturation. DnaK was also shown to be
involved in PI translocation and dnaK mRNA levels were affected by the presence of PI
deletion constructs. Furthermore, the A- and P-regions of PI were shown to be capable
of interacting with the A- and P-regions of the Antigen I/II proteins, SspA and SspB,
from Streptococcus gordonii. These interactions restored epitopes recognized by several
anti-Pl mAbs. Replacing the A-region of PI with the A-regions of SspA and SspB also
restored some mAb binding, but did not restore stability and translocation of PI to the
cell surface. The results of this research have implications for understanding surface
localization of virulence factors in pathogenic microorganisms and for understanding
how the protein structure of a vaccine antigen contributes to recognition by antibodies.
xt


CHAPTER 1
INTRODUCTION
Streptococcus mutans and Dental Caries
Streptococcus mutans is considered to be the major etiological agent of human
dental caries [1,2], one of the most common infectious diseases that affect humans. S.
mutans was first identified in a human carious lesion in 1924 and isolates were later
divided into eight serotypes designated a through h based on differences in cell wall
carbohydrate composition [3,4], Concurrent DNA hybridization studies further
categorized the serotypes as four genetic types based upon the guanine plus cytosine
(G+C) content of their genomes [5, 6], The four genetic types were subsequently
classified as different species, Streptococcus critus (serotype a), Streptococcus rattus
(serotype b), Streptococcus sobrinus (serotypes d, g, h), and S. mutans (serotypes c, e,f).
These species are collectively known as mutans streptococci [7]. S. mutans serotype c is
the most common mutans streptococcus isolated from human dental plaque [1,2].
5. mutans is equipped with several proteins that enable its attachment and
subsequent colonization of the tooth surface. In the presence of sucrose, extracellular
glucosyltransferases (GTF) synthesize several forms of branched extracellular glucans.
These glucans provide a matrix for the aggregation of S. mutans and other oral
streptococci through interaction with proteins such as the bacterial surface-localized
glucan-binding proteins (GBP). S. mutans possesses four GTF genes, gtfA [8], gtjB [9],
gtfC [10], andgt/D [11], and three GBP genes, gbpA [12], gbpB [13], and gbpC [14].
Mutational inactivation of the GTF genes has shown that their products are important to
1


2
cariogenecity. However, a model for colonization of the tooth surface by S. mutans
suggests that initial attachment to the tooth pellicle is protein-mediated followed by
glucan-dependent bacterial accumulation [15]. The surface proteins that are implicated in
the initial adherence of S. mutans are members of the antigen I/II super-family of
multifunctional adhesins and are variously known as antigen I/II [16], Ag B [17], IF [18],
PI [19], SR [20], and PAc [21], and are encoded by the genes spaP or pac. Antigen I/II-
like molecules are expressed in nearly all of the oral streptococci [22] and include SpaA
[23]and PAg [24] from S. sobrinas, SSP-5 from Streptococcus sanguis [25], and SspA
[26] and SspB [27] from Streptococcus gordonii.
Major Surface Protein PI
The genes spaP and pac have been cloned and sequenced [21, 28, 29]. N-terminal
amino acid sequencing of the proteins and the predicted amino acid sequences indicate
that the spaP and pac gene products differ by only 36 residues. Major characteristics of
the Mr~1 85,000 PI include a 38 residue amino-terminal signal sequence, a region
containing three 82-residue alanine-rich repeats, a 150 residue variable region in which
20 of the 36 aforementioned amino acid substitutions reside, a central proline-rich region
containing three 39-residue tandem repeats, carboxy-terminal wall- and membrane-
spanning regions, and an LPXTG wall anchor motif [28] (Fig. 1). Secondary structure
predictions of PI based upon the sequence of spaP indicate that the alanine-rich region
would form an a-helicle coiled-coil structure while the central proline-rich region would
form an extended p-sheet structure [28], Recently the variable region of the S.mutans
serotype/antigen I/II was subcloned, and its crystal structure determined. The crystal
structure data indicate that the variable region forms a flexible p-sandwich [30].


3
Signal Sequence
(** 1-38)
A-REGION
VREGION P-REGION
(a.a. 679-823) (a.a. 840-963)
Wall Membrane Cytoplaimir
Spanning Spanning Tail
Region Region (a.a. 1557-1561)
(a.a. 1486-1535) (a.a. 1536- 1556k
(ii 186-464)
\
a
mm
Figure 1. Schematic representation of PI
Antigen I/II polypeptides are structurally complex and exhibit diverse binding
properties, which mediate interactions with a variety of substrates including host salivary
agglutinin, fibronectin, fibrinogen, and collagen [31, 32]. Several regions have been
implicated in the binding activities of antigen I/II polypeptides. Brady et al [33] provided
evidence that PI possessed multiple sites contributing to salivary agglutinin binding and
that different regions might be involved in binding to soluble or immobilized salivary
agglutinin. Later, Scatchard analysis of antigen I/II binding to saliva-coated
hydroxyapetite showed the binding to be mediated by two sites [34], Investigators have
showed that recombinant peptide fragments derived from the A-region bound salivary
agglutinin [35] or salivary glycoproteins [36] and Senpuku et al. (1995) demonstrated
that antibodies specific to a peptide fragment derived from PAc aa residues 200-481
inhibited the binding of fluid-phase salivary components to immobilized PAc.
Furthermore, an antigen I/II peptide fragment consisting of a.a. residues 816-1213
blocked 5. mutans cell adhesion to saliva-coated hydroxyapatite [37] and Kelly et al. [38]
found antigen I/II derived peptides consisting of residues 1005-1044 and 1085-1114 to be
inhibitory to S. mutans adhesion to salivary glycoproteins.


4
Proline and Proline-Rich Regions
Proline is unique among the amino acids in that its side chain is covalently bound
to the backbone amide. As a result of this unusual bond, the proline residue has a
restricted backbone conformation [39], the bulkiness of its side chain restricts the
conformation of the preceding residue [40], and the proline is unable to act as a hydrogen
bond donor. Proline is recognized as an a-helix and (3-sheet breaker and is often located
one or two residues C-terminal of an a-helix [41], A sequence of four or more prolines
in a row adopts the conformation of an extended structure with three residues per turn,
known as a polyproline II helix [42]. The polyproline 11 helix is a major structural
element in collagen, pancreatic polypeptides, and neuropeptides [43]. In a survey of
surface proteins, there were 90 occurrences of polyproline II helixes in 80 non-
homologous proteins [44],
Proline-rich regions are biologically important in numerous unrelated proteins in a
variety of organisms, both eukaryotic and prokaryotic. Although the functions of
proteins containing proline-rich regions can be quite diverse, the roles of the proline-rich
regions appear to be fairly conserved: protein-protein interaction, folding, and structure.
In eukarotes, anandamide amidase is responsible for the hydrolysis of neuromodulatory
fatty acid amides and esters [45], The enzyme contains a nine residue proline-rich
region, which upon removal resulted in loss of enzymatic activity and a change in
subcellular localization of the enzyme. It is suggested that the proline-rich region may be
essential for the correct folding of the amidase, although similar proline-rich regions are
not found in non-mammalian amidases [46], Involvement in cellular localization has also
been demonstrated for the proline-rich region in the eukaryotic enzyme dynamin.


5
Okamoto et al. has shown that a proline-rich domain is involved in the enzymes
localization to coated pits and in its GTP-binding activity [47],
The relevance of proline-rich domains to the field of medicine can be seen in the
human disease Liddle syndrome. Liddle syndrome is a disease of the amiloride-sensitive
epithelial sodium channel [48]. The sodium channel is composed of three subunits, two
of which contain highly conserved C-terminal proline-rich domains. Frameshift
mutations resulting in the deletion of at least 45 residues from the C-terminal segments of
the subunits have been the identified causes of this disease. More recently, a missense
mutation that results in the substitution of a leucine for a proline (P616) in the conserved
proline-rich domain of subunit p has been identified and correlated with the disease. The
substitution has greater effect on channel activity than the deletion of the complete C-
terminal segment of both the p and y subunits. It is suggested that this proline residue is
involved in an essential interaction with another protein and possibly another subunit
[49].
Proline-rich regions are also involved in protein-protein interactions between
organisms. In the world of virology, the transformation of primary B lymphocytes with
Epstein-Barr virus (EBV) is known to be dependent upon the expression of the EBV
nuclear protein 2 (EBNA2) [50], The 483-residue EBNA2 contains a 36 residue proline-
rich region in the N-terminal third of the protein. Of the 230 residues of the N-terminal
half of EBNA2, 222 were not essential for transformation of B lymphocytes. The eight
essential residues are seven prolines and a glutamine, and it is suggested that they may
constitute a critical domain for structure or intramolecular interaction [51]. Lastly, an
interaction between a proline-rich insect peptide and a molecular chaperone in bacteria


6
has been identified. Pyrrhocoricin, an antibacterial peptide originally isolated from the
European sap-sucking bug Pyrrliocoris apterus [52], kills sensitive species by binding to
the bacterial DnaK [53],
Previously, in an attempt to define a role for the P-region in the adhesive function
of PI, an internal deletion, P1AP (A826-996), was constructed [54]. The proline-rich
region (P-region) is highly conserved among the antigen I/II family of oral streptococcal
proteins, and similar highly repetitive proline-rich sequences have been identified in a
wide variety of bacterial proteins [55-64]. Homology to the P-region of PI is found in
numerous surface proteins in both prokaryotes and eukaryotes. Among these are the
fibronectin binding proteins of Streptococcus pyogenes and Staphylococcus aureus [65,
66], an immunogenic secreted protein (isp) of S. pyogenes [67], and the virulence
associated suface protein, PspA, of S. pneumonia [68]. The internally deleted
polypeptide PI AP was expressed in both E. coli and in S.mutans PC3370, an isogenic
s/>nP-negative mutant. Western blots of P1AP expressed in E. coli revealed a loss in
reactivity for fiveof eleven PI-specific MAbs. These five mAbs also did not react to a
subclone of the P-region (826-996), suggesting that they recognize a complex PI epitope
that is dependent upon the presence of the P-region. Although P1AP contains the signal
sequence, it was not translocated to the surface of S. mutans PC3370 (spaP). Also, in
comparison to full-length PI expressed from pDL289, only low levels of PI AP were
detected in the cytoplasm of PC3370, while mRNA levels were equivalent. These data
suggest that the P-region may be required for PI stability and subsequent translocation to
the cell surface.


7
Protein Translocation
Since P1AP possessed the N-terminal signal sequence and C-terminal cell wall
anchor motif, the lack of P1AP expression on the cell surface was unexpected. Proline-
rich regions are known to be involved in a variety of intra- and intermolecular protein-
protein interactions [69-78], including chaperone-like activities. Wang et al. [79]
identified a centrally located proline-rich region in the serine protease, Factor C.
The Limulus polyphemus (horseshoe crab) Factor C is a 132-kDa secreted serine
protease and contains a centrally located proline-rich region. The role of the proline-rich
region in the secretion and function of Factor C was investigated through the construction
and expression of homologues with and without the proline-rich region. The proline-rich
region is flanked by an amino-terminal lectin binding domain and a carboxy-terminal
protease domain. Factor C is 1019 amino acids in length, and the proline-rich region
spans residues 630 690. Deletion of either the lectin binding or protease domains
resulted in peptides that were stably expressed and secreted by the cell. In contrast,
deleting the proline-rich region resulted in a protein that was found in the cytoplasm but
was no longer secreted. In addition, expression of a truncated peptide consisting of the
amino-terminal 329 residues of Factor C was stable and secreted while a peptide
consisting of the secretion signal fused to the carboxy-terminal protease domain was not
secreted. Interestingly, the addition of the proline-rich region amino-terminal to the
protease domain restored secretion of the peptide, but fusing the proline-rich region
carboxy-terminal to the protease domain did not restore secretion.
To establish a role for the proline-rich region in the folding of Factor C, a partial
trypsin digestion analysis was performed. Trypsin cleaves preferentially at unfolded
regions in proteins, and although there are nearly 100 potential trypsin cleavage sites in


8
Factor C, four bands were detected after partial digestion. The visible fragments were
attributed to compactly folded domains. However, Factor C without the proline-rich
region was not detectable after 10 minutes of trypsin digestion indicating that the protein
was in an unfolded trypsin-susceptible conformation. This study revealed that the
proline-rich region is essential for the stability and secretion of Factor C. Because this
effect was similar to that previously described for the P-region of PI [54] these authors
suggested that internal proline-rich regions may act as intramolecular chaperones for
correct folding and secretion of proteins that contain them. The homology of the P-
region of PI to the surface proteins of numerous organisms and its conservation within
oral streptococci suggest that it plays an important role in PI, and considering the
prevalence of proline-rich regions in protein-protein interactions, it is likely that the P-
region is involved in such an interaction.
Recently, Van Dollarweed et al. (2003) demonstrated that the P-region of PI binds
to a polypeptide fragment of P1 that contains the alanine-rich region (A-region). This
interaction restored the reactivity of a PI specific Mab that was not reactive to either of
the fragments individually and suggests that these regions interact in mature, surface
expressed, PI. X-ray crystallography has revealed that the variable region of PI forms a
flexible beta-sandwich that would place the P-region and A-region into close proximity
[30], Given that the P-region is required for the native structure, stability, and
translocation of PI and that the P-region interacts with a fragment of PI containing the
A-region, it is likely that the A-region may also play a role in the structure, stability, and
translocation of P1.


9
To fully elucidate the role of the P-region in PI translocation, a better
understanding of the molecules route of translocation represents an important goal.
There is no experimental data that identify the secretion pathway PI or antigen I/II-like
proteins use. However, based upon the method of PI cell wall anchoring, a route of
translocation has been predicted. Gram-positive surface proteins containing the
conserved C-terminal LPXTG motif, such as PI, are anchored to the cell wall by the
membrane anchored transpeptidase, sortase. During cell wall anchoring, sortase cleaves
surface proteins between the threonine and the glycine of the LPXTG motif [80].
Following cleavage in S. aureus and Listeria monocytogenes, the proteins are linked to
cell wall peptides via an amide bond [81, 82]. Although several aspects of peptidoglycan
structure in Gram-positive bacteria are variable [83], the principles of surface protein
anchoring appear to be conserved [84]. Lee and Boran[85] identified and insertionally
inactivated the gene encoding sortase, srtA, in S. mutans. As predicted, SrtA' mutants
secreted PI into the supernatant demonstrating that PI is indeed a sortase anchored
protein. Current evidence suggests that sortase anchored proteins are translocated via the
Sec translocase [86].
The Sec-dependent secretion pathway has been well characterized and studied in E.
coli and to a lesser extent in B. subtilis. In E. coli, the Sec-translocase consists of SecA,
SecY, SecE, SecG, SecD, SecF, and YajC [87], Two major targeting pathways converge
on the Sec-translocase, the signal recognition particle (SRP) pathway and the SecB
pathway. The E. coli SRP consists of a 4.5s RNA and the GTPase Ffh, both of which are
required for cell viability [88]. Signal peptides of nascent polypeptides are recognized by
the SRP as they emerge from the ribosome [89], SRP binding stalls translation and


10
targets the SRP-ribosome complex to the SRP receptor, FtsY [90, 91]. The complex is
then targeted to the Sec-translocon where the ribosome docks and translation is restored.
The preprotein is cotranslationally translocated across the membrane via an integral
membrane complex consisting of Sec Y, SecE, and SecG. The ATPase Sec A provides
energy for the translocation [87]. In the case of posttranslational secretion, the
cytoplasmic chaperone SecB targets preproteins to the Sec-translocon. SecB binds to
nascent and full-length preproteins as they emerge from the ribosome [92]. SecB
interaction prevents premature folding of the preprotein and delivers it to the Sec-
translocon in a secretion-competent state. Binding of the SecB-preprotein complex with
SecA results in the transfer of the preprotein to SecA and the release of SecB [93]. The
preprotein is subsequently translocated across the membrane through the Sec-translocon
[94].
The SRP pathway exists in both gram-negative and gram-positive bacteria.
Identified homologs of the Sec-dependent pathway components in B. subtilis include
SecA, SecYEG, SecDF, YrbF, Ffh, and scRNA. As the genome sequences of gram
positive bacteria have become available, investigators have searched for homologs of
SecB to no avail. However, a B. subtilis complementation study of an E. coli SecB null
mutant revealed a functional ortholog, CsaA, with partially overlapping binding
characteristics [95-97]. As previously stated, the SRP is essential for viability in E. coli,
and this was assumed to be the case in all organisms. However, an Ffh null mutant in S.
mutans is viable, and PI is translocated and expressed on the cell surface [98], This
suggests that if PI secretion is Sec-dependent, the targeting pathway is likely to be SecB-


11
like and may require a SecB ortholog or possibly an unrelated chaperone with similar
functions.
DnaK and RopA
The translocation of PI to the cell surface in an S. mutans mutant devoid of the
SRP pathway [98] would suggest that PI is post-translationally secreted, and a protein of
1561 residues would most certainly require interactions with chaperones to prevent
misfolding and aggregation while transiting the cytosol. The 70-kD heat shock proteins
(Hsp70s) are ubiquitous proteins found in the bacterial cytosol and several compartments
of eukaryotic cells including the endoplasmic reticulum, the mitochondria, and the
cytosol [99], The E. coli Hsp70, DnaK, has been extensively studied and is involved in a
variety of cellular processes, including both protein folding and degradation. In studies
of substrate specificity it has been shown that DnaK preferentially binds to peptides that
contain hydrophobic residues [100]. In proteins these hydrophobic residues are typically
found in the core of the folded structure, or in subunit interfaces [101], Nascent
polypeptides emerging from the ribosomes, as well as malfolded proteins, display short
hydrophobic regions that are not exposed in the proteins native conformation. DnaK
binds to these exposed hydrophobic segments, thereby preventing aggregation and further
misfolding.
Another chaperone that interacts with nascent polypeptides is trigger factor, a
ribosome-associated peptidyl-prolyl cis-trans isomerase (PPIase). In S. mutans trigger
factor is known as RopA. Trigger factor associates with the large ribosomal subunit at
the peptide exit channel and binds to nearly all nascent polypeptides [102], There is
evidence that trigger factor cooperates with DnaK to promote the folding of a variety of
cytosolic E. coli proteins [103] and that they share substrates and binding specificities


12
[104], In fact, DnaK is not recruited to translating ribosomes that lack trigger factor
[105]. Besides its chaperone activities, trigger factor can catalyze cis-trans isomerizaion
of peptidyl-prolyl peptide bonds. The PPIase activity of trigger factor is not required by
all of the proteins that require trigger factor for proper folding, however the PPIase
activity is essential for some [106]. In S. pyogenes, the PPIase activity of trigger factor
influences the conformation of the nascent cysteine protease, SpeB, which in turn directs
the protease into one of several alternative folding pathways[107]. The malfolded
proteases are subsequently not targeted to the secretion pathway.
Summary and Specific Aims
In an effort to characterize the role of the proline-rich region of PI in the adherence
properties of the molecule, Brady et al. (1998) deleted the region from PI (PI AP). While
P1AP retained the sequences believed sufficient for expression and translocation,
unexpectedly, it was unstable and not translocated to the cell surface. As there is a lack
of research regarding protein translocation in gram-positive organisms and Streptococcus
in particular, it was of interest to identify the role of the proline-rich region in PI stability
and translocation. Since proline-rich regions are known to be involved in intra- and
intermolecular protein-protein interactions, the first specific aim of this work was to
identify regions within PI that interact with the proline-rich region. Once a proline-rich
region interaction was discovered, the second specific aim of this study was to analyze
the role of the interacting region in the structure, stability and translocation of P1.
PI is a large and structurally complex molecule as is evident by the change in
antibody reactivity seen against PI AP that suggests complex and possibly conformational
epitopes. Further evidence of the structural complexity of PI was revealed in the solved


13
crystal structure of the variable region [30], Based upon the surface expression of PI in
S. mutans lacking the SRP pathway [98] and the presumption that sortase-anchored
proteins are secreted via the Sec translocase, the successful post-translational
translocation of a large and complex molecule, such as PI, must be dependent upon
chaperones. The final specific aim of this work was to examine whether the chaperones
DnaK and RopA contributed to PI translocation or function.


CHAPTER 2
MATERIALS AND METHODS
Bacterial Strains, Plasmids, and Growth Conditions
Bacterial strains used in this study are listed in Table 1, and all plasmids used are
listed in Table 2. Unless otherwise noted, all S. mutans strains were grown under
anaerobic conditions at 37C in Todd-Hewitt broth (BBL, Cockeysville, Md.)
supplemented with 0.3% yeast extract (THBYE) and kanamyacin (500 pg/ml) as needed.
E. coli strains were grown aerobically at 37C with vigorous shaking in Luria-Bertani
broth (LB) (1% [wt/vol] tryptone, 0.5% [wt/vol] yeast extract, 1% [wt/vol] NaCl, pH 7.0)
supplemented with ampicillin (100 pg/ml) or kanamycin (50 pg/ml) as appropriate. E.
coli strains MC4100 and CK1953 were grown aerobically at 37C with vigorous shaking
in M9 medium (0.625% [wt/vol] Na?HP04, 0.075% [wt/vol] KH2PO4, 0.2% [wt/vol]
NaCI, 0.028% [wt/vol] MgS04, 0.1% [wt/vol] (NH4)2S04, 1% glucose) supplemented
with kanamycin (50 pg/ml) and ampicillin (100 pg/ml) as appropriate.
Identification of an Intramolecular Interaction Involving the Proline-Rich Region of
PI
Purification of A-region and P-Region-MBP Fusion Proteins
Overnight cultures of E. coli harboring pMA3 [54] or pMA41 [35] (Table 1) were
diluted 1:100 into fresh Luria-Bertani (LB) broth containing 100 pg/ml of ampicillin and
grown to an OD6oo of 0.5. The medium was supplemented with 0.3 mM isopropyl-b-D-
thiogalactopyranoside (IPTG), and the culture was incubated for an additional 2 hours at
37C Periplasmic contents were extracted by osmotic shock [108]. Affinity
14


Table 1. Bacterial Strains
Strain
Description
Source or Reference
E. coli
DH5a
F'cp80dlacZAM15 A(lacZYA-argF)U169 deoR, recAl endAl
hsdR17(rk mi¡+ phoA supE44 X thi-1 gyrA96 relAl
BL21
F' ompT hsdSB (rb mB ) gal dcm
MC4100
CK1953
E. coli FaraD 139A, (argF lac) U169, relA, rspP, thiA
[109]
5. mutans
MC4100, secB::Tn5
[109]
NG8
Wild-type serotype c
[110]
UA159
Wild-type serotype c
[111]
PC3370
spaP-negative mutant derived from S. mutans NG8
[54]
PC3370A
PC3370 transformed with pDL289
[54]
PC3370B
PC3370 transformed with pMAJJ8
[54]
PC3370C
PC3370 transformed with pMAD
[54]
PC3370D
PC3370 transformed with pTS21
(This study)
SM12
UA159 minimal expression of dnaK
(Courtesy of J. Lemos, unpublished)
TW90
UA159 (ropA)
[112]
S. gordonii M5
Wild-type
[113]


Table 2. Plasmids
Plasmid
Description
Source or Reference
pCR2.1-T0P0
T/A cloning vector
(Invitrogen Corp., San Diego, CA)
pMal-p
Vector for expression of maltose binding protein fusions
(NEB, Beverly, MA)
pMA3
pMal-p derived plasmid containing PCR-amplified DNA
encoding amino acids 819 to 1017 of P1
[54]
pMA41
pMal-p-derived plasmid containing PCR-amplified DNA
encoding amino acids 186 of 469 of PI
[54]
pDL289
E. co//-streptococcal shuttle vector provided by D. le Blanc
[114]
pMAJJ8
pDL289-derived plasmid containing internally deleted spaP
encoding amino acids 1 to 825 and 997 to 1561
[54]
pDC20
pUC18-derived plasmid containing PCR-amplified spaP
encoding full-length PI
[54]
pMAD
pDL289-derived plasmid containing PCR-amplified spaP
encoding full-length PI
[54]
pGEX-4T-2
Vector for expression of glutathione S-transferase fusions
(Amersham Biosciences)
pGEX-A
pGEX-4T-2 derived plasmid containing PCR-amplified
DNA encoding amino acids 179-466 of PI
(This study)
pGEX-P
pGEX-4T-2 derived plasmid containing PCR-amplified DNA
encoding amino acids 816-1016 of PI
(This study)
pGEX-AP
pGEX-4T-2 derived plasmid containing PCR-amplified DNA
encoding amino acids
(This study)
pGEX-BP
pUC18-derived plasmid containing internally deleted spaP
encoding amino acids 1 to 178 and 465 to 1561
[115]
pTS21
pDL289-derived plasmid containing internally deleted
encoding amino acids 1 to 178 and 465 to 1561
[115]


Table 2, continued
Plasmid
Description
Source or Reference
pTS22
pTS21 containing S. gordon M5 DNA encoding the A-region
of SspA
(This study)
pTS23
pTS21 containing S. gordon M5 DNA encoding the A-region
of SspB
(This study)
pTS31
pDL289 derived plasmid encoding PI expressed as
discontinuous N-terminal (a.a. 1-464) and C-terminal
(a.a.465-1561) fragments
(This study)
pTS30
pUCl8-derived plasmid containing spaP encoding amino
acids 1 to 465 and 466 to 1561
(This study)
pTS31
pDL289-derived plasmid containing spaP encoding amino
acids 1 to 465 and 466 to 1561
(This study)
pAR-A
pGEX-6T-P-derived plasmid containing S. gordon M5 DNA
encoding the A-region of SspA
[116]
pAR-B
pGEX-6T-P-derived plasmid containing S. gordon M5 DNA
encoding the A-region of SspB
[116]
pDDA
pGEM7-derived plasmid containing S. gordon M5 DNA
encoding SspA driven by the SspB promoter region
(D. Demuth, unpublished)
pEB-5
pUC19-derived plasmid containing S. gordon M5 DNA
encoding SspB
[25]


Table 3. PCR Primers
Primer
TS7
TS8
TS9K
TS10K
TS17
TS18
TS19
TS20
TS21
TS22
TS24
TS25
TS28
TS29
TS41
TS42
TS43
DNAKS
DNAK.AS
16SRVS
16SFWD
Sequence
Target Underlined
Restriction Site
5- GCCGACTATCCAGTTAAGTTAAAGGC-3
5-GCCATACTGTTCTTTAGTTGCCTG-3
5 -GCGGJACCGTTGG AT AAAGTGTGGAGTTTG-3
5 -GCGGTACCGC AGT GCGAAGT ACCTT ATC-3
5-AAACTCGAGTCATTCATTCATTGTTCATCTTCGTATGCCT-3
5 -AAACTCGAGGGAGGAAAAATGGCTTCTATT A AAGCTGCACTG-3
5 -G AAGACTTAAAAGCTC ATC AAGC-3
5 -CAACTTTTTCTTAT ATTTGGC AAGATC-3
5 -AAAGATCTAAAAAGTC ATCAAGAAGAAGT-3
5 -GAACTCTTTCTT AT ATTTGGC AAGATC-3
5 -GGAJCC AAAGATATGGCAGCTC ATAAAGC-3
5-GTCGACGATAAATCTTTTTGATATTTGGCAAGATCTG-3
5 -GGATCCGGT AAAAT CCGT GCGGTT AAT-3
5 -GJCGACGACACC AAAGTTCTGTCAATATTAA-3
5 -GGATCCGGT AAAATTCGTGCGGTCAAC-3
5 -GTCGACAACCAATGTCCGGTCGAT ATC-3
S-GGATCCTCAAACATTAATGCAATTGGGGTTC-3
5 -GGAGATGCTGTTGGCGGTGT-3
5 -GGAAGTATAACAGCATTCGCTGA-3
5 -ATATCTACGC ATTTCACCGC-3
5- GCTCTGGAAACTGTCTGACT-3
spaP
spaP
spaP Kpn I
spaP Kpn I
spaP
spaP
sspA
sspA
sspB
sspB
spaP
Bam HI
spaP
Sal I
spaP
Bam HI
spaP
Sal I
sspA
Bam HI
sspA and sspB
Sal I
sspB
Bam HI
dnaK
dnaK
16S RNA
16SRNA


19
purification of the fusion proteins was performed by passage of the periplasmic fractions
through a column of amylose resin (Bio-Rad) and elution with 10 mM maltose by a
standard protocol [108], Purified fusion proteins were quantified using the bicinchoninic
acid (BCA) protein assay kit (Sigma) with bovine serum albumin as the standard.
Enzyme-Linked Immunosorbent Assays (ELISA) to Detect A-region and P-Region
Interaction
Binding of the A-region to the P-region was measured by ELISA. Sample wells of
Costar High Binding plates (Coming Incorporated, Coming, N.Y.) were coated overnight
at 4C, in triplicate, with 100 pi of 0.1 M carbonate-bicarbonate buffer (pH 9.6)
containing 0.02% sodium azide and 100 ng of purified maltose binding protein (MBP),
A-region-MBP, or P-region-MBP. Coating buffer and unbound antigens were removed
from the ELISA plate wells, and unreacted sites were blocked with PBS-Tw and
overnight incubation at 4C. Plates were washed four times with PBS-Tw. Purified A-
region-MBP, P-region-MBP, and MBP were two-fold serially diluted in PBS-Tw and
added to the wells, beginning at 1000 ng/well. The plates were incubated overnight at
4C and washed four times with PBS-Tw. A-region-specific MAb 3-8D [35] or rabbit
anti-MBP Ab (NEB, Beverley, MA) was added to the wells at a 1:1000 dilution. Plates
were washed with PBS-Tw and peroxidase-labeled goat anti-mouse IgG or goat anti
rabbit Ig (Cappell) were added to the wells at a 1:1000 dilution. After washing, 100 pi of
0.01 M phosphate citrate buffer (pH 5.0) containing 0.1 M o-phenylenediamine
dihydrochloride and 0.012% (vol/vol) hydrogen peroxide were added to each well. Plates
were incubated for 30 min at room temperature, and the absorbance at 450 nm was
recorded by using an MPM Titertek model 550 ELISA plate reader (Bio-Rad).


20
Elimination of spaP DNA Encoding the A-Region
Fragments oispaP both upstream and downstream of the A-region were amplified
by polymerase chain reaction (PCR) and subsequently ligated together to create spaPAA.
Fidelity of the reactions was confirmed by restriction and sequence analysis. Forward
primer TS9k and reverse primer TS8 were used to amplify spaP DNA upstream of the A-
region, including the spaP promoter. Forward primer TS7 and reverse primer TSIOk
were used to amplify spaP downstream of the A-region. Primers TS9 and TS10 contain
engineered Kpn\ restriction sites. Primers TS7 and TS8 were engineered with single base
changes that introduce silent mutations, which upon ligation of the PCR products produce
a unique Sfol restriction site. Reactions were carried out in a UNO thermoblock
thermocycler (Biometra, Tampa, FL) with plasmid-encoded spaP, pDC20 [54] as the
template and VENT polymerase (NEB) under the following conditions fo 30 cycles:
denaturation at 94C for 30 seconds, primer annealing at 53C for 30 seconds, primer
extension at 72C for 1 minute or 3 minutes and 30 seconds; and final extension at 72C
for 7 min. The resulting 727 and 3,568 bp gene fragments were ligated together and
cloned into the Sma\ site of pUC18, creating pTS20, which was introduced into E. coli
DH5a by electroporation. Clones were screened on LB agar supplemented with 100
pg/mL ampicillin and 0.75 pg/mL X-gal (5-bromo-4 chloro-3 indolyl-p-D-
galactopyranoside). White colonies were picked and tested for the presence of spaPAA
insert DNA after alkaline lysis. Sequences of all recombinant constructs were confirmed
by the DNA sequencing core (University of Florida).


21
Evaluation of Antibody Binding to P1AA
E. coli DH5a harboring pTS20 or pDC20 were grown for 16 hours at 37C ,
harvested by centrifugation, and lysed by boiling for 5 minutes in SDS-sample buffer
(4% [wt/vol] sodium dodecyl sulfate [SDS], 2% [vol/vol] 2-mercaptoethanol, 20%
[vol/vol] glycerol, 125 mM Tris-HCl [pH 6.8], 0.1 mg of bromophenol blue per ml).
Proteins were separated by SDS-polyacrylamide gel electrophoresis on 7.5% (vol/vol)
acrylamide preparatory gels by the method of Laemmli [117]. Proteins were
electroblotted onto nitrocellulose membrane (Schleichter and Schuell, Keene, N.H.) for 1
h at 100 V by the method of Towbin et ai. [118], Immunoblots were blocked with PBS-
Tw and cut into 0.5 cm strips. Strips were incubated with anti-Pl MAbs [119, 120] at
dilutions of 1:1000 in individual troughs of an Incutray (Schleichter and Schuell). After
washing, strips were incubated in peroxidase-labeled goat anti-mouse IgG (Cappel) and
developed with 4-chloro-l-naphthol solution (7 ml of PBS, 1 ml of 4-chloro-l- naphthol
[Sigma; 3 mg/ml in ice-cold methanol], and 8 pi of 30% [vol/vol] hydrogen peroxide).
Assessment of Epitope Restoration by ELISA
Sample wells of Costar High Binding plates were coated as before with 500 ng of
purified maltose binding protein (MBP), A-region-MBP, or P-region-MBP. Following
blocking and washes as previously, purified A-region-MBP, P-region-MBP, and MBP
were serially diluted two-fold in PBS-Tw and added to the wells, beginning at 500
ng/well. The plates were incubated overnight at 4C and washed four times with PBS-
Tw. MAbs 4-10A, 5-5D, and 6-11A were added to the wells at a 1:1000 dilution.
Binding of the MAbs was traced with peroxidase-labeled goat anti-mouse IgG at a


22
1:2000 dilution, the plates were developed, and the absorbance was measured as
previously described.
PCR and Construction of S. mutans spaP and S. gordonii M5 sspA and sspB
Subclones
The P-regions of S. gordonii M5 sspA and sspB and several regions of spaP were
amplified by PCR and cloned into the pGEX-4T-2 vector (Amersham Biosciences) for
expression as fusion polypeptides with glutathione S-transferase (GST). Forward and
reverse primers were designed based upon the published sequences of sspA and sspB
(accession numbers U40025 and U40026 respectively) and the unpublished sequence of
NG8 spaP. The primer sequences and engineered restriction sites are shown in Table 3.
The following primers were used in these amplifications: sspA P-region (a.a. 808-1008) -
TS41 and TS42, sspB P-region (a.a. 749-942) TS42 and TS43, spaP A-region (a.a. 179-
466) TS24 and TS25, and spaP P-region (a.a. 816-1016) TS28 and TS29. These
primers were engineered with BamHX and SalI restriction sites to enable subsequent
cloning into the pGEX-4T-2 expression vector.
PCR was performed for 30 cycles under the following conditions: denaturation at
95C for 3 min; primer annealing at 51C for 30 sec; and primer extension at 72C for 40
sec. Final primer extension was carried out for an additional 7 min after the last cycle.
The amplified PCR products of correct predicted size were cloned into the T/A cloning
vector pCR2.1-TOPO (Invitrogen). This vector is supplied linearized with overlapping
thymidine residues that can be ligated to the overhanging adenosine residues generated in
the PCR-amplified products. Insertion of foreign DNA into this region prevents the
expression of lacZa allowing for blue-white screening of E. coli transformants. Ligated
pCR2.1 and PCR amplified products were used to transform E. coli DH5a by calcium


23
chloride [121]. Clones were screened on LB agar supplemented with 50 pg/mL
kanamycin and 0.75 pg/mL X-gal. White colonies were picked and tested for the
presence o sspA, sspB, and spaP insert DNA after alkaline lysis. Plasmid DNA from
each recombinant was restricted with Bam HI (Promega) and Sail (Promega), and
electrophoresed on 0.7% (wt/vol) agarose. The appropriate sized DNA fragments were
excised from the gel and purified using a Qiagen gel extraction kit. The sspA, sspB, and
spaP fragments were ligated into Bam HI (Promega) and Sail (Promega) linearized
pGEX-4T-2 resulting in directional cloning downstream of the gst gene, which encodes
the glutathione S-transferase (GST) of Schistosoma japonicumi. Ligated DNA was used
to transform E. coli BL21 and transformants were selected for on LB agar supplemented
with 100 pg/mL of ampicillin and 75 pg/mL X-gal. White colonies were screened for the
presence of -spaP-containing insert DNA as described previously.
The pGEX-4T-2-derived plasmids encoding the PI A- and P-regions were
designated pGEX-A and pGEX-P, respectively. The plasmids encoding the SspA and
SspB P-region-GST fusions were designated pGEX-AP and pGEX-BP.
Purification and Confirmation of GST-Fusion Proteins
Recombinant E. coli harboring plasmids encoding GST-fusion proteins and pGEX-
4T-2 as a control were grown for 16 hours in LB broth supplemented with 100 pg/ml of
ampicillin (LB/A100) and passaged 1:100 into LB/A100. Following shaking at 25C
until an optical density at 600 nm of 0.5 was achieved, cultures were supplemented with
0.1 mM IPTG and grown for an additional 4 hours at 25C.
To confirm expression of each fusion protein, lysates from each recombinant E.
coli, as well as uninduced controls, were analyzed by SDS-PAGE and Western


24
immunoblot on 7.5% (wt/vol) polyacrylamide gels. Proteins in the gels were
electroblotted onto nitrocellulose membranes for 1 hour at 100 volts. Replicate filters
were stained with colloidal gold (Diversified Biotech, Boston, MA) or blocked for 1 hour
at room temperature with PBS-Tw. Membranes were incubated overnight at room
temperature with anti-GST rabbit polyclonal antisera (Amersham Biosciences) diluted
1:1000 in PBS-Tw. Membranes were washed four times with PBS-Tw prior to
incubation for 2 hours at room temperature with affinity-purified peroxidase-labeled goat
anti-rabbit conjugate (ICN/Cappell ICN Biomedicals, Aurora, OH) diluted 1:1000 in
PBS-Tw. Membranes were washed twice with PBS-Tw and twice with PBS prior to
development with 4-chloro-l-napthol solution for 30 min.
The PI-GST fusion proteins were purified by affinity chromatography using
glutathione sepharose 4B (Amersham Biosciences). IPTG induced recombinant E. coli
were resuspended in PBS containing 1 mM PMSF (phenylmethylsulfonyl fluoride) and
lysed by sonication on ice 5 times for 15 seconds at power setting 3 using a Sonic 300
Dismembrator (ARTEK Systems Corporation, Farmingdale, NY). Triton X-100 was
added to the sonicate to a final volume of 1% (vol/vol). Following a 30 minute
incubation at 25C, the sonicate was centrifuged for 10 minutes at 12,000 xg, and the
supernatant was applied to the glutathione sepharose 4B. After repeated washes with
PBS, the bound fusion proteins were eluted with 10 mM reduced glutathione in 50 mM
Tris-HCl, pH 8. The recovery of purified Pl-GST fusion proteins was confirmed by
Western immunoblot using anti-GST rabbit polyclonal antisera (Amersham Biosciences).
Purified fusion proteins were quantified using the bicinchoninic acid (BCA) protein assay
kit (Sigma) with bovine serum albumin as the standard.


25
Competitive Inhibition ELISA to Detect A-Region and P-Region Interaction
Individual wells of Costar High Binding plates (Coming Incorporated, Coming,
N.Y.) were coated overnight at 4C, in triplicate, with 100 pi of 0.1 M carbonate-
bicarbonate buffer (pH 9.6) containing 0.02% (wt/vol) sodium azide and 100 ng of PI.
Coating buffer and unbound antigens were removed from the ELISA plate wells and
unreacted sites were blocked with PBS-Tw and overnight incubation at 4C. Plates were
washed four times with PBS-Tw. Purified A-region-GST, P-region-GST, a 1:1 molar
ratio of A-region-GST and P-region-GST, and GST were added to MAb 4-10A, diluted
1:8000, to a final concentration of 1 nM. Controls included MAb 4-10A alone and no
primary antibody. The mixtures of Pl-GST fusions and MAb 4-10A were incubated at
4C for 30 minutes and then applied to the PI coated ELISA plate at 100 pi per well.
The plates were incubated for 2 hours at 37C and washed four times with PBS-Tw. The
binding of MAb 4-10A to the immobilized PI was traced with peroxidase-labeled goat
anti-mouse IgG (Cappell) at a 1:2000 dilution. The plates were developed with 4-CN,
and absorbance was measured as previously described. The percent inhibition of MAb 4-
10A binding to captured PI was calculated as 100 [(mean OD of Mab 4-10A + Pl-
GST fusion /mean OD of MAb 4-10A alone) x 100].
Binding Stoichiometry of the A- and P-Regions by Continuous Variation
A variation on the Job Plot [122] was used to measure the binding stoichiometry of
the A- and P-regions required for the formation of the MAb 4-10A epitope. Purified A-
region-GST and P-region-GST fusion proteins were diluted in 0.1 M carbonate-
bicarbonate buffer (pH 9.6) containing 0.02% (wt/vol) sodium azide and then mixed in 7
different molar ratios (0:6, 1:5, 2:4, 3:3, 4:2, 5:1, and 6:0) while maintaining a constant


26
total concentration of 0.67 pM. The mixtures were incubated at 4C for 1 hour, and then
100 pi per well was applied to a Costar High Binding plate (Coming Incorporated,
Coming, N.Y.) in triplicate. The plate was incubated overnight at 4C. Coating buffer
and unbound antigens were removed from the ELISA plate wells, and unreacted sites
were blocked with an overnight incubation in PBS-Tw at 4C. After washing 4 times
with PBS-Tw, MAb 4-10A was added to the wells at a 1:1000 dilution. Wells were
washed with PBS-Tw and peroxidase-labeled goat anti-mouse IgG was added to the wells
at a 1:2000 dilution. After washing, the plate was developed with OPD, and absorbance
was measured as above.
Analysis of PI Translocation and the Contribution of the Alanine- and Proline-Rich
Regions
Introduction of spaAA into S. mutans PC3370
The spaPAA DNA, including the promoter, was restricted by Kpn I from pTS20
and isolated by gel electrophoresis and purification with a Qiagen gel extraction kit. The
purified spaPAA was ligated into the Kpn I site of the E. coli S. mutans shuttle vector
pDL289, creating pTS21, and introduced into E. coli DH5a by electroporation. Clones
were screened on LB agar supplemented with 50 pg/mL ampicillin. Colonies were
picked and tested for the presence of spaPAA insert DNA after alkaline lysis. pTS21 was
subsequently introduced to the S. mutans spaP-negative mutant PC3370 by natural
transformation. An overnight culture of PC3370 grown in THYE media was diluted 1:20
into THYE media containing 5% (vol/vol) sterile horse serum (THYHS). The culture
was grown to Klett 100 at 37C at which time pTS21 (pg/ml) was added. After an
additional 30 minutes at 37C, an equal volume of THYHS was added to the cultures.


27
Following 90 minutes at 37C, transformants were screened on THYE agar supplemented
with 500 pg/mL kanamycin. The sequences of all recombinant constructs were
confirmed by the DNA sequencing core (University of Florida).
Analysis of P1AA Cell Surface Expression in PC3370
The spaP isogenic mutant PC3370 harboring plasmids encoding PI (pMAD),
P1AA (pTS21), PI AP (pMAJJ8) and vector only (pDL289) were grown for 16 hours at
37C, the cells were harvested by centrifugation and washed twice with PBS. Cells were
resuspended in PBS, and the densities of the suspensions were equalized at Klett 160.
Twofold serial dilutions of the cell suspensions were made in PBS, and 100 pi of each
dilution was applied in duplicate to two nitrocellulose membranes (Schleicher and
Schuell) by using a 96-well dot blot manifold (Schleicher and Schuell). Wells were
washed twice with 200 ml of PBS, and the filters were removed from the apparatus and
blocked with PBS containing 0.25% (wt/vol) gelatin and 0.25% (vol/vol) Tween 20. Cell
surface PI was detected with rabbit antiserum 230 [37] or Mab 3-10E [119] as the
primary antibodies diluted 1:500, peroxidase-conjugated goat anti-rabbit IgG and goat
anti-mouse IgG as the secondary antibodies diluted 1:1000, and development with 4-
chloro-l-naphthol solution.
RNA and Dot Blotting for Confirmation of P1AA Expression in PC3370
Following the manufacturers protocol, RNA was isolated from stationary phase
cultures of PC3370 harboring pDL289, pTS21 (P1AA), and pMAD (PI) using the Qiagen
Rneasy kit (Qiagen, Valencia, CA). Total RNA concentration was measured by OD260/280
nm and standardized to ~92 pg/ml by the addition of RNA dilution buffer (6x SSC, 20%
formaldehyde). Samples were serially diluted two-fold, and 50 pi of each were applied


28
to a nylon membrane using a 96-well dot blot manifold (Schleicher & Schuell). The
membrane was baked for 30 minutes at 120C and incubated in DIG Easy Hyb (Roche,
Indianapolis, IN) for 2 hours at 37C. The membrane was probed overnight at 37C with
digoxigenin-labeled, PCR amplified, DNA complementary to the 3 end of spaP,
nucleotides 3985-4125. The membrane was washed, blocked for 1 hour at 25C in
Roche blocking buffer, and incubated in alkaline phosphatase-labeled anti-digoxigenin
antibodies. After washing in detection buffer, chemiluminence substrate, CSPD, was
added and the membrane was exposed to Super Rx x-ray film (Fuji, Tokyo).
Western Immunoblot Analysis of Periplasm Extracts from E. coli MC4100 and
CK1953 Harboring pUC18, pDC20, pDC9, and pTS20
Periplasm contents of£. coli DH5a harboring pUC18, pDC20, pDC9, or pTS20
and E. coli MC4100 and CK1953, a secB mutant [109], harboring pUC18 or pDC20 were
extracted by osmotic shock [108]. Briefly, cells were grown for 16 hours at 37C. The
medium was supplemented with 0.3 mM IPTG to induce P-galactasidase expression, and
the culture was incubated for an additional 2 hours at 37C harvested by centrifugation
at 7000 x g for 10 minutes, and resuspended in 30 mM Tric-HCl/20% (wt/vol) sucrose,
pH8.0, and EDTA to a final concentration of ImM. The cells were incubated at 25C for
10 minutes while shaking, harvested by centrifugation for 10 minutes at 10,000 x g, and
resuspended in ice-cold 5 mM MgSCV Cells were next incubated in an ice bath for 10
minutes, centrifuged for 10 minutes at 10,000 x g, and again decanted. One molar Tris-
HC1, pH 7.4, was added to the supernatant to a final concentration of 20 mM. The
supernatant containing the periplasm contents was diluted 5:1 with SDS sample buffer
and incubated for 5 minutes at 100C. The cell pellets were resuspended in SDS-sample
buffer and also heated for 5 minutes at 100C. Proteins were separated on 7.5% (wt/vol)


29
SDS-polyacrylamide gels and transferred to nitrocellulose for 1 hour at 100V.
Immunoblots were blocked and developed as described above for the dot blot assay.
Construction of a Bicistronic spaP for Expression of a Discontinuous Pi.
The following engineering produced a genetic construct encoding spaP that
expressed PI as two independent fragments, the N-terminal 465 residues and the C-
terminal 1095 residues. Fragments of spaP both upstream and downstream of the 3 end
of the A-region were amplified by PCR and subsequently ligated together to create a
split spaP (Fig. 3-5). Forward primer TS9k and reverse primer TS17 were used to
amplify spaP DNA upstream of the 3 end of the A-region, including the spaP promoter.
Forward primer TS18 and reverse primer TS1 Ok were used to amplify spaP downstream
of the A-region. Primers TS9 and TS10 were engineered with Kpnl restriction sites and
primers TS17 and TS18 contain engineered Xhol restriction sites (Table 3). Primer TS17
also encodes multiple stop codons for the termination of the N-terminal PI fragment
translation. Primer TS18 contains the spaP ribosome binding site and encodes a start
codon for translation of the C-terminal PI fragment. Reactions were carried out in a
UNO thermoblock thermocycler (Biometra, Tampa, FL) with plasmid-encoded spaP,
pDC20 [54] as the template and HiFi DNA polymerase (Invitrogen) for 30 cycles under
the following conditions: denaturation at 94C for 30 seconds, primer annealing at 51 C
for 1 minute, primer extension at 68C for 2 minutes and 30 seconds or 72C for 1
minute and 30 seconds; and a final extension at 72C or 68C for 7 min. The resulting
1,653- and 3,536-bp gene fragments were restricted with Xhol before being ligated
together. The ligated fragments were gel purified and amplified by PCR as before using
primers TS9 and TS10 under the following conditions for 30 cycles: denaturation at 94C
for 30 seconds, primer annealing at 58C for 1 minute, primer extension at 68C for 3


30
minutes 45 seconds; and 68C for an additional 7 min. The PCR product was cloned into
the pCR 2.1-TOPO vector, creating pTS30, which was introduced into E. coli Top 10
cells according to manufacturers instructions. Clones were screened on LB agar
supplemented with 50 pg/mL kanamycin and 0.75 pg/mL X-gal. White colonies were
picked and tested for the presence of spaP insert DNA after alkaline lysis. Plasmid
pTS30 from the recombinant was restricted with Kpnl and electrophoresed on 0.7%
(wt/vol) agarose. The appropriate sized split spaP DNA fragment was excised from the
gel and purified with the Qiagen gel extraction kit. The split spaP sequence was ligated
into the Kpnl site of the shuttle vector pDL289, creating pTS31, and used to transform E.
coli DH5a by electroporation. Transformants were selected for on LB agar
supplemented with 50 pg/mL of kanamycin and 0.75 pg/mL X-gal. White colonies were
screened for the presence of spaP-containing insert DNA as before. Sequences of all
recombinant constructs were confirmed by the DNA sequencing core (University of
Florida).
Evaluation of PI Fragment Expression by Western Immunoblot.
E. coli DH5a harboring pTS30 was grown for 16 hours at 37C, harvested by
centrifugation, and lysed by boiling for 5 minutes in SDS-sample buffer (4% [wt/vol]
sodium dodecyl sulfate [SDS], 2% [vol/vol] 2-mercaptoethanol, 20% [vol/vol] glycerol,
125 mM Tris-HCl [pH 6.8], 0.1 mg of bromophenol blue per ml). Proteins were
separated by SDS-polyacrylamide gel electrophoresis on 7.5% acrylamide preparatory
gels by the method of Laemmli [117], Proteins were electroblotted onto nitrocellulose
membrane (Schleichter and Schuell, Keene, N.H.) for 1 h at 100 V by the method of
Towbin et al. [118], Immunoblots were blocked with PBS-Tw. Membranes were


31
incubated with A-region specific mAb 3-8D, A- and P-region dependent mAb 4-10A, and
C-terminal specific mAb 5-3E [119, 120] at dilutions of 1:000. After washing,
membranes were incubated in peroxidase-labeled goat anti-mouse IgG (Cappel) and
developed with 4-chloro-l-naphthol solution.
Evaluation of Surface Expression of Discontinuous PI in S. mutans
Plasmid pTS31 was introduced into S. mutans PC3370 by natural transformation as
before. S. mutans NG8 and PC3370 harboring pDL289 and derivatives expressing PI
(pMAD) and discontinuous PI fragments (pTS31) were grown for 16 hours at 37C .
Cells were harvested, applied to a nitrocellulose membrane, and surface expression of PI
was traced as before with MAbs, 3-8D, 4-9D, 4-10A, 5-5D, 6-11 A, and 3-10E.
Introduction of S. gordonii SspA and SspB A-Regions into P1AA
DNA encoding the A-regions of sspA and sspB were amplified by PCR and ligated
into the plasmid encoding P1AA, pTS21. pTS21 was constructed with two silent
mutations that created a unique Sfo I recognition sequence at the site of the deleted A-
region DNA [115]. PCR was used to amplify DNA fragments of sspA and sspB that
encode 287 residues, which are homologous to the deleted A-region in the spaP construct
PI AA. Primers TS19 and TS20 were used to amplify the sspA DNA fragment and
primers TS21 and TS22 were used to amplify the sspB fragment (Table 3). Reactions
were carried out in a UNO thermoblock thermocycler (Biometra, Tampa, FL) with
chromosomal sspA and sspB as the templates and VENT polymerase (NEB) under the
following conditions: (i) 94C for 2 minutes; (ii) 30 cycles of 94C for 30 seconds, 50C
for 30 seconds, 72C for 30 and (iii) 72C for an additional 7 min. The resulting 861 bp
gene fragments were cloned into the Sfo I site of pTS21 with E. coli DH5a as the host
strain. Plasmid DNA was isolated from clones and insert orientation was confirmed by


32
restriction digest and sequencing. The resulting plasmids, designated pTS22 (sspA A-
region) and pTS23 (sspB A-region), were introduced into the S. mutans spaP-negative
mutant strain PC3370 by natural transformation as previously described. Transformants
were selected for their ability to grow on THYE containing 500pg/ml of kanamycin.
Western Immunoblot Analysis of Chimeric PI Containing the A-region of S.
gordonii SspA and SspB
Whole cell lysates ofE co/iDH5a harboring pTS22 and pTS23 and mechanically
lysed S. mutans PC3370 harboring the same plasmids were electrophoresed on 7.5%
(wt/vol) SDS-PA gels, transferred to nitrocellulose, and traced with a panel of eleven
anti-Pl mAbs as previously described.
Surface Expression of SspA and SspB in S. mutans PC3370
S. gordonii M5 SspA and SspB were expressed in the spaP-negative mutant
PC3370, and translocation to the cell surface was determined by whole cell dot blot.
Plasmids containing sspA driven by the sspB promoter, pGEM-.s.s/?/f (unpublished), and
sspB, pEB-5 [25] were kindly donated by D. Demuth (University of Pennsylvania,
Philadelphia, PA). pGEM-ssjM was linearized with Sac I and blunted with BClenow
fragment, followed by a second digestion with Sphl. The sspA fragment was gel purified,
ligated into the Sphl-Smal site of the streptococcal shuttle vector pDL289 and introduced
into PC3370 by natural transformation. pEB-5 [25] was digested with BamHl and Ecor\
and the appropriate-sized sspB band was gel purified. The sspB fragment was ligated
into pDL289 and introduced into PC3370 as previously described. Transformants were
selected for their ability to grow on THYE containing 500pg/ml of kanamycin.


33
Involvement of RopA (Trigger Factor) and DnaK in the Maturation and
Translocation of PI
Evaluation of PI Surface Expression by Whole Cell Dot Blot in the S. mutans ropA
Mutant, TW90
Whole cell dot blots of TW90 [112], courtesy of Tom Wen (University of Florida,
Gainesville, FL), were used to determine whether the reduction in adherence was due to a
reduced level of surface localized PI. UA159 and TW90 were grown for 16 hours at
37C in THYE broth. The cells were passaged into triplicate cultures at 1:50 in THYE
broth, grown at 37C to a Klett reading of 50, and passaged again in THYE broth at 1:50.
Cells were grown to Klett readings of 20 and 150, harvested by centrifugation, and
washed twice with PBS. Cells were resuspended in 50% of the original culture volume
of PBS. Two-fold serial dilutions of the cell suspensions were made in PBS, and 100 pi
of each dilution was applied to replicate nitrocellulose membranes (Schleicher and
Schuell) by using a 96-well dot blot manifold (Schleicher and Schuell). Wells were
washed twice with 200 pi of PBS, and the filters were removed from the apparatus and
blocked with PBS containing 0.25% (wt/vol) gelatin and 0.25% (vol/vol) Tween 20. PI
was detected with five anti-Pl monoclonal antibodies [33] that recognize cell surface PI
as well as with rabbit polyclonal serum as the primary antibodies, each diluted 1:500.
Secondary antibodies were goat anti-mouse IgG or goat anti-rabbit Ig (MP Biomedicals,
Irvine, Ca) diluted 1:1000. The membranes were developed with 4-chloro-l-naphthol
solution. Quantification of PI surface expression was performed by densitometry using a
Fluorchem imager and software (Alpha Innotech, San Leandro, Ca).


34
Evaluation of PI Surface Expression by Whole Cell Dot Blot in S. mutans SM12, a
Low-Level Expresser of DnaK
To examine the contribution of DnaK to PI surface expression, a whole cell dot
blot experiment as above was performed using S. mutans SMI2, which was engineered to
express approximately 5% of the level of DnaK as the parent strain, UA159 (Lemos and
Bume, in preparation, University of Florida, Gainesville, FL)). S. mutans UA159 and
SM12 were grown and harvested at early-log and stationary phases, Klett readings of 20
and 150, and surface expression was determined as previously detailed.
Analysis of dnaK Message Levels by Quantitative Real-Time PCR
Real-Time PCR was utilized to evaluate the effects of expression of the A- and P-
region deletion constructs on dnaK mRNA level. Cultures of PC3370 harboring pDL289
(shuttle vector), pMAJJ8 (P1 AP-region), and pMAD (PI), and pTS21 (PI AA-region)
were grown in triplicate to Klett 100 after multiple passages, as above. RNA from each
culture was isolated according to suppliers instructions using the Qiagen RNeasy kit
(Qiagen, Valencia, CA). The total RNA concentration was measured by OD 260/28onm.
cDNA of dnaK and 16S RNA was synthesized from 0.5 pg of RNA using primer
dnaKAS and 16sRVS respectively, and Superscript II reverse transcriptase (Invitrogen,
Carlsbad, CA) for 10 minutes at 25C, 50 minutes 42C, and 15 minutes at 70C.
Transcript levels were determined by using iQ SYBR Green Supermix (Bio-Rad,
Hercules, CA). Reactions were performed in a 25-pl volume using the manufacturer's
protocols. The forward primers for dnaK and 16s RNA were DnaKS and 16SFWD.
Amplification was performed under the following conditions: 30 seconds at 95C,
followed by 40 cycles of 10 seconds at 95C and 45 seconds at 60C. Melt curve data
was collected with an additional 100 cycles of 10 seconds starting at 60C and increasing


35
by 0.4C after cycle 2 and 15 seconds at 72C. DNA amplification and fluorescence
detection was performed with the ¡Cycler IQ real-time PCR detection system and
accompanying software (Bio-Rad). A standard curve was plotted for the reaction with
values obtained from the amplification of known quantities of DNA from dnaK. 16s
RNA was used to normalize RNA abundance for all reactions. For each experiment,
cDNA was amplified from RNA which was freshly isolated from each of three parallel
cultures of each transformant. Real-Time PCT was conducted on each cDNA sample
triplicate resulting in 36 data points for each transformant


CHAPTER 3
RESULTS
Expression of Recombinant P1AA and Recognition by Anti-Pi Monoclonal
Antibodies
Regions of PI that contributed to the epitopes for eleven anti-Pl mAbs were
identified based on immunoblot analysis of full-length and truncated PI polypeptides.
Several of these mAbs, 6-11A, 5-5D, 3-10E, and 1-6F, were initially mapped to the
central region of the protein, which contained the P-region [120], Deletion of the P-
region (a.a. 826-996) from PI eliminated the binding of mAbs 6-11 A, 5-5D, 3-10E, and
4-10A. A region contributing to the binding of mAb 4-10A had also been mapped to the
region just amino-terminal to the central region. Surprisingly, none of the P-region-
dependent mAbs bound to a P-region subclone (a.a. 819-1017) [54] suggesting that the
epitopes were complex and possibly conformational. Characterization of the epitope for
mAb 6-11A was conducted by Rhodin et al [123], Construction of several PI subclones
and analysis by Western immunoblot revealed that residues 465-1561 were not sufficient
for the binding of mAb 6-11 A. These data suggested that the P-region and residues
amino-terminal of a.a. 465 were necessary for mAb 6-11A binding. Taken together with
crystal structure data indicating that the A-region and P-region may be in close proximity
[30], we elected to examine whether the A-region contributed to a complex structure also
involving the P-region. A spaP gene lacking DNA encoding the A-region (a.a. 179-466)
was constructed by PCR and cloned into pUC18, creating pTS20, as detailed in Chapter
2. PI lacking the A-region (PI AA) was detectable by Western immunoblot in whole cell
36


37
lysates of recombinant E. coli DH5a using anti-Pl polyclonal antibodies (data not
shown). While full-length PI migrates approximately 20-kD larger than its predicted
~165 kD on SDS-polyacrylamide gels, P1AA, like P1AP, migrates at its predicted
molecular weight. The effect of deleting the A-region on the antigenicity of PI was
examined by Western blotting utilizing the eleven anti-Pl monoclonal antibodies [33].
Deletion of the A-region from PI eliminated the reactivity of five of the eleven mAbs
(Figure 2). Three of the non-reactive mAbs, 4-10A, 5-5D, and 6-11 A, are also not
reactive with PI AP [54], Reactivity of mAbs 5-3E, 2-8G, 3-3B, and 6-8C, which are
specific to the C-terminus of PI [120], confirmed that the deletion of the DNA encoding
the A-region did not disrupt the reading frame. The Western blot also shows that like
PI AP, PI AA is stably expressed and easily detectable in E. coli.
Evaluation of P1AA Expression in S. mutans
When expressed in S. mutans, PI AP was unstable and not detected on the cell
surface [54], To determine whether the deletion of the A-region resulted in similar PI
characteristics, PI AA was expressed in the spaP mutant PC3370. Whole cell dot blot
analysis of PC3370 harboring pDL289 (vector), pMAD (PI), or pTS21 (P1AA) was used
to examine whether the A-region, like the P-region, is necessary for PI surface
expression in S. mutans. These results are shown in Figure 3. Two-fold serial dilutions
of the cells were applied to the nitrocellulose membrane in duplicate. The positive
control PC3370C expressing full-length PI (row 4) demonstrated the reactivity of the
antiserum with surface expressed PI. Negative controls, PC3370 and PC3370A, vector
only, (rows 1 and 2) showed lack of reactivity of the antiserum with cells lacking PI.
PC3370 harboring pTS21 encoding PI AA (row 3) was not reactive with the polyclonal


38
antiserum indicating a lack of surface expression of PI. These results indicated that
P1AA was not translocated to the surface of PC3370. No PI AA was detected in spent
culture liquor, although PI was found in the spent culture liquor of PC3370C
(complemented spaP mutant) and NG8 (wild-type) (data not shown).
To determine if the lack of detectable PI AA on the surface was due to a problem
with translocation out of the cytoplasm, cell lysates were examined for detectable PI AA.
NG8, PC3370A, PC3370C, PC3370, and PC3370 harboring pTS21 were subjected to
mechanical lysis in a Mini Beadbeater apparatus, and samples were analyzed by Western
blotting (data not shown). Full-length PI was present in both cell extracts and cell debris
of NG8 (wild-type) and PC3370C (complemented spaP mutant). PI AA was not detected
in either the cell extract or the cell debris of PC3370 harboring pTS21, and no PI was
observed in the negative controls, PC3370A (vector only) or PC3370.
Evaluation of s/wP-Specific mRNA in PC3370 Harboring the Deletion Construct
pTS21
With a lack of detectable PI AA in PC3370, an RNA dot blot was used to confirm
that spaPAA was transcribed from the pDL289 shuttle vector in PC3370 (Figure 4).
Dilutions of total cellular RNA were probed with a digoxinin-labeled probe
corresponding to the 3 end of spaP. The top two rows correspond to the negative
controls, PC3370 and PC3370A harboring the vector only. The third row contains RNA
from PC3370 harboring pTS21 and the bottom row contains RNA from the positive
control, PC3370 harboring pMAD. The dot blot shows that spaPAA message is
expressed at levels equivalent to the full-length spaP expressed from pMAD.


39
Evaluation of Secretion of PI, P1AA, and P1AP in E. coli
Since P1AA and PI AP were undetectable and possibly unstable in S. mutans while
being clearly detectable in E. coli, the use of E. coli as a model to determine the secretion
competency of these proteins was examined. To this end, periplasmic extracts of E. coli
DH5a harboring pUC18, pDC20, pDC9, or pTS20 (vector only, and expressing PI,
P1AP, and PI AA respectively) were prepared by osmotic shock, and the presence of PI
and derivatives was detected by electrophoresis on SDS-polyacrylamide gels followed by
Western immunoblotting. These results are shown in Figure 5. Lanes marked C
contain cellular lysates and lanes marked P contain periplasmic extracts. Lanes marked
pDC20 contain cellular extracts from E. coli DH5a harboring pDC20 (full-length PI) and
clearly show that PI is present in both the cytoplasm and the periplasm. Lanes marked
pDC9 show cellular fractions from DH5a harboring pDC9 and show that PI AP is present
in the cytoplasm, but absent from the periplasm. Lanes pTS20 correspond to cell
fractions from DH5a harboring pTS20 and show that, like P1AP, PI AA is present in the
cytoplasm, but not translocated to the periplasm. Lanes marked pUC18 are cellular
lysates and periplasm extracts from E. coli harboring pUC18 (vector only). These results
suggest that E. coli may be a viable model for the study of the intramolecular
requirements for PI translocation.
Interaction of the A- and P-Regions Detected by ELISA
The demonstration that the binding of mAbs 4-10A, 5-5D, and 6-11A to PI were
dependent upon the simultaneous presence of the A- and P-regions and work by van
Dolleweerd et al [ 124] characterizing a complex epitope comprised of the P-region and a
fragment of PI containing the A-region suggested a possible interaction between these


40
domains. To determine whether the isolated A- (a.a. 186-469) and P-regions (a.a. 819-
1017) were capable of such an interaction, ELISA was used to evaluate binding (Figure
6). To facilitate protein purification, the A-region and P-region of PI were expressed as
fusions with maltose-binding protein (MBP), pMA41 and pMA3 respectively (Table 1).
Purified P-region-MBP or MBP alone as a negative control was immobilized in ELISA
plate wells. After washing and blocking the plates, two-fold serial dilutions of A-region-
MBP were added to the wells. Binding of A-region-MBP to the immobilized proteins
was detected by the A-region-specific MAb 3-8D. As shown, the A-region-MBP bound
to P-region-MBP in a dose-dependent manner, but not to MBP alone. MBP alone did not
bind to MBP or to P-region-MBP (data not shown).
Restoration of Epitopes by the Interaction of the A- and P-Regions
The requirement for the simultaneous presence of both the A- and P-regions for
MAb 4-10A, 5-5D, and 6-11A binding to PI suggested that both of these regions
contribute to the epitopes for these mAbs. Reactivity of these mAbs against ELISA
plates coated with the A- and P-regions was tested as above (Figure 7). The ELISA
revealed that while the mAbs did not react to the A- or P-regions alone, they did react to
the wells containing both regions. Additionally, MAb 4-10A reacted equally well
regardless of which region is immobilized, while mAbs 5-5D and 6-11A clearly reacted
better when the P-region is immobilized to the plate.
Inhibition of MAb 4-10A Binding to PI by an A- and P-Region Complex
Competitive inhibition ELISA was used to assay the ability of the A- and P-regions
to interact in solution phase. It was previously shown that the binding of MAb 4-10A to
PI was dependent upon the presence of both the A- and the P-regions. In this assay, the
ability of A-region and P-region-GST fusions alone and together to inhibit MAb 4-10A


41
binding to immobilized PI was analyzed. As shown in Figure 8 as a percentage of
inhibition, MAb 4-10A binding to immobilized Plwas not inhibited by A-region-GST, P-
region-GST, or GST alone. However. MAb 4-10A binding was inhibited by a mixture of
A-and P-region-GST as well as by PI in solution.
Stoichiometry of the A- and P-Region Interaction
A quasi-continuous variation assay was performed to determine the stoichiometry
of the A- and P-region interaction required for the reconstitution of the epitope required
by MAb 4-10A. Varying molar ratios of A- and P-region-GST fusion proteins were
mixed while maintaining a constant total molar concentration. The A-region/P-region
mixtures were immobilized on a 96-well ELISA plate, and binding of MAb 4-10A to the
mixtures was traced with peroxidase-labeled goat anti-mouse antibody. The maximum
binding of MAb 4-10A to the A-region/P-region complex was clearly seen at a 1:1 molar
ratio (Figure 9).
Interaction of PI, SspA, and SspB A- and P-Regions
The A- and P-regions of PI are approximately 70% identical to the same regions in
the S. gordonii M5 SspA and SspB, also members of the antigen I/O family. To
determine whether the SspA and SspB A- and P-regions exhibited the same binding
characteristics as the P1 regions, ELISA was used to analyze their ability to interact with
one another and with the A- and P-regions of P1. A- and P-region-GST fusion proteins
were purified by affinity column chromatography and immobilized to ELISA plates as
previously described. Two-fold serial dilutions of A-region-GST fusion proteins were
incubated with the immobilized P-region-GST proteins, and binding was traced with the
A-region specific mAb 3-8D as before. Figure 11 shows that the A-regions of PI, SspA,
and SspB are capable of binding to the P-regions of all three of the antigen I/II family


42
proteins. As measured by ELISA and Western blot (Figure 10) mAb 3-8D reacts equally
to each of the A-region-GST fusions.
Anti-Pi mAb Epitope Restoration by the Interaction of A- and P-Regions of SspA
and SspB
Based on the demonstrated restoration of epitopes by the interaction of the A- and
P-regions of PI, the interactions of the A- and P-regions of SspA and SspB, and the
reactivity of mAbs 4-10A and 5-5D to full-length SspA and SspB (Figure 12), restoration
of epitopes for the mAbs by the interaction of the A- and P-regions of SspA and SspB
was examined. Reactivity of mAbs 4-1OA, 5-5D, and 6-11A with a combination of the
A- and P-regions was tested by ELISA as previously described. As shown in Figures 13
through 18, none of the mAbs reacted to the A- or P-regions alone; however, the results
showed that all three mAbs reacted to all A-region/P-region interactions in which a PI
fragment was the overlaid moiety. The binding of all three mAbs was also restored upon
the interaction of any P-region to the immobilized A-region of P1. The interaction of
SspA A-region with immobilized PI P-region was also able to restore binding of mAb 5-
5D. MAb 5-5D binding was also restored to a more limited extent when the P-region of
PI was overlaid on the immobilized A-region of SspA. In summary, all heterologous A-
and P-regions interacted, yet not all of the interactions restored anti-Pl mAb epitopes.
Introduction of the A-Regions of SspA and SspB into PI AA
The identification of the interaction between the A-regions of SspA and SspB and
the P-region of PI including the restoration of the mAb 5-5D epitope suggested that some
degree of PI structure was attained but native structure was not fully restored at the
polypeptide level. To determine whether introduction of the A-regions of SspA and SspB


43
into P1AA could restore native structure and translocation of the deletion construct, each
A-region was ligated in-frame into the site of the deletion in PI AA. The homology
between each of the A-regions is illustrated in Figure 19. The resulting chimeric PI
proteins were examined for restoration of mAb binding by Western immunoblot (Figure
20). The binding of mAb 3-8D demonstrated that the S. gordonii A-regions had been
inserted into PI AA and were in-frame (panel A). Restoration of binding was only seen
for mAb 5-5D with the chimeric PI protein containing the A-region of SspA (panel B).
Carboxy-terminal specific mAb 6-8C reacted to both chimeric proteins indicating that the
insertion was in-frame and that the proteins were not truncated (data not shown). The
bands that mAb 6-8C reacted to were of the same molecular weight as the band that 5-5D
reacted to in panel B. Full-length PI migrates on SDS-polyacrylamide gels near 185 kD.
Oddly, neither chimeric protein appeared to migrate slower than PI AA. It is apparent
that the introduction of the A-regions did not restore native PI migration characteristics
to the proteins.
Stability and Translocation of Chimeric PI Containing the A-Regions of SspA and
SspB.
Although full native structure based upon recognition by all A- and P-dependent
mAbs was not achieved, the binding of 5-5D to the SspA chimeric construct indicated
that some degree of A- and P-region interaction had been restored, therefore it was still of
interest to examine the possible restoration of translocation of the chimeric molecules to
the cell surface. To insure that there was not an intrinsic problem with the translocation
of the S. gordonii proteins to the surface of S. mutans, SspA and SspB were expressed in
PC3370. Whole cell dot blots were performed and expression was traced with mAb 5-5D
as it demonstrated the strongest cross-reactivity with SspA and SspB in Western blots.


44
Figure 21 demonstrates that both SspA and SspB were translocated to the surface in S.
mutans.
The surface expression of chimeric PI containing the A-regions of SspA and SspB
was also examined by whole cell dot blot. PC3370 harboring pDL289, pMAD (P1),
pTS21 (P1AA), pTS22 (PlAA+SspA A-region), and pTS23 (PlAA+SspA A-region)
were bound to nitrocellulose membrane using a 96-well dot blot manifold. Surface
expression of PI was traced with mAbs 4-10A and 5-5D as they are reactive to PI on the
cell surface and were reactive to SspA and SspB by Western immunoblot (Figure 22).
No surface expression of either chimeric PI was detected on the surface of PC3370. No
full-length chimeric PI proteins were detected in cell lysates of transformed PC3370 by
Western blot with C-terminal specific anti-Pl mAbs (Figure 23, upper panel).
Breakdown products of the proteins were, however, detected with the A-regions specific
mAb 3-8D (Figure 23, lower panel).
Evaluation of the Involvement of SecB in the Secretion of PI, P1AA, and P1AP in
E. coli
It is presumed that PI is translocated to the cell surface via the general secretory
pathway and the Sec translocase [86], The two major routes to the Sec translocase are
via the chaperones, signal recognition particle (SRP) or SecB. In S. mutans, however, PI
is secreted in the absence of the SRP pathway and S. mutans does not possess SecB or a
known ortholog. To determine whether the translocation of PI is dependent upon SecB
in E. coli and possibly a SecB ortholog in S. mutans, secretion of P1 to the periplasm was
examined in the E. coli SecB-negative mutant CK1953 [109], Periplasmic extracts of
CK.1953 and the wild-type MC4100 expressing PI were prepared by osmotic shock, and
the presence of PI was detected by Western immunoblotting using mAbs 5-3E, 2-8G,


45
and 6-8C. These mAbs are specific to the carboxy-terminus of PI and were used to
insure that only full-length molecules were traced. These results are shown in Figure
24A. Lanes marked C contain cellular lysates and lanes marked P contain periplasm
extracts. The host and plasmid expressed is indicated above each pair of lanes. The first
pair of lanes contains cellular extracts from MC4100 harboring pDC20 (full-length PI)
and show that PI is detected in both the cytoplasm and the periplasm. The cellular
fractions of the second pair of lanes contains cellular extracts from the SecB' mutant
CK1953 harboring pDC20 and show that, like in MC4100, PI is detected in both the
cytoplasm and the periplasm. The final pair of lanes corresponds to cell fractions from
MC4100 harboring pUCl 8 (vector only). The above cell extracts were also analyzed by
Western immunoblotting for the cytoplasmic protein (3-galactosidase to confirm the
integrity of the periplasm extractions (Figure 24B). No p-galactosidase was detected in
the periplasmic extracts. These results show that P1 translocation in E. cot is not
dependent on SecB, the chaperone that is central to the general secretory pathway of E.
cot,
Expression of Discontinuous PI and Recognition by Anti-Pi Monoclonal Antibodies
It has been proposed that proteins frequently contain uncleaved intramolecular
chaperone-like fragments. These fragments are believed to assist in protein stabilization
and folding by binding to adjacent regions [125], Intramolecular chaperones (IMC) have
been identified in a number of proteases, including a proline-rich IMC in the Limulus
Factor C [79] in which deletion of the IMC resulted in a malfolded and non-secreted
protein. Complementation of a secretion defect resulting from an IMC deletion has been
demonstrated in the Pseudomonas aeruginosa elastase, LasB. Mclver et al [126]


46
successfully rescued secretion and activity by expressing the IMC in trans. Additionally,
not all secreted proteins are translocated in an unfolded conformation. The TAT system
is capable of secreting proteins that are first folded in the cytoplasm [127], Although the
TAT system has not been found in S. mutans, it was of interest to determine whether the
A- or P- regions possessed IMC activity and whether such an interaction would result in
the translocation of a non-linear or folded PI. To examine this, a spaP gene engineered
to express PI as two peptides (a.a. 1-480 and a.a. 481-1561, see Figure 25) was
constructed by PCR and cloned into pCR2.1, creating pTS30, as detailed in Methods and
Materials.
The predicted molecular weights of the PI fragments are 51 kD for the 480 residue
N-terminal fragment and 119 kD for the 1081 residue C-terminal fragment. Cell lysates
of E. coli harboring pTS30 were examined by Western blotting utilizing anti-Pl mAbs, 3-
8D, 4-10A, and 5-3E (Figure 26). MAb 3-8D is specific to the A-region of PI [35],
reactivity of MAb 4-10A has been shown to be dependent upon the simultaneous
presence of both the A- and P-regions, and MAb 5-3E is specific to the C-terminal end of
PI [120], In lane A, MAb 3-8D is shown to be reactive with bands migrating between
approximately 65 and 80 kD. In lane B, MAb 4-10A reacts with a band that corresponds
to the molecular weight of the C-terminal fragment at 119 kD. The binding of mAb 4-
10A suggests that enough N-terminal fragments co-migrate with the 119 kD C-terminal
fragment to restore epitope recognition by this antibody. In lane 3, mAb 5-3E also reacts
with a 119 kD band. The reactivity of all three mAbs indicates that both the N-terminal
and C-terminal PI fragments are expressed and detectable in E. coli.


47
Evaluation of Surface Expression of Discontinuous PI in S. mutans
The spaP mutant PC3370 was used as the host for plasmids pMAD and pTS31,
encoding full-length PI and discontinuous PI respectively. Whole cell dot blot analysis
was used to examine whether an interaction of the A- and P-regions, when expressed in
trans, could result in translocation of the fragments to the cell surface. These results are
shown in Figure 27. The positive controls S. mutans NG8 (wild-type) and PC3370C
expressing full-length PI (columns A and C) demonstrate the reactivity of the mAbs with
surface expressed PI. MAb 3-8D has previously been shown to be unreactive with full-
length PI on the cell surface. The negative control, PC3370A, harboring the vector only,
(column B) showed lack of reactivity of the mAbs with cells lacking P1. PC3370
harboring pTS31 encoding the PI fragments (column D) was not reactive with the mAbs
indicating a lack of surface expression of the PI fragments. These results indicated that
PI fragments were not anchored to the surface of PC3370. The N-terminal fragment was,
however, detected in spent culture liquor with MAb 3-8D (data not shown).
To determine if the PI fragments were detectable in S. mutans cell lysates, PC3370
harboring pTS31 was subjected to mechanical lysis in a Mini Beadbeater apparatus and
samples were analyzed by Western immunoblotting (data not shown). While both the bl
and C-terminal fragments were detected in E. coli, only the N-terminal fragment was
present in the S. mutans cell extracts, indicating that the C-terminal fragment was
unstable in S. mutans.
Surface Expression of PI in a RopA-Deficient A. mutans and Bacterial Adherence to
Salivary Agglutinin
The first chaperone encountered by nascent polypeptides is believed to be the
polyprolyl isomerase (PPIase), RopA or trigger factor. Trigger factor is involved in


48
protein secretion and maturation. The involvement of RopA in the expression of
functional PI was analyzed using an adherence assay. PI mediates binding to salivary
agglutinin, and the binding can be inhibited by the PI-specific monoclonal antibody
(mAb) 4-10A, but not by the Pl-specific mAb 6-11A [33]. Adherence ofS. mutans
TW90, a RopA-deficient mutant [112], to human salivary agglutinin immobilized on an
FI sensor chip was assayed using the BIAcore 3000 (BlAcore AB, Uppsala, Sweden) by
Monika Oli by the method described in [128]. Briefly, agglutinin was immobilized on
the BIAcore FI sensor chip surface, and suspensions of S. mutans UA159 (wild-type) and
TW90 (AropA) in adherence buffer were injected onto the sensor chip. A substantial
reduction in adherence (> 50%) in three separate assays was observed for the RopA-
deficient cells (Brady laboratory, unpublished). The complete inhibition of adherence of
both UA159 and TW90 by the addition of anti-Pl mAb 4-10A indicated that the residual
adherence was PI mediated (Brady laboratory, unpublished).
In light of the laboratorys findings that the function of PI appeared to be altered in
a ro/x4-negative strain, whole cell dot blots of TW90 were used to determine whether the
reduction in adherence was due to a reduced level of surface localized PI in the ropA-
negative background. Cells were grown to early-log and stationary phases, and samples
were standardized for cell number by absorbance measurements. Replicate blots were
reacted with mAbs 3-8D, 4-9D, 4-10A, 5-5D, 6-11 A, 3-10E, 1-6F, 5-3E, 2-8G, 3-3B, or
6-8C. Quantification of PI surface expression was performed by densitometry using a
Fluorchem imager and software (Alpha Innotech, San Leandro, Ca). The mAb 4-10A
results shown in Figure 28 are representative of all data. There were no differences
detected in the surface expression of PI between wild-type UA159 and TW90.


49
Analysis of PI Surface Expression in an A. imitans Mutant Expressing Low-Levels of
DnaK
The route of PI translocation to the cell surface and the chaperones involved are
unknown. PI is secreted in the absence of the chaperones SRP, SecB, and RopA,
although RopA appears to affect PI function. DnaK binds to proline-rich proteins [129]
and is involved in chaperoning a wide variety of proteins. DnaK also has a pool of
substrates that overlaps with RopA [104], The contribution of DnaK to PI surface
expression was examined by whole cell dot blot as was performed with the RopA mutant.
The experiment was performed using S. mutans SMI2, which was engineered to express
approximately 5% of the level of DnaK as the parent strain, UA159 (Lemos and Bume,
in preparation, University of Florida, Gainesville, FL). S. mutans UA159 and SM12 were
grown and harvested at early-log and stationary phases, samples were standardized for
cell number by absorbance measurements, and surface expression was determined as
previously detailed. Figure 29 shows that there is a significant reduction in the amount of
surface expressed PI at early-log growth in SM12 (P<0.0001), but PI levels were equal
in both strains at stationary phase (data not shown).
Evaluation of dnaK mRNA Expression in S. mutans PC3370 Harboring pDL289,
pMAJJ8, pMAD, and pTS21
The reduction of PI surface expression seen in the early-log phase of SMI 2
suggested that DnaK might have a role in PI translocation. Changes in dnaK mRNA
levels in response to the expression of PI and PI deletion constructs in S. mutans could
indicate an interaction between the chaperone and the PI proteins. To this end,
quantitative Real-Time PCR was utilized to measure levels of dnaK mRNA expression.
DnaK message was quantified from total RNA isolated from early-log phase cultures of
PC3370 harboring pDL289 (shuttle vector), pMAJJ8 (PlAP-region), and pMAD (PI),


50
and pTS21 (PI AA-region). Compared to the vector only control or PC3370
complemented with full-length PI, the level of dnaK message was significantly decreased
(P<0.005 and PO.05, respectively) in the presence of PI AP and increased (P<0.005 and
PO.05, respectively)in the presence of PI AA (Figure. 30) The mRNA levels of 16S
RNA were used as an internal control, and no significant difference was found between
samples (P<0.38).


51
Q
00
m
Q
O'
4
<
Q
*n
U UJ O CQ U
yo rn oo m oo
O (N C*"> VC
Pi
P1AA
185 kD
135 kD
Figure 2. Western blot analysis of PI and recombinant PI lacking the A-region (PI AA).
The reactivity of eleven anti-Pl mAbs against whole cell lysates of E. coli
harboring pDC20 (PI) or pTS20 (PI AA) were analyzed by Western blot to
determine the effect of the A-region deletion on antigenicity. The mAbs used
are listed above each strip. The epitope of mAb 3-8D is within the A-region,
however mAb 3-8D does not bind to full-length PI. The reactivity of mAbs
4-10A, 5-5D, 6-11 A, and 3-10E are dependent upon the P-region. The
reactivity of mAbs 5-3E, 2-8G, 3-3B, and 6-8C are dependent upon the C-
terminal terminal third of PI.


52
PC3370
PC3370 + vector
PC3370 + P1AA
PC3370 + P1
Figure 3. Lack of surface expression of PI devoid of the A-region. Whole cell dot blots
of S. mutans spaP isogenic mutant PC3370, PC3370 harboring shuttle vector
pDL289 alone, and PC3370 harboring the pDL289 construct encoding PI AA
or full-length PI. Blots were reacted with anti-Pl mAbs 1-6F and 3-1OE.
These antibodies had been shown in previous experiments to react with
recombinant P1AA. Identical results were obtained using a polyclonal anti-Pl
rabbit antiserum (data not shown).


h Ui M Ji W -JUI
9 2, W S) N iti 00 VO VO
cg<5<5<2<2 <30
CFU/well


53
PC3370
PC3370 + vector
PC3370 + P1
PC3370 + P1AA
10 5 2.5 1.2 0.62 0.31 0.15
gg/well
Figure 4. RNA dot blot analysis of i/raP-specific mRNA levels in the S. mutans spaP-
negative mutant PC3370 and derivatives. Twofold serial dilutions of total
cellular RNA, beginning with 10 mg, were probed with DNA encoding the C-
terminus of spaP. From top to bottom, the rows contain mRNA from
PC3370, PC3370A (vector only), PC3370C (full-length spaP), and PC3370
harboring pTS21 (spaP with A-region encoding DNA deleted), respectively.


54
Figure 5. Western immunoblot of cytoplasm (C) and periplasm (P) fractions of E. cot
DH5a harboring pUC18 derived plasmids expressing full-length PI (pDC20),
P1AP (pDC9), P1AA (pTS20), and vector alone detected with C-terminus
specific mAbs 5-3E, 6-8C, and 2-8G. Migration of molecular weight
standards are indicated in kilodaltons.


55
Figure 6. Demonstration of A-region and P-region interaction by ELISA. 100 ng of P-
region-maltose binding protein (MBP) fusion polypeptide () or MBP alone
(A) were used to coat ELISA plate wells. Two-fold serial dilutions of purified
A-region-MBP fusion polypeptide starting at 1000 ng/well were added to the
coated wells, and binding of the A-region to the P-region or to the MBP
negative control was detected with the A-region specific MAb 3-8D.


56
4-10A
Figure 7. Restoration of epitopes by A- and P-region interactions as measured by ELISA.
500 ng of P-region-MBP fusion polypeptide, A-region-MBP, or MBP were
used to coat ELISA plate wells. Two-fold serial dilutions of purified A-
region-MBP starting at 500 ng/well were added to the P-region and MBP
coated wells and vice versa. MAbs 4-10A, 5-5D, and 6-11A were tested for
reactivity. Panel titles indicate the mAb tested and the legends indicate the P1
fragment that was immobilized. A- and P-regions did not interact with MBP
alone and no mAb binding was detected with the controls (data not shown).


57
Figure 8. Inhibition of anti-Pl MAb 4-10A binding to immobilized PI in ELISA. To
determine whether the A- and P-region polypeptides could interact in solution
and produce an epitope recognized by mAb 4-10A, the antibody was mixed
with soluble PI, glutathione S-transferase (GST), A-region-GST, P-region-
GST, or a 1:1 molar mixture of A-region-GST and P-region-GST
polypeptides. The mAb 4-10A mixtures were applied to PI immobilized to an
ELISA plate, and inhibition of binding to the immobilized PI was measured.
Bars indicate percent inhibition.


58
0.25
0.2
0.15
q-
o
o o.i
0.05
0 -
A: 0
0.16
0.33
0.5
0.66
0.83
1
R 1
0.83
0.66
0.5
0.33
0.16
0
Molar Fraction
Figure 9. Stoichiometry of the mAb 4-10A epitope. Varying molar ratios of PI A-and
P-region polypeptides with a constant total concentration of 3.3 pmoles were
immobilized in ELISA plate wells and epitope restoration was detected with
mAb 4-10A. The experiment was performed in triplicate and standard
deviation is represented by the error bars.


59
Figure 10. Demonstration of similar level of mAb 3-8D reactivity to A-region-GST
fusion polypeptides of SspA, SspB, and PI by Western immunoblot.


60
P1 P-reg¡on
3-8D
500 250 125 62.5 31.2 15.6 7.8 0
SspB P-reg¡on
3-8D
ng/well
Figure 11. Demonstration of interactions between the A- and P-regions of different
antigen I/II proteins. Panel titles indicate the source of the immobilized P-
regions. Binding of the different A-regions identified in the legends were
traced with the cross-reactive A-region specific mAb 3-8D. Legends identify
the overlaid polypeptides.


61
O o Q
<
w 4 i
i
250-
mu u
feSS
150-
100-
rn m 11
75-
e
250-
A:.
I i
150-
t 1 *
100-
75-
W
250-
150-
***- '
100-
75-
5
Figure 12. Evaluation of reactivity of A- and P-region dependent anti-Pl mAbs with PI,
SspA, and SspB. Whole cell lysates of E. coli DH5a harboring pDC20 (PI),
pDDA (SspA), and pEB-5 (SspB) were electrophoresed on 7.5% SDS
polyacrylamide gels, transferred to nitrocellulose and probed with the anti-Pl
mAbs shown above. The indicated molecular weights are in kilodaltons.


62
SspA P-region
4-1OA
500 250 125 62.5 31.2 15.6 7.8 0
SspA P-region
5-5D
500 250 125 82.5 31.2 15.6 7.8 0
SspA P-region
6-11A
Figure 13. Restoration of epitopes by the interaction of various antigen 1711 A-regions
with the immobilized P-region of SspA. Panel titles indicate the source of
immobilized P-region and the mAb tested. Legend indicates the source of the
overlaid A-regions.


63
SspB P-region
4-1OA
500 250 125 62.5 31.2 15.6 7.8 0
SspB P-region
5-5D
500 250 125 62.5 31.2 15.6 7.8 0
ng/well
Figure 14. Restoration of epitopes by the interaction of various antigen I/II A-regions
with the immobilized P-region of SspA. Panel titles indicate the source of
immobilized P-region and the mAh tested. Legend indicates the source of the
overlaid A-regions.


64
P1 P-reg¡on
4-10A
P1 P-region
5-5D
ng/well
Figure 15. Restoration of epitopes by the interaction of various antigen I/II A-regions
with the immobilized P-region of SspA. Panel titles indicate the source of
immobilized P-region and the mAb tested. Legend indicates the source of the
overlaid A-regions


65
SspA A-region
4-1OA
8 1-0
§ 0.8
SspA P-region
-O- SspB P-region
t Pi P-reglon
SspA A-region
5-5D
SspA P-region
.6 -O SspB P-region
T P1 P-reglon
500 250 125 62.5 31.2 15.8 7.8 0
SspA A-region
6-11A
8
O 0.8
- SspA P-region
- SspB P-region
- P1 P-region
0.2
o.o TT?T??tT
500 250 125 62 5 31.2 15.8 7.8 0
ng/well
Figure 16. Restoration of epitopes by the interaction of various antigen I/II A-regions
with the immobilized A-region of SspA. Panel titles indicate the source of
immobilized P-region and the mAb tested. Legend indicates the source of the
overlaid P-regions


66
SspB A-region
4-1OA
SspA P-region
-O- SspB P-reglon
T P1 P-reglon
SspB A-region
5-5D
SspA P-reglon
-O- SspB P-region
P1 P-region
.0
500
31.2 15.6 7.8 0
SspB A-region
6-11A
SspA P-reglon
-O- SspB P-region
s
8 o.
i-
500 250 125 62.5 31.2 15.6 7.8 0
ng/well
Figure 17. Restoration of epitopes by the interaction of various antigen I/II A-regions
with the immobilized A-region of SspA. Panel titles indicate the source of
immobilized P-region and the mAb tested. Legend indicates the source of the
overlaid P-regions.


67
500 250 125 62.5 31.2 15.6 7.8 0
ng/well
Figure 18. Restoration of epitopes by the interaction of various antigen I/II A-regions
with the immobilized A-region of SspA. Panel titles indicate the source of
immobilized P-region and the mAb tested. Legend indicates the source of the
overlaid P-regions.


68
PI
SspA
SspB
PI
SspA
SspB
50
60
70
90
H.^- KLSA vUft ^ R V^A N A^ A K^A V E^A^ K E^N T A K N [eIa^K^
100 110 120 130
PI Af~~|E[;l RKRNATAK A|E|Y E T|k[l|a|Q Y Q A f L,[k RjV Q|e[a n|a A|N E A D V Q A K L|
SspA [enea ikqrnatakanydaamkqyeadlaa i kk a[_kJe d NDADVQAKL
SspB |e N E A I K Q R N[e1t A K A T V E A A M K Q V E A P L A A I K K A N E D N D A D Y Q A K L|
NO 150 160 170 1X0
PI Itayqtelarvqkanadakaay e|aJav] a aJn n a k n a "a' L]_tJa E N[tJa I K Q it]
SspA A A Y Q A E L A R Y Q K A N A D A K A A Y E K A V E [E N T A K N T A I Q A E N E A I KQR
SspB [aaYQTELARVQKANAEA KflTI A Y P K A v|k| E N T A K N T A I Q A E N E A I K Q r|
190 200 20 220
SspA In [aJA A K a T Y E a A L K Q Y E A D L A A V K K A N|E D S [ E A DYQTKL a[|]y Q T E L A
SspB [NET A k A T Y D A A V K k V E A D L A A V K ij A N A IN EADVQAKLAAVQTEI, A[
PI
SspA
SspB
RVQKANAPAKAAV E|Af~VlA a|n1n[a]a|N A A l[ T[A E N[T a| I KKR.NA
RVQKANADAKAAYEKAVEDNKAKNAALQAEN EE I KQRNA
V Q K A N A D A K A T Y E K A V E D N K A K N A A I KAENEE I KQRNA
A K A D \
A K T D V
A K T D V
PI
SspA
SspB
QADLAKYQI
[eaklakyead la KYK K| K [ 1
|eaklakyeaplakykke|f
300
310
Figure 19. CLUSTAL W alignment of the A-regions of PI, SspA, and SspB. Dark
grey shading indicates identity. Light grey shading indicates similarity.


69
3-8D
5-5D
Figure 20. Western iramunoblot of chimeric PI containing the A-regions of SspA and
SspB. Whole cell lysates of E. coli DH5a harboring plasmids encoding PI
containing with the A-regions of SspA and SspB. Lanes contain PI (1),
P1AA (2), P1AA + A-region of SspA (3), P1AA + A-region of SspB (4).
Panel A was reacted with the A-region specific mAb 3-8D. Panel B was
reacted with the A- and P-region dependent mAb 5-5D.


70
Vector PI SspA SspB
Figure 21. Surface expression of 5. gordonii SspA and SspB in S. mutans PC3370.
Whole cell dot blot of PI-deficient S. mutans PC3370 complemented with
plasmid-encoded PI, SspA, and SspB. Surface expression was traced with
mAb 5-5D.
1 2 3 4 5
17
Figure 22. Demonstration of lack of ability of heterologous A-regions to restore surface
expression of P1AA in PC3370. Whole cell dot blot of PC3370 harboring
vector alone (1) and plasmids expressing PI (2), PI AA (3), and PI containing
the A-regions of SspA (4) and SspB (5). Surface expression of PI was
detected with mAb 5-5D.


71
A B C D E
250-
150 -
100 -
75-
50-
250-
150 -
100 -
75-
50-
3-8D
Figure 23. Western iramunoblots of cell lysates of PC3370 harboring vector alone (A),
and plasmids encoding PI (B), P1AA (C), P1AA + SspA A-region (D), and
PI AA + SspB A-region. PI was detected with C-terminals specific mAbs
(upper panel) and A-region specific mAb 3-8D (lower panel).


72
A
pDC20
pDC20
pUC18
B
pDC20
pDC20
MC4100
CK1953
CK1953
MC4100
CK1953
C P
C P
C P
C P
C P
250-
150 -
mu
100-
75-
50-
Figure 24. Western immunoblot of cytoplasm (C) and periplasm (P) fractions of E. coli
MC4100 (wild-type) and CK.1953 (AsecB) harboring pDC20 (PI). PI was
traced with mAbs 5-3E, 2-8G, and 6-8C in panel A. In panel B, p-
galactosidase was traced with a rabbit polyclonal antibody. Migration of
molecular weight standards are indicated in kilodaltons.


73
A-Region
(a.a. 186-464)
a.a. 1-465
P-Region
(a.a. 840-963)
a.a. 466-1561
Figure 25. Schematic representation of discontinuous PI. Black arrow represents the
spaP promoter. N-terminal open reading frame (ORF) expresses residues 1-
465 including the A-region (shaded). C-terminal ORF expresses residues
466-1561, which includes the P-region (shaded).
Figure 26. Western immunoblot of PI fragments expressed from pTS30 in E. coli and
traced with mAbs 3-8D (A), 4-10A (B), and 5-3E (C). Migration of molecular
weight standards are indicated in kilodaltons.


74
A
B
C
D
3-8D
4-9D
9
m
9
4-10D
9
9
9
5-5D
£
9
9
6-11A
9
3-10E
9
9
Figure 27. Whole cell dot blot of S. mutans NG8 (A) and PC3370 harboring pDL289
vector control (B) pMAD encoding PI (C), and pTS31 encoding
discontinuous PI fragments (D). Surface expression of P1 polypeptides was
traced with the indicated anti-Pl mAbs.


75
Figure 28. PI surface expression levels ofS. mutans UA159 and TW90 (ropA- mutant)
at early log stage traced with mAb 4-10A as measured by densitometry.


76
D
&
Figure 29. PI surface expression levels of S. mutans UA159 and SM12 (DnaK-deficient)
at early log phase traced with mAb 4-10A as measured by densitometry. No
difference was detected at stationary phase ([n = 12]* statistically significant,
P<0.0001. Significance was determined by student's t-test.)


77
Figure 30. Real-Time PCR quantification of dnaK mRNA from S mutans PC3370
harboring the pDL289 vector alone and expressing PI AP-region, full-length
PI, and PI AA-region. ( [n = 36]* statistically significant compared to vector,
P<0.005. ** statistically significant compared to PI, PO.05.
Significance was determined by students t-test.)


CHAPTER 4
DISCUSSION AND CONCLUSIONS
Dental caries is one of the most prevalent oral diseases worldwide, affecting 60-
90% of schoolchildren and the majority of adults. In the United States, dental caries is
the most common chronic childhood disease with 78% of 17 year olds having at least one
cavity or filling [130] and, according to the U.S. Department of Health and Human
Services, it is estimated that over $84 billion dollars is spent annually on dental treatment
and caries prevention in the United States alone. While advances in dental care and caries
prevention has reduced the incidence of caries in developed countries, the incidence of
caries worldwide has remained unchanged for the past 20 years [131].
A major contributing factor to the decline of caries in developed countries was the
introduction of fluoride to water and toothpaste. Unfortunately, in developing countries,
where the incidence of caries is on the rise, fluoridated community water is commonly
not a viable option. Although fluoridated water reaches 60% of the U.S. population,
more than 90% of toothpastes contain fluoride, and processed food and beverages often
contain fluoride, the reduction in caries incidence has been uneven across the general
population in the United States. The majority of the disease is now being borne by a
disproportionately small segment of the population; those of low socioeconomic status,
low education, and lack of access to dental care [132-134], in essence a mirror of the
populations in developing countries. The inability to manage caries in this subpopulation
of the United States, where the dentist to population ratio is better than 1:2000 people,
78


79
illustrates the improbable task of preventing caries in developing countries, such as in
Africa where the ratio isl: 150,000. A better understanding of the virulence factors and/or
targets of protective immunity in S. mutans could lead to preventative measures that
could help overcome the lack of resources, education, and infrastructure that is currently
required for caries prevention.
The major surface protein PI of the cariogenic organism, S. mutans, is a
multifunctional adhesin and plays a role in the attachment of the bacterium to the tooth
surface. PI shares similarities to virulence factors of several other bacterial species,
including the fibronectin binding proteins of S. aureus and S. pyogenes [65, 66], and the
pneumococcal surface protein (PspA) of S. pneumonia [68]. PI has been identified as a
target for protective immunity and has been studied as a potential antigen candidate for
an anti-caries vaccine [135]. It has also been used for the production of mAbs that are
currently being investigated for their ability to modulate the immune response in mice
that are challenged with mAb-5. mutans or mAb-Pl complexes [136], Also, with little
known about the maturation and translocation of Streptococcal surface proteins, PI is a
potential model for studies in these areas.
The goal of this research was to further our understanding of the structure and
antigenic properties of this large and complex molecule with an emphasizes on
identifying intramolecular interactions, the contribution of intramolecular interactions to
structure, stability, and translocation of PI, and to begin to identify chaperones that
contribute to PI maturation and translocation.
Identification of an Intramolecular Interaction within PI
Previously, by process of elimination using truncated PI polypeptides, the central
region of PI was determined to contribute to the epitopes of six of eleven anti-Pl mAbs


80
(4-9D, 4-10A, 5-5D, 6-11A, 3-10E, and 1-6F) [120]. It was additionally shown that
deletion of the P-region of PI (PI AP) abrogated the binding of four of the eleven mAbs
(4-10A, 5-5D, 6-11 A, and 3-1 OH ) and that none of these antibodies recognized a
subcloned P-region peptide suggesting that their epitopes were complex and
conformational. Surprisingly, although P1AP retained its N-terminal signal sequence and
C-terminal cell wall anchoring motif it was unstable in S. mutans and not translocated to
the cell surface [54], Proline-rich regions have been shown to be involved in both
protein-protein interactions and intramolecular chaperone-like interactions. The initial
objective of these studies was to identify interactions between the P-region and other
regions of PI.
Work by Rhodin et al. [123] on the characterization of the mAb 6-11A epitope
further defined regions of PI that were required for reactivity of the 6-11 A. Analysis of
several P-region spanning PI subclones revealed that in addition to the P-region (a.a.
819-1017), residues N-terminal of D465 also contributed to the reactivity of mAh 6-11 A.
In addition, the crystal structure of the PI variable region suggested that the A- and P-
regions may be in close proximity [30], and it was reported that a polypeptide containing
the P-region bound to the N-terminal third of PI [124], Based upon these reports, the A-
region was examined to determine whether it contributed to a complex structure by
association with the P-region.
The initial experiment was to examine the effects of the removal of the A-region
from PI. Therefore, a spaP gene lacking the A-region (a.a. 179-466) was constructed by
PCR and cloned into pUC18, creating pTS20. The construct was engineered with a silent
mutation that produced a unique Sfo\ restriction site that would later be used to insert


81
heterologous A-regions. The insertion of the Sfol site dictated the exact residues that
were deleted. Deletion of the A-region resulted in a loss of reactivity of five of eleven of
the anti-Pl MAbs (3-8D, 4-9D, 4-10A, 5-5D, and 6-11A), 3 of which are also dependent
upon the presence of the P-region (4-10A, 5-5D, and 6-11A) (see Figure 2). This
suggests that the epitopes of these three antibodies are complex and composed of portions
of discontinuous segments or that an interaction between the regions results in
conformational epitopes being produced within one or both of the regions. Reactivity of
Mabs 5-3E, 2-8G, 3-3B, and 6-8C, which are specific to the C-terminal of PI, confirmed
that the deletion of the DNA encoding the A-region did not disrupt the reading frame.
The Western immunoblot also shows that like PI AP, P1AA is stably expressed and
detectable in E. coli.
The presence of internal proline-rich regions has been associated with aberrant
migration of streptococcal and staphylococcal proteins on SDS-polyacrylamide gels. The
molecular mass of PI has been predicted to be -166 kDa, although the protein migrates
with an apparent molecular mass of-185 kDa by SDS-PAGE. Interestingly, P1AP and
PI AA run at their predicted sizes of 152 kDa and 135 kDa, respectively, suggesting that
an interaction between the A- and the P-regions may contribute to anomalous migration
of PI by SDS-PAGE. On a sided note, the abberant migration of PI was observed even
after denaturing in 8 M urea and SDS-PAGE at both 4C and 60C.
With the data from the A-region deletion indicating that the A- and P-regions
contribute to the same epitopes, it was of interest to determine if these regions were, in
fact, capable of interacting. An interaction between recombinant polypeptides
corresponding to the isolated A-region (a.a. 186-469) and P-region (a.a.819-1017) was


82
examined by ELISA. A-region polypeptide was incubated with immobilized P-region
and A-region binding was detected with anti-Pl MAb 3-8D, which recognizes an epitope
contained entirely within the alanine-rich repeats. The ELISA revealed a direct, dose-
dependent, interaction (see Figure 6).
The required simultaneous presence of both the A- and P-regions for the binding of
mAbs 4-10A, 5-5D, and 6-11A to PI and the ability of recombinant A- and P-region
polypeptides to interact suggested that the interaction of these regions could contribute to
the epitopes that are recognized by these mAbs. To further analyze the characteristics of
the epitopes recognized by these mAbs, ELISA were performed with A- and P-region
polypeptides to determine whether binding of mAbs 4-10A, 5-5D, or 6-11A was restored
upon interaction of these two discontinuous domains. Interestingly, mAbs 5-5D and 6-
11A reacted considerably better when the A-region was applied to immobilized P-region
rather than visa versa, while MAb 4-10A displayed no apparent preference (see Figure 7).
This would suggest that the contact residues for MAbs 5-5D and 6-11A are largely
contained within the A-region while both regions may contain residues required for the
MAb 4-10A epitope. Since, all three of these mAbs bind to PI on the surface of S.
mutans, these results indicate that the A- and P-regions interact in the context of the
whole molecule in its native conformation.
Due to the possibility that the interaction of the A- and P-regions may be an artifact
of being immobilized to the ELISA plate, a competitive inhibition ELISA was performed
to assess the interaction of the A- and P-regions in solution. Since it was shown that an
interaction of the A- and P-region is required for the binding of MAb 4-10A, recombinant
A- and P-region polypeptides were used alone and in combination to inhibit the binding


83
of MAb 4-1OA to immobilized PI. As can be seen in Figure 8, neither the A-region nor
the P-region individually inhibits MAb 4-10A binding to PI, however the combination of
both polypeptides does. This indicates that the A- and P-regions are capable of
interacting in solution.
In an effort to establish the stoichiometry of the A- and P-region interaction, a
variation of the Job Plot was performed. The Job Plot, or continuous variation, consists
of mixing two binding partners, or an enzyme and substrate, at various molar ratios while
holding the total concentration constant and then recording a measurable change. While
continuous variation is normally performed in solution, due to the use of antibodies to
measure the A- and P-region interaction, the A- and P-region polypeptides had to be
immobilized to an ELISA plate to afford the removal of excess unbound antibody. Since
MAb 4-10A was the tool used to measure the A- and P-region interaction, the
stoichiometry that was determined would actually be that required for the formation of
the MAb 4-10A epitope. According to the assay, the epitope of mAb 4-10A consists of a
1:1 ration of A-region to P-region (see Figure 9).
Although antigen I/II proteins are highly conserved, the functional properties of
individual members of this family of proteins differ. 5. gordonii possesses two antigen
I/II proteins, SspA and SspB, which have been well characterized. Several functional
differences between these two proteins have been identified, including coaggregation
with other oral flora and interaction with type I collagen [137, 138], PI is closer to SspA
in homology, 67% identity versus 57% with SspB. Specific amino acid residues that are
not in PI have been identified to be important for SspB binding to Porhromonas
gingivalis [139] and interactions of SspB and PI with salivary agglutinin also differ


84
[140]. Recent studies focusing on the A-regions of SspA, SspB, and PI have also
identified structural and functional variation. It was reported that the A-regions of PI and
SspA bound to salivary agglutinin but that the A-region of SspB did not. In addition,
structural analysis suggested that the A-region of SspB is less stable than that of SspA
and PI, both at high temperature and low pH. It should be noted that the A-regions of
SspA and SspB exhibit approximately 87% primary sequence identity with one another
while the A-regions of SspA and PI only share 70% (see Figure 19) [35,36, 116, 141],
In light of the similarities and differences reported between the A-regions of SspA,
SspB, and PI, it was of interest to see if the A- and P-regions of these S. gordonii
proteins interacted with one another as well as with the A-and P-regions of P1. Again,
interaction between these regions was examined by ELISA and a dose-dependent
interaction was observed with mAb 3-8D reacting to A-region polypeptides binding to
immobilized P-region polypeptides (see Figure 11). The results indicate that the A-
region of PI interacts more strongly with all of the P-regions than either of the S.
gordonii polypetides and that the SspB A-region is the weakest binder, which follows the
trend of PI being more like SspA.
The contribution of the PI A-region and P-region interactions to native structure as
determined by epitope restoration and the ability of the heterologous interaction of A-
and P-regions led to the examination of epitope restoration by the interaction of the
heterologous A- and P-regions. As before, ELISA was used to detect the restoration of
epitopes for mAbs 4-10A, 5-5D, and 6-11A by every combination of PI, SspA, and SspB
A- and P-region interactions in which eith the A- or P-region was immobilized. The
results demonstrated that the epitopes recognized by these three A- and P-region


85
dependent mAbs were restored regardless of which P-region interacted with the
immobilized A-region from PI (see Figure 18). While when P-regions were interacted
with either of the S. gordonii A-regions, only the P-region of P1 restored any mAb
reactivity, which was for mAb 5-5D and at a low level (see Figuresl and 17).
Additionally, the A-region of PI was able to restore all of the epitopes when interacted
with any of the immobilized P-regions and the A-region of SspA was able to restore the
mAb 5-5D epitope when interacted with immobilized PI P-region (see Figure 15). And
lastly, the interaction of the A-region of SspB with any immobilized P-region failed to
restore epitopes.
Comparing the results of the A- and P-region interactions to the reactivity of mAbs
4-10A, 5-5D, and 6-11A against full-length SspA and SspB as examined by Western
immunoblot was interesting (see Figure 12). While mAb 5-5D reacted to both full-length
SspA and SspB, its epitope was not restored by the interaction of the SspA and SspB A-
and P-regions. The same held true for mAb 4-10A which bound to full-length SspB and
weakly reacted to SspA. To summarize, although mAbs 4-10A and 5-5D bound to full-
length SspA and SspB, their epitopes were not restored by interactions of the A- and P-
regions of these proteins unless one of the interacting regions was from P1.
Analysis of PI Translocation and the Contribution of the Alanine- and Proline-Rich
Regions
All life depends upon the targeting of newly synthesized proteins to their site of
action. During transit to its destination, a protein must avoid a variety of hazards such as
malfolding, aggregation, and degradation and may be required to pass through one or
more membranes, known as translocation. Protein translocation has been extensively


86
studied in E. coli and the models established through this research are believed to be
representative of all bacterial cells [142-144] but more recently, Bacillus subtilis has
become the model for Gram-positive bacteria. Proteins that are targeted for translocation
across the cytoplasmic membrane contain an N-terminal signal sequence [145] that
generally contains positively charged residues followed by 15 to 20 hydrophobic
residues[146, 147], which are usually removed during or shortly after translocation.
Signal peptides can be classified by the type of signal peptidase that is responsible for
their proteolytic processing and these classifications can be used to predict the
translocation pathways [148], Based upon surveys of signal peptides in the genomes of
B. subtilis and several other Gram-positive bacterium, it is predicted that most
extracellular proteins in these organisms are secreted via the Sec-translocase [149-151] In
Bacillus subtilis, there are four predicted protein transport pathways; (i) the Sec-
dependent pathway, (ii) Twin-arginine translocation (Tat), (in) ABC transporter-
dependent secretion pathways, (iv) and a pseudopilin-specific export pathway. A survey
of the S. mutans UA159 genome failed to reveal any homologues of the Tat machinery or
Tat signal peptides.
In addition to the requirement for MAb reactivity, the simultaneous presence of
both the A- and the P-regions appear to be required for PI stability in S. mutans.
Analysis of mRNA encoding P1AA, like PI AP [54], demonstrated that the internally
deleted spaP gene was transcribed at levels equivalent to the wild-type spaP gene (see
Figure 4). Differences in dnaK mRNA levels in 5. mutans harboring plasmids encoding
PI, PI AA, and PI AP also suggested that the P1AA was being translated. However, no
P1AA was detected in the cytoplasm, on the cell surface (see Figure 3), nor in the culture


87
liquor. While P1AP contains a deletion of 170 residues and P1AA lacks 287 residues,
there are examples of stable antigen I/II polypeptides that, when compared to PI, are
lacking large segments of the molecules. The antigen I/II protein expressed by S.
intermedins, Pas, lacks -270 residues from the A-region and -80 residues from the P-
region [152]; Paa from S. cricetus possesses an additional -139 residues in the A-region
and -39 residues less in the P-region [152]; and S. mutans GS-5 expresses a PAc
molecule lacking the C-termmal -400 residues [153], The A-region of PI consists of
three-82 residue repeats and the P-region consists of three 39-residue repeats and both
Paa and Pas retain repeats in both regions. Not all internal deletions in P1 result in the
apparent level of instability seen in P1AA and P1AP. Rhodin et al. constructed a P1
construct lacking residues 84-190 which was detectable in 5. mutans PC3370, but was
not translocated to the surface (unpublished). This suggests that the A- and P-regions
may contain inherent structural information, possible chaperone binding sites, or perhaps
possess chaperone-like activities that are critical to PI stability. A proline-rich region has
been implicated as an intramolecular chaperone by Wang et al. [79]. The central proline-
rich region of the Limulus secreted serine protease, Factor C, was shown to be required
for secretion of the molecule. Their data suggested that the correct folding of the
molecule C-terminal of the pro line-rich region was dependent upon the presence of the
proline-rich region and that the lack of secretion was due to malfolding.
To fully understand the role of the A- and P-regions in PI translocation, identifying
the molecules route of translocation is necessary. There is no experimental data that
identifies the secretion pathway employed by PI or antigen I/II-like proteins. Cell wall
anchoring of PI and PAc is mediated by the transpeptidase sortase [85, 154] and sortase


88
anchored proteins are presumed to be translocated via the sec translocase [86], As
detailed in the introduction, the Sec-dependent secretion pathway has been thoroughly
studied in E. coli and the characteristics of the pathway are presumed to be conserved for
all bacteria. In E. coli, the Sec-translocase consists of a structure composed of several
proteins including the ATPase SecA, which provides the energy for translocation [87],
Current literature identifies two major pathways that a nascent protein destined for the
Sec-translocase would be transported upon, the signal recognition particle (SRP) pathway
and the SecB pathway.
The SRP pathway is involved in co-translational protein secretion. The SRP
recognizes and binds to the signal peptides of nascent polypeptides as they emerge from
the ribosome [89]. Binding of the SRP stalls translation and targets the SRP-ribosome
complex to the SRP receptor, FtsY [90, 91]. The SRP-ribosome-FtsY complex is then
targeted to the Sec-translocon where the ribosome docks and the protein is co-
translationally translocated across the membrane [87].
The cytoplasmic chaperone SecB targets preproteins to the Sec-translocon for post-
translational translocation. SecB binds to nascent and full-length proteins as they emerge
from the ribosome [92], SecB interaction prevents premature folding of the preprotein
and delivers it to the Sec-translocon in a secretion-competent state. Binding of the SecB-
protein complex with SecA results in the transfer of the preprotein to SecA and the
release of SecB [93]. The protein is subsequently translocated across the membrane
through the Sec-translocon [94].
Due to the faint expression of PI AP and the undetectable expression of PI AA in S.
mutans, E. coli was used to begin to examine PI secretion. PI AP and PI AA are stable


Full Text

PAGE 1

02/(&8/$5 ,17(5$&7,216 2) 7+( 6WUHSWRFRFFXV PXWDQV 685)$&( 3527(,1 3, &2175,%87,216 72 3527(,1 6758&785( 67$%,/,7< $1' 75$16/2&$7,21 %\ 75(925 %5<$17 6(,)(57 $ ',66(57$7,21 35(6(17(' 72 7+( *5$'8$7( 6&+22/ 2) 7+( 81,9(56,7< 2) )/25,'$ ,1 3$57,$/ )8/),//0(17 2) 7+( 5(48,5(0(176 )25 7+( '(*5(( 2) '2&725 2) 3+,/2623+< 81,9(56,7< 2) )/25,'$

PAGE 2

&RS\ULJKW E\ 75(925 %5<$17 6(,)(57

PAGE 3

$&.12:/('*0(176 ZRXOG OLNH WR WKDQN DOO RI WKH PHPEHUV RI WKH %UDG\ ODE IRU VKDULQJ WKHLU NQRZOHGJH DQG SURYLGLQJ WHFKQLFDO DVVLVWDQFH GXULQJ P\ VWD\ LQ WKH ODE DP HVSHFLDOO\ LQGHEWHG WR 'U %UDG\ IRU RIIHULQJ WR EH P\ PHQWRU DQG SURYLGLQJ PH ZLWK D QHZ ODERUDWRU\ DQG UHVHDUFK SURMHFW DIWHU WKH IDLOXUH RI P\ LQLWLDO fPHQWRUf ZRXOG DOVR OLNH WR WKDQN P\ FRPPLWWHH PHPEHUV 'U $UQROG %OHLZHLV 'U 3DXO *XOLJ 'U 'DQLHO 3XULFK DQG 'U 5REHUW %XPH IRU WKHLU LGHDV DQG DGYLFH )LQDOO\ WKDQN P\ SDUHQWV IRU WKHLU ZKROHKHDUWHG VXSSRUW DQG HQFRXUDJHPHQW GXULQJ WKHVH VHHPLQJO\ HQGOHVV \HDUV RI VWXG\

PAGE 4

7$%/( 2) &217(176 SDJH $&.12:/('*0(176 LLL /,67 2) 7$%/(6 YLL /,67 2) ),*85(6 YLLL $%675$&7 [ &+$37(5 ,1752'8&7,21 6WUHSWRFRFFXV PXWDQV DQG 'HQWDO &DULHV 0DMRU 6XUIDFH 3URWHLQ 3, 3UROLQH DQG 3UROLQH5LFK 5HJLRQV 3URWHLQ 7UDQVORFDWLRQ 'QD. DQG 5RS$ 6XPPDU\ DQG 6SHFLILF $LPV 0$7(5,$/6 $1' 0(7+2'6 %DFWHULDO 6WUDLQV 3ODVPLGV DQG *URZWK &RQGLWLRQV ,GHQWLILFDWLRQ RI DQ ,QWUDPROHFXODU ,QWHUDFWLRQ ,QYROYLQJ WKH 3UROLQH5LFK 5HJLRQ RI3O 3XULILFDWLRQ RI $UHJLRQ DQG 35HJLRQ0%3 )XVLRQ 3URWHLQV (Q]\PH/LQNHG ,PPXQRVRUEHQW $VVD\V (/,6$f WR 'HWHFW $UHJLRQ DQG 3 5HJLRQ ,QWHUDFWLRQ (OLPLQDWLRQ RI VSD3 '1$ (QFRGLQJ WKH $5HJLRQ (YDOXDWLRQ RI $QWLERG\ %LQGLQJ WR 3$$ $VVHVVPHQW RI (SLWRSH 5HVWRUDWLRQ E\ (/,6$ 3&5 DQG &RQVWUXFWLRQ RI 6 PXWDQV VSD3 DQG 6 JRUGRQLL 0 VVS$ DQG VVS% 6XEFORQHV 3XULILFDWLRQ DQG &RQILUPDWLRQ RI *67)XVLRQ 3URWHLQV &RPSHWLWLYH ,QKLELWLRQ (/,6$ WR 'HWHFW $5HJLRQ DQG 35HJLRQ ,QWHUDFWLRQ %LQGLQJ 6WRLFKLRPHWU\ RI WKH $ DQG 35HJLRQV E\ &RQWLQXRXV 9DULDWLRQ $QDO\VLV RI 3, 7UDQVORFDWLRQ DQG WKH &RQWULEXWLRQ RI WKH $ODQLQH DQG 3UROLQH 5LFK 5HJLRQV ,QWURGXFWLRQ RIVSD$$ LQWR 6 PXWDQV 3& ,9

PAGE 5

$QDO\VLV RI 3$$ &HOO 6XUIDFH ([SUHVVLRQ LQ 3& 51$ DQG 'RW %ORWWLQJ IRU &RQILUPDWLRQ RI 3$$ ([SUHVVLRQ LQ 3& :HVWHUQ ,PPXQREORW $QDO\VLV RI 3HULSODVP ([WUDFWV IURP ( FROL 0& DQG &. +DUERULQJ S8& S'& S'& DQG S76 &RQVWUXFWLRQ RI D %LFLVWURQLF VSD3 IRU ([SUHVVLRQ RI D 'LVFRQWLQXRXV 3, (YDOXDWLRQ RI 3, )UDJPHQW ([SUHVVLRQ E\ :HVWHUQ ,PPXQREORW (YDOXDWLRQ RI 6XUIDFH ([SUHVVLRQ RI 'LVFRQWLQXRXV 3, LQ 6 PXWDQV ,QWURGXFWLRQ RI 6 JRUGRQLL 6VS$ DQG 6VS% $5HJLRQV LQWR 3$$ :HVWHUQ ,PPXQREORW $QDO\VLV RI &KLPHULF 3, &RQWDLQLQJ WKH $UHJLRQ RI 6 JRUGRQLL 6VS$ DQG 6VS% 6XUIDFH ([SUHVVLRQ RI 6VS$ DQG 6VS% LQ 6 PXWDQV 3& ,QYROYHPHQW RI 5RS$ 7ULJJHU )DFWRUf DQG 'QD. LQ WKH 0DWXUDWLRQ DQG 7UDQVORFDWLRQ RI 3 (YDOXDWLRQ RI 3, 6XUIDFH ([SUHVVLRQ E\ :KROH &HOO 'RW %ORW LQ WKH 6n PXWDQV URS$ 0XWDQW 7: (YDOXDWLRQ RI 3, 6XUIDFH ([SUHVVLRQ E\ :KROH &HOO 'RW %ORW LQ 6 PXWDQV 60 D /RZ/HYHO ([SUHVVHU RI 'QD. $QDO\VLV RI GQD. 0HVVDJH /HYHOV E\ 4XDQWLWDWLYH 5HDO7LPH 3&5 5(68/76 ([SUHVVLRQ RI 5HFRPELQDQW 3, $$ DQG 5HFRJQLWLRQ E\ $QWL3L 0RQRFORQDO $QWLERGLHV (YDOXDWLRQ RI 3, $$ ([SUHVVLRQ LQ 6 PXWDQV (YDOXDWLRQ RIVSD36SHFLILF P51$ LQ 3& +DUERULQJ WKH 'HOHWLRQ &RQVWUXFW S76 (YDOXDWLRQ RI6HFUHWLRQ RI3O 3O$$DQG3O$3 LQIV FROL ,QWHUDFWLRQ RI WKH $ DQG 35HJLRQV E\ (/,6$ 5HVWRUDWLRQ RI (SLWRSHV E\ WKH ,QWHUDFWLRQ RI WKH $ DQG 35HJLRQV ,QKLELWLRQ RI 0$E $ %LQGLQJ WR 3, E\ DQ $ DQG 35HJLRQ &RPSOH[ 6WRLFKLRPHWU\ RI WKH $ DQG 35HJLRQ ,QWHUDFWLRQ ,QWHUDFWLRQ RI 3, 6VS$ DQG 6VS% $ DQG 35HJLRQV ,QWURGXFWLRQ RI WKH $5HJLRQV RI 6VS$ DQG 6VS% LQWR 3$$ 6WDELOLW\ DQG 7UDQVORFDWLRQ RI &KLPHULF 3, &RQWDLQLQJ WKH $5HJLRQV RI 6VS$ DQG 6VS% (YDOXDWLRQ RI WKH ,QYROYHPHQWRI 6HF% LQ WKH 6HFUHWLRQ RI 3, 3, $$ DQG 3O$3LQ ( FROL ([SUHVVLRQ RI 'LVFRQWLQXRXV 3, DQG 5HFRJQLWLRQ E\ $QWL3L 0RQRFORQDO $QWLERGLHV (YDOXDWLRQ RI6XUIDFH ([SUHVVLRQ RI 'LVFRQWLQXRXV 3, LQ6 PXWDQV 6XUIDFH ([SUHVVLRQ RI 3, LQ D 5RS$'HILFLHQW 6 PXWDQV DQG %DFWHULDO $GKHUHQFH WR 6DOLYDU\ $JJOXWLQLQ $QDO\VLV RI 3, 6XUIDFH ([SUHVVLRQ LQ D /RZ/HYHO 'QD. ([SUHVVLQJ 6 PXWDQV 0XWDQW (YDOXDWLRQ RI GQD. P51$ ([SUHVVLRQ LQ 6 PXWDQV 3& +DUERULQJ S'/ S0$-S0$' DQG S76 Y

PAGE 6

',6&866,21 $1' &21&/86,216 ,GHQWLILFDWLRQ RI DQ ,QWUDPROHFXODU ,QWHUDFWLRQ ZLWKLQ 3, $QDO\VLV RI 3, 7UDQVORFDWLRQ DQG WKH &RQWULEXWLRQ RI WKH $ODQLQH DQG 3UROLQH 5LFK 5HJLRQV ,QYROYHPHQW RI 5RS$ 7ULJJHU )DFWRUf DQG 'QD. LQ WKH 0DWXUDWLRQ DQG 7UDQVORFDWLRQ RI 3, &RQFOXVLRQV /,67 2) 5()(5(1&(6 %,2*5$3+,&$/ 6.(7&+ YL

PAGE 7

/,67 2) 7$%/(6 7DEOH SDJH %DFWHULDO 6WUDLQV 3ODVPLGV 3&5 3ULPHUV YLL

PAGE 8

/,67 2) ),*85(6 )LJXUH SDJH 6FKHPDWLF UHSUHVHQWDWLRQ RI3O :HVWHUQ EORW DQDO\VLV RI 3, DQG UHFRPELQDQW 3, ODFNLQJ WKH $UHJLRQ /DFN RI VXUIDFH H[SUHVVLRQ RI 3, GHYRLG RI WKH $UHJLRQ 51$ GRW EORW DQDO\VLV RI [SD3VSHFLILF P51$ OHYHOV LQ WKH 6WUHSWRFRFFXV PXWDQV VSD3QHJDWLYH PXWDQW 3& DQG GHULYDWLYHV :HVWHUQ LPPXQREORW RI F\WRSODVP DQG SHULSODVP IUDFWLRQV RI ( FROL '),D KDUERULQJ S8& GHULYHG SODVPLGV H[SUHVVLQJ IXOOOHQJWK 3, 3$3 3$$ DQG YHFWRU DORQH 'HPRQVWUDWLRQ RI $UHJLRQ DQG 3UHJLRQ LQWHUDFWLRQ E\ (/,6$ 5HVWRUDWLRQ RI HSLWRSHV E\ $ DQG 3UHJLRQ LQWHUDFWLRQV DV PHDVXUHG E\ (/,6$ ,QKLELWLRQ RI DQWL3 0$E 2$ ELQGLQJ WR LPPRELOL]HG 3 LQ (/,6$ 6WRLFKLRPHWU\ RI WKH P$K $ HSLWRSH 'HPRQVWUDWLRQ RI VLPLODU OHYHO RI P$E UHDFWLYLW\ WR $UHJLRQ*67 IXVLRQ SRO\SHSWLGHV RI 6VS$ 6VS% DQG 3, E\ :HVWHUQ LPPXQREORW 'HPRQVWUDWLRQ RI LQWHUDFWLRQV EHWZHHQ WKH $ DQG 3UHJLRQV RI GLIIHUHQW DQWLJHQ ,,, SURWHLQV (YDOXDWLRQ RI UHDFWLYLW\ RI $ DQG 3UHJLRQ GHSHQGHQW DQWL3O P$EV ZLWK 3, 6VS$ DQG 6VS% 5HVWRUDWLRQ RI HSLWRSHV E\ WKH LQWHUDFWLRQ RI YDULRXV DQWLJHQ ,,, $UHJLRQV ZLWK WKH LPPRELOL]HG 3UHJLRQ RI 6WUHSWRFRFFXV JRUGRQLL 6VS$ 5HVWRUDWLRQ RI HSLWRSHV E\ WKH LQWHUDFWLRQ RI YDULRXV DQWLJHQ ,,, $UHJLRQV ZLWK WKH LPPRELOL]HG 3UHJLRQ RI 6VS$ YLLL

PAGE 9

5HVWRUDWLRQ RI HSLWRSHV E\ WKH LQWHUDFWLRQ RI YDULRXV DQWLJHQ ,,, $UHJLRQV ZLWK WKH LPPRELOL]HG 3UHJLRQ RI 6VS$ 5HVWRUDWLRQ RI HSLWRSHV E\ WKH LQWHUDFWLRQ RI YDULRXV DQWLJHQ ,,, $UHJLRQV ZLWK WKH LPPRELOL]HG $UHJLRQ RI 6VS$ 5HVWRUDWLRQ RI HSLWRSHV E\ WKH LQWHUDFWLRQ RI YDULRXV DQWLJHQ ,,, $UHJLRQV ZLWK WKH LPPRELOL]HG $UHJLRQ RI 6VS$ 5HVWRUDWLRQ RI HSLWRSHV E\ WKH LQWHUDFWLRQ RI YDULRXV DQWLJHQ ,,, $UHJLRQV ZLWK WKH LPPRELOL]HG $UHJLRQ RI 6VS$ :HVWHUQ LPPXQREORW RI FKLPHULF 3, FRQWDLQLQJ WKH $UHJLRQV RI 6VS$ DQG 6VS% 6XUIDFH H[SUHVVLRQ RI 6 JRUGRQLL 6VS$ DQG 6VS% LQ 6 PXWDQV 3& 'HPRQVWUDWLRQ RI ODFN RI DELOLW\ RI KHWHURORJRXV $UHJLRQV WR UHVWRUH VXUIDFH H[SUHVVLRQ RI 3$$ LQ 3& :HVWHUQ LPPXQREORWV RI FHOO O\VDWHV RI 3& KDUERULQJ YHFWRU DORQH DQG SODVPLGV HQFRGLQJ 3, 3$$ 3, $$ 6VS$ $UHJLRQ DQG 3, $$ 6VS% $ UHJLRQ :HVWHUQ LPPXQREORW RI F\WRSODVP DQG SHULSODVP IUDFWLRQV RI e FROL 0& ZLOGW\SHf DQG &. $VHF%f KDUERULQJ S'& 3,f 6FKHPDWLF UHSUHVHQWDWLRQ RI GLVFRQWLQXRXV 3, :HVWHUQ LPPXQREORW RI 3, IUDJPHQWV H[SUHVVHG IURP S76 LQ ( FROL :KROH FHOO GRW EORW RI 6 PXWDQV 1* DQG 3& KDUERULQJ S'/ YHFWRU FRQWURO S0$' HQFRGLQJ 3, DQG S76 HQFRGLQJ GLVFRQWLQXRXV 3, IUDJPHQWV 3, VXUIDFH H[SUHVVLRQ OHYHOV RI 6 PXWDQV 8$ DQG 7: URS$ PXWDQWf DW HDUO\ ORJ VWDJH WUDFHG ZLWK P$E $ DV PHDVXUHG E\ GHQVLWRPHWU\ 3, VXUIDFH H[SUHVVLRQ OHYHOV RI 6 PXWDQV 8$ DQG 60 'QD.GHILFLHQWf DW HDUO\ ORJ SKDVH 5HDO7LPH 3&5 TXDQWLILFDWLRQ RI GQD. P51$ IURP 6 PXWDQV 3& KDUERULQJ WKH S'/ YHFWRU DORQH DQG H[SUHVVLQJ 3, $3UHJLRQ IXOOOHQJWK 3 DQG 3O$$UHJLRQ L[

PAGE 10

$EVWUDFW RI 'LVVHUWDWLRQ 3UHVHQWHG WR WKH *UDGXDWH 6FKRRO RI WKH 8QLYHUVLW\ RI )ORULGD LQ 3DUWLDO )XOILOOPHQW RI WKH 5HTXLUHPHQWV IRU WKH 'HJUHH RI 'RFWRU RI 3KLORVRSK\ 02/(&8/$5 ,17(5$&7,216 2) 7+( 6WUHSWRFRFFXV PXWDQV 685)$&( 3527(,1 3, &2175,%87,216 72 685)$&( 6758&785( 67$%,/,7< $1' 75$16/2&$7,21 %\ 7UHYRU %U\DQW 6HLIHUW 0D\ &KDLU / -HDQQLQH %UDG\ 0DMRU 'HSDUWPHQW 2UDO %LRORJ\ 6WUHSWRFRFFXV PXWDQV LV FRQVLGHUHG WR EH WKH PDMRU HWLRORJLF DJHQW RI KXPDQ GHQWDO FDULHV $WWDFKPHQW RI 6 PXWDQV WR WKH WRRWK VXUIDFH LV UHTXLUHG IRU WKH GHYHORSPHQW RI FDULHV DQG LV PHGLDWHG LQ SDUW E\ WKH N' VXUIDFH SURWHLQ YDULRXVO\ NQRZQ DV DQWLJHQ 9,, 3$F DQG 3, 6XFK SURWHLQV DUH H[SUHVVHG E\ QHDUO\ DOO VSHFLHV RI RUDO VWUHSWRFRFFL DQG KDYH EHHQ LGHQWLILHG DV SRVVLEOH DQWLJHQV IRU YDFFLQH GHYHORSPHQW ,Q DGGLWLRQ UHVHDUFKHUV DUH XWLOL]LQJ 3, WR VWXG\ LPPXQH UHVSRQVH DQG LPPXQRPRGXODWLRQ 7KH JRDO RI WKLV UHVHDUFK ZDV WR LGHQWLI\ LQWUDPROHFXODU LQWHUDFWLRQV ZLWKLQ 3, DQG WR H[DPLQH WKHLU FRQWULEXWLRQV WR 3, VWUXFWXUH VWDELOLW\ DQG WUDQVORFDWLRQ 7R WKDW HQG WKLV UHVHDUFK GHPRQVWUDWHV Df WKDW VHYHUDO DQWL3O PRQRFORQDO DQWLERGLHV P$EVf UHTXLUH WKH VLPXOWDQHRXV SUHVHQFH RI WKH DODQLQHULFK DQG SUROLQHULFK UHJLRQV IRU ELQGLQJ Ef WKDW WKH SUROLQHULFK UHJLRQ RI 3, LQWHUDFWV ZLWK WKH DODQLQHULFK UHJLRQ Ff WKDW OLNH WKH SUROLQHULFK UHJLRQ WKH DODQLQHULFK UHJLRQ LV UHTXLUHG IRU WKH VWDELOLW\ DQG WUDQVORFDWLRQ [

PAGE 11

RI 3, Gf WKDW ERWK WKH SUROLQHULFK DQG DODQLQHULFK UHJLRQV DUH UHTXLUHG IRU VHFUHWLRQ RI 3, LQ ( FROL DQG Hf WKDW LQ ( FRW 3, LV VHFUHWHG LQ WKH DEVHQFH RI 6HF% $GGLWLRQDOO\ LW ZDV GHPRQVWUDWHG WKDW WKH FKDSHURQH 5RS$ WULJJHU IDFWRUf ZDV QRW UHTXLUHG IRU 3, WUDQVORFDWLRQ +RZHYHU LWV DEVHQFH UHVXOWHG LQ UHGXFHG 3 PHGLDWHG DGKHUHQFH WR VDOLYDU\ DJJOXWLQLQ VXJJHVWLQJ D UROH LQ 3, PDWXUDWLRQ 'QD. ZDV DOVR VKRZQ WR EH LQYROYHG LQ 3, WUDQVORFDWLRQ DQG GQD. P51$ OHYHOV ZHUH DIIHFWHG E\ WKH SUHVHQFH RI 3, GHOHWLRQ FRQVWUXFWV )XUWKHUPRUH WKH $ DQG 3UHJLRQV RI 3, ZHUH VKRZQ WR EH FDSDEOH RI LQWHUDFWLQJ ZLWK WKH $ DQG 3UHJLRQV RI WKH $QWLJHQ ,,, SURWHLQV 6VS$ DQG 6VS% IURP 6WUHSWRFRFFXV JRUGRQLL 7KHVH LQWHUDFWLRQV UHVWRUHG HSLWRSHV UHFRJQL]HG E\ VHYHUDO DQWL3O P$EV 5HSODFLQJ WKH $UHJLRQ RI 3, ZLWK WKH $UHJLRQV RI 6VS$ DQG 6VS% DOVR UHVWRUHG VRPH P$E ELQGLQJ EXW GLG QRW UHVWRUH VWDELOLW\ DQG WUDQVORFDWLRQ RI 3, WR WKH FHOO VXUIDFH 7KH UHVXOWV RI WKLV UHVHDUFK KDYH LPSOLFDWLRQV IRU XQGHUVWDQGLQJ VXUIDFH ORFDOL]DWLRQ RI YLUXOHQFH IDFWRUV LQ SDWKRJHQLF PLFURRUJDQLVPV DQG IRU XQGHUVWDQGLQJ KRZ WKH SURWHLQ VWUXFWXUH RI D YDFFLQH DQWLJHQ FRQWULEXWHV WR UHFRJQLWLRQ E\ DQWLERGLHV [W

PAGE 12

&+$37(5 ,1752'8&7,21 6WUHSWRFRFFXV PXWDQV DQG 'HQWDO &DULHV 6WUHSWRFRFFXV PXWDQV LV FRQVLGHUHG WR EH WKH PDMRU HWLRORJLFDO DJHQW RI KXPDQ GHQWDO FDULHV >@ RQH RI WKH PRVW FRPPRQ LQIHFWLRXV GLVHDVHV WKDW DIIHFW KXPDQV 6 PXWDQV ZDV ILUVW LGHQWLILHG LQ D KXPDQ FDULRXV OHVLRQ LQ DQG LVRODWHV ZHUH ODWHU GLYLGHG LQWR HLJKW VHURW\SHV GHVLJQDWHG D WKURXJK K EDVHG RQ GLIIHUHQFHV LQ FHOO ZDOO FDUERK\GUDWH FRPSRVLWLRQ >@ &RQFXUUHQW '1$ K\EULGL]DWLRQ VWXGLHV IXUWKHU FDWHJRUL]HG WKH VHURW\SHV DV IRXU JHQHWLF W\SHV EDVHG XSRQ WKH JXDQLQH SOXV F\WRVLQH *&f FRQWHQW RI WKHLU JHQRPHV > @ 7KH IRXU JHQHWLF W\SHV ZHUH VXEVHTXHQWO\ FODVVLILHG DV GLIIHUHQW VSHFLHV 6WUHSWRFRFFXV FULWXV VHURW\SH Df 6WUHSWRFRFFXV UDWWXV VHURW\SH Ef 6WUHSWRFRFFXV VREULQXV VHURW\SHV G J Kf DQG 6 PXWDQV VHURW\SHV F HIf 7KHVH VSHFLHV DUH FROOHFWLYHO\ NQRZQ DV PXWDQV VWUHSWRFRFFL >@ 6 PXWDQV VHURW\SH F LV WKH PRVW FRPPRQ PXWDQV VWUHSWRFRFFXV LVRODWHG IURP KXPDQ GHQWDO SODTXH >@ PXWDQV LV HTXLSSHG ZLWK VHYHUDO SURWHLQV WKDW HQDEOH LWV DWWDFKPHQW DQG VXEVHTXHQW FRORQL]DWLRQ RI WKH WRRWK VXUIDFH ,Q WKH SUHVHQFH RI VXFURVH H[WUDFHOOXODU JOXFRV\OWUDQVIHUDVHV *7)f V\QWKHVL]H VHYHUDO IRUPV RI EUDQFKHG H[WUDFHOOXODU JOXFDQV 7KHVH JOXFDQV SURYLGH D PDWUL[ IRU WKH DJJUHJDWLRQ RI 6 PXWDQV DQG RWKHU RUDO VWUHSWRFRFFL WKURXJK LQWHUDFWLRQ ZLWK SURWHLQV VXFK DV WKH EDFWHULDO VXUIDFHORFDOL]HG JOXFDQELQGLQJ SURWHLQV *%3f 6 PXWDQV SRVVHVVHV IRXU *7) JHQHV JWI$ >@ JWM% >@ JWI& >@ DQGJW' >@ DQG WKUHH *%3 JHQHV JES$ >@ JES% >@ DQG JES& >@ 0XWDWLRQDO LQDFWLYDWLRQ RI WKH *7) JHQHV KDV VKRZQ WKDW WKHLU SURGXFWV DUH LPSRUWDQW WR

PAGE 13

FDULRJHQHFLW\ +RZHYHU D PRGHO IRU FRORQL]DWLRQ RI WKH WRRWK VXUIDFH E\ 6 PXWDQV VXJJHVWV WKDW LQLWLDO DWWDFKPHQW WR WKH WRRWK SHOOLFOH LV SURWHLQPHGLDWHG IROORZHG E\ JOXFDQGHSHQGHQW EDFWHULDO DFFXPXODWLRQ >@ 7KH VXUIDFH SURWHLQV WKDW DUH LPSOLFDWHG LQ WKH LQLWLDO DGKHUHQFH RI 6 PXWDQV DUH PHPEHUV RI WKH DQWLJHQ ,,, VXSHUIDPLO\ RI PXOWLIXQFWLRQDO DGKHVLQV DQG DUH YDULRXVO\ NQRZQ DV DQWLJHQ ,,, >@ $J % >@ ,) >@ 3, >@ 65 >@ DQG 3$F >@ DQG DUH HQFRGHG E\ WKH JHQHV VSD3 RU SDF $QWLJHQ ,,, OLNH PROHFXOHV DUH H[SUHVVHG LQ QHDUO\ DOO RI WKH RUDO VWUHSWRFRFFL >@ DQG LQFOXGH 6SD$ >@DQG 3$J >@ IURP 6 VREULQDV 663 IURP 6WUHSWRFRFFXV VDQJXLV >@ DQG 6VS$ >@ DQG 6VS% >@ IURP 6WUHSWRFRFFXV JRUGRQLL 0DMRU 6XUIDFH 3URWHLQ 3, 7KH JHQHV VSD3 DQG SDF KDYH EHHQ FORQHG DQG VHTXHQFHG > @ 1WHUPLQDO DPLQR DFLG VHTXHQFLQJ RI WKH SURWHLQV DQG WKH SUHGLFWHG DPLQR DFLG VHTXHQFHV LQGLFDWH WKDW WKH VSD3 DQG SDF JHQH SURGXFWV GLIIHU E\ RQO\ UHVLGXHV 0DMRU FKDUDFWHULVWLFV RI WKH 0Ua 3, LQFOXGH D UHVLGXH DPLQRWHUPLQDO VLJQDO VHTXHQFH D UHJLRQ FRQWDLQLQJ WKUHH UHVLGXH DODQLQHULFK UHSHDWV D UHVLGXH YDULDEOH UHJLRQ LQ ZKLFK RI WKH DIRUHPHQWLRQHG DPLQR DFLG VXEVWLWXWLRQV UHVLGH D FHQWUDO SUROLQHULFK UHJLRQ FRQWDLQLQJ WKUHH UHVLGXH WDQGHP UHSHDWV FDUER[\WHUPLQDO ZDOO DQG PHPEUDQH VSDQQLQJ UHJLRQV DQG DQ /3;7* ZDOO DQFKRU PRWLI >@ )LJ f 6HFRQGDU\ VWUXFWXUH SUHGLFWLRQV RI 3, EDVHG XSRQ WKH VHTXHQFH RI VSD3 LQGLFDWH WKDW WKH DODQLQHULFK UHJLRQ ZRXOG IRUP DQ DKHOLFOH FRLOHGFRLO VWUXFWXUH ZKLOH WKH FHQWUDO SUROLQHULFK UHJLRQ ZRXOG IRUP DQ H[WHQGHG SVKHHW VWUXFWXUH >@ 5HFHQWO\ WKH YDULDEOH UHJLRQ RI WKH 6PXWDQV VHURW\SHDQWLJHQ ,,, ZDV VXEFORQHG DQG LWV FU\VWDO VWUXFWXUH GHWHUPLQHG 7KH FU\VWDO VWUXFWXUH GDWD LQGLFDWH WKDW WKH YDULDEOH UHJLRQ IRUPV D IOH[LEOH SVDQGZLFK >@

PAGE 14

6LJQDO 6HTXHQFH rfr‘ f $5(*,21 95(*,21 35(*,21 DD f DD f :DOO 0HPEUDQH &\WRSODLPLU 6SDQQLQJ 6SDQQLQJ 7DLO 5HJLRQ 5HJLRQ DD f DD f DD N LL f ? D PP )LJXUH 6FKHPDWLF UHSUHVHQWDWLRQ RI 3, $QWLJHQ ,,, SRO\SHSWLGHV DUH VWUXFWXUDOO\ FRPSOH[ DQG H[KLELW GLYHUVH ELQGLQJ SURSHUWLHV ZKLFK PHGLDWH LQWHUDFWLRQV ZLWK D YDULHW\ RI VXEVWUDWHV LQFOXGLQJ KRVW VDOLYDU\ DJJOXWLQLQ ILEURQHFWLQ ILEULQRJHQ DQG FROODJHQ > @ 6HYHUDO UHJLRQV KDYH EHHQ LPSOLFDWHG LQ WKH ELQGLQJ DFWLYLWLHV RI DQWLJHQ ,,, SRO\SHSWLGHV %UDG\ HW DO >@ SURYLGHG HYLGHQFH WKDW 3, SRVVHVVHG PXOWLSOH VLWHV FRQWULEXWLQJ WR VDOLYDU\ DJJOXWLQLQ ELQGLQJ DQG WKDW GLIIHUHQW UHJLRQV PLJKW EH LQYROYHG LQ ELQGLQJ WR VROXEOH RU LPPRELOL]HG VDOLYDU\ DJJOXWLQLQ /DWHU 6FDWFKDUG DQDO\VLV RI DQWLJHQ ,,, ELQGLQJ WR VDOLYDFRDWHG K\GUR[\DSHWLWH VKRZHG WKH ELQGLQJ WR EH PHGLDWHG E\ WZR VLWHV >@ ,QYHVWLJDWRUV KDYH VKRZHG WKDW UHFRPELQDQW SHSWLGH IUDJPHQWV GHULYHG IURP WKH $UHJLRQ ERXQG VDOLYDU\ DJJOXWLQLQ >@ RU VDOLYDU\ JO\FRSURWHLQV >@ DQG 6HQSXNX HW DO f GHPRQVWUDWHG WKDW DQWLERGLHV VSHFLILF WR D SHSWLGH IUDJPHQW GHULYHG IURP 3$F DD UHVLGXHV LQKLELWHG WKH ELQGLQJ RI IOXLGSKDVH VDOLYDU\ FRPSRQHQWV WR LPPRELOL]HG 3$F )XUWKHUPRUH DQ DQWLJHQ ,,, SHSWLGH IUDJPHQW FRQVLVWLQJ RI DD UHVLGXHV EORFNHG PXWDQV FHOO DGKHVLRQ WR VDOLYDFRDWHG K\GUR[\DSDWLWH >@ DQG .HOO\ HW DO >@ IRXQG DQWLJHQ ,,, GHULYHG SHSWLGHV FRQVLVWLQJ RI UHVLGXHV DQG WR EH LQKLELWRU\ WR 6 PXWDQV DGKHVLRQ WR VDOLYDU\ JO\FRSURWHLQV

PAGE 15

3UROLQH DQG 3UROLQH5LFK 5HJLRQV 3UROLQH LV XQLTXH DPRQJ WKH DPLQR DFLGV LQ WKDW LWV VLGH FKDLQ LV FRYDOHQWO\ ERXQG WR WKH EDFNERQH DPLGH $V D UHVXOW RI WKLV XQXVXDO ERQG WKH SUROLQH UHVLGXH KDV D UHVWULFWHG EDFNERQH FRQIRUPDWLRQ >@ WKH EXONLQHVV RI LWV VLGH FKDLQ UHVWULFWV WKH FRQIRUPDWLRQ RI WKH SUHFHGLQJ UHVLGXH >@ DQG WKH SUROLQH LV XQDEOH WR DFW DV D K\GURJHQ ERQG GRQRU 3UROLQH LV UHFRJQL]HG DV DQ DKHOL[ DQG VKHHW EUHDNHU DQG LV RIWHQ ORFDWHG RQH RU WZR UHVLGXHV &WHUPLQDO RI DQ DKHOL[ >@ $ VHTXHQFH RI IRXU RU PRUH SUROLQHV LQ D URZ DGRSWV WKH FRQIRUPDWLRQ RI DQ H[WHQGHG VWUXFWXUH ZLWK WKUHH UHVLGXHV SHU WXUQ NQRZQ DV D SRO\SUROLQH ,, KHOL[ >@ 7KH SRO\SUROLQH KHOL[ LV D PDMRU VWUXFWXUDO HOHPHQW LQ FROODJHQ SDQFUHDWLF SRO\SHSWLGHV DQG QHXURSHSWLGHV >@ ,Q D VXUYH\ RI VXUIDFH SURWHLQV WKHUH ZHUH RFFXUUHQFHV RI SRO\SUROLQH ,, KHOL[HV LQ QRQ KRPRORJRXV SURWHLQV >@ 3UROLQHULFK UHJLRQV DUH ELRORJLFDOO\ LPSRUWDQW LQ QXPHURXV XQUHODWHG SURWHLQV LQ D YDULHW\ RI RUJDQLVPV ERWK HXNDU\RWLF DQG SURNDU\RWLF $OWKRXJK WKH IXQFWLRQV RI SURWHLQV FRQWDLQLQJ SUROLQHULFK UHJLRQV FDQ EH TXLWH GLYHUVH WKH UROHV RI WKH SUROLQHULFK UHJLRQV DSSHDU WR EH IDLUO\ FRQVHUYHG SURWHLQSURWHLQ LQWHUDFWLRQ IROGLQJ DQG VWUXFWXUH ,Q HXNDURWHV DQDQGDPLGH DPLGDVH LV UHVSRQVLEOH IRU WKH K\GURO\VLV RI QHXURPRGXODWRU\ IDWW\ DFLG DPLGHV DQG HVWHUV >@ 7KH HQ]\PH FRQWDLQV D QLQH UHVLGXH SUROLQHULFK UHJLRQ ZKLFK XSRQ UHPRYDO UHVXOWHG LQ ORVV RI HQ]\PDWLF DFWLYLW\ DQG D FKDQJH LQ VXEFHOOXODU ORFDOL]DWLRQ RI WKH HQ]\PH ,W LV VXJJHVWHG WKDW WKH SUROLQHULFK UHJLRQ PD\ EH HVVHQWLDO IRU WKH FRUUHFW IROGLQJ RI WKH DPLGDVH DOWKRXJK VLPLODU SUROLQHULFK UHJLRQV DUH QRW IRXQG LQ QRQPDPPDOLDQ DPLGDVHV >@ ,QYROYHPHQW LQ FHOOXODU ORFDOL]DWLRQ KDV DOVR EHHQ GHPRQVWUDWHG IRU WKH SUROLQHULFK UHJLRQ LQ WKH HXNDU\RWLF HQ]\PH G\QDPLQ

PAGE 16

2NDPRWR HW DO KDV VKRZQ WKDW D SUROLQHULFK GRPDLQ LV LQYROYHG LQ WKH HQ]\PHfV ORFDOL]DWLRQ WR FRDWHG SLWV DQG LQ LWV *73ELQGLQJ DFWLYLW\ >@ 7KH UHOHYDQFH RI SUROLQHULFK GRPDLQV WR WKH ILHOG RI PHGLFLQH FDQ EH VHHQ LQ WKH KXPDQ GLVHDVH /LGGOH V\QGURPH /LGGOH V\QGURPH LV D GLVHDVH RI WKH DPLORULGHVHQVLWLYH HSLWKHOLDO VRGLXP FKDQQHO >@ 7KH VRGLXP FKDQQHO LV FRPSRVHG RI WKUHH VXEXQLWV WZR RI ZKLFK FRQWDLQ KLJKO\ FRQVHUYHG &WHUPLQDO SUROLQHULFK GRPDLQV )UDPHVKLIW PXWDWLRQV UHVXOWLQJ LQ WKH GHOHWLRQ RI DW OHDVW UHVLGXHV IURP WKH &WHUPLQDO VHJPHQWV RI WKH VXEXQLWV KDYH EHHQ WKH LGHQWLILHG FDXVHV RI WKLV GLVHDVH 0RUH UHFHQWO\ D PLVVHQVH PXWDWLRQ WKDW UHVXOWV LQ WKH VXEVWLWXWLRQ RI D OHXFLQH IRU D SUROLQH 3f LQ WKH FRQVHUYHG SUROLQHULFK GRPDLQ RI VXEXQLW S KDV EHHQ LGHQWLILHG DQG FRUUHODWHG ZLWK WKH GLVHDVH 7KH VXEVWLWXWLRQ KDV JUHDWHU HIIHFW RQ FKDQQHO DFWLYLW\ WKDQ WKH GHOHWLRQ RI WKH FRPSOHWH & WHUPLQDO VHJPHQW RI ERWK WKH S DQG \ VXEXQLWV ,W LV VXJJHVWHG WKDW WKLV SUROLQH UHVLGXH LV LQYROYHG LQ DQ HVVHQWLDO LQWHUDFWLRQ ZLWK DQRWKHU SURWHLQ DQG SRVVLEO\ DQRWKHU VXEXQLW >@ 3UROLQHULFK UHJLRQV DUH DOVR LQYROYHG LQ SURWHLQSURWHLQ LQWHUDFWLRQV EHWZHHQ RUJDQLVPV ,Q WKH ZRUOG RI YLURORJ\ WKH WUDQVIRUPDWLRQ RI SULPDU\ % O\PSKRF\WHV ZLWK (SVWHLQ%DUU YLUXV (%9f LV NQRZQ WR EH GHSHQGHQW XSRQ WKH H[SUHVVLRQ RI WKH (%9 QXFOHDU SURWHLQ (%1$f >@ 7KH UHVLGXH (%1$ FRQWDLQV D UHVLGXH SUROLQH ULFK UHJLRQ LQ WKH 1WHUPLQDO WKLUG RI WKH SURWHLQ 2I WKH UHVLGXHV RI WKH 1WHUPLQDO KDOI RI (%1$ ZHUH QRW HVVHQWLDO IRU WUDQVIRUPDWLRQ RI % O\PSKRF\WHV 7KH HLJKW HVVHQWLDO UHVLGXHV DUH VHYHQ SUROLQHV DQG D JOXWDPLQH DQG LW LV VXJJHVWHG WKDW WKH\ PD\ FRQVWLWXWH D FULWLFDO GRPDLQ IRU VWUXFWXUH RU LQWUDPROHFXODU LQWHUDFWLRQ >@ /DVWO\ DQ LQWHUDFWLRQ EHWZHHQ D SUROLQHULFK LQVHFW SHSWLGH DQG D PROHFXODU FKDSHURQH LQ EDFWHULD

PAGE 17

KDV EHHQ LGHQWLILHG 3\UUKRFRULFLQ DQ DQWLEDFWHULDO SHSWLGH RULJLQDOO\ LVRODWHG IURP WKH (XURSHDQ VDSVXFNLQJ EXJ 3\UUOLRFRULV DSWHUXV >@ NLOOV VHQVLWLYH VSHFLHV E\ ELQGLQJ WR WKH EDFWHULDO 'QD. >@ 3UHYLRXVO\ LQ DQ DWWHPSW WR GHILQH D UROH IRU WKH 3UHJLRQ LQ WKH DGKHVLYH IXQFWLRQ RI 3, DQ LQWHUQDO GHOHWLRQ 3$3 $f ZDV FRQVWUXFWHG >@ 7KH SUROLQHULFK UHJLRQ 3UHJLRQf LV KLJKO\ FRQVHUYHG DPRQJ WKH DQWLJHQ ,,, IDPLO\ RI RUDO VWUHSWRFRFFDO SURWHLQV DQG VLPLODU KLJKO\ UHSHWLWLYH SUROLQHULFK VHTXHQFHV KDYH EHHQ LGHQWLILHG LQ D ZLGH YDULHW\ RI EDFWHULDO SURWHLQV >@ +RPRORJ\ WR WKH 3UHJLRQ RI 3, LV IRXQG LQ QXPHURXV VXUIDFH SURWHLQV LQ ERWK SURNDU\RWHV DQG HXNDU\RWHV $PRQJ WKHVH DUH WKH ILEURQHFWLQ ELQGLQJ SURWHLQV RI 6WUHSWRFRFFXV S\RJHQHV DQG 6WDSK\ORFRFFXV DXUHXV > @ DQ LPPXQRJHQLF VHFUHWHG SURWHLQ LVSf RI 6 S\RJHQHV >@ DQG WKH YLUXOHQFH DVVRFLDWHG VXIDFH SURWHLQ 3VS$ RI 6 SQHXPRQLD >@ 7KH LQWHUQDOO\ GHOHWHG SRO\SHSWLGH 3, $3 ZDV H[SUHVVHG LQ ERWK ( FROL DQG LQ 6PXWDQV 3& DQ LVRJHQLF V!Q3QHJDWLYH PXWDQW :HVWHUQ EORWV RI 3$3 H[SUHVVHG LQ ( FROL UHYHDOHG D ORVV LQ UHDFWLYLW\ IRU ILYHRI HOHYHQ 3,VSHFLILF 0$EV 7KHVH ILYH P$EV DOVR GLG QRW UHDFW WR D VXEFORQH RI WKH 3UHJLRQ f VXJJHVWLQJ WKDW WKH\ UHFRJQL]H D FRPSOH[ 3, HSLWRSH WKDW LV GHSHQGHQW XSRQ WKH SUHVHQFH RI WKH 3UHJLRQ $OWKRXJK 3$3 FRQWDLQV WKH VLJQDO VHTXHQFH LW ZDV QRW WUDQVORFDWHG WR WKH VXUIDFH RI 6 PXWDQV 3& VSD3f $OVR LQ FRPSDULVRQ WR IXOOOHQJWK 3, H[SUHVVHG IURP S'/ RQO\ ORZ OHYHOV RI 3, $3 ZHUH GHWHFWHG LQ WKH F\WRSODVP RI 3& ZKLOH P51$ OHYHOV ZHUH HTXLYDOHQW 7KHVH GDWD VXJJHVW WKDW WKH 3UHJLRQ PD\ EH UHTXLUHG IRU 3, VWDELOLW\ DQG VXEVHTXHQW WUDQVORFDWLRQ WR WKH FHOO VXUIDFH

PAGE 18

3URWHLQ 7UDQVORFDWLRQ 6LQFH 3$3 SRVVHVVHG WKH 1WHUPLQDO VLJQDO VHTXHQFH DQG &WHUPLQDO FHOO ZDOO DQFKRU PRWLI WKH ODFN RI 3$3 H[SUHVVLRQ RQ WKH FHOO VXUIDFH ZDV XQH[SHFWHG 3UROLQH ULFK UHJLRQV DUH NQRZQ WR EH LQYROYHG LQ D YDULHW\ RI LQWUD DQG LQWHUPROHFXODU SURWHLQ SURWHLQ LQWHUDFWLRQV >@ LQFOXGLQJ FKDSHURQHOLNH DFWLYLWLHV :DQJ HW DO >@ LGHQWLILHG D FHQWUDOO\ ORFDWHG SUROLQHULFK UHJLRQ LQ WKH VHULQH SURWHDVH )DFWRU & 7KH /LPXOXV SRO\SKHPXV KRUVHVKRH FUDEf )DFWRU & LV D N'D VHFUHWHG VHULQH SURWHDVH DQG FRQWDLQV D FHQWUDOO\ ORFDWHG SUROLQHULFK UHJLRQ 7KH UROH RI WKH SUROLQHULFK UHJLRQ LQ WKH VHFUHWLRQ DQG IXQFWLRQ RI )DFWRU & ZDV LQYHVWLJDWHG WKURXJK WKH FRQVWUXFWLRQ DQG H[SUHVVLRQ RI KRPRORJXHV ZLWK DQG ZLWKRXW WKH SUROLQHULFK UHJLRQ 7KH SUROLQHULFK UHJLRQ LV IODQNHG E\ DQ DPLQRWHUPLQDO OHFWLQ ELQGLQJ GRPDLQ DQG D FDUER[\WHUPLQDO SURWHDVH GRPDLQ )DFWRU & LV DPLQR DFLGV LQ OHQJWK DQG WKH SUROLQHULFK UHJLRQ VSDQV UHVLGXHV 'HOHWLRQ RI HLWKHU WKH OHFWLQ ELQGLQJ RU SURWHDVH GRPDLQV UHVXOWHG LQ SHSWLGHV WKDW ZHUH VWDEO\ H[SUHVVHG DQG VHFUHWHG E\ WKH FHOO ,Q FRQWUDVW GHOHWLQJ WKH SUROLQHULFK UHJLRQ UHVXOWHG LQ D SURWHLQ WKDW ZDV IRXQG LQ WKH F\WRSODVP EXW ZDV QR ORQJHU VHFUHWHG ,Q DGGLWLRQ H[SUHVVLRQ RI D WUXQFDWHG SHSWLGH FRQVLVWLQJ RI WKH DPLQRWHUPLQDO UHVLGXHV RI )DFWRU & ZDV VWDEOH DQG VHFUHWHG ZKLOH D SHSWLGH FRQVLVWLQJ RI WKH VHFUHWLRQ VLJQDO IXVHG WR WKH FDUER[\WHUPLQDO SURWHDVH GRPDLQ ZDV QRW VHFUHWHG ,QWHUHVWLQJO\ WKH DGGLWLRQ RI WKH SUROLQHULFK UHJLRQ DPLQRWHUPLQDO WR WKH SURWHDVH GRPDLQ UHVWRUHG VHFUHWLRQ RI WKH SHSWLGH EXW IXVLQJ WKH SUROLQHULFK UHJLRQ FDUER[\WHUPLQDO WR WKH SURWHDVH GRPDLQ GLG QRW UHVWRUH VHFUHWLRQ 7R HVWDEOLVK D UROH IRU WKH SUROLQHULFK UHJLRQ LQ WKH IROGLQJ RI )DFWRU & D SDUWLDO WU\SVLQ GLJHVWLRQ DQDO\VLV ZDV SHUIRUPHG 7U\SVLQ FOHDYHV SUHIHUHQWLDOO\ DW XQIROGHG UHJLRQV LQ SURWHLQV DQG DOWKRXJK WKHUH DUH QHDUO\ SRWHQWLDO WU\SVLQ FOHDYDJH VLWHV LQ

PAGE 19

)DFWRU & IRXU EDQGV ZHUH GHWHFWHG DIWHU SDUWLDO GLJHVWLRQ 7KH YLVLEOH IUDJPHQWV ZHUH DWWULEXWHG WR FRPSDFWO\ IROGHG GRPDLQV +RZHYHU )DFWRU & ZLWKRXW WKH SUROLQHULFK UHJLRQ ZDV QRW GHWHFWDEOH DIWHU PLQXWHV RI WU\SVLQ GLJHVWLRQ LQGLFDWLQJ WKDW WKH SURWHLQ ZDV LQ DQ XQIROGHG WU\SVLQVXVFHSWLEOH FRQIRUPDWLRQ 7KLV VWXG\ UHYHDOHG WKDW WKH SUROLQHULFK UHJLRQ LV HVVHQWLDO IRU WKH VWDELOLW\ DQG VHFUHWLRQ RI )DFWRU & %HFDXVH WKLV HIIHFW ZDV VLPLODU WR WKDW SUHYLRXVO\ GHVFULEHG IRU WKH 3UHJLRQ RI 3, >@ WKHVH DXWKRUV VXJJHVWHG WKDW LQWHUQDO SUROLQHULFK UHJLRQV PD\ DFW DV LQWUDPROHFXODU FKDSHURQHV IRU FRUUHFW IROGLQJ DQG VHFUHWLRQ RI SURWHLQV WKDW FRQWDLQ WKHP 7KH KRPRORJ\ RI WKH 3 UHJLRQ RI 3, WR WKH VXUIDFH SURWHLQV RI QXPHURXV RUJDQLVPV DQG LWV FRQVHUYDWLRQ ZLWKLQ RUDO VWUHSWRFRFFL VXJJHVW WKDW LW SOD\V DQ LPSRUWDQW UROH LQ 3, DQG FRQVLGHULQJ WKH SUHYDOHQFH RI SUROLQHULFK UHJLRQV LQ SURWHLQSURWHLQ LQWHUDFWLRQV LW LV OLNHO\ WKDW WKH 3 UHJLRQ LV LQYROYHG LQ VXFK DQ LQWHUDFWLRQ 5HFHQWO\ 9DQ 'ROODUZHHG HW DO f GHPRQVWUDWHG WKDW WKH 3UHJLRQ RI 3, ELQGV WR D SRO\SHSWLGH IUDJPHQW RI 3 WKDW FRQWDLQV WKH DODQLQHULFK UHJLRQ $UHJLRQf 7KLV LQWHUDFWLRQ UHVWRUHG WKH UHDFWLYLW\ RI D 3, VSHFLILF 0DE WKDW ZDV QRW UHDFWLYH WR HLWKHU RI WKH IUDJPHQWV LQGLYLGXDOO\ DQG VXJJHVWV WKDW WKHVH UHJLRQV LQWHUDFW LQ PDWXUH VXUIDFH H[SUHVVHG 3, ;UD\ FU\VWDOORJUDSK\ KDV UHYHDOHG WKDW WKH YDULDEOH UHJLRQ RI 3, IRUPV D IOH[LEOH EHWDVDQGZLFK WKDW ZRXOG SODFH WKH 3UHJLRQ DQG $UHJLRQ LQWR FORVH SUR[LPLW\ >@ *LYHQ WKDW WKH 3UHJLRQ LV UHTXLUHG IRU WKH QDWLYH VWUXFWXUH VWDELOLW\ DQG WUDQVORFDWLRQ RI 3, DQG WKDW WKH 3UHJLRQ LQWHUDFWV ZLWK D IUDJPHQW RI 3, FRQWDLQLQJ WKH $UHJLRQ LW LV OLNHO\ WKDW WKH $UHJLRQ PD\ DOVR SOD\ D UROH LQ WKH VWUXFWXUH VWDELOLW\ DQG WUDQVORFDWLRQ RI 3

PAGE 20

7R IXOO\ HOXFLGDWH WKH UROH RI WKH 3UHJLRQ LQ 3, WUDQVORFDWLRQ D EHWWHU XQGHUVWDQGLQJ RI WKH PROHFXOHfV URXWH RI WUDQVORFDWLRQ UHSUHVHQWV DQ LPSRUWDQW JRDO 7KHUH LV QR H[SHULPHQWDO GDWD WKDW LGHQWLI\ WKH VHFUHWLRQ SDWKZD\ 3, RU DQWLJHQ ,,,OLNH SURWHLQV XVH +RZHYHU EDVHG XSRQ WKH PHWKRG RI 3, FHOO ZDOO DQFKRULQJ D URXWH RI WUDQVORFDWLRQ KDV EHHQ SUHGLFWHG *UDPSRVLWLYH VXUIDFH SURWHLQV FRQWDLQLQJ WKH FRQVHUYHG &WHUPLQDO /3;7* PRWLI VXFK DV 3, DUH DQFKRUHG WR WKH FHOO ZDOO E\ WKH PHPEUDQH DQFKRUHG WUDQVSHSWLGDVH VRUWDVH 'XULQJ FHOO ZDOO DQFKRULQJ VRUWDVH FOHDYHV VXUIDFH SURWHLQV EHWZHHQ WKH WKUHRQLQH DQG WKH JO\FLQH RI WKH /3;7* PRWLI >@ )ROORZLQJ FOHDYDJH LQ 6 DXUHXV DQG /LVWHULD PRQRF\WRJHQHV WKH SURWHLQV DUH OLQNHG WR FHOO ZDOO SHSWLGHV YLD DQ DPLGH ERQG > @ $OWKRXJK VHYHUDO DVSHFWV RI SHSWLGRJO\FDQ VWUXFWXUH LQ *UDPSRVLWLYH EDFWHULD DUH YDULDEOH >@ WKH SULQFLSOHV RI VXUIDFH SURWHLQ DQFKRULQJ DSSHDU WR EH FRQVHUYHG >@ /HH DQG %RUDQ>@ LGHQWLILHG DQG LQVHUWLRQDOO\ LQDFWLYDWHG WKH JHQH HQFRGLQJ VRUWDVH VUW$ LQ 6 PXWDQV $V SUHGLFWHG 6UW$n PXWDQWV VHFUHWHG 3, LQWR WKH VXSHUQDWDQW GHPRQVWUDWLQJ WKDW 3, LV LQGHHG D VRUWDVH DQFKRUHG SURWHLQ &XUUHQW HYLGHQFH VXJJHVWV WKDW VRUWDVH DQFKRUHG SURWHLQV DUH WUDQVORFDWHG YLD WKH 6HF WUDQVORFDVH >@ 7KH 6HFGHSHQGHQW VHFUHWLRQ SDWKZD\ KDV EHHQ ZHOO FKDUDFWHUL]HG DQG VWXGLHG LQ ( FROL DQG WR D OHVVHU H[WHQW LQ % VXEWLOLV ,Q ( FROL WKH 6HFWUDQVORFDVH FRQVLVWV RI 6HF$ 6HF< 6HF( 6HF* 6HF' 6HF) DQG @ 7ZR PDMRU WDUJHWLQJ SDWKZD\V FRQYHUJH RQ WKH 6HFWUDQVORFDVH WKH VLJQDO UHFRJQLWLRQ SDUWLFOH 653f SDWKZD\ DQG WKH 6HF% SDWKZD\ 7KH ( FROL 653 FRQVLVWV RI D V 51$ DQG WKH *73DVH )IK ERWK RI ZKLFK DUH UHTXLUHG IRU FHOO YLDELOLW\ >@ 6LJQDO SHSWLGHV RI QDVFHQW SRO\SHSWLGHV DUH UHFRJQL]HG E\ WKH 653 DV WKH\ HPHUJH IURP WKH ULERVRPH >@ 653 ELQGLQJ VWDOOV WUDQVODWLRQ DQG

PAGE 21

WDUJHWV WKH 653ULERVRPH FRPSOH[ WR WKH 653 UHFHSWRU )WV< > @ 7KH FRPSOH[ LV WKHQ WDUJHWHG WR WKH 6HFWUDQVORFRQ ZKHUH WKH ULERVRPH GRFNV DQG WUDQVODWLRQ LV UHVWRUHG 7KH SUHSURWHLQ LV FRWUDQVODWLRQDOO\ WUDQVORFDWHG DFURVV WKH PHPEUDQH YLD DQ LQWHJUDO PHPEUDQH FRPSOH[ FRQVLVWLQJ RI 6HF < 6HF( DQG 6HF* 7KH $73DVH 6HF $ SURYLGHV HQHUJ\ IRU WKH WUDQVORFDWLRQ >@ ,Q WKH FDVH RI SRVWWUDQVODWLRQDO VHFUHWLRQ WKH F\WRSODVPLF FKDSHURQH 6HF% WDUJHWV SUHSURWHLQV WR WKH 6HFWUDQVORFRQ 6HF% ELQGV WR QDVFHQW DQG IXOOOHQJWK SUHSURWHLQV DV WKH\ HPHUJH IURP WKH ULERVRPH >@ 6HF% LQWHUDFWLRQ SUHYHQWV SUHPDWXUH IROGLQJ RI WKH SUHSURWHLQ DQG GHOLYHUV LW WR WKH 6HF WUDQVORFRQ LQ D VHFUHWLRQFRPSHWHQW VWDWH %LQGLQJ RI WKH 6HF%SUHSURWHLQ FRPSOH[ ZLWK 6HF$ UHVXOWV LQ WKH WUDQVIHU RI WKH SUHSURWHLQ WR 6HF$ DQG WKH UHOHDVH RI 6HF% >@ 7KH SUHSURWHLQ LV VXEVHTXHQWO\ WUDQVORFDWHG DFURVV WKH PHPEUDQH WKURXJK WKH 6HFWUDQVORFRQ >@ 7KH 653 SDWKZD\ H[LVWV LQ ERWK JUDPQHJDWLYH DQG JUDPSRVLWLYH EDFWHULD ,GHQWLILHG KRPRORJV RI WKH 6HFGHSHQGHQW SDWKZD\ FRPSRQHQWV LQ % VXEWLOLV LQFOXGH 6HF$ 6HF<(* 6HF') @ $V SUHYLRXVO\ VWDWHG WKH 653 LV HVVHQWLDO IRU YLDELOLW\ LQ ( FROL DQG WKLV ZDV DVVXPHG WR EH WKH FDVH LQ DOO RUJDQLVPV +RZHYHU DQ )IK QXOO PXWDQW LQ 6 PXWDQV LV YLDEOH DQG 3, LV WUDQVORFDWHG DQG H[SUHVVHG RQ WKH FHOO VXUIDFH >@ 7KLV VXJJHVWV WKDW LI 3, VHFUHWLRQ LV 6HFGHSHQGHQW WKH WDUJHWLQJ SDWKZD\ LV OLNHO\ WR EH 6HF%

PAGE 22

OLNH DQG PD\ UHTXLUH D 6HF% RUWKRORJ RU SRVVLEO\ DQ XQUHODWHG FKDSHURQH ZLWK VLPLODU IXQFWLRQV 'QD. DQG 5RS$ 7KH WUDQVORFDWLRQ RI 3, WR WKH FHOO VXUIDFH LQ DQ 6 PXWDQV PXWDQW GHYRLG RI WKH 653 SDWKZD\ >@ ZRXOG VXJJHVW WKDW 3, LV SRVWWUDQVODWLRQDOO\ VHFUHWHG DQG D SURWHLQ RI UHVLGXHV ZRXOG PRVW FHUWDLQO\ UHTXLUH LQWHUDFWLRQV ZLWK FKDSHURQHV WR SUHYHQW PLVIROGLQJ DQG DJJUHJDWLRQ ZKLOH WUDQVLWLQJ WKH F\WRVRO 7KH N' KHDW VKRFN SURWHLQV +VSVf DUH XELTXLWRXV SURWHLQV IRXQG LQ WKH EDFWHULDO F\WRVRO DQG VHYHUDO FRPSDUWPHQWV RI HXNDU\RWLF FHOOV LQFOXGLQJ WKH HQGRSODVPLF UHWLFXOXP WKH PLWRFKRQGULD DQG WKH F\WRVRO >@ 7KH ( FROL +VS 'QD. KDV EHHQ H[WHQVLYHO\ VWXGLHG DQG LV LQYROYHG LQ D YDULHW\ RI FHOOXODU SURFHVVHV LQFOXGLQJ ERWK SURWHLQ IROGLQJ DQG GHJUDGDWLRQ ,Q VWXGLHV RI VXEVWUDWH VSHFLILFLW\ LW KDV EHHQ VKRZQ WKDW 'QD. SUHIHUHQWLDOO\ ELQGV WR SHSWLGHV WKDW FRQWDLQ K\GURSKRELF UHVLGXHV >@ ,Q SURWHLQV WKHVH K\GURSKRELF UHVLGXHV DUH W\SLFDOO\ IRXQG LQ WKH FRUH RI WKH IROGHG VWUXFWXUH RU LQ VXEXQLW LQWHUIDFHV >@ 1DVFHQW SRO\SHSWLGHV HPHUJLQJ IURP WKH ULERVRPHV DV ZHOO DV PDOIROGHG SURWHLQV GLVSOD\ VKRUW K\GURSKRELF UHJLRQV WKDW DUH QRW H[SRVHG LQ WKH SURWHLQfV QDWLYH FRQIRUPDWLRQ 'QD. ELQGV WR WKHVH H[SRVHG K\GURSKRELF VHJPHQWV WKHUHE\ SUHYHQWLQJ DJJUHJDWLRQ DQG IXUWKHU PLVIROGLQJ $QRWKHU FKDSHURQH WKDW LQWHUDFWV ZLWK QDVFHQW SRO\SHSWLGHV LV WULJJHU IDFWRU D ULERVRPHDVVRFLDWHG SHSWLG\OSURO\O FLVWUDQV LVRPHUDVH 33,DVHf ,Q 6 PXWDQV WULJJHU IDFWRU LV NQRZQ DV 5RS$ 7ULJJHU IDFWRU DVVRFLDWHV ZLWK WKH ODUJH ULERVRPDO VXEXQLW DW WKH SHSWLGH H[LW FKDQQHO DQG ELQGV WR QHDUO\ DOO QDVFHQW SRO\SHSWLGHV >@ 7KHUH LV HYLGHQFH WKDW WULJJHU IDFWRU FRRSHUDWHV ZLWK 'QD. WR SURPRWH WKH IROGLQJ RI D YDULHW\ RI F\WRVROLF ( FROL SURWHLQV >@ DQG WKDW WKH\ VKDUH VXEVWUDWHV DQG ELQGLQJ VSHFLILFLWLHV

PAGE 23

>@ ,Q IDFW 'QD. LV QRW UHFUXLWHG WR WUDQVODWLQJ ULERVRPHV WKDW ODFN WULJJHU IDFWRU >@ %HVLGHV LWV FKDSHURQH DFWLYLWLHV WULJJHU IDFWRU FDQ FDWDO\]H FLVWUDQV LVRPHUL]DLRQ RI SHSWLG\OSURO\O SHSWLGH ERQGV 7KH 33,DVH DFWLYLW\ RI WULJJHU IDFWRU LV QRW UHTXLUHG E\ DOO RI WKH SURWHLQV WKDW UHTXLUH WULJJHU IDFWRU IRU SURSHU IROGLQJ KRZHYHU WKH 33,DVH DFWLYLW\ LV HVVHQWLDO IRU VRPH >@ ,Q 6 S\RJHQHV WKH 33,DVH DFWLYLW\ RI WULJJHU IDFWRU LQIOXHQFHV WKH FRQIRUPDWLRQ RI WKH QDVFHQW F\VWHLQH SURWHDVH 6SH% ZKLFK LQ WXUQ GLUHFWV WKH SURWHDVH LQWR RQH RI VHYHUDO DOWHUQDWLYH IROGLQJ SDWKZD\V>@ 7KH PDOIROGHG SURWHDVHV DUH VXEVHTXHQWO\ QRW WDUJHWHG WR WKH VHFUHWLRQ SDWKZD\ 6XPPDU\ DQG 6SHFLILF $LPV ,Q DQ HIIRUW WR FKDUDFWHUL]H WKH UROH RI WKH SUROLQHULFK UHJLRQ RI 3, LQ WKH DGKHUHQFH SURSHUWLHV RI WKH PROHFXOH %UDG\ HW DO f GHOHWHG WKH UHJLRQ IURP 3, 3, $3f :KLOH 3$3 UHWDLQHG WKH VHTXHQFHV EHOLHYHG VXIILFLHQW IRU H[SUHVVLRQ DQG WUDQVORFDWLRQ XQH[SHFWHGO\ LW ZDV XQVWDEOH DQG QRW WUDQVORFDWHG WR WKH FHOO VXUIDFH $V WKHUH LV D ODFN RI UHVHDUFK UHJDUGLQJ SURWHLQ WUDQVORFDWLRQ LQ JUDPSRVLWLYH RUJDQLVPV DQG 6WUHSWRFRFFXV LQ SDUWLFXODU LW ZDV RI LQWHUHVW WR LGHQWLI\ WKH UROH RI WKH SUROLQHULFK UHJLRQ LQ 3, VWDELOLW\ DQG WUDQVORFDWLRQ 6LQFH SUROLQHULFK UHJLRQV DUH NQRZQ WR EH LQYROYHG LQ LQWUD DQG LQWHUPROHFXODU SURWHLQSURWHLQ LQWHUDFWLRQV WKH ILUVW VSHFLILF DLP RI WKLV ZRUN ZDV WR LGHQWLI\ UHJLRQV ZLWKLQ 3, WKDW LQWHUDFW ZLWK WKH SUROLQHULFK UHJLRQ 2QFH D SUROLQHULFK UHJLRQ LQWHUDFWLRQ ZDV GLVFRYHUHG WKH VHFRQG VSHFLILF DLP RI WKLV VWXG\ ZDV WR DQDO\]H WKH UROH RI WKH LQWHUDFWLQJ UHJLRQ LQ WKH VWUXFWXUH VWDELOLW\ DQG WUDQVORFDWLRQ RI 3 3, LV D ODUJH DQG VWUXFWXUDOO\ FRPSOH[ PROHFXOH DV LV HYLGHQW E\ WKH FKDQJH LQ DQWLERG\ UHDFWLYLW\ VHHQ DJDLQVW 3, $3 WKDW VXJJHVWV FRPSOH[ DQG SRVVLEO\ FRQIRUPDWLRQDO HSLWRSHV )XUWKHU HYLGHQFH RI WKH VWUXFWXUDO FRPSOH[LW\ RI 3, ZDV UHYHDOHG LQ WKH VROYHG

PAGE 24

FU\VWDO VWUXFWXUH RI WKH YDULDEOH UHJLRQ >@ %DVHG XSRQ WKH VXUIDFH H[SUHVVLRQ RI 3, LQ 6 PXWDQV ODFNLQJ WKH 653 SDWKZD\ >@ DQG WKH SUHVXPSWLRQ WKDW VRUWDVHDQFKRUHG SURWHLQV DUH VHFUHWHG YLD WKH 6HF WUDQVORFDVH WKH VXFFHVVIXO SRVWWUDQVODWLRQDO WUDQVORFDWLRQ RI D ODUJH DQG FRPSOH[ PROHFXOH VXFK DV 3, PXVW EH GHSHQGHQW XSRQ FKDSHURQHV 7KH ILQDO VSHFLILF DLP RI WKLV ZRUN ZDV WR H[DPLQH ZKHWKHU WKH FKDSHURQHV 'QD. DQG 5RS$ FRQWULEXWHG WR 3, WUDQVORFDWLRQ RU IXQFWLRQ

PAGE 25

&+$37(5 0$7(5,$/6 $1' 0(7+2'6 %DFWHULDO 6WUDLQV 3ODVPLGV DQG *URZWK &RQGLWLRQV %DFWHULDO VWUDLQV XVHG LQ WKLV VWXG\ DUH OLVWHG LQ 7DEOH DQG DOO SODVPLGV XVHG DUH OLVWHG LQ 7DEOH 8QOHVV RWKHUZLVH QRWHG DOO 6 PXWDQV VWUDLQV ZHUH JURZQ XQGHU DQDHURELF FRQGLWLRQV DW r& LQ 7RGG+HZLWW EURWK %%/ &RFNH\VYLOOH 0Gf VXSSOHPHQWHG ZLWK b \HDVW H[WUDFW 7+%<(f DQG NDQDP\DFLQ SJPOf DV QHHGHG ( FROL VWUDLQV ZHUH JURZQ DHURELFDOO\ DW r& ZLWK YLJRURXV VKDNLQJ LQ /XULD%HUWDQL EURWK /%f b >ZWYRO@ WU\SWRQH b >ZWYRO@ \HDVW H[WUDFW b >ZWYRO@ 1D&O S+ f VXSSOHPHQWHG ZLWK DPSLFLOOLQ SJPOf RU NDQDP\FLQ SJPOf DV DSSURSULDWH ( FROL VWUDLQV 0& DQG &. ZHUH JURZQ DHURELFDOO\ DW r& ZLWK YLJRURXV VKDNLQJ LQ 0 PHGLXP b >ZWYRO@ 1D"+3 b >ZWYRO@ .+32 b >ZWYRO@ 1D&, b >ZWYRO@ 0J6 b >ZWYRO@ 1+f6 b JOXFRVHf VXSSOHPHQWHG ZLWK NDQDP\FLQ SJPOf DQG DPSLFLOOLQ SJPOf DV DSSURSULDWH ,GHQWLILFDWLRQ RI DQ ,QWUDPROHFXODU ,QWHUDFWLRQ ,QYROYLQJ WKH 3UROLQH5LFK 5HJLRQ RI 3, 3XULILFDWLRQ RI $UHJLRQ DQG 35HJLRQ0%3 )XVLRQ 3URWHLQV 2YHUQLJKW FXOWXUHV RI ( FROL KDUERULQJ S0$ >@ RU S0$ >@ 7DEOH f ZHUH GLOXWHG LQWR IUHVK /XULD%HUWDQL /%f EURWK FRQWDLQLQJ SJPO RI DPSLFLOOLQ DQG JURZQ WR DQ 2'RR RI 7KH PHGLXP ZDV VXSSOHPHQWHG ZLWK P0 LVRSURS\OE' WKLRJDODFWRS\UDQRVLGH ,37*f DQG WKH FXOWXUH ZDV LQFXEDWHG IRU DQ DGGLWLRQDO KRXUV DW r& 3HULSODVPLF FRQWHQWV ZHUH H[WUDFWHG E\ RVPRWLF VKRFN >@ $IILQLW\

PAGE 26

7DEOH %DFWHULDO 6WUDLQV 6WUDLQ 'HVFULSWLRQ 6RXUFH RU 5HIHUHQFH ( FROL '+D )nFSGODF=$0 $ODF=<$DUJ)f8 GHR5 UHF$O HQG$O KVG5UNf PLc SKR$ VXS( ; WKL J\U$ UHO$O %/ )n RPS7 KVG6% UEf P% f JDO GFP 0& &. ( FROL )fDUD' $ DUJ)f ODFf 8 UHO$ UVS3 WKL$ >@ PXWDQV 0& VHF%7Q >@ 1* :LOGW\SH VHURW\SH F >@ 8$ :LOGW\SH VHURW\SH F >@ 3& VSD3QHJDWLYH PXWDQW GHULYHG IURP 6 PXWDQV 1* >@ 3&$ 3& WUDQVIRUPHG ZLWK S'/ >@ 3&% 3& WUDQVIRUPHG ZLWK S0$->@ 3&& 3& WUDQVIRUPHG ZLWK S0$' >@ 3&' 3& WUDQVIRUPHG ZLWK S76 7KLV VWXG\f 60 8$ PLQLPDO H[SUHVVLRQ RI GQD. &RXUWHV\ RI /HPRV XQSXEOLVKHGf 7: 8$ URS$f >@ 6 JRUGRQLL 0 :LOGW\SH >@

PAGE 27

7DEOH 3ODVPLGV 3ODVPLG 'HVFULSWLRQ 6RXUFH RU 5HIHUHQFH S&573 7$ FORQLQJ YHFWRU ,QYLWURJHQ &RUS 6DQ 'LHJR &$f S0DOS 9HFWRU IRU H[SUHVVLRQ RI PDOWRVH ELQGLQJ SURWHLQ IXVLRQV 1(% %HYHUO\ 0$f S0$ S0DOS GHULYHG SODVPLG FRQWDLQLQJ 3&5DPSOLILHG '1$ HQFRGLQJ DPLQR DFLGV WR RI 3 >@ S0$ S0DOSGHULYHG SODVPLG FRQWDLQLQJ 3&5DPSOLILHG '1$ HQFRGLQJ DPLQR DFLGV RI RI 3, >@ S'/ ( FRVWUHSWRFRFFDO VKXWWOH YHFWRU SURYLGHG E\ OH %ODQF >@ S0$-S'/GHULYHG SODVPLG FRQWDLQLQJ LQWHUQDOO\ GHOHWHG VSD3 HQFRGLQJ DPLQR DFLGV WR DQG WR >@ S'& S8&GHULYHG SODVPLG FRQWDLQLQJ 3&5DPSOLILHG VSD3 HQFRGLQJ IXOOOHQJWK 3, >@ S0$' S'/GHULYHG SODVPLG FRQWDLQLQJ 3&5DPSOLILHG VSD3 HQFRGLQJ IXOOOHQJWK 3, >@ S*(;7 9HFWRU IRU H[SUHVVLRQ RI JOXWDWKLRQH 6WUDQVIHUDVH IXVLRQV $PHUVKDP %LRVFLHQFHVf S*(;$ S*(;7 GHULYHG SODVPLG FRQWDLQLQJ 3&5DPSOLILHG '1$ HQFRGLQJ DPLQR DFLGV RI 3, 7KLV VWXG\f S*(;3 S*(;7 GHULYHG SODVPLG FRQWDLQLQJ 3&5DPSOLILHG '1$ HQFRGLQJ DPLQR DFLGV RI 3, 7KLV VWXG\f S*(;$3 S*(;7 GHULYHG SODVPLG FRQWDLQLQJ 3&5DPSOLILHG '1$ HQFRGLQJ DPLQR DFLGV 7KLV VWXG\f S*(;%3 S8&GHULYHG SODVPLG FRQWDLQLQJ LQWHUQDOO\ GHOHWHG VSD3 HQFRGLQJ DPLQR DFLGV WR DQG WR >@ S76 S'/GHULYHG SODVPLG FRQWDLQLQJ LQWHUQDOO\ GHOHWHG HQFRGLQJ DPLQR DFLGV WR DQG WR >@

PAGE 28

7DEOH FRQWLQXHG 3ODVPLG 'HVFULSWLRQ 6RXUFH RU 5HIHUHQFH S76 S76 FRQWDLQLQJ 6 JRUGRQ 0 '1$ HQFRGLQJ WKH $UHJLRQ RI 6VS$ 7KLV VWXG\f S76 S76 FRQWDLQLQJ 6 JRUGRQ 0 '1$ HQFRGLQJ WKH $UHJLRQ RI 6VS% 7KLV VWXG\f S76 S'/ GHULYHG SODVPLG HQFRGLQJ 3, H[SUHVVHG DV GLVFRQWLQXRXV 1WHUPLQDO DD f DQG &WHUPLQDO DDf IUDJPHQWV 7KLV VWXG\f S76 S8&OGHULYHG SODVPLG FRQWDLQLQJ VSD3 HQFRGLQJ DPLQR DFLGV WR DQG WR 7KLV VWXG\f S76 S'/GHULYHG SODVPLG FRQWDLQLQJ VSD3 HQFRGLQJ DPLQR DFLGV WR DQG WR 7KLV VWXG\f S$5$ S*(;73GHULYHG SODVPLG FRQWDLQLQJ 6 JRUGRQ 0 '1$ HQFRGLQJ WKH $UHJLRQ RI 6VS$ >@ S$5% S*(;73GHULYHG SODVPLG FRQWDLQLQJ 6 JRUGRQ 0 '1$ HQFRGLQJ WKH $UHJLRQ RI 6VS% >@ S''$ S*(0GHULYHG SODVPLG FRQWDLQLQJ 6 JRUGRQ 0 '1$ HQFRGLQJ 6VS$ GULYHQ E\ WKH 6VS% SURPRWHU UHJLRQ 'HPXWK XQSXEOLVKHGf S(% S8&GHULYHG SODVPLG FRQWDLQLQJ 6 JRUGRQ 0 '1$ HQFRGLQJ 6VS% >@

PAGE 29

7DEOH 3&5 3ULPHUV 3ULPHU 76 76 76. 76. 76 76 76 76 76 76 76 76 76 76 76 76 76 '1$.6 '1$.$6 6596 6):' 6HTXHQFH 7DUJHW 8QGHUOLQHG 5HVWULFWLRQ 6LWH f *&&*$&7$7&&$*77$$*77$$$**&f f*&&$7$&7*77&777$*77*&&7*f f*&**-$&&*77** $7 $$$*7*7**$*777* f f *&**7$&&*& $*7 *&*$$*7 $&&77 $7& f f$$$&7&*$*7&$77&$77&$77*77&$7&77&*7$7*&&7f f$$$&7&*$***$**$$$$$7**&77&7$77 $ $$*&7*&$&7* f f* $$*$&77$$$$*&7& $7& $$*& f f&$$&77777&77$7 $777**& $$*$7& f f$$$*$7&7$$$$$*7& $7&$$*$$*$$*7 f f *$$&7&777&77 $7 $777**& $$*$7& f f**$-&& $$$*$7$7**&$*&7& $7$$$*& f f*7&*$&*$7$$$7&77777*$7$777**&$$*$7&7*f f **$7&&**7 $$$$7 &&*7 *&**77 $$7 f f*-&*$&*$&$&& $$$*77&7*7&$$7$77$$ f f**$7&&**7 $$$$77&*7*&**7&$$& f f*7&*$&$$&&$$7*7&&**7&*$7 $7& f 6f**$7&&7&$$$&$77$$7*&$$77****77&f f**$*$7*&7*77**&**7*7 f f**$$*7$7$$&$*&$77&*&7*$ f f$7$7&7$&*& $777&$&&*& f f *&7&7**$$$&7*7&7*$&7f VSD3 VSD3 VSD3 .SQ VSD3 .SQ VSD3 VSD3 VVS$ VVS$ VVS% VVS% VSD3 %DP +, VSD3 6DO VSD3 %DP +, VSD3 6DO VVS$ %DP +, VVS$ DQG VVS% 6DO VVS% %DP +, GQD. GQD. 6 51$ 651$

PAGE 30

SXULILFDWLRQ RI WKH IXVLRQ SURWHLQV ZDV SHUIRUPHG E\ SDVVDJH RI WKH SHULSODVPLF IUDFWLRQV WKURXJK D FROXPQ RI DP\ORVH UHVLQ %LR5DGf DQG HOXWLRQ ZLWK P0 PDOWRVH E\ D VWDQGDUG SURWRFRO >@ 3XULILHG IXVLRQ SURWHLQV ZHUH TXDQWLILHG XVLQJ WKH ELFLQFKRQLQLF DFLG %&$f SURWHLQ DVVD\ NLW 6LJPDf ZLWK ERYLQH VHUXP DOEXPLQ DV WKH VWDQGDUG (Q]\PH/LQNHG ,PPXQRVRUEHQW $VVD\V (/,6$f WR 'HWHFW $UHJLRQ DQG 35HJLRQ ,QWHUDFWLRQ %LQGLQJ RI WKH $UHJLRQ WR WKH 3UHJLRQ ZDV PHDVXUHG E\ (/,6$ 6DPSOH ZHOOV RI &RVWDU +LJK %LQGLQJ SODWHV &RPLQJ ,QFRUSRUDWHG &RPLQJ 1@ RU UDEELW DQWL0%3 $E 1(% %HYHUOH\ 0$f ZDV DGGHG WR WKH ZHOOV DW D GLOXWLRQ 3ODWHV ZHUH ZDVKHG ZLWK 3%67Z DQG SHUR[LGDVHODEHOHG JRDW DQWLPRXVH ,J* RU JRDW DQWLn UDEELW ,J &DSSHOOf ZHUH DGGHG WR WKH ZHOOV DW D GLOXWLRQ $IWHU ZDVKLQJ SL RI 0 SKRVSKDWH FLWUDWH EXIIHU S+ f FRQWDLQLQJ 0 RSKHQ\OHQHGLDPLQH GLK\GURFKORULGH DQG b YROYROf K\GURJHQ SHUR[LGH ZHUH DGGHG WR HDFK ZHOO 3ODWHV ZHUH LQFXEDWHG IRU PLQ DW URRP WHPSHUDWXUH DQG WKH DEVRUEDQFH DW QP ZDV UHFRUGHG E\ XVLQJ DQ 030 7LWHUWHN PRGHO (/,6$ SODWH UHDGHU %LR5DGf

PAGE 31

(OLPLQDWLRQ RI VSD3 '1$ (QFRGLQJ WKH $5HJLRQ )UDJPHQWV RLVSD3 ERWK XSVWUHDP DQG GRZQVWUHDP RI WKH $UHJLRQ ZHUH DPSOLILHG E\ SRO\PHUDVH FKDLQ UHDFWLRQ 3&5f DQG VXEVHTXHQWO\ OLJDWHG WRJHWKHU WR FUHDWH VSD3$$ )LGHOLW\ RI WKH UHDFWLRQV ZDV FRQILUPHG E\ UHVWULFWLRQ DQG VHTXHQFH DQDO\VLV )RUZDUG SULPHU 76N DQG UHYHUVH SULPHU 76 ZHUH XVHG WR DPSOLI\ VSD3 '1$ XSVWUHDP RI WKH $ UHJLRQ LQFOXGLQJ WKH VSD3 SURPRWHU )RUZDUG SULPHU 76 DQG UHYHUVH SULPHU 76,2N ZHUH XVHG WR DPSOLI\ VSD3 GRZQVWUHDP RI WKH $UHJLRQ 3ULPHUV 76 DQG 76 FRQWDLQ HQJLQHHUHG .SQ? UHVWULFWLRQ VLWHV 3ULPHUV 76 DQG 76 ZHUH HQJLQHHUHG ZLWK VLQJOH EDVH FKDQJHV WKDW LQWURGXFH VLOHQW PXWDWLRQV ZKLFK XSRQ OLJDWLRQ RI WKH 3&5 SURGXFWV SURGXFH D XQLTXH 6IRO UHVWULFWLRQ VLWH 5HDFWLRQV ZHUH FDUULHG RXW LQ D 812 WKHUPREORFN WKHUPRF\FOHU %LRPHWUD 7DPSD )/f ZLWK SODVPLGHQFRGHG VSD3 S'& >@ DV WKH WHPSODWH DQG 9(17 SRO\PHUDVH 1(%f XQGHU WKH IROORZLQJ FRQGLWLRQV IR F\FOHV GHQDWXUDWLRQ DW r& IRU VHFRQGV SULPHU DQQHDOLQJ DW r& IRU VHFRQGV SULPHU H[WHQVLRQ DW r& IRU PLQXWH RU PLQXWHV DQG VHFRQGV DQG ILQDO H[WHQVLRQ DW r& IRU PLQ 7KH UHVXOWLQJ DQG ES JHQH IUDJPHQWV ZHUH OLJDWHG WRJHWKHU DQG FORQHG LQWR WKH 6PD? VLWH RI S8& FUHDWLQJ S76 ZKLFK ZDV LQWURGXFHG LQWR ( FROL '+D E\ HOHFWURSRUDWLRQ &ORQHV ZHUH VFUHHQHG RQ /% DJDU VXSSOHPHQWHG ZLWK SJP/ DPSLFLOOLQ DQG SJP/ ;JDO EURPR FKORUR LQGRO\OS' JDODFWRS\UDQRVLGHf :KLWH FRORQLHV ZHUH SLFNHG DQG WHVWHG IRU WKH SUHVHQFH RI VSD3$$ LQVHUW '1$ DIWHU DONDOLQH O\VLV 6HTXHQFHV RI DOO UHFRPELQDQW FRQVWUXFWV ZHUH FRQILUPHG E\ WKH '1$ VHTXHQFLQJ FRUH 8QLYHUVLW\ RI )ORULGDf

PAGE 32

(YDOXDWLRQ RI $QWLERG\ %LQGLQJ WR 3$$ ( FROL '+D KDUERULQJ S76 RU S'& ZHUH JURZQ IRU KRXUV DW r& KDUYHVWHG E\ FHQWULIXJDWLRQ DQG O\VHG E\ ERLOLQJ IRU PLQXWHV LQ 6'6VDPSOH EXIIHU b >ZWYRO@ VRGLXP GRGHF\O VXOIDWH >6'6@ b >YROYRO@ PHUFDSWRHWKDQRO b >YROYRO@ JO\FHURO P0 7ULV+&O >S+ @ PJ RI EURPRSKHQRO EOXH SHU POf 3URWHLQV ZHUH VHSDUDWHG E\ 6'6SRO\DFU\ODPLGH JHO HOHFWURSKRUHVLV RQ b YROYROf DFU\ODPLGH SUHSDUDWRU\ JHOV E\ WKH PHWKRG RI /DHPPOL >@ 3URWHLQV ZHUH HOHFWUREORWWHG RQWR QLWURFHOOXORVH PHPEUDQH 6FKOHLFKWHU DQG 6FKXHOO .HHQH 1+f IRU K DW 9 E\ WKH PHWKRG RI 7RZELQ HW DL >@ ,PPXQREORWV ZHUH EORFNHG ZLWK 3%6 7Z DQG FXW LQWR FP VWULSV 6WULSV ZHUH LQFXEDWHG ZLWK DQWL3O 0$EV > @ DW GLOXWLRQV RI LQ LQGLYLGXDO WURXJKV RI DQ ,QFXWUD\ 6FKOHLFKWHU DQG 6FKXHOOf $IWHU ZDVKLQJ VWULSV ZHUH LQFXEDWHG LQ SHUR[LGDVHODEHOHG JRDW DQWLPRXVH ,J* &DSSHOf DQG GHYHORSHG ZLWK FKORUROQDSKWKRO VROXWLRQ PO RI 3%6 PO RI FKORURO QDSKWKRO >6LJPD PJPO LQ LFHFROG PHWKDQRO@ DQG SL RI b >YROYRO@ K\GURJHQ SHUR[LGHf $VVHVVPHQW RI (SLWRSH 5HVWRUDWLRQ E\ (/,6$ 6DPSOH ZHOOV RI &RVWDU +LJK %LQGLQJ SODWHV ZHUH FRDWHG DV EHIRUH ZLWK QJ RI SXULILHG PDOWRVH ELQGLQJ SURWHLQ 0%3f $UHJLRQ0%3 RU 3UHJLRQ0%3 )ROORZLQJ EORFNLQJ DQG ZDVKHV DV SUHYLRXVO\ SXULILHG $UHJLRQ0%3 3UHJLRQ0%3 DQG 0%3 ZHUH VHULDOO\ GLOXWHG WZRIROG LQ 3%67Z DQG DGGHG WR WKH ZHOOV EHJLQQLQJ DW QJZHOO 7KH SODWHV ZHUH LQFXEDWHG RYHUQLJKW DW r& DQG ZDVKHG IRXU WLPHV ZLWK 3%6 7Z 0$EV $ DQG $ ZHUH DGGHG WR WKH ZHOOV DW D GLOXWLRQ %LQGLQJ RI WKH 0$EV ZDV WUDFHG ZLWK SHUR[LGDVHODEHOHG JRDW DQWLPRXVH ,J* DW D

PAGE 33

GLOXWLRQ WKH SODWHV ZHUH GHYHORSHG DQG WKH DEVRUEDQFH ZDV PHDVXUHG DV SUHYLRXVO\ GHVFULEHG 3&5 DQG &RQVWUXFWLRQ RI 6 PXWDQV VSD3 DQG 6 JRUGRQLL 0 VVS$ DQG VVS% 6XEFORQHV 7KH 3UHJLRQV RI 6 JRUGRQLL 0 VVS$ DQG VVS% DQG VHYHUDO UHJLRQV RI VSD3 ZHUH DPSOLILHG E\ 3&5 DQG FORQHG LQWR WKH S*(;7 YHFWRU $PHUVKDP %LRVFLHQFHVf IRU H[SUHVVLRQ DV IXVLRQ SRO\SHSWLGHV ZLWK JOXWDWKLRQH 6WUDQVIHUDVH *67f )RUZDUG DQG UHYHUVH SULPHUV ZHUH GHVLJQHG EDVHG XSRQ WKH SXEOLVKHG VHTXHQFHV RI VVS$ DQG VVS% DFFHVVLRQ QXPEHUV 8 DQG 8 UHVSHFWLYHO\f DQG WKH XQSXEOLVKHG VHTXHQFH RI 1* VSD3 7KH SULPHU VHTXHQFHV DQG HQJLQHHUHG UHVWULFWLRQ VLWHV DUH VKRZQ LQ 7DEOH 7KH IROORZLQJ SULPHUV ZHUH XVHG LQ WKHVH DPSOLILFDWLRQV VVS$ 3UHJLRQ DD f 76 DQG 76 VVS% 3UHJLRQ DD f 76 DQG 76 VSD3 $UHJLRQ DD f 76 DQG 76 DQG VSD3 3UHJLRQ DD f 76 DQG 76 7KHVH SULPHUV ZHUH HQJLQHHUHG ZLWK %DP+; DQG 6DO, UHVWULFWLRQ VLWHV WR HQDEOH VXEVHTXHQW FORQLQJ LQWR WKH S*(;7 H[SUHVVLRQ YHFWRU 3&5 ZDV SHUIRUPHG IRU F\FOHV XQGHU WKH IROORZLQJ FRQGLWLRQV GHQDWXUDWLRQ DW r& IRU PLQ SULPHU DQQHDOLQJ DW r& IRU VHF DQG SULPHU H[WHQVLRQ DW r& IRU VHF )LQDO SULPHU H[WHQVLRQ ZDV FDUULHG RXW IRU DQ DGGLWLRQDO PLQ DIWHU WKH ODVW F\FOH 7KH DPSOLILHG 3&5 SURGXFWV RI FRUUHFW SUHGLFWHG VL]H ZHUH FORQHG LQWR WKH 7$ FORQLQJ YHFWRU S&57232 ,QYLWURJHQf 7KLV YHFWRU LV VXSSOLHG OLQHDUL]HG ZLWK RYHUODSSLQJ WK\PLGLQH UHVLGXHV WKDW FDQ EH OLJDWHG WR WKH RYHUKDQJLQJ DGHQRVLQH UHVLGXHV JHQHUDWHG LQ WKH 3&5DPSOLILHG SURGXFWV ,QVHUWLRQ RI IRUHLJQ '1$ LQWR WKLV UHJLRQ SUHYHQWV WKH H[SUHVVLRQ RI ODF=D DOORZLQJ IRU EOXHZKLWH VFUHHQLQJ RI ( FROL WUDQVIRUPDQWV /LJDWHG S&5 DQG 3&5 DPSOLILHG SURGXFWV ZHUH XVHG WR WUDQVIRUP ( FROL '+D E\ FDOFLXP

PAGE 34

FKORULGH >@ &ORQHV ZHUH VFUHHQHG RQ /% DJDU VXSSOHPHQWHG ZLWK SJP/ NDQDP\FLQ DQG SJP/ ;JDO :KLWH FRORQLHV ZHUH SLFNHG DQG WHVWHG IRU WKH SUHVHQFH R VVS$ VVS% DQG VSD3 LQVHUW '1$ DIWHU DONDOLQH O\VLV 3ODVPLG '1$ IURP HDFK UHFRPELQDQW ZDV UHVWULFWHG ZLWK %DP +, 3URPHJDf DQG 6DLO 3URPHJDf DQG HOHFWURSKRUHVHG RQ b ZWYROf DJDURVH 7KH DSSURSULDWH VL]HG '1$ IUDJPHQWV ZHUH H[FLVHG IURP WKH JHO DQG SXULILHG XVLQJ D 4LDJHQ JHO H[WUDFWLRQ NLW 7KH VVS$ VVS% DQG VSD3 IUDJPHQWV ZHUH OLJDWHG LQWR %DP +, 3URPHJDf DQG 6DLO 3URPHJDf OLQHDUL]HG S*(;7 UHVXOWLQJ LQ GLUHFWLRQDO FORQLQJ GRZQVWUHDP RI WKH JVW JHQH ZKLFK HQFRGHV WKH JOXWDWKLRQH 6WUDQVIHUDVH *67f RI 6FKLVWRVRPD MDSRQLFXPL /LJDWHG '1$ ZDV XVHG WR WUDQVIRUP ( FROL %/ DQG WUDQVIRUPDQWV ZHUH VHOHFWHG IRU RQ /% DJDU VXSSOHPHQWHG ZLWK SJP/ RI DPSLFLOOLQ DQG SJP/ ;JDO :KLWH FRORQLHV ZHUH VFUHHQHG IRU WKH SUHVHQFH RI VSD3FRQWDLQLQJ LQVHUW '1$ DV GHVFULEHG SUHYLRXVO\ 7KH S*(;7GHULYHG SODVPLGV HQFRGLQJ WKH 3, $ DQG 3UHJLRQV ZHUH GHVLJQDWHG S*(;$ DQG S*(;3 UHVSHFWLYHO\ 7KH SODVPLGV HQFRGLQJ WKH 6VS$ DQG 6VS% 3UHJLRQ*67 IXVLRQV ZHUH GHVLJQDWHG S*(;$3 DQG S*(;%3 3XULILFDWLRQ DQG &RQILUPDWLRQ RI *67)XVLRQ 3URWHLQV 5HFRPELQDQW ( FROL KDUERULQJ SODVPLGV HQFRGLQJ *67IXVLRQ SURWHLQV DQG S*(; 7 DV D FRQWURO ZHUH JURZQ IRU KRXUV LQ /% EURWK VXSSOHPHQWHG ZLWK SJPO RI DPSLFLOOLQ /%$f DQG SDVVDJHG LQWR /%$ )ROORZLQJ VKDNLQJ DW r& XQWLO DQ RSWLFDO GHQVLW\ DW QP RI ZDV DFKLHYHG FXOWXUHV ZHUH VXSSOHPHQWHG ZLWK P0 ,37* DQG JURZQ IRU DQ DGGLWLRQDO KRXUV DW r& 7R FRQILUP H[SUHVVLRQ RI HDFK IXVLRQ SURWHLQ O\VDWHV IURP HDFK UHFRPELQDQW ( FROL DV ZHOO DV XQLQGXFHG FRQWUROV ZHUH DQDO\]HG E\ 6'63$*( DQG :HVWHUQ

PAGE 35

LPPXQREORW RQ b ZWYROf SRO\DFU\ODPLGH JHOV 3URWHLQV LQ WKH JHOV ZHUH HOHFWUREORWWHG RQWR QLWURFHOOXORVH PHPEUDQHV IRU KRXU DW YROWV 5HSOLFDWH ILOWHUV ZHUH VWDLQHG ZLWK FROORLGDO JROG 'LYHUVLILHG %LRWHFK %RVWRQ 0$f RU EORFNHG IRU KRXU DW URRP WHPSHUDWXUH ZLWK 3%67Z 0HPEUDQHV ZHUH LQFXEDWHG RYHUQLJKW DW URRP WHPSHUDWXUH ZLWK DQWL*67 UDEELW SRO\FORQDO DQWLVHUD $PHUVKDP %LRVFLHQFHVf GLOXWHG LQ 3%67Z 0HPEUDQHV ZHUH ZDVKHG IRXU WLPHV ZLWK 3%67Z SULRU WR LQFXEDWLRQ IRU KRXUV DW URRP WHPSHUDWXUH ZLWK DIILQLW\SXULILHG SHUR[LGDVHODEHOHG JRDW DQWLUDEELW FRQMXJDWH ,&1&DSSHOO ,&1 %LRPHGLFDOV $XURUD 2+f GLOXWHG LQ 3%67Z 0HPEUDQHV ZHUH ZDVKHG WZLFH ZLWK 3%67Z DQG WZLFH ZLWK 3%6 SULRU WR GHYHORSPHQW ZLWK FKORUROQDSWKRO VROXWLRQ IRU PLQ 7KH 3,*67 IXVLRQ SURWHLQV ZHUH SXULILHG E\ DIILQLW\ FKURPDWRJUDSK\ XVLQJ JOXWDWKLRQH VHSKDURVH % $PHUVKDP %LRVFLHQFHVf ,37* LQGXFHG UHFRPELQDQW ( FROL ZHUH UHVXVSHQGHG LQ 3%6 FRQWDLQLQJ P0 306) SKHQ\OPHWK\OVXOIRQ\O IOXRULGHf DQG O\VHG E\ VRQLFDWLRQ RQ LFH WLPHV IRU VHFRQGV DW SRZHU VHWWLQJ XVLQJ D 6RQLF 'LVPHPEUDWRU $57(. 6\VWHPV &RUSRUDWLRQ )DUPLQJGDOH 1
PAGE 36

&RPSHWLWLYH ,QKLELWLRQ (/,6$ WR 'HWHFW $5HJLRQ DQG 35HJLRQ ,QWHUDFWLRQ ,QGLYLGXDO ZHOOV RI &RVWDU +LJK %LQGLQJ SODWHV &RPLQJ ,QFRUSRUDWHG &RPLQJ 1PHDQ 2' RI 0DE $ 3O *67 IXVLRQ PHDQ 2' RI 0$E $ DORQHf [ @ %LQGLQJ 6WRLFKLRPHWU\ RI WKH $ DQG 35HJLRQV E\ &RQWLQXRXV 9DULDWLRQ $ YDULDWLRQ RQ WKH -RE 3ORW >@ ZDV XVHG WR PHDVXUH WKH ELQGLQJ VWRLFKLRPHWU\ RI WKH $ DQG 3UHJLRQV UHTXLUHG IRU WKH IRUPDWLRQ RI WKH 0$E $ HSLWRSH 3XULILHG $ UHJLRQ*67 DQG 3UHJLRQ*67 IXVLRQ SURWHLQV ZHUH GLOXWHG LQ 0 FDUERQDWH ELFDUERQDWH EXIIHU S+ f FRQWDLQLQJ b ZWYROf VRGLXP D]LGH DQG WKHQ PL[HG LQ GLIIHUHQW PRODU UDWLRV DQG f ZKLOH PDLQWDLQLQJ D FRQVWDQW

PAGE 37

WRWDO FRQFHQWUDWLRQ RI S0 7KH PL[WXUHV ZHUH LQFXEDWHG DW r& IRU KRXU DQG WKHQ SL SHU ZHOO ZDV DSSOLHG WR D &RVWDU +LJK %LQGLQJ SODWH &RPLQJ ,QFRUSRUDWHG &RPLQJ 1
PAGE 38

)ROORZLQJ PLQXWHV DW r& WUDQVIRUPDQWV ZHUH VFUHHQHG RQ 7+<( DJDU VXSSOHPHQWHG ZLWK SJP/ NDQDP\FLQ 7KH VHTXHQFHV RI DOO UHFRPELQDQW FRQVWUXFWV ZHUH FRQILUPHG E\ WKH '1$ VHTXHQFLQJ FRUH 8QLYHUVLW\ RI )ORULGDf $QDO\VLV RI 3$$ &HOO 6XUIDFH ([SUHVVLRQ LQ 3& 7KH VSD3 LVRJHQLF PXWDQW 3& KDUERULQJ SODVPLGV HQFRGLQJ 3, S0$'f 3$$ S76f 3, $3 S0$--f DQG YHFWRU RQO\ S'/f ZHUH JURZQ IRU KRXUV DW r& WKH FHOOV ZHUH KDUYHVWHG E\ FHQWULIXJDWLRQ DQG ZDVKHG WZLFH ZLWK 3%6 &HOOV ZHUH UHVXVSHQGHG LQ 3%6 DQG WKH GHQVLWLHV RI WKH VXVSHQVLRQV ZHUH HTXDOL]HG DW .OHWW 7ZRIROG VHULDO GLOXWLRQV RI WKH FHOO VXVSHQVLRQV ZHUH PDGH LQ 3%6 DQG SL RI HDFK GLOXWLRQ ZDV DSSOLHG LQ GXSOLFDWH WR WZR QLWURFHOOXORVH PHPEUDQHV 6FKOHLFKHU DQG 6FKXHOOf E\ XVLQJ D ZHOO GRW EORW PDQLIROG 6FKOHLFKHU DQG 6FKXHOOf :HOOV ZHUH ZDVKHG WZLFH ZLWK PO RI 3%6 DQG WKH ILOWHUV ZHUH UHPRYHG IURP WKH DSSDUDWXV DQG EORFNHG ZLWK 3%6 FRQWDLQLQJ b ZWYROf JHODWLQ DQG b YROYROf 7ZHHQ &HOO VXUIDFH 3, ZDV GHWHFWHG ZLWK UDEELW DQWLVHUXP >@ RU 0DE ( >@ DV WKH SULPDU\ DQWLERGLHV GLOXWHG SHUR[LGDVHFRQMXJDWHG JRDW DQWLUDEELW ,J* DQG JRDW DQWLPRXVH ,J* DV WKH VHFRQGDU\ DQWLERGLHV GLOXWHG DQG GHYHORSPHQW ZLWK FKORUROQDSKWKRO VROXWLRQ 51$ DQG 'RW %ORWWLQJ IRU &RQILUPDWLRQ RI 3$$ ([SUHVVLRQ LQ 3& )ROORZLQJ WKH PDQXIDFWXUHUfV SURWRFRO 51$ ZDV LVRODWHG IURP VWDWLRQDU\ SKDVH FXOWXUHV RI 3& KDUERULQJ S'/ S76 3$$f DQG S0$' 3,f XVLQJ WKH 4LDJHQ 5QHDV\ NLW 4LDJHQ 9DOHQFLD &$f 7RWDO 51$ FRQFHQWUDWLRQ ZDV PHDVXUHG E\ 2' QP DQG VWDQGDUGL]HG WR a SJPO E\ WKH DGGLWLRQ RI 51$ GLOXWLRQ EXIIHU [ 66& b IRUPDOGHK\GHf 6DPSOHV ZHUH VHULDOO\ GLOXWHG WZRIROG DQG SL RI HDFK ZHUH DSSOLHG

PAGE 39

WR D Q\ORQ PHPEUDQH XVLQJ D ZHOO GRW EORW PDQLIROG 6FKOHLFKHU t 6FKXHOOf 7KH PHPEUDQH ZDV EDNHG IRU PLQXWHV DW r& DQG LQFXEDWHG LQ ',* (DV\ +\E 5RFKH ,QGLDQDSROLV ,1f IRU KRXUV DW r& 7KH PHPEUDQH ZDV SUREHG RYHUQLJKW DW r& ZLWK GLJR[LJHQLQODEHOHG 3&5 DPSOLILHG '1$ FRPSOHPHQWDU\ WR WKH f HQG RI VSD3 QXFOHRWLGHV 7KH PHPEUDQH ZDV ZDVKHG EORFNHG IRU KRXU DW r& LQ 5RFKH EORFNLQJ EXIIHU DQG LQFXEDWHG LQ DONDOLQH SKRVSKDWDVHODEHOHG DQWLGLJR[LJHQLQ DQWLERGLHV $IWHU ZDVKLQJ LQ GHWHFWLRQ EXIIHU FKHPLOXPLQHQFH VXEVWUDWH &63' ZDV DGGHG DQG WKH PHPEUDQH ZDV H[SRVHG WR 6XSHU 5[ [UD\ ILOP )XML 7RN\Rf :HVWHUQ ,PPXQREORW $QDO\VLV RI 3HULSODVP ([WUDFWV IURP ( FROL 0& DQG &. +DUERULQJ S8& S'& S'& DQG S76 3HULSODVP FRQWHQWV RIe FROL '+D KDUERULQJ S8& S'& S'& RU S76 DQG ( FROL 0& DQG &. D VHF% PXWDQW >@ KDUERULQJ S8& RU S'& ZHUH H[WUDFWHG E\ RVPRWLF VKRFN >@ %ULHIO\ FHOOV ZHUH JURZQ IRU KRXUV DW r& 7KH PHGLXP ZDV VXSSOHPHQWHG ZLWK P0 ,37* WR LQGXFH 3JDODFWDVLGDVH H[SUHVVLRQ DQG WKH FXOWXUH ZDV LQFXEDWHG IRU DQ DGGLWLRQDO KRXUV DW r& KDUYHVWHG E\ FHQWULIXJDWLRQ DW [ J IRU PLQXWHV DQG UHVXVSHQGHG LQ P0 7ULF+&Ob ZWYROf VXFURVH S+ DQG ('7$ WR D ILQDO FRQFHQWUDWLRQ RI ,P0 7KH FHOOV ZHUH LQFXEDWHG DW r& IRU PLQXWHV ZKLOH VKDNLQJ KDUYHVWHG E\ FHQWULIXJDWLRQ IRU PLQXWHV DW [ J DQG UHVXVSHQGHG LQ LFHFROG P0 0J6&9 &HOOV ZHUH QH[W LQFXEDWHG LQ DQ LFH EDWK IRU PLQXWHV FHQWULIXJHG IRU PLQXWHV DW [ J DQG DJDLQ GHFDQWHG 2QH PRODU 7ULV +& S+ ZDV DGGHG WR WKH VXSHUQDWDQW WR D ILQDO FRQFHQWUDWLRQ RI P0 7KH VXSHUQDWDQW FRQWDLQLQJ WKH SHULSODVP FRQWHQWV ZDV GLOXWHG ZLWK 6'6 VDPSOH EXIIHU DQG LQFXEDWHG IRU PLQXWHV DW r& 7KH FHOO SHOOHWV ZHUH UHVXVSHQGHG LQ 6'6VDPSOH EXIIHU DQG DOVR KHDWHG IRU PLQXWHV DW r& 3URWHLQV ZHUH VHSDUDWHG RQ b ZWYROf

PAGE 40

6'6SRO\DFU\ODPLGH JHOV DQG WUDQVIHUUHG WR QLWURFHOOXORVH IRU KRXU DW 9 ,PPXQREORWV ZHUH EORFNHG DQG GHYHORSHG DV GHVFULEHG DERYH IRU WKH GRW EORW DVVD\ &RQVWUXFWLRQ RI D %LFLVWURQLF VSD3 IRU ([SUHVVLRQ RI D 'LVFRQWLQXRXV 3L 7KH IROORZLQJ HQJLQHHULQJ SURGXFHG D JHQHWLF FRQVWUXFW HQFRGLQJ VSD3 WKDW H[SUHVVHG 3, DV WZR LQGHSHQGHQW IUDJPHQWV WKH 1WHUPLQDO UHVLGXHV DQG WKH & WHUPLQDO UHVLGXHV )UDJPHQWV RI VSD3 ERWK XSVWUHDP DQG GRZQVWUHDP RI WKH f HQG RI WKH $UHJLRQ ZHUH DPSOLILHG E\ 3&5 DQG VXEVHTXHQWO\ OLJDWHG WRJHWKHU WR FUHDWH D fVSOLWf VSD3 )LJ f )RUZDUG SULPHU 76N DQG UHYHUVH SULPHU 76 ZHUH XVHG WR DPSOLI\ VSD3 '1$ XSVWUHDP RI WKH f HQG RI WKH $UHJLRQ LQFOXGLQJ WKH VSD3 SURPRWHU )RUZDUG SULPHU 76 DQG UHYHUVH SULPHU 76 2N ZHUH XVHG WR DPSOLI\ VSD3 GRZQVWUHDP RI WKH $UHJLRQ 3ULPHUV 76 DQG 76 ZHUH HQJLQHHUHG ZLWK .SQO UHVWULFWLRQ VLWHV DQG SULPHUV 76 DQG 76 FRQWDLQ HQJLQHHUHG ;KRO UHVWULFWLRQ VLWHV 7DEOH f 3ULPHU 76 DOVR HQFRGHV PXOWLSOH VWRS FRGRQV IRU WKH WHUPLQDWLRQ RI WKH 1WHUPLQDO 3, IUDJPHQW WUDQVODWLRQ 3ULPHU 76 FRQWDLQV WKH VSD3 ULERVRPH ELQGLQJ VLWH DQG HQFRGHV D VWDUW FRGRQ IRU WUDQVODWLRQ RI WKH &WHUPLQDO 3, IUDJPHQW 5HDFWLRQV ZHUH FDUULHG RXW LQ D 812 WKHUPREORFN WKHUPRF\FOHU %LRPHWUD 7DPSD )/f ZLWK SODVPLGHQFRGHG VSD3 S'& >@ DV WKH WHPSODWH DQG +L)L '1$ SRO\PHUDVH ,QYLWURJHQf IRU F\FOHV XQGHU WKH IROORZLQJ FRQGLWLRQV GHQDWXUDWLRQ DW r& IRU VHFRQGV SULPHU DQQHDOLQJ DW r& IRU PLQXWH SULPHU H[WHQVLRQ DW r& IRU PLQXWHV DQG VHFRQGV RU r& IRU PLQXWH DQG VHFRQGV DQG D ILQDO H[WHQVLRQ DW r& RU r& IRU PLQ 7KH UHVXOWLQJ DQG ES JHQH IUDJPHQWV ZHUH UHVWULFWHG ZLWK ;KRO EHIRUH EHLQJ OLJDWHG WRJHWKHU 7KH OLJDWHG IUDJPHQWV ZHUH JHO SXULILHG DQG DPSOLILHG E\ 3&5 DV EHIRUH XVLQJ SULPHUV 76 DQG 76 XQGHU WKH IROORZLQJ FRQGLWLRQV IRU F\FOHV GHQDWXUDWLRQ DW r& IRU VHFRQGV SULPHU DQQHDOLQJ DW r& IRU PLQXWH SULPHU H[WHQVLRQ DW r& IRU

PAGE 41

PLQXWHV VHFRQGV DQG r& IRU DQ DGGLWLRQDO PLQ 7KH 3&5 SURGXFW ZDV FORQHG LQWR WKH S&5 7232 YHFWRU FUHDWLQJ S76 ZKLFK ZDV LQWURGXFHG LQWR ( FROL 7RS FHOOV DFFRUGLQJ WR PDQXIDFWXUHUfV LQVWUXFWLRQV &ORQHV ZHUH VFUHHQHG RQ /% DJDU VXSSOHPHQWHG ZLWK SJP/ NDQDP\FLQ DQG SJP/ ;JDO :KLWH FRORQLHV ZHUH SLFNHG DQG WHVWHG IRU WKH SUHVHQFH RI VSD3 LQVHUW '1$ DIWHU DONDOLQH O\VLV 3ODVPLG S76 IURP WKH UHFRPELQDQW ZDV UHVWULFWHG ZLWK .SQO DQG HOHFWURSKRUHVHG RQ b ZWYROf DJDURVH 7KH DSSURSULDWH VL]HG VSOLW VSD3 '1$ IUDJPHQW ZDV H[FLVHG IURP WKH JHO DQG SXULILHG ZLWK WKH 4LDJHQ JHO H[WUDFWLRQ NLW 7KH VSOLW VSD3 VHTXHQFH ZDV OLJDWHG LQWR WKH .SQO VLWH RI WKH VKXWWOH YHFWRU S'/ FUHDWLQJ S76 DQG XVHG WR WUDQVIRUP ( FROL '+D E\ HOHFWURSRUDWLRQ 7UDQVIRUPDQWV ZHUH VHOHFWHG IRU RQ /% DJDU VXSSOHPHQWHG ZLWK SJP/ RI NDQDP\FLQ DQG SJP/ ;JDO :KLWH FRORQLHV ZHUH VFUHHQHG IRU WKH SUHVHQFH RI VSD3FRQWDLQLQJ LQVHUW '1$ DV EHIRUH 6HTXHQFHV RI DOO UHFRPELQDQW FRQVWUXFWV ZHUH FRQILUPHG E\ WKH '1$ VHTXHQFLQJ FRUH 8QLYHUVLW\ RI )ORULGDf (YDOXDWLRQ RI 3, )UDJPHQW ([SUHVVLRQ E\ :HVWHUQ ,PPXQREORW ( FROL '+D KDUERULQJ S76 ZDV JURZQ IRU KRXUV DW r& KDUYHVWHG E\ FHQWULIXJDWLRQ DQG O\VHG E\ ERLOLQJ IRU PLQXWHV LQ 6'6VDPSOH EXIIHU b >ZWYRO@ VRGLXP GRGHF\O VXOIDWH >6'6@ b >YROYRO@ PHUFDSWRHWKDQRO b >YROYRO@ JO\FHURO P0 7ULV+&O >S+ @ PJ RI EURPRSKHQRO EOXH SHU POf 3URWHLQV ZHUH VHSDUDWHG E\ 6'6SRO\DFU\ODPLGH JHO HOHFWURSKRUHVLV RQ b DFU\ODPLGH SUHSDUDWRU\ JHOV E\ WKH PHWKRG RI /DHPPOL >@ 3URWHLQV ZHUH HOHFWUREORWWHG RQWR QLWURFHOOXORVH PHPEUDQH 6FKOHLFKWHU DQG 6FKXHOO .HHQH 1+f IRU K DW 9 E\ WKH PHWKRG RI 7RZELQ HW DO >@ ,PPXQREORWV ZHUH EORFNHG ZLWK 3%67Z 0HPEUDQHV ZHUH

PAGE 42

LQFXEDWHG ZLWK $UHJLRQ VSHFLILF P$E $ DQG 3UHJLRQ GHSHQGHQW P$E $ DQG &WHUPLQDO VSHFLILF P$E ( > @ DW GLOXWLRQV RI $IWHU ZDVKLQJ PHPEUDQHV ZHUH LQFXEDWHG LQ SHUR[LGDVHODEHOHG JRDW DQWLPRXVH ,J* &DSSHOf DQG GHYHORSHG ZLWK FKORUROQDSKWKRO VROXWLRQ (YDOXDWLRQ RI 6XUIDFH ([SUHVVLRQ RI 'LVFRQWLQXRXV 3, LQ 6 PXWDQV 3ODVPLG S76 ZDV LQWURGXFHG LQWR 6 PXWDQV 3& E\ QDWXUDO WUDQVIRUPDWLRQ DV EHIRUH 6 PXWDQV 1* DQG 3& KDUERULQJ S'/ DQG GHULYDWLYHV H[SUHVVLQJ 3, S0$'f DQG GLVFRQWLQXRXV 3, IUDJPHQWV S76f ZHUH JURZQ IRU KRXUV DW r& &HOOV ZHUH KDUYHVWHG DSSOLHG WR D QLWURFHOOXORVH PHPEUDQH DQG VXUIDFH H[SUHVVLRQ RI 3, ZDV WUDFHG DV EHIRUH ZLWK 0$EV ' $ $ DQG ( ,QWURGXFWLRQ RI 6 JRUGRQLL 6VS$ DQG 6VS% $5HJLRQV LQWR 3$$ '1$ HQFRGLQJ WKH $UHJLRQV RI VVS$ DQG VVS% ZHUH DPSOLILHG E\ 3&5 DQG OLJDWHG LQWR WKH SODVPLG HQFRGLQJ 3$$ S76 S76 ZDV FRQVWUXFWHG ZLWK WZR VLOHQW PXWDWLRQV WKDW FUHDWHG D XQLTXH 6IR UHFRJQLWLRQ VHTXHQFH DW WKH VLWH RI WKH GHOHWHG $ UHJLRQ '1$ >@ 3&5 ZDV XVHG WR DPSOLI\ '1$ IUDJPHQWV RI VVS$ DQG VVS% WKDW HQFRGH UHVLGXHV ZKLFK DUH KRPRORJRXV WR WKH GHOHWHG $UHJLRQ LQ WKH VSD3 FRQVWUXFW 3, $$ 3ULPHUV 76 DQG 76 ZHUH XVHG WR DPSOLI\ WKH VVS$ '1$ IUDJPHQW DQG SULPHUV 76 DQG 76 ZHUH XVHG WR DPSOLI\ WKH VVS% IUDJPHQW 7DEOH f 5HDFWLRQV ZHUH FDUULHG RXW LQ D 812 WKHUPREORFN WKHUPRF\FOHU %LRPHWUD 7DPSD )/f ZLWK FKURPRVRPDO VVS$ DQG VVS% DV WKH WHPSODWHV DQG 9(17 SRO\PHUDVH 1(%f XQGHU WKH IROORZLQJ FRQGLWLRQV Lf r& IRU PLQXWHV LLf F\FOHV RI r& IRU VHFRQGV r& IRU VHFRQGV r& IRU DQG LLLf r& IRU DQ DGGLWLRQDO PLQ 7KH UHVXOWLQJ ES JHQH IUDJPHQWV ZHUH FORQHG LQWR WKH 6IR VLWH RI S76 ZLWK ( FROL '+D DV WKH KRVW VWUDLQ 3ODVPLG '1$ ZDV LVRODWHG IURP FORQHV DQG LQVHUW RULHQWDWLRQ ZDV FRQILUPHG E\

PAGE 43

UHVWULFWLRQ GLJHVW DQG VHTXHQFLQJ 7KH UHVXOWLQJ SODVPLGV GHVLJQDWHG S76 VVS$ $ UHJLRQf DQG S76 VVS% $UHJLRQf ZHUH LQWURGXFHG LQWR WKH 6 PXWDQV VSD3QHJDWLYH PXWDQW VWUDLQ 3& E\ QDWXUDO WUDQVIRUPDWLRQ DV SUHYLRXVO\ GHVFULEHG 7UDQVIRUPDQWV ZHUH VHOHFWHG IRU WKHLU DELOLW\ WR JURZ RQ 7+<( FRQWDLQLQJ SJPO RI NDQDP\FLQ :HVWHUQ ,PPXQREORW $QDO\VLV RI &KLPHULF 3, &RQWDLQLQJ WKH $UHJLRQ RI 6 JRUGRQLL 6VS$ DQG 6VS% :KROH FHOO O\VDWHV RI( FRL'+D KDUERULQJ S76 DQG S76 DQG PHFKDQLFDOO\ O\VHG 6 PXWDQV 3& KDUERULQJ WKH VDPH SODVPLGV ZHUH HOHFWURSKRUHVHG RQ b ZWYROf 6'63$ JHOV WUDQVIHUUHG WR QLWURFHOOXORVH DQG WUDFHG ZLWK D SDQHO RI HOHYHQ DQWL3O P$EV DV SUHYLRXVO\ GHVFULEHG 6XUIDFH ([SUHVVLRQ RI 6VS$ DQG 6VS% LQ 6 PXWDQV 3& 6 JRUGRQLL 0 6VS$ DQG 6VS% ZHUH H[SUHVVHG LQ WKH VSD3QHJDWLYH PXWDQW 3& DQG WUDQVORFDWLRQ WR WKH FHOO VXUIDFH ZDV GHWHUPLQHG E\ ZKROH FHOO GRW EORW 3ODVPLGV FRQWDLQLQJ VVS$ GULYHQ E\ WKH VVS% SURPRWHU S*(0VV"I XQSXEOLVKHGf DQG VVS% S(% >@ ZHUH NLQGO\ GRQDWHG E\ 'HPXWK 8QLYHUVLW\ RI 3HQQV\OYDQLD 3KLODGHOSKLD 3$f S*(0VVM0 ZDV OLQHDUL]HG ZLWK 6DF DQG EOXQWHG ZLWK %&OHQRZ IUDJPHQW IROORZHG E\ D VHFRQG GLJHVWLRQ ZLWK 6SKO 7KH VVS$ IUDJPHQW ZDV JHO SXULILHG OLJDWHG LQWR WKH 6SKO6PDO VLWH RI WKH VWUHSWRFRFFDO VKXWWOH YHFWRU S'/ DQG LQWURGXFHG LQWR 3& E\ QDWXUDO WUDQVIRUPDWLRQ S(% >@ ZDV GLJHVWHG ZLWK %DP+O DQG (FRU? DQG WKH DSSURSULDWHVL]HG VVS% EDQG ZDV JHO SXULILHG 7KH VVS% IUDJPHQW ZDV OLJDWHG LQWR S'/ DQG LQWURGXFHG LQWR 3& DV SUHYLRXVO\ GHVFULEHG 7UDQVIRUPDQWV ZHUH VHOHFWHG IRU WKHLU DELOLW\ WR JURZ RQ 7+<( FRQWDLQLQJ SJPO RI NDQDP\FLQ

PAGE 44

,QYROYHPHQW RI 5RS$ 7ULJJHU )DFWRUf DQG 'QD. LQ WKH 0DWXUDWLRQ DQG 7UDQVORFDWLRQ RI 3, (YDOXDWLRQ RI 3, 6XUIDFH ([SUHVVLRQ E\ :KROH &HOO 'RW %ORW LQ WKH 6 PXWDQV URS$ 0XWDQW 7: :KROH FHOO GRW EORWV RI 7: >@ FRXUWHV\ RI 7RP :HQ 8QLYHUVLW\ RI )ORULGD *DLQHVYLOOH )/f ZHUH XVHG WR GHWHUPLQH ZKHWKHU WKH UHGXFWLRQ LQ DGKHUHQFH ZDV GXH WR D UHGXFHG OHYHO RI VXUIDFH ORFDOL]HG 3, 8$ DQG 7: ZHUH JURZQ IRU KRXUV DW r& LQ 7+<( EURWK 7KH FHOOV ZHUH SDVVDJHG LQWR WULSOLFDWH FXOWXUHV DW LQ 7+<( EURWK JURZQ DW r& WR D .OHWW UHDGLQJ RI DQG SDVVDJHG DJDLQ LQ 7+<( EURWK DW &HOOV ZHUH JURZQ WR .OHWW UHDGLQJV RI DQG KDUYHVWHG E\ FHQWULIXJDWLRQ DQG ZDVKHG WZLFH ZLWK 3%6 &HOOV ZHUH UHVXVSHQGHG LQ b RI WKH RULJLQDO FXOWXUH YROXPH RI 3%6 7ZRIROG VHULDO GLOXWLRQV RI WKH FHOO VXVSHQVLRQV ZHUH PDGH LQ 3%6 DQG SL RI HDFK GLOXWLRQ ZDV DSSOLHG WR UHSOLFDWH QLWURFHOOXORVH PHPEUDQHV 6FKOHLFKHU DQG 6FKXHOOf E\ XVLQJ D ZHOO GRW EORW PDQLIROG 6FKOHLFKHU DQG 6FKXHOOf :HOOV ZHUH ZDVKHG WZLFH ZLWK SL RI 3%6 DQG WKH ILOWHUV ZHUH UHPRYHG IURP WKH DSSDUDWXV DQG EORFNHG ZLWK 3%6 FRQWDLQLQJ b ZWYROf JHODWLQ DQG b YROYROf 7ZHHQ 3, ZDV GHWHFWHG ZLWK ILYH DQWL3O PRQRFORQDO DQWLERGLHV >@ WKDW UHFRJQL]H FHOO VXUIDFH 3, DV ZHOO DV ZLWK UDEELW SRO\FORQDO VHUXP DV WKH SULPDU\ DQWLERGLHV HDFK GLOXWHG 6HFRQGDU\ DQWLERGLHV ZHUH JRDW DQWLPRXVH ,J* RU JRDW DQWLUDEELW ,J 03 %LRPHGLFDOV ,UYLQH &Df GLOXWHG 7KH PHPEUDQHV ZHUH GHYHORSHG ZLWK FKORUROQDSKWKRO VROXWLRQ 4XDQWLILFDWLRQ RI 3, VXUIDFH H[SUHVVLRQ ZDV SHUIRUPHG E\ GHQVLWRPHWU\ XVLQJ D )OXRUFKHP LPDJHU DQG VRIWZDUH $OSKD ,QQRWHFK 6DQ /HDQGUR &Df

PAGE 45

(YDOXDWLRQ RI 3, 6XUIDFH ([SUHVVLRQ E\ :KROH &HOO 'RW %ORW LQ 6 PXWDQV 60 D /RZ/HYHO ([SUHVVHU RI 'QD. 7R H[DPLQH WKH FRQWULEXWLRQ RI 'QD. WR 3, VXUIDFH H[SUHVVLRQ D ZKROH FHOO GRW EORW H[SHULPHQW DV DERYH ZDV SHUIRUPHG XVLQJ 6 PXWDQV 60, ZKLFK ZDV HQJLQHHUHG WR H[SUHVV DSSUR[LPDWHO\ b RI WKH OHYHO RI 'QD. DV WKH SDUHQW VWUDLQ 8$ /HPRV DQG %XPH LQ SUHSDUDWLRQ 8QLYHUVLW\ RI )ORULGD *DLQHVYLOOH )/ff 6 PXWDQV 8$ DQG 60 ZHUH JURZQ DQG KDUYHVWHG DW HDUO\ORJ DQG VWDWLRQDU\ SKDVHV .OHWW UHDGLQJV RI DQG DQG VXUIDFH H[SUHVVLRQ ZDV GHWHUPLQHG DV SUHYLRXVO\ GHWDLOHG $QDO\VLV RI GQD. 0HVVDJH /HYHOV E\ 4XDQWLWDWLYH 5HDO7LPH 3&5 5HDO7LPH 3&5 ZDV XWLOL]HG WR HYDOXDWH WKH HIIHFWV RI H[SUHVVLRQ RI WKH $ DQG 3 UHJLRQ GHOHWLRQ FRQVWUXFWV RQ GQD. P51$ OHYHO &XOWXUHV RI 3& KDUERULQJ S'/ VKXWWOH YHFWRUf S0$-3 $3UHJLRQf DQG S0$' 3,f DQG S76 3, $$UHJLRQf ZHUH JURZQ LQ WULSOLFDWH WR .OHWW DIWHU PXOWLSOH SDVVDJHV DV DERYH 51$ IURP HDFK FXOWXUH ZDV LVRODWHG DFFRUGLQJ WR VXSSOLHUfV LQVWUXFWLRQV XVLQJ WKH 4LDJHQ 51HDV\ NLW 4LDJHQ 9DOHQFLD &$f 7KH WRWDO 51$ FRQFHQWUDWLRQ ZDV PHDVXUHG E\ 2' RQP F'1$ RI GQD. DQG 6 51$ ZDV V\QWKHVL]HG IURP SJ RI 51$ XVLQJ SULPHU GQD.$6 DQG V596 UHVSHFWLYHO\ DQG 6XSHUVFULSW ,, UHYHUVH WUDQVFULSWDVH ,QYLWURJHQ &DUOVEDG &$f IRU PLQXWHV DW r& PLQXWHV r& DQG PLQXWHV DW r& 7UDQVFULSW OHYHOV ZHUH GHWHUPLQHG E\ XVLQJ L4 6<%5 *UHHQ 6XSHUPL[ %LR5DG +HUFXOHV &$f 5HDFWLRQV ZHUH SHUIRUPHG LQ D SO YROXPH XVLQJ WKH PDQXIDFWXUHUnV SURWRFROV 7KH IRUZDUG SULPHUV IRU GQD. DQG V 51$ ZHUH 'QD.6 DQG 6):' $PSOLILFDWLRQ ZDV SHUIRUPHG XQGHU WKH IROORZLQJ FRQGLWLRQV VHFRQGV DW r& IROORZHG E\ F\FOHV RI VHFRQGV DW r& DQG VHFRQGV DW r& 0HOW FXUYH GDWD ZDV FROOHFWHG ZLWK DQ DGGLWLRQDO F\FOHV RI VHFRQGV VWDUWLQJ DW r& DQG LQFUHDVLQJ

PAGE 46

E\ r& DIWHU F\FOH DQG VHFRQGV DW r& '1$ DPSOLILFDWLRQ DQG IOXRUHVFHQFH GHWHFWLRQ ZDV SHUIRUPHG ZLWK WKH c&\FOHU ,4 UHDOWLPH 3&5 GHWHFWLRQ V\VWHP DQG DFFRPSDQ\LQJ VRIWZDUH %LR5DGf $ VWDQGDUG FXUYH ZDV SORWWHG IRU WKH UHDFWLRQ ZLWK YDOXHV REWDLQHG IURP WKH DPSOLILFDWLRQ RI NQRZQ TXDQWLWLHV RI '1$ IURP GQD. V 51$ ZDV XVHG WR QRUPDOL]H 51$ DEXQGDQFH IRU DOO UHDFWLRQV )RU HDFK H[SHULPHQW F'1$ ZDV DPSOLILHG IURP 51$ ZKLFK ZDV IUHVKO\ LVRODWHG IURP HDFK RI WKUHH SDUDOOHO FXOWXUHV RI HDFK WUDQVIRUPDQW 5HDO7LPH 3&7 ZDV FRQGXFWHG RQ HDFK F'1$ VDPSOH WULSOLFDWH UHVXOWLQJ LQ GDWD SRLQWV IRU HDFK WUDQVIRUPDQW

PAGE 47

&+$37(5 5(68/76 ([SUHVVLRQ RI 5HFRPELQDQW 3$$ DQG 5HFRJQLWLRQ E\ $QWL3L 0RQRFORQDO $QWLERGLHV 5HJLRQV RI 3, WKDW FRQWULEXWHG WR WKH HSLWRSHV IRU HOHYHQ DQWL3O P$EV ZHUH LGHQWLILHG EDVHG RQ LPPXQREORW DQDO\VLV RI IXOOOHQJWK DQG WUXQFDWHG 3, SRO\SHSWLGHV 6HYHUDO RI WKHVH P$EV $ ( DQG ) ZHUH LQLWLDOO\ PDSSHG WR WKH FHQWUDO UHJLRQ RI WKH SURWHLQ ZKLFK FRQWDLQHG WKH 3UHJLRQ >@ 'HOHWLRQ RI WKH 3 UHJLRQ DD f IURP 3, HOLPLQDWHG WKH ELQGLQJ RI P$EV $ ( DQG $ $ UHJLRQ FRQWULEXWLQJ WR WKH ELQGLQJ RI P$E $ KDG DOVR EHHQ PDSSHG WR WKH UHJLRQ MXVW DPLQRWHUPLQDO WR WKH FHQWUDO UHJLRQ 6XUSULVLQJO\ QRQH RI WKH 3UHJLRQ GHSHQGHQW P$EV ERXQG WR D 3UHJLRQ VXEFORQH DD f >@ VXJJHVWLQJ WKDW WKH HSLWRSHV ZHUH FRPSOH[ DQG SRVVLEO\ FRQIRUPDWLRQDO &KDUDFWHUL]DWLRQ RI WKH HSLWRSH IRU P$E $ ZDV FRQGXFWHG E\ 5KRGLQ HW DO >@ &RQVWUXFWLRQ RI VHYHUDO 3, VXEFORQHV DQG DQDO\VLV E\ :HVWHUQ LPPXQREORW UHYHDOHG WKDW UHVLGXHV ZHUH QRW VXIILFLHQW IRU WKH ELQGLQJ RI P$E $ 7KHVH GDWD VXJJHVWHG WKDW WKH 3UHJLRQ DQG UHVLGXHV DPLQRWHUPLQDO RI DD ZHUH QHFHVVDU\ IRU P$E $ ELQGLQJ 7DNHQ WRJHWKHU ZLWK FU\VWDO VWUXFWXUH GDWD LQGLFDWLQJ WKDW WKH $UHJLRQ DQG 3UHJLRQ PD\ EH LQ FORVH SUR[LPLW\ >@ ZH HOHFWHG WR H[DPLQH ZKHWKHU WKH $UHJLRQ FRQWULEXWHG WR D FRPSOH[ VWUXFWXUH DOVR LQYROYLQJ WKH 3UHJLRQ $ VSD3 JHQH ODFNLQJ '1$ HQFRGLQJ WKH $UHJLRQ DD f ZDV FRQVWUXFWHG E\ 3&5 DQG FORQHG LQWR S8& FUHDWLQJ S76 DV GHWDLOHG LQ &KDSWHU 3, ODFNLQJ WKH $UHJLRQ 3, $$f ZDV GHWHFWDEOH E\ :HVWHUQ LPPXQREORW LQ ZKROH FHOO

PAGE 48

O\VDWHV RI UHFRPELQDQW ( FROL '+D XVLQJ DQWL3O SRO\FORQDO DQWLERGLHV GDWD QRW VKRZQf :KLOH IXOOOHQJWK 3, PLJUDWHV DSSUR[LPDWHO\ N' ODUJHU WKDQ LWV SUHGLFWHG a N' RQ 6'6SRO\DFU\ODPLGH JHOV 3$$ OLNH 3$3 PLJUDWHV DW LWV SUHGLFWHG PROHFXODU ZHLJKW 7KH HIIHFW RI GHOHWLQJ WKH $UHJLRQ RQ WKH DQWLJHQLFLW\ RI 3, ZDV H[DPLQHG E\ :HVWHUQ EORWWLQJ XWLOL]LQJ WKH HOHYHQ DQWL3O PRQRFORQDO DQWLERGLHV >@ 'HOHWLRQ RI WKH $UHJLRQ IURP 3, HOLPLQDWHG WKH UHDFWLYLW\ RI ILYH RI WKH HOHYHQ P$EV )LJXUH f 7KUHH RI WKH QRQUHDFWLYH P$EV $ DQG $ DUH DOVR QRW UHDFWLYH ZLWK 3, $3 >@ 5HDFWLYLW\ RI P$EV ( % DQG & ZKLFK DUH VSHFLILF WR WKH &WHUPLQXV RI 3, >@ FRQILUPHG WKDW WKH GHOHWLRQ RI WKH '1$ HQFRGLQJ WKH $UHJLRQ GLG QRW GLVUXSW WKH UHDGLQJ IUDPH 7KH :HVWHUQ EORW DOVR VKRZV WKDW OLNH 3, $3 3, $$ LV VWDEO\ H[SUHVVHG DQG HDVLO\ GHWHFWDEOH LQ ( FROL (YDOXDWLRQ RI 3$$ ([SUHVVLRQ LQ 6 PXWDQV :KHQ H[SUHVVHG LQ 6 PXWDQV 3, $3 ZDV XQVWDEOH DQG QRW GHWHFWHG RQ WKH FHOO VXUIDFH >@ 7R GHWHUPLQH ZKHWKHU WKH GHOHWLRQ RI WKH $UHJLRQ UHVXOWHG LQ VLPLODU 3, FKDUDFWHULVWLFV 3, $$ ZDV H[SUHVVHG LQ WKH VSD3 PXWDQW 3& :KROH FHOO GRW EORW DQDO\VLV RI 3& KDUERULQJ S'/ YHFWRUf S0$' 3,f RU S76 3$$f ZDV XVHG WR H[DPLQH ZKHWKHU WKH $UHJLRQ OLNH WKH 3UHJLRQ LV QHFHVVDU\ IRU 3, VXUIDFH H[SUHVVLRQ LQ 6 PXWDQV 7KHVH UHVXOWV DUH VKRZQ LQ )LJXUH 7ZRIROG VHULDO GLOXWLRQV RI WKH FHOOV ZHUH DSSOLHG WR WKH QLWURFHOOXORVH PHPEUDQH LQ GXSOLFDWH 7KH SRVLWLYH FRQWURO 3&& H[SUHVVLQJ IXOOOHQJWK 3, URZ f GHPRQVWUDWHG WKH UHDFWLYLW\ RI WKH DQWLVHUXP ZLWK VXUIDFH H[SUHVVHG 3, 1HJDWLYH FRQWUROV 3& DQG 3&$ YHFWRU RQO\ URZV DQG f VKRZHG ODFN RI UHDFWLYLW\ RI WKH DQWLVHUXP ZLWK FHOOV ODFNLQJ 3, 3& KDUERULQJ S76 HQFRGLQJ 3, $$ URZ f ZDV QRW UHDFWLYH ZLWK WKH SRO\FORQDO

PAGE 49

DQWLVHUXP LQGLFDWLQJ D ODFN RI VXUIDFH H[SUHVVLRQ RI 3, 7KHVH UHVXOWV LQGLFDWHG WKDW 3$$ ZDV QRW WUDQVORFDWHG WR WKH VXUIDFH RI 3& 1R 3, $$ ZDV GHWHFWHG LQ VSHQW FXOWXUH OLTXRU DOWKRXJK 3, ZDV IRXQG LQ WKH VSHQW FXOWXUH OLTXRU RI 3&& FRPSOHPHQWHG VSD3 PXWDQWf DQG 1* ZLOGW\SHf GDWD QRW VKRZQf 7R GHWHUPLQH LI WKH ODFN RI GHWHFWDEOH 3, $$ RQ WKH VXUIDFH ZDV GXH WR D SUREOHP ZLWK WUDQVORFDWLRQ RXW RI WKH F\WRSODVP FHOO O\VDWHV ZHUH H[DPLQHG IRU GHWHFWDEOH 3, $$ 1* 3&$ 3&& 3& DQG 3& KDUERULQJ S76 ZHUH VXEMHFWHG WR PHFKDQLFDO O\VLV LQ D 0LQL %HDGEHDWHU DSSDUDWXV DQG VDPSOHV ZHUH DQDO\]HG E\ :HVWHUQ EORWWLQJ GDWD QRW VKRZQf )XOOOHQJWK 3, ZDV SUHVHQW LQ ERWK FHOO H[WUDFWV DQG FHOO GHEULV RI 1* ZLOGW\SHf DQG 3&& FRPSOHPHQWHG VSD3 PXWDQWf 3, $$ ZDV QRW GHWHFWHG LQ HLWKHU WKH FHOO H[WUDFW RU WKH FHOO GHEULV RI 3& KDUERULQJ S76 DQG QR 3, ZDV REVHUYHG LQ WKH QHJDWLYH FRQWUROV 3&$ YHFWRU RQO\f RU 3& (YDOXDWLRQ RI VZ36SHFLILF P51$ LQ 3& +DUERULQJ WKH 'HOHWLRQ &RQVWUXFW S76 :LWK D ODFN RI GHWHFWDEOH 3, $$ LQ 3& DQ 51$ GRW EORW ZDV XVHG WR FRQILUP WKDW VSD3$$ ZDV WUDQVFULEHG IURP WKH S'/ VKXWWOH YHFWRU LQ 3& )LJXUH f 'LOXWLRQV RI WRWDO FHOOXODU 51$ ZHUH SUREHG ZLWK D GLJR[LQLQODEHOHG SUREH FRUUHVSRQGLQJ WR WKH f HQG RI VSD3 7KH WRS WZR URZV FRUUHVSRQG WR WKH QHJDWLYH FRQWUROV 3& DQG 3&$ KDUERULQJ WKH YHFWRU RQO\ 7KH WKLUG URZ FRQWDLQV 51$ IURP 3& KDUERULQJ S76 DQG WKH ERWWRP URZ FRQWDLQV 51$ IURP WKH SRVLWLYH FRQWURO 3& KDUERULQJ S0$' 7KH GRW EORW VKRZV WKDW VSD3$$ PHVVDJH LV H[SUHVVHG DW OHYHOV HTXLYDOHQW WR WKH IXOOOHQJWK VSD3 H[SUHVVHG IURP S0$'

PAGE 50

(YDOXDWLRQ RI 6HFUHWLRQ RI 3, 3$$ DQG 3$3 LQ ( FROL 6LQFH 3$$ DQG 3, $3 ZHUH XQGHWHFWDEOH DQG SRVVLEO\ XQVWDEOH LQ 6 PXWDQV ZKLOH EHLQJ FOHDUO\ GHWHFWDEOH LQ ( FROL WKH XVH RI ( FROL DV D PRGHO WR GHWHUPLQH WKH VHFUHWLRQ FRPSHWHQF\ RI WKHVH SURWHLQV ZDV H[DPLQHG 7R WKLV HQG SHULSODVPLF H[WUDFWV RI ( FROL '+D KDUERULQJ S8& S'& S'& RU S76 YHFWRU RQO\ DQG H[SUHVVLQJ 3, 3$3 DQG 3, $$ UHVSHFWLYHO\f ZHUH SUHSDUHG E\ RVPRWLF VKRFN DQG WKH SUHVHQFH RI 3, DQG GHULYDWLYHV ZDV GHWHFWHG E\ HOHFWURSKRUHVLV RQ 6'6SRO\DFU\ODPLGH JHOV IROORZHG E\ :HVWHUQ LPPXQREORWWLQJ 7KHVH UHVXOWV DUH VKRZQ LQ )LJXUH /DQHV PDUNHG f&f FRQWDLQ FHOOXODU O\VDWHV DQG ODQHV PDUNHG f3f FRQWDLQ SHULSODVPLF H[WUDFWV /DQHV PDUNHG S'& FRQWDLQ FHOOXODU H[WUDFWV IURP ( FROL '+D KDUERULQJ S'& IXOOOHQJWK 3,f DQG FOHDUO\ VKRZ WKDW 3, LV SUHVHQW LQ ERWK WKH F\WRSODVP DQG WKH SHULSODVP /DQHV PDUNHG S'& VKRZ FHOOXODU IUDFWLRQV IURP '+D KDUERULQJ S'& DQG VKRZ WKDW 3, $3 LV SUHVHQW LQ WKH F\WRSODVP EXW DEVHQW IURP WKH SHULSODVP /DQHV S76 FRUUHVSRQG WR FHOO IUDFWLRQV IURP '+D KDUERULQJ S76 DQG VKRZ WKDW OLNH 3$3 3, $$ LV SUHVHQW LQ WKH F\WRSODVP EXW QRW WUDQVORFDWHG WR WKH SHULSODVP /DQHV PDUNHG S8& DUH FHOOXODU O\VDWHV DQG SHULSODVP H[WUDFWV IURP ( FROL KDUERULQJ S8& YHFWRU RQO\f 7KHVH UHVXOWV VXJJHVW WKDW ( FROL PD\ EH D YLDEOH PRGHO IRU WKH VWXG\ RI WKH LQWUDPROHFXODU UHTXLUHPHQWV IRU 3, WUDQVORFDWLRQ ,QWHUDFWLRQ RI WKH $ DQG 35HJLRQV 'HWHFWHG E\ (/,6$ 7KH GHPRQVWUDWLRQ WKDW WKH ELQGLQJ RI P$EV $ DQG $ WR 3, ZHUH GHSHQGHQW XSRQ WKH VLPXOWDQHRXV SUHVHQFH RI WKH $ DQG 3UHJLRQV DQG ZRUN E\ YDQ 'ROOHZHHUG HW DO > @ FKDUDFWHUL]LQJ D FRPSOH[ HSLWRSH FRPSULVHG RI WKH 3UHJLRQ DQG D IUDJPHQW RI 3, FRQWDLQLQJ WKH $UHJLRQ VXJJHVWHG D SRVVLEOH LQWHUDFWLRQ EHWZHHQ WKHVH

PAGE 51

GRPDLQV 7R GHWHUPLQH ZKHWKHU WKH LVRODWHG $ DD f DQG 3UHJLRQV DD f ZHUH FDSDEOH RI VXFK DQ LQWHUDFWLRQ (/,6$ ZDV XVHG WR HYDOXDWH ELQGLQJ )LJXUH f 7R IDFLOLWDWH SURWHLQ SXULILFDWLRQ WKH $UHJLRQ DQG 3UHJLRQ RI 3, ZHUH H[SUHVVHG DV IXVLRQV ZLWK PDOWRVHELQGLQJ SURWHLQ 0%3f S0$ DQG S0$ UHVSHFWLYHO\ 7DEOH f 3XULILHG 3UHJLRQ0%3 RU 0%3 DORQH DV D QHJDWLYH FRQWURO ZDV LPPRELOL]HG LQ (/,6$ SODWH ZHOOV $IWHU ZDVKLQJ DQG EORFNLQJ WKH SODWHV WZRIROG VHULDO GLOXWLRQV RI $UHJLRQ 0%3 ZHUH DGGHG WR WKH ZHOOV %LQGLQJ RI $UHJLRQ0%3 WR WKH LPPRELOL]HG SURWHLQV ZDV GHWHFWHG E\ WKH $UHJLRQVSHFLILF 0$E $V VKRZQ WKH $UHJLRQ0%3 ERXQG WR 3UHJLRQ0%3 LQ D GRVHGHSHQGHQW PDQQHU EXW QRW WR 0%3 DORQH 0%3 DORQH GLG QRW ELQG WR 0%3 RU WR 3UHJLRQ0%3 GDWD QRW VKRZQf 5HVWRUDWLRQ RI (SLWRSHV E\ WKH ,QWHUDFWLRQ RI WKH $ DQG 35HJLRQV 7KH UHTXLUHPHQW IRU WKH VLPXOWDQHRXV SUHVHQFH RI ERWK WKH $ DQG 3UHJLRQV IRU 0$E $ DQG $ ELQGLQJ WR 3, VXJJHVWHG WKDW ERWK RI WKHVH UHJLRQV FRQWULEXWH WR WKH HSLWRSHV IRU WKHVH P$EV 5HDFWLYLW\ RI WKHVH P$EV DJDLQVW (/,6$ SODWHV FRDWHG ZLWK WKH $ DQG 3UHJLRQV ZDV WHVWHG DV DERYH )LJXUH f 7KH (/,6$ UHYHDOHG WKDW ZKLOH WKH P$EV GLG QRW UHDFW WR WKH $ RU 3UHJLRQV DORQH WKH\ GLG UHDFW WR WKH ZHOOV FRQWDLQLQJ ERWK UHJLRQV $GGLWLRQDOO\ 0$E $ UHDFWHG HTXDOO\ ZHOO UHJDUGOHVV RI ZKLFK UHJLRQ LV LPPRELOL]HG ZKLOH P$EV DQG $ FOHDUO\ UHDFWHG EHWWHU ZKHQ WKH 3UHJLRQ LV LPPRELOL]HG WR WKH SODWH ,QKLELWLRQ RI 0$E $ %LQGLQJ WR 3, E\ DQ $ DQG 35HJLRQ &RPSOH[ &RPSHWLWLYH LQKLELWLRQ (/,6$ ZDV XVHG WR DVVD\ WKH DELOLW\ RI WKH $ DQG 3UHJLRQV WR LQWHUDFW LQ VROXWLRQ SKDVH ,W ZDV SUHYLRXVO\ VKRZQ WKDW WKH ELQGLQJ RI 0$E $ WR 3, ZDV GHSHQGHQW XSRQ WKH SUHVHQFH RI ERWK WKH $ DQG WKH 3UHJLRQV ,Q WKLV DVVD\ WKH DELOLW\ RI $UHJLRQ DQG 3UHJLRQ*67 IXVLRQV DORQH DQG WRJHWKHU WR LQKLELW 0$E $

PAGE 52

ELQGLQJ WR LPPRELOL]HG 3, ZDV DQDO\]HG $V VKRZQ LQ )LJXUH DV D SHUFHQWDJH RI LQKLELWLRQ 0$E $ ELQGLQJ WR LPPRELOL]HG 3OZDV QRW LQKLELWHG E\ $UHJLRQ*67 3 UHJLRQ*67 RU *67 DORQH +RZHYHU 0$E $ ELQGLQJ ZDV LQKLELWHG E\ D PL[WXUH RI $DQG 3UHJLRQ*67 DV ZHOO DV E\ 3, LQ VROXWLRQ 6WRLFKLRPHWU\ RI WKH $ DQG 35HJLRQ ,QWHUDFWLRQ $ TXDVLFRQWLQXRXV YDULDWLRQ DVVD\ ZDV SHUIRUPHG WR GHWHUPLQH WKH VWRLFKLRPHWU\ RI WKH $ DQG 3UHJLRQ LQWHUDFWLRQ UHTXLUHG IRU WKH UHFRQVWLWXWLRQ RI WKH HSLWRSH UHTXLUHG E\ 0$E $ 9DU\LQJ PRODU UDWLRV RI $ DQG 3UHJLRQ*67 IXVLRQ SURWHLQV ZHUH PL[HG ZKLOH PDLQWDLQLQJ D FRQVWDQW WRWDO PRODU FRQFHQWUDWLRQ 7KH $UHJLRQ3UHJLRQ PL[WXUHV ZHUH LPPRELOL]HG RQ D ZHOO (/,6$ SODWH DQG ELQGLQJ RI 0$E $ WR WKH PL[WXUHV ZDV WUDFHG ZLWK SHUR[LGDVHODEHOHG JRDW DQWLPRXVH DQWLERG\ 7KH PD[LPXP ELQGLQJ RI 0$E $ WR WKH $UHJLRQ3UHJLRQ FRPSOH[ ZDV FOHDUO\ VHHQ DW D PRODU UDWLR )LJXUH f ,QWHUDFWLRQ RI 3, 6VS$ DQG 6VS% $ DQG 35HJLRQV 7KH $ DQG 3UHJLRQV RI 3, DUH DSSUR[LPDWHO\ b LGHQWLFDO WR WKH VDPH UHJLRQV LQ WKH 6 JRUGRQLL 0 6VS$ DQG 6VS% DOVR PHPEHUV RI WKH DQWLJHQ ,2 IDPLO\ 7R GHWHUPLQH ZKHWKHU WKH 6VS$ DQG 6VS% $ DQG 3UHJLRQV H[KLELWHG WKH VDPH ELQGLQJ FKDUDFWHULVWLFV DV WKH 3 UHJLRQV (/,6$ ZDV XVHG WR DQDO\]H WKHLU DELOLW\ WR LQWHUDFW ZLWK RQH DQRWKHU DQG ZLWK WKH $ DQG 3UHJLRQV RI 3 $ DQG 3UHJLRQ*67 IXVLRQ SURWHLQV ZHUH SXULILHG E\ DIILQLW\ FROXPQ FKURPDWRJUDSK\ DQG LPPRELOL]HG WR (/,6$ SODWHV DV SUHYLRXVO\ GHVFULEHG 7ZRIROG VHULDO GLOXWLRQV RI $UHJLRQ*67 IXVLRQ SURWHLQV ZHUH LQFXEDWHG ZLWK WKH LPPRELOL]HG 3UHJLRQ*67 SURWHLQV DQG ELQGLQJ ZDV WUDFHG ZLWK WKH $UHJLRQ VSHFLILF P$E DV EHIRUH )LJXUH VKRZV WKDW WKH $UHJLRQV RI 3, 6VS$ DQG 6VS% DUH FDSDEOH RI ELQGLQJ WR WKH 3UHJLRQV RI DOO WKUHH RI WKH DQWLJHQ ,,, IDPLO\

PAGE 53

SURWHLQV $V PHDVXUHG E\ (/,6$ DQG :HVWHUQ EORW )LJXUH f P$E UHDFWV HTXDOO\ WR HDFK RI WKH $UHJLRQ*67 IXVLRQV $QWL3L P$E (SLWRSH 5HVWRUDWLRQ E\ WKH ,QWHUDFWLRQ RI $ DQG 35HJLRQV RI 6VS$ DQG 6VS% %DVHG RQ WKH GHPRQVWUDWHG UHVWRUDWLRQ RI HSLWRSHV E\ WKH LQWHUDFWLRQ RI WKH $ DQG 3UHJLRQV RI 3, WKH LQWHUDFWLRQV RI WKH $ DQG 3UHJLRQV RI 6VS$ DQG 6VS% DQG WKH UHDFWLYLW\ RI P$EV $ DQG WR IXOOOHQJWK 6VS$ DQG 6VS% )LJXUH f UHVWRUDWLRQ RI HSLWRSHV IRU WKH P$EV E\ WKH LQWHUDFWLRQ RI WKH $ DQG 3UHJLRQV RI 6VS$ DQG 6VS% ZDV H[DPLQHG 5HDFWLYLW\ RI P$EV 2$ DQG $ ZLWK D FRPELQDWLRQ RI WKH $ DQG 3UHJLRQV ZDV WHVWHG E\ (/,6$ DV SUHYLRXVO\ GHVFULEHG $V VKRZQ LQ )LJXUHV WKURXJK QRQH RI WKH P$EV UHDFWHG WR WKH $ RU 3UHJLRQV DORQH KRZHYHU WKH UHVXOWV VKRZHG WKDW DOO WKUHH P$EV UHDFWHG WR DOO $UHJLRQ3UHJLRQ LQWHUDFWLRQV LQ ZKLFK D 3, IUDJPHQW ZDV WKH RYHUODLG PRLHW\ 7KH ELQGLQJ RI DOO WKUHH P$EV ZDV DOVR UHVWRUHG XSRQ WKH LQWHUDFWLRQ RI DQ\ 3UHJLRQ WR WKH LPPRELOL]HG $UHJLRQ RI 3 7KH LQWHUDFWLRQ RI 6VS$ $UHJLRQ ZLWK LPPRELOL]HG 3, 3UHJLRQ ZDV DOVR DEOH WR UHVWRUH ELQGLQJ RI P$E 0$E ELQGLQJ ZDV DOVR UHVWRUHG WR D PRUH OLPLWHG H[WHQW ZKHQ WKH 3UHJLRQ RI 3, ZDV RYHUODLG RQ WKH LPPRELOL]HG $UHJLRQ RI 6VS$ ,Q VXPPDU\ DOO KHWHURORJRXV $ DQG 3UHJLRQV LQWHUDFWHG \HW QRW DOO RI WKH LQWHUDFWLRQV UHVWRUHG DQWL3O P$E HSLWRSHV ,QWURGXFWLRQ RI WKH $5HJLRQV RI 6VS$ DQG 6VS% LQWR 3, $$ 7KH LGHQWLILFDWLRQ RI WKH LQWHUDFWLRQ EHWZHHQ WKH $UHJLRQV RI 6VS$ DQG 6VS% DQG WKH 3UHJLRQ RI 3, LQFOXGLQJ WKH UHVWRUDWLRQ RI WKH P$E HSLWRSH VXJJHVWHG WKDW VRPH GHJUHH RI 3, VWUXFWXUH ZDV DWWDLQHG EXW QDWLYH VWUXFWXUH ZDV QRW IXOO\ UHVWRUHG DW WKH SRO\SHSWLGH OHYHO 7R GHWHUPLQH ZKHWKHU LQWURGXFWLRQ RI WKH $UHJLRQV RI 6VS$ DQG 6VS%

PAGE 54

LQWR 3$$ FRXOG UHVWRUH QDWLYH VWUXFWXUH DQG WUDQVORFDWLRQ RI WKH GHOHWLRQ FRQVWUXFW HDFK $UHJLRQ ZDV OLJDWHG LQIUDPH LQWR WKH VLWH RI WKH GHOHWLRQ LQ 3, $$ 7KH KRPRORJ\ EHWZHHQ HDFK RI WKH $UHJLRQV LV LOOXVWUDWHG LQ )LJXUH 7KH UHVXOWLQJ FKLPHULF 3, SURWHLQV ZHUH H[DPLQHG IRU UHVWRUDWLRQ RI P$E ELQGLQJ E\ :HVWHUQ LPPXQREORW )LJXUH f 7KH ELQGLQJ RI P$E GHPRQVWUDWHG WKDW WKH 6 JRUGRQLL $UHJLRQV KDG EHHQ LQVHUWHG LQWR 3, $$ DQG ZHUH LQIUDPH SDQHO $f 5HVWRUDWLRQ RI ELQGLQJ ZDV RQO\ VHHQ IRU P$E ZLWK WKH FKLPHULF 3, SURWHLQ FRQWDLQLQJ WKH $UHJLRQ RI 6VS$ SDQHO %f &DUER[\WHUPLQDO VSHFLILF P$E & UHDFWHG WR ERWK FKLPHULF SURWHLQV LQGLFDWLQJ WKDW WKH LQVHUWLRQ ZDV LQIUDPH DQG WKDW WKH SURWHLQV ZHUH QRW WUXQFDWHG GDWD QRW VKRZQf 7KH EDQGV WKDW P$E & UHDFWHG WR ZHUH RI WKH VDPH PROHFXODU ZHLJKW DV WKH EDQG WKDW UHDFWHG WR LQ SDQHO % )XOOOHQJWK 3, PLJUDWHV RQ 6'6SRO\DFU\ODPLGH JHOV QHDU N' 2GGO\ QHLWKHU FKLPHULF SURWHLQ DSSHDUHG WR PLJUDWH VORZHU WKDQ 3, $$ ,W LV DSSDUHQW WKDW WKH LQWURGXFWLRQ RI WKH $UHJLRQV GLG QRW UHVWRUH QDWLYH 3, PLJUDWLRQ FKDUDFWHULVWLFV WR WKH SURWHLQV 6WDELOLW\ DQG 7UDQVORFDWLRQ RI &KLPHULF 3, &RQWDLQLQJ WKH $5HJLRQV RI 6VS$ DQG 6VS% $OWKRXJK IXOO QDWLYH VWUXFWXUH EDVHG XSRQ UHFRJQLWLRQ E\ DOO $ DQG 3GHSHQGHQW P$EV ZDV QRW DFKLHYHG WKH ELQGLQJ RI WR WKH 6VS$ FKLPHULF FRQVWUXFW LQGLFDWHG WKDW VRPH GHJUHH RI $ DQG 3UHJLRQ LQWHUDFWLRQ KDG EHHQ UHVWRUHG WKHUHIRUH LW ZDV VWLOO RI LQWHUHVW WR H[DPLQH WKH SRVVLEOH UHVWRUDWLRQ RI WUDQVORFDWLRQ RI WKH FKLPHULF PROHFXOHV WR WKH FHOO VXUIDFH 7R LQVXUH WKDW WKHUH ZDV QRW DQ LQWULQVLF SUREOHP ZLWK WKH WUDQVORFDWLRQ RI WKH 6 JRUGRQLL SURWHLQV WR WKH VXUIDFH RI 6 PXWDQV 6VS$ DQG 6VS% ZHUH H[SUHVVHG LQ 3& :KROH FHOO GRW EORWV ZHUH SHUIRUPHG DQG H[SUHVVLRQ ZDV WUDFHG ZLWK P$E DV LW GHPRQVWUDWHG WKH VWURQJHVW FURVVUHDFWLYLW\ ZLWK 6VS$ DQG 6VS% LQ :HVWHUQ EORWV

PAGE 55

)LJXUH GHPRQVWUDWHV WKDW ERWK 6VS$ DQG 6VS% ZHUH WUDQVORFDWHG WR WKH VXUIDFH LQ 6 PXWDQV 7KH VXUIDFH H[SUHVVLRQ RI FKLPHULF 3, FRQWDLQLQJ WKH $UHJLRQV RI 6VS$ DQG 6VS% ZDV DOVR H[DPLQHG E\ ZKROH FHOO GRW EORW 3& KDUERULQJ S'/ S0$' 3f S76 3$$f S76 3O$$6VS$ $UHJLRQf DQG S76 3O$$6VS$ $UHJLRQf ZHUH ERXQG WR QLWURFHOOXORVH PHPEUDQH XVLQJ D ZHOO GRW EORW PDQLIROG 6XUIDFH H[SUHVVLRQ RI 3, ZDV WUDFHG ZLWK P$EV $ DQG DV WKH\ DUH UHDFWLYH WR 3, RQ WKH FHOO VXUIDFH DQG ZHUH UHDFWLYH WR 6VS$ DQG 6VS% E\ :HVWHUQ LPPXQREORW )LJXUH f 1R VXUIDFH H[SUHVVLRQ RI HLWKHU FKLPHULF 3, ZDV GHWHFWHG RQ WKH VXUIDFH RI 3& 1R IXOOOHQJWK FKLPHULF 3, SURWHLQV ZHUH GHWHFWHG LQ FHOO O\VDWHV RI WUDQVIRUPHG 3& E\ :HVWHUQ EORW ZLWK &WHUPLQDO VSHFLILF DQWL3O P$EV )LJXUH XSSHU SDQHOf %UHDNGRZQ SURGXFWV RI WKH SURWHLQV ZHUH KRZHYHU GHWHFWHG ZLWK WKH $UHJLRQV VSHFLILF P$E )LJXUH ORZHU SDQHOf (YDOXDWLRQ RI WKH ,QYROYHPHQW RI 6HF% LQ WKH 6HFUHWLRQ RI 3, 3$$ DQG 3$3 LQ ( FROL ,W LV SUHVXPHG WKDW 3, LV WUDQVORFDWHG WR WKH FHOO VXUIDFH YLD WKH JHQHUDO VHFUHWRU\ SDWKZD\ DQG WKH 6HF WUDQVORFDVH >@ 7KH WZR PDMRU URXWHV WR WKH 6HF WUDQVORFDVH DUH YLD WKH FKDSHURQHV VLJQDO UHFRJQLWLRQ SDUWLFOH 653f RU 6HF% ,Q 6 PXWDQV KRZHYHU 3, LV VHFUHWHG LQ WKH DEVHQFH RI WKH 653 SDWKZD\ DQG 6 PXWDQV GRHV QRW SRVVHVV 6HF% RU D NQRZQ RUWKRORJ 7R GHWHUPLQH ZKHWKHU WKH WUDQVORFDWLRQ RI 3, LV GHSHQGHQW XSRQ 6HF% LQ ( FROL DQG SRVVLEO\ D 6HF% RUWKRORJ LQ 6 PXWDQV VHFUHWLRQ RI 3 WR WKH SHULSODVP ZDV H[DPLQHG LQ WKH ( FROL 6HF%QHJDWLYH PXWDQW &. >@ 3HULSODVPLF H[WUDFWV RI &. DQG WKH ZLOGW\SH 0& H[SUHVVLQJ 3, ZHUH SUHSDUHG E\ RVPRWLF VKRFN DQG WKH SUHVHQFH RI 3, ZDV GHWHFWHG E\ :HVWHUQ LPPXQREORWWLQJ XVLQJ P$EV ( *

PAGE 56

DQG & 7KHVH P$EV DUH VSHFLILF WR WKH FDUER[\WHUPLQXV RI 3, DQG ZHUH XVHG WR LQVXUH WKDW RQO\ IXOOOHQJWK PROHFXOHV ZHUH WUDFHG 7KHVH UHVXOWV DUH VKRZQ LQ )LJXUH $ /DQHV PDUNHG f&f FRQWDLQ FHOOXODU O\VDWHV DQG ODQHV PDUNHG f3f FRQWDLQ SHULSODVP H[WUDFWV 7KH KRVW DQG SODVPLG H[SUHVVHG LV LQGLFDWHG DERYH HDFK SDLU RI ODQHV 7KH ILUVW SDLU RI ODQHV FRQWDLQV FHOOXODU H[WUDFWV IURP 0& KDUERULQJ S'& IXOOOHQJWK 3,f DQG VKRZ WKDW 3, LV GHWHFWHG LQ ERWK WKH F\WRSODVP DQG WKH SHULSODVP 7KH FHOOXODU IUDFWLRQV RI WKH VHFRQG SDLU RI ODQHV FRQWDLQV FHOOXODU H[WUDFWV IURP WKH 6HF%n PXWDQW &. KDUERULQJ S'& DQG VKRZ WKDW OLNH LQ 0& 3, LV GHWHFWHG LQ ERWK WKH F\WRSODVP DQG WKH SHULSODVP 7KH ILQDO SDLU RI ODQHV FRUUHVSRQGV WR FHOO IUDFWLRQV IURP 0& KDUERULQJ S8&O YHFWRU RQO\f 7KH DERYH FHOO H[WUDFWV ZHUH DOVR DQDO\]HG E\ :HVWHUQ LPPXQREORWWLQJ IRU WKH F\WRSODVPLF SURWHLQ JDODFWRVLGDVH WR FRQILUP WKH LQWHJULW\ RI WKH SHULSODVP H[WUDFWLRQV )LJXUH %f 1R SJDODFWRVLGDVH ZDV GHWHFWHG LQ WKH SHULSODVPLF H[WUDFWV 7KHVH UHVXOWV VKRZ WKDW 3 WUDQVORFDWLRQ LQ ( FRW LV QRW GHSHQGHQW RQ 6HF% WKH FKDSHURQH WKDW LV FHQWUDO WR WKH JHQHUDO VHFUHWRU\ SDWKZD\ RI ( FRW ([SUHVVLRQ RI 'LVFRQWLQXRXV 3, DQG 5HFRJQLWLRQ E\ $QWL3L 0RQRFORQDO $QWLERGLHV ,W KDV EHHQ SURSRVHG WKDW SURWHLQV IUHTXHQWO\ FRQWDLQ fXQFOHDYHG LQWUDPROHFXODU FKDSHURQHOLNH IUDJPHQWVf 7KHVH IUDJPHQWV DUH EHOLHYHG WR DVVLVW LQ SURWHLQ VWDELOL]DWLRQ DQG IROGLQJ E\ ELQGLQJ WR DGMDFHQW UHJLRQV >@ ,QWUDPROHFXODU FKDSHURQHV ,0&f KDYH EHHQ LGHQWLILHG LQ D QXPEHU RI SURWHDVHV LQFOXGLQJ D SUROLQHULFK ,0& LQ WKH /LPXOXV )DFWRU & >@ LQ ZKLFK GHOHWLRQ RI WKH ,0& UHVXOWHG LQ D PDOIROGHG DQG QRQVHFUHWHG SURWHLQ &RPSOHPHQWDWLRQ RI D VHFUHWLRQ GHIHFW UHVXOWLQJ IURP DQ ,0& GHOHWLRQ KDV EHHQ GHPRQVWUDWHG LQ WKH 3VHXGRPRQDV DHUXJLQRVD HODVWDVH /DV% 0FOYHU HW DO >@

PAGE 57

VXFFHVVIXOO\ UHVFXHG VHFUHWLRQ DQG DFWLYLW\ E\ H[SUHVVLQJ WKH ,0& LQ WUDQV $GGLWLRQDOO\ QRW DOO VHFUHWHG SURWHLQV DUH WUDQVORFDWHG LQ DQ XQIROGHG FRQIRUPDWLRQ 7KH 7$7 V\VWHP LV FDSDEOH RI VHFUHWLQJ SURWHLQV WKDW DUH ILUVW IROGHG LQ WKH F\WRSODVP >@ $OWKRXJK WKH 7$7 V\VWHP KDV QRW EHHQ IRXQG LQ 6 PXWDQV LW ZDV RI LQWHUHVW WR GHWHUPLQH ZKHWKHU WKH $ RU 3 UHJLRQV SRVVHVVHG ,0& DFWLYLW\ DQG ZKHWKHU VXFK DQ LQWHUDFWLRQ ZRXOG UHVXOW LQ WKH WUDQVORFDWLRQ RI D QRQOLQHDU RU IROGHG 3, 7R H[DPLQH WKLV D VSD3 JHQH HQJLQHHUHG WR H[SUHVV 3, DV WZR SHSWLGHV DD DQG DD VHH )LJXUH f ZDV FRQVWUXFWHG E\ 3&5 DQG FORQHG LQWR S&5 FUHDWLQJ S76 DV GHWDLOHG LQ 0HWKRGV DQG 0DWHULDOV 7KH SUHGLFWHG PROHFXODU ZHLJKWV RI WKH 3, IUDJPHQWV DUH N' IRU WKH UHVLGXH 1WHUPLQDO IUDJPHQW DQG N' IRU WKH UHVLGXH &WHUPLQDO IUDJPHQW &HOO O\VDWHV RI ( FROL KDUERULQJ S76 ZHUH H[DPLQHG E\ :HVWHUQ EORWWLQJ XWLOL]LQJ DQWL3O P$EV $ DQG ( )LJXUH f 0$E LV VSHFLILF WR WKH $UHJLRQ RI 3, >@ UHDFWLYLW\ RI 0$E $ KDV EHHQ VKRZQ WR EH GHSHQGHQW XSRQ WKH VLPXOWDQHRXV SUHVHQFH RI ERWK WKH $ DQG 3UHJLRQV DQG 0$E ( LV VSHFLILF WR WKH &WHUPLQDO HQG RI 3, >@ ,Q ODQH $ 0$E LV VKRZQ WR EH UHDFWLYH ZLWK EDQGV PLJUDWLQJ EHWZHHQ DSSUR[LPDWHO\ DQG N' ,Q ODQH % 0$E $ UHDFWV ZLWK D EDQG WKDW FRUUHVSRQGV WR WKH PROHFXODU ZHLJKW RI WKH &WHUPLQDO IUDJPHQW DW N' 7KH ELQGLQJ RI P$E $ VXJJHVWV WKDW HQRXJK 1WHUPLQDO IUDJPHQWV FRPLJUDWH ZLWK WKH N' &WHUPLQDO IUDJPHQW WR UHVWRUH HSLWRSH UHFRJQLWLRQ E\ WKLV DQWLERG\ ,Q ODQH P$E ( DOVR UHDFWV ZLWK D N' EDQG 7KH UHDFWLYLW\ RI DOO WKUHH P$EV LQGLFDWHV WKDW ERWK WKH 1WHUPLQDO DQG &WHUPLQDO 3, IUDJPHQWV DUH H[SUHVVHG DQG GHWHFWDEOH LQ ( FROL

PAGE 58

(YDOXDWLRQ RI 6XUIDFH ([SUHVVLRQ RI 'LVFRQWLQXRXV 3, LQ 6 PXWDQV 7KH VSD3 PXWDQW 3& ZDV XVHG DV WKH KRVW IRU SODVPLGV S0$' DQG S76 HQFRGLQJ IXOOOHQJWK 3, DQG GLVFRQWLQXRXV 3, UHVSHFWLYHO\ :KROH FHOO GRW EORW DQDO\VLV ZDV XVHG WR H[DPLQH ZKHWKHU DQ LQWHUDFWLRQ RI WKH $ DQG 3UHJLRQV ZKHQ H[SUHVVHG LQ WUDQV FRXOG UHVXOW LQ WUDQVORFDWLRQ RI WKH IUDJPHQWV WR WKH FHOO VXUIDFH 7KHVH UHVXOWV DUH VKRZQ LQ )LJXUH 7KH SRVLWLYH FRQWUROV 6 PXWDQV 1* ZLOGW\SHf DQG 3&& H[SUHVVLQJ IXOOOHQJWK 3, FROXPQV $ DQG &f GHPRQVWUDWH WKH UHDFWLYLW\ RI WKH P$EV ZLWK VXUIDFH H[SUHVVHG 3, 0$E KDV SUHYLRXVO\ EHHQ VKRZQ WR EH XQUHDFWLYH ZLWK IXOO OHQJWK 3, RQ WKH FHOO VXUIDFH 7KH QHJDWLYH FRQWURO 3&$ KDUERULQJ WKH YHFWRU RQO\ FROXPQ %f VKRZHG ODFN RI UHDFWLYLW\ RI WKH P$EV ZLWK FHOOV ODFNLQJ 3 3& KDUERULQJ S76 HQFRGLQJ WKH 3, IUDJPHQWV FROXPQ 'f ZDV QRW UHDFWLYH ZLWK WKH P$EV LQGLFDWLQJ D ODFN RI VXUIDFH H[SUHVVLRQ RI WKH 3, IUDJPHQWV 7KHVH UHVXOWV LQGLFDWHG WKDW 3, IUDJPHQWV ZHUH QRW DQFKRUHG WR WKH VXUIDFH RI 3& 7KH 1WHUPLQDO IUDJPHQW ZDV KRZHYHU GHWHFWHG LQ VSHQW FXOWXUH OLTXRU ZLWK 0$E GDWD QRW VKRZQf 7R GHWHUPLQH LI WKH 3, IUDJPHQWV ZHUH GHWHFWDEOH LQ 6 PXWDQV FHOO O\VDWHV 3& KDUERULQJ S76 ZDV VXEMHFWHG WR PHFKDQLFDO O\VLV LQ D 0LQL %HDGEHDWHU DSSDUDWXV DQG VDPSOHV ZHUH DQDO\]HG E\ :HVWHUQ LPPXQREORWWLQJ GDWD QRW VKRZQf :KLOH ERWK WKH EOn DQG &WHUPLQDO IUDJPHQWV ZHUH GHWHFWHG LQ ( FROL RQO\ WKH 1WHUPLQDO IUDJPHQW ZDV SUHVHQW LQ WKH 6 PXWDQV FHOO H[WUDFWV LQGLFDWLQJ WKDW WKH &WHUPLQDO IUDJPHQW ZDV XQVWDEOH LQ 6 PXWDQV 6XUIDFH ([SUHVVLRQ RI 3, LQ D 5RS$'HILFLHQW $ PXWDQV DQG %DFWHULDO $GKHUHQFH WR 6DOLYDU\ $JJOXWLQLQ 7KH ILUVW FKDSHURQH HQFRXQWHUHG E\ QDVFHQW SRO\SHSWLGHV LV EHOLHYHG WR EH WKH SRO\SURO\O LVRPHUDVH 33,DVHf 5RS$ RU WULJJHU IDFWRU 7ULJJHU IDFWRU LV LQYROYHG LQ

PAGE 59

SURWHLQ VHFUHWLRQ DQG PDWXUDWLRQ 7KH LQYROYHPHQW RI 5RS$ LQ WKH H[SUHVVLRQ RI IXQFWLRQDO 3, ZDV DQDO\]HG XVLQJ DQ DGKHUHQFH DVVD\ 3, PHGLDWHV ELQGLQJ WR VDOLYDU\ DJJOXWLQLQ DQG WKH ELQGLQJ FDQ EH LQKLELWHG E\ WKH 3,VSHFLILF PRQRFORQDO DQWLERG\ P$Ef $ EXW QRW E\ WKH 3OVSHFLILF P$E $ >@ $GKHUHQFH RI6 PXWDQV 7: D 5RS$GHILFLHQW PXWDQW >@ WR KXPDQ VDOLYDU\ DJJOXWLQLQ LPPRELOL]HG RQ DQ ), VHQVRU FKLS ZDV DVVD\HG XVLQJ WKH %,$FRUH %O$FRUH $% 8SSVDOD 6ZHGHQf E\ 0RQLND 2OL E\ WKH PHWKRG GHVFULEHG LQ >@ %ULHIO\ DJJOXWLQLQ ZDV LPPRELOL]HG RQ WKH %,$FRUH ), VHQVRU FKLS VXUIDFH DQG VXVSHQVLRQV RI 6 PXWDQV 8$ ZLOGW\SHf DQG 7: $URS$f LQ DGKHUHQFH EXIIHU ZHUH LQMHFWHG RQWR WKH VHQVRU FKLS $ VXEVWDQWLDO UHGXFWLRQ LQ DGKHUHQFH bf LQ WKUHH VHSDUDWH DVVD\V ZDV REVHUYHG IRU WKH 5RS$ GHILFLHQW FHOOV %UDG\ ODERUDWRU\ XQSXEOLVKHGf 7KH FRPSOHWH LQKLELWLRQ RI DGKHUHQFH RI ERWK 8$ DQG 7: E\ WKH DGGLWLRQ RI DQWL3O P$E $ LQGLFDWHG WKDW WKH UHVLGXDO DGKHUHQFH ZDV 3, PHGLDWHG %UDG\ ODERUDWRU\ XQSXEOLVKHGf ,Q OLJKW RI WKH ODERUDWRU\fV ILQGLQJV WKDW WKH IXQFWLRQ RI 3, DSSHDUHG WR EH DOWHUHG LQ D UR[QHJDWLYH VWUDLQ ZKROH FHOO GRW EORWV RI 7: ZHUH XVHG WR GHWHUPLQH ZKHWKHU WKH UHGXFWLRQ LQ DGKHUHQFH ZDV GXH WR D UHGXFHG OHYHO RI VXUIDFH ORFDOL]HG 3, LQ WKH URS$ QHJDWLYH EDFNJURXQG &HOOV ZHUH JURZQ WR HDUO\ORJ DQG VWDWLRQDU\ SKDVHV DQG VDPSOHV ZHUH VWDQGDUGL]HG IRU FHOO QXPEHU E\ DEVRUEDQFH PHDVXUHPHQWV 5HSOLFDWH EORWV ZHUH UHDFWHG ZLWK P$EV ' $ $ ( ) ( % RU & 4XDQWLILFDWLRQ RI 3, VXUIDFH H[SUHVVLRQ ZDV SHUIRUPHG E\ GHQVLWRPHWU\ XVLQJ D )OXRUFKHP LPDJHU DQG VRIWZDUH $OSKD ,QQRWHFK 6DQ /HDQGUR &Df 7KH P$E $ UHVXOWV VKRZQ LQ )LJXUH DUH UHSUHVHQWDWLYH RI DOO GDWD 7KHUH ZHUH QR GLIIHUHQFHV GHWHFWHG LQ WKH VXUIDFH H[SUHVVLRQ RI 3, EHWZHHQ ZLOGW\SH 8$ DQG 7:

PAGE 60

$QDO\VLV RI 3, 6XUIDFH ([SUHVVLRQ LQ DQ $ LPLWDQV 0XWDQW ([SUHVVLQJ /RZ/HYHOV RI 'QD. 7KH URXWH RI 3, WUDQVORFDWLRQ WR WKH FHOO VXUIDFH DQG WKH FKDSHURQHV LQYROYHG DUH XQNQRZQ 3, LV VHFUHWHG LQ WKH DEVHQFH RI WKH FKDSHURQHV 653 6HF% DQG 5RS$ DOWKRXJK 5RS$ DSSHDUV WR DIIHFW 3, IXQFWLRQ 'QD. ELQGV WR SUROLQHULFK SURWHLQV >@ DQG LV LQYROYHG LQ FKDSHURQLQJ D ZLGH YDULHW\ RI SURWHLQV 'QD. DOVR KDV D SRRO RI VXEVWUDWHV WKDW RYHUODSV ZLWK 5RS$ >@ 7KH FRQWULEXWLRQ RI 'QD. WR 3, VXUIDFH H[SUHVVLRQ ZDV H[DPLQHG E\ ZKROH FHOO GRW EORW DV ZDV SHUIRUPHG ZLWK WKH 5RS$ PXWDQW 7KH H[SHULPHQW ZDV SHUIRUPHG XVLQJ 6 PXWDQV 60, ZKLFK ZDV HQJLQHHUHG WR H[SUHVV DSSUR[LPDWHO\ b RI WKH OHYHO RI 'QD. DV WKH SDUHQW VWUDLQ 8$ /HPRV DQG %XPH LQ SUHSDUDWLRQ 8QLYHUVLW\ RI )ORULGD *DLQHVYLOOH )/f 6 PXWDQV 8$ DQG 60 ZHUH JURZQ DQG KDUYHVWHG DW HDUO\ORJ DQG VWDWLRQDU\ SKDVHV VDPSOHV ZHUH VWDQGDUGL]HG IRU FHOO QXPEHU E\ DEVRUEDQFH PHDVXUHPHQWV DQG VXUIDFH H[SUHVVLRQ ZDV GHWHUPLQHG DV SUHYLRXVO\ GHWDLOHG )LJXUH VKRZV WKDW WKHUH LV D VLJQLILFDQW UHGXFWLRQ LQ WKH DPRXQW RI VXUIDFH H[SUHVVHG 3, DW HDUO\ORJ JURZWK LQ 60 3f EXW 3, OHYHOV ZHUH HTXDO LQ ERWK VWUDLQV DW VWDWLRQDU\ SKDVH GDWD QRW VKRZQf (YDOXDWLRQ RI GQD. P51$ ([SUHVVLRQ LQ 6 PXWDQV 3& +DUERULQJ S'/ S0$-S0$' DQG S76 7KH UHGXFWLRQ RI 3, VXUIDFH H[SUHVVLRQ VHHQ LQ WKH HDUO\ORJ SKDVH RI 60, VXJJHVWHG WKDW 'QD. PLJKW KDYH D UROH LQ 3, WUDQVORFDWLRQ &KDQJHV LQ GQD. P51$ OHYHOV LQ UHVSRQVH WR WKH H[SUHVVLRQ RI 3, DQG 3, GHOHWLRQ FRQVWUXFWV LQ 6 PXWDQV FRXOG LQGLFDWH DQ LQWHUDFWLRQ EHWZHHQ WKH FKDSHURQH DQG WKH 3, SURWHLQV 7R WKLV HQG TXDQWLWDWLYH 5HDO7LPH 3&5 ZDV XWLOL]HG WR PHDVXUH OHYHOV RI GQD. P51$ H[SUHVVLRQ 'QD. PHVVDJH ZDV TXDQWLILHG IURP WRWDO 51$ LVRODWHG IURP HDUO\ORJ SKDVH FXOWXUHV RI 3& KDUERULQJ S'/ VKXWWOH YHFWRUf S0$-3O$3UHJLRQf DQG S0$' 3,f

PAGE 61

DQG S76 3, $$UHJLRQf &RPSDUHG WR WKH YHFWRU RQO\ FRQWURO RU 3& FRPSOHPHQWHG ZLWK IXOOOHQJWK 3, WKH OHYHO RI GQD. PHVVDJH ZDV VLJQLILFDQWO\ GHFUHDVHG 3 DQG 32 UHVSHFWLYHO\f LQ WKH SUHVHQFH RI 3, $3 DQG LQFUHDVHG 3 DQG 32 UHVSHFWLYHO\fLQ WKH SUHVHQFH RI 3, $$ )LJXUH f 7KH P51$ OHYHOV RI 6 51$ ZHUH XVHG DV DQ LQWHUQDO FRQWURO DQG QR VLJQLILFDQW GLIIHUHQFH ZDV IRXQG EHWZHHQ VDPSOHV 3f

PAGE 62

4 P 4 2n 4 rQ 8m 82 &4 8 \R UQ RR P RR f§ m2 1 &r! 9& 3L 3$$ N' N' )LJXUH :HVWHUQ EORW DQDO\VLV RI 3, DQG UHFRPELQDQW 3, ODFNLQJ WKH $UHJLRQ 3, $$f 7KH UHDFWLYLW\ RI HOHYHQ DQWL3O P$EV DJDLQVW ZKROH FHOO O\VDWHV RI ( FROL KDUERULQJ S'& 3,f RU S76 3, $$f ZHUH DQDO\]HG E\ :HVWHUQ EORW WR GHWHUPLQH WKH HIIHFW RI WKH $UHJLRQ GHOHWLRQ RQ DQWLJHQLFLW\ 7KH P$EV XVHG DUH OLVWHG DERYH HDFK VWULS 7KH HSLWRSH RI P$E LV ZLWKLQ WKH $UHJLRQ KRZHYHU P$E GRHV QRW ELQG WR IXOOOHQJWK 3, 7KH UHDFWLYLW\ RI P$EV $ $ DQG ( DUH GHSHQGHQW XSRQ WKH 3UHJLRQ 7KH UHDFWLYLW\ RI P$EV ( % DQG & DUH GHSHQGHQW XSRQ WKH & WHUPLQDO WHUPLQDO WKLUG RI 3,

PAGE 63

3& 3& YHFWRU 3& 3$$ 3& 3 )LJXUH /DFN RI VXUIDFH H[SUHVVLRQ RI 3, GHYRLG RI WKH $UHJLRQ :KROH FHOO GRW EORWV RI 6 PXWDQV VSD3 LVRJHQLF PXWDQW 3& 3& KDUERULQJ VKXWWOH YHFWRU S'/ DORQH DQG 3& KDUERULQJ WKH S'/ FRQVWUXFW HQFRGLQJ 3, $$ RU IXOOOHQJWK 3, %ORWV ZHUH UHDFWHG ZLWK DQWL3O P$EV ) DQG 2( 7KHVH DQWLERGLHV KDG EHHQ VKRZQ LQ SUHYLRXV H[SHULPHQWV WR UHDFW ZLWK UHFRPELQDQW 3$$ ,GHQWLFDO UHVXOWV ZHUH REWDLQHG XVLQJ D SRO\FORQDO DQWL3O UDEELW DQWLVHUXP GDWD QRW VKRZQf f f f f f f K 8L 0 f§ -L : -8, f§ : 6f 1 LWL 92 92 FJ k &)8ZHOO

PAGE 64

3& 3& YHFWRU 3& 3 3& 3$$ JJZHOO )LJXUH 51$ GRW EORW DQDO\VLV RI LUD3VSHFLILF P51$ OHYHOV LQ WKH 6 PXWDQV VSD3 QHJDWLYH PXWDQW 3& DQG GHULYDWLYHV 7ZRIROG VHULDO GLOXWLRQV RI WRWDO FHOOXODU 51$ EHJLQQLQJ ZLWK PJ ZHUH SUREHG ZLWK '1$ HQFRGLQJ WKH & WHUPLQXV RI VSD3 )URP WRS WR ERWWRP WKH URZV FRQWDLQ P51$ IURP 3& 3&$ YHFWRU RQO\f 3&& IXOOOHQJWK VSD3f DQG 3& KDUERULQJ S76 VSD3 ZLWK $UHJLRQ HQFRGLQJ '1$ GHOHWHGf UHVSHFWLYHO\

PAGE 65

)LJXUH :HVWHUQ LPPXQREORW RI F\WRSODVP &f DQG SHULSODVP 3f IUDFWLRQV RI ( FRW '+D KDUERULQJ S8& GHULYHG SODVPLGV H[SUHVVLQJ IXOOOHQJWK 3, S'&f 3$3 S'&f 3$$ S76f DQG YHFWRU DORQH GHWHFWHG ZLWK &WHUPLQXV VSHFLILF P$EV ( & DQG 0LJUDWLRQ RI PROHFXODU ZHLJKW VWDQGDUGV DUH LQGLFDWHG LQ NLORGDOWRQV

PAGE 66

)LJXUH 'HPRQVWUDWLRQ RI $UHJLRQ DQG 3UHJLRQ LQWHUDFWLRQ E\ (/,6$ QJ RI 3 UHJLRQPDOWRVH ELQGLQJ SURWHLQ 0%3f IXVLRQ SRO\SHSWLGH ‘f RU 0%3 DORQH $f ZHUH XVHG WR FRDW (/,6$ SODWH ZHOOV 7ZRIROG VHULDO GLOXWLRQV RI SXULILHG $UHJLRQ0%3 IXVLRQ SRO\SHSWLGH VWDUWLQJ DW QJZHOO ZHUH DGGHG WR WKH FRDWHG ZHOOV DQG ELQGLQJ RI WKH $UHJLRQ WR WKH 3UHJLRQ RU WR WKH 0%3 QHJDWLYH FRQWURO ZDV GHWHFWHG ZLWK WKH $UHJLRQ VSHFLILF 0$E '

PAGE 67

$ )LJXUH 5HVWRUDWLRQ RI HSLWRSHV E\ $ DQG 3UHJLRQ LQWHUDFWLRQV DV PHDVXUHG E\ (/,6$ QJ RI 3UHJLRQ0%3 IXVLRQ SRO\SHSWLGH $UHJLRQ0%3 RU 0%3 ZHUH XVHG WR FRDW (/,6$ SODWH ZHOOV 7ZRIROG VHULDO GLOXWLRQV RI SXULILHG $ UHJLRQ0%3 VWDUWLQJ DW QJZHOO ZHUH DGGHG WR WKH 3UHJLRQ DQG 0%3 FRDWHG ZHOOV DQG YLFH YHUVD 0$EV $ DQG $ ZHUH WHVWHG IRU UHDFWLYLW\ 3DQHO WLWOHV LQGLFDWH WKH P$E WHVWHG DQG WKH OHJHQGV LQGLFDWH WKH 3 IUDJPHQW WKDW ZDV LPPRELOL]HG $ DQG 3UHJLRQV GLG QRW LQWHUDFW ZLWK 0%3 DORQH DQG QR P$E ELQGLQJ ZDV GHWHFWHG ZLWK WKH FRQWUROV GDWD QRW VKRZQf

PAGE 68

)LJXUH ,QKLELWLRQ RI DQWL3O 0$E $ ELQGLQJ WR LPPRELOL]HG 3, LQ (/,6$ 7R GHWHUPLQH ZKHWKHU WKH $ DQG 3UHJLRQ SRO\SHSWLGHV FRXOG LQWHUDFW LQ VROXWLRQ DQG SURGXFH DQ HSLWRSH UHFRJQL]HG E\ P$E $ WKH DQWLERG\ ZDV PL[HG ZLWK VROXEOH 3, JOXWDWKLRQH 6WUDQVIHUDVH *67f $UHJLRQ*67 3UHJLRQ *67 RU D PRODU PL[WXUH RI $UHJLRQ*67 DQG 3UHJLRQ*67 SRO\SHSWLGHV 7KH P$E $ PL[WXUHV ZHUH DSSOLHG WR 3, LPPRELOL]HG WR DQ (/,6$ SODWH DQG LQKLELWLRQ RI ELQGLQJ WR WKH LPPRELOL]HG 3, ZDV PHDVXUHG %DUV LQGLFDWH SHUFHQW LQKLELWLRQ

PAGE 69

r ‘T R R RL $ 5 0RODU )UDFWLRQ )LJXUH 6WRLFKLRPHWU\ RI WKH P$E $ HSLWRSH 9DU\LQJ PRODU UDWLRV RI 3, $DQG 3UHJLRQ SRO\SHSWLGHV ZLWK D FRQVWDQW WRWDO FRQFHQWUDWLRQ RI SPROHV ZHUH LPPRELOL]HG LQ (/,6$ SODWH ZHOOV DQG HSLWRSH UHVWRUDWLRQ ZDV GHWHFWHG ZLWK P$E $ 7KH H[SHULPHQW ZDV SHUIRUPHG LQ WULSOLFDWH DQG VWDQGDUG GHYLDWLRQ LV UHSUHVHQWHG E\ WKH HUURU EDUV

PAGE 70

)LJXUH 'HPRQVWUDWLRQ RI VLPLODU OHYHO RI P$E UHDFWLYLW\ WR $UHJLRQ*67 IXVLRQ SRO\SHSWLGHV RI 6VS$ 6VS% DQG 3, E\ :HVWHUQ LPPXQREORW

PAGE 71

3 3UHJcRQ 6VS% 3UHJcRQ QJZHOO )LJXUH 'HPRQVWUDWLRQ RI LQWHUDFWLRQV EHWZHHQ WKH $ DQG 3UHJLRQV RI GLIIHUHQW DQWLJHQ ,,, SURWHLQV 3DQHO WLWOHV LQGLFDWH WKH VRXUFH RI WKH LPPRELOL]HG 3 UHJLRQV %LQGLQJ RI WKH GLIIHUHQW $UHJLRQV LGHQWLILHG LQ WKH OHJHQGV ZHUH WUDFHG ZLWK WKH FURVVUHDFWLYH $UHJLRQ VSHFLILF P$E /HJHQGV LGHQWLI\ WKH RYHUODLG SRO\SHSWLGHV

PAGE 72

2 R 4 Z L L PX X IH66 UQ P H $ L W  f r : ‘ ‘ m‘rrr n )LJXUH (YDOXDWLRQ RI UHDFWLYLW\ RI $ DQG 3UHJLRQ GHSHQGHQW DQWL3O P$EV ZLWK 3, 6VS$ DQG 6VS% :KROH FHOO O\VDWHV RI ( FROL '+D KDUERULQJ S'& 3,f S''$ 6VS$f DQG S(% 6VS%f ZHUH HOHFWURSKRUHVHG RQ b 6'6 SRO\DFU\ODPLGH JHOV WUDQVIHUUHG WR QLWURFHOOXORVH DQG SUREHG ZLWK WKH DQWL3O P$EV VKRZQ DERYH 7KH LQGLFDWHG PROHFXODU ZHLJKWV DUH LQ NLORGDOWRQV

PAGE 73

6VS$ 3UHJLRQ 2$ 6VS$ 3UHJLRQ 6VS$ 3UHJLRQ $ )LJXUH 5HVWRUDWLRQ RI HSLWRSHV E\ WKH LQWHUDFWLRQ RI YDULRXV DQWLJHQ $UHJLRQV ZLWK WKH LPPRELOL]HG 3UHJLRQ RI 6VS$ 3DQHO WLWOHV LQGLFDWH WKH VRXUFH RI LPPRELOL]HG 3UHJLRQ DQG WKH P$E WHVWHG /HJHQG LQGLFDWHV WKH VRXUFH RI WKH RYHUODLG $UHJLRQV

PAGE 74

6VS% 3UHJLRQ 2$ 6VS% 3UHJLRQ QJZHOO )LJXUH 5HVWRUDWLRQ RI HSLWRSHV E\ WKH LQWHUDFWLRQ RI YDULRXV DQWLJHQ ,,, $UHJLRQV ZLWK WKH LPPRELOL]HG 3UHJLRQ RI 6VS$ 3DQHO WLWOHV LQGLFDWH WKH VRXUFH RI LPPRELOL]HG 3UHJLRQ DQG WKH P$K WHVWHG /HJHQG LQGLFDWHV WKH VRXUFH RI WKH RYHUODLG $UHJLRQV

PAGE 75

3 3UHJcRQ $ 3 3UHJLRQ QJZHOO )LJXUH 5HVWRUDWLRQ RI HSLWRSHV E\ WKH LQWHUDFWLRQ RI YDULRXV DQWLJHQ ,,, $UHJLRQV ZLWK WKH LPPRELOL]HG 3UHJLRQ RI 6VS$ 3DQHO WLWOHV LQGLFDWH WKH VRXUFH RI LPPRELOL]HG 3UHJLRQ DQG WKH P$E WHVWHG /HJHQG LQGLFDWHV WKH VRXUFH RI WKH RYHUODLG $UHJLRQV

PAGE 76

6VS$ $UHJLRQ 2$ i f§6VS$ 3UHJLRQ 2 6VS% 3UHJLRQ W 3L 3UHJORQ 6VS$ $UHJLRQ 6VS$ 3UHJLRQ 2f§ 6VS% 3UHJLRQ f§7f§ 3 3UHJORQ 6VS$ $UHJLRQ $ 2 6VS$ 3UHJLRQ 6VS% 3UHJLRQ 3 3UHJLRQ RR 77"7""W7 QJZHOO )LJXUH 5HVWRUDWLRQ RI HSLWRSHV E\ WKH LQWHUDFWLRQ RI YDULRXV DQWLJHQ ,,, $UHJLRQV ZLWK WKH LPPRELOL]HG $UHJLRQ RI 6VS$ 3DQHO WLWOHV LQGLFDWH WKH VRXUFH RI LPPRELOL]HG 3UHJLRQ DQG WKH P$E WHVWHG /HJHQG LQGLFDWHV WKH VRXUFH RI WKH RYHUODLG 3UHJLRQV

PAGE 77

6VS% $UHJLRQ 2$ f§ff§ 6VS$ 3UHJLRQ 2 6VS% 3UHJORQ f§7f§ 3 3UHJORQ 6VS% $UHJLRQ f§6VS$ 3UHJORQ 2 6VS% 3UHJLRQ 3 3UHJLRQ 6VS% $UHJLRQ $ 6VS$ 3UHJORQ 2 6VS% 3UHJLRQ V R L QJZHOO )LJXUH 5HVWRUDWLRQ RI HSLWRSHV E\ WKH LQWHUDFWLRQ RI YDULRXV DQWLJHQ ,,, $UHJLRQV ZLWK WKH LPPRELOL]HG $UHJLRQ RI 6VS$ 3DQHO WLWOHV LQGLFDWH WKH VRXUFH RI LPPRELOL]HG 3UHJLRQ DQG WKH P$E WHVWHG /HJHQG LQGLFDWHV WKH VRXUFH RI WKH RYHUODLG 3UHJLRQV

PAGE 78

QJZHOO )LJXUH 5HVWRUDWLRQ RI HSLWRSHV E\ WKH LQWHUDFWLRQ RI YDULRXV DQWLJHQ ,,, $UHJLRQV ZLWK WKH LPPRELOL]HG $UHJLRQ RI 6VS$ 3DQHO WLWOHV LQGLFDWH WKH VRXUFH RI LPPRELOL]HG 3UHJLRQ DQG WKH P$E WHVWHG /HJHQG LQGLFDWHV WKH VRXUFH RI WKH RYHUODLG 3UHJLRQV

PAGE 79

3, 6VS$ 6VS% 3, 6VS$ 6VS% +A ./6$ Y8IW A 5 9A$ 1 $A $ .A$ 9 (A$A (A1 7 $ 1 >H,DA.A 3, $I“aa‹_(>O 5.51$7$. $_(_< ( 7_N>O_D_4 < 4 $ I />N 5M9 4_H>D Q_D $_1 ( $ 9 4 $ /_ 6VS$ >HQHD LNTUQDWDNDQ\GDDPNT\HDGODD L NN D>BN-H G 1'$'94$./ 6VS% _H 1 ( $ 4 5 1>HW $ $ 7 9 ( $ $ 0 4 9 ( $ 3 / $ $ . $ 1 ( 1 $ < 4 $ /_ 12 ; 3, ,WD\TWHODUYTNDQDGDNDD\ H_D-DY@ D D-Q Q D N Q D Dn /@BW-D ( 1>W-D 4 LW@ 6VS$ $ $ < 4 $ ( / $ 5 < 4 $ 1 $ $ $ $ < ( $ 9 ( >( 1 7 $ 1 7 $ 4 $ ( 1 ( $ .45 6VS% >DD<47(/$594.$1$($ .IO7, $ < 3 $ Y_N_ ( 1 7 $ 1 7 $ 4 $ ( 1 ( $ 4 U_  6VS$ ,Q >D-$ $ D 7 < ( D $ / 4 < ( $ / $ $ 9 . $ 1_( 6 > ( $ '<47./ D>_@\ 4 7 ( / $ 6VS% >1(7 $ N $ 7 < $ $ 9 N 9 ( $ / $ $ 9 LM $ 1 $ ,1 ($'94$./$$947(, $> 3, 6VS$ 6VS% 594.$1$3$.$$9 (_$Iƒa9O$ D_QQ>D@D_1 $ $ O> 7>$ ( 1>7 D_ ..51$ 594.$1$'$.$$<(.$9('1.$.1$$/4$(1 (( .451$ 9 4 $ 1 $ $ $ 7 < ( $ 9 ( 1 $ 1 $ $ .$(1(( .451$ $ $ ? $ 7 9 $ 7 9 3, 6VS$ 6VS% 4$'/$.<4, >HDNODN\HDG OD .<. ._ > _HDNODN\HDSODN\NNH_I )LJXUH &/867$/ : DOLJQPHQW RI WKH $UHJLRQV RI 3, 6VS$ DQG 6VS% 'DUN JUH\ VKDGLQJ LQGLFDWHV LGHQWLW\ /LJKW JUH\ VKDGLQJ LQGLFDWHV VLPLODULW\

PAGE 80

' )LJXUH :HVWHUQ LUDPXQREORW RI FKLPHULF 3, FRQWDLQLQJ WKH $UHJLRQV RI 6VS$ DQG 6VS% :KROH FHOO O\VDWHV RI ( FROL '+D KDUERULQJ SODVPLGV HQFRGLQJ 3, FRQWDLQLQJ ZLWK WKH $UHJLRQV RI 6VS$ DQG 6VS% /DQHV FRQWDLQ 3, f 3$$ f 3$$ $UHJLRQ RI 6VS$ f 3$$ $UHJLRQ RI 6VS% f 3DQHO $ ZDV UHDFWHG ZLWK WKH $UHJLRQ VSHFLILF P$E 3DQHO % ZDV UHDFWHG ZLWK WKH $ DQG 3UHJLRQ GHSHQGHQW P$E '

PAGE 81

9HFWRU 3, 6VS$ 6VS% )LJXUH 6XUIDFH H[SUHVVLRQ RI JRUGRQLL 6VS$ DQG 6VS% LQ 6 PXWDQV 3& :KROH FHOO GRW EORW RI 3,GHILFLHQW 6 PXWDQV 3& FRPSOHPHQWHG ZLWK SODVPLGHQFRGHG 3, 6VS$ DQG 6VS% 6XUIDFH H[SUHVVLRQ ZDV WUDFHG ZLWK P$E k n )LJXUH 'HPRQVWUDWLRQ RI ODFN RI DELOLW\ RI KHWHURORJRXV $UHJLRQV WR UHVWRUH VXUIDFH H[SUHVVLRQ RI 3$$ LQ 3& :KROH FHOO GRW EORW RI 3& KDUERULQJ YHFWRU DORQH f DQG SODVPLGV H[SUHVVLQJ 3, f 3, $$ f DQG 3, FRQWDLQLQJ WKH $UHJLRQV RI 6VS$ f DQG 6VS% f 6XUIDFH H[SUHVVLRQ RI 3, ZDV GHWHFWHG ZLWK P$E '

PAGE 82

$ % & ( )LJXUH :HVWHUQ LUDPXQREORWV RI FHOO O\VDWHV RI 3& KDUERULQJ YHFWRU DORQH $f DQG SODVPLGV HQFRGLQJ 3, %f 3$$ &f 3$$ 6VS$ $UHJLRQ 'f DQG 3, $$ 6VS% $UHJLRQ 3, ZDV GHWHFWHG ZLWK &WHUPLQDOV VSHFLILF P$EV XSSHU SDQHOf DQG $UHJLRQ VSHFLILF P$E ORZHU SDQHOf

PAGE 83

$ S'& S'& S8& % S'& S'& 0& &. &. 0& &. & 3 & 3 & 3 & 3 & 3 PX )LJXUH :HVWHUQ LPPXQREORW RI F\WRSODVP &f DQG SHULSODVP 3f IUDFWLRQV RI ( FROL 0& ZLOGW\SHf DQG &. $VHF%f KDUERULQJ S'& 3,f 3, ZDV WUDFHG ZLWK P$EV ( DQG & LQ SDQHO $ ,Q SDQHO % S JDODFWRVLGDVH ZDV WUDFHG ZLWK D UDEELW SRO\FORQDO DQWLERG\ 0LJUDWLRQ RI PROHFXODU ZHLJKW VWDQGDUGV DUH LQGLFDWHG LQ NLORGDOWRQV

PAGE 84

$5HJLRQ DD f DD 35HJLRQ DD f DD )LJXUH 6FKHPDWLF UHSUHVHQWDWLRQ RI GLVFRQWLQXRXV 3, %ODFN DUURZ UHSUHVHQWV WKH VSD3 SURPRWHU 1WHUPLQDO RSHQ UHDGLQJ IUDPH 25)f H[SUHVVHV UHVLGXHV LQFOXGLQJ WKH $UHJLRQ VKDGHGf &WHUPLQDO 25) H[SUHVVHV UHVLGXHV ZKLFK LQFOXGHV WKH 3UHJLRQ VKDGHGf )LJXUH :HVWHUQ LPPXQREORW RI 3, IUDJPHQWV H[SUHVVHG IURP S76 LQ ( FROL DQG WUDFHG ZLWK P$EV $f $ %f DQG ( &f 0LJUDWLRQ RI PROHFXODU ZHLJKW VWDQGDUGV DUH LQGLFDWHG LQ NLORGDOWRQV

PAGE 85

$ % & ' P ' e $ ( )LJXUH :KROH FHOO GRW EORW RI 6 PXWDQV 1* $f DQG 3& KDUERULQJ S'/ YHFWRU FRQWURO %f S0$' HQFRGLQJ 3, &f DQG S76 HQFRGLQJ GLVFRQWLQXRXV 3, IUDJPHQWV 'f 6XUIDFH H[SUHVVLRQ RI 3 SRO\SHSWLGHV ZDV WUDFHG ZLWK WKH LQGLFDWHG DQWL3O P$EV

PAGE 86

)LJXUH 3, VXUIDFH H[SUHVVLRQ OHYHOV RI6 PXWDQV 8$ DQG 7: URS$ PXWDQWf DW HDUO\ ORJ VWDJH WUDFHG ZLWK P$E $ DV PHDVXUHG E\ GHQVLWRPHWU\

PAGE 87

' t )LJXUH 3, VXUIDFH H[SUHVVLRQ OHYHOV RI 6 PXWDQV 8$ DQG 60 'QD.GHILFLHQWf DW HDUO\ ORJ SKDVH WUDFHG ZLWK P$E $ DV PHDVXUHG E\ GHQVLWRPHWU\ 1R GLIIHUHQFH ZDV GHWHFWHG DW VWDWLRQDU\ SKDVH >Q @r VWDWLVWLFDOO\ VLJQLILFDQW 3 6LJQLILFDQFH ZDV GHWHUPLQHG E\ VWXGHQWnV WWHVWf

PAGE 88

)LJXUH 5HDO7LPH 3&5 TXDQWLILFDWLRQ RI GQD. P51$ IURP 6 PXWDQV 3& KDUERULQJ WKH S'/ YHFWRU DORQH DQG H[SUHVVLQJ 3, $3UHJLRQ IXOOOHQJWK 3, DQG 3, $$UHJLRQ >Q @r VWDWLVWLFDOO\ VLJQLILFDQW FRPSDUHG WR YHFWRU 3 rr VWDWLVWLFDOO\ VLJQLILFDQW FRPSDUHG WR 3, 32 6LJQLILFDQFH ZDV GHWHUPLQHG E\ VWXGHQWfV WWHVWf

PAGE 89

&+$37(5 ',6&866,21 $1' &21&/86,216 'HQWDO FDULHV LV RQH RI WKH PRVW SUHYDOHQW RUDO GLVHDVHV ZRUOGZLGH DIIHFWLQJ b RI VFKRROFKLOGUHQ DQG WKH PDMRULW\ RI DGXOWV ,Q WKH 8QLWHG 6WDWHV GHQWDO FDULHV LV WKH PRVW FRPPRQ FKURQLF FKLOGKRRG GLVHDVH ZLWK b RI \HDU ROGV KDYLQJ DW OHDVW RQH FDYLW\ RU ILOOLQJ >@ DQG DFFRUGLQJ WR WKH 86 'HSDUWPHQW RI +HDOWK DQG +XPDQ 6HUYLFHV LW LV HVWLPDWHG WKDW RYHU ELOOLRQ GROODUV LV VSHQW DQQXDOO\ RQ GHQWDO WUHDWPHQW DQG FDULHV SUHYHQWLRQ LQ WKH 8QLWHG 6WDWHV DORQH :KLOH DGYDQFHV LQ GHQWDO FDUH DQG FDULHV SUHYHQWLRQ KDV UHGXFHG WKH LQFLGHQFH RI FDULHV LQ GHYHORSHG FRXQWULHV WKH LQFLGHQFH RI FDULHV ZRUOGZLGH KDV UHPDLQHG XQFKDQJHG IRU WKH SDVW \HDUV >@ $ PDMRU FRQWULEXWLQJ IDFWRU WR WKH GHFOLQH RI FDULHV LQ GHYHORSHG FRXQWULHV ZDV WKH LQWURGXFWLRQ RI IOXRULGH WR ZDWHU DQG WRRWKSDVWH 8QIRUWXQDWHO\ LQ GHYHORSLQJ FRXQWULHV ZKHUH WKH LQFLGHQFH RI FDULHV LV RQ WKH ULVH IOXRULGDWHG FRPPXQLW\ ZDWHU LV FRPPRQO\ QRW D YLDEOH RSWLRQ $OWKRXJK IOXRULGDWHG ZDWHU UHDFKHV b RI WKH 86 SRSXODWLRQ PRUH WKDQ b RI WRRWKSDVWHV FRQWDLQ IOXRULGH DQG SURFHVVHG IRRG DQG EHYHUDJHV RIWHQ FRQWDLQ IOXRULGH WKH UHGXFWLRQ LQ FDULHV LQFLGHQFH KDV EHHQ XQHYHQ DFURVV WKH JHQHUDO SRSXODWLRQ LQ WKH 8QLWHG 6WDWHV 7KH PDMRULW\ RI WKH GLVHDVH LV QRZ EHLQJ ERUQH E\ D GLVSURSRUWLRQDWHO\ VPDOO VHJPHQW RI WKH SRSXODWLRQ WKRVH RI ORZ VRFLRHFRQRPLF VWDWXV ORZ HGXFDWLRQ DQG ODFN RI DFFHVV WR GHQWDO FDUH >@ LQ HVVHQFH D PLUURU RI WKH SRSXODWLRQV LQ GHYHORSLQJ FRXQWULHV 7KH LQDELOLW\ WR PDQDJH FDULHV LQ WKLV VXESRSXODWLRQ RI WKH 8QLWHG 6WDWHV ZKHUH WKH GHQWLVW WR SRSXODWLRQ UDWLR LV EHWWHU WKDQ SHRSOH

PAGE 90

LOOXVWUDWHV WKH LPSUREDEOH WDVN RI SUHYHQWLQJ FDULHV LQ GHYHORSLQJ FRXQWULHV VXFK DV LQ $IULFD ZKHUH WKH UDWLR LVO $ EHWWHU XQGHUVWDQGLQJ RI WKH YLUXOHQFH IDFWRUV DQGRU WDUJHWV RI SURWHFWLYH LPPXQLW\ LQ 6 PXWDQV FRXOG OHDG WR SUHYHQWDWLYH PHDVXUHV WKDW FRXOG KHOS RYHUFRPH WKH ODFN RI UHVRXUFHV HGXFDWLRQ DQG LQIUDVWUXFWXUH WKDW LV FXUUHQWO\ UHTXLUHG IRU FDULHV SUHYHQWLRQ 7KH PDMRU VXUIDFH SURWHLQ 3, RI WKH FDULRJHQLF RUJDQLVP 6 PXWDQV LV D PXOWLIXQFWLRQDO DGKHVLQ DQG SOD\V D UROH LQ WKH DWWDFKPHQW RI WKH EDFWHULXP WR WKH WRRWK VXUIDFH 3, VKDUHV VLPLODULWLHV WR YLUXOHQFH IDFWRUV RI VHYHUDO RWKHU EDFWHULDO VSHFLHV LQFOXGLQJ WKH ILEURQHFWLQ ELQGLQJ SURWHLQV RI 6 DXUHXV DQG 6 S\RJHQHV > @ DQG WKH SQHXPRFRFFDO VXUIDFH SURWHLQ 3VS$f RI 6 SQHXPRQLD >@ 3, KDV EHHQ LGHQWLILHG DV D WDUJHW IRU SURWHFWLYH LPPXQLW\ DQG KDV EHHQ VWXGLHG DV D SRWHQWLDO DQWLJHQ FDQGLGDWH IRU DQ DQWLFDULHV YDFFLQH >@ ,W KDV DOVR EHHQ XVHG IRU WKH SURGXFWLRQ RI P$EV WKDW DUH FXUUHQWO\ EHLQJ LQYHVWLJDWHG IRU WKHLU DELOLW\ WR PRGXODWH WKH LPPXQH UHVSRQVH LQ PLFH WKDW DUH FKDOOHQJHG ZLWK P$E PXWDQV RU P$E3O FRPSOH[HV >@ $OVR ZLWK OLWWOH NQRZQ DERXW WKH PDWXUDWLRQ DQG WUDQVORFDWLRQ RI 6WUHSWRFRFFDO VXUIDFH SURWHLQV 3, LV D SRWHQWLDO PRGHO IRU VWXGLHV LQ WKHVH DUHDV 7KH JRDO RI WKLV UHVHDUFK ZDV WR IXUWKHU RXU XQGHUVWDQGLQJ RI WKH VWUXFWXUH DQG DQWLJHQLF SURSHUWLHV RI WKLV ODUJH DQG FRPSOH[ PROHFXOH ZLWK DQ HPSKDVL]HV RQ LGHQWLI\LQJ LQWUDPROHFXODU LQWHUDFWLRQV WKH FRQWULEXWLRQ RI LQWUDPROHFXODU LQWHUDFWLRQV WR VWUXFWXUH VWDELOLW\ DQG WUDQVORFDWLRQ RI 3, DQG WR EHJLQ WR LGHQWLI\ FKDSHURQHV WKDW FRQWULEXWH WR 3, PDWXUDWLRQ DQG WUDQVORFDWLRQ ,GHQWLILFDWLRQ RI DQ ,QWUDPROHFXODU ,QWHUDFWLRQ ZLWKLQ 3, 3UHYLRXVO\ E\ SURFHVV RI HOLPLQDWLRQ XVLQJ WUXQFDWHG 3, SRO\SHSWLGHV WKH FHQWUDO UHJLRQ RI 3, ZDV GHWHUPLQHG WR FRQWULEXWH WR WKH HSLWRSHV RI VL[ RI HOHYHQ DQWL3O P$EV

PAGE 91

' $ $ ( DQG )f >@ ,W ZDV DGGLWLRQDOO\ VKRZQ WKDW GHOHWLRQ RI WKH 3UHJLRQ RI 3, 3, $3f DEURJDWHG WKH ELQGLQJ RI IRXU RI WKH HOHYHQ P$EV $ $ DQG 2+ f DQG WKDW QRQH RI WKHVH DQWLERGLHV UHFRJQL]HG D VXEFORQHG 3UHJLRQ SHSWLGH VXJJHVWLQJ WKDW WKHLU HSLWRSHV ZHUH FRPSOH[ DQG FRQIRUPDWLRQDO 6XUSULVLQJO\ DOWKRXJK 3$3 UHWDLQHG LWV 1WHUPLQDO VLJQDO VHTXHQFH DQG &WHUPLQDO FHOO ZDOO DQFKRULQJ PRWLI LW ZDV XQVWDEOH LQ 6 PXWDQV DQG QRW WUDQVORFDWHG WR WKH FHOO VXUIDFH >@ 3UROLQHULFK UHJLRQV KDYH EHHQ VKRZQ WR EH LQYROYHG LQ ERWK SURWHLQSURWHLQ LQWHUDFWLRQV DQG LQWUDPROHFXODU FKDSHURQHOLNH LQWHUDFWLRQV 7KH LQLWLDO REMHFWLYH RI WKHVH VWXGLHV ZDV WR LGHQWLI\ LQWHUDFWLRQV EHWZHHQ WKH 3UHJLRQ DQG RWKHU UHJLRQV RI 3, :RUN E\ 5KRGLQ HW DO >@ RQ WKH FKDUDFWHUL]DWLRQ RI WKH P$E $ HSLWRSH IXUWKHU GHILQHG UHJLRQV RI 3, WKDW ZHUH UHTXLUHG IRU UHDFWLYLW\ RI WKH $ $QDO\VLV RI VHYHUDO 3UHJLRQ VSDQQLQJ 3, VXEFORQHV UHYHDOHG WKDW LQ DGGLWLRQ WR WKH 3UHJLRQ DD f UHVLGXHV 1WHUPLQDO RI DOVR FRQWULEXWHG WR WKH UHDFWLYLW\ RI P$K $ ,Q DGGLWLRQ WKH FU\VWDO VWUXFWXUH RI WKH 3, YDULDEOH UHJLRQ VXJJHVWHG WKDW WKH $ DQG 3 UHJLRQV PD\ EH LQ FORVH SUR[LPLW\ >@ DQG LW ZDV UHSRUWHG WKDW D SRO\SHSWLGH FRQWDLQLQJ WKH 3UHJLRQ ERXQG WR WKH 1WHUPLQDO WKLUG RI 3, >@ %DVHG XSRQ WKHVH UHSRUWV WKH $ UHJLRQ ZDV H[DPLQHG WR GHWHUPLQH ZKHWKHU LW FRQWULEXWHG WR D FRPSOH[ VWUXFWXUH E\ DVVRFLDWLRQ ZLWK WKH 3UHJLRQ 7KH LQLWLDO H[SHULPHQW ZDV WR H[DPLQH WKH HIIHFWV RI WKH UHPRYDO RI WKH $UHJLRQ IURP 3, 7KHUHIRUH D VSD3 JHQH ODFNLQJ WKH $UHJLRQ DD f ZDV FRQVWUXFWHG E\ 3&5 DQG FORQHG LQWR S8& FUHDWLQJ S76 7KH FRQVWUXFW ZDV HQJLQHHUHG ZLWK D VLOHQW PXWDWLRQ WKDW SURGXFHG D XQLTXH 6IR? UHVWULFWLRQ VLWH WKDW ZRXOG ODWHU EH XVHG WR LQVHUW

PAGE 92

KHWHURORJRXV $UHJLRQV 7KH LQVHUWLRQ RI WKH 6IRO VLWH GLFWDWHG WKH H[DFW UHVLGXHV WKDW ZHUH GHOHWHG 'HOHWLRQ RI WKH $UHJLRQ UHVXOWHG LQ D ORVV RI UHDFWLYLW\ RI ILYH RI HOHYHQ RI WKH DQWL3O 0$EV ' $ DQG $f RI ZKLFK DUH DOVR GHSHQGHQW XSRQ WKH SUHVHQFH RI WKH 3UHJLRQ $ DQG $f VHH )LJXUH f 7KLV VXJJHVWV WKDW WKH HSLWRSHV RI WKHVH WKUHH DQWLERGLHV DUH FRPSOH[ DQG FRPSRVHG RI SRUWLRQV RI GLVFRQWLQXRXV VHJPHQWV RU WKDW DQ LQWHUDFWLRQ EHWZHHQ WKH UHJLRQV UHVXOWV LQ FRQIRUPDWLRQDO HSLWRSHV EHLQJ SURGXFHG ZLWKLQ RQH RU ERWK RI WKH UHJLRQV 5HDFWLYLW\ RI 0DEV ( % DQG & ZKLFK DUH VSHFLILF WR WKH &WHUPLQDO RI 3, FRQILUPHG WKDW WKH GHOHWLRQ RI WKH '1$ HQFRGLQJ WKH $UHJLRQ GLG QRW GLVUXSW WKH UHDGLQJ IUDPH 7KH :HVWHUQ LPPXQREORW DOVR VKRZV WKDW OLNH 3, $3 3$$ LV VWDEO\ H[SUHVVHG DQG GHWHFWDEOH LQ ( FROL 7KH SUHVHQFH RI LQWHUQDO SUROLQHULFK UHJLRQV KDV EHHQ DVVRFLDWHG ZLWK DEHUUDQW PLJUDWLRQ RI VWUHSWRFRFFDO DQG VWDSK\ORFRFFDO SURWHLQV RQ 6'6SRO\DFU\ODPLGH JHOV 7KH PROHFXODU PDVV RI 3, KDV EHHQ SUHGLFWHG WR EH N'D DOWKRXJK WKH SURWHLQ PLJUDWHV ZLWK DQ DSSDUHQW PROHFXODU PDVV RI N'D E\ 6'63$*( ,QWHUHVWLQJO\ 3$3 DQG 3, $$ UXQ DW WKHLU SUHGLFWHG VL]HV RI N'D DQG N'D UHVSHFWLYHO\ VXJJHVWLQJ WKDW DQ LQWHUDFWLRQ EHWZHHQ WKH $ DQG WKH 3UHJLRQV PD\ FRQWULEXWH WR DQRPDORXV PLJUDWLRQ RI 3, E\ 6'63$*( 2Q D VLGHG QRWH WKH DEEHUDQW PLJUDWLRQ RI 3, ZDV REVHUYHG HYHQ DIWHU fGHQDWXULQJf LQ 0 XUHD DQG 6'63$*( DW ERWK r& DQG r& :LWK WKH GDWD IURP WKH $UHJLRQ GHOHWLRQ LQGLFDWLQJ WKDW WKH $ DQG 3UHJLRQV FRQWULEXWH WR WKH VDPH HSLWRSHV LW ZDV RI LQWHUHVW WR GHWHUPLQH LI WKHVH UHJLRQV ZHUH LQ IDFW FDSDEOH RI LQWHUDFWLQJ $Q LQWHUDFWLRQ EHWZHHQ UHFRPELQDQW SRO\SHSWLGHV FRUUHVSRQGLQJ WR WKH LVRODWHG $UHJLRQ DD f DQG 3UHJLRQ DDf ZDV

PAGE 93

H[DPLQHG E\ (/,6$ $UHJLRQ SRO\SHSWLGH ZDV LQFXEDWHG ZLWK LPPRELOL]HG 3UHJLRQ DQG $UHJLRQ ELQGLQJ ZDV GHWHFWHG ZLWK DQWL3O 0$E ZKLFK UHFRJQL]HV DQ HSLWRSH FRQWDLQHG HQWLUHO\ ZLWKLQ WKH DODQLQHULFK UHSHDWV 7KH (/,6$ UHYHDOHG D GLUHFW GRVH GHSHQGHQW LQWHUDFWLRQ VHH )LJXUH f 7KH UHTXLUHG VLPXOWDQHRXV SUHVHQFH RI ERWK WKH $ DQG 3UHJLRQV IRU WKH ELQGLQJ RI P$EV $ DQG $ WR 3, DQG WKH DELOLW\ RI UHFRPELQDQW $ DQG 3UHJLRQ SRO\SHSWLGHV WR LQWHUDFW VXJJHVWHG WKDW WKH LQWHUDFWLRQ RI WKHVH UHJLRQV FRXOG FRQWULEXWH WR WKH HSLWRSHV WKDW DUH UHFRJQL]HG E\ WKHVH P$EV 7R IXUWKHU DQDO\]H WKH FKDUDFWHULVWLFV RI WKH HSLWRSHV UHFRJQL]HG E\ WKHVH P$EV (/,6$ ZHUH SHUIRUPHG ZLWK $ DQG 3UHJLRQ SRO\SHSWLGHV WR GHWHUPLQH ZKHWKHU ELQGLQJ RI P$EV $ RU $ ZDV UHVWRUHG XSRQ LQWHUDFWLRQ RI WKHVH WZR GLVFRQWLQXRXV GRPDLQV ,QWHUHVWLQJO\ P$EV DQG $ UHDFWHG FRQVLGHUDEO\ EHWWHU ZKHQ WKH $UHJLRQ ZDV DSSOLHG WR LPPRELOL]HG 3UHJLRQ UDWKHU WKDQ YLVD YHUVD ZKLOH 0$E $ GLVSOD\HG QR DSSDUHQW SUHIHUHQFH VHH )LJXUH f 7KLV ZRXOG VXJJHVW WKDW WKH FRQWDFW UHVLGXHV IRU 0$EV DQG $ DUH ODUJHO\ FRQWDLQHG ZLWKLQ WKH $UHJLRQ ZKLOH ERWK UHJLRQV PD\ FRQWDLQ UHVLGXHV UHTXLUHG IRU WKH 0$E $ HSLWRSH 6LQFH DOO WKUHH RI WKHVH P$EV ELQG WR 3, RQ WKH VXUIDFH RI 6 PXWDQV WKHVH UHVXOWV LQGLFDWH WKDW WKH $ DQG 3UHJLRQV LQWHUDFW LQ WKH FRQWH[W RI WKH ZKROH PROHFXOH LQ LWV QDWLYH FRQIRUPDWLRQ 'XH WR WKH SRVVLELOLW\ WKDW WKH LQWHUDFWLRQ RI WKH $ DQG 3UHJLRQV PD\ EH DQ DUWLIDFW RI EHLQJ LPPRELOL]HG WR WKH (/,6$ SODWH D FRPSHWLWLYH LQKLELWLRQ (/,6$ ZDV SHUIRUPHG WR DVVHVV WKH LQWHUDFWLRQ RI WKH $ DQG 3UHJLRQV LQ VROXWLRQ 6LQFH LW ZDV VKRZQ WKDW DQ LQWHUDFWLRQ RI WKH $ DQG 3UHJLRQ LV UHTXLUHG IRU WKH ELQGLQJ RI 0$E $ UHFRPELQDQW $ DQG 3UHJLRQ SRO\SHSWLGHV ZHUH XVHG DORQH DQG LQ FRPELQDWLRQ WR LQKLELW WKH ELQGLQJ

PAGE 94

RI 0$E 2$ WR LPPRELOL]HG 3, $V FDQ EH VHHQ LQ )LJXUH QHLWKHU WKH $UHJLRQ QRU WKH 3UHJLRQ LQGLYLGXDOO\ LQKLELWV 0$E $ ELQGLQJ WR 3, KRZHYHU WKH FRPELQDWLRQ RI ERWK SRO\SHSWLGHV GRHV 7KLV LQGLFDWHV WKDW WKH $ DQG 3UHJLRQV DUH FDSDEOH RI LQWHUDFWLQJ LQ VROXWLRQ ,Q DQ HIIRUW WR HVWDEOLVK WKH VWRLFKLRPHWU\ RI WKH $ DQG 3UHJLRQ LQWHUDFWLRQ D YDULDWLRQ RI WKH -RE 3ORW ZDV SHUIRUPHG 7KH -RE 3ORW RU FRQWLQXRXV YDULDWLRQ FRQVLVWV RI PL[LQJ WZR ELQGLQJ SDUWQHUV RU DQ HQ]\PH DQG VXEVWUDWH DW YDULRXV PRODU UDWLRV ZKLOH KROGLQJ WKH WRWDO FRQFHQWUDWLRQ FRQVWDQW DQG WKHQ UHFRUGLQJ D PHDVXUDEOH FKDQJH :KLOH FRQWLQXRXV YDULDWLRQ LV QRUPDOO\ SHUIRUPHG LQ VROXWLRQ GXH WR WKH XVH RI DQWLERGLHV WR PHDVXUH WKH $ DQG 3UHJLRQ LQWHUDFWLRQ WKH $ DQG 3UHJLRQ SRO\SHSWLGHV KDG WR EH LPPRELOL]HG WR DQ (/,6$ SODWH WR DIIRUG WKH UHPRYDO RI H[FHVV XQERXQG DQWLERG\ 6LQFH 0$E $ ZDV WKH WRRO XVHG WR PHDVXUH WKH $ DQG 3UHJLRQ LQWHUDFWLRQ WKH VWRLFKLRPHWU\ WKDW ZDV GHWHUPLQHG ZRXOG DFWXDOO\ EH WKDW UHTXLUHG IRU WKH IRUPDWLRQ RI WKH 0$E $ HSLWRSH $FFRUGLQJ WR WKH DVVD\ WKH HSLWRSH RI P$E $ FRQVLVWV RI D UDWLRQ RI $UHJLRQ WR 3UHJLRQ VHH )LJXUH f $OWKRXJK DQWLJHQ ,,, SURWHLQV DUH KLJKO\ FRQVHUYHG WKH IXQFWLRQDO SURSHUWLHV RI LQGLYLGXDO PHPEHUV RI WKLV IDPLO\ RI SURWHLQV GLIIHU JRUGRQLL SRVVHVVHV WZR DQWLJHQ ,,, SURWHLQV 6VS$ DQG 6VS% ZKLFK KDYH EHHQ ZHOO FKDUDFWHUL]HG 6HYHUDO IXQFWLRQDO GLIIHUHQFHV EHWZHHQ WKHVH WZR SURWHLQV KDYH EHHQ LGHQWLILHG LQFOXGLQJ FRDJJUHJDWLRQ ZLWK RWKHU RUDO IORUD DQG LQWHUDFWLRQ ZLWK W\SH FROODJHQ > @ 3, LV FORVHU WR 6VS$ LQ KRPRORJ\ b LGHQWLW\ YHUVXV b ZLWK 6VS% 6SHFLILF DPLQR DFLG UHVLGXHV WKDW DUH QRW LQ 3, KDYH EHHQ LGHQWLILHG WR EH LPSRUWDQW IRU 6VS% ELQGLQJ WR 3RUKURPRQDV JLQJLYDOLV >@ DQG LQWHUDFWLRQV RI 6VS% DQG 3, ZLWK VDOLYDU\ DJJOXWLQLQ DOVR GLIIHU

PAGE 95

>@ 5HFHQW VWXGLHV IRFXVLQJ RQ WKH $UHJLRQV RI 6VS$ 6VS% DQG 3, KDYH DOVR LGHQWLILHG VWUXFWXUDO DQG IXQFWLRQDO YDULDWLRQ ,W ZDV UHSRUWHG WKDW WKH $UHJLRQV RI 3, DQG 6VS$ ERXQG WR VDOLYDU\ DJJOXWLQLQ EXW WKDW WKH $UHJLRQ RI 6VS% GLG QRW ,Q DGGLWLRQ VWUXFWXUDO DQDO\VLV VXJJHVWHG WKDW WKH $UHJLRQ RI 6VS% LV OHVV VWDEOH WKDQ WKDW RI 6VS$ DQG 3, ERWK DW KLJK WHPSHUDWXUH DQG ORZ S+ ,W VKRXOG EH QRWHG WKDW WKH $UHJLRQV RI 6VS$ DQG 6VS% H[KLELW DSSUR[LPDWHO\ b SULPDU\ VHTXHQFH LGHQWLW\ ZLWK RQH DQRWKHU ZKLOH WKH $UHJLRQV RI 6VS$ DQG 3, RQO\ VKDUH b VHH )LJXUH f > @ ,Q OLJKW RI WKH VLPLODULWLHV DQG GLIIHUHQFHV UHSRUWHG EHWZHHQ WKH $UHJLRQV RI 6VS$ 6VS% DQG 3, LW ZDV RI LQWHUHVW WR VHH LI WKH $ DQG 3UHJLRQV RI WKHVH 6 JRUGRQLL SURWHLQV LQWHUDFWHG ZLWK RQH DQRWKHU DV ZHOO DV ZLWK WKH $DQG 3UHJLRQV RI 3 $JDLQ LQWHUDFWLRQ EHWZHHQ WKHVH UHJLRQV ZDV H[DPLQHG E\ (/,6$ DQG D GRVHGHSHQGHQW LQWHUDFWLRQ ZDV REVHUYHG ZLWK P$E UHDFWLQJ WR $UHJLRQ SRO\SHSWLGHV ELQGLQJ WR LPPRELOL]HG 3UHJLRQ SRO\SHSWLGHV VHH )LJXUH f 7KH UHVXOWV LQGLFDWH WKDW WKH $ UHJLRQ RI 3, LQWHUDFWV PRUH VWURQJO\ ZLWK DOO RI WKH 3UHJLRQV WKDQ HLWKHU RI WKH 6 JRUGRQLL SRO\SHWLGHV DQG WKDW WKH 6VS% $UHJLRQ LV WKH ZHDNHVW ELQGHU ZKLFK IROORZV WKH WUHQG RI 3, EHLQJ PRUH OLNH 6VS$ 7KH FRQWULEXWLRQ RI WKH 3, $UHJLRQ DQG 3UHJLRQ LQWHUDFWLRQV WR QDWLYH VWUXFWXUH DV GHWHUPLQHG E\ HSLWRSH UHVWRUDWLRQ DQG WKH DELOLW\ RI WKH KHWHURORJRXV LQWHUDFWLRQ RI $ DQG 3UHJLRQV OHG WR WKH H[DPLQDWLRQ RI HSLWRSH UHVWRUDWLRQ E\ WKH LQWHUDFWLRQ RI WKH KHWHURORJRXV $ DQG 3UHJLRQV $V EHIRUH (/,6$ ZDV XVHG WR GHWHFW WKH UHVWRUDWLRQ RI HSLWRSHV IRU P$EV $ DQG $ E\ HYHU\ FRPELQDWLRQ RI 3, 6VS$ DQG 6VS% $ DQG 3UHJLRQ LQWHUDFWLRQV LQ ZKLFK HLWK WKH $ RU 3UHJLRQ ZDV LPPRELOL]HG 7KH UHVXOWV GHPRQVWUDWHG WKDW WKH HSLWRSHV UHFRJQL]HG E\ WKHVH WKUHH $ DQG 3UHJLRQ

PAGE 96

GHSHQGHQW P$EV ZHUH UHVWRUHG UHJDUGOHVV RI ZKLFK 3UHJLRQ LQWHUDFWHG ZLWK WKH LPPRELOL]HG $UHJLRQ IURP 3, VHH )LJXUH f :KLOH ZKHQ 3UHJLRQV ZHUH LQWHUDFWHG ZLWK HLWKHU RI WKH 6 JRUGRQLL $UHJLRQV RQO\ WKH 3UHJLRQ RI 3 UHVWRUHG DQ\ P$E UHDFWLYLW\ ZKLFK ZDV IRU P$E DQG DW D ORZ OHYHO VHH )LJXUHVO DQG f $GGLWLRQDOO\ WKH $UHJLRQ RI 3, ZDV DEOH WR UHVWRUH DOO RI WKH HSLWRSHV ZKHQ LQWHUDFWHG ZLWK DQ\ RI WKH LPPRELOL]HG 3UHJLRQV DQG WKH $UHJLRQ RI 6VS$ ZDV DEOH WR UHVWRUH WKH P$E HSLWRSH ZKHQ LQWHUDFWHG ZLWK LPPRELOL]HG 3, 3UHJLRQ VHH )LJXUH f $QG ODVWO\ WKH LQWHUDFWLRQ RI WKH $UHJLRQ RI 6VS% ZLWK DQ\ LPPRELOL]HG 3UHJLRQ IDLOHG WR UHVWRUH HSLWRSHV &RPSDULQJ WKH UHVXOWV RI WKH $ DQG 3UHJLRQ LQWHUDFWLRQV WR WKH UHDFWLYLW\ RI P$EV $ DQG $ DJDLQVW IXOOOHQJWK 6VS$ DQG 6VS% DV H[DPLQHG E\ :HVWHUQ LPPXQREORW ZDV LQWHUHVWLQJ VHH )LJXUH f :KLOH P$E UHDFWHG WR ERWK IXOOOHQJWK 6VS$ DQG 6VS% LWV HSLWRSH ZDV QRW UHVWRUHG E\ WKH LQWHUDFWLRQ RI WKH 6VS$ DQG 6VS% $ DQG 3UHJLRQV 7KH VDPH KHOG WUXH IRU P$E $ ZKLFK ERXQG WR IXOOOHQJWK 6VS% DQG ZHDNO\ UHDFWHG WR 6VS$ 7R VXPPDUL]H DOWKRXJK P$EV $ DQG ERXQG WR IXOO OHQJWK 6VS$ DQG 6VS% WKHLU HSLWRSHV ZHUH QRW UHVWRUHG E\ LQWHUDFWLRQV RI WKH $ DQG 3 UHJLRQV RI WKHVH SURWHLQV XQOHVV RQH RI WKH LQWHUDFWLQJ UHJLRQV ZDV IURP 3 $QDO\VLV RI 3, 7UDQVORFDWLRQ DQG WKH &RQWULEXWLRQ RI WKH $ODQLQH DQG 3UROLQH5LFK 5HJLRQV $OO OLIH GHSHQGV XSRQ WKH WDUJHWLQJ RI QHZO\ V\QWKHVL]HG SURWHLQV WR WKHLU VLWH RI DFWLRQ 'XULQJ WUDQVLW WR LWV GHVWLQDWLRQ D SURWHLQ PXVW DYRLG D YDULHW\ RI KD]DUGV VXFK DV PDOIROGLQJ DJJUHJDWLRQ DQG GHJUDGDWLRQ DQG PD\ EH UHTXLUHG WR SDVV WKURXJK RQH RU PRUH PHPEUDQHV NQRZQ DV WUDQVORFDWLRQ 3URWHLQ WUDQVORFDWLRQ KDV EHHQ H[WHQVLYHO\

PAGE 97

VWXGLHG LQ ( FROL DQG WKH PRGHOV HVWDEOLVKHG WKURXJK WKLV UHVHDUFK DUH EHOLHYHG WR EH UHSUHVHQWDWLYH RI DOO EDFWHULDO FHOOV >@ EXW PRUH UHFHQWO\ %DFLOOXV VXEWLOLV KDV EHFRPH WKH PRGHO IRU *UDPSRVLWLYH EDFWHULD 3URWHLQV WKDW DUH WDUJHWHG IRU WUDQVORFDWLRQ DFURVV WKH F\WRSODVPLF PHPEUDQH FRQWDLQ DQ 1WHUPLQDO VLJQDO VHTXHQFH >@ WKDW JHQHUDOO\ FRQWDLQV SRVLWLYHO\ FKDUJHG UHVLGXHV IROORZHG E\ WR K\GURSKRELF UHVLGXHV> @ ZKLFK DUH XVXDOO\ UHPRYHG GXULQJ RU VKRUWO\ DIWHU WUDQVORFDWLRQ 6LJQDO SHSWLGHV FDQ EH FODVVLILHG E\ WKH W\SH RI VLJQDO SHSWLGDVH WKDW LV UHVSRQVLEOH IRU WKHLU SURWHRO\WLF SURFHVVLQJ DQG WKHVH FODVVLILFDWLRQV FDQ EH XVHG WR SUHGLFW WKH WUDQVORFDWLRQ SDWKZD\V >@ %DVHG XSRQ VXUYH\V RI VLJQDO SHSWLGHV LQ WKH JHQRPHV RI % VXEWLOLV DQG VHYHUDO RWKHU *UDPSRVLWLYH EDFWHULXP LW LV SUHGLFWHG WKDW PRVW H[WUDFHOOXODU SURWHLQV LQ WKHVH RUJDQLVPV DUH VHFUHWHG YLD WKH 6HFWUDQVORFDVH >@ ,Q %DFLOOXV VXEWLOLV WKHUH DUH IRXU SUHGLFWHG SURWHLQ WUDQVSRUW SDWKZD\V Lf WKH 6HF GHSHQGHQW SDWKZD\ LLf 7ZLQDUJLQLQH WUDQVORFDWLRQ 7DWf LQf $%& WUDQVSRUWHU GHSHQGHQW VHFUHWLRQ SDWKZD\V LYf DQG D SVHXGRSLOLQVSHFLILF H[SRUW SDWKZD\ $ VXUYH\ RI WKH 6 PXWDQV 8$ JHQRPH IDLOHG WR UHYHDO DQ\ KRPRORJXHV RI WKH 7DW PDFKLQHU\ RU 7DW VLJQDO SHSWLGHV ,Q DGGLWLRQ WR WKH UHTXLUHPHQW IRU 0$E UHDFWLYLW\ WKH VLPXOWDQHRXV SUHVHQFH RI ERWK WKH $ DQG WKH 3UHJLRQV DSSHDU WR EH UHTXLUHG IRU 3, VWDELOLW\ LQ 6 PXWDQV $QDO\VLV RI P51$ HQFRGLQJ 3$$ OLNH 3, $3 >@ GHPRQVWUDWHG WKDW WKH LQWHUQDOO\ GHOHWHG VSD3 JHQH ZDV WUDQVFULEHG DW OHYHOV HTXLYDOHQW WR WKH ZLOGW\SH VSD3 JHQH VHH )LJXUH f 'LIIHUHQFHV LQ GQD. P51$ OHYHOV LQ PXWDQV KDUERULQJ SODVPLGV HQFRGLQJ 3, 3, $$ DQG 3, $3 DOVR VXJJHVWHG WKDW WKH 3$$ ZDV EHLQJ WUDQVODWHG +RZHYHU QR 3$$ ZDV GHWHFWHG LQ WKH F\WRSODVP RQ WKH FHOO VXUIDFH VHH )LJXUH f QRU LQ WKH FXOWXUH

PAGE 98

OLTXRU :KLOH 3$3 FRQWDLQV D GHOHWLRQ RI UHVLGXHV DQG 3$$ ODFNV UHVLGXHV WKHUH DUH H[DPSOHV RI VWDEOH DQWLJHQ ,,, SRO\SHSWLGHV WKDW ZKHQ FRPSDUHG WR 3, DUH ODFNLQJ ODUJH VHJPHQWV RI WKH PROHFXOHV 7KH DQWLJHQ ,,, SURWHLQ H[SUHVVHG E\ 6 LQWHUPHGLQV 3DV ODFNV UHVLGXHV IURP WKH $UHJLRQ DQG UHVLGXHV IURP WKH 3 UHJLRQ >@ 3DD IURP 6 FULFHWXV SRVVHVVHV DQ DGGLWLRQDO UHVLGXHV LQ WKH $UHJLRQ DQG UHVLGXHV OHVV LQ WKH 3UHJLRQ >@ DQG 6 PXWDQV *6 H[SUHVVHV D 3$F PROHFXOH ODFNLQJ WKH &WHUPPDO UHVLGXHV >@ 7KH $UHJLRQ RI 3, FRQVLVWV RI WKUHH UHVLGXH UHSHDWV DQG WKH 3UHJLRQ FRQVLVWV RI WKUHH UHVLGXH UHSHDWV DQG ERWK 3DD DQG 3DV UHWDLQ UHSHDWV LQ ERWK UHJLRQV 1RW DOO LQWHUQDO GHOHWLRQV LQ 3 UHVXOW LQ WKH DSSDUHQW OHYHO RI LQVWDELOLW\ VHHQ LQ 3$$ DQG 3$3 5KRGLQ HW DO FRQVWUXFWHG D 3 FRQVWUXFW ODFNLQJ UHVLGXHV ZKLFK ZDV GHWHFWDEOH LQ PXWDQV 3& EXW ZDV QRW WUDQVORFDWHG WR WKH VXUIDFH XQSXEOLVKHGf 7KLV VXJJHVWV WKDW WKH $ DQG 3UHJLRQV PD\ FRQWDLQ LQKHUHQW VWUXFWXUDO LQIRUPDWLRQ SRVVLEOH FKDSHURQH ELQGLQJ VLWHV RU SHUKDSV SRVVHVV FKDSHURQHOLNH DFWLYLWLHV WKDW DUH FULWLFDO WR 3, VWDELOLW\ $ SUROLQHULFK UHJLRQ KDV EHHQ LPSOLFDWHG DV DQ LQWUDPROHFXODU FKDSHURQH E\ :DQJ HW DO >@ 7KH FHQWUDO SUROLQH ULFK UHJLRQ RI WKH /LPXOXV VHFUHWHG VHULQH SURWHDVH )DFWRU & ZDV VKRZQ WR EH UHTXLUHG IRU VHFUHWLRQ RI WKH PROHFXOH 7KHLU GDWD VXJJHVWHG WKDW WKH FRUUHFW IROGLQJ RI WKH PROHFXOH &WHUPLQDO RI WKH SUR OLQHULFK UHJLRQ ZDV GHSHQGHQW XSRQ WKH SUHVHQFH RI WKH SUROLQHULFK UHJLRQ DQG WKDW WKH ODFN RI VHFUHWLRQ ZDV GXH WR PDOIROGLQJ 7R IXOO\ XQGHUVWDQG WKH UROH RI WKH $ DQG 3UHJLRQV LQ 3, WUDQVORFDWLRQ LGHQWLI\LQJ WKH PROHFXOHfV URXWH RI WUDQVORFDWLRQ LV QHFHVVDU\ 7KHUH LV QR H[SHULPHQWDO GDWD WKDW LGHQWLILHV WKH VHFUHWLRQ SDWKZD\ HPSOR\HG E\ 3, RU DQWLJHQ ,,,OLNH SURWHLQV &HOO ZDOO DQFKRULQJ RI 3, DQG 3$F LV PHGLDWHG E\ WKH WUDQVSHSWLGDVH VRUWDVH > @ DQG VRUWDVH

PAGE 99

DQFKRUHG SURWHLQV DUH SUHVXPHG WR EH WUDQVORFDWHG YLD WKH VHF WUDQVORFDVH >@ $V GHWDLOHG LQ WKH LQWURGXFWLRQ WKH 6HFGHSHQGHQW VHFUHWLRQ SDWKZD\ KDV EHHQ WKRURXJKO\ VWXGLHG LQ ( FROL DQG WKH FKDUDFWHULVWLFV RI WKH SDWKZD\ DUH SUHVXPHG WR EH FRQVHUYHG IRU DOO EDFWHULD ,Q ( FROL WKH 6HFWUDQVORFDVH FRQVLVWV RI D VWUXFWXUH FRPSRVHG RI VHYHUDO SURWHLQV LQFOXGLQJ WKH $73DVH 6HF$ ZKLFK SURYLGHV WKH HQHUJ\ IRU WUDQVORFDWLRQ >@ &XUUHQW OLWHUDWXUH LGHQWLILHV WZR PDMRU SDWKZD\V WKDW D QDVFHQW SURWHLQ GHVWLQHG IRU WKH 6HFWUDQVORFDVH ZRXOG EH WUDQVSRUWHG XSRQ WKH VLJQDO UHFRJQLWLRQ SDUWLFOH 653f SDWKZD\ DQG WKH 6HF% SDWKZD\ 7KH 653 SDWKZD\ LV LQYROYHG LQ FRWUDQVODWLRQDO SURWHLQ VHFUHWLRQ 7KH 653 UHFRJQL]HV DQG ELQGV WR WKH VLJQDO SHSWLGHV RI QDVFHQW SRO\SHSWLGHV DV WKH\ HPHUJH IURP WKH ULERVRPH >@ %LQGLQJ RI WKH 653 VWDOOV WUDQVODWLRQ DQG WDUJHWV WKH 653ULERVRPH FRPSOH[ WR WKH 653 UHFHSWRU )WV< > @ 7KH 653ULERVRPH)WV< FRPSOH[ LV WKHQ WDUJHWHG WR WKH 6HFWUDQVORFRQ ZKHUH WKH ULERVRPH GRFNV DQG WKH SURWHLQ LV FR WUDQVODWLRQDOO\ WUDQVORFDWHG DFURVV WKH PHPEUDQH >@ 7KH F\WRSODVPLF FKDSHURQH 6HF% WDUJHWV SUHSURWHLQV WR WKH 6HFWUDQVORFRQ IRU SRVW WUDQVODWLRQDO WUDQVORFDWLRQ 6HF% ELQGV WR QDVFHQW DQG IXOOOHQJWK SURWHLQV DV WKH\ HPHUJH IURP WKH ULERVRPH >@ 6HF% LQWHUDFWLRQ SUHYHQWV SUHPDWXUH IROGLQJ RI WKH SUHSURWHLQ DQG GHOLYHUV LW WR WKH 6HFWUDQVORFRQ LQ D VHFUHWLRQFRPSHWHQW VWDWH %LQGLQJ RI WKH 6HF% SURWHLQ FRPSOH[ ZLWK 6HF$ UHVXOWV LQ WKH WUDQVIHU RI WKH SUHSURWHLQ WR 6HF$ DQG WKH UHOHDVH RI 6HF% >@ 7KH SURWHLQ LV VXEVHTXHQWO\ WUDQVORFDWHG DFURVV WKH PHPEUDQH WKURXJK WKH 6HFWUDQVORFRQ >@ 'XH WR WKH IDLQW H[SUHVVLRQ RI 3, $3 DQG WKH XQGHWHFWDEOH H[SUHVVLRQ RI 3, $$ LQ 6 PXWDQV ( FROL ZDV XVHG WR EHJLQ WR H[DPLQH 3, VHFUHWLRQ 3, $3 DQG 3, $$ DUH VWDEOH

PAGE 100

DQG GHWHFWDEOH DOEHLW DW UHGXFHG OHYHOV LQ ZKROH FHOO O\VDWHV RI ( FRW E\ :HVWHUQ LPPXQREORW $QDO\VLV RI SHULSODVPLF H[WUDFWV E\ :HVWHUQ LPPXQREORW UHYHDOHG WKDW 3, ZDV VHFUHWHG LQWR WKH SHULSODVP EXW 3$3 DQG 3$$ ZHUH QRW 7KLV VXJJHVWV WKDW ZKLOH WKH $ DQG 3UHJLRQV DUH DSSDUHQWO\ QRW UHTXLUHG IRU VWDELOLW\ LQ ( FRW WKH UHJLRQV DUH UHTXLUHG IRU VHFUHWLRQ ,I D ODFN RI FKDSHURQH LQWHUDFWLRQ ZLWK WKH GHOHWLRQ UHFRPELQDQW SURWHLQV UHVXOWV LQ WKH ODFN RI VHFUHWLRQ SHUKDSV D VLPLODU ODFN RI LQWHUDFWLRQ DOVR IDYRUV GHJUDGDWLRQ RI WKH PROHFXOHV LQ 6 PXWDQV ,W LV NQRZQ WKDW VHFUHWLRQ LQFRPSHWHQW SURWHLQV DUH VXEMHFW WR UDSLG WXUQRYHU ZKLFK LV D OLNHO\ VFHQDULR ZKHQ WKHVH FRQVWUXFWV DUH H[SUHVVHG LQ 6 PXWDQV :LWK VXFK D UDSLG WXUQRYHU LQ 6 PXWDQV DQG FRQVLGHULQJ WKH WLPH UHTXLUHG IRU O\VLV RI WKH EDFWHULXP SXOVHFKDVH H[SHULPHQWV WR GHWHUPLQH WKH KDOIOLIH RI WKHVH GHOHWLRQ SURWHLQV LQ 6WUHSWRFRFFL DUH FXUUHQWO\ WHFKQLFDOO\ LPSUREDEOH 7KH 653 SDWKZD\ KDV EHHQ LGHQWLILHG LQ ERWK JUDPQHJDWLYH DQG JUDPSRVLWLYH EDFWHULD ,Q % VXEWLOLV QXPHURXV KRPRORJV RI WKH JHQHUDO VHFUHWRU\ SDWKZD\ FRPSRQHQWV KDYH EHHQ LGHQWLILHG +RZHYHU DV LV WKH FDVH ZLWK 6 PXWDQV QR 6HF% KRPRORJ KDV EHHQ LGHQWLILHG EXW % VXEWLOLV KDV EHHQ IRXQG WR SRVVHVV D IXQFWLRQDO RUWKRORJ &VD$ ZKLFK KDV EHHQ VKRZQ WR KDYH SDUWLDOO\ RYHUODSSLQJ ELQGLQJ FKDUDFWHULVWLFV >@ $V SUHYLRXVO\ VWDWHG WKH 653 LV HVVHQWLDO IRU YLDELOLW\ LQ ( FRW DQG LW ZDV DVVXPHG WR EH WKH FDVH LQ DOO RUJDQLVPV +RZHYHU LW KDV EHHQ GHPRQVWUDWHG WKDW 6 PXWDQV LV YLDEOH ZLWKRXW 653 >@ DQG 3, LV WUDQVORFDWHG DQG H[SUHVVHG RQ WKH FHOO VXUIDFH LQ LWV DEVHQFH XQSXEOLVKHGf 7KLV ZRXOG VXJJHVW WKDW LI 3, VHFUHWLRQ LV 6HF GHSHQGHQW WKH WDUJHWLQJ SDWKZD\ VKRXOG OLNHO\ EH 6HF%OLNH DQG UHTXLUH D IXQFWLRQDO 6HF% RUWKRORJ 7R H[DPLQH WKH SRVVLELOLW\ RI D UROH IRU 6HF% LQ 3, VHFUHWLRQ 3, ZDV H[SUHVVHG LQ D 6HF%QHJDWLYH ( FRW PXWDQW &. 3, ZDV VKRZQ WR EH VWDEOH DQG

PAGE 101

VHFUHWHG LQWR WKH SHULSODVP LQ &. 7KLV VXJJHVWV WKDW LQ ( FROL LI 3, LV VHFUHWHG YLD WKH 6HFSDWKZD\ LW LV DVVRFLDWLQJ ZLWK DQ DOWHUQDWLYH FKDSHURQH WR 6HF% D IXQFWLRQDO HTXLYDOHQW RU WKDW LW PD\ EH DEOH WR XVH WKH 653 SDWKZD\ 5HFHQW HYLGHQFH VXJJHVWV WKDW LQ WKH 6 PXWDQV 653 PXWDQWV WKH SURWHLQ @ 7KH UHFHQWO\ GLVFRYHUHG WZLQDUJLQLQHWUDQVORFDWLRQ 7$7f SDWKZD\ WUDQVSRUWV IROGHG SURWHLQV DFURVV FHOO PHPEUDQHV >@ DQG DOWKRXJK D VXUYH\ RI WKH 6 PXWDQV JHQRPH GLG QRW UHYHDO DQ\ KRPRORJRXV 7$7 JHQHV RU 7$7 VLJQDO VHTXHQFHV WKH WUDQVORFDWLRQ FKDUDFWHULVWLFV RI WKH 3, GHULYDWLYHV DQG WKH LQWHUDFWLRQ RI WKH $ DQG 3UHJLRQV VXJJHVWHG WKH SRVVLELOLW\ RI D SDUWLDO IROGLQJ UHTXLUHPHQW SULRU WR WUDQVORFDWLRQ ,Q ( FROL ERWK WKH 1WHUPLQDO $UHJLRQ DQG &WHUPLQDO 3UHJLRQ FRQWDLQLQJ IUDJPHQWV FRXOG EH HDVLO\ GHWHFWHG LQ WKH FHOO O\VDWHV E\ :HVWHUQ LPPXQREORW VHH )LJXUH f +RZHYHU LQ 6 PXWDQV RQO\ WKH $UHJLRQ FRQWDLQLQJ IUDJPHQW ZDV GHWHFWHG LQ WKH FHOO H[WUDFWV ,Q DGGLWLRQ WKH 1WHUPLQDO IUDJPHQW FRXOG EH GHWHFWHG LQ WKH 6 PXWDQV

PAGE 102

FXOWXUH VXSHUQDWDQW 7KHVH UHVXOWV LQGLFDWH WKDW WKH DPLQRWHUPLQDO VLJQDO VHTXHQFH LV VXIILFLHQW IRU WKH VWDEOH H[SUHVVLRQ DQG WUDQVORFDWLRQ RI D 3, SRO\SHSWLGH FRQVLVWLQJ RI WKH ILUVW DPLQR DFLGV $OVR WKDW WKH $UHJLRQ IUDJPHQW H[SUHVVHG LQ WUDQV LV QRW VXIILFLHQW WR SURWHFW WKH DSSDUHQWO\ XQVWDEOH FDUER[\WHUPLQDO DPLQR DFLGV LQ 6 PXWDQV 7KHVH UHVXOWV GLG QRW UHYHDO DQ\ GHWDLOV RI 3, WUDQVORFDWLRQ WKDW FRQWUDGLFW WKH SUHVXPHG XVH RI WKH 6HF WUDQVORFDVH ,W DSSHDUV IURP WKH DERYH UHVXOWV WKDW WKH $DQG 3UHJLRQ PXVW UHVLGH ZLWKLQ WKH VDPH PROHFXOH IRU WKH VWDEOH H[SUHVVLRQ RI 3, 7R EHJLQ WR LGHQWLI\ ZKLFK UHVLGXHV ZLWKLQ WKH $UHJLRQ DUH LPSRUWDQW IRU 3, VWDELOLW\ VWUXFWXUH DQG WUDQVORFDWLRQ WKH '1$ HQFRGLQJ WKH $UHJLRQV IURP 6 JRUGRQLL 6VS$ DQG 6VS% ZDV OLJDWHG LQWR WKH VLWH RI WKH $UHJLRQ GHOHWLRQ LQ 3$$ 7KH FKLPHULF 3, SURWHLQV ZHUH H[SUHVVHG LQ ERWK L" FROL DQG 6 PXWDQV 3& DQG UHVWRUDWLRQ RI VWDELOLW\ DQG VWUXFWXUH DV GHWHUPLQHG E\ HSLWRSH UHVWRUDWLRQ ZDV H[DPLQHG E\ :HVWHUQ LPPXQREORW ,Q ( FROL WKH LPPXQREORWV LQGLFDWHG WKDW VRPH QDWLYH VWUXFWXUH ZDV UHVWRUHG E\ WKH $UHJLRQ RI 6VS$ DV VXJJHVWHG E\ UHVWRUDWLRQ RI WKH P$E HSLWRSH VHH )LJXUH f +RZHYHU WKH $UHJLRQ RI 6VS$ GLG QRW UHVWRUH $ RU $ ELQGLQJ DQG WKH LQVHUWLRQ RI WKH $ UHJLRQ RI 6VS% GLG QRW UHVWRUH DQ\ RI WKH $ DQG 3UHJLRQ GHSHQGHQW HSLWRSHV 7KHVH UHVXOWV DJUHH ZLWK WKH SUHYLRXVO\ GHPRQVWUDWHG UHVWRUDWLRQ RI WKH P$E HSLWRSH E\ WKH LQWHUDFWLRQ RI WKH $ UHJLRQ RI 6VS$ DQG WKH 3UHJLRQ RI 3 )XOOOHQJWK 6VS$ DQG 6VS% ZHUH WUDQVORFDWHG WR WKH VXUIDFH RI 3& LQGLFDWLQJ WKDW WKHUH ZDV QR LQKHUHQW LQVWDELOLW\ ZKHQ H[SUHVVHG LQ 6 PXWDQV VHH )LJXUH f 7KH LQWURGXFWLRQ RI WKH KHWHURORJRXV $UHJLRQV GLG QRW UHVWRUH VXUIDFH H[SUHVVLRQ RI 3, LQ 3& VHH )LJXUH f ,Q DGGLWLRQ QR IXOOOHQJWK FKLPHULF 3, SURWHLQV ZHUH GHWHFWHG LQ

PAGE 103

O\VDWHV RI 3& E\ :HVWHUQ LPPXQREORWV +RZHYHU EUHDN GRZQ SURGXFWV ZHUH GHWHFWHG E\ WKH $UHJLRQV VSHFLILF P$E VHH )LJXUH f $V VHHQ SUHYLRXVO\ ZLWK WKH H[SUHVVLRQ RI WKH GLVFRQWLQXRXV 3, IUDJPHQWV WKH 1WHUPLQDO DSSHDUV WR EH PRUH VWDEOH WKDQ WKH &WHUPLQDO RI 3, 7KH ODFN RI VWDELOLW\ DQG WUDQVORFDWLRQ RI WKH FKLPHULF 3, SURWHLQV LQ 3& VXJJHVWV WKDW LQIRUPDWLRQ LQWULQVLF WR WKH 3, $UHJLRQ LV UHTXLUHG IRU 3, VWDELOLW\ DQG WKDW DOWKRXJK KLJKO\ FRQVHUYHG WKH VWUXFWXUDO LQIRUPDWLRQ SURYLGHG E\ WKH $UHJLRQV RI WKH DQWLJHQ ,,, SURWHLQV PD\ EH SURWHLQ VSHFLILF 2I WKH DPLQR DFLG UHVLGXHV LQ WKH $UHJLRQV WKDW ZHUH VZDSSHG WKH $UHJLRQ RI 3, GLIIHUV IURP WKH $UHJLRQ RI 6VS$ DW UHVLGXHV DOWKRXJK RI WKRVH KDYH VLPLODU SURSHUWLHV DQG ZLWK 6VS% DW UHVLGXHV ZLWK EHLQJ VLPLODU VHH )LJXUH f 7KH GLIIHUHQFHV EHWZHHQ WKH $UHJLRQV LQ 6VS$ DQG 6VS% DUH DW UHVLGXHV ZLWK EHLQJ VLPLODU ,W LV XQOLNHO\ WKDW D VLQJOH UHVLGXH LV UHVSRQVLEOH IRU WKH GLIIHUHQFH EHWZHHQ WKH SDUWLDO UHVWRUDWLRQ LQ VWUXFWXUH WKDW LV VHHQ ZLWK WKH 6VS$ $UHJLRQ DQG FRPSOHWH QDWLYH 3, VWUXFWXUH +RZHYHU E\ VXEWUDFWLQJ WKRVH UHVLGXHV WKDW 6VS% KDV LQ FRPPRQ ZLWK 3, IURP WKH UHVLGXHV WKDW GLIIHU EHWZHHQ 6VS$ DQG 3, WKH ILHOG RI FDQGLGDWHV FDQ EH QDUURZHG WR UHVLGXHV ZLWK EHLQJ VLPLODU 7KHVH UHVXOWV FDQ EH XVHG WR GHILQH WDUJHW UHVLGXHV IRU SRWHQWLDO VLWH GLUHFWHG PXWDJHQHVLV LQ IXWXUH VWXGLHV ,Q DGGLWLRQ DV SUHYLRXVO\ VWDWHG WKH 6 LQWHUPHGLXV 3DV SURWHLQ LV PLVVLQJ RI WKH $UHJLRQ DQG LV VWLOO VWDEOH ZKLFK LOOXVWUDWHV WKDW WKHUH LV QR JOREDO UHTXLUHPHQW IRU WKH HQWLUH $UHJLRQ )XWXUH H[SHULPHQWV LQYROYLQJ WKH LQVHUWLRQ RI $UHJLRQ VHJPHQWV LQWR 3$$ PD\ DOVR HOXFLGDWH D PLQLPXP UHTXLUHPHQW IRU 3, VWDELOLW\

PAGE 104

,QYROYHPHQW RI 5RS$ 7ULJJHU )DFWRUf DQG 'QD. LQ WKH 0DWXUDWLRQ DQG 7UDQVORFDWLRQ RI 3, 6LJQDO SHSWLGHV DUH QHFHVVDU\ DQG VXIILFLHQW IRU SURWHLQ WUDQVORFDWLRQ LI WKH SURWHLQ FDQ EH PDLQWDLQHG LQ D VHFUHWLRQFRPSHWHQW VWDWH ZKLFK IRU PRVW SURWHLQV LV DQ XQIROGHG VWDWH 7R PDLQWDLQ WKLV H[SRUW FRPSHWHQW FRQIRUPDWLRQ SUHFXUVRU SURWHLQV LQWHUDFW ZLWK F\WRSODVPLF FKDSHURQHV &KDSHURQHV GR QRW UHFRJQL]H VLJQDO SHSWLGHV EXW WKH\ SOD\ DQ HVVHQWLDO UROH LQ WKH WUDQVSRUW DQG WUDQVORFDWLRQ RI H[WUDFHOOXODU SURWHLQV E\ ELQGLQJ WR DQG PDLQWDLQLQJ WKHLU SURWHLQ VXEVWUDWHV LQ D ORRVHO\ IROGHG FRQIRUPDWLRQ WKDW LV UHTXLUHG IRU WUDQVORFDWLRQ DFURVV WKH PHPEUDQH >@ 7R EHJLQ WR FKDUDFWHUL]H WKH FKDSHURQHV LQYROYHG LQ WKH WUDQVORFDWLRQ DQG PDWXUDWLRQ RI 3 WKH FKDSHURQHV 5RS$ DQG 'QD. ZHUH H[DPLQHG 7KH EDFWHULDO KHDW VKRFN SURWHLQ 'QD. LV LQYROYHG LQ D ZLGHYDULHW\ RI FHOOXODU SURFHVVHV UDQJLQJ IURP DVVLVWLQJ LQ SURWHLQ IROGLQJ WR WDUJHWLQJ D SURWHLQ IRU GHJUDGDWLRQ 7KH FRPPRQ IXQFWLRQ RI 'QD. LV WR ELQG WR VKRUW K\GURSKRELF UHJLRQV RI SRO\SHSWLGHV WKDW DUH JHQHUDOO\ QRW H[SRVHG LQ SURSHUO\ IROGHG SURWHLQV 'QD. ELQGLQJ WR WKHVH UHJLRQV SUHYHQWV SURWHLQ DJJUHJDWLRQ DQG KDOWV IROGLQJ 'HSHQGLQJ XSRQ WKH FHOOXODU FRQGLWLRQV WKH SURWHLQ PD\ EH WUDQVIHUUHG WR PRUH VSHFLDOL]HG FKDSHURQHV IRU UHIROGLQJ RU GHVWLQHG IRU GHJUDGDWLRQ 6HYHUDO VWXGLHV KDYH VKRZQ WKDW 'QD. FDQ DOVR PDLQWDLQ WKH WUDQVORFDWLRQ FRPSHWHQFH RI SUHVHFUHWRU\ SURWHLQV ZKLFK LV DOVR WKH UROH RI 6HF% > @ 'QD. LV VWUXFWXUDOO\ XQUHODWHG WR 6HF% DQG LWV ELQGLQJ WR SRO\SHSWLGHV LV $73 GHSHQGHQW DQG LV UHJXODWHG E\ FRFKDSHURQHV > @ ,Q DGGLWLRQ WKH VXEVWUDWH VSHFLILFLW\ DQG IRU HDFK FKDSHURQH GLIIHUV FRQVLGHUDEO\ >@ (YLGHQFH VXJJHVWV WKDW FKDSHURQHV KDYH RYHUODSSLQJ IXQFWLRQV LQ WKH SURWHLQ H[SRUW SDWKZD\ 7KH

PAGE 105

IXQFWLRQDO UHGXQGDQF\ RI FKDSHURQHV PD\ H[SODLQ ZK\ 6HF% LQ ( FROL DQG 653 LQ 6 PXWDQV DUH QRW HVVHQWLDO IRU FHOO YLDELOLW\ 7KH ILUVW FKDSHURQH RU IROGLQJ FDWDO\VW WKDW LQWHUDFWV ZLWK QDVFHQW SUHVHFUHWRU\ SURWHLQV LV WKH SHSWLG\O SURO\O LVRPHUDVH WULJJHU IDFWRU > @ 7ULJJHU IDFWRU LV DQ DEXQGDQW F\WRSODVPLF SURWHLQ ZKLFK FDWDO\]HV WUDQV WR FLV SURO\O ERQG LVRPHUL]DWLRQ GXULQJ WKH UHIROGLQJ RI GHQDWXUHG SURWHLQV ,Q ( FROL WULJJHU IDFWRU DVVRFLDWHV ZLWK WKH V VXEXQLW RI WKH ULERVRPH >@ DQG LW ZDV IRXQG WR LQWHUDFW ZLWK D ZLGH YDULHW\ RI QDVFHQW SURWHLQV ERWK LQ YLWUR DV ZHOO DV LQ YLYR > @ ,Q YLYR VWXGLHV SUHVHQW HYLGHQFH WKDW WULJJHU IDFWRU KDV D UROH LQ WKH F\WRVROLF IROGLQJ SDWKZD\ WRJHWKHU ZLWK WKH F\WRSODVPLF FKDSHURQH 'QD. > @ 'QD. ZDV IRXQG WR LQWHUDFW XQGHU QRQVWUHVV FRQGLWLRQV ZLWK QDVFHQW FKDLQV ZLWK RI N'D RU ORQJHU 'HOHWLRQ RI WKH QRQ HVVHQWLDO JHQH HQFRGLQJ WULJJHU IDFWRU UHVXOWHG LQ WKH GRXEOLQJ RI WKH QXPEHU RI QDVFHQW FKDLQV LQWHUDFWLQJ ZLWK 'QD. 8QGHU WKHVH FRQGLWLRQV 'QD. LQWHUDFWHG ZLWK PXFK VKRUWHU QDVFHQW FKDLQV VXJJHVWLQJ WKDW WULJJHU IDFWRU LV WKH ILUVW SURWHLQ WKDW LQWHUDFWV ZLWK WKH QDVFHQW FKDLQV DV VRRQ DV WKH\ HPHUJH IURP WKH ULERVRPH 6HYHUDO UHFHQW VWXGLHV KDYH UHYHDOHG WKDW LQ DGGLWLRQ WR LVRPHUDVH DFWLYLW\ WULJJHU IDFWRU KDV FKDSHURQH DFWLYLW\ 7ULJJHU IDFWRU SUHYHQWV WKH DJJUHJDWLRQ RI SURWHLQV HLWKHU LQ FRPELQDWLRQ ZLWK *UR(/*UR(6 RU DORQH >@ DQG LV QHFHVVDU\ IRU WKH EUHDNGRZQ RI DEQRUPDO SURWHLQV >@ 0RUHRYHU UHIROGLQJ RI *$3'+ ZDV VKRZQ WR EH DVVLVWHG E\ WKH FKDSHURQH IXQFWLRQ RI WULJJHU IDFWRU >@ DQG WKH LVRPHUDVH DFWLYLW\ RI WULJJHU IDFWRU KDV EHHQ VKRZQ QRW WR EH UHTXLUHG IRU WKH IROGLQJ RI QHZO\ V\QWKHVL]HG F\WRSODVPLF SURWHLQV LQ ( FROL >@

PAGE 106

$GGLWLRQDO D UROH IRU WULJJHU IDFWRU LQ VHFUHWLRQ ZDV GHPRQVWUDWHG E\ %HFN HW DO >@ ZKR VXJJHVWHG WKDW WULJJHU IDFWRU KDV D UROH DV D GHFLVLRQ PDNHU DQG GLUHFWV SUHVHFUHWRU\ SURWHLQV LQWR WKH FKDSHURQH EDVHG WDUJHWLQJ SDWKZD\ +RZHYHU WULJJHU IDFWRU KDV QRW EHHQ IRXQG WR EH HVVHQWLDO IRU VHFUHWLRQ RI DQ\ NQRZQ SURWHLQ LQ ( FROW RU % VXEWLOLV QRU LV LW HVVHQWLDO IRU FHOO YLDELOLW\ > @ ,Q 6 S\RJHQHV KRZHYHU WULJJHU IDFWRU 5RS$f LV HVVHQWLDO IRU WKH VHFUHWLRQ DQG PDWXUDWLRQ RI WKH F\VWHLQH SURWHDVH 6SH% /\RQ HW DO GHPRQVWUDWHG WKDW LQ WKH DEVHQFH RI 5RS$ WKH QDVFHQW SURWHDVH SRO\SHSWLGH ZDV QRW WDUJHWHG WR WKH VHFUHWRU\ SDWKZD\ :KLOH DQ LQIUDPH GHOHWLRQ RI WKH 33,DVH GRPDLQ ZLWKLQ 5RS$ UHVXOWHG LQ D VHFUHWHG EXW HQ]\PDWLFDOO\ LQDFWLYH SURWHDVH VXJJHVWLQJ WKDW WULJJHU IDFWRU KDV DQ DGGLWLRQDO UROH LQ SURWHDVH PDWXUDWLRQ >@ ,W ZDV VXEVHTXHQWO\ GHWHUPLQHG WKDW D VLQJOH SUROLQH 3 ZDV WKH WDUJHW RI WKH 33,DVH DFWLYLW\ WKDW ZDV UHTXLUHG IRU PDWXUDWLRQ RI WKH SURWHDVH >@ ,W LV LQWHUHVWLQJ WKDW WKH ODFN RI LVRPHUL]DWLRQ FDQ VHQG WKH SURWHDVH LQWR DQ DOWHUQDWLYH IROGLQJ SDWKZD\ ZKLFK UHVXOWV LQ D PDOIXQFWLRQLQJ HQ]\PH \HW QRW DSSHDU WR HIIHFW LWV VHFUHWLRQ ,Q 6 PXWDQV 5RS$ ZDV UHFHQWO\ IRXQG WR EH LQYROYHG LQ VWUHVV WROHUDQFH DQG ELRILOP IRUPDWLRQ >@ 7KH LQYROYHPHQW RI 5RS$ LQ WKH H[SUHVVLRQ RI IXQFWLRQDO 3, LQ 6 PXWDQV ZDV H[DPLQHG XVLQJ DQ DGKHUHQFH DVVD\ DQG DQDO\]HG ZLWK D %/$FRUH %,$FRUH $% 8SSVDOD 6ZHGHQf DV GHVFULEHG LQ >@ 7KH ELQGLQJ RI 6 PXWDQV WR VDOLYDU\ DJJOXWLQLQ KDV EHHQ VKRZQ WR EH PHGLDWHG E\ 3, DQG WKH ELQGLQJ FDQ EH LQKLELWHG E\ WKH 3OVSHFLILF 0DE $ EXW QRW E\ WKH 3OVSHFLILF 0DE $ >@ $GKHUHQFH RI WKH URS$QHJDWLYH 6 PXWDQV 7: WR VDOLYDU\ DJJOXWLQLQ ZDV VXEVWDQWLDOO\ ORZHU bf WKDQ WKDW RI WKH ZLOGW\SH 8$ DQG WKH LQKLELWLRQ RI DGKHUHQFH RI ERWK 8$ DQG 7: E\ WKH

PAGE 107

DGGLWLRQ RI 0DE $ LQGLFDWHG WKDW WKH DGKHUHQFH ZDV 3, PHGLDWHG $Q REYLRXV FDXVH RI WKH UHGXFWLRQ LQ DGKHUHQFH ZRXOG EH D UHGXFWLRQ LQ VXUIDFH H[SUHVVHG 3 KRZHYHU ZKROH FHOO GRW EORWV LQGLFDWHG WKDW WKLV ZDV QRW WKH FDVH 7: DQG 8$ H[SUHVVHG HTXLYDOHQW OHYHOV RI 3, RQ WKHLU VXUIDFHV DW ERWK WLPH SRLQWV H[DPLQHG HDUO\ORJ DQG VWDWLRQDU\ SKDVH VHH )LJXUH f 7KHVH UHVXOWV LQGLFDWH WKDW 5RS$ LV QRW UHTXLUHG IRU WKH VHFUHWLRQ RI 3, EXW VXJJHVW WKDW LW LV UHTXLUHG IRU WKH PDWXUDWLRQ RI 3, WR D IXOO\ IXQFWLRQDO DGKHVLQ :KHWKHU WKH HIIHFW LV GXH WR WKH ODFN RI D GLUHFW LQWHUDFWLRQ EHWZHHQ 5RS$ DQG QDVFHQW 3, RU DQ LQGLUHFW HIIHFW WKURXJK LQWHUPHGLDWHV LV XQNQRZQ DQG WKH VXEMHFW RI IXWXUH VWXGLHV 6LQFH 'QD. LV UHTXLUHG IRU 6 PXWDQV YLDELOLW\ WKH HIIHFW RI 'QD. RQ WKH VXUIDFH H[SUHVVLRQ RI 3, ZDV H[DPLQHG LQ 6 PXWDQV 60 ZKLFK H[SUHVVHV RQO\ b RI ZLOG W\SH OHYHOV RI 'QD. :KROH FHOO GRW EORWV RI 60, KDUYHVWHG DW HDUO\ORJ SKDVH H[SUHVVHG VLJQLILFDQWO\ UHGXFHG OHYHOV RI 3, RQ WKH VXUIDFH FRPSDUHG WR ZLOGW\SH 8$ VHH )LJXUH f )ORZHYHU DW VWDWLRQDU\ SKDVH WKH OHYHOV RI VXUIDFH 3, ZHUH HTXLYDOHQW 7KHVH UHVXOWV GR QRW QHFHVVDULO\ LQGLFDWH D GLUHFW LQWHUDFWLRQ RI 'QD. ZLWK 3, DV WKH UHGXFHG VXUIDFH H[SUHVVLRQ PD\ EH D JHQHUDO UHGXFWLRQ LQ DOO SURWHLQ WUDQVORFDWLRQ $GGLWLRQDOO\ OLNH ZLWK 5RS$ DQ\ REVHUYHG HIIHFWV PD\ EH GXH WR UHTXLUHG 'QD. LQWHUDFWLRQV HOVHZKHUH LQ WKH VHFUHWLRQ SDWKZD\ $W WKH VWDWLRQDU\ JURZWK VWDJH 3, VXUIDFH H[SUHVVLRQ LQ WKH GRZQUHJXODWHG 'QD. PXWDQW LV HTXLYDOHQW WR WKH ZLOGW\SH VXJJHVWLQJ WKDW WKH FRQWLQXRXV EXW UHGXFHG WUDQVORFDWLRQ RI 3, HYHQWXDOO\ FDWFKHV XS WR WKH ZLOGW\SH OHYHOV :KHWKHU WKH UHGXFHG OHYHO RI WUDQVORFDWLRQ LV GXH WR D GLUHFW HIIHFW RI 'QD. RQ 3, RU LV GXH WR DQ HIIHFW RQ WKH VHFUHWLRQ SDWKZD\ FRPSRQHQWV LV VWLOO WR EH GHWHUPLQHG

PAGE 108

4XDQWLWDWLYH 5HDO7LPH 3&5 ZDV XVHG WR PHDVXUH WKH HIIHFWV RI WKH SUHVHQFH RI 3, 3$$ DQG 3$3 RQ GQD. P51$ OHYHOV LQ 6 PXWDQV 3& VHH )LJXUH f 6WDWLVWLFDO DQDO\VLV RI WKH GDWD UHYHDOHG VLJQLILFDQW GLIIHUHQFHV EHWZHHQ WKH OHYHOV RI GQD. P51$ LQ 3& KDUERULQJ WKH YHFWRU RQO\ YHUVHV 3& H[SUHVVLQJ 3$$ DQG 3$3 2GGO\ WKH OHYHO RI P51$ LQ WKH FHOOV H[SUHVVLQJ 3, $3 ZDV ORZHU WKDQ LQ WKH YHFWRU RQO\ FRQWURO 7KH KLJKHVW OHYHO RI GQD. P51$ ZDV LQ 3& H[SUHVVLQJ 3, $$ ,Q ( FROL WUDQVFULSWLRQ RI GQD. LV LQLWLDWHG E\ D D SURPRWHU ZKLFK 'QD. LV LQYROYHG LQ UHJXODWLQJ E\ LQWHUDFWLQJ ZLWK WKH D VXEXQLW RI 51$ SRO\PHUDVH ,W ZDV SURSRVHG WKDW WKH SUHVHQFH RI GHQDWXUHG SURWHLQV DFWV DV D VLQN IRU 'QD. WKXV IUHHLQJ R WKXV LQLWLDWLQJ GQD. WUDQVFULSWLRQ>@ 'QD. LQ 6 PXWDQV RQ WKH RWKHU KDQG LV WUDQVFULEHG IURP DD$W\SH SURPRWHU >@ DQG LV QHJDWLYHO\ UHJXODWHG E\ +UF$ >@ $OWKRXJK QHLWKHU 3$$ QRU 3, $3 FRXOG EH GHWHFWHG LQ 3& XVLQJ LPPXQRORJLFDO PHWKRGV WKH HIIHFW RI WKHLU H[SUHVVLRQ RQ GQD. P51$ OHYHOV ZRXOG VXJJHVW WKDW WKH\ ZHUH LQGHHG WUDQVODWHG 7KH GLIIHUHQFH LQ GQD. P51$ OHYHOV LQ WKH SUHVHQFH RI 3$$ YHUVHV 3, $$ PD\ EH D FLUFXPVWDQFH RI SURWHLQ VWDELOLW\ LQ WKDW 3$3 PLJKW EH WXUQHG RYHU PRUH UDSLGO\ WKDQ 3, $$ DQG WKDW 'QD. ZDV QRW LQYROYHG LQ WKH SURFHVV ,W LV DOVR SODXVLEOH WKDW WKH 3UHJLRQ LQ WKH PDOIROGHG 3 $$ DFWHG DV D VLQN IRU 'QD. ZKLFK UHVXOWHG LQ XSUHJXODWLRQ LQ D PDQQHU RI WUDQVFULSWLRQDO FRQWURO WKDW LV VLPLODU WR WKDW VHHQ ZLWK WKH ( FROL D )XUWKHU UHVHDUFK ZLOO EH QHHGHG WR GHWHUPLQH LI WKH GLIIHUHQFH LQ H[SUHVVLRQ OHYHOV FRUUHODWHV WR GLIIHUHQFHV LQ 'QD. ELQGLQJ WR 3, DQG LWV GHULYDWLYHV &RQFOXVLRQV 7KH JRDO RI WKLV UHVHDUFK ZDV WR SURYLGH LQVLJKW LQWR WKH FRQWULEXWLRQ RI WKH SUROLQH ULFK UHJLRQ WR WKH VWUXFWXUH WUDQVORFDWLRQ DQG DQWLJHQLFLW\ RI 3, 7KH DQDO\VLV RI WKH 3

PAGE 109

UHJLRQ DQG LWV LQWHUDFWLRQ ZLWK WKH $UHJLRQ KDV UHYHDOHG LQIRUPDWLRQ UHJDUGLQJ WKH VWUXFWXUH RI WKH PROHFXOH DQG WKH FRPSOH[LW\ RI WKH HSLWRSHV WKDW DUH UHFRJQL]HG E\ DQWL 3 P$EV 7KHVH VWXGLHV KDYH DOVR VKRZQ D UHTXLUHPHQW RI WKHVH UHJLRQV IRU 3, VWDELOLW\ DQG WUDQVORFDWLRQ WR WKH FHOO VXUIDFH RI 6 PXWDQV DQG WR WKH SHULSODVP RI ( FROL ,Q DGGLWLRQ LW KDV HVWDEOLVKHG ( FROL DV D YLDEOH WRRO IRU IXWXUH 3, WUDQVORFDWLRQ VWXGLHV 7KH UHVXOWV RI WKLV UHVHDUFK KDYH LPSOLFDWLRQV IRU XQGHUVWDQGLQJ VXUIDFH ORFDOL]DWLRQ RI YLUXOHQFH IDFWRUV LQ SDWKRJHQLF PLFURRUJDQLVPV DQG IRU XQGHUVWDQGLQJ KRZ WKH SURWHLQ VWUXFWXUH RI D YDFFLQH DQWLJHQ FRQWULEXWHV WR UHFRJQLWLRQ E\ DQWLERGLHV

PAGE 110

/,67 2) 5()(5(1&(6 +DPDGD 6DQG ), '6ODGH %LRORJ\ LPPXQRORJ\ DQG FDULRJHQLFLW\ RI 6WUHSWRFRFFXV PXWDQV 0LFURELRO 5HY S /RHVFKH :5ROH RI 6WUHSWRFRFFXV PXWDQV LQ KXPDQ GHQWDO GHFD\ 0LFURELRO 5HY S %UDWWKDOO 'HPRQVWUDWLRQ RIILYH VHURORJLFDO JURXSV RI VWUHSWRFRFFDO VWUDLQV UHVHPEOLQJ 6WUHSWRFRFFXV PXWDQV 2GRQWRO 5HY S 3HUFK % ( .MHPV DQG 7 5DYQ %LRORJLFDO DQG VHURORJLFDO SURSHUWLHV RI 6WUHSWRFRFFXV PXWDQV IURP YDULRXV KXPDQ DQG DQLPDO VRXUFHV $FWD 3DWKRO 0LFURELRO 6FDQG >%@ 0LFURELRO ,PPXQRO S &R\NHQGDOO $/ %DVH FRPSRVLWLRQ RI GHR[\ULERQXFOHLF DFLG LVRODWHG IURP FDULRJHQLF VWUHSWRFRFFL $UFK 2UDO %LRO S &R\NHQGDOO $/ )RXU W\SHV RI 6WUHSWRFRFFXV PXWDQV EDVHG RQ WKHLU JHQHWLF DQG ELRFKHPLFDO FKDUDFWHULVWLFV *HQ 0LFURELRO S &R\NHQGDOO $/ 3URSRVDO WR HOHYDWH WKH VXEVSHFLHV RI 6WUHSWRFRFFXV PXWDQV WR VSHFLHV VWDWXV EDVHG RQ WKHLU PROHFXODU FRPSRVLWLRQ ,QW 6\VW %DFWHULRO 3XFFL 0DQG ) / 0DFULQD &ORQHG JWI$ JHQH RI 6WUHSWRFRFFXV PXWDQV /0 DOWHUV JOXFDQ V\QWKHVLV LQ 6WUHSWRFRFFXV VDQJXLV ,QIHFW ,PPXQ S 6KLUR]D 7 6 8HGD DQG +. .XUDPLWVX 6HTXHQFH DQDO\VLV RI WKH JWI% JHQH IURP 6WHSWRFRFFXV PXWDQV %DFWHULRO S 3XFFL 0 5 -RQHV + .XUDPLWVX DQG ) / 0DFULQD 0ROHFXODU FORQLQJ DQG FKDUDFWHUL]DWLRQ RI WKH JOXFRV\OWUDQVIHUDVH & JHQH JWI&f IURP 6WUHSWRFRFFXV PXWDQV /0 ,QIHFW ,PPXQ S +RQGD 2 & .DWR DQG + .XUDPLWVX 1XFOHRWLGH VHTXHQFH RI WKH 6WUHSWRFRFFXV PXWDQV JWI' JHQH HQFRGLQJ WKH JOXFRV\OWUDQVIHUDVH6 HQ]\PH *HQ 0LFURELRO S

PAGE 111

5XVVHOO 55 *OXFDQELQGLQJ SURWHLQV RI 6WUHSWRFRFFXV PXWDQV VHURW\SH F *HQ 0LFURELRO S 6PLWK '+ $NLWD : ) .LQJ DQG 0 $ 7DXEPDQ 3XULILFDWLRQ DQG DQWLJHQLFLW\ RI D QRYHO JOXFDQ ELQGLQJ SURWHLQ RI 6WUHSWRFRFFXV PXWDQV ,QIHFW ,PPXQ S 6DWR < <
PAGE 112

7DNDKDVKL 1 2NDKDVKL & 6DVDNDZD 0
PAGE 113

+DMLVKHQJDOOLV 7 .RJD DQG 0: 5XVVHOO $IILQLW\ DQG VSHFLILFLW\ RI WKH LQWHUDFWLRQV EHWZHHQ 6WUHSWRFRFFXV PXWDQV DQWLJHQ ,,, DQG VDOLYDU\ FRPSRQHQWV 'HQW 5HV f S &URZOH\ 3/%UDG\ '$ 3LDFHQWLQL DQG $6 %OHLZHLV ,GHQWLILFDWLRQ RI D VDOLYDU\ DJJOXWLQLQELQGLQJ GRPDLQ ZLWKLQ FHOO VXUIDFH DGKHVLQ 3, RI 6WUHSWRFRFFXV PXWDQV ,QIHFW ,PPXQ f S 0RLVVHW $ 1 6FKDW] < /HSRLYUH 6 $PDGLR :DFKVPDQQ 0 6FKROOHU DQG -3 .OHLQ &RQVHUYDWLRQ RI VDOLYDU\ JO\FRSURWHLQLQWHUDFWLQJ DQG KXPDQ LPPXQRJOREXOLQ *FURVVUHDFWLYH GRPDLQV RI DQWLJHQ ,,, LQ RUDO VWUHSWRFRFFL ,QIHFW ,PPXQ f S 0XQUR *+ 3 (YDQV 6 7RGU\N 3 %XFNHWW &* .HOO\ DQG 7 /HKQHU $ SURWHLQ IUDJPHQW RI VWUHSWRFRFFDO FHOO VXUIDFH DQWLJHQ ,,, ZKLFK SUHYHQWV DGKHVLRQ RI 6WUHSWRFRFFXV PXWDQV ,QIHFW ,PPXQ f S .HOO\ &* 6 7RGU\N +/ .HQGDO *+ 0XQUR DQG 7 /HKQHU 7FHOO DGKHVLRQ DQG %FHOO HSLWRSHV RI WKH FHOO VXUIDFH 6WUHSWRFRFFXV PXWDQV SURWHLQ DQWLJHQ ,QIHFW ,PPXQ f S 0RUULV $/ 0: 0DF$UWKXU (* +XWFKLQVRQ DQG -0 7KRUQWRQ 6WHUHRFKHPLFDO TXDOLW\ RI SURWHLQ VWUXFWXUH FRRUGLQDWHV 3URWHLQV f S +XUOH\ -+ '$ 0DVRQ DQG %: 0DWWKHZV )OH[LEOHJHRPHWU\ FRQIRUPDWLRQDO HQHUJ\ PDSV IRU WKH DPLQR DFLG UHVLGXH SUHFHGLQJ D SUROLQH %LRSRO\PHUV f S 5LFKDUGVRQ -6 DQG '& 5LFKDUGVRQ $PLQR DFLG SUHIHUHQFHV IRU VSHFLILF ORFDWLRQV DW WKH HQGV RI DOSKD KHOLFHV 6FLHQFH f S &RZDQ 30 0 6 DQG 1$ & 7KH SRO\SHSWLGH FKDLQ FRQILJXUDWLRQ RI FROODJHQ 1DWXUH f S %OXQGHOO 7/ -( 3LWWV L7LFNOH DQG 63 :RRG 7KH FRQIRUPDWLRQ DQG UHFHSWRU ELQGLQJ RI SDQFUHDWLF KRUPRQHV %LRFKHP 6RF 7UDQV f S $G]KXEHL $ $ DQG 0 6WHUQEHUJ /HIWKDQGHG SRO\SUROLQH ,, KHOLFHV FRPPRQO\ RFFXU LQ JOREXODU SURWHLQV 0RO %LRO f S &UDYDWW %) '. *LDQJ 63 0D\ILHOG '/ %RJHU 5$ /HPHU DQG 1% *LOXOD 0ROHFXODU FKDUDFWHUL]DWLRQ RI DQ HQ]\PH WKDW GHJUDGHV QHXURPRGXODWRU\ IDWW\DFLG DPLGHV 1DWXUH f S

PAGE 114

$UUHD]D DQG '* 'HXWVFK 'HOHWLRQ RI D SUROLQHULFK UHJLRQ DQG D WUDQVPHPEUDQH GRPDLQ LQ IDWW\ DFLG DPLGH K\GURODVH )(%6 /HWW f S 2NDPRWR 30 -6 +HUVNRYLWV DQG 5% 9DOOHH 5ROH RI WKH EDVLF SUROLQHULFK UHJLRQ RI G\QDPLQ LQ 6UF KRPRORJ\ GRPDLQ ELQGLQJ DQG HQGRF\WRVLV %LRO &KHP f S +DQVVRQ -+ & 1HOVRQ:LOOLDPV + 6X]XNL / 6FKLOG 5 6KLPNHWV < /X & &DQHVVD 7 ,ZDVDNL % 5RVVLHU DQG 53 /LIWRQ +\SHUWHQVLRQ FDXVHG E\ D WUXQFDWHG HSLWKHOLDO VRGLXP FKDQQHO JDPPD VXEXQLW JHQHWLF KHWHURJHQHLW\ RI /LGGOH V\QGURPH 1DW *HQHW f S +DQVVRQ -+ / 6FKLOG < /X 7$ :LOVRQ *DXWVFKL 5 6KLPNHWV & 1HOVRQ:LOOLDPV %& 5RVVLHU DQG 53 /LIWRQ $ GH QRYR PLVVHQVH PXWDWLRQ RI WKH EHWD VXEXQLW RI WKH HSLWKHOLDO VRGLXP FKDQQHO FDXVHV K\SHUWHQVLRQ DQG /LGGOH V\QGURPH LGHQWLI\LQJ D SUROLQHULFK VHJPHQW FULWLFDO IRU UHJXODWLRQ RI FKDQQHO DFWLYLW\ 3URF 1DWO $FDG 6FL 86$ f S 0DQQLFN -% -, &RKHQ 0 %LUNHQEDFK $ 0DUFKLQL DQG ( .LHII 7KH (SVWHLQ%DUU YLUXV QXFOHDU SURWHLQ HQFRGHG E\ WKH OHDGHU RI WKH (%1$ 51$V LV LPSRUWDQW LQ %O\PSKRF\WH WUDQVIRUPDWLRQ 9LURO f S
PAGE 115

*LONHV 15 % +HQULVVDW '* .LOEXP 5& 0LOOHU -U DQG 5$ :DUUHQ 'RPDLQV LQ PLFURELDO EHWD JO\FDQDVHV VHTXHQFH FRQVHUYDWLRQ IXQFWLRQ DQG HQ]\PH IDPLOLHV 0LFURELRO 5HY f S +DQ 1 :KLWORFN DQG $ 3URJXOVNH)R[ 7KH KHPDJJOXWLQLQ JHQH $ KDJ$f RI 3RUSK\URPRQDV JLQJLYDOLV FRQWDLQV IRXU ODUJH FRQWLJXRXV GLUHFW UHSHDWV ,QIHFW ,PPXQ f S +DQQDY\ *& %DUU &'RUPDQ $GDPVRQ /5 0D]HQJHUD 03 *DOODJKHU -6 (YDQV %$ /HYLQH ,3 7UD\HU DQG &) +LJJLQV 7RQ%SURWHLQ RI 6DOPRQHOOD W\SKLPXULXP $ PRGHO IRU VLJQDO WUDQVGXFWLRQ EHWZHHQ PHPEUDQHV 0RO %LRO f S +HGHQ /2 ( )ULWK] DQG /LQGDKO 0ROHFXODU FKDUDFWHUL]DWLRQ RI DQ ,J$ UHFHSWRU IURP JURXS % VWUHSWRFRFFL VHTXHQFH RI WKH JHQH LGHQWLILFDWLRQ RI D SUROLQHULFK UHJLRQ ZLWK XQLTXH VWUXFWXUH DQG LVRODWLRQ RI 1WHUPLQDO IUDJPHQWV ZLWK ,J$ELQGLQJ FDSDFLW\ (XU ,PPXQRO f S /DUVHQ 5$ *( :RRG DQG 3RVWOH 7KH FRQVHUYHG SUROLQHULFK PRWLI LV QRW HVVHQWLDO IRU HQHUJ\ WUDQVGXFWLRQ E\ (VFKHULFKLD FROL 7RQ% SURWHLQ 0RO 0LFURELRO f S 3LVWRU 6 7 &KDNUDERUW\ 1LHEXKU ( 'RPDQQ DQG :HKODQG 7KH $FW$ SURWHLQ RI /LVWHULD PRQRF\WRJHQHV DFWV DV D QXFOHDWRU LQGXFLQJ UHRUJDQL]DWLRQ RI WKH DFWLQ F\WRVNHOHWRQ (PER f S 3URIW 7 + +LOEHUW /D\K6FKPLWW DQG 5 +HPQDQQ 7KH SUROLQHULFK 3 SURWHLQ RI 0\FRSODVPD SQHXPRQLDH LV D FRPSRQHQW RI WKH 7ULWRQ ;LQVROXEOH IUDFWLRQ DQG H[KLELWV VL]H SRO\PRUSKLVP LQ WKH VWUDLQV 0O DQG )+ %DFWHULRO f S 6RXWKZLFN )6 DQG '/ 3XULFK ,QWUDFHOOXODU SDWKRJHQHVLV RI OLVWHULRVLV 1 (QJO 0HG f S 7LPRQH\ -) :DONHU 0 =KRX DQG 'LQJ &ORQLQJ DQG VHTXHQFH DQDO\VLV RI D SURWHFWLYH 0OLNH SURWHLQ JHQH IURP 6WUHSWRFRFFXV HTXL VXEVS ]RRHSLGHPLFXV ,QIHFW ,PPXQ f S 6LJQDV & 5DXFFL -RQVVRQ 3( /LQGJUHQ *0 $QDQWKDUDPDLDK 0 +RRN DQG 0 /LQGEHUJ 1XFOHRWLGH VHTXHQFH RI WKH JHQH IRU D ILEURQHFWLQ ELQGLQJ SURWHLQ IURP 6WDSK\ORFRFFXV DXUHXV XVH RI WKLV SHSWLGH VHTXHQFH LQ WKH V\QWKHVLV RI ELRORJLFDOO\ DFWLYH SHSWLGHV 3URF 1DWO $FDG 6FL 86$ f S

PAGE 116

7DOD\ 65 3 9DOHQWLQ:HLJDQG .1 7LPPLV DQG *6 &KKDWZDO 'RPDLQ VWUXFWXUH DQG FRQVHUYHG HSLWRSHV RI 6IE SURWHLQ WKH ILEURQHFWLQELQGLQJ DGKHVLQ RI 6WUHSWRFRFFXV S\RJHQHV 0RO 0LFURELRO f S 0FOYHU .6 6 6XEEDUDR (0 .HOOQHU $6 +HDWK DQG -5 6FRWW ,GHQWLILFDWLRQ RI LVS D ORFXV HQFRGLQJ DQ LPPXQRJHQLF VHFUHWHG SURWHLQ FRQVHUYHG DPRQJ JURXS $ VWUHSWRFRFFL ,QIHFW ,PPXQ f S
PAGE 117

:DQJ 16 7DQ % +R DQG -/ 'LQJ 0RGXODU DUUDQJHPHQW DQG VHFUHWLRQ RI D PXOWLGRPDLQ VHULQH SURWHDVH (YLGHQFH IRU LQYROYHPHQW RISUROLQHULFK UHJLRQ DQG 1JO\FDQV LQ WKH VHFUHWLRQ SDWKZD\ %LRO &KHP f S 1DYDUUH :: DQG 2 6FKQHHZLQG 3URWHRO\WLF FOHDYDJH DQG FHOO ZDOO DQFKRULQJ DW WKH /3;7* PRWLI RI VXUIDFH SURWHLQV LQ JUDPSRVLWLYH EDFWHULD 0RO 0LFURELRO f S 7RQ7KDW + .) )DXOO DQG 2 6FKQHHZLQG $QFKRU VWUXFWXUH RI VWDSK\ORFRFFDO VXUIDFH SURWHLQV $ EUDQFKHG SHSWLGH WKDW OLQNV WKH FDUER[\O WHUPLQXV RI SURWHLQV WR WKH FHOO ZDOO %LRO &KHP f S 'KDU .) )DXOO DQG 6FKQHHZLQG $QFKRU VWUXFWXUH RI FHOO ZDOO VXUIDFH SURWHLQV LQ /LVWHULD PRQRF\WRJHQHV %LRFKHPLVWU\ f S 6FKOHLIHU .+ DQG 2 .DQGOHU 3HSWLGRJO\FDQ W\SHV RI EDFWHULDO FHOO ZDOOV DQG WKHLU WD[RQRPLF LPSOLFDWLRQV %DFWHULRO 5HY f S 1DYDUUH :: DQG 2 6FKQHHZLQG 6XUIDFH SURWHLQV RI JUDPSRVLWLYH EDFWHULD DQG PHFKDQLVPV RI WKHLU WDUJHWLQJ WR WKH FHOO ZDOO HQYHORSH 0LFURELRO 0RO %LRO 5HY f S /HH 6) DQG 7/ %RUDQ 5ROHV RI VRUWDVH LQ VXUIDFH H[SUHVVLRQ RI WKH PDMRU SURWHLQ DGKHVLQ 3, VDOLYDLQGXFHG DJJUHJDWLRQ DQG DGKHUHQFH DQG FDULRJHQLFLW\ RI 6WUHSWRFRFFXV PXWDQV ,QIHFW ,PPXQ f S 0D]PDQLDQ 6. + 7RQ7KDW DQG 2 6FKQHHZLQG 6RUWDVHFDWDO\VHG DQFKRULQJ RI VXUIDFH SURWHLQV WR WKH FHOO ZDOO RI 6WDSK\ORFRFFXV DXUHXV 0RO 0LFURELRO f S GH .H\]HU & YDQ GHU 'RHV DQG $'ULHVVHQ 7KH EDFWHULDO WUDQVORFDVH D G\QDPLF SURWHLQ FKDQQHO FRPSOH[ &HOO 0RO /LIH 6FL f S 3KLOOLSV DQG 76LOKDY\ 7KH ( FROLIIK JHQH LV QHFHVVDU\ IRU YLDELOLW\ DQG HIILFLHQW SURWHLQ H[SRUW 1DWXUH f S 9DOHQW 4$ -: GH *LHU YRQ +HLMQH '$ .HQGDOO &0 WHQ +DJHQ -RQJPDQ % 2XGHJD DQG /XLULQN 1DVFHQW PHPEUDQH DQGSUHVHFUHWRU\ SURWHLQV V\QWKHVL]HG LQ (VFKHULFKLD FROL DVVRFLDWH ZLWK VLJQDO UHFRJQLWLRQ SDUWLFOH DQG WULJJHU IDFWRU 0RO 0LFURELRO f S /XLULQN -f &0 WHQ +DJHQ-RQJPDQ && YDQ GHU :HLMGHQ % 2XGHJD 6 +LJK % 'REEHUVWHLQ DQG 5 .XVWHUV $Q DOWHUQDWLYH SURWHLQ WDUJHWLQJ SDWKZD\ LQ (VFKHULFKLD FROL VWXGLHV RQ WKH UROH RI )WV< (PER f S

PAGE 118

6HOXDQRY $ DQG ( %LEL )WV< WKH SURNDU\RWLF VLJQDO UHFRJQLWLRQ SDUWLFOH UHFHSWRU KRPRORJXH LV HVVHQWLDO IRU ELRJHQHVLV RI PHPEUDQH SURWHLQV %LRO &KHP f S )UDQFHWLF 2 03 +DQVRQ DQG &$ .XPDPRWR SUO$ VXSSUHVVLRQ RI GHIHFWLYH H[SRUW RI PDOWRVHELQGLQJ SURWHLQ LQ VHF% PXWDQWV RI (VFKHULFKLD FRW %DFWHULR f S +DLWL )8 6 /HFNHU ( 6FKLHEHO -3 +HQGULFN DQG : :LFNQHU 7KH ELQGLQJ FDVFDGH RI 6HF% WR 6HF$ WR 6HF<( PHGLDWHV SUHSURWHLQ WDUJHWLQJ WR WKH ( FROL SODVPD PHPEUDQH &HOO f S 'ULHVVHQ $3 )HNNHV DQG -3 YDQ GHU :RON 7KH 6HF V\VWHP &XUU 2SLQ 0LFURELRO f S /LQGH 5 9RONPHU(QJHUW 6 6FKUHLEHU DQG -3 0XOOHU ,QWHUDFWLRQ RI WKH %DFLOOXV VXEWLOLV FKDSHURQH &VD$ ZLWK WKH VHFUHWRU\ SURWHLQ
PAGE 119

'HXHUOLQJ ( $ 6FKXO]H6SHFNLQJ 7 7RPR\DVX $ 0RJN DQG % %XNDX 7ULJJHU IDFWRU DQG 'QD. FRRSHUDWH LQ IROGLQJ RI QHZO\ V\QWKHVL]HG SURWHLQV 1DWXUH f S 'HXHUOLQJ ( + 3DW]HOW 6 9RUGHUZXOEHFNH 7 5DXFK .UDPHU ( 6FKDIILW]HO $ 0RJN $ 6FKXO]H6SHFNLQJ + /DQJHQ DQG % %XNDX 7ULJJHU )DFWRU DQG 'QD. SRVVHVV RYHUODSSLQJ VXEVWUDWH SRROV DQG ELQGLQJ VSHFLILFLWLHV 0RO 0LFURELRO f S .UDPHU 9 5DPDFKDQGLUDQ 30 +RURZLW] DQG % +DUGHVW\ 7KH PROHFXODU FKDSHURQH 'QD. LV QRW UHFUXLWHG WR WUDQVODWLQJ ULERVRPHV WKDW ODFN WULJJHU IDFWRU $UFK %LRFKHP %LRSK\V f S .UDPHU + 3DW]HOW 7 5DXFK 7$ .XU] 6 9RUGHUZXOEHFNH % %XNDX DQG ( 'HXHUOLQJ 7ULJJHU IDFWRU SHSWLG\OSURO\O FLVWUDQV LVRPHUDVH DFWLYLW\ LV QRW HVVHQWLDO IRU WKH IROGLQJ RI F\WRVROLF SURWHLQV LQ (VFKHULFKLD FROL %LRO &KHP f S f /\RQ :5 DQG 0* &DSDURQ 7ULJJHU IDFWRUPHGLDWHG SURO\O LVRPHUL]DWLRQ LQIOXHQFHV PDWXUDWLRQ RI WKH 6WUHSWRFRFFXV S\RJHQHV F\VWHLQH SURWHDVH %DFWHULRO f S $XVXEHO )0 %UHQW 5 6WUXKO HG ([SUHVVLRQ DQG SXULILFDWLRQ RI PDOWRVHELQGLQJ SURWHLQ IXVLRQV &XUUHQW SURWRFROV LQ PROHFXODU %LRORJ\ -RKQ :LOH\ DQG 6RQV ,QF 1HZ
PAGE 120

'HPXWK '5 < 'XDQ +) -HQNLQVRQ 5 0F1DE 6 *LO DQG 5/DPRQW ,QWHUUXSWLRQ RI WKH 6WUHSWRFRFFXV JRUGRQLL 0 VVS$VVS% LQWHUJHQLF UHJLRQ E\ DQ LQVHUWLRQ VHTXHQFH UHODWHG WR ,6, RI 6WUHSWRFRFFXV SQHXPRQLDH 0LFURELRORJ\ 3W f S %XFNOH\ 1' /1 /HH DQG '/H%ODQF 8VH RI D QRYHO PRELOL]DEOH YHFWRU WR LQDFWLYDWH WKH VFU$ JHQH RI 6WUHSWRFRFFXV VREULQXV E\ DOOHOLF UHSODFHPHQW %DFWHULRO f S 6HLIHUW 7% $6 %OHLZHLV DQG /%UDG\ &RQWULEXWLRQ RI WKH DODQLQHULFK UHJLRQ RI 6WUHSWRFRFFXV PXWDQV 3, WR DQWLJHQLFLW\ VXUIDFH H[SUHVVLRQ DQG LQWHUDFWLRQ ZLWK WKH SUROLQHULFK UHSHDW GRPDLQ ,QIHFW ,PPXQ f S 'HPXWK '5 DQG '& ,UYLQH 6WUXFWXUDO DQG IXQFWLRQDO YDULDWLRQ ZLWKLQ WKH DODQLQHULFK UHSHWLWLYH GRPDLQ RI VWUHSWRFRFFDO DQWLJHQ ,QIHFW ,PPXQ f S /DHPPOL 8. &OHDYDJH RI VWUXFWXUDO SURWHLQV GXULQJ WKH DVVHPEO\ RI WKH KHDG RI EDFWHULRSKDJH 7 1DWXUH f S 7RZELQ + 7 6WDHKHOLQ DQG *RUGRQ (OHFWURSKRUHWLF WUDQVIHU RISURWHLQV IURP SRO\DFU\ODPLGH JHOV WR QLWURFHOOXORVH VKHHWV SURFHGXUH DQG VRPH DSSOLFDWLRQV 3URF 1DWO $FDG 6FL 86$ f S $\DNDZD *< /: %RXVKHOO 3&URZOH\ *: (UGRV :3 0F$UWKXU DQG $6 %OHLZHLV ,VRODWLRQ DQG FKDUDFWHUL]DWLRQ RI PRQRFORQDO DQWLERGLHV VSHFLILF IRU DQWLJHQ 3, D PDMRU VXUIDFH SURWHLQ RI PXWDQV VWUHSWRFRFFL ,QIHFW ,PPXQ f S %UDG\ /'$ 3LDFHQWLQL 3&URZOH\ DQG $6 %OHLZHLV ,GHQWLILFDWLRQ RI PRQRFORQDO DQWLERG\ELQGLQJ GRPDLQV ZLWKLQ DQWLJHQ 3, RI 6WUHSWRFRFFXV PXWDQV DQG FURVVUHDFWLYLW\ ZLWK UHODWHG VXUIDFH DQWLJHQV RI RUDO VWUHSWRFRFFL ,QIHFW ,PPXQ f S 6HLGPDQ &( .HYLQ 6WUXKO -HQ 6KHHQ DQG 7LPP -HVVHQ 7UDQVIRUPDWLRQ 8VLQJ &DOFLXP &KORULGH LQ &XUUHQW 3URWRFROV LQ 0ROHFXODU %LRORJ\ 5% )UHGHULFN 0 $XVXEHO 5REHUW ( .LQJVWRQ 'DYLG 0RRUH -* 6HLGPDQ -RKQ $ 6PLWK DQG .HYLQ 6WUXKO (GLWRU -RKQ :LOH\ DQG 6RQV 1HZ
PAGE 121

5KRGLQ 15 -0 &WDOR .% 7RPHU :3 0F$UWKXU DQG /%UDG\ &KDUDFWHUL]DWLRQ RI WKH 6WUHSWRFRFFXV PXWDQV 3, HSLWRSH UHFRJQL]HG E\ LPPXQRPRGXODWRU\ PRQRFORQDO DQWLERG\ $ ,QIHFW ,PPXQ f S YDQ 'ROOHZHHUG &' &KDUJHOHJXH DQG -. 0D &KDUDFWHUL]DWLRQ RI WKH FRQIRUPDWLRQDO HSLWRSH RI *X\fV D PRQRFORQDO DQWLERG\ WKDW SUHYHQWV 6WUHSWRFRFFXV PXWDQV FRORQL]DWLRQ LQ KXPDQV ,QIHFW ,PPXQ f S 0D % &7VDL DQG 5 1XVVLQRY %LQGLQJ DQG IROGLQJ LQ VHDUFK RI LQWUDPROHFXODU FKDSHURQHOLNH EXLOGLQJ EORFN IUDJPHQWV 3URWHLQ (QJ f S 0FOYHU .6 ( .HVVOHU -& 2OVRQ DQG '( 2KPDQ 7KH HODVWDVH SURSHSWLGH IXQFWLRQV DV DQ LQWUDPROHFXODU FKDSHURQH UHTXLUHG IRU HODVWDVH DFWLYLW\ DQG VHFUHWLRQ LQ 3VHXGRPRQDV DHUXJLQRVD 0RO 0LFURELRO f S W 5RELQVRQ & 7KH WZLQDUJLQLQH WUDQVORFDWLRQ V\VWHP D QRYHO PHDQV RI WUDQVSRUWLQJ IROGHG SURWHLQV LQ FKORURSODVWV DQG EDFWHULD %LRO &KHP f S 2OL 0: 1 5KRGLQ :3 0F$UWKXU DQG /%UDG\ 5HGLUHFWLQJ WKH KXPRUDO LPPXQH UHVSRQVH DJDLQVW 6WUHSWRFRFFXV PXWDQV DQWLJHQ 3, ZLWK PRQRFORQDO DQWLERGLHV ,QIHFW ,PPXQ f S 2WYRV / -U 2 0( 5RJHUV 3&RQVROYR %$ &RQGLH 6 /RYDV 3 %XOHW DQG 0 %ODV]F]\N7KXULQ ,QWHUDFWLRQ EHWZHHQ KHDW VKRFN SURWHLQV DQG DQWLPLFURELDO SHSWLGHV %LRFKHPLVWU\ f S 2UDO KHDOWK LQ $PHULFD D UHSRUW RI WKH 6XUJHRQ *HQHUDO &DOLI 'HQW $VVRF f S 3HWHUVHQ 3( 7KH :RUOG 2UDO +HDOWK 5HSRUW FRQWLQXRXV LPSURYHPHQW RI RUDO KHDOWK LQ WKH VW FHQWXU\f§WKH DSSURDFK RI WKH :+2 *OREDO 2UDO +HDOWK 3URJUDPPH &RPPXQLW\ 'HQW 2UDO (SLGHPLRO 6XSSO S 3LWWV 1% 5LVN DVVHVVPHQW DQG FDULHV SUHGLFWLRQ 'HQW (GXF f S 9DUJDV &0 -&UDOO DQG '$ 6FKQHLGHU 6RFLRGHPRJUDSKLF GLVWULEXWLRQ RI SHGLDWULF GHQWDO FDULHV 1+$1(6 ,,, $P 'HQW $VVRF f S (GHOVWHLQ %/ 7KH PHGLFDO PDQDJHPHQW RI GHQWDO FDULHV $P 'HQW $VVRF 6XSSO S 66

PAGE 122

5XVVHOO 0: 1. &KLOGHUV 60 0LFKDOHN '6PLWK DQG 0$ 7DXEPDQ $ &DULHV 9DFFLQH" 7KH VWDWH RI WKH VFLHQFH RI LPPXQL]DWLRQ DJDLQVW GHQWDO FDULHV &DULHV 5HV f S %UDG\ /0/ YDQ 7LOEXUJ &( $OIRUG DQG :3 0F$UWKXU 0RQRFORQDO DQWLERG\PHGLDWHG PRGXODWLRQ RI WKH KXPRUDO LPPXQH UHVSRQVH DJDLQVW PXFRVDOO\ DSSOLHG 6WUHSWRFRFFXV PXWDQV ,QIHFW ,PPXQ f S (JODQG 3* /' 'X DQG 3( .ROHQEUDQGHU ,GHQWLILFDWLRQ RI LQGHSHQGHQW 6WUHSWRFRFFXV JRUGRQLL 6VS$ DQG 6VS% IXQFWLRQV LQ FRDJJUHJDWLRQ ZLWK $FWLQRP\FHV QDHVOXQGLL ,QIHFW ,PPXQ f S +ROPHV $5 5 0F1DE DQG +) -HQNLQVRQ &DQGLGD DOELFDQV ELQGLQJ WR WKH RUDO EDFWHULXP 6WUHSWRFRFFXV JRUGRQLL LQYROYHV PXOWLSOH DGKHVLQUHFHSWRU LQWHUDFWLRQV ,QIHFW ,PPXQ f S 'HPXWK '5 '& ,UYLQH -: &RVWHUWRQ *6 &RRN DQG 5/DPRQW 'LVFUHWH SURWHLQ GHWHUPLQDQW GLUHFWV WKH VSHFLHVVSHFLILF DGKHUHQFH RI 3RUSK\URPRQDV JLQJLYDOLV WR RUDO VWUHSWRFRFFL ,QIHFW ,PPXQ f S 'HPXWK '5 (( *ROXE DQG 0DODPXG 6WUHSWRFRFFDOKRVW LQWHUDFWLRQV 6WUXFWXUDO DQG IXQFWLRQDO DQDO\VLV RI D 6WUHSWRFRFFXV VDQJXLV UHFHSWRU IRU D KXPDQ VDOLYDU\ JO\FRSURWHLQ %LRO &KHP f S 1DNDL 0 1 2NDKDVKL + 2KWD DQG 7 .RJD 6DOLYDELQGLQJ UHJLRQ RI 6WUHSWRFRFFXV PXWDQV VXUIDFH SURWHLQ DQWLJHQ ,QIHFW ,PPXQ f S 'XRQJ ) (LFKOHU $ 3ULFH 05 /HRQDUG DQG : :LFNQHU %LRJHQHVLV RI WKH JUDPQHJDWLYH EDFWHULDO HQYHORSH &HOO f S 3RKOVFKURGHU 0 :$ 3ULQ] ( +DUWPDQQ DQG %HFNZLWK 3URWHLQ WUDQVORFDWLRQ LQ WKH WKUHH GRPDLQV RI OLIH YDULDWLRQV RQ D WKHPH &HOO f S 3XJVOH\ $3 7KH FRPSOHWH JHQHUDO VHFUHWRU\ SDWKZD\ LQ JUDPQHJDWLYH EDFWHULD 0LFURELRO 5HY f S %OREHO ,QWUDFHOOXODU SURWHLQ WRSRJHQHVLV 3URF 1DWO $FDG 6FL 86$ f S (PU 6' +HGJSHWK -0 &OHPHQW 76LOKDY\ DQG 0 +RIQXQJ 6HTXHQFH DQDO\VLV RI PXWDWLRQV WKDW SUHYHQW H[SRUW RI ODPEGD UHFHSWRU DQ (VFKHULFKLD FROL RXWHU PHPEUDQH SURWHLQ 1DWXUH f S

PAGE 123

6LOKDY\ 76$ %HQVRQ DQG 6' (PU 0HFKDQLVPV RI SURWHLQ ORFDOL]DWLRQ 0LFURELRO 5HY f S 0DUWRJOLR % DQG % 'REEHUVWHLQ 6LJQDO VHTXHQFHV PRUH WKDQ MXVW JUHDV\ SHSWLGHV 7UHQGV &HOO %LRO f S 7MDOVPD + $ %ROKXLV -' -RQJEORHG 6 %URQ DQG -0 YDQ 'LMO 6LJQDO SHSWLGHGHSHQGHQW SURWHLQ WUDQVSRUW LQ %DFLOOXV VXEWLOLV D JHQRPHEDVHG VXUYH\ RI WKH VHFUHWPH 0LFURELRO 0RO %LRO 5HY f S /RU\ 6 /HDGHU 3HSWLGDVHV RI 7\SH ,9 3UHSLOLQV DQG 5HODWHG 3URWHLQV LQ 0ROHFXODU ELRORJ\ LQWHOOLJHQFH XQLW 8QQXPEHUHGf *Y +HLMQH (GLWRU 5* /DQGHV &R $XVWLQ 7H[ S -0 YDQ 'LMO $% + 7MDOVPD -'+ -RQJEORHG $ GH -RQJ 3URWHLQ 7UDQVSRUW 3DWKZD\V LQ %DFLOOXV VXEWLOLV D *HQRPH%DVHG 5RDG 0DS LQ %DFLOOXV VXEWLOLV DQG LWV &ORVHVW 5HODWLYHV 5/ $EUDKDP / 6RQHQVKHLQ -DPHV $ +RFK (GLWRU $60 :DKLQJWRQ '& S 7DPXUD + 7 .LNXFKL 5 6KLUDWR DQG + .DWR &ORQLQJ DQG '1$ VHTXHQFLQJ RI WKH VXUIDFH SURWHLQ DQWLJHQ ,,, 3$Df RI 6WUHSWRFRFFXV FULFHWXV )(06 0LFURELRO /HWW f S 6DWR < 2NDPRWR DQG + .L]DNL JES& DQG SDF JHQH PXWDWLRQV GHWHFWHG LQ 6WUHSWRFRFFXV PXWDQV VWUDLQ *6 2UDO 0LFURELRO ,PPXQRO f S ,JDUDVKL 7 ( $VDJD DQG 1 *RWR 7KH VRUWDVH RI 6WUHSWRFRFFXV PXWDQV PHGLDWHV FHOO ZDOO DQFKRULQJ RI D VXUIDFH SURWHLQ DQWLJHQ 2UDO 0LFURELRO ,PPXQRO f S %HUNV %& ) 6DUJHQW DQG 7 3DOPHU 7KH 7DW SURWHLQ H[SRUW SDWKZD\ 0RO 0LFURELRO f S 5DQGDOO // DQG 6+DUG\ &RUUHODWLRQ RI FRPSHWHQFH IRU H[SRUW ZLWK ODFN RI WHUWLDU\ VWUXFWXUH RI WKH PDWXUH VSHFLHV D VWXG\ LQ YLYR RI PDOWRVHELQGLQJ SURWHLQ LQ ( FROO &HOO f S /HFNHU 6 5 /LOL 7 =LHJHOKRIIHU & *HRUJRSRXORV 3%DVVIRUG -U &$ .XPDPRWR DQG : :LFNQHU 7KUHH SXUH FKDSHURQH SURWHLQV RI (VFKHULFKLD FROLf§ 6HF% WULJJHU IDFWRU DQG *UR(/f§IRUP VROXEOH FRPSOH[HV ZLWK SUHFXUVRU SURWHLQV LQ YLWUR (PER f S

PAGE 124

.XVXNDZD 1 7
PAGE 125

+XDQJ *& =< /L -0 =KRX DQG )LVFKHU $VVLVWHG IROGLQJ RI JO\FHUDOGHK\GHSKRVSKDWH GHK\GURJHQDVH E\ WULJJHU IDFWRU 3URWHLQ 6FL f S %HFN /) :X %UXQQHU DQG 0 0XOOHU 'LVFULPLQDWLRQ EHWZHHQ 653 DQG 6HF$6HF%GHSHQGHQW VXEVWUDWHV LQYROYHV VHOHFWLYH UHFRJQLWLRQ RI QDVFHQW FKDLQV E\ 653 DQG WULJJHU IDFWRU (PER f S &URRNH ( / %UXQGDJH 0 5LFH DQG : :LFNQHU 3UR2PS$ VSRQWDQHRXVO\ IROGV LQ D PHPEUDQH DVVHPEO\ FRPSHWHQW VWDWH ZKLFK WULJJHU IDFWRU VWDELOL]HV (PERf S *RWKHO 6) & 6FKRO] ); 6FKPLG DQG 0$ 0DUDKLHO &\FORSKLOLQ DQG WULJJHU IDFWRU IURP %DFLOOXV VXEWLOLV FDWDO\]H LQ YLWUR SURWHLQ IROGLQJ DQG DUH QHFHVVDU\ IRU YLDELOLW\ XQGHU VWDUYDWLRQ FRQGLWLRQV %LRFKHPLVWU\ f S /\RQ :5 &0 *LEVRQ DQG 0* &DSDURQ $ UROH IRU WULJJHU IDFWRU DQG DQ UJJOLNH UHJXODWRU LQ WKH WUDQVFULSWLRQ VHFUHWLRQ DQG SURFHVVLQJ RI WKH F\VWHLQH SURWHLQDVH RI 6WUHSWRFRFFXV S\RJHQHV (PER f S %XNDX % 5HJXODWLRQ RI WKH (VFKHULFKLD FROL KHDWVKRFN UHVSRQVH 0RO 0LFURELRO f S -D\DUDPDQ *& -( 3HQGHUV DQG 5$ %XPH 7UDQVFULSWLRQDO DQDO\VLV RI WKH 6WUHSWRFRFFXV PXWDQV KUF$ JUS( DQG GQD. JHQHV DQG UHJXODWLRQ RI H[SUHVVLRQ LQ UHVSRQVH WR KHDW VKRFN DQG HQYLURQPHQWDO DFLGLILFDWLRQ 0RO 0LFURELRO f S /HPRV -$ << &KHQ DQG 5$ %XPH *HQHWLF DQG SK\VLRORJLF DQDO\VLV RI WKH JUR( RSHURQ DQG UROH RI WKH +UF$ UHSUHVVRU LQ VWUHVV JHQH UHJXODWLRQ DQG DFLG WROHUDQFH LQ 6WUHSWRFRFFXV PXWDQV %DFWHULRO f S

PAGE 126

%,2*5$3+,&$/ 6.(7&+ 7UHYRU % 6HLIHUW ZDV UDLVHG LQ &KLQR &DOLIRUQLD ZKHUH KH SXUVXHG FULPLQDOV DV D SROLFH RIILFHU EHIRUH SXUVXLQJ D %6 LQ %LRORJ\ DW 6RXWKHUQ 2UHJRQ 8QLYHUVLW\ LQ $VKODQG 2UHJRQ )ROORZLQJ DWWDLQPHQW RI D 3K' LQ 0HGLFDO 6FLHQFHV DQG SRVWn GRFWRUDO WUDLQLQJ 7UHYRU KRSHV WR UHWXUQ WR WKH ILHOG RI ODZ HQIRUFHPHQW DV D IRUHQVLF VFLHQWLVW

PAGE 127

, FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRS %LRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 5REHUW $ %XPH 3URIHVVRU RI 2UDO %LRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDMSLp VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 3DXO $ *XOLJ 3URIHVVRU RI 0ROHFXODU *HQHWLFV DQG 0LFURELRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSHMMQGTXAOLW\ DVMMA GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ -DQLHO / 3XQFK 3URIHVVRU RI %LRFKHPLVWU\ DQG 0R %LRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQWL TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ $PGOIFI6 6WMMLLAYnHLV (PHULWXJAURIHVVRU RI 2UDO %LRORJ\

PAGE 128

7KLV GLVVHUWDWLRQ ZDV VXEPLWWHG WR WKH *UDGXDWH )DFXOW\ RI WKH &ROOHJH RI 0HGLFLQH DQG WR WKH *UDGXDWH 6FKRRO DQG ZDV DFFHSWHG DV SDUWLDO IXOILOOPHQW RI WKH UHTXLUHPHQWV IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 0D\ 'HDQ &ROOHJH RI 0HGLFLQH 'HDQ *UDGXDWH 6FKRRO

PAGE 129

81,9(56,7< 2) )/25,'$


UNIVERSITY OF FLORIDA
3 1262 08554 6108


xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E5JORPTFB_9O1AAF INGEST_TIME 2012-09-24T13:56:10Z PACKAGE AA00011846_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES



PAGE 1

MOLECULAR INTERACTIONS OF THE Streptococcus mutans SURFACE PROTEIN P 1: CONTRIBUTIONS TO PROTEIN STRUCTURE, ST ABILITY AND TRANSLOCA TION .. By TREVOR BRYANT SEIFERT A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2005

PAGE 2

C o pyright 2005 b y TREVORBRYANTSEIFERT

PAGE 3

ACKNOWLEDGMENTS I would like to thank all of the members of the Brady lab for sharing their knowledge and providing technical assistance during my stay in the lab. I am e s pecially indebted to Dr. Brady for offering to be my mentor and providing me with a new laboratory and research project after the failure of my initial 'mentor'' I would al s o lik e to thank my committee members, Dr Arnold Bleiweis, Dr Paul Gulig, Dr. Dani e l Puric~ and Dr Robert Burne for their ideas and advice Finally, I thank my parent s for t h e ir wholehearted support and encouragement during these seemingly endless y e ars of s tudy. 111

PAGE 4

T AB LE O F C ONT ENT S page ACK.N"OWL E D G ME NTS . . .. ..... .. lll LIST OFT.ABL E S ........... ....... .... ...................... .......... .. ....... ... . ..... . . ...................... . V ll LIST O F FIGURE S ... . .. .. .. . .. .. ..... .. .. .. .... .. . ..... ... .. .. ........ .. . ...... ... .. . ......... .............. viii AB s TRA. C T . . . .............. .. .. .. . .. . ........ .. . ....... .. ........ . . .. .. t _. X C HAPTE R 1 IN" T ROD UC TIO N . .. .. .. ....... .. ....... . ..... . ..... . .. ..... . .. . . .. ... .. . .. . .. . . . .. ... ..... . ........ 1 Str ep t ococc u s 1ii1,ta n s and Dent a l Ca ri es . . .... . .. .. . .. ........... . ......... ........................... 1 Maj o r Surface Protein P 1 . ... . .. .. . ... . . .. . . .... . .. . . . ..... . .. .... .. . . .. . .. . .. ............ ... 2 Pr o lin e and Pr o li ne Ri c h R eg i o n s ....... .. . ....... .. . ................... . ....... .... ........ .......... .. .. 4 Prot e in Tr a n s l oca tion ......... .. ..... .. . .. ....... .. .. .. ..... . . .. . ....... . . .. .. ...... ........................ 7 Dn aK and Rop A . ....... ... ....... ..... .... .... .. .. .. . ....... . . ......... . .. ...... ...... ..... ..... ......... 11 S un1mary and Sp e cifi c Aim s . . . . ... .. ...... .... .. . .. . .. . ......... . . .... . . .. . . ....................... 12 2 MAT E RIALS AND ME T HODS ... .. .. . .. .... ..... .. . .... .... .... .. . . .. .. ........ .................. 14 Bact e rial S t r a i n s, P l as mid s, an d G r owth Co ndit i on s .. ...... .. . . . .. ........................ 14 Id e ntificatio n of an Int r a mol e cular Int e ra c tion In vo l v in g th e Pralin eRi ch Region of Pl ..... ..... ..... .. .. .......... .. .. ........ . ............. .. .......... .............. . ......... .................. .. 14 P t rr i:fi c a t ion of A-r eg i o n and P Re g ion MBP Fu s ion Prot e in s .. .... .................. . 14 E nzym e-L in k ed Immuno s orb e nt A s sa y s ( ELISA ) to Detec t A-r egio n and PR eg ion fu .te 1act i on . .. . ........... .. . . ..... .. . .. .. ..... ... .. .. ..... . . . . .. ...... ............ ...... 19 E l imin ati on o f spa P D N A E n c odu 1 g t h e A R egi on . . ....... .. ............ ................ 20 E valu a ti o n o f Antibod y Bu1d i n g t o P 1 M .... .... ...... ... . . . ......... . ... ................ 2 1 As s e ss n 1e nt of E p i top e R es tor a tion b y E LISA . .. ..... .. . . .. ... ...... . ................. .... 21 P C R and C on st ru c tion of S nuta is s p a P and S gordo nii MS sspA and ssp B Subc l o n es ........... .. ..... .......... .. .... .... .. .. ... .......................... . .. .......... ............. 22 Puri fica t io n a nd Co n fim1ation of O S T-F u s i on P roteins ......................... .......... ... 23 C omp e tit ive Inh i bi t io1 1 E LIS A to D e tect A-R eg ion and P R eg i on I nteractio n ... 25 Bindin g St o i c hi o m etry of the A and P-R e g i on s b y Co ntinuo u s Var i at i on .... .... 25 An a l ys i s o f Pl T r an s l oc at ion and the Co ntribution of t h e A lanin eand P ralineRi c h R egio n s ........... . ............ ............ ... .. .. ............................. . .. ........ .. . ............... 26 Introdu c ti on of spaM i nt o S'. mutans P C3370 .... .............. . ....................... ....... 26 IV

PAGE 5

Analysis of PlLlA Cell Surface Exp r ession in PC3370 . . .. .. .. . . .. .............. .. .. ... 27 RNA and Dot B l otting for Co nfirmat i on of PIM Expression in P C3370 ..... ... 27 Western Immunoblot Analysis of Perip l asm Extracts from E coli MC4100 and CK1953 Harborin g pUCl 8, pDC20 pDC9, and pTS20 .... ............... .. ... 28 Constn1ctio11 of a Bici st roni c spa P for Exp r ession of a Djsco11tinuou s P 1 ......... 29 Evaluation of P 1 Fraginent Expression by We s tern Irmnunoblot ........... ... ......... 30 Evaluation of Surfac e Expressi on of Discontinuou s P 1 in S. r1iuta;zs ......... ....... 31 Introduction of S. gordoriii SspA and SspB A Regions into Pl LlA .. .................. 31 Western Immunoblot Analy s is of Chimeric Pl Containing the A-re gion of S. gordonii SspA and SspB ... ... ... .. ..... . ... . . ... .. .............. . .. ... .................... .. .. 32 Surface Expression o f SspA and SspB in S. muta1is PC3370 . .. . ..... ............ ... 32 Involvem e nt of RopA (T1igger Fac tor) and DnaK in the Maturation a11d Transl ocati on of P 1 ........ . ........ . .. .... .. ....... .. .. . .. . .. ......... . . ........... ................ .. .... 3 3 Evaluation of Pl Surf ace Ex pre ssio n by Whole Ce l l Dot Blot ii1 th e S. 111uta11 s ropA Mutant TW 90 ................... ....................................... ......... . ... . .. ... .. 3 3 Evaluation of P 1 Surf ace Expressio n b y Whole Cel l Dot Blot in S. 11zu( a n s SM12 a Low-Level Exp r esse r of Dnal ( .... ....... ...... ... ....................... ... ... .. 34 Analysis of dnaK Me ssage Levels by Quantitativ e Real Time PCR .................. 34 3 RESULTS ..... . . ... .... .. ................ ........ . .. ..... ... ...... . ................ . .. ... ........... ... ... . 36 Expression of Recombinant PlM and Recognition by Anti-Pl Mono clona l Antibodi es . .... . ..... .... .. ......... .... . .. .. . . ................................ . . . .. . ...... ....... 36 Evaluation of PIM Ex p ressio n in S. rnut a n s ................. . . . ... .. .. .. ..... ........... 37 Evaluation of spa P Sp ec i fic n lRNA in P C3370 Harboring the D e l etio11 Construct pTS21 ..... .......... .. .. .. .................. . ..... .... . ...................... ........... 38 Evaluation of Secr e tio11 of Pl Pl LlA, and PlAf> in E col i .. .... . . ..... ...... ....... 39 Interaction of the Aand P-Regions by ELISA . . .. .... .. .................................... 39 Restoration of Epitopes by the Interaction of the Aand P-Regions ... ...... ... ... 4 0 Inhibition ofMAb 4-1 O A Binding to Pl by an Aand P-Region Co mpl ex ........ 40 Stoichiometry of the Aand P-Region Interaction .... ... ......... ... . .. .. .. .. ........... 41 Interaction of Pl, SspA, a n d Ss pB Aand P-Regions .... ................. .................. 41 Introdt1ction of the A-Re g i ons of S s pA and S s pB into P l~A ................. .. .......... 42 Stability and Translocation of Chimeric P l Containing tl1e A-Region s of S s pA a11d SspB .. ............................................. . . . ... .. . . ..................... .......... 43 Evaluation of the Inv o l ven1entof S ec B in tl1e Secretion of Pl PIM and PIM in E. coli .. .............. . ... .......... .. . . ... .. ....... . . . . .... . ....................... ... 44 Expression of Discontinuou s Pl and Recognition by Anti Pl Monoclo nal Anti bodies . .... .. .. .. .. ............. . . ..... .... .. .... . . .... ... .. .. . ................................ .. 4 5 E valuation of Surf ace Expression ofDi.scontinuous Pl in S. mutans ................. 47 Surface Ex pression of Pl in a RopA-D efic ient S. mutans and Bact erial Adherence to Salivary Agglutinin .. . .. ..... ................ . ........... ... . .. . . ...... .. ... 47 Analy s is of Pl Surfac e Exp r essi on in a L ow Level DnaK Ex pr essing S niuta1i s Mutant . .. . ...................... ............ . .. . . . . ... ... .. . . .. . . ........ ... .. .. ... 49 Evaluation of dnaK mRNA Expression in S. mutans PC3370 Harb oring pDL289 pMAJJ 8, p MAD and pTS 2 1 .......................... ........................... .... 49 V

PAGE 6

4 DIS CU SSION AND C O NC L U SIONS . .... ...... ............. .. ... .... . .. ... .... .. ........ ... .. ... 78 Id e ntification of an Intramolecular Inter a ction within P 1 .. .. ... .. . . .... . ... .......... .. .... 79 Anal ys is of P 1 Tra.11s lo c ation a nd tl1 e C ontribu t i o n o f the Alanine and Pr o l i n e Ricl1 R eg i o n s . .. ................. ......... .... ..................... .. ....... ........... . .. ..................... 85 Invol v ement of RopA ( Tri gge r F ac tor ) and Dn aK in tl1e M a turatio n a n d T r a n s lo ca ti o n o f Pl ............... ......................... . .. .. .. ............................... ............ . 93 C onclusion s . .. ....... .. ........... .. ............ ...... .. .. .. ................... .... ........ .. . .................... 97 LIST OF REFERE NC ES ........... .. ........ .. . ......... ... .... .. .... . . .... . . .. ........ .. . ....... ... .. .. . .. 99 BIOGRAPHICAL SKET C H . ........ .... .. .. .. . .. . ........ ........... .. . .. .... ..... .. . ..... . .. .. ......... 1 15 V l

PAGE 7

LIST OF TABLES Table page 1 Bact eria l S tram s .... ............ .. .. ....... .. .... .. .. . ...... .. . .. ..... ..... . .. ........ ... .. ............ .......... 1 5 2. Pla smi d s . .. ..... ....... .............. ........ .. . .. .... .... .. . .. .. . .. .. . . .. . . .. ................................ 16 3. P CR Primers ... .. ..... .. .... .......... ...... . ...... .. .... .. . . . .. .... .. . .... .... .......... ... ..................... 1 8 Vll

PAGE 8

LIST OF FIGURES Figur e p age 1 Sch e m a tic repre s entati o n o f P l ...... . ... . .. . .. ... ..... ................ .. . . .. .. ... ......... ...... ........ 3 2 We s tern blot anal ys is o f Pl an d r ec o mbin a n t Pl lacki ng th e A-re g i o n ..... ...... .......... 5 1 3 Lack o f s urface expre ssi o n of P l d ev oid of th e A-re g i o n .............. . . .. . .... .. .. .......... .. 52 4 RNA dot blot an a lysis of spa P -s p e ci:fic mRNA levels in the Strep tococci t s n 2utans spa P-ne g ati ve mutan t P C3370 and d e riv at i ves . .. . .. ....... ...................... . ................ 53 5 We s tern immunoblot of c ytop la s m and periplasm fract io n s of E co l i DH5 a harboring p U C18 deri ve d Pl as n1 i ds e xpre ss in g full-l en gth Pl Pl~P Pl ~A and vector alone .. .. . .. .... .... ........................... .. .. ....... . ... .. .. .... . .. .. . ..... . ....... .. .. ............................ ........... 54 6 D e mon s trati on o f A-re gion a11d P-regi on int erac ti o n b y EL ISA ....... .... . .... ..... ... . ..... 55 7 Restoration of epitope s b y Aai1 d P-r eg ion inter a ction s as m ea sur e d b y EL I SA ..... . 56 8 Inhibition of anti-P 1 MA b 4-1 OA b i ndin g t o i mm o bi liz e d P 1 in E LIS A .. ................... 57 9 Stoichiometry of the mAb 41 OA epitop e . .... .. .. .... .. ................... ... .. ... .. . ... ... . .. ... . 5 8 l 0 Demonstration of similar l eve l of mAb 3-8D reactivi ty t o A-regi.on-G ST fu sion polypeptides of SspA Ssp B and P 1 b y Western i mmu noblot ... . .... . . .. ... .. .. .. . . ... 59 11 Demon s tration of inter a cti ons between the Aand P-r egi o ns of differ e nt anti ge11 vn proteins ...... ..... .. .. .. . ..... . .. ... .. . .. ..... ... .... ... ...... . ...... .. . .. ......... .. .............................. 60 12 Evaluation of reacti v it y of Aa nd P-re gi on depend e nt an ti P l mAb s w ith P 1 S s pA and SspB ................ .. ..................... ...................... .... .. . .. ...... .... ... .. ... .. .. ... ... .. .... ...... 6 1 13. Restoration of epitope s b y tl 1 e il1teraction of vaiiou s antigen I/ II A-re gio n s with the immobi l ized P-r e gion of Stre pt oc o ccus go l o n ii Ss pA ............... ..... . ... ......... 62 14 Re s toration of epitope s b y t he int e 1action of va 1i o u s a11tige 1 1 I / II A r egio n s with the immobilized P-r e gi on of S s pA. . ..... . . ............. . ..... .. ... ....... ....... ... ..... ........ 6 3 Vlll

PAGE 9

15 Restoration of epitopes by the interaction ofvariot1 s antigen I/II A re gions wit l1 the immobi l ized P-r egion of SspA ... . ... . ... ........................ .. . . ........................ .... 64 16 Re storation of epitopes by the interaction of various antigen I/ II A-regions with the inm1obilized A-regio11 of SspA .... . .. . ....................... ...... .. . ........ ........ .. ... ....... 65 17 Restoration of epitopes by th e i11teractio11 of vaii.ot1s antigen I/II A-re gions with the immobili ze d A-regio n of SspA .. ............. .. .. ... ........ ..... ..... ............ .. ...... ...... . 66 18 Restoration of epitopes by the i nte raction of variot1 s antigen I/II A-re gions witl1 the immobil ized A-r egion of SspA ....... .... .. ... .... .................... . .. . ......................... 67 20 West e rn in1munoblot of c hime1-ic PI co ntai11i ng tl1 e A-regions of SspA and SspB ... 69 21. Surface expression of S. gordo,zii SspA and S spB in S. 1n utans PC 3370 ................ 70 22. Demonsn ation of lack of ability of heterologo c1s A-regions to restore surface expression of P lM in PC 3370 ........ . ...... .................. .. . . ...... . . .. ... .. .. .. ........... 70 23. Western immunoblots of cell lysates of P C3370 ha1boring vector alone and pla s mids encoding Pl Pl M PlM + SspA A-region and PIM + SspB A r egio n . .. .. ..... ............................... ........................................................ ...... ....... 7 1 24. Western immunoblot of cytop l as m a11d p e ripl asm fractions of E coli MC4 l 00 (wild-type) and CK1953 (6.secB) harboring pDC20 (Pl) .. . . .................. ...... ...... 72 25. Schematic representation of di scon tinuou s P 1 ................. . ........ ........ . . ........... . .. .. . 73 26. We s tern immunoblot of Pl fragi11ents express e d fron1 pTS30 in E. coli ................... 73 27 Whole cell dot b l ot of S. ,riutanJ NG8 and PC 3370 l1arboring pDL2 89 vector control pMAD encoding Pl, an d pTS 3 l e n codjng disco n tin uo1:1 s Pl fra gtnents .... 74 28. Pl surface expression lev els of S. mittans UA159 a nd TW90 ( ropA mtttant ) at ear ly log stage traced with mAb 4-1 OA as m east 1r ed by densiton1etry .................... 75 29. Pl surface expression l evels of S. mutarzs UA l 59 and SM 12 (DnaK-defici e nt) at early log phase .. ... . . .. ...... ....... ...... .... .. .. . .................... ........... .. ... ... .. . . .. .. .. ... .... 76 30. Real-Time PCR quantific at ion of dnaK mRNA from S. mutans PC3370 harborin g the pDL289 vector alone and ex pr essing PI M-region, ft1ll-length Pl and P 1 ~A-region . .. . . . .. .......... ......................... ....................... ..... .. .. ........ ..... ........... 77 IX

PAGE 10

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy MOLECULAR INTERACTIONS OF THE Streptococ cus mutans SURFACE PROTElN Pl: CONTRIBUTIONS TO SURFACE STRUCTURE, STABILITY AND TRANSLOCA TION Chair: L. Jeannine Brady Major Departn1ent: Oral Biology By Trevor Bryant Seifert May 2005 Streptococcus rnutan s is considered to be the n1ajor e tiologic agent of htun a 11 dental caries. Attachment of S mutans to the tootl1 surface i s required for the developn1ent of caries and is n1ecliated, in part, by the 185 kD surface protein variously known as antigen I/II, PAc, and Pl. Such proteins are expressed by nea1ly all species of oral streptococci and have been identified as possible a11tigens for vaccine development In addition, researchers are utilizing Pl to study immune respons e and im1nunon1odu.lation. The goal of this resea1ch was to identify intramol ec ular interaction s witl1in P 1 and to examine their contributions to P 1 structure, stability, and translocation. To that end, this research demonstrates a) t}1at several anti-Pl monoclonal antibodies (mAbs) require the sim ultaneous presence of th e alanine-rich and pro line-rich regions for bindin g b ) that the pro line-rich region of P 1 interact s with the alanine-rich region c) tl1at like the pro line rich region, the alanine-rich region is required for the stability and tran s location X

PAGE 11

of Pl, d) that both the pro line-rich and alanine-rich regions are required for secretion of Pl in E co li, and e) that in E. co li P 1 is secreted in the ab se nce of SecB Addition al l y, it wa s demonstrated that the chaperone RopA (trigger factor) was not required for Pl translocation However its absence resulted in reduced P 1 mediated adherence to salivary agglutinin suggesting a role in Pl maturation DnaK was also s hown to b e involved in PI translocation and dnaK mRNA lev e ls were affected b y the pr esence of Pl deletion constructs Furtherrnore the Aand P-re g ion s of Pl we re s l1own to b e ca p ab l e of interacting with the Aand P-re g ions of the Anti gen I/II prot e in s, S s pA and SspB, from Streptococcus gordonii These interactions re s tored epitopes r ec ogni ze d b y seve r al anti-Pl mAbs. Replacing the A-region of Pl with th e A-regions of SspA and SspB al so restored some mAb binding but did not restore stability and trans location of P 1 to th e cell surface The results of this re sear ch have impli cations for understandin g s ur face localization of virulence factors in pathogenic microor g ani s ms and for und e r s t an d ing how the protein structure of a vacc i n e antigen co11tributes to recognition by antib odies XI

PAGE 12

CHAPTER 1 INTRODUCTION Streptococc1-1s n1i1ta1is and Dental Caries Streptococcus mutans is considered to be the major etiological agent of l1un1an dental caries [ 1 2], one of the mo s t co mmon infectious di s ea ses tl1at affect hu ma n s. S. mutans was first identified in a human carious lesion in 1924 and isolates were l ate r divided into eight serotypes designated a through h base d on differences in cell wall carbohydrate composition [3, 4 ]. Concurrent DNA hybridization studies further categorized the serotypes as four ge netic type s based upon tl1e guanine plu s cytosi11e (G+C) content of their genome s [5, 6]. The four gen e ti c typ es were subsequently classified as different species, Streptococcus critus (serotype a), Streptococc i ts ratti,s (se rotype b), St1~eptococcus sob ~ irzus (se rotypes d, g, h), and S. ,rzutans (serotype s c e, j). These species are collectively kr1own as mutans streptococci [7] S. mi,tan s se ro type c i s the n1ost common mutans streptococcus isolated from human dental plaque [1, 2 ] S. mutans is equipped witl1 seve ral prot eins that enable it s attachment and subsequent colonization of the tooth s urface In the pre se 11ce of sucrose, extracellular glucosyltransferases (GTF) synthesize several forms of branched extracellular g lu ca n s. These glucans provide a matrix for the aggregation of S mutans and other oral streptococci through interaction with proteins s uch a s the bacterial surface-lo ca li ze d g lucan-bindin g prot e in s (G BP ). S mittans po ssesses four GTF ge ne s, gtfA [8], gtfB [9], gtfC [10 ], andgtjD [11] a n d thr ee G BP ge n es,gbpA [ 1 2], gbp B [ 1 3], and gbpC [14] Mutational inactivation of the GTF genes has shown that their products are important to 1

PAGE 13

2 cariogenecity. However, a model for colonization of the tooth surface b y S mutans suggests that initial attachment to tl1e tooth peJlicle is protein-mediated followed by glucan-dependent bacterial accumulation [15]. The st1rface proteins that are implicated in the initial adherence of S. mutans are members of the antigen I/II super-family of multifunctional adhesins and are variously known as antigen I/II [16] Ag B [17] IF [18] Pl [19] SR [20], and PAc [21], and are encoded by the ge11es spaP or pac. Antigen VII like molecules are expressed in nearly all of the oral streptococci [22] and includ e SpaA [23]and PAg [24] from S. sobril'ius, SSP-5 from Strep tococcus sa nguis [25], and SspA [26] and SspB [27] from Strept ococc u s gordonii. Major Surface Protein Pl The genes spaP and pac hav e been cloned and sequenced [21, 28, 29]. N-ten~ninal amino acid sequencing of the proteins and the predicted amino acid sequence s indicate that the spaP and pac gene products differ by only 36 residues Major characteri s tics of the MR 185,000 Pl include a 38 residue amino-tenninal signal sequence, a region containing three 82-residue alanine-rich repeats, a 150 residue variable region in which 20 of the 36 aforementioned amino acid substitutions reside, a central proli11e-ri ch re g ion containing three 39-residue tandem repeats, carboxy-terminal walland memb1 ne spanning regions, and an LPXTG wall anchor motif [ 28] (Fig 1) Seconda1 y st1 c ture predictions of Pl based upon th e sequence of spaP indicate that the alanine-rich region would form an a-helicle coiled-coil structure while the central praline-rich region would fonn an extended P-sheet structure [28). Recently the variable region of the S.11'1utans serotype f antigen I/II was subcloned, and its crystal structure determined. The crystal structure data indicate that the variable region forrns a flexible P-sandwich [30].

PAGE 14

Sign.al Sequence (a.a. 1 38) A REGIO N ( a.a. 186 464 ) . . . . . . .. . . .. .. . 3 V REGION P REGIO N (a.a. 679 8 23) (a.a. 840 963) Figure 1 Schematic representation of Pl Wall Membrane C yu,pwrnic Spanning Spa:nnin; Tail Region Region ( a.a. 15 5 7 15 6 1 ) ( a.a. 1486 15 3 5) ( a.a. 15 3 6 1556 Anti ge n rm polypept i d es a r e s tru c tural l y c ompl ex a n d ex h i bit di verse b indit1g propertie s, which mediat e int e r a ct io n s with a variet y of s ub s trat es includin g h os t sa li vary agglutinin, fibronectin, fibrino ge n and collagen [31 32] Several region s ha v e b ee n implicated in the binding activities of antigen I/II polypeptide s. Brady et al [33] pr ov id ed e v iden ce th a t Pl po sse ssed mu l tip le s ite s contributin g t o s ali v ar y agg lu ti n i n b indi n g and that different regions might b e in vo l ve d in bindin g to so lubl e o r immobili ze d s al iva ry a gg lutinin. Later Scatcha r d anal ys i s of anti ge n I/II binding to s aliva-co a t e d hydroxyapetite showed th e bindin g to be mediated b y two s it es [34] In v e s ti ga t o r s h ave s how e d th a t recombinant p e ptid e f r a gment s derived from th e A-r eg ion b o und sa li va r y a gg lutinin [35] or salivary g lycopr o teins [36] and Senpuku e t al (1995 ) d e mon stra t ed that antib o di es specific to a p e ptid e fragment deriv e d fr o m PA c aa r es idu e s 200 -4 8 1 inhibited the binding of fluid-phas e s alivary component s to immobili ze d PAc. Furthermore an antigen I/II peptid e fragment c on s istin g of a a. residu es 8 1 6 -1 2 1 3 blo c ked S mutan s cell adh es ion to s aliva coat e d h y dro xy ap a ti te [ 37] and Kel l y e t a l [38] found anti ge n I/ II d e riv e d p e pt i d es co nsi s tin g o f re s idL1 es 1 00 5 1 0 44 an d l 085 1 114 to be inhibitory to S. mutan s adhe s ion to s alivary glycoprotein s.

PAGE 15

4 Proline and Proline-Rich Regions Praline is uniqu e a mon g the amino acids in that its sid e cl1ain is covalentl y bound to the backbo11e amide As a re s ult of this unusual bond the pro line residue h as a restricted backbone conformation [39] the bulkiness of its side chain r es tricts th e confo rmation of the preceding r es idu e [ 40] and th e pro line is un a ble to act as a hyd r ogen bond donor Praline is recogni z ed as an a-helix and ~-sheet br e ak e r and i s often l oc at e d one or two re si dues C-terminal of an a -helix [ 41] A sequence of four or more pr o lin es in a row adopts the confo1n1ation of an extended structure with three residues p er tum known as a polyproline II helix [ 42] The polyproline II helix i s a major structural element in collagen, pancreatic polypeptides, and neuropeptide s [ 43]. In a survey of surface proteins there were 90 occurre11ces of polyproline II helixes in 80 non homologous protein s [ 44] Praline-rich regions are biologically important in numerous unrelated prot e in s in a variety of organisms, both eukaryotic and prokaryotic Althou g h the function s of proteins containing pro line-rich re g ions can be quite diverse th e roles of the pralin e -ri c h regions appear to be fairly co n serve d : protein-prot e in int e ra c ti o n folding a nd s trL 1 ctu r e. In eukarotes anandan1ide amidase is r es ponsible for th e h y d1 01 ys i s of n e urom odulatory fatty acid amides and esters [ 45] The enzyme contains a nine residue pralin e -ri ch region, which upon removal resulted in loss of enzymatic activity and a cl1ange in su b c ellular lo ca li za tion of th e enzyme It i s s u ggested that the pro line-rich region may b e essential for the correct foldin g of th e amidase a lthough s im i lar pro lin e -ri ch r egions are not found in non-mammalian amidases [ 46]. Involvement in cellular localization l1as also been demon s trated for the praline-rich region in the eukaryotic enzyme dynamin

PAGE 16

5 Okamoto et al. has shown that a proline-ricl1 do1nain is involved in the enzym e's localization to coated pits and in it s GTP-binding activity [ 47] The relevance of pro line-rich domains to the field of medicine can be s e e n in th e hun1an disease Lidd l e syndro1ne. Liddle syndrome is a dise a se of the amilorid e s ensitiv e epithelial sodium channel [ 48] Th e sodium channel is compo s ed of three s ubunit s, two of which contain highly con s erved C-terminal pro l ine -ri ch domains Fraine s hift mutations resulting in the delet i on of at least 45 residues frotn the C -t erminal se gm e nt s o f the subunits have been the identified causes of thi s dise a se. More recently a m isse n s e mutation that results in the substitution of a leucine for a prolin e (P616) in tl1 e c on se r ve d pro line-rich domain of subunit p has been identified and correlated with the di se a s e The substitution has greater effect on channel activity than the d e letion of the compl e t e C t e rminal segment of both th e p a nd y s ubunits It i s s ug ges t e d th a t thi s pro lin e r es idu e i s involved in an esse ntial interaction with another protein and po s sibly another subunit [ 49] Proline-rich regions are al s o involved in prot e in-protein int e raction s betw ee n organisms. In the world of v irology, the transf o rmation of primary B l ympho c yt es with Ep s tein-Barr virus (EBY) is known to be depe11dent t1pon th e e x pression of th e E BY nuclear protein 2 (EBNA2) [50] The 483-residue EBNA2 contains a 36 residu e prolin rich region in the N-terminal third of the protein Of the 230 r e sidues of the N-t e rminal half of EBNA2 222 were not e ss ential for tran s form a tion of B lymphocyt es. Th e eig ht es s ential residues are s e v en proline s and a glutamine a nd it i s s u gge sted th a t t l 1 ey 1na y constitute a critical domain for s tructure or intramole c ular interaction [51]. La s tl y a n interaction between a praline-rich insect peptide and a molecular chaperone in bacteria

PAGE 17

6 has been identified. Pyrrhocori cin, an antibacterial p e ptide originally isolated from th e E uropean sap-s ucking bug Pyrr hoco ris apterus [52], kills sens iti ve s peci es by bi nding t o the bacterial DnaK [53] Pre v iou s l y, in an attempt to defme a role for the P-r egio11 in the adhesive fu11ction of Pl an internal deletion Pl liP (li 8 26-996), was co nstruct ed [54] The prolin er icl1 region (P-region) is highl y cons e rved an1o n g th e antigen I/ II family of oral st r eptococcal proteins and s imilar highl y r e p e titive pralin e -rich se quences ha ve been identified in a wide variety of bacterial protein s [556 4]. Homolo gy to the P-region of Pl i s fo und in numerous surface proteins in both prokaryotes and eukaryotes. Among thes e are the fibronectin binding prot eins of Streptococci ts pyog e ne s and Staph y lococcus azJreus [65, 66 ] an immunogenic secreted prot e in (isp) of S. pyogenes [6 7 ] and the virulence assoc iated suface protein PspA of S. p n eumonia [ 68]. The intern a lly del e t e d polypeptide P 1 M was expressed in both E. co li and in S mutans PC3370, an i sogenic spa P-ne ga tiv e mutant. We s tern blot s of PlLlP expressed in E.coli revealed a l oss in reactiv i ty for fiveof eleven Plspecific MAbs. These fi ve mAbs a l s o did n ot react t o a s ubclone of the P-region (826 996), sugges ting th at they recogni ze a complex Pl ep it o p e that is depend e nt upon the pre se nce of the P-re g i o n Although Pl LlP contains th e signa l se quence it was not translocated to th e surface of S mutans P C3370 (spaP). Also, in comparison to full-length Pl expressed fro1n pDL 2 89 only low le ve ls of PlliP were detected in the cytoplasm of P C3370, w hil e mRNA l eve ls were equ ivalent These d ata s u ggest that the P region may b e requir e d for P 1 stabi lity and s ub se quent tr ans l ocation to the cell s urface

PAGE 18

7 P1otein Translocation Since PlLlP posses s ed the N-tenninal signal sequence and C-terminal cell wall anchor motif, the lack of Pl LlP expression on the c e ll surface was unexpected. Proline rich regions are known to be involved in a variety of intraand intertnolecular protein protein interactions [69-78] including chap e ro11e-like activitie s. Wang et al. [79] identified a centrally located pr o line-rich r e gion in tl1e serine protease Factor C. The Lirnulus polyplzemus (horseshoe crab) F a ctor C is a 132-kDa secreted serine protease and contains a centrally located proline-rich region. The role of the pro line-rich region in the secretion and function of Fa c t o r C w as investigated through th e con s truct io n and expression of homologt1es w ith and wi t h o ut th e prolin e -ri c h regio11. Th e prolin e -ri c h region is flanked by an amino-t e rminal Ie c tin bindin g domain a nd a carbox y -temunaJ protease domain. Factor C is 1019 amino a c ids in length and the proline-rich region spans residues 630 690. Deletion of eith e r the lectin bindin g or protease domains resulted in peptides that were stably expre s s e d and s ecreted by tl1e cell. In contra s t deleting the proline-rich regio11 resulted in a protein that was found in the cytoplasm but was no longer secreted. In addition expre ss ion of a truncated peptide consisting of the runino-terminal 329 residues of Factor C was stable and secret e d while a peptide consisting of the secretion signal fused to tl1e carboxy-terminal protease domain was not secreted. Interestingly the addition of the pro line-rich region a mino-terminal to the protease domain restored secretion of the peptide but fusing th e proline-rich region c arboxy-terminal to the prot e a se domain did not re s tor e s e c r e ti o n To establish a role for the proline-rich region in the foldi11 g of Factor C a partial trypsin digestion analysis was p e rforrned Trypsin cleaves pr e ferentially at unfolded regions in proteins, and although there are nearly 100 potential trypsin cleavage sites in

PAGE 19

8 Factor C, four band s were dete ct ed after partial di ges tion. Th e v i si ble fra g ment s were attributed to compactly folded domains However Factor C without the praline-ri c h region was not detectable after 10 minutes of trypsin digestion indicating that the prot ein was in an unfold ed tryp s in-susc e ptibl e confo1mation. This s tud y revealed that th e pro line-rich region i s essential for the s tabilit y and sec r e tion of Factor C. B ecause this effect wa s similar to tl1at pr ev io 1 1 s l y d es crib e d for t he P-re gio n of Pl [54] th ese authors suggested that int e rnal proline-rich r eg ions may act as intramol ec ular chaperon es for correct folding and secretion of prot e ins that co 11tain them The homolog y of th e re gio n of Pl to the s urface prot e ins of numerou s organisms an d its conservation w ithin oral streptococci suggest that it pla ys an important rol e in Pl an d co n s iderin g th e pre va lence of pro line-rich re gio n s in protein-protein interactions it is likely th at th e region is involved in such an int e raction Recently Van Dollarw ee d et al. (2003) d e m o n s trated that the P-re gio n of Pl bind s to a polypeptide fragme nt of Pl that co ntain s th e ala nin e-r i c l1 r egion (A-region) Thi s interaction re store d the reactivit y of a Pl s p ec ifi c Mab that was not r eac ti ve to eithe r of the fragments individually and s ug ges ts that these regions int e ract in mature surface expressed, Pl X-ray crystallograph y ha s revealed that the variable region of Pl forms a flexible beta-sandwich that would place th e P-region and Are gi on into close pr ox imit y [30 ] Given that th e P r egio n i s required for t he native s tru ct ur e s tabilit y a nd tran s location of Pl and that the P-re g ion int e r acts w ith a fragment of P 1 containin g the A-region, it is likely that the A-region ma y also pl ay a role in th e structure, stability, and tran s location of Pl.

PAGE 20

9 To fully elucidate the role of the P-region in Pl tran s location a better understanding of the molecule s route of translocation represents an important goal There is no experimental data that identify the secretion pathway Pl or antigen I/II-like proteins use. However, based upon the method of P 1 cell wa ll anchoring, a route of translocation has been predicted Gram-positive s urface proteins containing the conserved C-te1minal LPXTG motif, s uch a s Pl are anchor e d to the cell wall b y the membrane anchored transpeptidase sortase. During cel l wall anchoring, sortase cleaves surface proteins between the threonine and the glycine of the LPXTG motif [80]. Following cleavage in S aureu s and List e ria mono cy togenes the protein s are linked to cell wall peptides via an amide bond [81 82] A lt hough sev e ra l aspects of peptidog l ycan structure in Gram-positive bacteria are variable [83], the principles of surface protein anchoring appear to be conserved [84] Lee and Boran[85] identified and insertionally inactivated the gene encoding sortase, s rtA, in S mutans As predicted, SrtAmutants secreted P 1 into the supernatant demonstrating that P 1 is indeed a sortase anchored protein Current evidence s ug ge sts that sorta s e anchored proteins are tran s located via th e Sec translocase [86]. The Sec-dependent secretion pathway has been well characterized and studied in E co li and to a le ss er extent in B s ubtil is In E co li the Sec-translocase con s i s t s of SecA SecY, SecE, SecG, SecD SecF and YajC [87 ] Two major tar g eting path w a ys c onver ge on the Sec-translocase, the signal re c ognition particle (SRP) pathway and the SecB pathway The E. coli SRP consists of a 4 5s RNA and the GTPase Ffh, both of which are required for cell viability [88]. Signal peptides of na s cent polypeptides are recognized by the SRP as they emerge from the ribo s ome [89] SRP binding s tal l s translation and

PAGE 21

10 targets the SRP-ribosome complex to the SRP receptor, FtsY [90, 91]. The complex is then targeted to the Sec-translocon where the ribosome docks and translation is restored The preprotein is cotranslationally translocated across the membrane via an integral membrane complex consisting of SecY SecE, and SecG. The ATPase SecA provides energy for the translocation [87]. In the case of posttranslational secretion, the cytoplasmic chaperone SecB targets preproteins to the Sec-translocon. SecB binds to nascent and full-length preproteins as they e merge from the ribosome [92]. SecB interaction prevents premature folding of the preprotein and delivers it to the Sec translocon in a secretion-competent state. Binding of the SecB-preprotein complex with SecA results in the transfer of the pr eprotein to SecA and the release of SecB [93]. The preprotein is subsequent ly translocated across the membrane through the Sec-translocon [94]. The SRP pathway exists in both gram-negative and gram-positive bacteria. Identified homo lo gs of the Sec-dependent pathway components in B. subtilis include SecA, SecYEG SecDF, YrbF, Ffb ru1d scRNA As the geno1ne sequences of gram positive bacteria have be come available, investigators have searched for l1omolo gs of SecB to no avail. However, a B. subtilis complementation study of an E. coli SecB null mutant revealed a functional ortholog, CsaA, with partially overlapping binding characteristics [95-97]. As previously stated, the SRP is essential for viability in E. coli, and this was assumed to be the case in all organisms However, an Ffh null mutant in S. mutans is viab le and Pl is translocated and expressed 011 the cell surface (98]. This suggests that if Pl secretion is Sec-dependent the targeting pathway is likely to b e SecB

PAGE 22

11 like and may require a SecB ortholog or po ssib ly an unrelated chaperone with similar functions. DnaK and RopA The translocation of Pl to tl1e cell surface in an S. mutans mt1tant devoid of the SRP pathway [98] would suggest that Pl is post-translationally secreted, and a protein of 1561 residues would most certainly require interactions with chape1ones to prevent misfolding and aggregation while transiti11g the cytosol The 70-kD heat s hock protein s (Hsp70s) are ubiquitous proteins found in the bacterial cytosol and seve r al compartments of eukaryotic cells including the endoplasmic retict1lum, the mitochondria, and the cytosol [99]. The E. coli Hsp70, DnaK has been extensive l y studied and is involved in a variety of cellular processes including both protein folding and degradation. In studies of substrate specificity it has been shown that DnaK preferentially binds to peptides tl1at contain hydrophobic residues [ 100] In proteins these hydrophobic residues are typically found in the core of the folded structure, or in subunit interfaces [101]. Nascent polypeptides emerging from the ribosomes as well as malfolded proteins, display short hydrophobic regions that are not exposed in the protein's native conformation. DnaK binds to these exposed hydrophobic segments, thereby preventing aggregation and further misfolding. Another chaperone that interacts with nascent polypeptides is trigger factor, a ribosome-associated peptidyl-prolyl cis-tra ns isomerase (PPiase). In S nzutans trigger factor is known as RopA. Trigger factor associates with tl1e lar ge ribosomal subunit at the peptide exit channel and binds to nearly all nascent polypeptides [102]. There is evidence that trigger factor cooperates with DnaK to promote the folding of a variety of cytosolic E. coli proteins [l 03] and that they share s ubstrate s and binding specificities

PAGE 23

12 [ 104]. In fact DnaK is not recruited to translating ribosomes that lack trigger factor [105]. Besides its chaperone activities trigger factor can catalyze cis-trans isomeri za ion of peptidyl-prolyl peptide bonds The PP lase activity of trigger factor is not required by all of the proteins that require trigger factor for proper folding, however the PP la se activity is essential for some [106]. In S. pyogenes, the PPia se activity of trigger factor influences tl1e conformation of the na sce nt cysteine protease, SpeB, which in turn directs the protea.se into one of several alternative folding patbways[l 07]. The malfolded proteases are subsequently not targeted to the secretion pathway. Summary and Specific Aims In an effort to characterize the role of the proline-rich region of Pl in the adherence properties of the molecule, Brady et al. (1998) deleted the region from Pl (PlAf>). While PlLlP retained the sequences believed sufficient for expression and translocation, unexpectedly, it was unstable and not translocated to the cell surface As there is a lack of research regarding protein translocation in gram-positive organisms and Streptococcus in particular, it was of interest to identify the role of the pro line-rich regio11 in P 1 stability and translocation. Since proline-rich regions are known to be involved in intraand intermolecular protein-protein interactions the first specific aim of this wo rk was to identify regions within Pl that interact with the proline-rich region Once a proline-rich region interaction was discovered, the second s pecific aim of this study was to analy z e the role of the interacting region in the structure, stability and traoslocation of Pl. Pl is a large and structurally complex molecule as is evident by the change in antibody reactivity seen against PlLlP that suggests complex and po ssi bly conformational epitopes Further evidence of the structural complexity of Pl was r evea l e d in the so lved

PAGE 24

13 crystal structure of the variable region [30]. Based upon the surface expression of Pl in S mutans lacking the SRP pathway [98] and the presumption that sortase-anchored proteins are secreted via the Sec translocase, the successful post-translational translocation of a large and con1plex molecule s11ch as Pl, must be dependent upon chaperones. The final specific aim of this work was to examine whether the chaperones DnaK and RopA contributed to P 1 translocation or function.

PAGE 25

CHAPTER2 MATERIALS AND METHODS Bacterial Strains, Plasmids, and Growth Conditions Bacterial strains used in this s tudy are listed in Table 1, and all plasmids used are listed in Table 2. Unless otherwise noted, all S. mutans strains were grown under anaerobic conditions at 37 C in Todd-Hewitt broth (BBL, Cockeysville, Md.) supplemented with 0.3 % yeast extract (THBYE) an d kanamyacin (500 g/n1l) as needed. E coli strains were grown aerobically at 37 C with vigorous shaking in Luria-Bertani broth (LB) (1 % [ wt/vol] tryptone, 0.5 % [ wt/vol] yeast extract l % [ wt/vol] NaCl, pH 7 0) supplemented with ampicillin (100 g/ ml) or kanainycin (50 g/ml) as appropriate. E. coli strai ns MC4100 and CK1953 were grown aerobically at 37 C with vigorous shaking in M9 medium (0 625% [wt / vo]] Na 2 HP0 4, 0 075 3/o [wt / vol] KH 2 P0 4, 0 2 % [ wt / vol] NaCl 0 028 % [ wt / vo l ] MgS0 4 0 1 o/o [ wt/vol] (NH 4 ) 2 S0 4 I % g luco se) S Llppl e mented with kanamycin (50 g/ml) and ampicillin (100 g/ ml) as appropriate. Identification of an Intramolecular Interaction Involving the Proline-Rich Region of Pl Purification of A-region and P-Region-MBP Fusion Proteins Overnight cultures of E .co li harboring pMA3 [54] or pMA41 [35] (Tab l e 1) were diluted 1:100 into fresh Luria-Bertani (LB) broth containing 100 ~Lg/ml of ampicillin and grown to an OD 6 oo of 0.5. The medium was supplemented with 0.3 mM isopropyl-b-D thiogalactopyrano side (IPTG), and the culture was incubated for an addition a l 2 hours at 37 C Periplasmic contents were extracted by os1notic shock [108] Affmit y 14

PAGE 26

Table 1. Bacterial Strains Strain E. co li DH5a BL21 MC4100 CK1953 S. mutan s NG8 UA159 PC3370 PC3370A P C 3370B PC3370C PC3370D SM12 TW90 Description F cp80dlacZLlM15 ~(lacZYA-argF)U169 deoR, recAl endAI h s dRl 7(r kmk + phoA supE44 'A. thi-1 gyrA96 relAl F ompT hsdSB (rb mB -) gal dcm E coli F araD 139~ (argF la c) U169, relA rspP thiA MC4100 se cB :: Tn5 Wild t ype serotype c Wild-type serotype c s paP-negative 1nutant derived from S. mutans NG8 PC3 370 transformed with pDL289 P C 3 3 70 transformed with pMAJJ8 PC3 370 transformed with pMAD PC3 370 transformed with pTS21 U A1 59 minimal expression of dnaK U A159 (ropA) S go rd o nii M5 Wild-type Source or Reference [109] [109] [11 O] [ 111] [54] [54] [54] [54] (Trus study) (Courtesy of J Lemos unpubli s hed) [112] [11 3 ] ...... Vl

PAGE 27

Table 2 Plasmids Plasmid pCR2 1-TOPO pMal-p pMA3 pMA41 pDL289 pMAJJ8 pDC20 pMAD pGEX-4T-2 pGEX-A pGEX-P pGEX-AP pGEX-BP pTS21 Description T I A cloning vector Vector for expression of maltose binding protein fusions pMal-p derived plasmid containing PCR-amplified DNA encoding amino acids 819 to 1017 of Pl pMal-p derived plasmid containing PCR-amplified DNA encoding amino acids 186 of 469 of Pl E c oli-streptococcal shuttle ve c tor provided by D le Blanc pDL289-derived plasmid containing internally deleted spaP encoding amino acids l to 825 and 997 to 1561 pUC18-derived plasmid containing PCR-amplified spaP encoding full-length P 1 pDL289-derived plasmid containing PCR-amplified spaP encoding full-length Pl Vector for expression of glutatluon e S-tran s f e ra se fusions pGEX-4T-2 derived plasmid containing PCR-amplified DNA encoding amino acids 179-466 of Pl pGEX-4T-2 derived pl as mid co ntaining PCR-amplified DNA encoding amino acids 816 1016 of P 1 pGEX-4T-2 derived plasmid containing PCR-amplified DNA encoding amino acids pUCl 8-derived plasmid containing internally deleted s paP encoding amino acids 1 to 178 and 465 to 1561 pDL289-derived plasmid containing internally d e leted encoding amino acids I to 1 78 and 465 to 15 6 1 Source or Reference (Invitrogen Corp ., San Diego CA) (NEB, Beverly MA) [54] [54] [114] [54] [54] [54] (Amersham Bio s cien ce s) (This study) (This study) (This study) [115] [115] ...... 0\

PAGE 28

Table 2, continued Plasmid pTS22 pTS23 pTS31 pTS30 pTS31 pAR-A pAR-B pDDA pEB-5 Description pTS21 containing S gordonii M5 DNA encoding the A-region ofS s pA pTS21 containing S gord o nii M5 DNA encoding the A region ofSspB pDL289 d e rived plasmid encoding Pl expressed as discontinuou s N-terminal (a.a.1-464) and C-terminal (a.a.465-1561) fragments p UC l 8-derived plasmid containing s paP encoding amino acids 1 to 465 and 466 to 1561 pDL2 89d e ri ve d plasmid containing spa P encoding amino acids 1 to 465 and 466 to 1561 pGEX-6T P derived plasmid containin g S. go rdo,zii M5 DNA encoding the A-region of SspA pGEX-6T P-d e rived plasmid containing S. go rdonii M5 DNA e 1 1 co di11g t h e Ar egion of SspB pGEM 7d e ri ve d plasmid co ntaining S. go rdonii MS DNA encoding S s pA driven by the SspB promoter region pU C l 9-derived plasmid containing S gordoni i MS DNA encoding SspB Source or Reference (This study) (This study) (This study) (This study) (This study) [116] [116] (D Demuth, unpublish e d) [25 ] ...... -J

PAGE 29

Table 3 PCR Primers Primer TS7 TS8 TS9K TSlOK TS17 TS18 TS19 TS20 TS21 TS22 TS24 TS25 TS28 TS29 TS41 TS42 TS4 3 DNAKS DNAKAS 16SRVS 16SFWD Sequence 5'GCCGACTATCCAGTTAAGTTAAAGGC-3' 5 -GCCAT A CT GTTCTTTAGTTGCCTG-3' 5 -GCGGTACCGTTGGATAAAGTGTGGAGTTTG -3' 5 -GCGGT ACCGCAGTGCGAAGT ACCTT A TC-3 5 'AAACTCGAGTCATTCATTCATTGTTCATCTT CG T ATGCCT-3' 5 -AAACTCGAGGGAGGAAAAA TGGCTTCT ATT AAAGCTGCACTG-3' 5 'GAAGACTT AAAAGCTCATCAAGC-3' 5' -CAACTTTTTCTTATATTTGGCAAGATC-3 5 -AAAGATCTAAAAAGTCATCAAGAAGAAGT-3 5 'GAACTCTTTCTTATATTTGGCAAGATC-3 5'-GGATCCAAAGATATGGCAGCTCATAAAGC-3' 5'GTCGACGATAAATCTTTTTGATATTTGG C AAGATCTG-3' 5 GGATCCGGT AAAA TCCGTGCGGTT AAT -3 5 -G TCGACGACACCAAAGTTCTGTCAATA TT AA -3' 5 -GGATCCGGT AAAA TTCGTGCGGTCAAC3' 5 'GTCGACAACCAA TGT CC GGTCGAT AT C-3' 5 '-GG A TCCTCAAA CA TT AA TG C AATTGGGGTT C-3' 5'-GG AGATGCTGTTGGCGGTGT-3' 5 'GGAAGT AT AACAG CA TTCGCTGA-3 5 '-AT A TCT ACGCATTTCA CC GC-3 5'GCTCTGGAAACTGTCTGACT-3' Target spaP spaP s paP s paP s paP spa P ss pA ss pA ss pB ss pB s paP sp aP s paP s paP ss pA ss pA and sspB ss pB dnaK d naK 16SRNA 16S RNA Underlined Re s triction Site Kpn I Kpnl BamHI Sall BamHI Sall B a m HI Sa ll BamIIl .00

PAGE 30

19 purification of the fusio11 proteins was perform e d by passage of the p e riplasrnic fraction s through a column of am y lose resin (Bio-Rad) and e luti on with 10 mM maltos e b y a standard protocol [108] Purified fusion prot eins were qua11tified using the bicinchoninic acid (BCA) protein ass ay ki t (Sigma) witl1 bo vi ne se rum albumin as the s tandard Enzyme-Linked lmmuno s orbent Assays (ELISA) to Detect A-region and P-Regioo Interaction Bindin g of the A-region to th e P-region was measured b y E LISA Sample we ll s of Cos tar High Bindin g pl ates (Co rnin g Incorporated Corning, N Y.) were coa ted overnight at 4 C, in triplicate with 1 0 0 l of 0. 1 M carbonate -bi carbonate bu ffe r (pH 9.6) containing 0.02% sodi LL m a z ide and I 00 ng of purified maltos e bindin g protein (MBP), A-region-MBP or P-region-MBP Coa ting buff e r and unbound anti gens were removed from the ELISA pl ate wells, and unreacted sites were blocked with PBS-Tw and overnight incubation at 4 C Plate s we r e washed four time s with PBS-Tw Purifi ed region-MBP P region-MBP and MBP were two-fold serially diluted in PBS-Tw and added to the wells, be g inning at I 000 n g/ well The plates were inc ub ated overnight at 4 C and washed four ti mes with PBS-Tw. A-region-specific MAb 3 8 D [35] or rabbit anti -MBP Ab (NEB B eve rl ey MA ) was added to th e we ll s at a 1 : 1 000 dilution Plat es were washed with PBS -Tw an d p e ro xi da se-labele d goa t a nti -mot1se I gG or goat a nt rabbit lg (Cappel ) were added to the wells at a 1 : 100 0 diluti o n Aft er washing, 100 of 0.0 1 M phosphate citrate bu ffe r (pH 5 .0) containing 0. 1 M o-phenylenediamine dihydrochloride and 0.0 1 2 % (vol/vo l ) hydro ge n pero x ide were a dded to eac h we l l. Plat es were in c ubated for 30 min at ro om temperature, and th e absorbance at 450 nm was record e d b y using an MPM Titertek n1odel 550 ELISA plat e r ea d e r (Bio Rad ).

PAGE 31

20 Elimination of spaP DNA Encoding the A-Region Fragments of spaP both upstream and downstream of the A-regio11 were amplifi e d by polymerase chain reaction (PCR) and subsequently ligated together to create s p a P!1A Fidelity of the reactions was confirmed by restriction and sequence analysis. Forward primer TS9k and reverse primer TS8 were used to amplify s paP DNA upstream of the region including the spaP promoter Forward primer TS7 and reverse primer TS 1 Ok were used to amplify spaP downstream of the A-region Prin1ers TS9 and TSlO contain engineered Kpnl restriction sites Primers TS7 and TS8 were engineered with singl e b ase changes that introduce silent mutations which 11pon ligation of the PCR product s produce a unique Sfol restriction site. Reactions were carried out in a UNO thermoblock thermocycler (Biometra, Tampa FL) with plasmid-encoded spaP pDC20 [54] a s the template and VENT polymerase (NEB) under the following conditions fo 30 cycle s : denaturation at 94 C for 30 seconds primer ann e aling at 53 C for 30 s econds primer extension at 72 C for 1 minute or 3 minutes and 30 seconds ; and final extension at 72 C for 7 min The resulting 727 and 3 568 bp gene fragments were ligated together and cloned into the SmaI site of pUC18 creating pTS20, which was introduced into E co li DH5a by electroporation Clones were screened on LB agar supplemented with 100 g/mL ampici]lin and 0 75 g/mL X gal (5-bromo-4 chloro-3 indolyl-P-D galactopyranoside ). White colonies were picked and tested for the presence of spaPM insert DNA after alkaline lysis Sequences of all recombinant constructs were confirm e d by the DNA sequencing core (University of Florida )

PAGE 32

21 Evaluation of Antibody Binding to Pl AA E coli DH5a harboring pTS20 or pDC20 were grown for 16 hours at 37 C harvested by centrifugation, and lysed by boiling for 5 minutes in SOS-sample buffer (4% [wt/vol] sodi\1m dodecyl sulfate [SDS], 2% [vol/vol] 2-mercaptoethanol, 20 % [vol/vol] glycero~ 125 mM Tris-HCI [pH 6.8], 0 1 mg ofbromophenol blue per ml) Proteins were separated by SDS-polyacrylamide gel electrophoresis on 7.5% (vol / vol ) acrylamide preparatory gels by the method of Laemmli [11 7]. Proteins were electroblotted onto nitrocellulose membrane (Schleichter and Schuell Keene, N.H ) for 1 hat 100 V by the method of Towbin et al. [118]. Immunoblots were blocked with PBS Tw and cut into 0.5 cm strips. Strips were incubated with anti-Pl MAbs [119, 120] at dilutions of 1 : 1000 in individual troughs of an Incutray (Schlei c hter and Schuell) After washing, strips were incubated in peroxidase-labeled goat anti-mouse IgG (Cappel) and developed with 4-chloro-1-naphthol solution (7 ml of PBS, 1 1nl of 4-chloro-1naphtha] [Sigma; 3 mg/ml in ice-cold methanol], and 8 l of 30 % [vol / v ol] hydrogen peroxide). Assessment of Epitope Restoration by ELISA Sample wells of Costar High Binding plates were coated as before with 500 ng of purified maltose binding protein (MBP), A-region-MBP, or P-r e gion-MBP Following blocki11g and washes as previously, purified A-region-MBP, P-region-MBP and MBP were serially diluted two-fold in PBS-Tw and added to the well s beginning at 500 ng/well. The plates were incubated overnight at 4 C and washed four times with PBS Tw. MAbs 4-lOA, 5-5D, and 6-1 lA were added to the wells at a 1 : 1000 dilution. Binding of the MAbs was traced with peroxidase-labeled goat anti-mouse IgG at a

PAGE 33

22 1 :2000 dilution the plates were d eve loped and th e absorbance w a s mea s ur ed as previousl y described PCR and Construction of S. ll1uta1ts spaP and S. gordo11ii MS sspA and sspB Subclones The P-regions of S. gordonii MS sspA and sspB and several regions of spaP were amplified by PCR and cloned into th e pGEX-4T-2 vec tor (Amersham Bio sc ienc es) for expression as fusion polypeptide s with glutathione S-transfera se (GST). Forward and reverse primers were designed ba sed upon the published sequences of sspA and ssp B (accession numbers U40025 and U40026 respectively) and the unpublished sequence of NG8 spaP. The primer sequences and engineered restriction sites are shown in Table 3. The following primers were used in these amplifications : sspA P-region ( a a. 8 08-10 08) TS41 and TS42, sspB P-region (a.a. 749-942) TS42 and TS43, spa P A-region (a.a. 179466) TS24 and TS25, and spaP P-region (a.a. 816-1016) TS28 and TS29 The se primers were engineered with BamHI and SalI restriction sites to enable subsequent cloning into the pGEX-4T-2 expression vector PCR was performed for 30 c yc les under the following conditions: den a turation at 95C for 3 min; primer anneali11g at 51 C for 30 se c ; and primer extension at 72 C for 40 sec. Final primer e xtension was carried out for an additional 7 min after the last cycle. The amplified PCR products of correct predicted size were clo11ed into the T / A cloning vector pCR2. l-TOPO (Invitrogen). This vector is supplied lineari ze d with overlapping thymidine resid ues that can be li ga t e d to th e overhanging adenosine re si du es gene r a t e d iJ1 the PCR-amplified products. In s ertion of foreign DNA into this region prevents the expression of /acZaallowing for blue-white screening of E. col i transformants. Ligated pCR2 l and PCR amplified products were used to transform E. coli DH5a b y calcium

PAGE 34

23 chloride [121] Clones were screened on LB agar supp lemented with 50 / mL kanamycin and 0.75 / mL X-gal. White colonies were picked and tested for the presence of sspA, sspB, and spaP insert DNA after alkaline lysi s. Plasmid DNA from each recombinant was restricted with BamHI (Promega) and SalI (Promega), and electrophoresed on 0. 7% (wt/vo l) agarose. The appropriate sized DNA fragments were excised from the gel and pttrified using a Qiagen gel extraction kit. Tl1e sspA sspB, and spaP fragments were ligat e d into Ba,nHI (Promega) an d Sall (Promega) linearized pGEX-4T-2 resulting in dir e ctional c loning downstream of the gst gene, which encodes the glutathione S-transferas e (GST) of Schistosomajapo1zicurr1i. Ligated DNA was used to transform E. coli BL21 a11d transformants were selected for on LB agar sup plemented with 100 g/mL of ampicillin and 75 g/mL X-gal. White colonies were screened for the pre sence of spaP -containi 11 g in s ert DNA as described previously The pGEX-4T-2-de1 ived plasmids encoding tl1e Pl Aand P-regions were designated pGEX-A and pGEX-P, respectively. The plasmids encoding the SspA and SspB P-region-GST fusion s were de signated pGEX-AP and pGEX-BP. Purification and Confirmation of GST-Fusion Proteins Recombinant E. coli harboring plasmid s encoding OST-fusion proteins and pGEX4T-2 as a control were grow11 for 16 hours in LB bro th supplen1ented with 100 g/m l of ampicillin (LB / AlOO) and p a s s aged 1:100 into LB / AlOO Following shaking at 25 C until an optical density at 600 run of 0 5 was acl1ieved, cultures were Sl lppl emented witl1 0.1 mM IPTG and grown f o r an additional 4 hours at 25 C. To confirm expression of each fusion protein lysates from each recombi11ant E. coli, as well as uninduced controls, were analyzed by SDS-PAGE and Western

PAGE 35

24 immunoblot on 7.5% (wt/vol) polyacrylamide gels Proteins in the gels were electro blotted onto nitroceliL1lo se membranes for 1 hour at 100 volts. Replicate filters were stained with colloidal go ld (Diversified Biotech Boston, MA) or blocked for 1 hour at room temperature with PBS -Tw. Membranes were incubated overnight at room temperature with anti-GST r a bbit polyclonal antisera (Amersham Biosciences) diluted 1 : 1000 in PBSTw Membran es were washed four times with PBSTw prior to incubation for 2 hours at ro on1 te mperature with affinity-purified peroxida se -lab e led goat anti-rabbit conjugate (ICN / Ca ppell ICN Biomedicals Aurora OH) diluted 1: 1000 in PBS-Tw Membranes were washed twice with PBS-Tw and twice with PBS prior to development with 4-chloro-1-n a pthol so lution for 30 min The P 1-GST fusion pr otei ns were purifi e d b y affinity c hromatography usin g glutathione sepharose 4B (Amersham Biosciences) IPTG induced recombinant E. coli were resuspended in PBS containing 1 mM PMSF (phenylmethylsulfonyl fluoride) and lysed by sonication on ioe 5 times for 15 seconds at power se tting 3 using a Sonic 300 Dismembrator (ARTEK Sy stems Corporation, Farmingdale NY). Triton X-100 was added to the sonicate to a fm a l v olume of 1 % (vol/vol). Following a 30 minute incubation at 25C, the sonicate was centrifuged for 1 0 minutes at 12 ,000 xg, and th e supernatant was applied to the g lutathione sepharose 4B. After repeated washes with PBS, the bound fusion proteins were eluted with 10 mM reduced glutathione in 50 mM Tris-HCl pH 8 The reco very of purified P 1-GST fusion proteins was confi rrn ed by Western immunoblot usin g a1 1ti -GST rabbit polyclon al an ti se ra (Ame r s bam Bio sciences). Purified fusion proteins wer e quantified using the bicinchoninic acid (BCA) prot ei n assay kit (Sigma) with bovine serum a lbumin as the standard.

PAGE 36

25 Competitive Inhibition ELISA to Detect A-Region and P-Region Interaction Individual wells of Cos tar High Binding plates (Corni1 1g Incorporated Conling N Y ) were coated overnight a t 4 C, in triplicate with 100 o fO.l M carbonate bicarbonate buffer (pH 9.6 ) c ontaining 0.02 3/ o (wt / vol ) sodiw n az ide and 100 n g of Pl Coating buffer and unbound antigens were removed from th e E LISA plat e we ll s an d unreacted sites were block e d with PBS-Tw and overnight in cu bation a t 4 C Plat es w e re wa s hed four times with PBS-Tw Purified A-region-OST, P r eg ion-GST a I : 1 molar ratio of A-region-OST and P-re g ion-GST, and GST were add e d to MAb 4-lOA dilt1ted I :8000 to a final concentration of 1 nM C ontrols included MAb 4-1 OA al o ne and no primary antibody. The mi x tures of P 1-GST fu s ions and MAb 4-1 OA were incub a t e d a t 4 C for 30 minutes and then applied to the PI coated ELISA plate at I 00 I per well The plates were incubated for 2 hours at 37 C and washed fo1.1r times with PBS-Tw Th e binding ofMAb 4-lOA to the immobili z ed Pl was traced with pero x ida sel a bel e d g o a t anti-mouse IgG (Cappel!) at a 1 :2000 dilution Th e plate s w e r e d eve lop e d w ith 4 -CN and absorbance was measured as previously described The p e rcent inhibi t i o n of MAb 4 1 OA binding to captured P 1 wa s calculated as 100 [ ( mean OD of Mab 4-1 OA + P 1GST fu s ion / mean OD ofMAb 4-l O A alone ) x 100] Binding Stoichiometry of the Aand P-Regions by Continuous Variation A variation on the Job Plot [122] was used to measure the binding s toichiometr y of the Aand P-regions requir e d for the formation of th e MAb 4-lOA epitop e. Purifi e d A region-GST and P-regionG ST fusion proteins w e re diluted in 0 1 M carbonate bicarbonate buffer (pH 9.6 ) c ontainin g 0 02 % ( wt / vol ) sodium az ide and th e n mi x ed in 7 different molar ratios ( 0:6 1 : 5 2: 4 3 : 3 4 : 2 5: I and 6: 0) whil e maintainin g a c on s tan t

PAGE 37

26 total concentration of 0.67 M. Tl1e mixture s were incub ate d at 4 C for 1 hour, and then 100 l per we ll was applied to a Costar High Bindin g plate (Co nun g Incorporated Co rning N.Y.) in triplicat e. Th e plate was incubated overnight at 4 C Coating buff er and unbound antigens were remo ve d from t he ELISA plate wells, a nd unr eacte d sites were blocked with an overnight i n c ubation in PBS-T w at 4 C. After washing 4 times with PBS-Tw, MAb 4-1 OA was adde d to th e we ll s at a 1 : 100 0 dilution Wells were washed with PBS-Tw and p e ro xidase -label ed goat anti-mouse IgG was added to the well s at a 1 : 2000 dilution After washing, the plat e was d eve loped with OPD, and absorbanc e was measured as above Ana l ysis of Pl Translocation and the Contribution of the Alanineand Prolioe-Rich Re g ions Introduction of spaM into S. 1n1,1ta1ts PC3370 The spaPM DNA inc lu ding the pro moter, was restri c t ed by Kpn I from pTS 20 a nd isolated by ge l e l ec tr op l1 o r esis an d puri fica tion wi th a Qia ge n ge l extraction kit The p u rified spaPM wa s liga te d int o the Kpn I si te of t h e E. col; S nri,t a ns s huttl e vector pDL2 89, creating pTS2 l and int rodt1ce d into E coli DH5a by e l ectro poration C lon es we re scree n ed on LB agar s upplemented with 50 g/ mL ampicillin Co loni es were picked and te s ted for the pr esence of spaPtiA in sert DNA after alkaline l ys i s pTS2 l was subsequently introduced to the S. muta n s sp a P-negative mutant P C3370 by natural transformation An overni g ht c ulture of P C3370 grown in THYE m ed ia was d i lut ed 1 :20 into THYE media containin g 5% (v o V vol) ste rile horse serum (THYHS). The culture was grown to Klett 100 at 37 C at w hich t ime pTS21 ( g/ rnl) was added. Afte r an a dditional 30 minute s at 3 7 C a11 e qual vo lume of THYHS was added to th e cultures.

PAGE 38

27 Following 90 minutes at 37 C, transformants were screened on THYE agar supplemented with 500 g/mL kanamycin. The sequences of all recombinant constructs were confrrmed by the DNA sequencing core (University of Florida). Analysis of Pl AA Cel l Surface Expression in PC3370 The spaP isogenic mutant PC3370 harboring plasmids encoding Pl (pMAD) Pl~A (pTS21) Pl~P (pMAJJ8) and vector only (pDL289) were grown for 16 hours at 37 C, the cells were harvested by centrifugation a nd washed twice with PBS. Cells were resuspended in PBS, and the densities of the suspensions were equalized at Klett 160. Twofold serial dilutions of the cell suspensions were made in PBS, and I 00 I of each dilution was applied in duplicate to two nitrocellulose membranes (Schleicher and Schuell) by using a 96-well dot blot manifold (Schleicher and Schuell) Wells were washed twice with 200 ml of PBS, and the filters were removed from the apparatus and blocked with PBS containing 0.25% (wt/vol) gelatin and 0 25% (vol/vol) Tween 20. Cell surface P 1 was detected with rabbit antiserum 230 [3 7 ] or Mab 3-1 OE [ 119] as th e primary antibodies dilt1ted 1 : 500 peroxidase-con j u g at e d goat a11ti-rabbit IgG and g oat anti-mouse IgG as the secondary antibodies dilut e d 1 : 1000, and development with 4chloro-1-naphthol solution RNA and Dot Blotting for Confirmation of Pl AA Expression in PC3370 Following the manufach1rer s protocol RNA was isolated from stationary phase cultures of PC3370 harborin g pDL289, pTS21 (PIM), and pMAD (Pl) using the Qiagen Rneasy kit (Qiagen, Valencia, CA) Total RNA c oncentration was measured by 0D 26 0 1 280 nm and standardized to ~ 92 g/ml by the addition of RNA dilution buffer ( 6x SSC 20 % formaldehyde). Samples were serially diluted two-fold, and 50 l of each were applied

PAGE 39

28 to a nylon membrane using a 96-well dot blot manifold (Schleicher & Schuell) The membrane was baked for 30 minutes at 120 C and incubated in DIG Easy Hyb (Roche Indianapolis, IN) for 2 hours at 37 C. The membrane was probed overnight at 37 C with digoxigenin-labeled PCR amplified, DNA complementary to the 3' end of s paP, nucleotides 3985-4125 The men1brru 1e was wa s hed, blocked for l l1our at 25 C in Roche blocking buffer, and inct1bated i n alkaline phosphatase-labeled anti-digoxigenin antibodies. After washing in detection buffer, cherniluminence s ubstrate, CSPD, was added and the membrane was exposed to Super Rx x-ray film (Fuji, Tokyo). Western Immunoblot Analysis of Periplasm Extracts from E. coli MC4100 and CK1953 Harboring pUC18, pDC20, pDC9, and pTS20 Periplasm contents of E coli DH5a harboring pUC18 pDC20, pDC9 or pTS20 and E.coli MC4100 and CK1953 a s ec B mutant [109], harboring pUC18 or pDC20 were extracted by osmotic shock [108]. Bri e fly cells were grown for 16 hours at 37 C. The medium was supplen1 e nt e d w ith 0.3 mM IPTG to induce p-galactasidase ex pres sion, and the culture was incubat ed for an additional 2 hour s at 3 7 C l1arv ested by centrift1gation at 7000 x g for 10 minutes, and re s uspended in 30 mM Tric-HCl/20 /o (wt/vol) sucrose, pH8 .0, and EDTA to a fmal concentration of lrnM. The cells were incubated at 25 C for 10 minutes while shaking, harvest e d by centrifugation for 10 minutes at 10 000 x g and resuspended in ice-cold 5 mM M g S0 4 Cells were ne xt incubated in a n ice bath for I 0 minutes centrifuged for 1 0 minut es at I 0,000 x g and again decanted One molar Tri HCl, pH 7.4, was added to the supernatant to a final concentration of 20 mM. The supernatant containing the periplasm contents was diluted 5 : 1 with SDS sample buffer and incubated for 5 minutes at l 00 C. The cell pellets were resuspended in SOS-sample buffer and also heated for 5 minttt es at 100 C. Proteins were s eparated on 7 .5 % (wt / vol)

PAGE 40

29 SDS-polyacrylamide gels and transferred to nitrocellulose for 1 hour at lOOV. Immunoblots were blocked and developed as described above for the dot blot assay Construction of a Bicistronic spaP for Expression of a Discontinuous Pl. The following engineering produced a genetic construct encoding s p a P that expressed Pl as two independent fragments the N-ter1ninal 465 residues and the te1rninal 1095 residues. Fragments of spaP both upstream and downstream of the 3 end of the A-region were amplified by PCR and s ubsequently ligated together to create a ''split'' spaP (Fig 3-5) Forward prirner TS9k and reverse primer TS 17 were used to amplify spaP DNA upstream of the 3' end of the A-region, including the spaP promoter Forward primer TS 18 and reverse primer TS 1 Ok were used to amplify spaP downstream of the A-region. Primers TS9 and TS 10 were engineered with KpnI restriction sites and primers TS 17 and TS 18 contain engineered XhoI restriction sites (Table 3). Primer TS 17 also encodes multiple stop codo11s for the termination of the N-terminal Pl fragment translation. Primer TS 18 contains the spaP ribosome binding site and encodes a start codon for translation of the C-tenninal Pl fragn1ent. Reactions were carried out i11 a UNO thennoblock ther1nocycl e r (Biometra Tampa, FL) with plasmid-encoded spaP pDC20 [54] as the templat e and HiFi DNA polymerase (lnvitrogen) for 30 cycles under the following conditions: denaturation at 94 C for 30 seconds primer annealing at 51 C for 1 minute, primer exten s ion at 68 C for 2 minutes and 30 seconds or 72 C for 1 minute and 30 seconds; and a final extension at 72 C or 68 C for 7 min. The rest1lting 1,653and 3,536-bp gene f ragn1ents were restricted with XhoI before being ligated together. The ligated fragments were gel purified and amplified by PCR as before using primers TS9 and TSlO und e r the following conditions for 30 cycles: denaturation at 94 C for 30 seconds, primer ann e aling at 58 C for 1 minute prim e r extension at 68 C for 3

PAGE 41

30 minutes 45 seconds; and 68 C for an additional 7 min The PCR product was cloned into the pCR 2.1-TOPO vector c re a ting pTS30, which was introduced into E. coli Top 10 cells according to ma11ufacturer ? s in s tructions. Clo nes were screened on LB agar supplemented with 50 / 1nL kanamycin and 0.75 g/ mL Xg al. White colonie s w e r e picked and tested for the pre s ence of spaP insert DNA after alkaline lysis. Plasmid pTS30 from the recombinant was restricted with Kpnl and electrophoresed on 0 7 % (wt/vol) agarose The appropriate sized split s paP DNA fragment was exci s ed from the gel and purified with the Qia ge n ge l e xtraction kit The split s p a P se quenc e w a s li g a te d into the Kpnl site of the shuttle vector pDL289 cr e ating pTS3 l and used to transform E coli DH5a by electroporation. Transformants were selected for on LB agar supp l emented with 50 g/mL ofkanamycin and 0 75 g/mL X-gal White colonie s were screened for the presence of s paPc ontaining insert DNA a s b e fore Sequences of all recombinant constructs were con.finned by the DNA sequen c ing core (University of Florida) Evaluation of Pl Fragment Expression by Western lmmunoblot. E c oli DH5a harboring pTS30 was grow11 for 16 hour s at 37 C harvested b y centrifugation and lysed by boiling for 5 minute s in SDSsan 1ple buffer ( 4 o/ o [ wt / vol] sodium dodecyl st1lfat e [SDS] 2o/o [vol / vol] 2-mercaptoeth a11 ol 2 0 % [ v ol/vol] g ly ce rol 125 mM Tris-HCI [pH 6.8] 0 1 mg ofbromophenol blue per 1nl) Proteins were separated by SDS-polyacrylamide gel electrophor e si s on 7. 5/o acrylamide pr e paratory gels by the method of Laemmli [ 11 7 ] Proteins were electro b lotted onto nitrocellulo se membrane (Schleichter and Schuell Keene N.H ) for 1 h at 100 V by th e method o f Towbin et al [118] Immunoblot s were blocked with PBST w Membr an es were

PAGE 42

31 incubated with A-region specific mAb 3-8D, Aand P-region dependent mAb 4-1 OA, and C-te1minal specific mAb 5-3E [119 120] at dilutions of 1 :000. After washing membranes were incubated in peroxidase-labeled goat anti-1nouse IgG (Cappel) and developed with 4-chlorol-napl1thol s olution Evaluation of Surface Expression of Discontinuous Pl in S. 1n1,ta1is Plasmid pTS31 was introduced into S. mutans PC3370 by natural transformation as before S mutans NG8 and PC3370 harboring pDL289 and derivatives expressing Pl (pMAD) and discontinuous Pl fragments (pTS31) were grown for 16 hours at 37 C Cells were harvested, applied to a nitrocellulose membrane and surface e x pression of P 1 was traced as before with MAbs 3-8D, 4-9D 4-1 OA 5-5D 6-11 A and 3-1 OE Introduction of S. gordo,iii SspA and SspB A-Regions into P1M DNA encoding the A-regions of sspA and sspB were amplified by PCR and ligated into the plasmid encoding Pl~A pTS21. pTS21 was con s tructed with two s ilent mutations that created a uniqt1e Sf o I recognition sequence at the site of th e delet e d region DNA [115] PCR was used to amplify DNA fragments of sspA and s s pB that encode 287 residues, which are homologous to the deleted A-region in the spaP construct PIM. Primers TS 19 and TS20 were used to amplify the sspA DNA fragment and primers TS21 and TS22 were u s ed to amplify the s s pB fragment (Table 3). Reactions were carried out in a UNO thermoblock thermocycler (Biometra Tampa FL) with chromosomal sspA and sspB as the templates and VENT polymerase (NEB) under the following conditions: (i) 94 C for 2 minutes ; (ii) 30 cycles of 94 C for 30 seconds 50 C for 30 seconds, 72 C for 30 and (iii ) 72 C for an additional 7 min The re s ulting 861 hp gene fragments were cloned into the Sf o I site of pTS2 l with E. c oli DH5a as the ho s t strain. Plasmid DNA was i s olated from clone s and in s ert orientation was confirm e d b y

PAGE 43

32 restriction digest and sequencing Tl1 e resulting plasmids, designated pTS22 (sspA region) and pTS23 (sspB A-region), were introduced into the S mutans spaP-negative mutant strain PC3370 by natural transformation as previously described. Transformants were selected for their ability to grow on THYE containing 500g/ml of kanamycit1 Western lmmunoblot Analysis of Chimeric Pl Containing the A-region of S. gordonii SspA and SspB Whole cell lysates of E. co l i DHSa harboring pTS22 and pTS23 ai1d mechanicall y lysed S mutans PC3370 harboring the same plasmids were electrophoresed on 7.5 % (wt/vol) SDS-PA gels tran s ferred to nitrocellulose and trac e d with a panel of eleven anti-Pl mAbs as previously de sc ribed Surface Expression of SspA and SspB in S. ,nutans PC3370 S gordonii MS SspA and SspB were expressed in the spaP-negative mutant PC3370, and translocation to the cell surface was detennined by whole cell dot blot. Plasmids containing sspA driven by th e sspB promoter pGEMssp A (unpublished), and sspB, pEB-5 [25] were kindly donated by D Demuth (University of Penn sy lvania Philadelphia, PA). pGEM-s spA was lineari z ed with SacI a11d blu11ted with Klenow fragment, followed by a second digestion with SphI. The sspA fragment was gel purified, ligated into the Sphl-Smal site of the streptococcal s huttle vec tor p DL289 and introdu ce d into PC3370 by natural tran s formation pEB-5 [25] was di g es te d w ith BamHI and Ecor I and the appropriate-sized sspB band was gel purifi e d The ssp B fragme 11t was li gated into pDL289 and introduced into PC3370 as previously de scr ibed Transformants were selected for their ability to grow on THYE containing 500 g/ ml of kanamycin.

PAGE 44

33 Involvement of RopA (Trigger Factor) and DnaK in the Maturation and Translocation of Pl Evaluation of Pl Surface Expression by Whole Ce ll Dot Blot in the S. ,,.,,,ta,,s ropA Mutant, TW90 Whol e c e ll dot blot s of T W90 [ 1 12], court esy o f To m We n (U ni ve r s it y o f F l o rid a, Gainesville FL) were used to det e rmin e wheth e r tl1 e r e du ctio n in adh e rence wa s du e t o a reduced level of s urface locali ze d Pl U A15 9 and TW90 we r e grown for 16 hour s a t 37 C in THYE broth. The cell s w e r e passaged into triplic ate c ultt1res at 1 : 50 in THYE broth, grown at 37 C to a Klett readin g of 50 and passaged a g ain in THYE broth at 1 :50 Cells were grown to Klett readings of 2 0 and 150, harvested by ce11trifugation and washed twice with PBS Ce ll s were r es uspended in 50 % o f the original cultur e v olum e of PBS Two-fold serial dilution s of the cell susp e n s io ns were made in PBS, and 100 I of each dilution was appli e d to replicate nitrocellulos e 1nem b ran e s (Schleicher and Schuell) by using a 96-well dot blot manifold (Schleicher and Schuell) Wells wer e washed twice with 200 I of PBS and the filters w e re remo v ed from the apparatus and block e d with PBS containin g 0 .2 5 % (wt/v ol) g el a t i n and 0.25% (vo l / v ol ) Tw ee n 20 Pl was detected with five anti-Pl monocl o nal antibodie s (33] that r e cognize cell surfac e Pl as well as with rabbit polyclonal s erum as the primary antib o dies each diluted 1 : 5 0 0 S e condary antibodies were g oat a nti-mouse I g G or g oat anti-r a bbit l g (MP Biomedical s, Irvine Ca ) diluted 1: 1000 The membranes were d e velop e d witl1 4-cllloro-1-naphthol solution Quantification of Pl s urface expression w as perforrn e d by densitometry usin g a Fluorchem imager and software (Alpha Innotech San Leandro C a ).

PAGE 45

34 Evaluation of Pl Surface Expression by Whole Cell Dot Blot in S. niuta,is SM12, a Low-Level Expresser of DnaK To examine the contribution ofDnaK to Pl surface expression, a whole cell dot blot experiment as above was perfonned using S. mutans SM12, which was engineered to express approximately 5% of the le ve l ofDnaK as the parent strain, UA159 (Lemos and Burne, in preparation, University of Florida, Gaine sv ille, FL)). S. mutans UA159 and SM12 were grown and harvested at early-log and stationary phases Klett readings of 20 and 150 and surface expression was dete1mined a s previou s ]y detailed. Analysis of dnaK Message Levels by Quantitative Real-Time PCR Real-Time PCR was utilized to evaluate the e ffects of expression of the Aand Pregion deletion constructs on dnaK mRNA level C ultures of PC3370 harboring pDL289 (shuttle vector), pMAJJ8 (Pl~P-region) and pMAD (Pl), and pTS21 (PlLlA-region) were grown in triplicate to Klett 100 after n1ultiple passage s, as above. RNA from each culture was isolated according to supplier's instructions using the Qiagen RNeasy kit (Qiagen, Valencia CA). The total RNA concentra t ion was measured by OD 260 1 2so nm. cDNA of dnaK and 16S RNA was synthesized from 0 5 g of RNA using primer dnaKAS and 16sRVS respectively and SuperScrip t II rever se transcriptase (Invitrogen, Carlsbad, CA) for IO minutes at 25 C 50 minutes 42 C, and 15 minutes at 70 C. Transcript levels were deterrnined by using iQ SYBR Gree11 Supermix (Bio-Rad Hercules, CA). Reactions were performed in a 25-l volume u s ing the manufacturer's protocols. The forward primers for dnaK and 16s RNA were DnaKS and 16SFWD Amplification was performed under the following c onditions: 30 seconds at 95 C, followed by 40 cycl es of 10 seconds at 95 C and 4 5 se conds at 60 C. Melt curve data was collected with an additional I 00 cycles of 10 sec onds sta rting at 60 C and increasin g

PAGE 46

35 by 0.4 C after cycle 2 and 15 seconds at 72 D N A amplification and fluorescence detection was performed with the iCycler IQ r eal-time PCR detection system and accompanying software (Bio-Rad) A s tandard C L11 ve was plott e d for th e r eac tion with values obtained from the amplification of know n qL1a11tities of DNA from dna K 1 6s RNA was used to normali ze RNA abundance for all 1eactions. For each experiment, cDNA was amplified from RNA which was freshly i sola t e d from each of three parallel ct1ltures of each transfonnant Real-Time PCT was cond u cte d on each cDNA sample triplicate resulting in 36 data point s for each tran sfo1111ant

PAGE 47

CHAPTER 3 RESULTS Expression of Recombinant Pl AA and Recognition by Anti-Pl Monoclonal Antibodies Regions of Pl that contributed to the epitopes fo r eleven anti-Pl mAbs were identified based on immunoblot analy sis of full-len g th and trun ca ted Pl polypeptid es Several of the se mAbs 611 A, 5-5D, 31 OE, and l6F, were ini tia ll y mapp ed to the central region of the protein, which contained the P-r egio n [12 0]. Deletion of the region (a.a. 826-996) from Pl elinunated the bindin g of mAbs 6-1 IA, 5-5D, 3-lOE, and 4-1 OA. A region contributing to the binding of tnAb 4-1 OA had also be e n mapped to the region ju s t amino-terminal to th e ce n tra l re gi on Surprisingly no ne of th e P-re g ion dependent mAbs bound to a P-r egi on s ubclone ( a.a. 8 19-101 7) [ 54] s ug ges tin g that the epitopes were complex and pos s ibly conformational Characterization of the epitope for mAb 6-1 lA was conducted by Rhodin et al [123] Construction of se veral Pl subclones and analysis by Western immunoblot revealed that residues 465 1561 w e re not sufficient for the binding ofmAb 6-1 IA These data s u ggested that the P r egio n a nd re s idu es amino-terrninal of a.a. 465 wer e n ecessa ry for mAb 6 -11 A binding Taken to get her with crystal structure data indicating that th e A-region a nd P-region may be in close proximit y [30 ] we elected to examine whether the A-region contr ibut e d to a complex structure also involving the P-r egio n. A spa P ge n e l acki n g D NA encodi n g th e A-region (a.a. 1 79 -4 66) was constructed by PCR and cloned into p UC l 8, creat in g pTS20, as det a iled in C h a pt e r 2. Pl lacking the A-region (Pl M) was detectable b y Western immunoblot in wh o le cell 36

PAGE 48

37 lysates of recombinant E. coli DH5a using anti-Pl polyclonal antibodies (data not shown). While full-length Pl migrates approximately 20-kD larger than its predicted ~ 165 kD on SDS-polyacrylamide gels PlL\A like PlL\P migrates at its predicted molecular weight. The effect o f deleting the A-region on the antigenicity of P 1 was examined by Western blotting utilizing the eleven anti-Pl monoclonal antibodies [33] Deletion of the A-region from Pl eliminated the reactivity of five of the eleven mAbs (Figure 2). Three of the non-re a ctive mAbs, 4-1 OA, 5-5D, and 6-11 A, are also not reactive with Pll\P [54]. Reactivity of mAbs 5-3E 2-8G, 3-3B, and 6-8C, which are specific to the C-terminus of Pl [120] confirmed that the deletion of the DNA encoding the A-region did not disrupt the reading frame. The Western blot also shows that like PIL\P PIM is stably expressed and easily detectable in E. coli. Evaluation of Pl AA Expression in S. m1,ta1is When expressed in S. mu ta n s, PIL\P wa s unstable and n o t detected on the ce ll surface [54]. To determine wh e th e r the del etion of the A-region resulted in similar Pl characteristics PIM was expr esse d in the s paP mutant PC3370. Whole cell dot blot analysis of PC3370 harborir1g pDL289 (vector), pMAD (Pl) or pTS21 (PIM) was u se d to exainine whether the A-region, lik e the P-region, is nece ssary for Pl surface expression in S mutans. These re s t1lts are shown in Figure 3 Two-fold serial dilutions of the cells were applied to the nitro ce llulose membrane in dt1plicate The positive control PC3370C expressing full-length Pl (row 4) demonstrated the reactivity of the antiserum with surface expressed Pl. Negative controls PC3370 and PC3370A vector only, (rows 1 and 2) showed la ck of reacti v ity of the a11tiserum witl1 cells lacking P 1 PC3370 harboring pTS21 encodin g PlL\A (row 3) was not reactive with the polyclonal

PAGE 49

38 antiserum indicating a lack of surface expression of Pl. These results indicated that Pl~A was not translocated to th e surface of PC3370. No PIM was detected in spent culture liquor, although Pl was found in the spent culture liquor of PC3370C (complemented spaP mutant) and NG8 (wild-type) (data not shown). To determine if the lack of detectable Pl~A on the surface was due to a problem with translocation out of the cytoplasm, cell lysat es were examined for detectable P 1 ~A. NG8, PC3370A, PC3370C, PC 3370, and PC3370 harboring pTS21 were subjected to mechanical lysis in a Mini B ead beater apparatus ru1d samples were analyzed by We ste rn blotting (data not shown). Full-length Pl was pr ese nt in both cell extracts and cell debris ofNG8 (wild-type) and PC3370C (complemented spaP mutant) Pl~A was not detected in either the cell extract or the cell debris of PC33 7 0 harboring pTS21, and no Pl was observed in the negative control s, PC3370A (vector only) or PC3370 Evaluation of spaP-Specific mRNA in PC3370 Harboring the Deletion Construct pTS21 With a lack of detectable P 1 l:lA in PC33 70, a n RNA dot blot was used to confirm that spaP~A was transcribed from the pDL289 sht1ttle vector in PC3370 (Figure 4). Dilutions of total cellular RNA were probed with a digoxinin-labeled probe corresponding to the 3' end of s pa P The top two rows correspond to the negative controls, PC3370 and PC3370A harboring th e vector only. The third row contains RNA from PC3370 harboring pTS2 l and the bottom row contains RNA from the positive control, PC3370 harboring pMAD. The dot blot shows that sp aPM message is expressed at levels equivale11t to the full-length spa P expressed from pMAD

PAGE 50

39 Evaluation of Secretion of Pl, PIM, and Pl~P in coli Since PIM and Pl ~p w e re und e tectable and po s sibl y unstable in S. ,nittar zs while being clearly detectable in E co li the u s e of E c o li as a model to determine the secretion competency of these proteins was examined. To this end, periplasmic extracts of E coli DH5a harboring pUC18, pDC20 pDC9 or pTS20 (vector only, and expressing Pl, Pl~ and PIM respectively) were prepared by o s motic shock and the presence of Pl and derivatives was detected by electrophoresis on SDS-polyacrylamide gels followed by Western immunoblotting These results are shown in Figure 5. Lanes marked ''C'' contain cellular lysates and lanes marked ''P'' contain periplasmic extracts. Lane s marked pDC20 contain cellular extracts from E c oli DH5a harboring pDC20 (full-length Pl) and clearly show that P 1 is present in both the cytoplasm and th e peripla s m. Lanes n 1 arked pDC9 show cellular fractions from DH5a harborin g pDC9 and show that PIL\.P i s pre se nt in the cytoplasm, but absent from the peripla s m. Lan es pTS20 corre s pond to cell fractions from DH5a harboring pTS20 and s h o w th a t like PlL\.P PlL\.A is present in the cytoplasm, but not translocated to the p e riplasm. Lan e s marked pUCl 8 are cellular lysates and periplasm extracts from E. c oli harboril1 g pUC18 (vector only). These result s suggest that E. coli may be a viable model for the s tLtdy of the intramolecular requirements for Pl translocation. Interaction of the Aand P-Regions Detected by ELISA The demonstration that the binding ofmAbs 4-1 OA 5-5D and 6-1 lA to Pl were dependent upon the simultaneous prese11ce of the A and P-regions and work b y v an Dolleweerd et al [124] characteri z in g a complex epitope compri s ed of the P region and a fragment of Pl containing the A-region suggested a po s sible interaction between these

PAGE 51

40 domains. To detennine whether the isolated A(a .a. 186-469) and P-regions (a.a. 8191017) were capable of such an interaction, ELISA was used to evaluate binding (Figure 6). To facilitate protein purification, the A-region and P-region of P 1 were expressed as fusions with maltose-binding protein (MBP), pMA41 and pMA3 respectively (Table 1 ). Purified P-region-MBP or MBP alone as a negative control was immobilized in ELISA plate wells. After washing and blocking the plates, two-fold serial dilutions of A-region MBP were added to the wells. Binding of A-region-MBP to tl1e inunobilized prot eins was detected by the A-region-specific MAb 3-8D. As shown, the A-region -MBP bound to P-region-MBP in a dose-dependent n1anner, but not to MBP alon e MBP alone did not bind to MBP or to P-region-MBP ( data not shown) Restoration of Epitopes by the Interaction of the Aand P-Regions The requirement for the simu ltan eo us presence of both the Aru1d P-regions for MAb 4-lOA, 5-SD, and 6-1 lA binding to Pl suggested that both of these regions contribute to the epitopes for these mAbs. Reactivity of these mAbs against ELISA plates coated with the Aand P-regions was tested as above (Figure 7) The ELISA revealed that while tl1e mAbs did not react to the Aor P-regions alone, they did react to the wells containing both regions Additionally, MAb 4-1 OA reacted equal ly well regardless of which region is immobilized while mAbs 5-5D and 6-1 lA clearly reacted better when the P-region is immobilized to the plate. Inhibition ofMAb 4-lOA Binding to Pl by an Aand P-Region Complex Competitive inhibition ELISA was used to assay the ability of the Aand P-region s to interact in solution phase It was previously shown that the binding of MAb 4-1 OA to Pl was dependent upon the presence of both the Aand the P-regions In this assay, the ability of A-region and P-region-GST fusions alone and together to inhibit MAb 4-1 OA

PAGE 52

41 binding to immobilized P 1 was analyzed. As shown in Figure 8 as a percentage of inhibition MAb 4-1 OA bindin g to immobili ze d P 1 was not inhibited by A-region-GST, region-GST or GST alone. However, MAb 4-lOA bindin g was inhibited by a mixtur e of A-and P-region-GST as well as by Pl in solution. Stoichiometry of the Aand P-Region Interaction A quasi-continuous variation assay was performed to determine the stoichiometry of the Aand P-region int e ra c ti o n r e quir e d for th e reconstitution of the epitope required by MAb 4-1 OA. Varying molar ratio s of Aand P-region-GST fusion proteins were mixed while maintaining a constant total molar concentration. The A-region/P-region mixtures were immobili ze d on a 96 -well ELISA plate, and binding ofMAb 4-lOA to the mixtures was traced with pero xi dase-labeled goat anti-mouse antibody. The ma x imum binding ofMAb 4-lOA to the A-region/P-region com plex was clearly seen at a 1 : 1 molar ratio (Figure 9). Interaction of Pl, SspA, and SspB Aand P-Regions The Aand P-regions of Pl are approximately 70% identical to the same regions in the S. gordonii M5 SspA an d SspB, also member s of the antigen I/Il family. To determine whether the SspA and SspB Aai1d P-r egions exhibited the same bindin g characteristics as the Pl region s, ELISA was used to analyze their ability to interact with one another and with the Aand P-re gio ns of Pl. Aru1d P-region-GST fusion protein s were purified by affinity column chromatography and immobilized to ELISA plates as previously de sc ribed Two-fold serial dilutions of A-region-GST fusion proteins were incubated with the immobilized P-region-GST proteins, and binding was traced wit h the A-region specific mAb 3-8D as befor e. Figure 11 s how s that the A-regions of Pl SspA 1 and SspB are capable of bindin g to the P-regions of all three of the antigen I/II family

PAGE 53

42 proteins. As measured by ELISA and Western blot (Figure 10) mAb 3-8D reacts equally to each of the A-region-GST fu s ion s. Anti-Pl mAb Epitope Restoration by the Interaction of Aand P-Regions of SspA and SspB Based on the demonstrated restoration of epitopes by the i11teraction of the Aand P-regions of Pl the interaction s of the Aand P-regions of SspA and SspB and the reactivity of mAbs 4-lOA and 5-5D to full-length SspA and SspB (Figure 12 ), re sto ration of epitopes for them.Abs by th e interaction of the Aand P-regions of SspA and SspB was examined. Reactivity ofmAbs 4-lOA, 5-5D, and 6-1 lA with a combination of the Aand P-regions was tested by ELISA as previou sly described. As shown in Figures 13 through 18, none of the mAbs r eacte d to the Aor P-regions alone; however the results showed that all three mAbs reacted to all A-region/P-region interactions in which a Pl fragment was the overlaid moiety. The binding of a ll three mAbs was also restor ed upon the interaction of any P-region to the immobili ze d A-region of Pl The interaction of SspA A-region with immobilized Pl P-region was also able to restore binding of nlAb 55D. MAb 5 SD binding was also restored to a more limited extent when the P-re gion of Pl was overlaid on th e immobilized A-region of SspA. In Stlffiffiary, a ll heterolo g ous and P-regions interacted, yet not all of the int eractions restored anti-Pl mAb ep it opes. Introduction of the A-Regions of SspA and SspB into PIM The identification of the interaction between the A-regions of SspA and SspB and the P-region of Pl including the re stora tion of the mAb 5-SD epitope s1 1 gges ted that some degree of Pl structure was attained but native s tructure was not fully restored at the polypeptide level. To deterrnine whether introduction of the A-regions of SspA and SspB

PAGE 54

43 into Pl~A could restore nati ve strt1ctt1re and translocation of the deletion construct each A-region was ligated in-frame into the site of the deletion in P 111A The homolo gy between each of the A-regions is illl1strated in Figure 19. The resulting chimeric Pl proteins were examined for restoration of mAb binding by Western immunoblot (Figure 20). The binding of mAb 3-8D demonstrated that the S. gordonii A-regions had been in se rted into P 1 D,..A and were in-frame (panel A). Restoration of binding was only seen for mAb 5-SD with the chimeric Pl protein containing the A-region of SspA (panel B) Carboxy-tenninal specific mAb 6-8C reacted to both chimeric proteins indicating that the insertion was in-frame and that the proteins were not truncated (data not shown). The bands that m.Ab 6-8C reacted to were of the same molecular weight as the band th a t 5-5D reacted to in panel B. Full-length Pl migrates on SDS-polya c rylamide gels near 185 kD. Oddly neither chimeric protein appeared to migrate s lower than PlLlA It is apparent that the introduction of the A-r eg ions did not restore native Pl migration characteristics to the proteins Stability and Translocation of Chimeric Pl Containing the A-Regions of SspA and SspB. Although full native structure based upon recognition by all Aand P-dependent mAbs was not achieved, the binding of 5-5D to the S s pA chimeric construct indicated that some degree of Aand P-region interaction had been restored therefore it was still of interest to examine the possible restoration of translocation of the chimeric molecules to the cell surface. To insure that there was not an intrinsic pr ob l em with tl1 e transloc at ion of the S. gordonii proteins to the su1face of S. mutans, SspA an d SspB were expressed in PC3370. Whole cell dot blots were performed and expression was traced with mAb 5-5D as it demonstrated the strongest cross-reactivity with SspA and SspB in W estem blots.

PAGE 55

44 Figure 21 demonstrates that both SspA and SspB were translocated to the st 1rfac e in S mutans. The surface expression of chimeric Pl containing the A-regions of SspA and SspB was also examined by whole cell dot blot. PC3370 harboring pDL289 pMAD (Pl), pTS21 (Pl~A), pTS22 ( Pl~A +Ss pA A-region), and pTS23 ( PlM +SspA A-region) were bound to nitrocellulos e membrane u sing a 96-well dot bl ot manif o ld. Surfac e expression of Pl was traced with mAbs 4-lOA and 5-5D as they are re act ive to Pl on the cell surface and were reactive to SspA and SspB by Western immunoblot (Figure 22). No surface expression of either cl1imeric Pl was detected on the surface of PC3370. No full-length chimeric Pl protein s were detected in cell lysates of transformed PC3370 by Western blot with C-te1minal specific anti-Pl mAbs (Figure 23, upper panel). Breakdown products of the proteins were, however, detected with the A-regions specific mAb 3-8D (Figure 23, lower panel) Evaluation of the Involvement of SecB in the Secretion of Pl, PlAA, and PlAP in E.coli It is presumed that Pl i s trru1slocated to the cell s urfa ce via the gene ral sec retory pathway and the Sec translocase [86] The two 1najor rout es to the Sec translocase are via the chaperones signal recognition particle (SRP) or SecB. In S. mutans, however Pl is secreted in the absence of the SRP pathway and S. mutans does not possess SecB or a known ortholog. To deter1nine whether the translocation of Pl is dependent upon SecB in E. coli and possibly a SecB ortholog in S. mutans, sec1etion of Pl to the periplasm was examined in the E. coli SecB negative mutant CK1953 [10 9] Peripla sm ic extracts of CKI 953 and the wild-type MC4100 expressing P 1 were pr e pared by osmotic shock, and the presence of Pl was detected by Western immunoblotting using mAbs 5-3E 2-8G

PAGE 56

45 and 6-8C. These m.Abs are specific to the carboxy-tem1i11us of Pl and were used to insure that only full-length n1olecu]es were traced. These results are shown in Figure 24A Lanes marked ''C'' contain cellular lysates and lan es marked ''P'' contain peripla sm extracts. The host and plasmid expressed is it1dicated above each pair of lanes. The first pair of lanes contains cellular extracts from MC4100 harb oring pDC20 (full-length Pl) and show that P 1 is detected in both the cytopla sm and th e periplasm. The cellular fractions of the second pair of lanes contains cellular extracts from the SecB mutant CK1953 harboring pDC20 and show that like in MC4100 Pl is detected in both the cytoplasm and the periplasm. The fmal pair of lanes corresponds to cell fractions from MC4100 harboring pUCl.8 (vector only). The above cell ext racts were also analyzed by Western immunoblotting for the cytoplasmic protein P-galactosidase to confirm the integrity of the periplasm extractions (Figure 24B). No p-galactosidase was detected in the periplasmic extracts. These r es ult s show tl1at Pl tran s l ocat ion in E. coli is not dependent on SecB the chaperone that is central to the general secretory pathway of E. coli. Expression of Discontinuous Pl and Recognition by Anti-Pl Monoclonal Antibodies It has been proposed that proteins frequently contain '' uncleaved intramolecular chaperone-like fragments'' These fragments are believed to assist in protein stabilization and folding by bin ding to adjacent regions [125]. Intramol ec ular chaperones (IMC) have been identified in a number of proteases including a proli ne -rich IMC in the Limi1,/u s Factor C [79] in which deletion of the IMC resulted in a malfo lded and no11-secreted protein. Complementation of a secretion defect resulting fro m an IMC deletion has been demonstrated in the Pseud omonas aeruginosa e lasta se, L asB Mclver et al [126]

PAGE 57

46 successfully rescued secret i on and activity by expressing the IMC in trans Additionally, not all secreted proteins ar e translocated in a 11 unfolded conformation The TAT system is capable of secreting pro te ins that ar e f irst folded in the cytoplasm [127] Although the TAT system has not been found in S. tnutan s it was of interest to detem1ii1e whether the Aor Pregions possessed IMC activity and whetl1er such an i11teraction would result in the translocation of a non-l i n e ar or folded Pl To examin e tl1i s a spaP gene engineered to express Pl as two pepti des (a a 1-4 8 0 an d a. a 481-1561 s ee Figure 25) was constructed by PCR and cl o ned into pCR2 1 creating pTS30 as detailed i11 Methods and Materials. The predicted molect1lar weights of th e P 1 fragment s a re 51 kD for the 480 residue N-te1minal fragment and 119 kD for the I 081 residue C-terminal fragment Cell lysates of E. coli harboring pTS30 were examined b y Western blotting utilizing anti Pl mAbs, 38D, 4-lOA, and 5-3E (Figure 26) MAb 3-8D is specific to the A-region of Pl [35], reactivity ofMAb 4-lOA has been shown to be dependent upon the simultaneous presence of both the Aand P-regions and MAb 5-3E is sp ec ific to the C-terminal end of Pl [120]. In lane A, MAb 3 -8D i s shown to be reactive with bands migrating between approximately 65 and 80 kD In lane B, MAb 4 1 OA react s with a band that corresponds to the molecular weight of the C-tem1inal fragment at 119 kD. The binding of mAb 4lOA suggests that enough N-terminal fragments co-migrate with the 119 kD C-tenninal fragment to restore epitope recognition by this antibody. In lane 3, mAb 5-3E al s o reacts with a 119 kD band The reactivity of all three mAbs indic a tes that both the N-te1 rninal and C-te11ninal Pl fragments are expressed and detectable in E coli

PAGE 58

47 Evaluation of Surface Ex pression of Discontinuous Pl in S. mutans The spaP mutant PC3370 was used as the host for pl asmids pMAD and pTS31, encoding full-length Pl and discontinuous Pl respectively. Whole cell dot blot analysis was used to examine whether an interaction of the Aand P-regions, when expressed in trans, could result in translocation of the fragments to the cell surface. These results are shown in Figure 27. The positive controls S. muta11s NG8 (wild-type) and PC3370C expressing full-length Pl (columns A and C) demonstrate the reactivity of the mAbs with surface expressed Pl MAb 3-8D ha s previously b een shown to be unre active with full length Pl on the cell surface. The negative control, PC3370A, harboring the vector only, (column B) showed lack of reactivity of the rnAbs with cells lackin g Pl. PC3370 harboring pTS3 l encoding the Pl fragments ( colunu1 D) was not reactive with the mAbs indicating a lack of s urface expression of the P 1 fragments. These re su lt s indicated that Pl fragments were not anchored to the surface of PC3370. The N-terminal fragment was, however detected in spent culture liquor with MAb 3-8D ( data not shown). To deterrnine if the Pl fragments were detectable in S. mutans cell lysates PC3370 harboring pTS31 was subjected to mechanical lysis in a Mini B ea dbeat e r a pparatus and samples were analyzed by Western immunoblotting ( data not sl1own). While both the and C-terminal fragments were detected in E. co li only the N-terminal fragment was present in the S mutans cell extracts, indicating tl1at the C-terminal fraginent was unstable in S. mutans. Surface Expression of Pl in a RopA-Deficient S. m11ta1is and Bacterial Adherence to Salivary Agglutinin The first chaperone encountered by nascent polypeptid es is believed to be the polyprolyl isomerase (PPiase) RopA or trigger factor. Trigger factor is involved in

PAGE 59

48 protein secretion and maturation. The involvement of RopA in the expression of functional Pl was analyzed u s ing an adherence assay. Pl mediates binding to salivary agglutinin, and the binding can be inhibited by the PI -specific monoclonal antibody (mAb) 4-lOA but not by the Pl-sp ec ific m.Ab 6-1 lA (33] Adherence of S. mutans TW90, a RopA-deficient mt1tant [112] to hun 1an sa li vary agg lt1 tinin immobilized on an Fl sensor chip was assayed usin g the BIAcor e 3000 ( BIAcore AB, Uppsala, Swed e n) b y Monika Oli by the method described in [128]. Briefl y, agglutinin was immobili ze d on the BIAcore Fl sensor chip surface, and suspensions of S. mi,ta11s UA159 (wild-type) and TW90 (f:tropA) in adherence bttffer were injected onto the sensor chip. A substantial reduction in adherence( > 50 %) in three separate assays was ob s erved for the RopA deficient cells (Brady laborator y, unpublished) The complete inhibition of adher e nce of both UA159 and TW90 by the addition of anti-Pl mAb 4-lOA indicated t11at the residual adherence was Pl mediated (Brady laboratory unpublished ). In light of the laboratory' s findings that the function of Pl appeared to be altered in a ropA-negative strain whole cell dot blots of TW90 were u se d to det e rmi11 e whether th e reduction in adherence was du e to a r e dt1ced l eve l of s urfa ce locali zed Pl in th e ropA negative background Cells were grown to early-log an d sta tion a ry pha ses, and sam ple s were standardized for cell number by a b s orbance measurement s. Replicate blots were reacted with mAbs 3-8D 4-9D 4 lOA 5-5D 6-1 lA, 3-lOE 1-6F 5-3 E, 2-8G 3-3B, or 6-8C. Quantification of Pl surface ex pre ss ion was p e rf o rm e d b y den s itom etry t1 sing a Fluorchem imager and softwa re (Alp l 1a Inn o te ch, San Leandro Ca). The mAb 4-1 OA results shown in Figure 28 are representative of all data There were no differences detected in the surface expression of P 1 between wild-type UA 159 ru1d TW90.

PAGE 60

49 Analysis of Pl Surface Expression in an S. 11iuta11s Muta11t Expressing Low-Levels of DnaK The route of Pl trans location to the cell surface and the chaperones involved are unknown. Pl is secreted in the absence of the chaperone s SRP, SecB, and RopA although RopA appears to affect Pl function. DnaK bind s to proline-rich proteins [129] and is involved in chaperoning a wide variety of proteins. D11aK also has a pool of substrates that overlaps with RopA [104]. The contribution ofDnaK to Pl surface expression was examined by whole cell dot blot as was performed with the RopA mutant. The experiment was performed using S n,zutans SM12 whicl1 was engineered to express approximately 5o/o of the level of DnaK as the parent strain UA159 (Lemos and Burne in preparation, University of Florida, Gainesville, FL). S mutans UA159 and SM12 were grown and harvested at early-log and stationary phases, samples were standardized for cell number by absorbance measurements, and surface expression was determined as previously detailed. Figure 29 shows that there is a significant reduction in the amount of surface expressed Pl at early-log growth in SM12 (P < 0.0001), but Pl levels were equal in both strains at stationary phase (data not shown). Evaluation of dnaK mRNA Expression in S. niuta,is PC3370 Harboring pDL289, pMAJJS, pMAD, and pTS21 The reduction of Pl surface expression seen in tl1e earlylog phase of SMl 2 suggested that DnaK might have a role in Pl translocation. Changes in dnaK mRNA levels in response to the expression of Pl and Pl deletion constructs in S mutans could indicate an interaction betw een the chaperone and the Pl proteins. To this end quantitative Real-Time PCR was utili zed to measure le vels of dnaK mRNA expression. DnaK message was quantified from total RNA isolated from early-log phase cultures of PC3370 harboring pDL289 (shuttle vector) pMAJJ8 (Pll\P-region) a11d pMAD (Pl)

PAGE 61

50 and pTS21 (Pl~A-region). Compared to the vector only control or PC3370 complemented with full-length Pl, the level of dnaK message was significantly decreased (P<0.005 and P < 0.05 re spe ctively) in the presence of Pll1P and increased (P<0.005 and P < 0 05, respectively)in tl1e presence of PI !lA (Figure. 30) The mRNA levels of 16S RNA were used as an internal control, and no significant difference was found b etwee n samples (P < 0.38).

PAGE 62

Pl PIM 0 00 I C'f') . 1 < 0 I 0 V) I V) < I 5 1 ' ,J 0 I M -~ ..... Jl .... tr ,, ~. "{ I 0 00 I N ,. l I t u 00 I . 1 85 kD 1 35 kD Figu r e 2 Western b l ot ana l ysis of P l a n d r ecom binant P l l ac king the A-reg i on (PlM ). The reactivity of e l e v en a nt i P l m A b s a g ai 1 1 s t w l1 o l e ce l l l ys ate s of E col i h arboring pDC20 (Pl ) o r pTS20 (P lL\A ) w ere a n a l yz ed b y We s tern bl o t to detennine the effect of the A-region de l etion on antigenicity The mAbs used are listed a b ove each s trip The epitope of mAb 3 -8D is within the A-region, however mA b 3 8D does not bind to ful l-l ength P l T h e reac t ivity of mAbs 4 l OA, 55 D 6-1 lA and 3-lOE ar e dependent upon t he P-region The r eactivity of mAbs 5-3E 2-80 3 -3 B and 6 8C are dependent upon the tennina l te rr n i n a l t h ird o f Pl

PAGE 63

PC3370 PC3370 + vector PC3370 + Pl/J.A PC3370 + Pl e e ..... V, X N .... iv V, X X 0 V, 52 .. 0\ w -..J w Iv . V, 00 1.0 I.O >< X >< X X >< 0 ....
PAGE 64

PC3370 PC3 3 70 + vector PC3370 + Pl PC3370 + Plil.A ' 53 1 0 5 2 5 1 2 0 62 0 3 1 0. 1 5 g/ well Figure 4. RNA dot blot analysi s of sp aPs pecific mRNA level s in tl1 e S mutan s spaP negative mutant PC337 0 an d derivative s. Twofold s erial dilutions of total cellular RNA beginnin g with 10 mg wer e probed with DNA encoding the C terminus of spaP From t o p to bottom, th e row s contain mRNA from PC3370 PC3370A (vect o r only) PC3370C (full-length spaP) and PC3370 harboring pTS21 (spaP with A-region encoding DNA deleted) respectively

PAGE 65

250 1 50 J OO 7 5 54 PI P l !iP PIM Vector C P C P C P C P Figure 5 Western immunoblot of cytoplasm (C) and peripl as n1 ( P ) fractions of E coli DH5a harboring pUCl 8 derived pla s mids expressing full-length Pl (pDC20 ), Pl AP (pDC9) PlM (pTS20) and vector alone detected with C-terminus specific mAbs 5-3E 6-8C, and 2-8G. Migration of molecular weight standards are indicated in kilodalton s.

PAGE 66

' 0 I() 1 2 1 0 0 8 0 6 0 0 4 0 2 55 P -reglon Im mo b ili zed .t. MBP Immobili zed 0 0 +----.----,----,----,----,----,-----,----,----r----, 1000 500 250 12 5 62. 5 0 31 2 5 1 5.62 7.81 3.90 A-regi onMBP ( ng /w ell ) Figure 6 Demonstration of A-region and P-region interaction by ELISA 100 ng of region-maltose binding protein (MBP) fusion polypeptide() or MBP alone (~) were used to coat ELISA plate wells Two-fold serial dilutions of purified A-region-MBP fusion polypeptide s tarting at I 000 ng/well were added to the coated wells, and binding of the A-region to the P-region or to the MBP negative control was detected with the A-region specific MAb 3 -8D.

PAGE 67

1 8 1 6 1 4 1 2 15 1 0 V 0 O O.ll 0 6 0 4 56 4 -10A A-region Immobilized -oP region Immobilized 0 2 L~-~---~--===::::~~~0 0 0 30 0.25 0.20 0 O 0 1 5 0 0 IO 0 1 0 0 05 0 30 0 25 0.20 V O 15 0 0 0 10 500 250 125 62.5 31 25 15 62 7 81 3 91 0 5-5D -.... A-region tmmobOized -0P regiQr1 Immobilized 600 250 1 25 62.5 31 25 1 5 62 7 81 3 91 0 6 11A A -region Immobilized -0P-regioo Immobilized 500 250 125 62.5 3 1 25 15 62 7 81 3 91 0 ng/We ll Figure 7. Restoration of epitopes by Aand P-region interactions as measured by ELISA. 500 ng of P-region-MBP fusion polypeptid e, A-region-MBP, or MBP were used to coat ELISA plate we lls Two-fold s erial dilt1tions of purified r e gio n-MBP starting at 500 ng/well were added to the P-region and MBP co ated wells and vice versa. MAbs 4-1 OA 5-SD, and 6-1 lA were tested for r e activity. Panel title s indjcate the mAb te st ed and the legend s indicate the P 1 fragment that was immobilized Aand P-r e gions did not interact with MBP a lone and no mAb binding was detected with the controls ( data not shown)

PAGE 68

57 100 .. _______ 1,~, ,~r"'"~vu:. ,,.. , .. -----~~,,, ... "' t 80 1--r--,, __ ___ 60 C 0 :.:, 40 --.c a A-region .c C 20 o P region 0 0 20 t------i, __ ,-----~ -40 __.__ ___________ .... ____ ... .... -. --Figure 8. Inhibition of anti-Pl MAb 4-1 OA binding to immobili z ed Pl in EL ISA To determine whether the Aand P-region polyp epti d es could inter ac t in solution and produce an e pit o p e recogni z e d b y rnAb 4-1 OA, the antibod y w as mi xed with soluble Pl g lutathion e S-t1ansferase (G ST ) A-region-OST P-region GST or a 1: 1 molar mixture of A-region-GST and P region-GST polypeptid es. The rnAb 4-1 OA mixtures were applied to P 1 immob ili ze d to an ELISA plate and inhibition of binding to the immobilized Pl w as measured. Bars indicate percent inhibition.

PAGE 69

0.25 0 2 0 15 8 0 1 0 05 58 0--------------A: 0 0.16 0.33 0 5 0 66 0.83 1 P: 1 0.83 0 66 0 5 0 33 0.16 0 Molar Fraction Figure 9. Stoichiometry of the mAb 4-lOA epitope. Varying molar ratio s of Pl Aand P-region polypeptides with a constant total concentratio1 1 of 3 3 pmoles were immobilized in ELISA plate wells and epitope restoration was detected with mAb 4-1 OA. The experiment was performed in triplicate and st andard deviation is represented by the error bars.

PAGE 70

100 75 50 37 Ss pA 59 Ss pB Pl Figure 10 Demonstration of s i1 11 ilar level of mAb 3-8D rea c tivity to A-region-GST fusion polypeptid es of SspA, SspB, and P 1 by W es t e 111 imn 1 L1noblot.

PAGE 71

1 8 1.6 1.4 1 2 0 1 0 0 0 8 0 0 6 0 4 0 2 0 0 1 8 1 6 1 4 1 2 55 1 0 .., 0 0 8 0 0 6 0 4 0 2 0 0 1 8 1 8 1 4 1.2 0 1.0 .,. 0 0 8 0 0 6 0 .4 0 2 o o 60 P1 P -re g ion 3 -8D SspA A-region ---0SspB A-region .., P 1 A region 500 250 125 62 5 3 1 2 15 6 7 8 0 SspA P region 3-80 SspA A-region -oSspB A-region .., P1 A-region 500 260 125 62 5 31 2 15 6 7 8 0 Ss pB P -r eg ion 38D SspA A reglon -oSspB A-region _...,._ P 1 A-region 500 250 1 25 62 5 31 2 15 6 7 8 0 n g/w ell Figure 11 Demonstration of interactions between the Aa nd P-r e gions of different antigen I/II proteins. Panel titles indicate the sour c e of the immobilized regions. Binding of the different A-regions identified in the legends were traced with the cross-reactive A-region specific mAb 3-8D Legends identify the overlaid polypeptides.

PAGE 72

2 5 01 5 075 2501501 00752 501501007 5 61 <( 0 I 0 V) I V) < I \0 Pl Ss pA S s pB Figure 12. Evaluation of reactivity of Aand P-re g ion dependent anti-PI mAbs with P 1 SspA, and SspB. Whole cell lysates o f E coli DH5a harboring pDC20 ( Pl) pDDA (SspA) and pEB-5 (SspB) were electrophore s ed on 7.5% SDS polyacrylamide gels transferred to nitrocellulose and probed with the anti-Pl mAbs shown above The indicated molecular weights are in kilodaltons

PAGE 73

1 8 1 6 1 4 2 0 I() 1 0 ..,. 0 0 8 0 0 6 0.4 0 2 0 0 1 8 1 6 1 4 1.2 0 !fl 1 0 0 0 8 0 0 6 0.4 0 2 0 0 1 8 1 6 1 4 1 2 0 IO ..,. 1 0 0 0 8 0 0 6 0.4 0 2 0 0 62 SspA P-r egion 4 10A SspA A-region -0SspB A-region P1 A-region 500 250 1 25 62 5 31 2 15 6 7 8 0 SspA P -region 5-50 SspA A-region -0Ssp8 A-region P 1 A-region 500 250 125 62 5 31 2 15 6 7 8 0 SspA P-region 6-11A SspA A-region -0Sspa A-region P 1 A-region 500 250 125 62.5 31 2 15 6 7 8 0 ng/well Figure 13. Restoration of epitopes by the interaction of various antigen I/II A-regions with the immobi l ized P-region of SspA. Panel titles indicate the source of imtnobilized P region and the mAb tested Legend indicates the source of the overlaid A regions.

PAGE 74

1 8 1 6 1 4 1 2 1.0 0 8 0 0 0 6 0 4 0 2 0.0 1 8 1 6 1 4 1 2 0 1 0 0 0 8 0 0 6 0 4 0.2 0 0 1.8 1 6 1 2 0 it) 1 0 0 0 8 0 0 6 0.'4 0 2 0 0 63 SspB P-region 4-10A SspA A reg io n -oSspB Aregion P 1 A region 500 250 125 62 5 31 2 15 6 7 8 0 SspB P -region 5-50 SspA A -region -oSSpB A r egion P 1 A region 500 250 125 62 5 3 1 2 15 6 7 8 0 SspB P-region 6 -11 A SspA A-region -<>SspB A-reg ion Pt A region 500 250 125 62.5 31 2 15 6 7 8 0 ng/ we ll Figure 14 Restoration of epitopes by the interaction of various antigen I / II A-regions with the immobil i zed P-region of SspA Pane l tit l es indicate the source of immobilized P-region and them.Ab test e d Legend indicates the source of the overlaid A regions

PAGE 75

1 8 1 8 1 4 1 2 0 1.0 .., 0 0 8 0 0 6 04 0 2 0 0 1 8 1 8 1 1.2 0 It) 1 0 "I' 0 0 8 0 0 6 0 .4 0 2 0 0 1 8 1 6 1 4 1 2 0 1 0 0 0 0.8 0 8 0 4 0 2 0 0 64 P1 P-region 4 -10A SspA A-region -0SspB A-region P 1 A-region 500 250 125 62 5 31 2 15 6 7 8 0 P1 P-reglon 5-5D SspA A region -0SspB A-region -...P1 A -r egion 500 250 125 62 5 3 1 2 15 6 7 8 0 P1 P -region 6-11A SspA A-region -0SspB A-region P1 A-reg ion 500 250 1 25 62.5 31 2 15.8 7 8 0 ng/ well Figt1re 15. R es toration of epitopes b y the interaction of va rious antigen I/II A-region s wit h the immobilized P-re gi on of SspA Panel titles indicat e the sou rc e of i mmo bili zed P-re gion and the mAb te s ted. Legend indicates the source of th e o ve rlaid A-regions

PAGE 76

1.8 1 6 1 4 1 2 0 I() si1 0 0 0 8 0 0 6 0.4 0 2 0 0 1 8 1 6 1 4 1 .2 0 I() 1 0 'If 0 8 0 0 0 8 0 4 0 .2 00 1 8 1 6 1 4 1 2 0 1 0 0 0 8 0 0 6 0 4 0 2 0 0 50() i 65 250 1 25 ~ :::; SspA A reg ion 41 0A .. 62 5 312 S s pA A-reg i on 5 -50 ~ e 1 5 6 SspA P -r egio n -<>SspB P -r eg lon P1 P reg lo n 'ii 7 8 0 SspA P-reglon -0S spB P -region Pl P -reg t on 5 00 25 0 1 25 62 5 3 1 2 1 5 6 7 8 0 SspA A region 6 11 A SspA P teg ion -<>SspB P-r eg ion P 1 P -reglon 500 250 1 25 62 5 3 1 2 15 6 7 8 0 n g/w ell Figure 16 Restoration of epitopes by the interaction of various antigen I/ II A regions with the immobili z ed A region of SspA. Panel titl e s indicat e the sourc e of immobilized P region and the mAb tested Legend indicates the source of th e overlaid P-regi o n s

PAGE 77

l 8 1 6 1 4 1 2 1 o 0 0 0 8 0 6 0 2 0 0 1 8 1 6 1 4 1.2 0 1 0 Ill 0 0 8 0 0 6 0 4 0 2 o o 1 8 t.6 1 4 I 2 g 1 0 0 0 8 0 O & 0 4 0 2 0 0 66 Ss pB A -region 4 -10A SspA P-reglon -<>Ssp8 P-reglon .,. P 1 P-reglon e e 500 250 125 62 5 31 2 15 6 7 8 0 SspB Aregion 5 50 SspA P -r eg lon -<>Ss p8 P -r eg ion .,. P1 P-regton t 500 250 125 82 5 31 2 15 6 7 8 0 Ss pB A -re g ion 6-11 A SspA P-region -<>Ssp8 P-region .,. Pl P-region 500 250 1 2 5 62 5 31 2 15 6 7 8 0 ng/well Figu r e 1 7. R es t o r at i o n of e pit ope s b y t he i n t e r ac t io n of vario u s an ti gen V Il A-re g i o n s with the immobi l i ze d A re gi on o f SspA Panel ti t l es indi ca te th e s ourc e of immobilized P-region and the mAb te s t e d Legend i n dic a t es th e sour ce of th e overlaid P-region s

PAGE 78

1 8 1.6 1 1 2 0 It) .., 1 0 0 0 8 0 0 6 0 4 0.2 0 0 1 8 1 8 1 .. , 2 1 0 0 0 0.8 0 6 0 4 0 2 0 0 1 8 1 6 1 4 1 2 0 IO 1 0 .., 0 0 0 8 0 6 0 .. 0 2 0 0 67 P1 A-reg i on 4-10A SspA Preg lon -0SspB P reg ioo P 1 P-reg l oo 500 250 1 25 62 5 31 2 15 6 7 B 0 P1 A-r egion 5-50 SspA P-reglon -0SspB P reg ion P1 P-region 500 250 125 82 5 31 2 15 6 7 B 0 P1 A-re gion 611A SspA P-reglon -o.SspB P-reglon P1 P region 500 250 125 62 5 31 2 15 6 7 8 0 ng/ we ll Figu r e 1 8. Resto r atio n of epitopes by the interactio n of va riou s anti ge n V Il A-region s with the immo b ilized Ar egion of SspA P a ne l tit l es indicate the source of immob i lized P -r egion an d the mAb tested Legend ind i cates the so urce of t h e ove rl aid P regions

PAGE 79

Pl SspA Ss pB Pl SspA SspB Pl Ss p A Ssp B P l SspA Ss pB 68 1 0 20 JO 40 KD MV AH K AEVE R IN A ANA AS K TA YEAKLAQYQ A DLAAVQK T N AAN E DLXAHQAEVEKINTANATAKAEYEAKLAQVQKDLAAVQKANEDS KDLK S H E EVEKINTANATAKAEVEAKLAQYQKDLA T V K KANE~S 50 60 ---.---... 70 ----~ .... --. 80 ~---~ ')() Q A S Y Q K A L A A Y Q A E L K R V Q E A l"i A A A K A A Y D T A V A A N N A K N T E I A A Q L DVQNKLSAYQAELARVQKANAEAKEAYEKAVKENTAKN A AL Q A Q DY NKLSAYQ T ELARVQKANAEAKEAYEKAVKENTAKN E AL KV JOO -~ /IQ --~ 120 -~ __ IJ a ___ __, A NE E I RK RNATAKA E VE TKLA QY Q A E L KRVQE AN AA N E ADYQAKL &NEAIKQRNA~AKA N Y D AAM~QYEADLAAJKKA K EDNDADYQAKL ENEAIK QRN E TAKA T YEAAMK YEADLAAlKKANEDNtiADYQAKL /40 /50 JtiO /70 ,..._~ /NU T AYQTELARVQKANADAKAAVE A AV AA N N AKN A A LT AEN T AIKQR AAYQ A ELARVQKANADAKAAVEKAV E ENTAKNT~IQAENEAIKQR AAYQTELARVQKANA E AK E AY D KAV K tNTAKNTAJQAENEAIKQR 190 200 2/0 )20 PI ,N E N A. K A T y E A A L K Q \ E A D l. A A V K K A N" A A N E A D Y Q A K '-' T A Y Q T E L A Ss pA N A A K A T y I, A A L K '2 y ii A l) L A A V K K A NI E D s I E A D y Q T K L Am V Q T E L A SspB N T A K A T Y D A A V K K Y E A D L A A V K Q A N A T N E A D V Q A K L A A Y Q T E l. A 2 3 /J 2 4 0 r--.= 2 5() .--,--~ 2 60 2 71) Pl RV Q KAN AD AK A A VE A AV A A N N A A N A A L T A EN TA I K K R NA D A K A DY SspA R v Q K A l'ii A D A K A A Y E K A V E D N K A K N A A L Q A E N E E 1 K Q R N A A A K T D Y Ss pB R V K A N A D A K -A T V E 1( A V E D N K A K N A A I K A E N E E I K Q R N A V A K T D \ lliU 2YU J()I) 3 I 0 P I E A K L A K Y Q A D L A K Y Q I( D L Ss p A I A I( LAKY EA D LA KY K K fi< L SspB E A K L A K Y E A D L A K Y K K E F Figure 19. C LUSTAL W a lignment of the A-re gio ns o f Pl S s pA and S s pB D a rk gr e y s hading indicate s identi ty. Li g ht g re y s hadin g indic a t es s imilarity

PAGE 80

69 I 2 3 4 A 2501 50 3-8 0 1 00 B 2 50 1 50 5 5 0 1 00 Fi g ur e 20 We s t e rn immunoblot of c himeri c Pl containin g t he A-r eg ion s of S s pA and SspB. Whole cell ly s ate s of E co li DH5a harb o rin g pla s 11rid s en c odin g P 1 cont a ining with the A-r e gions of S s pA and S s pB Lane s c ontain Pl (1 ), Pl~ A ( 2 ) Pl~A + A-re g ion o f S s pA ( 3 ), PlM + A -re gio n of SspB ( 4 ) Pan e l A was react e d with the A-re g i o n s p ec ifi c mAb 38 D Panel B w as rea c t e d with th e Aa nd P-re g ion d e p e nd e nt mAb 5-5D

PAGE 81

70 Vector Pl SspA SspB Figur e 2 1. Surface expression of S gordonii SspA and SspB in S mutans PC3370. Whole cell dot blot of Pl-deficient S. mutans PC3370 complemented with plasmid-encoded P 1, SspA, and SspB. Surface expression was traced with mAb 5-5D 1 2 3 4 5 __ ,. .. ..,_,,.... . ......... "' .. ---Figure 22. Demonstration of lack of ability of heterologous A-regions to restore surface expression of PlM in PC3370. Whole cell dot blot of PC3370 harboring vector alone (1) and plasmids expressing Pl (2), PIM (3) and Pl containing the A-regions of SspA (4) and SspB (5). Surface expression of Pl was detected with mAb 5-5D.

PAGE 82

250 150 100 75 50 250 150 100 75 50 71 A B C D E 5-3E 2-8G 3-3B 6-8C 3 -8D Figure 2 3. W es tern immunoblot s of cell ly s ate s of PC3370 harboring vector alone (A ), and plasmids encoding Pl (B) Pl~A (C), Pl~A + S s pA A-region (D) and Pl ~A + S s pB A-re g ion Pl wa s detected with C-terminals specific mAb s (upper panel) and A-region specific mAb 3-8D (lower panel )

PAGE 83

A 2 50 1 50 '.. 1 00 75 pD C 2 0 M C 410 0 C P pD C 2 0 C K1 953 C p p UC 18 CK 1 9 5 3 C p 72 B 2 50 1 50 I 00 75 50 pDC2 0 M C 4l 00 C p pD C20 C K1 953 C p Figure 24. Western immunoblot of cytoplasm (C) and periplasm (P) fractions of E coli MC4100 (wild-type) and CK1953 (flsecB) harboring pDC20 (Pl). Pl was traced with mAbs 5-3E 2-8G and 6-8C in panel A. In panel B galactosidase wa s traced with a rabbit polyclonal ru1tibody Migration of molecular weight standards are indicated in kilodaltons.

PAGE 84

A-Region (a.a. 186-464 ) a.a 1-46 5 73 P-R egion (a.a. 840-963) ,,,,.. r ..,..-..:all" a.a 466156 1 Figure 25. Schematic repre se 11t at ion of dis co ntinL1ou s Pl Black arrow repre s ent s the spa P promoter N-termina l open reading frame (O RF) expresses re s idue s 1465 including the A-region (shaded). C -terminal ORF expresse s residue s 466-1561 whlch includes the P-region (shaded) A B C 250 1 50 100 75 50 Figure 26 Western immunoblot of Pl fragments expressed from pTS30 in E. coli and traced with mAbs 3 -8D ( A) 4-1 OA (B), and 5-3E (C). Migration of molecular weight standards are indicated in kilodaltons

PAGE 85

74 A B C D 3-8D 4-9D ... 4-100 5-5D 0 6-llA 3 lOE Figure 27. Whole cell dot blot of S mutans NG8 (A) and P C3 370 harboring pDL289 vector control (B) pMAD encoding Pl (C), and pTS31 encoding discontinuous Pl fragments (D). Surface expre ssio n of Pl polypeptides was traced with the indicat e d anti-Pl mAbs.

PAGE 86

75 5000 V') 4000 .... ::> 0 3000 E .. .. 0 2000 u .... I ., 8" 10 00 0 UA159 TW90 Figure 28. Pl swface ex pression level s of S. mutans UA159 and TW90 (ropA mutant ) at early log stage traced with mAb 4-1 OA as mea s ured by densitometry

PAGE 87

76 5000 ,---------------, en 4000 .... c:: '.:) 0 3000 (/) C: Q) Cl 2000 u .... .... 0. 0 1000 0 +-------'--.---..___..__ __ _.__ __ ----I UA159 SM12 Figure 29. Pl surface expression levels of S mutans UA159 and SM12 (DnaK deficient ) at early log phase trac e d with mAb 4-1 OA as measured by densitometry No difference was detected at stationary phase ([n = 12]* statistically significant, P < 0 0001. Significance was determined by student 's t-test )

PAGE 88

77 6e + 6 ** L-, Q) 5e + 6 .D -8 ::s z 4e+6 >, c.. 0 u 3e + 6 <( 2e+6 8 ** . A le +6 Cl . "n 0 ' V ec tor PIM Pl PIM Figure 30 Real-Tin1e PCR quantification of dnaK mRNA from S mutans PC3370 harboring the pDL28 9 vector alone and expressing Pl ~P-region, full-length Pl and PIM-region. ( [n = 36]* statistically significant compared to vector, P < 0.005. ** stat i stic ally significant compared to Pl, P < 0.05 Significance was determined by student's t-test. )

PAGE 89

CHAPTER4 DIS CU SSION AND CONCLUSIONS D enta l caries is on e of the mo s t preval e nt oral di se a ses worldwide, affecting 6090% of sc hoolchildren and th e 1na jo rity of a dults In the U nit e d States dental caries is the mo s t common chronic childhood disea se with 78% of 17 year olds having at least one cav ity or filling [130] and according to the U S. Department of Health and Human Services, it is estimated tl1at over $84 billion dollars is spent annually on dental treatment a nd carie s pr eve ntion in the United States alone. While advanc es in d e ntal care and caries prevention ha s reduced the in cide n ce of carie s in developed countries th e in ci den ce of caries worldwide has remain e d unchanged for the pa st 20 years [ 131] A major contributing factor to the decline of caries in developed countries was th e introduction of fluoride to water and toothpaste Unfortunately in d eve lopin g countries, where the incidence of caries i s on the ri se, fluoridated community wate r i s commonly 11ot a viable option Alth o L1 g h fluoridated wate r r eac h es 60 o/ o of the U.S. population, mor e than 90% of toothpastes contain fluoride and proce sse d food and beverages often contain fluoride, the reduction in carie s incid e nce has been uneven across the general population in the United State s. The majorit y of the disea se i s now being borne b y a disproporti ona tely s mall segment of tl1e popt1l atio n ; tho se of low socioecono mic sta tu s, low ed u cat ion and lack of acce ss to dental care [132 134] in essence a mirror of the populations in dev e loping countries. The inability to manag e caries in this subpopulation of the Unite d State s, where th e d e nti st to population ratio is b ette r than 1 :2000 people 78

PAGE 90

79 illustrates the improbable ta s k of preventing caries in developing countries such as in Africa where the ratio isl :150 000. A better understandin g of the virulence factors and / or tar g ets of protective immunity in S mutans could lead to preventative measures that could help overcome the lack of resources education and infrastructure that is currently required for caries prevention. The major surface protein Pl of the cariogenic orga11ism S. mut a n s, is a multifunctional adhesin and plays a role in the attachment of the bacterium to the tooth surface Pl shares similarities to virulence factors of several other bacterial species in c luding the fibronectin binding proteins of S aur e us and S py og e rz e s [ 65 66] and th e pneumococcal surface protein (PspA) of S pn e umoni a [68 ]. Pl has been identified as a t a r g et for prot ec tiv e i1nmun ity and ha s b ee n studi e d a s a p o t e ntial a11ti ge n c a ndidate f o r a n anti-caries vaccine [135] It has also been used for the production of mAbs that ar e ct1 rrentl y b e in g in ve stigated for th e ir ability to modulate the i mmun e re s ponse in mice t hat are c h a ll e n ge d with mAb-S n i utan s or mAb-Pl comple xe s [136]. Al s o with li t tl e known about the maturation and translocation of Streptococcal s urface proteins, Pl i s a potential mod e l for studies in th e se areas. Th e g oal o f this research w as to further our under s tanding of the s tructure and a ntigenic prop e rties of this large and complex molecule with an emphasi z es on id e ntifyin g intramolecular interactions the contribution of intramolecular i11teraction s to s tructur e st abilit y a nd tran s lo ca t i on of P 1, and to beg in to id e ntif y c h a per o ne s that c o ntribut e to Pl matw tio11 and tran s location Identification of an Intramolecular Interaction within Pl Previou s ly by proc ess of elimination using truncated Pl polypeptides the central r eg ion of P 1 wa s det e rmin e d to contribute to t he epitopes of six of e lev e n anti-P 1 rnAb s

PAGE 91

80 (4-9D, 4-lOA, 5-5D, 6-1 lA, 3-lOE, and l-6F) [120]. It was additionally shown that deletion of the P-region of Pl (Pl AP) abrogated the binding of four of the eleven nlAbs ( 4-1 OA, 5-5D 6-11 A and 3-1 OE) and that none of these antibodies recogni z ed a subcloned P-region peptide suggesting that their epitopes were complex and conforrnational Surprisingly altl1ough P 1 ~p retained its N-ter111inal signal sequence and C-terminal cell wall anchoring motif it was unstable in S. mutans and not translocated to the cell surface [54]. Proline-rich regions have been show11 to be involved in both protein-protein interactions and intramolecular chaperone like interactions. The initial objective of these studies was to identify interactions between the P-region and other regions of P 1 Work by Rhodin et al. [123] on the characterization of the mAb 6-1 lA epitope further defined regions of Pl that were required for reactivity of the 6-1 lA. Analysis of several P-region spanning Pl subclones revealed that in addition to the P-region (a.a. 819-1017) residues N-ter1ninal ofD465 also contributed to the reactivity of mAb 6-1 lA In addition, the crystal structure of the Pl variable region suggested that the Aand regions may be in close proximity [30], and it was reported that a polypeptide containing the P-regio11 bound to the N-terminal trurd of Pl [124]. Based upon these reports, the region was examined to determine whether it contributed to a complex structure by association with the P-region. The initial experiment was to examine the effects of the removal of the A region from Pl. Therefore, a spaP gene lacking the A-region (a.a 179-466) was constructed by PCR and cloned into pUC18, creating pTS20. The construct was engineered with a silent mutation that produced a unique Sfol restriction site that would later be used to insert

PAGE 92

81 heterologous A regions. The insertion of the Sfol site dictated the exact residues that were deleted. Deletion of tl1e A-region resulted in a loss of reactivity of five of eleven of the anti-Pl MAbs (3-8D, 4-9D, 4-lOA, 5-5D, and 6-1 lA), 3 of which are also dependent upon the presence of the P-region ( 4-1 OA, 5-5D, a11d 6-1 lA) (see Figure 2). This suggests that the epitopes of these three antibodies are complex and composed of portions of discontinuous segments or that an interaction between the regions results in conformational epitopes being produced within one or both of the region s. Reactivity of Mabs 5-3E, 2-8G, 3-3B, and 6-8C which are specific to the C tenninal of Pl confirmed that the deletion of the DNA encoding the A-region did not disrupt the reading frame The Western immunob l ot a l so shows that like PltlP, Pl~A is stably expressed and detectable in E coli. The presence of internal pro line-rich regions has been associated with aberrant migration of streptococcal and staphylococcal proteins on SDS-polyacrylamide gels. The molecular mass of P 1 has been predicted to be 166 kDa, although the protein migrates with an apparent molecular mass of ~ 185 kDa by SDS-PAGE Interestingly, Pl& and PIM run at their predicted sizes of 152 kDa arid 135 kDa, respectively, suggesting that an interaction between the Aand the P-regions may contribute to anomalous migration of Pl by SOS-PAGE. On a sided note, the abberant migration of Pl was observed even after ''denaturing'' in 8 M urea and SDS-P AGE at both 4 C and 60C. With the data from the A-region deletion indicating that the Aand P-regions contribute to the same epitopes, it was of interest to determine if these regions were in fact, capable of i nteracting. An interaction between recombinant polypeptides corresponding to the isolated A-region (a a. 186-469) and P-region (a.a.819-1017) was

PAGE 93

82 examined by ELISA. A-region polypeptide was incubated with immobilized P-region and A-region binding was detected with anti-Pl MAb 3-8D wluch recognizes an epitope contained entirely within the alanine-rich repeats The ELISA r ev ealed a direct dose depend e nt interaction ( see Figttr e 6) The required simultaneou s presence of both the Aa11d P-r e gions for the binding of mAbs 4-lOA 5-5D and 6-1 lA to Pl and the ability of recombi11ant A and P-region polypeptides to interact suggest e d that the interaction of these r e gions could contribute to tl1e epitopes that are recognized by these mAbs. To further analy z e the characteristics of the epitopes recognized by these mAb s, ELISA were performed with Aand P-region polyp e ptide s to determin e whether binding ofmAbs 4-lOA 5-5D or 6-1 lA was r es tor e d upon interaction of these two discontinuous domains. Interestin g ly, mAbs 5-5D and 61 lA reacted considerably better when the A-region was applied to inunobili z ed P-region rather than visa versa while MAb 4-lOA di s played no apparent preference (see Fi g ure 7 ) This would sugge s t that tl 1 e contact r es idue s for MAbs 5-5D and 6-1 lA are largel y contained within the A-re g ion while both regions n1ay contain residues required for the MAb 4-1 OA epitope Since all three of these mAbs bind to P 1 on the surface of S mutans these res ults indicate that the Aand P-regions interact in the context of tl1e whole molecule in its native confortnation Due to the possibility that the interaction of the Aand P-regions may be at1 artifact of being immobili z ed to the ELISA plate, a competitive inhibition ELISA was perform e d to assess the interaction of the Aand P-regions in solution. Since it was shown that an interaction of the A and P-region is required for the bindin g of MAb 4-1 OA recombinant Aand P-region polypeptide s w e re u s ed alone and in combination to inhibit the bindin g

PAGE 94

83 ofMAb 4-1 OA to inunobili zed Pl A s can be seen in Fi g ure 8, n e ith e r the A-region nor the P r egio n indi v idually inhibit s MAb 4 lOA binding to Pl however the combination of both polypeptides does Tl1is indicates that the Aand P-region s are capable of intera cting in solution. In an effo rt to establish the stoichiometry of the Aand P-r egio n interaction, a variation of the Job Plot was p erfo r1n e d. The Job Plot or conti11uous variation, consists of mixin g two binding partner s, or an enzyme and s ubstrate at var i o us molar ratios while holdin g the total concentration constant and then r eco rdin g a m eas urable change While co ntinu ou s varia tion is norrn a ll y perf o r1ned in solt1tion, du e to th e t1 s e of antibodies to measure t he Aand P-r eg ion int e racti on, th e Aand P-r eg io n p o lyp e ptides h a d to be immobilized to an ELISA plat e to afford the remo val of exce ss unbo und antibody. Since MAb 4-1 OA was the tool used to mea s ure the Aand P-region interaction, the s toichiometry that was detennin e d would actually be that re quir e d fo r the fonnation of tl1e MAb 4-1 OA epitope. According to the assay the epitope o f mAb 4-1 OA con sists of a 1: 1 ration of A re g ion to P-re gio n (see Figure 9). Althot1gh antigen I/II proteins are highly conserved th e funct ional propertie s of individual members of this famil y of proteins differ S gordonii possesses two antig e n I/II pr o t e ins, SspA and SspB wh i ch ha ve been we ll characteriz e d. Seve ral functional differ e nces between these two proteins ha v e been id e ntifi ed in c l L 1ding co aggregation w ith othe r oral flora and int e ra ct ion w ith type I collagen [137 1 38 ]. Pl i s closer to SspA in homology 67% identity versus 57 % with SspB Specific amino aci d residues that are not in P 1 have be e n identified to be important for SspB bindin g to Porhromonas gingivalis [139] and interaction s of S s pB ar1d Pl with salivary agg lu tinin also diff er

PAGE 95

84 [140]. Recent studies focusing on the A-regions of SspA, SspB and Pl have also identified structural and functional variation. It was reported th at the A-regions of Pl and SspA bound to salivary agglutinin but tl1at tl1e A-region of SspB did not In addition, structural analysis suggested that the A-region of SspB is le ss sta ble than that of SspA and PI both at high temperature and low pH. It should be not ed that the A-regions of SspA and SspB exhibit approximately 87% primary sequence ide11tity with one another while the A-regions of SspA and Pl only s hare 70% (see Figure 19 ) [35, 36, 116 141 ] In light of the similarities and di ffe rences reported betw een the A-regions of SspA SspB a 11d Pl it was of interest to see i f the Aand P-region s of these S. gordo,zii protei11s interacted with one another as we ll as with the A-and P-r egi ons of PI Again, interaction between these regions was examined by ELISA and a dose-dependent interaction was observed with mAb 3-8D reacting to A-region polypeptides binding to immobilized P-region polypeptides (see Figtire 11 ) The result s indicate that the r egion of P 1 intera c ts mor e strong l y with a ll of the P -regions t l1 an ei ther of the S. gordonii polypetides and that the SspB A-region is the weakest binder, which follows the tr e nd of Pl being more like SspA. Tl1e contribution of the Pl A-region and P-region interactions to native structure as det ermi ned by epitope restoration a nd the ability of the heterologous interaction of and P-regions led to the examination of epitope restoration b y t he interaction of the heterologous Aand P-region s As before, ELISA was u se d to de t ect the restoration of ep itope s for mAbs 4-lOA, 5-SD and 6-1 IA b y every combinatio11 of Pl SspA and SspB Aand P-region interactions in which eith the Aor P-regio n was immobilized. T h e re s ults demonstrated that the epitopes recogni ze d b y the se three Aand P-r egion

PAGE 96

85 dependent m.Abs were restored regardless of which P-region interacted with the immobilized A-region from Pl (see Figt1re 18). While when P-regions were interacted witl1 either of the S. gordonii A-regions, only the P-region of Pl restored any mAb reactivity, which was for mAb 5-5D and at a low level (see Figuresl6 and 17 ) Additionally, the A-region of Pl was able to restore all of the epitopes when interacted with any of the immobilized P-regions and the A-region of SspA was able to restore the mAb 5-5D epitope when interacted with immobilized Pl P-region (see Figure 1 5). And lastly, tl1e interaction of the A-region of SspB with any immobilized P-region failed to restore epitopes. Comparing the results of the Aand P-region interactions to the reactivity of mAbs 4-lOA, 5-5D, and 6-1 lA against full-length SspA and SspB as examined by Western immunoblot was interesting (see Figure 12). While mAb 5-5D reacted to both full-length SspA and SspB, its epitope was not restored by the interaction of the SspA and SspB and P-regions. The same held true for mAb 4-1 OA which bound to full-length SspB and weakly reacted to SspA. To summarize, although mAbs 4-1 OA and 5-SD bound to full length SspA and SspB, their epitopes were not restored by interactions of the Aand regions of these proteins unless one of the interacting regions was from P 1. Analysis of Pl Translocation and the Contribution of the Alanineand Proline-Rich Regions All life depends upon the targeting of newly synthesized proteins to their site of action. During transit to its destination, a protein must avoid a variety of hazards such as malfolding, aggregation, and degradation and may be required to pass through one or more membranes, known as translocation. Protein translocation has been extensive l y

PAGE 97

86 studied in E. coli and the model s established through this research are believed to be representative of all bacterial cells [142-144] but more recently, Ba c illus subtilis has become the model for Gram -p o sitiv e bacteria. Proteins that are targeted for translocation across the cytopla s mic membran e contain an N-terminal sig:i1al se quence [145] that generally contains positively charged residues followed by 15 to 20 hydrophobic residues[146, 147], which are usttally removed during or shortly after translocation Signal peptides can be clas s ified by the type of signal peptidase that is responsible for their proteolytic processing and these classifications can be used to predict the translocation pathways [148]. Based upon surveys of signal peptides in the genomes of B subtilis and several other Gram-positive bacterium it is predicted tl1at most extracellular proteins in these organisms are secreted via the Sec-translocase [149-151] 1n Bacillus subtili s, there are four predicted protein transport pathways; (i) the Sec dependent pathway, (ii) Twin arginine translocation (Tat), (iii) ABC transporter dependent secretion pathways (iv) and a pseudopilin-specific e x port pathway A survey offhe S mutans UA159 genome failed to reveal any homologue s of the Tat machinery or Tat signal peptides. In addition to the requirement for MAb reactivity the simultaneous presence of both the Aand the P-regions appear to be required for Pl stability in S. mutans. Analysis of mRNA encoding PIM like PlAf> [54], demonstrated that the internally deleted s paP gene was transcrib e d at levels equivalent to the wild-type spaP gene (see Figure 4) Differences in dnaK ntllNA levels in S mutan s harboring plasmids encoding Pl, Pl fl.A and Pl& also suggested that the Pl fl.A was being tra nslated However no PIM wa s detected in the cytopla s m on the cell surface (s ee Figure 3 ), nor in the culture

PAGE 98

87 liquor. While PlliP contains a deletion of 170 residues and PlliA lacks 287 residues, there are examples of stable antigen I/II polypeptides that, when compared to Pl, are lacking large segments of the molecules. The antigen I/II protein expressed by S interm e diu s Pas, lacks ~ 270 re s idues fro1n the A-region and -80 residues from the region [152]; Paa from S. cricetus possesse s an additional 139 residues in the A-region and ~ 39 residues less in the P-region (152]; and S. mutans GS-5 expresses a PAc molecule lacking the C-terminal ~ 400 residu e s (153]. The A-region of Pl consists of three-82 r e sidue repeats and th e P-region co n s ists of three 39-re s idue repeats and both Paa a11d Pas retain repeats in both regions. N ot all internal deletions in Pl result in the apparent level of instability seen in PlM and Pll\P. Rhodin et al. constructed a Pl construct lacking re sidues 84-190 which was detectable in S. mutans PC3370, but was not translocated to the surface (unpub li shed). This suggests that the Aand P-regions may contain inherent structural infor1r1ation possible chaperone binding sites, or perhaps possess chaperone-like activitie s that are critical to Pl stability A proline-rich r egion has been implicated as an intra1nolecular c hap erone by Wang et al. [79] The central proline ricl1 region of the Limulus secreted serine protease, Factor C, was shown to be required for s ecretion of the molecul e Their data s u gg ested that the corr e ct folding of th e molecule C-terminal of the pro lin e-rich re gi on was dependent tipon the presence of the proline-rich region and that the lack of secretion was due to malfolding. To fully understand the role of the Aand P-regions in Pl translocation, identifying the molecule's route of translocation is necessary. There is no experimenta l data that identifies the secretion pathway emp l oyed b y Pl or antigen I/II-lik e proteins Cell wall anchoring of P 1 and P Ac is 1nediated by the transpeptidase sortase [85, 154] and sortase

PAGE 99

88 anchored proteins are presumed to be translocated via the sec translocase [86] As detailed in the introduction, the Sec-dependent secretio n pathway has been thoroughly studied in E. coli and the characteristics of the pathway are pre sume d to be conserved for all bacteria. In E. coli, the Sec-translocase consists of a structure composed of several proteins including the ATPase SecA which provides the energy for translocation [87]. Current literature identifies two major pathways that a nascent protein destined for the Sec-translocase would be transported upon tl1e signal recognition particle (SRP) pathwa y and th e SecB pathway The SRP pathway is involved in co-translational protein sec retion The SRP recognizes and binds to the s ignal peptides of t1ascent polypeptid es as they emerge from the ribosome (89]. Binding of the SRP stalls translation and targets the SRP-ribosome complex to the SRP receptor FtsY [90, 91]. The SRP-ribosome-FtsY complex is then targeted to the Sec-transloco11 where the ribosome docks a nd th e protein is co tran s lationally translocated across the membrane [ 87 ] The cytoplasmic chaperone SecB targets preproteins to the Sec-translocon for post translational translocation. SecB binds to nascent an d full-l engt h proteins as they emerge from the ribos ome [92]. SecB interaction prevents premature folding of the preprotein and delivers it to the Sec-translocon in a sec retion-comp ete11t state. Binding of the SecB protein complex with SecA results in the transfer of the preprotein to SecA and the release of SecB [93] The protein is subsequently transloc ated across the membrane through the Sec-translocon [94] Due to the fai11t expression of PIM and the undet ectab l e ex pression of Pl~A in S. mutans, E.coli was used to begin to examine Pl secretio11. Pl 6 P and PlL.\,A are stab le

PAGE 100

89 and detectable, albeit at reduced l eve ls in whole cell lysates of E. coli by Western immunoblot. Analysis of peripla smic extracts by Western inm1unoblot revealed that Pl was secreted into the periplasm but Pl~P and PIM were not. This suggests that while the Aand P-regions are apparently not requir e d for stability in E. coli, the regions are required for secretion If a lack of chaperone interaction witl1 tl1e deletion recombin ant proteins results in the lack of secretion, perhap s a simi lar l ack of interaction also favo r s degradation of the molecules in S. mutans It is known that secretion incompetent proteins are subject to rapid turnover, which is a likely scenario when these constructs are expressed in S. mutans. With such a rapid turnover in S. mutan s and considering the time required for lysis of the bacterium pulse-chase experiments to determine the half-life of these deletion proteins in Streptococci are currently techni cally improbable. The SRP pathway has been identified in both gram-negative and gram-positive bacteria. In B subtilis, numerous homo log s of the general secretory pathway components have been identified. However, as is the ca se wi th S. mutans, no SecB homolog has been identified, but B. subtilis has been found to possess a functional ortholog, CsaA which has been shown to have partially overlapping binding characteristics [95-97]. As previously stated, the SRP i s essentia l for viability in E co li and it was assumed to be the case in all organisms. However it has been demonstrated that S mutans is viable without SRP [98] and P 1 is trans located and expressed on the cell surface in its absence (unpublished) This would suggest that if Pl secretion is Sec dependent, the targeting pathway sho uld likely be SecB-like and require a functional SecB ortholog To examine the possibility of a role for S ec B in P 1 secretion, P 1 was expressed in a SecB-negative E coli mutant, CK1953. Pl was shown to be stable and

PAGE 101

90 secreted into the periplasm in CKl 953. This suggest s th a t in E co li if Pl is secreted via the Sec-pathwa y, it i s associatin g with an alt e rnative chap e r o n e to SecB a function a l equivalent, or that it may b e abl e to use the SRP pathway Rec e nt evidence suggests that in the S mutans SRPmutants the protein YidC may be involved in a compensatory pathway (unpublished), illustrating the ever-evolving complexity of bacterial protein secretion pathways. The demonstrated interaction of the Aand P-region s combined with the apparent req uirement of their interaction for the restoration of structure as evidenced by epitope restoration led to the construction of a plasmid pTS31 which expressed Pl as two fragments The purpose of this construct was to examine wheth e r the expression of the Aand P-regions on separate polyp e ptides would be s uffi c i en t for translocation of th e polypeptides across the cell membrane Precedence for tr a n s complementation with an intramolecular chaperone resulting in protein secretion and function was demonstrated with P aerugin os a LasB [ 126 ]. Th e recently discovered twin-arginine-translocation (TAT) pathway tran s port s folded proteins across cell men 1 brar1 es [155] and although a survey of the S. mutan s genome did not reveal any homologou s TAT genes or TAT signal sequences the translocation characteristics of the Pl derivatives and the interaction of the Aand P-regions suggested the possibility of a partial folding requirement prior to translocation In E c oli both the N-terminal A-re g ion and C -tetm i nal P-re gj on co11tainin g fragments could be ea s il y d e t e ct e d in the cell ly s at e s b y Wes t e rn immunoblot (see Fi g ur e 26) However, in S. mutan s, only the A-region containin g fra g ment was detected in the cell extracts. In addition th e N-terrninal fragment could b e d e tect e d in the S. mutan s

PAGE 102

91 culture supernatant. These results indicate that the amino-terminal s ignal sequence is sufficient for the stable expression and translocation of a Pl polyp e ptide consisting of the first 480 amino acids. Also, tl1at the A-region fragment expressed in tra,zs is not sufficient to protect the apparently unstable carboxy-terminal 1081 amino acids in S mutans These results did not reveal any details of Pl translocatio1 1 that contradict the presumed use of the Sec tran s loca s e It appears from the above rest1lts that the A-and P-re gi o111nt1 s t reside within the same molecule for the stable expression of Pl To begin to identi fy which residues within the A-region are important for PI stability, structure and translocation, the DNA encoding the A-regions from S. gordonii SspA and SspB was ligated into the site of the A-region deletion in PIM The chimeric Pl proteins were expre ss ed in both E c ol i and S mutans PC33 70 and restoration of stability and stru cture as det e rrnined by epitope resto ration, was examined by Wes tern immunoblot. In E. c oli, the immW1oblots indicated that some native structure was restored by the A-region of SspA as suggested by restoration of the mAb 5-5D epitope (see Figure 20) Howe v er the A-region of SspA did not restore 4-1 OA or 6-11 A bi11ding and the insertion of tl1 e Aregion of SspB did not restore any of the Aand P-region dep e ndent epitopes These results agree with the previously demonstrated restoration of the mAb 5-SD epitope by tl1e interaction of the region of SspA and the P-region of Pl. Full-length SspA and SspB were translocated to the strrface of PC3370 indicating that there was no inherent instability when expressed in S niut a n s (see Figure 21) The introduction of the heterologous A-regions did not restore surface expression of Pl in PC3370 (see Figure 22). In addition, no full-length chimeric Pl proteins were detected in

PAGE 103

92 lysates of PC3370 by Western immunoblots. However, break down products were detected by the A-regions specific mAb 3-8D (see Figure 23) As seen previously with the expression of the discontinuous PI fragments, the N-terminal appears to be more stable than the C-tenninal of Pl. The lack of stability and translocation of the chimeric Pl proteins in PC3370 suggests that information intrinsic to the Pl A-region is required for Pl stability and that, although highly conserved, the structural information provided by the A-regions of the antigen VII proteins may be protein specific Of the 288 amino acid residues in the A-regions that were swapped, the A-region of Pl differs from the A region of SspA at 86 residues although 34 of those have similar properties and with SspB at 94 residues with 45 being similar (see Figure 19) The differences between the A-regions in SspA and SspB are at 36 residues with 19 being similar. It is unlikely that a s ingle residue is responsible for the difference between the partial restoration in structure that is seen with the SspA A-region and complete native Pl structure However, by subtracting those residues that SspB has in common with PI from the residues that differ between SspA and P 1, the field of candidates can be narrowed to 24 residues with 14 being similar. These results can be used to define target residues for potential site directed mutagenesis in future studies. In addition, as previously stated, the S. intermediz1,s Pas protein is missing 2 / 3 of the A-region and is still stable which illustrates that there is no global requirement for the entire A-region. Future experiments involving the insertion of A-region segments into Pl~A ma y al s o elucidate a minimum requirement for Pl stability.

PAGE 104

93 Involvement of RopA (Trigger Factor) and DnaK in the Maturation and Translocation of Pl Signal p eptides are neces s ary and s u ffi c ient fo r pr otein trai1slocation i f th e protein can be maintained in a secretion-competent s tate which for most proteins is an unfolded state To maintain this export competent conformatio n pr ecursor proteins interact w itl1 cytoplasmic chaperones Chap e rones do not r ec ognize s i gna l peptides, but they play a11 e sse ntial r ole in the tran s port and t r anslocati on of extrac e l lular proteins by binding to and maintaining their prot ein s ub strates in a lo o se l y folded conformation that is requir ed for translocation across the membran e [ 156]. To b e gin to characterize the chaperones involved in the tran s location and maturation of Pl, the chaperones RopA and DnaK were examine d The bacterial h eat s ho ck protein DnaK is involved in a wide-variety of cellular pr ocesses ran ging from assisting in protein folding to targeting a protein for degr a dat ion. Tl1e common function of DnaK is to bi11d t o s hort hydrophobic region s of polyp e ptide s that are ge n e rall y not ex po se d in properly fold e d prot ei n s. DnaK binding to th ese r egions prevents protein aggregation and halts foldin g Depending upon t h e cellular co ndition s th e protein may be transferred t o n1ore spe ci a li z ed c h a p eron e s for refo ldin g or de s tined for d egra dati on Sev e ral studies h ave shown tl1a t DnaK can also maintain the translocation com petence of pr esecreto r y p rot e ins which is also th e role of SecB [ 15 7 160]. DnaK i s s tructurall y unrel ated to SecB a1 1 d it s bindin g to polypeptides is ATP d e p endent and is re g ulat ed by co -ch apero n e s [ 16 1 162] 111 a ddition the substrate s p ecifici t y and for eac h c h a p erone differs co 1 1 s ide rabl y [1 6 1-1 64 ] Evi den ce suggests that c h a perones ha ve overlapping functio11S in the protein export pathway. The

PAGE 105

94 functional redundancy of chaperones may explain why SecB in E. coli and SRP in S. nzutans are not essential for cell viability. The first chaperone or folding catalyst that interacts with nascent presecretory proteins is the peptidyl prolyl isomerase trigger factor [ 102 165] Trigger factor is an abundant cytoplasmic protein whicl1 cataly z es trans to cis prolyl bond isomerization during the refolding of denatured proteins. In E. coli, trigger factor associates with the 50s subunit of the ribosome (166] and it was found to interact witl1 a wide variety of nascent proteins both in vitro as well as iri vivo (89, 102, 103, 165 167]. In vivo studies present evidence that trigger factor has a role in the cytosolic folding pathway together with the cytoplasmic chaperone DnaK [103, 167]. DnaK was found to interact under non-stress conditions with nascent chains with of 30 kDa or lon ge r. Deletion of the non essential gene encoding trigger factor resulted in the doubling of the number of nascent chains interacting with DnaK Under these conditions DnaK int e racted with much shorter nascent chains, suggestu1g that trigger factor is the first protein that interacts witl1 the nascent chains as soon as they emerge from the ribosome. Several recent studies have revealed that i11 addition to ison1erase activity trigger factor has chaperone activity Trigger factor prevents the aggre g ation of proteins either in combination with GroEL-GroES or alone [ 168] a11d is necessary for the breakdown of abnormal proteins [ 169] Moreover, refolding of GAP DH was sl1o w 11 to be assisted by the chaperone function of t1-igger factor [ l 70] and the isomera s e ac t ivi t y of trigger fa ctor has been shown not to be r e quir e d for the folding of newl y s ynth esi ze d cytoplasmic proteins in E. coli [ I 06]

PAGE 106

95 Additiona l l, a role for trigger factor in secretion was demon strate d by Beck et al. [ 171] who suggested that trigger factor has a role as a decisio11 m aker a nd directs presecretory proteins into the chaperone based targeting pathway H owev er, trigger factor bas not been found to b e esse ntial for sec r et ion of any kno wn pr o t e in in E coli or B s ubtilis nor i s it essential for ce ll v iability [ 1 67, 172, 1 73] In S p vog e n es, ho wever, trigger factor (RopA) is essential for tl1e secretion and matt1ration of t l1 e cysteine protease, SpeB. Lyon et al. demonstrated that in the absence of RopA tl1e nascent protease polypeptide was not targeted to the se cretory pathway Wl1il e an in-frame deletion of the PPiase domain within RopA re s ulted in a se cret e d but e 1 1Z ymatically inactive protease suggesting that trigger factor has an additional r o l e i11 protease maturation [174]. It was subsequently determined that a single pralin e, P78 was the target of the PP lase activity that was required for maturation of th e pr ot ease [ 107]. It is interesting that the lack of isomerization can send the protea se into a n a lternative foldin g pathway which results in a malfunctioning enzyme yet not appear to ef fect its secretion In S. mutans RopA was rec e ntl y found to be involved in st r ess tol e ran ce and biofilm formation [112] The involvement of RopA in the expression of functional P 1 in S. mutans was examined u s in g an adheren ce a ss ay and analy ze d with a BIAcor e 3000 ( BIAcore AB Uppsala, Sweden) as described in [12 8 ] .. The binding of S mutans to sa livary a gg lutinin has been shown to be mediated by Pl and the binding can be inhibit e d by the Pl-specific Mab 4-IOA but not by the Plspec ific Mab 6 1 lA [33] Adherence of th e ropA-negative S mutan s TW90 to salivar y agglutinin was substantially lower( < 50 %) than that of the wild-type UAl 59 and the inhibition of adherence of both UAl 5 9 and TW90 b y th e

PAGE 107

96 addition of Mab 4-lOA indicated that the adherence was Pl mediat ed An obvious cause of the reduction in adherence would be a reduction in surface expre s sed Pl; however, whole cell dot blots indicated that this was not the case TW90 and UA159 expressed equivalent levels of P 1 on their surfaces at botl1 time points examined earlyl og and stationary phase (see Figure 28) These results indicate that RopA is not required for the secretion of Pl but suggest that it is required for the maturation of Pl to a fully functional adhesin. Whether the effect is due to the lack of a direct interaction between RopA and nascent P 1 or an indirect effect through intennediates is tin.known and the subject of future studies. Since DnaK is required for S. mutans viability, the effect of DnaK on the surface expression of Pl was examined in S mi,tans SM12, which expresse s only 5% of wild type levels ofDnaK. Whole cell dot blots of SM12 harvested at early-log phase expressed significantly reduced levels of Pl on the surface compared to wild-type UA159 (see Figure 29) However at stationary phase the levels of surface P 1 were equivalent These results do not necessarily indicate a direct interaction of D11aK with P 1 as the reduced surface expression may be a general reduction in all protein translocation. Additionally, like with RopA any observed effects may be due to required DnaK interactions elsewhere in the secretion pathway At the stationary growtl1 stage, Pl surface expression in the down-regulated DnaK mutant is equivalent to the wild-type suggesting that the continuous, but reduced, translocation of Pl eventually catches up to the wild-type levels. Whether the reduced level of trans location is dt1e to a direct effect ofDnaK on Pl or is due to an effect on the secretion pathway compone11ts is still to be detennined.

PAGE 108

97 Quantitative Real-Time PCR was used to measure the effects of th e presence of Pl PlM and PlM on dnaK mRNA levels in S mutan s PC3370 (see Figure 30). Statistical analysis of the data revealed significant differences between the level s of dnaK mRNA in PC3370 harboring the vector onl y ve rses PC3370 expressing PIM and PlLiP. Oddly th e level of mRNA in the cells expressing PlLiP wa s lower than in the vector only control The highest level of dnaK mRNA was in PC3 3 70 expre ss ing PlLiA In E. coli transcription o f d naK is initiated by a cr 32 promoter which DnaK is involved in regulating by int e ra c ting with the cr 32 subunit of RNA polymerase It was proposed that the presenc e o f d e natured proteins acts as a s ink for DnaK thus freeing cr 32 thus initiating dnaK transcr iptio n[l 75]. Dn aK in S. mutan s, on the other hand is transcribed from a cr A -type promoter [176] and is negatively regulated by HrcA [I 77]. Although neither PlLi A nor Pl LiP could be detected in P C33 70 using immunological methods th e e ff ec t of their ex pression on dnaK mRNA levels would suggest that they were ind eed translated. The difference in dnaK mRNA levels in the pr ese nce of P 1 L1A verses P 1 LiA ma y be a circumstance of protein s tability in that P 1 LiP might be turned over more ra pidl y than Pl Mand that DnaK was not involved in the process. It is also plausible t hat the P-region in the malfolded PIM acted as a sink for DnaK which resulted in upr egu lation in a manner of transcriptional control that i s similar to that seen with the E coli a 32 Further research will be needed to determine if the difference in expression le vels c orr e lates to differe11ces in DnaK binding to Pl and its derivatives. Conclusions The goal of this rese arch was to provid e insight into th e cont ribution of th e prolin erich region to the structure translocation, and antige11icity of Pl The analysis of th e P

PAGE 109

98 region and its interaction with tl1e A-region has revealed information regarding the structure of the molecule and the complexity of the epitopes that are recognized by anti Pl mAbs. These studies have also shown a requirement of these regions for Pl stability and translocation to the cell surface of S. mu ta ns and to the periplasm of E coli. In addition, it has established E. co li as a viable tool for future Pl translocation studies. The results of this research have implications for understanding surface localization of virulence factors in pathogenic microorganisms and for understanding how the protein structure of a vaccine antigen contributes to recognition by antibodies.

PAGE 110

LIST OF REFERENCES 1 Hamada, S.and H D Slade Biolo gy, immunology, and cariogenicity of Streptococcit s rn utan s. Microbial Rev 1980. 44: p. 331-384. 2. Loesche, W.J ., Role of Streptococcus mutans in human dental decay Microbial Rev 1986 50 : p.353-380 3. Bratthall, D ., Demo,zstration of five serological groups of streptococcal strains r esemb ling Str e ptococcus mutans. Odontol Rev, 1970 21 : p 143-152 4. Perch B ., E. Kjems, and T Ravn, Biologi ca l and serological properties of Streptococcu s mutarzs fro,n , arious human and animal sources. Acta Pathol Microbial Scand [B] Microbial Immunol 1974 82: p. 357-370. 5 Coykendall, A.L., Bas e co,npositio n of deoxyribonucleic acid isolated from cariogenic streptococci Arch Oral Biol, 1970. 15 : p. 365-368. 6 Coykendall, A.L., Four t ypes of Streptococcus mutans based on their gen e tic and biochernical characteristics. J Gen Microbial, 1974. 83 : p 327-338. 7. Coykendall, A L., Pr opos al to elevate the subspecies of Str eptococc us mutans to species sta tu s based ori th e i1 molecular composition Int J Syst Bacterial, 1977 27 8 Pucci, M.J., and F. L. Ma cr ina Cloned gtfA gene of Streptococcus mutans LM7 alters glucan synthesis in St teptococci,s sanguis Infect Im.mun, 1985. 48: p 704712. 9. Shiroza, T ., S. Ueda, and H K Kuramitsu, Sequen ce anal y sis of the gtfB gene from Steptococcus mutan s. J Bacterial, 1987. 169 : p 4263-4270 10 Pucci M.J., K. R Jone s, H.K. Kuramitsu, and F. L Macrina, Molecular cloni ng and c haracteri z ation of th e glucosyltransferase C gene (gtfC) from Streptococcus mutans LM7 Infect Immu1 1, 198 7. 55 : p. 2176-2182 11. Honda, 0 ., C. Kato and H. K. Kuramitsu, Nucleotide sequenc e of the Streptococcus mutan s gtjD gene encoding the glu cosy ltra11s ferase -S enzyme. J Gen Microbial, 1990 136 : p. 2099-2105 99

PAGE 111

100 12. Russell, R.R., Glucan-binding proteins of Streptococcus mutans serotype c. J Gen Microbiol, 1979. 112: p. 197-201. 13. Smith, D.J., H. Akita, W F. King, and M A. Taubma11, Purtficatiorz and antigenicity of a novel glucan bindirzg protein of Streptococcits mutans. Infect Immun, 1994.62:p 2545-2552. 14. Sato, Y., Y. Yamamoto, and H Kizaki, Cloning and sequence analysis of the gbpC gene encodirzg a novel glucan-binding protein of Streptococcus mutans. Infect Immun, 1997. 65: p 668-67 5. 15. Staat R.H., S D. Langley and R. J Doyle, Streptococcus ni itta r1 s adherence: presumptive evidence for protein-mediated attachment followed by glucan dependent cellular accumulation. Infect Immun, 1980 27: p 675-681. 16 Russell, M W. and T. Lehner, Characterisation of antigerzs extracted from cells and culture fluids of Streptococcus mutans serotype c. Arch Oral Biol, 1978. 23(1): p. 7-15. 17. Russe ll R.R., Wall associated potein antigens of Streptococcus mutans J Gen Microbio l 1 979. 114 : p 109 115. 18. Hughes, M ., S. M. Machardy, A J. Sheppard, and N. C. Woods, Evidence for an immunological relationship between Streptococcus mutans and human cardiac tissue. Infect Immun 1980 27: p. 576-588. 19. Foreste r H., N. Hunter, and K.W. Knox, Characteristics of a high nioleci,lar weight extracellular p,~otein of Streptococcus mutans. J Gen Micro biol, 1983. 129 (Pt 9): p. 2779 88 20 Ackermans, F J.P. Klein, J. Ogier, H. Bazin, F. Cormont, and R M. Frank, Purification and characterization of a saliva-interacting cell wall protein frorn Streptococcus mutarz s serotype f by using monocloncil antibody immunoaffinity chromatography. Biochem J, 1985. 22 8 : p. 211-217 21 Oka h ashi, N C. Sasakawa, M Yoshikawa, S Hamada, and T Koga, Cloning of a surface protei,i antigen gene from serotype c Streptococcus mutans. Mo l Microbio l 1989 3 (2): p 221-8. 22. Ma, J.K., C.G. Kelly, G. Munro, R.A Whi l ey, and T Lehner, Conservation of the gene encoding streptococcal antigen I / II tn oral str e ptococci Infect Immun, 1991. 59(8) : p. 2686-94 23. Abiko, Y., M Hayakawa, H. Aoki, S. Saito and H. Takiguchi, Cloning the gene for cell-surface protein antigen A from Streptococcus sobrinus (serotype d) Arch Oral Biol, 1989 34: p 571-575.

PAGE 112

101 24. Takahashi, I., N. Okal1ashi, C. Sasakawa, M. Yoshikawa S. Hamada, a11d T. Koga, Homology betw ee n s urface prot e in antigen genes of Streptococcu s sobrinu s and Streptoco cc us mutans FEBS Lett, 1989 249(2): p. 383-8. 25 Demuth, D R ., C A Davi s A. M Comer R. J Lam o nt P S Leboy and D Malamud, C l o ning a nd exp r e ss i o n of a Str e pt ococc u s sa n gui s s itrfa c e a nti ge n that interacts with hum c in s a livary agglutinin Infect Irrunun 1988 56: p. 24842490. 26 Jenkinson, H.F S D. Terry R. McNab, and G W Tannock, Inactivation of the gerze encoding s urfa c e prot e in SspA in Streptococcus gordonii DLJ affects cell interactions with hitman s alivary agglutinin and oral actinomyces Infect Im.mun 1993. 61(8) : p 3199-208 27. Demuth, D.R. Y. Duan W. Brooks A R Holmes, R McNab and H.F Jenkinson, Tandem ge n es e n c od e cells ur fa ce pol y p e ptid es S s pA cznd SspB which mediate adhesion of th e oral bacterium Str e ptococcus gordonii to human and bacterial receptors Mol Microbial, 1996. 20(2) : p 403-13. 28 Kelly, C P. Evans, L. Bergmeier S.F. Lee, A. Progulske Fox, A.C. Harris, A Aitken, A.S Bleiweis, and T. Lehner, Seqitence anal y sis of the cloned strepto c occal ce ll su,fa ce antig e n I / II FEBS Lett 1989 258(1 ) : p 127-32 29. Lee S.F. A Progu l ske-Fox and A.S. Bleiweis, Mol ec ular c loning and ex pr ess ion of a St, ~ e pto cocc L,1, s 1 11 u ta i s 11 1. clj o r si,rfa ce pr o te i n an ti g e ti Pl ( J i ll ), i n Esch e richia c oli Infect Immun 1988. 56( 8 ) : p 2114-9. 30 Troffer-Charlier, N ., J. Ogier D Moras, and J Cavarelli, Crystal structure of th e V-region of Streptococcus mutans antigen J i ll at 2 4 A resolution suggest s a sugar preformed binding site. J Mol Biol, 2002. 318(1): p. 179-88. 31. Beg A M M N. Jones T Mill e r-Torbert, and R G. Holt Binding of Streptococcus mutan s to e xtra ce llular matrix moleci,les c ind fibrinogen Biochem Biophys Res Commun 2002 298(1 ) : p 75-9 32 Sciotti, M.A ., I Yamodo, J P. Klein and J A. Ogier, Th e N-terminal half part of the oral streptococcal antigen 1 /l lf contains two distinct binding domains FEMS Microbial Le~ 1997 153 ( 2) : p. 439-45 33. Brady, L J ., D A Piacentini P.J Crowley, P.C Oyston and A.S Bleiweis Differ e ntiation of saliva ry a gg litt i nin-m e diated adheren c e and aggregati o n of mutans streptococci b y it se of 111 o no c lorzal a ntibodi es against th e n i ajor s urfa ce adhesin P 1 Inf e ct lmrnun 199 2 60(3 ) : p 1008-1 7

PAGE 113

102 34 Hajishengalli s, G., T Koga, and M.W. Ru sse ll Affinity and sp ec ificity of the interactions between Str e ptococ c us mutans aritigen J I ii and saliv a ry co mp onents. J Dent Res, 1 99 4. 73 (9): p 14 93-502. 35. Crowley, P.J ., L.J. Brad y, D A Piacentini, and A.S Bleiweis I de ntification of a salivary agglutinin-bincl i ng domai n wit hirz cell su 1fa ce ad h esin P 1 of Streptococcus mutarz s. Inf ect Imrnun 1993. 61 ( 4): p 154 7 -5 2 36. Mois se t A., N. Schat z, Y Lepoivre, S .Ainadio, D Wachsma1111 M. Scholler, and J.P Klein Co n servation of sa liv ary glycoprotein-interacting a11 c l liuma n immun og lobul i n G-cros s -r eac tiv e d omains of a 1 1tige n I l l/ in or a l s treptococci. Infect Immun 1994 62 ( 1 ): p 1 8 4-93 37. Munro G.H., P Evans S. Todryk P Bu ckett, C.G. Kell y, and T. Lehner A protein fragment of streptoco c ca l cell surface a 1 ztigen J i ll whi c / 1 p revents adh e sion of Str e pto co c c i s 111z,1t a n s l11fect lmmun, 1 993. 61 (11 ): p. 45 90 8. 38. Kell y, C.G., S Todryk H.L Kendal, G.H. Munro, and T. Lehner T-cell adhesion, and B -cell e pitopes of the ce ll surface Streptococcu s m it ta ns protein antigen 1 11 1 Infect Immun 19 9 5 63 (9): p 3649-58. 39. Morris, A.L. M.W. MacArthur, E.G. Hutchinson and J M. Th ornt on St e r eoc h e m ica l quality of protein str u ctu r e coord ina tes Prote in s 1992 12 ( 4 ) : p 345-64. 40 Hurley J H ., D A Mason, and B .W. Matthews, Flexible-geo1n e tf) 1 conformat i o n al energy map s for the amino acid residue prece di t1 g a prolitie Biopolymers 1992 32 ( 11 ): p 144 3 -6 41. Richardson J S and D .C Richardson Amino acid preferences J o specific locations at th e e nds of alpha helices. Science, 1988. 240 ( 485 9): p 1648-52 42 C owan P .M, M S., a nd N.A. C., The polypepticle chain co r ifi g i,, ation of col l agen. Nature, 1955 176 ( 44 92): p. 10 624 43 Blund e ll T.L. J E Pitt s I.J. Ticl < l e, and S P. Wood Th e co nf or1 1 1c ztion and receptor binding of pancreatic h ormones Biochem Soc Trans 1 98 1 9(1 ): p 312. 44 Ad z hubei A.A and M.J. Sternberg L efthand ed polyproline II h e li ces co mm o nl y occur in globular pr oteins J Mol Biol 1993 229 (2) : p 472-9 3. 45 Cravatt, B .F., D K Giang S.P. Mayfield, D.L. Boger R A. Len1 e r, and N. B Gilula, Molecular chara c terization of an en zy m e that d e grade s ,i e uromodulatory fatty-acid amides. NatLlfe 1996. 384 (6604): p 83-7

PAGE 114

103 46. Arreaza G and D.G. Deutsch, Deletion of a praline-rich region arz c / a transmembrane domain i1z fatty acid amide hydrolas e. FBBS Lett 1999. 454( 1-2) : p. 57-60 47. Okamoto, P .M J.S Her skov its and R B. Vallee, Rol e of the basic proli1ze -r ich region of dynamin in Src homology 3 doniain binding and endocyto sis. J B iol Chem, 1997. 272(17) : p 1162935. 48 Hansson J H ., C. Nelso11-Williams, H. Su z uki L. Schild, R. Shimk e ts Y. Lu C. Canessa, T. Iwasaki B Rossier and R P. Lifton, H yper t e risi o n cait sec l by a truncated epithelial sodium cha nnel gamma subi,nit: genetic heter ogeneitJ 1 of Liddl e syndrome. Nat Genet, 1995 11(1) : p 76-82. 49 Hansson J H. L. Schild Y. Lu T.A. Wil so n, I. Gautschi, R Sbin1k ets, C. Nelson-Williams, B.C Rossier, and R P. Lifton, A de novo nii ssens e 11 i i1tation of the beta subunit of the epit helial sodiuni channel causes h yperte n siorz and Liddl e syndrome, id entifying a pr ol irz e -ri ch seg ni erz t cri ti cal for regulation of cha ,inel activity. Proc Nat l Acad Sci US A, 1995. 92(25) : p 11495-9 50 Mannick, J.B. J I. Cohen, M Birkenbach, A. Marchini and E. Ki eff, Tlz e Epstein-Barr virus nuclear protein encoded by th e leader of the EB NA RNAs is important in B l y mpho cyte transformation J Virol 1991 65(12): p. 6826 -37. 51 Yalamanchili, R., S Harada and E. Kieff, The N-tem1inal half of EBNA2, except for seven pr alines, is ,zot esse ritial for primary B-l ymphocJ 1 te grow th transformation. J Virol, 1996. 70( 4) : p 2468-73. 52 Cociancich, S ., A. Dupont G. Hegy, R. Lanot, F. Holder, C. Hetru J.A. Hoffinann, and P. Bulet, Novel indu cib l e antibacterial peptides fro,n a hemipteran in sec t, the sap-sucking bug P y rrho co ris apterus. Bioch e1n J, 1994 300 (Pt 2): p 567-75. 53 Otvos L ., Jr ., K Bokonyi I Varga, B.I Otvos, R. Hoffmann H .C. Ertl, J D Wade, A.M. McManus, D J Crailc, and P Bulet, Ins ect p eptides wit 71 i111proved protease-resistance p1ot ec t mice agai11st bacterial infection. Protei n Sci 2000. 9(4): p. 742-9 54 Brady L.J. D.G Cvitkovitch, C.M. Geric, M .N. Addison J.C. Jo yce, P J Crowley, and A.S. Bleiweis D e l etio n of the ce ntral proli,ie-rich r epeat do main results in alter e d antigenicity and lack of surface exp r essio n of th e Str e ptococcus mutans P 1 adhesin mole cule. Infect Imrnun, 1998 66(9): p 427482. 55 Chen, R ., W Sclunidmayr C. Kramer U. C h e n-Schm e i sse r and U. H en 11ing, Primary structitre of majol' o uter membrane protein II (0 111pA pro teirz) of Escherichia coli K -12. Pro c Natl Acad Sci US A, 1980 77 (8): p 4592-6.

PAGE 115

104 56. Gi l kes, N.R. B. Henrissat D .G. Kilburn R.C Miller Jr., and R.A Warren, Domains in microbial betaI, 4-glycanases : sequence conservation, function, and enzyme families. Microbiol Rev 1991 55(2) : p 303-15. 57 Han, N., J Whitlock and A. Progulske-Fox The hemagglutinin gene A (hagA) of Porph y romorza s gingivalis 381 contains four large, contiguoits, direct repeats. Infect Immun 1996 64(10) : p 4000-7. 58. Hannavy, K., G C. Barr C J Dorman, J. Adamson, L.R. Ma ze ngera M.P Gallagher, J S. Evans, B.A Levine, J.P Trayer, and C.F. Higgins, TonB protein of Salmonella typhimurium. A model for signal transduction between melrzbranes J Mol Biol, 1990 216 ( 4) : p 897-910. 59. Heden L O., E. Frithz, and G. Lindahl Molecular characterization of an JgA re ceptor from group B streptococci: sequence of the gene, id e 11tifi cation of a proline-rich region wit h unique structure and isolation of N-terminal fragments with lgA-binding capacity. Eur J Immunol 1991. 21(6): p. 1481-90. 60. Larsen, R.A., G.E. Wood and K Postle, Th e co nserv ed proline-rich motif is not essential for energy transduction by Escherichia coli TonB protein Mol Microbiol, 1993. 10(5) : p. 943-53. 61. Pistor, S. T Chakraborty, K Niebuhr, E. Domann, and J. Wehland, The ActA protein of Listeria n-zono cytoge n es acts as a nucleator inducing reorganization of the actin cytoskeleton E1nbo J 1994 13( 4) : p 758-63. 62. Proft, T., H. Hilbert G. Layh-Schmitt, and R. Hemnann The proline-rich P65 protein of Mycoplasma p11eumo nia e is a compone nt of the Triton X-1 OD-insoluble fraction and exhibits siz e poly morphism in th e strains Ml 29 and FH. J Bacteriol 1995. 177(12): p. 3370-8 63. Southwick, F.S. and D.L Purich, Intra cel lular pathogenesis of listeriosis. N Engl J Med 1996 334 (12): p 770-6. 64. Timoney, J.F., J. Walker M. Zhou, and J Ding, Cloning and sequence analysis of a protective M-like prot e i,i gene from Streptococcus equi subsp. zooepidemicus. Infect Immun, 1995 63(4 ): p. 1440-5. 65. Signas, C., G. Raucci, K Jonsson P .E. Lindgren, G.M. Anantharamaiah M Hook, and M. Lindberg Nucleotide sequence of the gene for a fibronectin binding protein from Staphylococcus aureus: use of this peptide sequence in the synthesis of biologi cal l y active peptides. Proc Natl Acad Sci US A, 1989 86 (2): p 699-703.

PAGE 116

105 66. Talay, S.R. P. Valentin Weigand, K.N. Timmis, and G S. Chhatwal, Domain structure and conserved epitopes of Sjb protein, tlze fibronectin-binding adhesin of Streptococcus pyogenes Mol Microbial 1994. 13 (3): p. 531-9. 67. Mciver, K.S., S. Subbarao, E.M Kellner, A.S. Heath and J .R. Scott, Id entification of isp, c, locus encoding ctn im munogenic secreted protein conserved among group A streptococci. Infect Immun 1996 64(7) : p 2548-55. 68. Yother, J. and D.E Briles, Structural prop erties and evolutionary relationships of PspA a surface protein of Streptococcus pneumoniae, as reveal e d by sequence ana l ysis. J Bacterial 1992. 174 (2): p 601-9. 69 Aravind, L., The WWE domain: a common interaction module in protein ubiquitination and ADP ribosylation. Trends Biochem Sci, 2001 26(5): p 273 -5 70. Ball L.J., T. Jarchau H. Oschkinat, and U Wa lt er, EVHJ domains: structu re function and interactions. FEBS Lett, 2002. 513 (1): p 45-52. 71. Foucault, I. Y.C. Liu A Bernard, and M Deckert The chapero ,i e pr otei n 14-3-3 interacts with 3BP2/SH3BP2 and regulates its adapter function J Biol Chem, 2003. 278(9): p. 7 14 6 -5 3 72 Freund, C., V. Dotsch K. Nishizawa, E.L. Reinherz, and G. Wagner, The GYF domain is a novel stri,ctilral fold that is involved in l y mphoid sig,zaling througl1 praline-rich sequences. Nat Struct Biol 19 99 6(7) : p 6 56-6 0. 73. Hung A.Y. and M She11g, PDZ do,nains: st ru ctu ral modules for protein complex assemb l y. J Biol C h em, 2002. 277(8): p. 5699702. 74. Kay, B.K., M P Williamson and M Sudol, Tlie importance of being praline: the interaction of pro line-rich motifs in signaling proteins with their cognate domains. Faseb J 2000. 14 (2): p. 231-41. 75. Koepf E .K. H.M. Petrassi G Ratnaswamy M .E. Huff M Sudol, and J W Kelly, Characterization of t}ze structure arid function of W -> F WW domain variants: identification of a nativel y unfolded protein that folds upon ligand binding. Bioch em i stry, 1999 38 (43): p. 14338-51 76 Macias M.J ., S Wi es n er, and M. Sudol WW an d SH3 domains two different scaffo lds to recogni ze praline-rich ligands. FEBS Lett, 2002 513(1 ): p 307. 77. Tzivion, G., Y H Shen, and J Zhu, 14-3-3 proteins ; bri11ging new definitions to scaffolding. Oncogen e, 2001. 20( 44): p. 6331 8. 78. Yaffe, M.B. and A.E. E li a, Pf,zosphoserine/threonine-binding domains. Cttrr Opin Cell Biol, 2001. 13 (2): p 131-8

PAGE 117

106 79. Wang, J., N.S. Tan, B. Ho, and J.L. Ding, Modular arrangement and secretion of a multidomain serine protea se. Evidence for involvement of praline-rich region and N-glycans in the secretion pathway J Biol Chem, 2002. 277(39): p. 3636372. 80. Navarre W.W. and 0 Schneewind, Proteolytic cleavage cznd cell wall anchoring at the LPXTG motif of surface proteins in gram-positive bacteria Mol Microbial, 1994. 14(1) : p. 115-21 81. Ton That, H., K.F. Faull, and 0. Schneewind Anchor structure of staphylococcal surface proteins A branched peptide that links the carboxyl terminus of proteins to the cell wall. J Biol Chem 1997. 272(35): p. 22285-92 82. Dhar, G., K F. Faull and 0 Sc hneewind Anchor structu r e of cell vvall surface proteins in Listeri a ,nonocyt og enes. Biochemistry, 2000 39(13): p 3725-33. 83. Schleifer, K.H. and 0. Kandler Peptidoglycan types of bact eria l cell walls and their taxonomic implications Bacteriol Rev 1972 36(4): p. 407-77. 84 Navarre W.W. and 0. Schneewind Surfa ce proteins of gram-posi tive bacteria and mechanisms of their tar geti ng to the cell w all envelope Microbial Mol Biol Rev, 1999 63(1): p. 174-229. 85. Lee, S.F and T.L Boran Rol es of sortase in surface expression of the major protein adhesin P 1 sa liva-induced aggregation and adherence, a1zd ca riogenici ty of Streptococcu s mi1tans. Infect Immun, 2003. 71(2): p. 676 81. 86 Mazmanian, S K., H Ton-That, and 0 Schn ee wind, Sortase-catal yse cl anchorin g of surface proteins to the cell wall of Stap}1 y lococcus aureus. Mol Micro biol, 200 l 40(5): p. 1049-57 87. de Keyzer, J ., C. van der Does and A.J. D ries~e n The bacterial t, ,.ansl ocase: c, dynamic protein c h a rznel com ple x. Cell M ol Life Sci, 2003. 60(10 ): p. 2034 52. 88. Phillips, G.J. and T.J. Silhavy, Th e E. coli jjh gene is necessary for viability and efficient protein export. Nature, 1992. 359(6397): p. 744-6. 89. Valent, Q.A. J.W de Gier, G von Heijne D.A Kendall, C.M ten Hagen Jongman, B. Oudega and J Luirink, Nasc e nt membrane and prese c r etory proteins synthesi ze d in Esch e ricl1ia coli as soc iate with signal re cogrzition parti cle and trigger factor. Mol Microbiol 1997 25(1): p. 53-64. 90. Luirink, J ., C.M. ten Hagen -J ongman, C C van der Weijden B. Oude ga, S. Hi g h B Dobberstein, and R Kusters, An alternative protein targeting pathway in Escherichia coli: studies on the role of FtsY Embo J, 1994. 13(10): p 2289-96

PAGE 118

107 91. Seluanov, A and E. Bibi, FtsY, the prokar; 1 otic signal recognition particle receptor homologu e, is essentia l for biogenesis of menibrane proteins. J Biol Chem, 1997. 272( 4) : p. 2053-5. 92 Francetic, 0., M P Hanson a11d C.A. Kumamoto pr/A suppression of defective export of maltose-binding protein in secB mutclrzts of Esc}ierichia coli. J Bacteri o l 1993. 175(13): p 4036 44 93. Hartl F.U., S. Leeker E. Schiebel J P. Hendrick, and W. Wickner The binding cascade of SecB to SecA to SecY/E mediat es p, ,.e protein targeting to the E. coli plasma membrane Cell, 1990 63(2): p 26979. 94. Driessen, A J P. Fekkes and J P van der Wolk, The Sec syste,,i. Curr Opin Microbiol, 1998 1 (2): p 216-22. 95. Linde, D., R. Volkmer-Engert S. Schreiber a11d J P Muller, I,zt eraction of th e Bacillus subtilis chaperone CsaA with the sec,,.etory protein YvaY. FEMS Microbiol Lett, 2003. 226(1) : p 93-100. 96. Muller, J.P J Ozegowski, S Vettermann, J. Swaving, K.H. Van Wely and A J. Driessen, Int e raction of B acillus subtilis CsaA wi th SecA and precursor proteirz s Biochem J, 2000. 348 Pt 2 : p. 367-73. 97 Muller, J P ., S. Bron G V e nema, and J.M van Dijl, Chaperone-like activities of the CsaA protein of Bacillus subtilis. Microbiology 2000. 146 (Pt 1): p. 77-88. 98 Gutierrez J.A., P.J Crow l ey, D.G. Cvitkovitch, L.J Brady I.R Hamilton J D Hillman, and A.S. Bleiweis Streptococcus mutans fjh, a gene encoding a homologue of the 54 kDa subunit of the signal recognition particle, is involved in resistan ce to acid stress. Microbiology, 1999. 145 (Pt 2) : p 357-66 99. Zimmermann R ., The role of molecitlar chapero n es in protein transport into the ,rzammalian endoplasmic reticulum. Biol Che1n, 1998. 379(3): p. 275-82. 100. Rudiger S ., L. Ge1rr1eroth J. Schneider-Mergener, and B Bukat1 Substrate specificity of the DnaK c haperone determined by screening cellulose-bound peptide libraries. Embo J, 1997 16(7): p. 1501-7. 101. Knarr, G., M.J Gething, S Modrow, and J B11chner BiP binding sequences in antibodies. J Biol Chem, 1995 270(46): p 27589-94 102 Valent Q.A., D.A. Kendall S High, R. Kusters, B Oudega, and J Luir ink, Earl y events i,z preprotein recognition in E. coli: interaction of SRP and tngger factor with nascent polypeptid es. En1bo J, 1995. 14(22): p. 5494-505.

PAGE 119

108 103. Deuerling, E., A. Schulze-Specking, T. Tomoyasu, A. Mogk, and B. Bukau, Trigger factor and DnaK cooperate inf olding of newly synthesized proteins. Nature, 1999. 400 (6745): p 693 6. 104. Deuerling, E., H Patzelt, S. Vorderwulbecke, T. Rauch, G. Kramer, E. Schaffitzel, A. Mogk, A. Schulze-Specking, H. Langen, and B Bukau, Trigger Factor and DnaK possess overlapping substrate pools and binding specificities. Mol Microbial, 2003 . 47(5): p. 1317-28. 105. Kramer, G., V. Ramacbandiran P.M. Horowitz, and B Hardesty, The ,nolecular chaperone DnaK is not recruited to translatirzg ribosomes that lack trigger factor. Arch Biochem Biophys, 2002. 403(1): p 6370. 106 Kramer G., H. Patzelt T. Rauch, T.A. Kt1rz S. Vorderwulbecke, B. Bukau, and E. Deuerling, Trigger factor peptidyl-prolyl cis/trans isomerase activity is not essential for the folding of cytosolic proteins in Escherichia coli. J Biol Chem, 2004. 279(14) : p. 14165-70. 107. Lyon, W.R. and M.G. Caparon, Trigger factor-mediated prolyl isomeri za tion influences maturat io n of the Streptococcus pyogenes cystei12e protease. J Bacteriol, 2003. 185 (12) : p. 3661-7. 108. Ausubel, F M., Brent R ., K. Struhl, K., ed. Expression and purification of maltose-binding pr otei n fusions. Current protocols in molecular Biology 1992, John Wiley and Sons, Inc.: New York. 16.6.1-16.6 12 109. Kumamoto, C.A. and J. Beckwith, Evidence for specificity at an early step in protein export in Eschericliia coli. J Bacteriol 1985. 163(1): p. 267-74. 110. Lee, S.F., A. Progulske-Fox, G.W. Erdos, D.A. Piace ntini, G.Y. Ayakawa, P.J. Crowley, and A.S. Bleiweis, Construction and characterization of isoge,zic mutants of Streptococcus mutans deficient in mqjor surface protein antigen P 1 (l/11). Infect Immun, 1989 57(11): p 3306-13 111 Ajdic, D., W M McShan, R.E. McLaughlin G. Savic J Chang, M B Carson, C. Primeaux, R. Tian, S. Kenton, H. Jia, S. Lin Y. Qian, S. Li, H. Zhu, F. Najar, H. Lai, J. White, B.A. Roe, and J.J. Ferretti, Genome sequence of Streptococcus mutans UAJ 59 a cariogenic dental pathogen. Proc Natl Acad Sci US A, 2002. 99(22): p 14434-9. 112 Wen, Z.T., P. Suntharaligham, D.G. Cvitkovitch, and R.A. Burne Trigger factor in Streptococcus mutan s is involved in stress tolerance, competence development, and biofilmformation Infect Immun, 2005. 73(1) : p 219-25

PAGE 120

109 113 Demuth D R. Y Duan H F. Jenkinson, R McNab S. Gil, and R.J Lamont, Interruption of the Streptococci,s gordonii M5 sspA / ssp B intergenic region by an insertion sequence related to ISJ 16 7 of Streptococcus pneumoniae. Microbiolog y, 1997. 143 (Pt 6): p 2047 -5 5. 114. Buckley, N.D., L.N. Lee and D.J LeBlanc, Use of a novel m ob ili z able vector to inactivate the scr A gene of Streptococcus sobrinus by allelic replacem e nt J Bacterial, 1995. 177(17): p 5028-34. 115 Seifert, T.B., A.S. Bl e iwei s, and L.J Brady, Contribution of the alanine-ric h region of Streptoco cc us ,nu ta ns P 1 to a,itigenicity, surface exp r essio n and interaction with the p1oline -ric h r epea t do,nain Infect Immun 2004. 72(8) : p. 4699-706 116. Demuth, D.R and D C. Irvine, Structural and functional variatiori within the alanine-rich repetitive domain of streptococcal antigen I / II Infect Im.mun 2002. 70(11) : p. 6389-98. 117. Laemmli U.K., Cleavage of structural proteins during th e assembly of th e head of bact e riophag e T4 Natur e, 1970. 227(259): p 680-5 118 Towbin, H. T Staeh e lin and J. Gordon Electrophoretic transfer of protei n s from polyacrylamide gels to nitrocellulose s heet s: procedi,re and some ap pli ca tions Proc Natl Acad Sci US A, 1979 76(9): p. 4350-4. 119 Ayakawa, G.Y., L.W Boushell P.J. Crowley, G.W. Erdos, W.P McArthur and A.S Bleiweis, I so lation and cha 1acteri za ti o n of monoclonal antibodies specific for antigen P 1 a major surface prot e in of muta,zs streptococci. Infect Imm un 1987 55 (11 ): p. 2759-67 120. Brady, L.J ., D A Piacentini P J Crow ley and A.S. Bleiweis Id e ntifi catio n of monoclonal a1tt ibody-bi nd i n g domains within antigen P 1 of Str ep toco ccus mutan s and cross-reactivity with relat e d surface a,ztig e ns of oral streptococ c i. Infect Im.mun, 1991 59 ( 1 2):p.4425 -35. 121. Seidman, C.E., Kevin Struhl Jen Sheen, and Timm Jessen, Transformation Using Ca lcium Chloride, in Current Protocols in Molecular Biology R B. Frederick M Ausubel, Robert E. Kingston David D. Moore J.G Seidman John A. Smith and Kevin Struhl Editor 1997 John Wiley and Sons: New York 122. Huang, C.A D ete rmin ation of Bindin g Stoichio,netry by the Co nt i ,iuou s Variati o n M et ho d: The Job Pl ot, in Enzyme Kinetics and Mechanisms, D.L Purich Editor 1982 Academic Press : New York p 509-525

PAGE 121

110 123. Rhodin, N.R., J M. Cutalo, K.B. Tomer, W P. McArthur, and L J. Brady, Characterization of the Streptococcus mutans P 1 epitope recognized by immunomodulatory monoclonal antibody 6-1 JA. Infect Immun, 2004. 72(8): p. 4680-8. 124. van Dolleweerd, C.J ., D Chargelegue, and J K. Ma Cliaracterization of the conformational epitope of Guy's 13, a monoclonal antibody that prevents Streptococcus muta,zs co loni z ation in human s. Infect Im.mun, 2003. 71(2 ): p. 75465 125. Ma B., C.J Tsai, ru1d R. Nussinov, Binding and folding : in sea rch of intramolecular chaperone-like building block fragm e nts. Protein Eng, 2000 13(9): p 617-27. 126. Mciver, K S., E. Kessler J.C. Olson, and D.E. Ohman, The elastase propeptide functions as an intramolecular chaperone required for elastase activity and secretion in Pseudomonas aeruginosa Mol Microbiol 1995. 18(5) : p. 877-89 t 127. Robinson C., The twin-arginine translocation system: a novel means of transporting folded proteins in ch loropla sts and ba c teria. Biol Chem 2000 381(2): p. 89-93 128. Oli, M.W., N. Rhodin W.P McArthur, and L.J Brady Redire c ting the humoral immune response against Streptococcus mutans antigen P 1 with monoclonal antibodies. Infect Immun 2004 72 ( 12): p. 6951-60 129. Otvos, L Jr. I. 0, M.E. Rogers, P.J. Consolvo, B.A. Condie S. Lovas, P. Bu1et and M. Blaszczyk-Thurin Interaction betw ee n heat s ho c k protein s and antimicrobial peptides. Biochemistry, 2000 39(46) : p 14150-9. 130. Oral health in Am e ri c a : a repo rt of the Surg eo n G e n e r a l. J Calif Dent Assoc, 2000. 28(9 ): p 685-95 131 Petersen P.E ., The World Oral Health Rep ort 2 003 : continuous improvement of oral health in the 21st century--the approacl,z of th e WHO Global Oral Health Programme Community Dent Oral Epidemiol, 2003. 31 Suppl 1: p. 3-23. 132. Pitts, N.B. Risk assessm en t and caries prediction J Dent Educ, 1998 62(10): p. 762-70 133 Vargas C.M ., J.J Crall and D A. Schneider, So cio d e mographic distribut io n of pediatric dental caries: NHANES III, 1988-1994. J Am Dent Assoc, 1998. 129( 9): p 1229-38. 134 Edelstein, B.L ., The medi ca l management of dental c aries. J Am Dent Assoc, 1994 125 Suppl: p 31S-39S

PAGE 122

111 135 Russell, M.W. N.K. Childers, S.M. Michalek, D.J Smith, and M.A. Taubman, A Ca,ies Vaccine ? The state of the science of immuni za tion against dental caries. Caries Res, 2004. 38(3) : p 230-5 136. Brady L.J., M.L. van Tilburg, C.E Alford, and W .P. McArthur, Monoclonal antibody-mediated modulation of the humoral im,nune respo,zse agairzst mucosally applied Strepto cocc us mutans. Infect Immun, 2000. 68(4) : p 1 796805 137. Egland, P.G ., L.D. Du and P.E. Kolenbrander, Id entification of independent Streptococcus gordonii SspA and SspB ful'ictio,zs irz coaggregation with Actinomyces naesli,ndii Infect Immun 2001 69(12): p. 7512-6. 138. Holmes, A.R., R McNab, and H.F. Jenl
PAGE 123

112 147 Silhavy T.J., S.A. Benson and S D. Emr, Mechanisms of protein localization. Microbial Rev, 1983. 47(3 ): p. 3 1 3 -44. 148 Martoglio B. and B. Dobberstein, Signal sequences: more than j ust greasy peptides. Trends Cel l Biol 1998 8 ( 1 0): p. 410-5 149. Tjalsma, H. A. Bolhuis J D Jongbloed S. Bron and J M van Dijl Signal peptide-dependent protein transport in Ba cil lu s subtilis: a genome-based survey of the sec retome Micro biol Mol Biol Rev 2000. 64(3) : p 515-4 7. 150 Lory S ., Leader P eptiliases of Type IV Prepilins and R elated Proteins, in Molecular biology intelligence unit (Unnumbered), G v. Heijne, Editor. 1994 R.G. Landes Co : Austin, Tex. p. 1 27 151. JM van Dijl, A.B., H Tjalsma, JDH Jongbloed A de Jong, Prot ein Transport Pathways in Bacillu s subtilis: a Ge,iome-Based R oad Map, in Bacillu s subtilis and its Closest Relative s, R L Abraham L. Sonenshein, James A. Hoch, Editor. 1991, ASM : Wahington, DC p. 337-355. 152 Tamura, H ., T. Kikuchi R. Shirato and H. Kato, Cloning and DNA seque11cing of the surface protein antigen Jill (P Aa) of Streptococcus cricetus. FEMS Microbial Lett, 2001. 196 (2): p. 251-6. 153 Sato Y., K. Okamoto and H. Kizaki, gbpC and pac gene mutations detected in Streptococcus mutans strain GS-5. Oral Microbial hnmunol 2002. 17( 4) : p 263 6. 154. Igarashi, T. E Asaga, and N. Goto, The sortase of Streptococcus mutans mediates ce ll wall cinchoring of a su rfa ce protein antigen. Oral Microbial lnlll1unol, 2003. 18 ( 4): p. 266-9. 155 Berks B.C ., F. Sargent and T P almer, The Tat prot ein export pathway. Mol Microbial 2000. 35 (2): p. 260-74. 156. Randall L L and S J Hardy Correlation of competence for export with lack of tertiary structure of the mature species: a study in vivo of ,naltose-bindirzg protein in E. coli. Ce ll 1 986. 46 (6): p 92 1 -8. 157 Leeker, S ., R Lill, T. Ziegelhoffer, C. Georgopoulos P J Bassford, Jr ., C.A. Kumamoto, and W. Wickner, Three pure chape rone proteins of Es che ri chia co l i SecB, trigger factor arid GroEL--form soluble complexes with precursor p roteins in vitro Embo J 1989 8 (9): p 2703-9.

PAGE 124

113 15 8. Kusukawa, N. T. Yura '.1 C. Ueguchi, Y. Akiyama, and K. Ito Effe cts of mutations in heat-shock genes groES and groEL on protein expo rt in Esch erichia coli Em bo J 198 9. 8 ( 11 ): p 35 1 7 21. 159 Wild J ., E. Altman, T. Yura, and C.A. Gross, DnaK and DnaJ heat shock proteins participate in protein export in Escherichia coli. Gene s D ev, 1 992. 6( 7): p. 116572. 1 60 Wild J ., P Ros s mei ss l W.A. Walt e r and C.A. Gross, Invol vement of the Dn aK DnaJ-GrpE c haper one team in protein secretion in Escheri ch ia col i. J B ac t e rial 199 6. 178(12) : p 3608 -1 3 161 Bukau B. and A.L. Horwich, The H sp 70 and H sp60 c haperone machines. Ce ll 1998. 92(3) : p 351-66. 162 Xu, Z., J.D Knafel s, and K. Yoshino, Crystal struc tur e of the bacterial protein export c hap e r o n e sec B. Nat Struct Biol 2000 7 ( 12) : p 11727 163. Knoblauch, N.T., S Rudi ger, H J Schonfeld, A.J. Dri esse n J Schn ei d e Mergener and B Bukau Substrate specificity of the SecB chaperone. J Biol C hem 1999. 274 ( 4 8): p 342 1 9 25. 164 Haury W .A., D. Fri shma n C. Ecke r sko m F. Lottspeich, and F U. Hartl Id e ntifi catio n of in vivo substrates of th e chape r o nin GroEL. Nature, 1999 402(6758) : p 14 7 -54. 165 Hesterkamp T. S Hauser, H Lutcke and B Buk a u Escherichia co li trigger factor is a prol yl isomerase that associates with nascent polypeptide chains. Pro c Natl Acad Sci U S A, 1 996. 93 (9): p 4437-41 16 6. Stoller G ., K.P Ru cknage l K.H. Nierhau s, F.X. Schmid, G. Fischer, and J .U. Rahfeld A ribosom e -a ssociated peptidyl-pro/yl cisltra rz s isomerase ide n tified as the trigg e r factor. Em bo J 1 99 5 14(20) : p 4939-48. 167 Teter S A ., W.A. Haur y, D. Ang T Tradl er, D Rockabrand G. Fischer, P. Blum C Geor go poulo s, and F .U. Hartl Polypeptide flux through bacterial Hsp 7 0: DnaK cooperates wit li trigger factor in c h ape r oni n g nascent chains. Cel l 1999 97(6) : p 755-65. 1 68 Nishihara, K ., M Kanemori H. Yanagi, and T Yura O ve r express ion of trigger factor prev e nts aggregation of recombinant proteins in Escherichia coli. Appl Environ Microbial 2000. 66 (3) : p 884-9 16 9. Kandror 0 ., M Sh e rman and A. Goldberg, R apid degradatiorz of a n abnormal protei n in Eschericliia co li proc eed s through repeated cyc l es of association with GroEL. J Biol Chem 1 999. 274 ( 53 ) : p 37743-9.

PAGE 125

114 170. Huang, G.C., Z.Y. Li, J.M. Zhou, and G. Fischer, Assisted folding of glyceraldehyde-3-phosphate dehydrogenase by trigger factor. Protein Sci, 2000. 9(6) : p. 1254-61. 1 71. Beck, K., L.F. Wu, J. Brunner, and M. Muller, Discrimination between SRPand SecA/SecB-dependent substrates involves selective recognition of nascent chains by SRP and trigger factor. Embo J, 2000. 19 (1): p. 1 34-43 172. Crooke, E., L. Brundage M. Rice, and W. Wickner ProOmpA sponta,zeousl y folds in a membran e as se mbl y competent state which trigger factor stabili z es. Embo J, 1988. 7(6): p. 1831-5. 173 Gothel, S.F., C. Scholz, F.X. Schmid, and M.A. Marahiel, Cyclophilin and trigger factor from Bacillz,s subtilis cata l yze in vitro protein folding and are necessary for viability under starvation conditions. Biochemistry, 1998 37(38 ): p. 13392-9 174. Lyon, W.R., C.M. Gibson, and M.G. Caparon, A role for trigger factor a1zd an rgg-like regulator irz the transcription, secretion and processing of the cysteine proteinase ofStreptococcuspyogenes. Embo J, 1998. 17(21) : p. 6263-75 175. Bukau, B., Regulation of the Escherichia coli heat-shock response. Mol Microbiol, 1993. 9(4) : p. 671-80. 176. Jayaraman, G.C., J.E. Penders, and R.A. Burne, Transcriptional analysis of the Streptococcus mutans hrcA grpE and dnaK genes and regulation of expression in response to heat shock and environmental acidification. Mol Microbiol, 1997 25(2): p. 329-41 177 Lemos, J.A. Y.Y. Ch en and R.A Burne, Genetic and physiologic anal y sis of th e groE operon and role of the HrcA repress or in stress gene regulation and acid tolerance in Streptococcus 1nutans. J Bacteriol, 2001. 183(20): p. 6074-84.

PAGE 126

BIOGRAPHICAL SKETCH Trevor B. Seifert was raised in Chino California where he pursued criminals as a police officer before pursuit1g a B.S. in Biology at Southern Oregon University in Ashland, Oregon. Following attainn1ent of a Ph D. in Medical Sciences, and post doctoral training, Trevor hopes to return to the field of law enforcement as a forensic scientist. 115

PAGE 127

I cert i fy that I h ave r ead th i s stu d y and tl1at i11 m y op i1 1 io11 it c onfonn s to acceptab l e s tandard s of sc l10J ar l y pr esentatio r1 and is full y adequa t e, in sco p e an d qu a lit y, as a dis se rtation for th e d egree o f Do c tor of Pl1il oso .. ~11 e Br a d y, C h a ir Ass i tan Profe sso r of Or I Biolo gy I certify that I h ave r ea d this s tud y and that in my opinion it confo11ns to acceptabl e standards of sc holarl y pr ese ntation and is full y adequate, in sco p e and quality a s a di ssertat i on for the degre e o f Doctor of Philo so ph y. A /4c:::::::;;::r--R o bert A. Bu111 e Pr ofessor of Or a l Biolo gy I certify that I have read thi s study and that i11 my op inion it confot rn s to acceptabl e standards of s cholarly pre se nt at io11 and i s full y ad e quat sco p e and quality, a s a di ssertation for the d egree of D oc tor of Philo so p~ P a ul A Gulig Prof esso r of Molecular G e n e ti cs a nd Mi c robiolo gy I certify that I have read tlus study and that in m y opinion it confo rm s to a cce ptabl e standards of s cl1olarly pres en tation and is fully adequate, in sco p e a lit y, a s a di sse rtation for the degr ee of D oc t o r of Philo sa 1 ,_, aniel L. Pun c h Profe ssor of Bio c h e mi s try and M Biol ogy I certify that I ha ve r ea d tlli s study and t11 at in my opinion it c onform s to acc e ptabl e standards of scho larl y pres e ntation and is full y ad e quat e, in s cope an quality a s a diss ertat ion for the d egree of Doctor of Philosopl1y .. Am S. B 1 eis En1eritt1 r ofessor o f Oral Bi o l ogy

PAGE 128

This diss e rtation was s ubmitt e d to the Graduate Fact1lty of the Col l ege of Medicine a nd to the Grad u a t e School and was accepte d as p a rti al ft.tlfil l ment of th e r eq uir ements for the degree of Doctor of Phjl oso ph y. May 2005 Dean olle ge of Meilicine Dean Graduate Schoo l

PAGE 129

UNIVERSITY OF FLORIDA II I II 11111 1 111 I l l 11 1 111 1 111 I I 1 11 1 111 1 1111 1 1 II 11 1 11 1 1111 I I 1 1111 I I 3 1262 08554 6108