| OGT Home | UPF Home | View Cart |
CITATION
PDF VIEWER
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Full Citation | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
STANDARD VIEW
MARC VIEW
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Downloads | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Full Text | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
PAGE 1 computing life U.S. DEPARTMENT OF HEALTH AND HUMAN SERVICESNational Institutes of Health National Institute of General Medical Sciences searching for genetic treasures the next top protein model movie mania sim sickness integrating biology made possible by2 7 10 12 16 18 PAGE 2 What Is NIGMS?The National Institute of General Medical Sciences (NIGMS) supports basic research on genes, proteins, and cells. It also funds studies on fundamental processes such as how cells communicate, how our bodies use energy, and how we respond to medicines. The results of this research increase our understanding of life and lay the foundation for advances in the diagnosis, treatment, and prevention of disease. The Institutes research training programs produce the next generation of scientists, and NIGMS has programs to encourage minorities under represented in biomedical and behavioral science to pursue research careers. NIGMS / supported the research of most of the scientists mentioned in this booklet. Produced by the Ofce of Communications and Public Liaison National Institute of General Medical Sciences National Institutes of Health U.S. Department of Health and Human Services PAGE 3 From text messaging friends to navigat ing city streets with GPS technology, were all living the computing life. But as weve upgraded from snail mail and compasses, so too have scientists. Computer advances now let researchers quickly search through DNA sequences to nd gene variations that could lead to disease, simulate how u might spread through your school, and design three-dimensional animations of molecules that rival any video game. By teaming computers and biology, scientists can answer new and old questions that could offer insights into the fundamental processes that keep us alive and make us sick. This booklet introduces you to just some of the ways that physicists, biologists, and even artists are computing life. Each section focuses on a different research problem, offers examples of current scientic projects, and acquaints you with the people conducting the work. You can follow the links for online extras and other opportunities to learn aboutand get involved inthis exciting new interdisciplinary eld. ing city streets with GPS technology, were all living the computing life. But as weve upgraded from snail mail and compasses, so too have scientists. Computer advances now let recomputing life PAGE 4 Imagine finding a treasure chest that contains all of the precious gems and metals ever mined, but you can only lift the lid far enough to see the glint of gold and the sparkle of diamonds. Thats how some biologists felt not too long ago. Advances in computer technology have opened the genetic treasure chest all the way, revealing the human genome and answering questions about diseases, drug treatments, and even crimes. searching for genetic treasures We share: 70% of our genes with fruit flies and98%with chimpanzees and99.9% with each other.NAT IONAL INSTITU TE OF GENERAL MEDICA L SCIENCES PAGE 5 EXPLORE GENETICS http://publications.nigms.nih.gov/thenewgenetics ?In 2005, the U.S. Food and Drug Administration approved a heartfailure drug specically targeted to African Americans. Why do you think some people raised ethical concerns? computing life | searching for genetic treasures < 02 | 03 > MEDI C INES that work wonders for you can be ineffectiveor even harmfulto others. Why? Age, weight, lifestyle, and other medicines each play a role, but so do GENES. Scientists use computers to nd the specic genetic variations that affect the way we respond to drugs. This eld of research is called pharmacogenetics, and its goal is to determine the type and dose of medicine best suited for each individual. Geneticist Gary Peltz at Roche Palo Alto in California leads one research team working in this eld. His group has looked for tiny differences that change how mice process, or metabolize, the drug warfarin. Nearly 2 million Americans, especially those who have heart disease or are recovering from major surgery, take warfarin to prevent deadly blood clots. But warfarin is tricky to prescribe. Too much causes excessive bleeding and too little could allow clots to form. Doctors use a careful, trial-and-error approach to nd the right amount for each person. The California researchers pinpointed the gene that makes an enzyme the mice need to metabolize warfarin. Searching with computers, they then found slight variations in the genes DNA that could inuence how quickly the animals eliminated the drug from their bodies. The scientists were able to use the mices genetic proles to predict how the mice would process the drug. Similar studies in humans could ultimately help doctors more quickly and precisely prescribe the right dose of warfarin.>side effects: genes and medicinesBy Susan Gaidos PAGE 6 answers from africaBy Alisa Zapp Machalek > Visit the online version of this story on the Computing Life Web site to learn more about Tishkoffs research, see photos, hear Tanzanian singing, and send her email. Tishkoff enlists African tribespeople in her project to understand how human genomes have responded to malaria. > Sarah TishkoffGeneticist Sarah Tishkoff splits her time between her L AB OR AT OR Y at the University of Maryland, C ollege P ark, and remote parts of AF RIC A. She works with and collects DNA from people as diverse as hunter-gatherers in the jungles of central Africa; graingrowing farmers in southern Africa; and nomadic, cattle-raising warriors in eastern Africa. By designing computer models to compare the DNA of these different populations, she hopes to track down gene variations that make some people less susceptible to malariaone of the worlds leading causes of death. People in certain African tribes that have been exposed to malaria for thousands of years can contract the disease and survive it. These tribespeople developed genetic adaptations that gave them natural resistance to malaria, which they passed on to their descendants. Through the generations, the resistance genes have become more common in the population. Tishkoff calls this process the footprints of natural selection. Following the trail can lead scientists to the genetic basis of innate resistanceand possibly to future therapiesfor malaria and other diseases. So far, the trail has taken Tishkoff to data indicating that innate resistance to malaria is caused by a variant in the gene for a specic enzyme nicknamed G6PD. People with this genetic variant make less of the enzyme, which is needed for several important chemical reactions inside cells. Up to one-quarter of the people living in malaria-infested regions of Africa have this variant. Everywhere else, fewer than 5 percent have it. Understanding how the G6PD genetic variant protects people from malaria could eventually help treat and prevent the spread of the disease. The work, Tishkoff adds, is also helping to unravel the history of modern humans in Africa and beyond. http://publications.nigms.nih.gov/computinglife NAT IONAL INSTITU TE OF GENERAL MEDICA L SCIENCES PAGE 7 What can dirty DIAPER S teach us about MEDI C INE? That infectious bugs are cagey. When scientists designed the rst antibiotics more than 50 years ago, they called them medical marvels. The drugs cured common infections caused by bacteria in just days, slashing death rates and transforming medical care. But through tiny genetic changes, prompted in part by our own overuse and misuse of antibiotics, super bugs now outsmart our once super drugs. Certain bacterial strains have developed resistance to antibiotics that once killed them and passed this ability to their descendants. Today, a few of these strains can even overcome every existing antibiotic. Scientists thought that after many generations without exposure to antibiotics, the bacteria would eventually succumb to the drugs once again. Unfortunately, that doesnt seem to be the case, says Bruce Levin, a population geneticist at Emory University in Atlanta, Georgia. Levin analyzed E. coli bacteriathe harmless kind in our colonsfound in 70 dirty diapers from a day care center. One-quarter of the bacteria in the used diapers were resistant to streptomycin, an antibiotic rarely prescribed in the previous 30 years. Levins diaper discovery was buoyed by research led by Richard Lenski, a microbiologist at Michigan State University in East Lansing who trained in Levins lab. Since 1988, Lenski has monitored asks of streptomycin-resistant E. coli After 10 years and 20,000 bacterial generations, he ooded the bugs with streptomycin for the rst time. They remained unfazed by the drug. Levin and others have run thousands of computer simulations to come up with strategies that slow the development and spread of resistance. Because drug-resistant bacteria will continue to plague us, Levin jokes that research on antibiotic resistance offers the perfect career opportunity. He says, We must continually discover new ways to deal with bacterial infections. I tell students that when you graduate from school, there are plenty of things for you to do! AZMThe answer is: BIT, BAT, BAN, FAN, FUN.word games > FAN BIT BAT BAN FUN > mutiny against antibioticsIf youre hooked on SUD OK U you should try the letter game called GENETI C CO DE Heres an easy example: P ut the following words in a sequence so that each one differs from the previous word by just one letter. Now imagine working with words that contain thousands of letters. And, instead of shufing around recognizable words, you have long, seemingly random strings of As, Ts, Gs, and Csthe letters of the DNA code. Thats what scientists face when they try to track and analyze changes within an organisms genetic material, or genome. The task may sound tough, but its easy with the help of computers. Scientists typically start with a collection of gene sequences from different people or organisms. These sequences could come from blood, bodily tissues, or even ancient bones. To gure out when the variations occurred, researchers use computa tional tools to put the gene sequences in chronological order. In this way, computers are revealing the genetic changes, combinations, and quirks that create the Earths remarkable biological diversity. AZM make up your own 3-letter series, and ask your friends to arrange them. !blowyour nose.Theres a good chance that your tissue contains Staphylococcus aureus, or staph bacteria. Normally, this common bug doesnt cause sickness, but it occasionally can be lifethreatening. Computer models can help identify strategies for keeping the spread of these infections at bay, especially in hospitals, where they can be the most dangerous. computing life | searching for genetic treasures < 04 | 05 > PAGE 8 In 1995, a L ouisiana nurse accused her ex-boyfriend, a doctor, of attempt ed MU R DE R She claimed he gave her the AIDS virus by injecting her with blood from an HIV-positive patient. L awyers from both sides recruited scientists to analyze viral DNA from the nurse.To prove its case, the prosecution had to convince the jury that the virus from the nurse and the virus from the patient were close relatives. So, scientists dusted for DNA ngerprints! The investigative team, led by computational biologist David Hillis at the University of Texas at Austin and virologist Michael Metzker at Baylor College of Medicine in Houston, Texas, used a technique called DNA ngerprinting to compare the DNA sequences from the two viral samples. The team also used a number of different computer programs to piece together how the viral sequences most likely changed between the alleged injection in 1994 and the trial in 1998. The results showed that certain genetic sequences from the nurses virus were identical to those of the patients >csd: crime scene dnavirus. The doctor was convicted of attempted second-degree murder and sentenced to 50 years in prison. Lawyers appealed his case all the way up to the U.S. Supreme Court, which let the conviction stand in 2002. The case marks the rst time that such genetic analysis, called phylogenetics, was used as evidence in a U.S. criminal court. AZM As of 2007, the Innocence Project, which offers legal assistance to people who claim theyve been wrongfully accused, says that DNA ngerprinting has led to the freeing of more than 194 people. ? Computational biologists helped prove that a doctor tried to murder his exgirlfriend using a syringe lled with the AIDS virus.who do you think is guilty?Evidence from a crime scene leads police to ve suspects. Compare DNA from the perpetrators blood left at the crime scene with the suspects DNA below. DNA sequence from perpetrators blood found at the crime scene: AGGCTGCCTACGCGGTTAGG DNA sequences from suspects:#1 AGGATGGCTACCCGGTTAGG #2 AGGCTGCCTCAGCGGATAGG #3 AGGCTGCCTACGCGGTTAGG #4 CGGCAGCCTACTCGGTTAGG #5 AGGCTGGATACGCGGCTAGGIn the Louisiana murder trial, scientists compared more than 2,000 letters of HIV from about 30 people. Computers did most of the work!NAT IONAL INSTITU TE OF GENERAL MEDICA L SCIENCES The answer is: #3. PAGE 9 the three-dimensional shape of his made-up molecule. Baker used that sequence to build an actual protein that was stable and quite similar in struc ture to the one he had drawn, validating his approach. With the ability to whip up new proteins, Bakers research may make it possible to customize proteins that could be used as drugs or tiny biological machines to treat certain diseases. Baker used his computer program to design a small protein not found in nature. > Brian Kuhlman, Gautam Dantas, David Baker the next top protein modelFrom building muscles to healing wounds, our bodies rely on proteinschains of small molecules called amino acids that fold into unique shapes. Incorrectly folded proteins can cause disorders like sickle cell disease or cystic fibrosis. Ever-improving computer power is making it easier for researchers to predict how proteins fold and interact with other molecules, possibly leading to new treatments for protein-related disorders. > tailor-made proteinsBy Emily Carlson To learn more about Bakers work, visit this story on the Computing Life Web site. http://publications.nigms.nih.gov/computinglife computing life | the next top protein model < 06 | 07 > Scientists can easily determine a proteins amino acid sequence, but they cant reliably PR EDI CT how this sequence will fold into a three-dimensional STRUC TU R E.So computational biologist David Baker at the University of Washington in Seattle took a different approach. He started by sketching a protein structure that nobody had ever seen. Next, he relied on a computer modeling program he developed called Rosetta to tell him what amino acid sequence would form PAGE 10 NATNATIONANAL INNSTTITTUTETE OF GENERAENERAL MEMEDICAAL SCIENENCEES in the lab check the result, also making sure that no one has tampered with the / information. You can volunteer your computer, whatever the make or model. The com puter must be connected to the Internet the type of connection doesnt matter. Older computers can do the job, although they generally get simpler calculations. You / can also choose how much computer memory you want to donate. You dont need to worry about hackers breaking into your computer system. Security checks protecting the main servers and the limited capabilities of the required software make participating in the projects considerably safer than surng the Internet.>modeling@home WARNING!Before you download distributed computing software onto a public computer, like the ones at school or work, ask if its OK. If you dont, you could get into serious trouble! DC Distributed computing @home Most likely a distributed computing project Credit Points received for solving a calculation Work Unit Problem sent to a donated computer BOINC The Berkeley Open Infrastructure for Network Computing, or the free software program used by many DC projects PC Personal computer Server Computer that sends information to other computers in a networkWanna Volunteer? Folding@Home: http://folding.stanford.edu Rosetta@home: http://boinc.bakerlab.org/rosetta FightAIDS@Home: http://ghtaidsathome.scripps.eduIf you visit the Web sites of distributed computing projects, youll likely nd computerese. Heres a brief glossary. While youre sleeping, your computer could be doing scientic research.In high school, Johnathon Tinsley had MIX X ED feelings about MATH and SC C IENC C E. Math was very challeng ing, he recalls. I enjoyed some parts of biology, but not physics. Today, this / British teenager is helping to nd cures for diseases like AIDS and Alzheimers just by letting researchers use his computer when he isnt. You can get involved, too! Tinsley is part of a tech trend called distributed computing that relies on the public to help advance health and medicine. Through this approach, researchers harness the power of personal computers to answer / important questions about biology. The typical computers in a scientists lab cant perform all of the required number crunching, but a network of hundreds and even thousands of personal computers can. How It WorksYou join a distributed computing network by downloading free software. When your computer isnt busy, it sends a message to a server in the researchers lab basically saying, Hey, Im available. Can I help? The server assigns a chunk of a large calculation that it knows the home computer can solve. The / donated computer may spend several days working out the problem. When its done, it hands in the answer. Just like teachers, people NATNATIONANAL INNSTTITTUTETE OF GENERAENERAL MEMEDICAAL SCIENENCEES PAGE 11 The computer model generated by David Bakers team for the 2004 community-wide experiment (left) was strikingly similar to the proteins actual structure (right). > Philip Bradley, David Baker Distributed Computing in ActionThe science we can do is unmatched by what we could do with any other available tools, says Vijay Pande, a scientist at Stanford University in California who started a distributed computing project called Folding@Home. Pande studies the dynamics of how proteins fold into their unique shapes. By studying how they fold, Pande can see what goes wrong and how drugs might patch misfolded proteins. Proteins fold much faster than you can fold a shirt. The quickest one is done in just 5 millionths of a second. Pande says that it would take a very fast desktop computer more than a thousand years to completely simulate the process! But with the help of nearly 200,000 personal computers participating Most people enjoy a little friendly CO MP ETITI ON and protein struc ture prediction researchers are no exception. Every other year, these experts go head-to-head to see whose computer MO DE LS make the best predictions. The goal is to most accurately model the shapes of pre-selected proteins. The contestants dont know the actual struc tures of these molecules, but the judges do. After reviewing the entries, the judges invite the most successful modelers to an international meeting where they talk about the approaches they used. The entire group discusses how all can do an even better job in the future. project structure> in his project, Pande can do the job in about a week. Tinsley donates about 40 hours of processing time every day between his two computers. Tinsley likes knowing that his computers are doing something useful. He says, Theyre not just sitting there like stuffed lemonsBritish slang for being idle. For his distributed computing projects, Tinsley tracks how much work his computer has contributed compared to others. If his computer helps predict a protein structure, hell see his name on the projects Web site and maybe even published in a scientic journal. Some projects also award special certicates. Seeing the impact makes a big difference, says Pande. When you donate to many charities, you dont see a direct link between what you give and The scientists dont actually call the event a contest or even a competition. Its a community-wide experiment to improve the accuracy of protein prediction modeling so researchers can discover new drugs more quickly and cheaply. EC how its used. For us, you can actually see what your computer has donated and the results. Serving science, though, is not the only benet. Distributing computing also offers its participants an active social network. Many projects have message boards where donors can post questions about the science or random thoughts about life. Donors who really want to be ranked at the top often will form competitive teams. I like competing to get my stats above my team members, says Tinsley. But he also really likes the social aspect. For one team, he explains, The main aim is to meet and talk with friends and do something good and worthwhile while were at it. EC computing life | the next top protein model < 08 | 09 > Scientists often are rewarded for making big breakthroughs, with the Nobel Prize being the ultimate honor. Read about the winner of a high school science competition on page 18. PAGE 12 NAT IONAL INSTITU TE OF GENERAL MEDICA L SCIENCES A scientist manipulates plastic models of two proteins while the computer tracks and displays their electrostatic properties, shown here as red and blue clouds. > Arthur Olson Just as sound and color revolutionized the film industry, computer technology has changed the way scientists view biology. Researchers today not only can take snapshots of biology, they can animate entire biological processes, thrusting viewers deep into never-before-seen worlds.movie mania scientists develop sixth sense> Thanks to a HIGH-TE C H tool, scientists just regained their SI X TH SENSE.Before you think of a certain ick starring Bruce Willis, think about feeling your muscles ex as you push a box across carpet or plunging forward as your car suddenly stops. These physical responses to external cues are what many experts consider the sixth type of sensory experience. Some scientists lost this sense in the computer age. They no longer used physical models of biologi cal molecules, like proteins or DNA, to see how they t together. Instead, they used computer-generated models. Many scientists stopped working with physical models altogether, says Arthur Olson, a structural molecular biologist. The nature of spatial perception changes and the kind of understanding you get from interacting with your surroundings were lost when computer graphics took over. Now, Olson and his team at the Scripps Research Institute in La Jolla, California, have developed a tool that allows them to do both: physically manipulate a model of a biological molecule while watch ing its chemical and biophysical properties change on a computer screen. Olson says combining the two experiences will let researchers approach and understand biological problems in new ways. The scientists use special printers that generate plastic or plaster 3-D shapes as easily as other printers produce 2-D pictures. As Olson and others hold and interact with the models, a camera records a close-up shot of the models in motion. A computer program then superimposes graphics, like the arrange ment of atoms or the energy between modeled molecules. Olson combines the model and computer graphics into one image that allows him to study all the different facets of the biological molecule. Olson hopes that one day his interface could double as a video game that lets students explore and play at the molecular level. EC pick upa nearby object. Rotate it so you see all its sides. Does it feel heavy? What about cold? Smooth? How would you determine these qualities if you only saw the object on a computer screen? PAGE 13 An artists rendering of how chemicals change and move among cells in the brain. Watch the animation on the Computing Life Web site. > Kim HagerThe ribosome plays itself in this molecular movie, now appearing on the Computing Life Web site. > Kevin Sanbonmatsu now playing on a computer near youBy David BochnerSuperman is super strong, super fast, and generally super fly. But in a CO CO MIC C book, hes also super FL L AT, leaving many of his superhero feats up to your imagination. But when the / comic book turns cinematic, Superman truly comes AL L IVE.Sometimes scientists only get to see / the comic book view of biology: Experimental data gives researchers just snapshots of what a biological process looks like at a specic time. Now, computa tional biologist Kevin Sanbonmatsu at the Los Alamos National Laboratory in New Mexico brings those processes to life. Sanbonmatsu uses high-performance computers to create movies of a tiny molecular machine present in every living organism. This machinecalled the ribosomebuilds proteins from the genetic instructions encoded in DNA. Amid a network of BLOO LOO D vessels and star-shaped support cells, neurons in the BR R AIN signal each other. The mists of COLOR COLOR show the flow of important molecules, such as glucose, oxygen, and nitric oxide. This image is a snapshot from a 52-second simulation created by Kim Hager, an animation artist in the Laboratory of Neuro Imaging at the University of California, Los Angeles. The animation, which portrays how chemicals change and move among cells in the brain, took about 300 hours to create. To put it all together, Hager worked closely with Neal Prakash, a neurobiologist in the same lab. Prakash initially asked for a drawing to illustrate a the art of animationBy Karin Jegalian > > research paper, but the director of the lab suggested producing an animation instead. Hager, who studied photography, video, and graphic design in college and later earned a graduate degree in media arts, does not draw movies frame-by-frame. Instead, she builds virtual sculptures lled / with color, light, texture, and motion and then guides the viewers eye through the scenes. The lab features this animation, along with dozens of others, on its Web site and also plays it in a state-of-the-art theater during presentations for scientists, students, and other visitors. Hager says her role is to make the research more accessible to different audiences. Seeing an animation, she explains, makes it easier to comprehend what a researcher is saying. Interested in understanding the origin of life, Sanbonmatsu says he studies the ribosome because it may be the oldest artifact in the cell. But theres more to it than curiosity. Sanbonmatsu also says that about half http://publications.nigms.nih.gov/computinglife/moviesof all antibiotics used to treat bacterial infections target the ribosome, meaning that a better understanding of this biological machine could lead to super-strong drugs. To make his movies, Sanbonmatsu starts with experimental data, like the structure of a ribosome in a particular instance, and generates a storyboard of sorts. Hundreds of connected computer processorsor a supercomputerthen turn the snapshots into an entire movie lled with information scientists couldnt otherwise see or even imagine. You can look at static structures of the ribosome, says Sanbonmatsu, but the only way to watch it in motion is the supercomputer simulation. His team has created the largest biological simulation ever, bringing new life to characters in the old story of protein synthesis. computing life | movie mania < 10 | 11 > nNOwW PLayingAYING PAGE 14 NAT IONAL INSTITU TE OF GENERAL MEDICA L SCIENCES sim sickness Scientists are creating their own virtual worlds where people live and work and get sick. Here, researchers can mimic viruses and predict the spread of contagious diseases through a community. Successful simulations can help us better prepare for real-life outbreaks. preparing for a pandemic > MIDAS,not to be confused with the king who turned everything to gold, stands for Models of Infectious Disease Agent Study. ?How would your simulated life be different from your best friends?In 2001, malicious mail containing anthrax endangered hundreds of people. In 2003, the SARS virus traveled the globe, infecting about 8,000 people. More than 700 of them died. Health officials say that a fatal flu is among our future threats. Right now, researchers participating in an international project called MIDAS are simulating the potential spread of such a pandemic inuenza. While a u virus capable of infecting millions of people worldwide hasnt emerged recently, many health ofcials fear that it soon could if the avian u spreading among birds in parts of Asia, Europe, and Africa becomes easily transmissible between people.Flu and YouTo create the pandemic u simulations, the MIDAS researchers use computer models to build virtual cities, countries, and even continents. Here, thousands of pretend people go to school, work, stores, and other places. The researchers base the residents activities on information about actual people like you. Stephen Eubank, a physi cist at Virginia Tech University in Blacksburg and part of the MIDAS team, has modeled virtual versions of major U.S. metropolitan areas using local transportation and census data. In Eubanks cities, there really are six (or fewer) degrees of separation between any two peoplemaking it easy for germs to spread. Viruses dont care much about geography, says Eubank. They care about social networks and how people come into contact with each other.NAT IONAL INSTITU TE OF GENERAL MEDICA L SCIENCES PAGE 15 Virtual VirusesAnother key part of studying the spread of infection with computers involves developing a virtual version of the germ. To model its spread as realistically as possible, the researchers track down everything known about the infectious agent. Eubank, who has studied plague, smallpox, and anthrax, has gathered information on how each agent spreads between people, how contagious it is, and how long it takes for an infected person to show symptoms. Not knowing the actual characteristics of such a virus, the MIDAS researchers use health reports and scientic data collected during earlier u pandemics to estimate what a future one might be like. Christina Mills, now a medical student at Harvard Medical School in Cambridge, Massachusetts, did a lot of her research in the library. She scoured the shelves for scientic articles that discussed the 1918 Spanish u, a pandemic that killed between 20 and 40 million people. Most of the people who died were young. It was very old-fashioned, says Mills, whos studying international health. I couldnt just type a search word into Google and get the necessary information. The hunt eventually led her to the 1918 transmission rates. Asking QuestionsWith these pieces in place, the MIDAS researchers invite policymakers to ask questions that can be answered using the models. Questions range from What happens if we dont do anything? to How many people could be protected if we intervene? The researchers create different simulations that change the variables, like the contagiousness of the virus or the number of people taking snow days Eubanks term for people who voluntarily hang out at home to avoid infection. Whats so great about the computer simulations is that you can try out different situations that you cant create in real societies, says Eubank. With more than 250 possible combinations to simulate, Eubank says he relies on statisticians to help him determine which arrangements will produce the most informative results. Its easy to come up with questions, says Mills. The hard part is guring out which ones we shouldand couldanswer. >>>Meet the SimulatorsStephen Eubank started out studying high-energy physics but then got into modeling the dynamics of nonlinear systems, which are systems that cant be solved by adding up all of the parts. He has developed computational models to study natural languages, trafc patterns, and nancial markets. He plans to use the infectious disease models to study how behaviors, like smoking, spread through society. Christina Mills has a Sc.D. (like a Ph.D.) and is now working toward an M.D. For her, modeling infectious diseases is a dream job because it combines her interests in math, biology, and human health. While most of her classmates getting double degrees will go on to practice bench to bedside research in which they translate lab ndings into patient care, Mills says shell stick with the computers to clinics approach. ?What questions would you want to ask the models? computing life | sim sickness < 12 | 13 > Because of the amount of data and calculations involved, the simulations run on high-performance computers that can simulate a 180-day outbreak in a matter of hours. Eubank uses software programs to take snapshots of the pretend pandemic as it occurs. I know exactly when a virtual person gets infected, shows symptoms, and recovers, says Eubank, explaining that the computer records every change in disease state. PAGE 16 NAT IONAL INSTITU TE OF GENERAL MEDICA L SCIENCES create a timelineof what you did yesterday. List all the people (even if you dont know their names) you came into contact with. If you were contagious with the seasonal u, how many of these people do you think you would have infected? The answer is surprisingly low. Estimates suggest that youd pass the virus to no more than three people. But if more than one other person catches it from you, the bug will continue to spread. These maps of the United States display the potential spread of pandemic u. Each dot changes from green to red as more people in that area get sick. The top map shows what could happen if we dont do anything. The bottom map shows the effect of giving people a less effective vaccine while a better one is being developed. > Proceedings of the National Academy of SciencesWatch the u spread on the Computing Life Movies Web site. Flu ForecastEubank and other researchers modeling pandemic u have simulated outbreak scenarios in virtual versions of Southeast Asia, the United States, and the United Kingdom. Even though these countries have different populations and transportation patterns, the researchers found similar results: The early implementation of a combination of intervention measures, such as vaccinating certain people and giving medicine to those who do get sick, was the most effective at either stopping or slowing the spread of infection. While the results generated by the simulations are useful, Eubank stresses that theyre not a guarantee of what actually will happen. He and others often will ask different models the same questions and, when the models agree, theyll have more condence in the predictions. EC NAT IONAL INSTITU TE OF GENERAL MEDICA L SCIENCES http://publications.nigms.nih.gov/computinglife PAGE 17 the rise & fall of deadly dengueBy Alison DavisIf you live in the United States and dont travel AB RO AD, chances are youll never come down with DENGUE fever. Thats not the case for people living in tropical and subtropical climates, like South America, Africa, and the C aribbean. Between 50 and 100 million of these people catch the mosquito-transmitted dengue virus every year. Most of them will bounce back after 2 weeks of rest and extra uids. A small percentage, however, wont be so lucky. After contracting dengue a second time, some people may develop a potentially fatal dengue hemorrhagic fever. Scientists suspected that the human immune system might be to blame for making the second infection more dangerous, but until recently they werent sure how. Using computer simulations, epide miologists Derek Cummings and Donald Burke at the Johns Hopkins Bloomberg School of Public Health in Baltimore, Maryland, learned that the infected persons antibodiesproteins that should ght off dengueactually help the virus copy itself. More copies make the virus a better predator, allowing it to spread faster and infect more people. But the researchers also learned that the virus actually causes its own demise. Like a hungry wolf pack that clears out > the local deer population, the virus eventually starves itself. Infecting too many people reduces its food supply. This work is just one example of how researchers can develop models to answer questions about outbreaks of dengue or other diseases. With a mathematically based model, ecologist Pejman Rohani at the University of Georgia in Atlanta examined 30 years of epidemiological data from Thailand, a hot spot for dengue. He learned that envi ronmental factors, like warmer temperatures, can re-route mosquito yways and in turn change dengue infection rates. This map from 2007 shows areas infested with the mosquito that carries the dengue virus (orange) and areas with both the mosquito and dengue epidemic activity (red). > Centers for Disease Control and Prevention International health organizations suspected that dengue cases would be on the rise in countries hard hit by the 2004 tsunami due to standing water and contaminated sanitation systems. Thanks to preventive measures, this increase did not occur. < 14 | 15 > computing life | sim sickness PAGE 18 NAT IONAL INSTITU TE OF GENERAL MEDICA L SCIENCES In this computer model, a Listeria bacterium propels itself through an infected cell by stimulating the growth of cellular laments (yellow and red) at the cells surface. > Jonathan Alberts, Susanne Rafelski, and Garrett Odell Ten, nine, eight, seven, six, five, four, three, two, one . B L AST O FF! While this object might look like a rocket blasting through space, its really a fake bacterium jetting around a virtual cell. It represents Listeria a type of bacteria best known for causing food poisoning. Computational biologist Jonathan Alberts and mathematical biologist Garrett Odell at the University of Washingtons Center for Cell Dynamics in Friday Harbor created it to study how the bacterium moves around the cells it infects, ultimately making you sick to your stomach. By combining experimental data with computer-based approaches, Alberts and Odell have created virtual models of Listeria that show it moving through time. This more complete picture may enable the researchers to identify new ways to prevent foodborne illnesses. ADintegrating biology bacteria blast off> Identifying all the parts of a cell or organism wont necessarily tell you how those parts work together to make the system run. To do this, scientists have turned to a relatively new field called systems biology that combines experimental data and computational models to diagram everything from how cells move to how hearts beat. With the diagrams, the researchers can tinker with different parts and begin to explore questions nearly impossible to answer through traditional lab experiments. Whats 1,010 x 15,580? Would you believe one answer is 6? Find out why at Computing Life online. http://publications.nigms.nih.gov/computinglife NAT IONAL INSTITU TE OF GENERAL MEDICA L SCIENCES PAGE 19 Each spot on this globe represents a city, and each color corresponds to a community of easily connected cities. > Luis A.N. Amaral and Roger Guimer This sphere represents all the known chemical reactions in the E. coli bacterium. > Luis A.N. Amaral connected worlds> L ike us, CE LL S rely on transporta tion to do their daily activities. But while we can choose to take cars, busses, bikes, and even Segways, cells take the pedestrian approach: They M O VE themselves. A cell moves by grabbing onto something, like the wall of a blood vessel, and then pulling itself forward. This mobility is an essential part of wound healing. When you cut yourself, your white blood cells speed to the wound like paramedics. But cellular movement can also cause health problems, like when cancer cells spread to other parts of the body. Scientists want to understand how cells move so they can develop new on the move >drugs that can rev up or stop cell migration altogether. But like most biological processes, cell movement hasnt been easy to gure out because it involves hundreds of proteins. Cell biologist Clare Waterman-Storer and bioengineer Gaudenz Danuser, both at the Scripps Research Institute, take a systems biology approach to studying cell movement. They use mathematical equations and computer software to piece together the various components that make cells motor along. AD http://publications.nigms.nih.gov/insidethecellJOUR NEY INSIDE THE CE LL For scientists, the INTE R NET is more than an information super highway and AI RPOR TS arent just places where planes take off and land. They are examples of complex NETW ORK S that can help research ers study even more complicated ones in the body.Networks, whether social or cellular, share a number of features. Each one is a system made up of different elements that connect through important centers of activity called hubs. Hubs could be Web pages linked to many other sites or major airports that route passengers to additional cities. Communication occurs within the network, letting it organize itself and even change over time. Any network can serve as a model for understanding another because all these systems operate by a similar set of rules, says physicist Luis Amaral at Northwestern University in Evanston, Illinois. Amaral models the networks of the Internet and air travel, but he also maps metabolic networksthe intricate pathways by which cells generate the energy needed to carry out biological processes spanning the production of proteins to the breakdown of drugs. He creates simple computational models that show how the paths of these complicated networks connect and communicate. Knowing all the details about the bodys networks may help scientists learn to rewire them to prevent certain diseases, just like air trafc controllers re-route planes to avoid thunderstorms. AD ?Did you know that some cells form ladders so other cells can climb up them? computing life | integrating biology < 16 | 17 > yellowThis image, taken with a microscopecamera, shows the intricate network of bers that builds a cells structure. These bers are called microtubules (yellow) and actin laments (blue). > Clare Waterman-Storer PAGE 20 Going from Moms or Dads savory home cooking to the C AM P US cafeterias mystery meat can be a big adjustment for any COLL EGE freshman. But for R yan Harrison, a S OP HOM ORE biomedical engineer ing and economics major at Johns Hopkins University in Baltimore, Maryland, it wasnt a big deal. While most of his high school friends took it easy their last year to fully enjoy senioritis, Harrison spent his downtime at Hopkins, where he worked in the chemical and biomolecular engineering lab of professor Jeff Gray. Harrison got the chance through his high school, which offers a program that pairs students with researchers. Harrison had been writing his own computer programs since the 4th grade. So when his high school biology teacher introduced him to Gray, everything fell into place. He was into computational biology and we immediately hit it off! says Harrison. While in the Gray lab, Harrison improved the Rosetta computer program time for computationBy Jilliene MitchellYouve learned a lot about how computing power gives us new perspectives on biology. At the center of it all is a component more advanced than any silicon chip inside a computer processor. Its the human brain. Biologists, engineers, physicists, computer scientists, epidemiologists, geneticists, and even writers and artists have brought their brainpower to the table to solve these old and new problems.made possible by > that predicts how proteins fold and attach to other biological molecules. Before he had even graduated from high school, Harrison had presented his research to scientists older than his parents and received numerous awards, including a top prize in the 2005 Intel Science Talent Searchthe nations oldest and most prestigious high school science competition. As a Hopkins student carrying a full load of courses, Harrison still nds time to work on the program. These days, hes mostly xing its bugs. Dont be fooled, though. Just because he was an awardwinning researcher at age 17 doesnt mean hes a whiz at everything! When he started losing the battle in a high-level algebra course, he says he knew it was time to visit the math help room, where students could work with tutors. The effort paid off. Harrison nished the class with a B-, which, considering how tough the class was, he says felt more like an A+. I study a lot, admits Harrison. But I still make time to do things that I enjoy. Among his hobbies: directing a oneact play, experimenting with light and sound for student theater productions, and playing his favorite computer game, Civilization III. And he teaches disadvantaged kids in Baltimore how to play chess, explaining, Its also really good practice for me! With so many interests, one of Harrisons biggest challenges in college is nding time for all of his activitiesand deciding what he ultimately wants to do professionally. As he wrote in his online diary (see excerpts on the next page), I have more questions now about my future than ever before. But, I guess thatsa normal part of growing up.Ryan Harrison Many scientists have mistaken Harrison for a college or graduate student!> Stephen SpartanaNAT IONAL INSTITU TE OF GENERAL MEDICA L SCIENCES PAGE 21 > Drew Endy likes taking things apart and putting them back together bikes, cars, lawn mowers. He essentially does the same thing when he tries to understand biology. A professor at the Massachusetts Institute of Technology in C ambridge, Endy assembles and programs living machines. I asked him a few questions about his work and why he likes it.DBprogramming biology > What got you interested in science? Im curious. It bothers me when I dont understand how things work. Youre trained as an engineer. How does that inuence your approach to biology? If you ask engineers what they want to do in their heart, they want to make something. My interest is to be able to routinely, reliably, quickly, easily, and cheaply put together the bits and pieces of biology to make new and useful things. Youre in a new eld called synthetic biology. Whats the goal of this eld? Its to make routine the engineering the programmingof living organisms. excerpts from an internshipRyan Harrison spent his first SUMME R off from college in New York City, where he did a 10-week INTER NSHI P at Weill Medical College of Cornell University. Instead of working in a computer lab, he worked in a wet lab, complete with live organisms, chemicals, and petri dishes. He studied how a particular protein affects the life cycle of the parasite that causes malaria. Harrison wrote about his summer experience in his blog, Verdant Force: Discoveries in Life and Proteomics. >>> B LO G N AME :Ryan Harrison 6/29/06 Thursday 8:37pm Ive been in New York City for almost a month now. Settling in well to my new lab environment and even forgetting that Im in NYC occasionally . . Wish I could work a little more independently, but I understand that I just dont have the proper laboratory background/experience to handle my own independent project. I guess I was expecting a Gray lab type arrangementwhere I work at my own pace at a problem I selected and I am the only one respon sible for the outcome (good or bad) . . Whatever I decide to do, I think it will combine computational with wet lab work. Since I havent the slightest idea how my life is going to unfold, I am just going to do what I enjoy. computing life | made possible by < 18 | 19 > Listen to the podcast of the interview on the Computing Life Extras Web site. http://publications.nigms.nih.gov/computinglife PAGE 22 NATNATIONANAL INNSTTITTUTETE OF GENERAENERAL MEMEDICAAL SCIENENCEES With the help of a Hollywood illustrator and others, Endy created a comic book called Adventures in Synthetic Biology He hopes to use it as a teaching tool. The entire comic is posted on the Computing Life Extras Web site. > Drew Endy Why do you want to do this? I started to think about why its been so hard to understand biology. The conclusion Ive come to is that the biological systems we nd in nature arent easy to understand. I gure that if I want to have biology that I / understand, Id be better off building it / myself. What makes the eld so hot right now? Seventy years ago, physicists came into / biology and really shook things up. I suspect that whats happening now is that the engineers are coming into biology, and theyre going to shake things up. Describe your typical day. I feel like Im an enzyme, helping stuff happen. I teach two courses on synthetic biology, and I supervise the research in my lab. Every now and then I get a little bit of time to think. What have you thought about lately? Are we discovering biology faster or slower than nature is inventing new biology? I did some back-of-the-envelope calculations, and this number could be completely wrong, but sometime between the year 2085 and 2105 we should be able to sequence all the DNA on the planet in a month. What do you like most about your job? The people in research are some of the coolest, [most] interesting, [and] nicest people youre ever going to meet. Its just a great experience. What do you think makes for a successful scientist? The best, most fun-loving, happy scientists Ive seen are the people who recognize when an idea isnt working and abandon it for a better idea without feeling too bad. Do you think youll always be a scientist? Im doing what I want to be doing, and if I wasnt, I would change it. If at some point in the future, Id rather be raising pheas ants in southern France, or northern France, or wherever they raise pheasants in France, I presume I would go do that. Of / course, Id have to learn French. Last words? People express great wonderment, excitement, and almost a magical relation ship with the living world. But I think over the coming yearsfaster than most expectwell see a transition in biology where it becomes much simpler and easier to engineer living systems. We dont actually know how to do that right now, but there are lessons buried in the lore and wisdom of other engineering disciplines. http://publications.nigms.nih.gov/ndings/mar07mMOReE OnN DRR EW ENDYNATNATIONANAL INNSTTITTUTETE OF GENERAENERAL MEMEDICAAL SCIENENCEES PAGE 23 Discrimination ProhibitedUnder provisions of applicable public laws enacted by Congress since 1964, no person in the United States shall, on the grounds of race, color, national origin, handicap, or age, be excluded from participation in, be denied the benets of, or be subjected to discrimination under any program or activity (or, on the basis of sex, with respect to any / education program or activity) receiving Federal nancial assistance. In addition, Executive Order 11141 prohibits discrimination on the basis of age by contractors and subcontractors in the performance of Federal contracts, and Executive Order 11246 states that no federally funded contractor may discriminate against any employee or / applicant for employment because of race, color, religion, sex, or national origin. Therefore, the programs of the National Institute of General Medical Sciences must be / operated in compliance with these laws and Executive Orders.AccessibilityThis publication can be made available in formats that are more accessible to people with disabilities. To request this material in a different format, contact the NIGMS Ofce / of Communications and Public Liaison at 301-496-7301, TDD 301-402-6327; send e-mail to info@nigms.nih.gov; or write to the ofce at the following address: 45 Center Drive MSC 6200, Bethesda, MD 20892-6200. If you have questions about this / publication, you can use the same contact information to reach the editor, Emily / Carlson.Additional Copies and Web LinksTo order additional copies of Computing Life or other free NIGMS publications, go to http://publications.nigms.nih.gov/order or use the contact information above. An updated Web version that includes additional links, simulations, and other materials is available at http://publications.nigms.nih.gov/computinglife. PAGE 24 P eople with many different talents can join in CO MP UTING L IFE. If youre interested, ask yourself what aspects of the research featured here you find E XC ITING. Do the projects blend many of your academic interests? Are there particular biological problems youd like to solve? Here are a few tips on how to get started looking into CO MP UTING L IFE as a career. > Ask your science teacher or guidance counselor about opportunities to work with a researcher at a nearby college or other institution.> Search the Web for scientists working at the crossroads of biology and computation.> E-mail scientists at your local college or university for more information.> Enter a science fair to get experience presenting research results. When I was in high school, I never thought there was a field that combined all my interests. C hristina Mills, a Harvard Medical School student who models infectious diseases> think you want to compute life?U.S. DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health National Institute of General Medical Sciences NIH Publication No. 07-5861 April 2007 http://www.nigms.nih.gov | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MILLISECOND | CLASS.METHOD | MESSAGE |
|---|---|---|
| 0 | sobekcm_page_globals.constructor | |
| 0 | sobekcm_page_globals.constructor | Application State validated or built |
| 0 | sobekcm_database.verify_item_lookup_object | |
| 0 | sobekcm_page_globals.constructor | Navigation Object created from URI query string |
| 0 | sobekcm_database.verify_item_lookup_object | |
| 0 | sobekcm_page_globals.display_item | Retrieving item or group information |
| 0 | sobekcm_page_globals.get_entire_collection_hierarchy | Retrieving hierarchy information |
| 0 | sobekcm_assistant.get_entire_collection_hierarchy | |
| 0 | cached_data_manager.retrieve_item_aggregation | |
| 0 | cached_data_manager.retrieve_item_aggregation | Found item aggregation on local cache |
| 0 | item_aggregation_builder.get_item_aggregation | Found 'all' item aggregation in cache |
| 0 | system.web.ui.page.page_load (ufdc.page_load) | |
| 0 | sobekcm_page_globals.constructor.on_page_load | |
| 0 | html_echo_mainwriter.add_style_references | Adding style references to HTML |
| 0 | html_echo_mainwriter.add_text_to_page | Reading the text from the file and echoing back to the output stream |
| 49 | html_echo_mainwriter.add_text_to_page | Finished reading and writing the file |