Molecular characterization of two components of the IP3 signalling pathway in the lobster olfactory organ

MISSING IMAGE

Material Information

Title:
Molecular characterization of two components of the IP3 signalling pathway in the lobster olfactory organ
Physical Description:
viii, 72 leaves : ill. ; 29 cm.
Language:
English
Creator:
Munger, Steven D., 1966-
Publication Date:

Subjects

Subjects / Keywords:
Inositol 1,4,5-Trisphosphate   ( mesh )
Receptors, Odorant -- analysis   ( mesh )
Receptors, Odorant -- isolation & purification   ( mesh )
Receptors, Odorant -- genetics   ( mesh )
Olfactory Pathways   ( mesh )
Olfactory Receptor Neurons   ( mesh )
Mice   ( mesh )
Genre:
bibliography   ( marcgt )
theses   ( marcgt )
non-fiction   ( marcgt )

Notes

Thesis:
Thesis (Ph. D.)--University of Florida, 1997.
Bibliography:
Includes bibliographical references (leaves 60-70).
Statement of Responsibility:
by Steven D. Munger.
General Note:
Typescript.
General Note:
Vita.

Record Information

Source Institution:
University of Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
oclc - 48663429
ocm48663429
System ID:
AA00011222:00001

Full Text











MOLECULAR CHARACTERIZATION OF TWO COMPONENTS OF THE IP3
SIGNALLING PATHWAY IN THE LOBSTER OLFACTORY ORGAN









By


STEVEN D. MUNGER


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY



UNIVERSITY OF FLORIDA


























Copyright 1997

by

Steven D. Munger




























To Peter and Joan Munger, for everything.















ACKNOWLEDGMENTS


I would like to thank my mentor, Dr. Barry Ache, for his patience when all looked

bleak, and for trusting me enough to allow me to pursue projects that may not have

shown the greatest likelihood of success. I have learned much of how science, in the

broadest sense, should be approached.

I thank Dr. Barbara-Anne Battelle for her support and for her excellent lessons in

how to properly construct an experiment. If I am half as rigorous a scientist, I will be

quite happy. I would also like to thank her for treating me like a colleague as well as a

student. I consider myself her graduate student as well. My thanks go to Dr. Robert

Greenberg, for rarely getting frustrated when I was the 37th person that hour to ask him a

question. He has been a good teacher and a good friend. Sincere thanks and appreciation

to all the other members of my committee: Dr. Peter Anderson, Dr. Gerry Shaw and last

minute-substitute and slumlord Dr. Michael Greenberg. All of you have been invaluable

to my education and to my enjoyment of the Whitney Lab.

Of course, I cannot neglect all of those Whitney folks, past and present, who have

made my stay at the Laboratory such a joy (at least, compared to graduate school

anywhere else). As everyone has helped me in so many different ways over the last

several years, I will not make a laundry list of good deeds. Everyone knows how they

helped in one way or the other. But here is the honor roll, in no particular order: Lynn

Milstead, Jim Netherton, Karen Kempler, Gary and Susanna LaFleur, Dave Price,

Gerhard Reich, Louise MacDonald, Shirley Metts, Gina White, Chris Brink, Scan Boyle,

Chuck Peterson, Luke Dunlap, Paul Linser, Anne Andrews, Jeri-Lynn Schremser, Chris









Williams, Rick Gleeson, Bill Carr, Hank Trapido-Rosenthal, Debi and Jim Fadool, Russ

Buono, Billy Raulerson, Bob Birkett, Mike Jeziorski, Asl Zhainazarov, Elisabeth Wiese,

Mike Michel, Matt Wachowiak, Manfred Schmidt, Aurea Orozco-Rivas, Nicole Rust and

all of those other REU students, the Sandpiper and, of course, Cornelius Vanderbilt

Whitney.

Finally, I thank my parents, for their support and encouragement. Nothing would

have been possible for me without all that they have done and all that they have been.















TABLE OF CONTENTS


ACKNOWLEDGMENTS ............................. ..... ............. ............................ iv

ABSTRACT............................................................................................................... vii

1 INTRODUCTION .......................... ...................................... ...................................

Olfactory Processing............................................................... .................................
Multiple Transduction Pathways in Olfaction........................... .......... .............. 2
The Lobster as an Olfactory Model System......................................................3
Both cAMP and IP3 Underlie Lobster Olfactory Transduction.................................... 8
The Lobster Olfactory IP3 Receptors..........................................................13
G proteins Mediate Lobster Olfactory Transduction.............. ..........................14
Specific Aims............................ ..........................................................................15

2 MOLECULAR CHARACTERIZATION OF AN OLFACTORY ORGAN IP3
RECEPTOR......................................................................... ..................................17

Introduction.......................................................................... ..................................17
M ethods............................................................................. .....................................22
Results............................................................................. ................................ ......25
Discussion............................................................................ ..................................33

3 MOLECULAR CHARACTERIZATION OF AN OLFACTORY ORGAN GQ
PROTEIN............................................................................. ..................................38

Introduction....................................................................... .....................................38
M ethods...................................................................... .................................. ......40
R esults.............................................................................. .....................................42
D discussion ........................................................................... ...................................50

4 SUMMARY............................................................................ .................................54

LIST OF REFERENCES.................................. .....................................................60

BIOGRAPHICAL SKETCH........................ ....................................71














Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy


MOLECULAR CHARACTERIZATION OF TWO COMPONENTS OF THE IP,
SIGNALLING PATHWAY IN THE LOBSTER OLFACTORY ORGAN

By

Steven D. Munger

May, 1997




Chairman: Barry W. Ache
Major Department: Neuroscience


Olfactory transduction is a complex biochemical process that transforms odor

signals from the environment into neural signals that can be interpreted by the brain,

triggering appropriate behavioral and physiological responses in the organism. Inositol

1,4,5-trisphosphate (IP3) has been implicated, in a variety of species, as a second

messenger involved in olfactory transduction, though its precise role remains

controversial. IP3 has been proposed by some to be either a modulatory factor or a

necessary cofactor for the better characterized transduction pathway mediated by

adenosine 3',5'-cyclic monophosphate (cAMP); others believe it to have a role

equivalent, but not identical, to cAMP. A key to understanding the funtional intricacies

of the cAMP pathway was the molecular isolation and characterization of components of

this signalling cascade in olfactory receptor neurons (ORNs). Unfortunately, few









components of the IP3 pathway of ORNs have been characterized. In the spiny lobster,

Panulirus argus, electrophysiological studies have implicated an IP3-gated channel, the

IP3 receptor (IP3R), as the target of IP3 generated by excitatory odor-stimulation. A Gq
protein a-subunit, a member of the family of heterotrimeric GTP-binding proteins, has

also been implicated in the excitatory odor response, serving to link the activated odor

receptor with the enzyme that generates IP3. This dissertation describes the molecular

cloning of cDNAs for two components of an IP3 signalling cascade from the olfactory

organ (nose) of the spiny lobster: an IP3 receptor and a Gq protein. These two proteins,

both implicated in the excitatory odor response in lobsters, share many structural

characteristics with those isolated from other species and tissues. The IP3 receptor cDNA

encodes a protein that is about 50% identical to those isolated from Drosophila and

several vertebrates. The Gq protein shows an even similarity to other Gq proteins (70-

80%). The messenger RNAs for these two molecules are both expressed in the olfactory

organ, making them candidates for roles in olfactory transduction. The isolation and

characterization of these two cDNAs is a critical step in the understanding of both the

role of IP3 in olfactory signalling and the complexity of odor transduction in all animals.














CHAPTER 1
INTRODUCTION


Olfactory Processing


Most odors are complex mixtures of compounds, and it is the role of the olfactory

system to transduce these chemical stimuli into neural signals that reflect the complex

nature of the odor. The olfactory system does this by doing more than just assigning each

odor component a neural signature, reflected as a change in membrane potential. The

system also processes the signals to reflect such information as concentration and mixture

composition. This processing could take place at several possible levels. In the

extracellular environment, access of odor molecules to olfactory receptor binding sites on

the surface of olfactory receptor neurons could be regulated by odorant binding proteins

or enzymes that degrade odor molecules, or there could be competition between odor

molecules for olfactory receptor binding sites. In olfactory receptor neurons that contain

multiple transduction cascades, the activation of olfactory receptors of different

specificity could activate more than one transduction pathway, providing ample targets

for biochemical cross-talk that might modulate the function of either cascade. The best

characterized site of olfactory processing is at the level of synaptic processing, beginning

at the point of contact between olfactory receptor neurons contact second order neurons in

the olfactory bulb (vertebrates) or lobe (invertebrates) and continuing in higher neural

centers; here, the activity of numerous olfactory receptor neurons is shaped by the

integration of activity across the population. Although each of these levels is a

potentially critical step in the coding and processing of odor information, this

dissertation will concentrate on some of the mechanisms of olfactory transduction.









Through the better understanding of these mechanisms in cells that express multiple

transduction cascades, it may be possible to decipher how individual receptor neurons

could begin to process multiple odor stimuli at the level of the single receptor cell.


Multiple Transduction Pathways in Olfaction

Olfactory transduction is thought to occur through standard G protein-mediated

second messenger systems (reviews: Breer and Boekhoff, 1992; Ache and Zhainazarov,

1995; Restrepo et al., 1996; but see Vodyanoy and Murphy, 1983; Labarca et al., 1988).

In such a system, a receptor is coupled to second messenger-metabolizing enzymes (e.g.

adenylyl cyclase, which synthesizes cAMP from ATP) by a heterotrimeric GTP-binding

protein (G protein). Evidence in rat (Breer et al., 1990; Boekhoff et al., 1990; Ronnett et

al., 1993), amphibian (Dionne, 1992; Bacigalupo et al., 1993; Lowe et al., 1989; Lischka

et al., 1995), catfish (Ivanova and Caprio, 1992; Miyamoto et al., 1992; Restrepo et al.,

1990; Bruch and Teeter; 1990), lobster (Michel and Ache, 1992; Fadool and Ache, 1992;

Boekhoff et al., 1994) and squid (Lucero et al., 1992; Lucero and Piper, 1994) points to

multiple olfactory transduction mechanisms, and implicates adenosine 3',5'-cyclic

monophosphate (cAMP) and inositol 1,4,5-trisphosphate (IP3) as olfactory second

messengers (review: Ache, 1994). However, the functional consequences of cAMP and

IP3 vary between species. For example, while cAMP and IP3 both depolarize ORNs in
the catfish (Ivanova and Caprio, 1992), the two messengers mediate opposing

conductances in the lobster (Fadool and Ache, 1992; Michel and Ache, 1992). cAMP

and IP3 both appear to act by directly gating ion channels in the plasma membrane

(Nakamura and Gold, 1987; Zufall et al., 1994; Fadool and Ache, 1992; Hatt and Ache,

1994; Lischka et al., 1994), though some have challenged the findings of a plasma-

membrane IP3-gated channel (Brunet et al., 1996; Nakamura et al., 1996). There is now

growing evidence for a multitude of modulatory and amplifying factors that may act on









one or both of these two pathways, including the gaseous messengers nitric oxide and

carbon monoxide (Lischka and Schild, 1993; Leinders-Zufall et al., 1995; Zufall, 1996;

Broillet and Firestein, 1996), Ca2+ (e.g. Anholt and Rivers, 1990; Kleene, 1993; Lowe

and Gold; 1993; Kurahashi and Yau, 1994) and cGMP (Breer et al., 1992) (Figure 1).

The advent of molecular biology has afforded the opportunity to identify many of

the molecules that compose these olfactory transduction pathways, permitting better

characterization of their functions and their distributions. Most of the major components

of the olfactory cAMP pathway have been cloned from mammals: a type III adenylyl

cyclase (Bakalyar and Reed, 1990); a G protein a-subunit, Golf (Jones and Reed, 1989);

and two subunits of the cAMP-gated channel (Dhallan et al., 1990; Bradley et al., 1994;

Liman and Buck, 1994). The IP3 pathway is not nearly as well characterized, with only a

catfish phospholipase C (Abogadie et al., 1995a), a lobster IP3-gated channel (Munger et

al., 1995; Munger et al., 1997; Chapter 2), two lobster Gq proteins (Munger et al., 1997;

Chapter 3; Xu et al., 1997) and a Drosophila Gq protein (Talluri et al., 1995) having been

cloned.


The lobster as an olfactory model system

One advantage of the spiny lobster, Panulirus argus, as a model system for the

study of olfactory transduction is the extensive characterization of behaviorally-relevant

odors. Many of these odors are small hydrophilic compounds, such as amino acids,

quatenary ammonium compounds, nucleotides, and amines (review: Carr et al., 1987;

Ache and Carr, 1989), present in the flesh of the animal's typical prey.

Electrophysiological and biochemical of the ORNs to many of these odors, as well as

behavioral responses of the animal, have been well characterized.

The olfactory organ, or the "nose," of the spiny lobster is the two lateral filaments

of paired, bifurcated antennules (Figure 2). The somata of the olfactory receptor neurons























Figure .. Proposed pathways in olfactory transduction. (A) A vertebrate olfactory receptor
neuron (ORN). Odor transduction takes place in the dendritic cilia, while the axon projects
to the CNS, where it makes its first synapse. Invertebrate ORNs have a similar structure
(see Figure 2). (B) These biochemical pathways have been proposed in a variety of
organisms to mediate olfactory transduction. The better characterized pathway involves the
activation of adenylyl cyclase (AC) after odor activation of a receptor (R), via a G protein
(G). The AC generates cAMP, which then directly gates a membrane channel. The second,
parallel pathway, involves separate receptors, G protein, and the metabolizing enzyme
phospholipase C (PLC), which generates the messengers IP3 (or InsP3) and diacylglycerol.
IP3 (InsP3) can also directly gate its own membrane channel. Several potential modulatory
and amplification pathways are also proposed, including the activation of protein kinase A
(PKA), protein kinase C (PKC) and a G protein-coupled receptor kinase (GRK). Ca2+,
entering the cell through either second messenger-gated channel, can act both through
calmodulin (CAM), such as by acting on phosphodiesterase (PDE), and by directly gating
other channels. Finally, IP3 (InsP3) can be phosphorylated by a 3-kinase into InsP4, which
may also gate a channel. From Ache and Zhainazarov, 1995, with permission.









A


L





























Figre 2. (A) The lateral filament of the antennule of P. argus is the olfactory organ. The
expanded view at right (B) shows the aesthetase sensilla between two rows of guard hairs.
The sensilla contain the dendrites of the ORNs, while the ORN somata lie within the
antennular lumen. (C) A cross section of a single aesthetasc sensillum shows the cluster of
somata surrounded by auxiliary cells, projecting their dendrites into the shaft of the
aesthetasc. The axons of the ORNs project to the olfactory lobe of the brain, where they
make their first synapse.


































































Inner
dendritic
segment





lOO.r









(ORNs) are clustered like bunches of grapes on the ventral aspect of the antennular

lumen. The ciliated dendrites of these bipolar neurons extend into porous cuticular

sensilla (aesthetascs), while the axons project to the CNS. Each sensillum has a cluster of

about 320 associated ORNs, and there are some 1500 aesthetascs per antennule (Grlnert

and Ache, 1988). The outer dendritic segment of the ORN is the site of olfactory

transduction and consists of only plasma membrane surrounding microtubules and

cytoplasm (no endoplasmic reticulum or mitochondria are present) (Grilnert and Ache,

1988).


Both cAMP and IP3 underlie lobster olfactory transduction

Individual odor molecules can either excite or inhibit a single ORN, but show

both capabilities across the ORN population (McClintock and Ache, 1989; Michel et a.,

1991). These opposing effects are due to the activation of different conductances: a K

conductance mediates the suppressive effect (Michel et al, 1991), while a non-selective

cation conductance underlies excitation (Schmiedel-Jakob et al., 1989; 1990).

These opposing conductances are mediated by cAMP and IP3 (Figure 3) (review

Fadool and Ache, 1994). Rapid kinetic measurements of second messenger production in

vitro show the elevation, in the dendrites, of both cAMP and IP3 in response to odor

exposure (Boekhoffet al., 1994) (Figure 4). Drugs targeting the cAMP pathway perturb

the inhibitory response (Michel and Ache, 1992), and cAMP directly gates a K+

conductance in ORN dendritic plasma membrane (Hatt and Ache, 1994), linking cAMP

to the inhibitory response. The excitatory response is affected by drugs targeting the IP3

pathway (i.e., heparin) (Fadool and Ache, 1992). Intracellular injection of IP3 mimics

the excitatory response (Fadool and Ache, 1992). IP3 directly gates two conductances of

different magnitudes in inside-out patches of cultured ORN somatic plasma membrane

(Fadool and Ache, 1992) and ORN dendritic plasma membrane blebs (Hatt and Ache,




























Figure 3. The lobster ORN dendritic plasma membrane supports at least two transduction
pathways, one mediated by cAMP and one by IP3. In both of these cases, odors activate the
enzymes adenylyl cyclase or phospholipase C via a receptor/G protein cascade. The evoked
messenger molecules then directly gate ion channels in the membrane. Na+ entering the cell
(possibly via the IP3-gated channel) activates an additional membrane channel, and may
serve to amplify the odor-evoked receptor potential. In the IP3 cascade, diacylglycerol
(DAG) is produced, along with IP3, with the hydrolysis of the membrane phospholipid
phosphatidylinositol 4,5-bisphosphate (PIP2).
















calcium selective
non-selective Na activated
cation channel channel


10:7


D


INHIBITORY EXCITATORY
PATHWAY PATHWAY
t d n/
Net depolarization




























Figure 4. Fast kinetic measurements of the second messengers cAMP and IP3 in ORN
dendrites as elicited by the odors taurine (A) and proline (B). Dendritic membrane
preparations were stimulated by individual odors before quenching the reactions and
measuring second messenger levels by radioimmunoassay. Both odors elevate both
messengers. However, the odor more likely to excite ORNs across the population (taurine)
elevates IP3 to a greater extent than cAMP, while the odor more likely to inhibit ORNs
across the population prolinee) elevates cAMP to a greater extent than IP3. From Boekhoff
et al.(1994), with permission.




































IP3 [pmol/mg
-800 81





600 6





400 4


-200 -100 0 100 200 300 400 500 600
Time [msecl

100o M Ta-urne


B
cAMP Ipmol/mg)


IP3 Ipmol/mg]


00 800





00- 600





00 400





00 0








-200 -100 0 100 200 300 400 500 600
Time [msec


100 pM Prol.n


cAMP Ipmol/mgi


2









1994). When a cell-free patch containing a large conductance IP3R was inserted into the

cytoplasm of a second cultured ORN ("patch-cram"), application of odor to the ORN

induced channel activity in the inside-out patch (Fadool and Ache, 1992), implying odor

induced generation of IP3 in the recipient ORN, an observation confirmed by Boekhoff

and colleagues (1994). Together, these data implicate IP3 as the "excitatory" second

messenger.


The lobster olfactory IP, receptors

The IP3-gated conductances described by Fadool and Ache (1990) and Hatt and

Ache (1994) must be definitively localized to either the dendritic plasma membrane or to

the endoplasmic membrane (the best understood location of IP3Rs). This is an important

point, as it would have great implications for the nature of the excitatory odor response:

the elicited IP3 could directly gate a plasma membrane channel, depolarizing the ORN by

increasing the conductance of ions across the membrane, or it could release Ca" from

intracellular stores, and this tertiary messenger would indirectly depolarize the ORN.

While one could argue that patches from cultured ORN somata might include ER

membrane, the patch recordings from dendritic blebs takes advantage of the

morphological feature that the outer dendrite contains no membranous structures other

than plasma membrane (Grilnert and Ache, 1988). Additionally, the drug thapsigargin,

which blocks the Ca -ATPase responsible for refilling IP3-depleted Ca2+ stores, did not

affect the odor response (Fadool and Ache, unpublished results), as would be expected if

this response were mediated by the release of Ca+ from intracellular stores. It is

therefore unlikely that the lobster olfactory IP3Rs are localized to the endoplasmic
reticulum.

Lobster ORNs express two different IP3Rs. In inside-out patches from cultured
ORN plasma membrane, the two IP3-gated channels showed conductances of 74 pS (large









channel) and 30 pS (small channel) (Fadool and Ache, 1992); two IP3-gated channels of

similar conductances (64 pS and 27 pS) were recorded in situ from dendritic membrane

(Hatt and Ache, 1994). The large and small conductance channels were found in the

same patch of membrane only twice, and exhibited different voltage dependencies of the

open probability (Fadool and Ache, 1992; Hatt and Ache, 1994). Both of these findings

are consistent with the hypothesis that the two IP3Rs are differentially expressed across

the population of ORNs. Whether these two IP3Rs are the products of different genes,

splice variants of the same gene, or are modified (e.g. phosphorylated) forms of the same

protein is unclear.

Structural similarity between the IP3Rs in the plasma membrane of the lobster

ORNs and the mammalian cerebellum is implied by immuno-crossreactivity. A

polyclonal antibody, raised against the carboxyl-tail of the rat cerebellar type 1 IP3R,

increased the odor-evoked current over 400% when injected into the soma of cultured

ORNs and, when copresented with 10-7 M IP3, the antibody increased the probability of

opening and the mean open time of both large and small conductance channels without

affecting the channel conductance (Fadool and Ache, 1992).

Lobster olfactory IP3Rs display important functional differences and similarities
with vertebrate IP3Rs. The lobster IP3Rs are functionally insensitive to ATP (Fadool and

Ache, 1992), even at high concentrations (up to 50 mM), unlike mammalian and

amphibian IP3Rs (Bezprozvanny and Ehrlich, 1994; Stehno-Bittel et al., 1995).

Preliminary evidence indicates that the lobster IP3Rs mediate nonspecific cation

conductances (Fadool and Ache, unpublished data) similar to intracellular IP3Rs
(Bezprozvanny and Ehrlich, 1994; Stehno-Bittel et al., 1995).








G proteins mediate lobster olfactory transduction

As described above, both the cAMP and the IP3 second messenger cascades rely

on a heterotrimeric GTP-binding protein (G protein) composed of a-, P- and y-subunits to

transduce the signal between the ligand-activated receptor and a downstream

metabolizing enzyme (e.g., adenylyl cyclase for cAMP or phospholipase C for IP3). In

lobster ORNs, the use of nonhydrolysable GTP analogs has demonstrated the necessity of

such proteins in olfactory transduction (Fadool et al., 1995). The identity of the G

protein involved in the inhibitory odor response has not been identified [though it is

clearly not the same as the one involved in the excitatory odor response (Fadool et al.,

1995)]. Two candidate a-subunits have been implicated in the excitatory odor response

(Fadool et al., 1995): a Gaq/ll of the Gq family, and a Geo of the Gi family. Only the

Gaq/,i protein has been localized to the ORN dendrites. These studies involved the use
of antibodies to conserved regions of these proteins, so the G proteins that may function

in the excitatory pathway must be isolated and characterized.


Specific Aims

In this project, I have attempted to address the following question: Is the

excitatory odor response in lobster ORNs mediated by common components of an IP3

signaling cascade? This dissertation presents a series of experiments designed to isolate

and partially characterize two components of the lobster excitatory odor transduction

pathway: an IP3 receptor and a Gq protein. I have used a cloning strategy based on

homology to known proteins to isolate and determine the primary structure of cDNAs for

these two molecules from the lobster olfactory organ. I have demonstrated that these two

molecules are expressed, as messenger RNAs, in the olfactory organ, a requirement for

any protein involved in olfactory transduction. Together, these data demonstrate two

fundamental principles: first, two transduction molecules, physiologically implicated in






16


the excitatory odor response, are present in the olfactory organ; and second, these

molecules appear to share many features of primary structure with similar proteins in

other IP3 signaling cascades. These two molecules are the first components of the IP3-

mediated olfactory transduction pathway to have both structure and function

characterized .














CHAPTER 2
MOLECULAR AND IMMUNOLOGICAL CHARACTERIZATION OF AN
OLFACTORY ORGAN IP3 RECEPTOR


Introduction

Physiological and biochemical evidence implicates inositol 1,4,5-trisphosphate

(IP3) as well as adenosine 3',5'-cyclic monophosphate (cAMP) as olfactory second
messengers (reviews: Breer and Boekhoff, 1992; Ache, 1994). Though IP3 plays a

primary transduction role in many invertebrates, the precise functional role of IP3 is less

clear in vertebrate ORNs (e.g. Firestein et al., 1991; Nakamura et al., 1994; Kleene et al.,

1994; Nakamura et al., 1996; Brunet et al., 1996), where this messenger may serve as a

modulatory factor, a required cofactor, or as an excitatory or inhibitory second messenger

acting in parallel to the cAMP pathway. But in contrast to the cAMP transduction

pathway, where many of the major molecular components have been cloned, sequenced

and localized to the transduction zone (Jones and Reed, 1989; Bakalyar and Reed, 1990;

Dhallan et al., 1990; Bradley etal., 1994; Liman and Buck, 1994), the IP3 pathway has

been minimally characterized at the molecular level. Notable exceptions include a

phospholipase C from catfish (Abogadie et al., 1995b) and Gq proteins from two species

of lobster ( Caribbean spiny lobster: Munger et al., 1997; American lobster: Xu et al.,

1997) and Drosophila (Talluri et al., 1995).

In olfactory systems, the binding of some odor molecules to G protein-associated

receptors is thought to activate the enzyme phospholipase C, which hydrolyses the

membrane lipid phosphatidylinositol 4,5-bisphosphate into IP3 and diacylglycerol (Breer

et al., 1990; Boekhoff et al., 1990; Berridge, 1993; Ronnett et al., 1993; Boekhoff et al.,

1994). The IP3 can then gate the intrinsic channel of IP3 receptors (IP3Rs) on the plasma









membrane of ORN cilia or outer dendrites (Fadool and Ache, 1992; Hatt and Ache, 1994;

Restrepo et al., 1990; Restrepo et al., 1992; Lischka et al., 1995). IP3Rs have been

traditionally thought to be principally localized to the ER and nuclear membranes

(reviews: Furuichi et al., 1994; Ferris and Snyder, 1992), but there is growing evidence

for the presence of IP3Rs in the plasma membrane (e.g. Restrepo et al., 1990; Fadool and

Ache, 1992; Fujimoto et a., 1992; Restrepo et a., 1992; Khan et al., 1992; Sharp et al.,

1992; Hatt and Ache, 1994; Lischka et al., 1994; Kuno et al., 1994; Khan et al., 1996)

including the immunological localization of an IP3R to the cilia (as well as other

compartments) of rat ORNs (Cunningham et al., 1993) and the description of a protein in

catfish ORNs affinity labeled by an 125I-IP3 analogue (Kalinowski etal., 1992); this latter
protein, however, is half the size (107 kDa) of all other known IP3Rs.

The primary structure of numerous vertebrate IP3Rs has been determined by cDNA

cloning (e.g. Yamada et al., 1994; Yamamoto-Hino et a., 1994; Maranto, 1994; Furuichi et

al., 1989; Mignery et a., 1990; Sudhof et a., 1991; Blondel et a., 1993; Kume et al., 1993)

as well as Drosophila (Yoshikawa et al., 1992). All of these cloned IP3Rs are homologous,

sharing the same basic structural motifs (Figure 5). Multiple isoforms, types 1, 2 and 3,

have been identified in mammals; they possess 60-70% sequence identity and appear to

vary only in sensitivity to modulation, affinity for IP3 binding and tissue distribution. The

IP3R proteins consist of 2693-2833 amino acids, coded for by an mRNA of 9-10 kb, and
have three functional domains: an IP3-binding domain, a central modulatory domain, and an

ion channel domain. The IP3-binding domain lies within the first 650 amino acids of the

IP3R [amino acids 476-501 are labeled by photoaffinity ligands (Mourey etal., 1993)]. The
type 1 IP3R contains the first of two short, alternatively spliced regions (SI) within the IP3-
binding domain. The modulatory domain lies between the IP3-binding and channel

domains, and may contain consensus sites for ATP binding and protein kinase A

phosphorylation, along with several calcium related signals and the second






























Figre 5. IP3Rs all contain three principle domains: a ligand binding domain (IP3) at the
amino end of the protein, a central modulatory domain, and a channel domain with six
transmembrane regions (MI-M6) and a putative pore-forming region. Both the amino and
carboxyl termini are extend into the cytoplasm (this is true for receptors on the endoplasmic
reticulum as well as on the plasma membrane). The channel is thought to be a nonselective
cation channel. Modified from Mikoshiba, 1993.















Ca2+/Na+


HOOC





cytoplasm


extracellular/luminal


After K. Mikoshiba, 1993.









splice site (SII; in type 1); the number and types of these consensus sites varies among IP3R

types and among species, and some sites (i.e., protein kinase C phosphorylation sites) are

as yet undefined (review: Furuichi et a., 1994). The channel domain contains six putative

transmembrane regions [as defined by hydrophobicity and N-linked glycosylation sites

(Michikawa et al., 1994)] and a carboxyl tail thought to be involved in calcium release

(Nakade et al., 1991). The channel pore is thought to lie between the last two

transmembrane regions, 5 and 6 (Michikawa et al., 1994). It is the final two transmembrane

regions and the carboxyl tail that show the greatest similarity in protein sequence to another

intracellular calcium release channel, the ryanodine receptor. Although these cation

channels are relatively nonselective (Bezprozvanny and Ehrlich, 1994; Stehno-Bittel et

al., 1995; but see McDonald et al., 1993), their main role is thought to be the release of

calcium from intracellular stores in response to an IP3-mediated extracellular signal

(review: Berridge, 1993).

Lobster olfactory IP3Rs display important functional differences and similarities

with vertebrate IP3Rs. The lobster IP3Rs are insensitive to ATP (Fadool and Ache, 1992),

even at high concentrations (up to 50 mM), unlike mammalian and amphibian IP3Rs

(Bezprozvanny and Erhlich, 1993). Preliminary evidence indicates that the lobster IP3Rs

mediate nonspecific cation conductances, similar to intracellular IP3Rs (Fadool and Ache,

unpublished data).

Cunningham and colleagues (1993) provided evidence that rat ORNs express an

IP3R in cilia that is somewhat similar to the cerebellar type-I IP3R But the antibodies used

in these studies cross-react with all three IP3R subtypes; so we cannot be sure whether the
IP3R in ORN cilia is the same as that expressed in cerebellum, or if the olfactory IP3R is

similar yet not identical IP3R form. In this chapter, I describe the isolation of an IP3R

cDNA from the olfactory organ of the spiny lobster, Panulirus argus. This IP3R is

expressed in both olfactory organ and brain. Attempts to localize this IP3R to the ORN

dendrites--the site of olfactory transduction--are inconclusive, so the involvement of this









particular IP3R is involved in shaping the initial odor response remains unproven. Portions

of this work have previously appeared in abstract form (Munger et al., 1995; Munger et al.,

1997).


Methods

RNA extraction: Olfactory organs (100 antennules per isolation) were harvested

into a dry ice/ethanol bath, transported from the Florida Keys to the Whitney Lab on dry

ice, and stored at -800C until used. The antennules were homogenized in liquid nitrogen

by mortar and pestle, then the powder was homogenized by polytron in a GTC/P-

mercaptoethanol solution (sarkosyl added to 2% after homogenization). After removing

cuticle by centrifugation, the homogenate was layered onto a 5.7M CsCI cushion for

ultracentrifugation (24 hours, 20C, 30,000 rpm in a Beckman SW-41 rotor). The RNA

pellet was resuspended in 10 mM Tris-HCl (pH 8.0), 1 mM EDTA-SDS,

spectrophotometrically quantified, and stored in ethanol with 0.3 M sodium acetate, pH

5.5, at-200C.

RT-PCR: IPJ-R Degenerate oligonucleotide primers were designed to match

regions of conserved nucleotide sequence within the final putative transmembrane region

(amino acids FFVMVIIIV, sense primer) and the carboxyl tail (amino acids

EHNMWHY, antisense primer) of known IP3Rs. Total RNA from nose (10 pg) was

reverse transcribed with SuperScript II M-MLV reverse transcriptase, using the antisense

primer. The resulting cDNA served as template for touchdown polymerase chain reaction

(PCR) amplification. The PCR reaction mixture contained 100 pmol of each primer, 5%

of the reverse transcription reaction volume, 2.5 units of a 60:1 mixture of Taq:pfu

polymerases, 1.5 mM MgCl2, 500 mM KC1, 100 mM Tris-HC1, pH 9.0 and 1% Triton X-

100. The PCR cycling profile was as follows: [94C, 5 min; 600C 2 min; 72C, 3 min]

x 1 cycle; [94C, 1 min; 590C (- PC/cycle), 1 min; 720C, 2 min] x 9 cycles; [940C, 1









min; 520C, 1 min; 720C, 2 min] x 30 cycles. The resulting 203 bp product was gel

purified, ligated into the TA-cloning vector pGem-T (Promega), and transformed into

JM109 competent E. coli for subcloning. Control RNA samples, which were treated as

above except for receiving no reverse transcriptase, showed no product. After screening

colonies for appropriately sized inserts by PCR, individual clones were selected for

sequencing by standard chain termination methods (Sanger et al., 1977). Seven clones

(78/79-1 through 78/79-7) were fully sequenced, and the cDNA sequences were

translated, assembled and analyzed with GeneRunner (Hastings Software, Inc.) and

Biolmage DNA Sequence Film Reader software (Biolmage). The deduced amino acid

sequences were compared with all known proteins using BLAST software (NCBI,

Altshul et al., 1990).

3-RACE (Rapid Amplification of cDNA Ends): The 3'-RACE technique is

modified from Frohman et al. (1988). Total RNA from nose (10 ig) was reverse

transcribed with an oligo-dT17 /Not I oligonucleotide. The resulting cDNA served as

template for the first round of PCR amplification; the oligo-dT primer and a primer

specific to clone 78/79-1 were used. The PCR product then served as template for a

second round of PCR amplification in which the same oligo-dT primer and a nested

78/79-1-specific primer were used. The resulting product of 643 bp (clone 3R2A) was

purified, subcloned and sequenced as described above.

Creation of cDNA minilibrary and library screening: A unidirectional cDNA
minilibrary was constructed in the bacteriophage Xgt22A vector system (Gibco-BRL

Lambda System) from olfactory organ poly(A)+ RNA. cDNA ligated into the X arms
was reverse transcribed with the antisense degenerate primer (see above) coupled to a

Not Iadapter. The library was screened by plaque hybridization at high stringency
(600C) using clone 78/79-1 as probe. A 1707 bp clone (1111-2), which overlaps with

clone 3R2A, was isolated. Clone 1111-2 maintains homology to other IP3Rs. Three









more overlapping clones (56/25H3, 1272 bp, 62/25N2, 938 bp, and 3/144H2, 2386 bp)

were also isolated from the library by PCR.

5'-RACE (Rapid Amplification of DNA Ends): 5'-RACE was modified from
Frohman et al. (1988) with the 5'-RACE kit (Life Technologies). Total RNA from nose

(10 tg) was reverse transcribed as above with an IP3R-specific antisense primer, and a

poly(C)+ tail was added to the 3'-end of the antisense single strand cDNA with terminal
transferase. The resulting cDNA served as template for the first round of PCR

amplification using a nested antisense IP3R-specific primer and an anchor primer to the

poly(C)+ tail (Sal I-Spe I-GTACGGGIIGGGIIGGGIIG, where I = inosine). The same
anchor primer and a second nested IP3R-specific primer were then used in a second round

of PCR amplification with the PCR products serving as template. The resulting products

were purified, subcloned and sequenced as described above. Control RNA samples,

which were treated as above, except that they received no reverse transcriptase or no

terminal transferase, showed no product. PCR reagents for both reactions were: 50 pmol

of each primer, 20% of the tailed cDNA (or 0.1% of the first PCR reaction), 1.5 mM
MgCl2, 500 mM KCI, 100 mM Tris-HC1, pH 9.0 and 1% Triton X-100. PCR cycling

times were as follows: [94C, 5 min; 490C, 2 min; 720C, 3 min] x 1 cycle; [940C, 30

sec; 490C, 30 sec; 720C, 2 min] x 30 cycles. Sequencing, translation, assembly and

analysis was done as above. A second 5'-RACE reaction was performed for the IP3R to

reach the 5'-UTR. Sequencing, translation, assembly and analysis was done as above;

some clones were sequenced by the University of Florida's Interdisciplinary Center for

Biotechnology DNA Sequencing Core Laboratory using the Taq DyeDeoxy Terminator
and Dyeprimer Cycle sequencing protocols, developed by Applied Biosystems, and the
Applied Biosystems Model 373A DNA Sequencer.

To control for errors which may have resulted from the actions of the DNA
polymerases or the reverse transcriptase, four overlapping clones, which together spanned









the entire contig from the 5'- to the 3'-untranslated regions, were amplified in duplicate,

independent RT-PCR reactions, and a consensus sequence was taken.

Ribonuclease Protection Assay (RPA): This assay was done according to the
protocols accompanying the RPA II kit (Ambion). RNA samples (1.5 and 3 fg nose

poly(A)+ RNA and 5 and 10 pg brain total RNA, along with yeast RNA controls) were
hybridized in solution to a 32P-labeled antisense riboprobe transcribed from clone 79/79-

1. The RNA samples were then subjected to RNase digestion (RNase A and T1) and

separated on an 8M urea/5% acrylamide gel. One of the yeast controls did not undergo

RNase digestion. The gel was exposed to X-ray film for 18 days at -800C with

intensifying screens.


Results


cDNA cloning

The 203 bp cDNA product obtained from the initial RT-PCR was subcloned,
sequenced, and conceptually translated. Seven separate clones (79/78-1 through 79/78-7)

were sequenced and were found to be identical in nucleotide sequence. A comparison of

the deduced amino acid sequence with sequences in the GenBank database revealed that

these products are homologous to previously cloned IP3Rs (they are less similar to the

ryanodine receptors, which share some primary structure with IP3Rs). The clone was

extended to the 3'-untranslated region (UTR) by 3'-RACE (clone 3R2A). To obtain the

remainder of the clone extending into the 5'-UTR, a cDNA minilibrary was constructed
in Xgt22A from olfactory organ poly(A)+ RNA reverse transcribed with the antisense
degenerate primer used in the initial RT-PCR experiment. This library was screened by

a combination of plaque hybridization and PCR to isolate a series of overlapping clones.
The minilibrary apparently contained no clones that extended to the 5' UTR, so 5'-









RACE was used to isolate the remainder of the coding sequence. Four overlapping

clones, which together spanned the entire open reading frame, were amplified in duplicate

RT-PCR reactions (data not shown), and the consensus sequence across all three clones

was taken. One of the original partial clones (1111-2) contained an intron that was not

present in any of the subsequent confirmatory clones; this was the only intron sequence

isolated from any of the clones, and no alternatively-spliced variant was ever isolated.

The assembled full-length clone has an open reading frame of 8409 bp coding for

2803 amino acids (Figure 6). The predicted protein has a calculated molecular weight of

320 kDa. The initiating methionine selected is the first methionine in the open reading

frame, and a consensus intiation sequence (Kozak, 1991) is present at this point. The

protein contains several residues predicted to be subject to posttranslational modification,

including one consensus site for extracellular N-glycosylation (N2310), three possible sites

for phosphorylation by protein kinase A (S1001, S1051, S2509, the latter of which is present

in the predicted pore-forming region of the channel) and one putative site for tyrosine

phosphorylation (Y 32). All these sites await experimental evidence as to their relevance

for the native protein. However, unlike many vertebrate IP3Rs, there is no consensus

sequence for ATP binding, though there is a related NAD/FAD consensus binding

sequence.

The deduced amino acid sequence for the full-length clone is homologous to

other IP3Rs [Figure 7--NCBI sequence identification numbers in parentheses;

Drosophila: 51% (266387); human type 1: 49% (1362832)]; it shows equivalent

similarity to type 2 IP3Rs, but is less similar to type 3 IP3Rs, and is clearly only distantly

related to ryanodine receptors, with the greatest similarity seen in the channel regions.

Like other IP3Rs, the putative pore-forming region of the channel domain (between the

fifth and sixth membrane-spanning regions), is poorly conserved. The entire lobster IP3R

sequence seems to maintain the distribution of conserved and variable regions that has

been seen in the other IP3Rs. One portion of the sequence, however, stands out as being





























Fige 6. The nucleotide and deduced amino acid sequence of the lobster IP3R cDNA.
The coding region of 8409 bp encodes 2803 amino acids. The target sites of the
degenerate primers used in the initial isolation are indicated in gray with arrows. The six
predicted transmembrane regions (Ml-M6) are indicated by underlines. Consensus
motifs for one putative N-glycosylation site (arrowhead), 3 potential sites for protein
kinase A phosphorylation (stars) and a putative tyrosine phosphorylation site (filled
circle) are seen.














IEiTeacCTO YUUmeTmeanoranTWea a acIaonmarcmanaamraam~ahucn

1)1 II~VCU~LTCICTCI~~CTNIorIeas~ms

lin ATTamUIEnetarc~mCroman~mcr~mWarIcntr~cmLmmcasaa a anoamCen4Tcc

(4 a" ;dd odod7lva1 oa e oomrmmn .cie~. r












.2."1 4 Tda."r/n' 4, LC I=,"LL2C U7 e ided.. .7 J

2 a a c sa e naTw s as n m n r
111 C* or noTUIICevrosysvpIssTzTsIrsFIeUr IT*
xula n ran cunr0m mm n uaaxrar a ec m r m


lei CULTarmersarsovTvUTxCynoIoran-rseveUxRAKK





1Isa m(LacaTCCLTTesErcmmncaansummammammIuwan To

dr iwed ,i cm e J! '-41 A lodi. .

1 ranc A came Aac cm Amamma c~m ma~lT~n 7 ewo m









2~ manan axTM Tcucans Ts acancqu e sma ccar






2 TonDw swammmount ma~LI nrCrms aic nmrmman Tomm

*s .A IIOUSOF* aIrl ea 4id eeald.^ ."""d.les"o

19^11 7 L ".J.^ J..'.. ."."J..7.7? 7. "cl ". .^.7.117,17













re1 ~aramTUa T IICman 7 CPG mA maLTcTmaaam c

mT rlr a can a s rmaea as rmur c

Tco c an ar~rr~c rr~om AT canmrmanaM mc








29






















































"- M3
B1e LTCAmAL L Im r l IIuFr N VTc V ThDN 1 A T A AGTOOUCI





v1 -. m -. -. ... .. .. ,. .
I A I I T I I

T14* 1 TG TIGIaTn C aG T I I T IIa IIM I T


















I I V I g I I I I L T L ._Y V I r L f






-- M


Figure 6--continued





























Figure 7 The lobster IP3R protein is aligned with an IP3R from Drosophila (NCBI ID:
266387) and a type 1 IP3R from human (NCBI ID: 1362832). Shading indicates amino
acids conserved between the lobster protein and at least one of the other two proteins.
The six transmembrane regions (M1-M6) are indicated by underlining. A unique
hydrophilic region, rich in lysine residues, is seen at amino acids 1159-1186.

























Lobster ,.. I ...-1s600606,L00108v007I5L v06610w 00101601,Lr00S13fl00w,1s
Drosophila I II0-- l iaIIBVSS LBOOIVBLTAV S vclSaTL6OLV0DMTVVCtPZOAC1PL rflSC-LB 5 ISTBaX* r Qaxat..H
Human I KD -L nL

9i L1BL U0SS0I0S23ZNEIaL O5500T100000- I XI 85lt 00vVLPSLLI Si.lll~flfDl085I1015NI701110i0


1077 iL fL t AAhT lAI.L t la.-. I S LuI r aS-LZn. 61n 2.r 1flXh... ...* L 3..B.tat1 ..OU f ..5

2Si ...f...Ti 6IA ia i BL'iO I li 'iVLM a rit. dui fi 6 T ;



ill 1,.HTiLIIiVTiDa1:0I i1 ib- IIi. l i a ll A.*..rLAA I L 1 : 1 .U1.. .Ip 6D .
231 .rv-t6 i6 .f It l !I-ifk 6Lir. i6 t Cl lriir0i tf l f l -l..Li.. i6. .i6i.





158 Ll "fi 61.IaDb 'Saf P.6ftlF r: -.iL ni A: I D r *. ;i- t l i i i. Ml- ili
si7 a:I tLLdLP : 6 Q0L6 I.: 5 1600 : .6..fl6,.T .IrwL n .6 -6i6 .rLia :Ic i y6,ojyv61.6z fii l.,riBYs6.6 66U *. *.flhfN i



f I I IQ T.... I L.fl. 1 -ar 3i6&06*T,6 .9 b064.*50

50 *LI rtS ;50flDa 0106f 16t, 06016d6'50f0I 1.fla6t0 oIasfll qaL t ylltT l m OL G ; I.6fl50rLLS8




63a 1S. SL!IIfA 60i.i O'U.li6i i 6i e.V-li.f 6i 6l rIWi3 ISI I il-Yi i LJlIA E 'Sl

513 -LL* 1-0': m*T. 7LD6r60L .i 651 L-I itT.*L LN5a_ _A :B.- LI .I;a L .6S mlf n




1167ll I E ifl nlnLI Di &&Ar lWl l aIP. .:iDLiB 6 IP *.3 Sl" P I U
605 6aKaS5*650A66i 7506.506 5'I 6 *kflflU.J rIn. IT i i 6 IQMLTlSAiaI'A SKaPE







l64e6661 6l3Mu lr!1 1. l.6* ... Is D 6.B6 .6 66 n L T lZ*a L
71T4 aia6"aA1i.Oa i.ii-in.a. 6 hai 'lul6 ". : ALCA .66, Ii6 E*ifF O 6.f
















1167 _:Ta'5'i6Y6..IIP ii. a'6L03.i666 a.6.aaaOLLLO6*lDbV




11061610 75*66TF~aP'61L36*153011.aa6101a.070616 160.55Y~i P165610...*5 Dp77fl5
























( ~~1 -. 1 0 Rnv00L00l3Tl0V011501rR1 a sICV0 QL1519DVLV7ERAsr0M50116 1ll3MA32R1ML1 0S0PL0y0vBI0LLt cC7KrltlA



LIe_ IT .... IPLLOTIV I. .... I. .....LVB.S..R LDD .S-LTMILV LVT
1460 01307 T1020.0OI0C0aL 0DI !eBC2 VK2A0017N20580030 li3 0iISL3i2lV21L 5010f l11050.25i52I0

1523 01051CB7L7NLDD8IV5lCBETCKEl20vnLtL7ICIDTE03E3RVflOC05lTBI1a50BIB5I50- klsolOnsu.

1581 0G0551.LLG03P19flO2I1000UIf2L L011000C5 LS0LGOR2FV3NCZ1T11S3K0RS0AL X5L31 T8S0TALT
1482 Bl 2Vei5VT P7S BaTTL3RQPVVQ0LL0VRVyH Lw3LBSaQ SVSCIRBD sKRAZIAIPVDcDSOVtNLr;saV

1611 TR*85sKWSBRLT0RDAs SS00laGHM688 2 L0V DNSVV0v5010006l8VA103LB0 L 2 1I5fl70R2 ROBai3KC1l0SR25 I IIaC

1573 l-TA .RLSRA IRRDSVL.AASRD~ L ai RE llV ,. '-ZR ,DIII, ,l ,l Er RI








11t2 12 6621 ,* ; r. .. .. .. *. L .'.. .. i .F I .

11i6 L 4. MI ...I ..i3 -3 5: l 2..5-.r" ii5 3 5 '101 "3.- 3n333 332112 *.r *w5i 5 3A m








1321 .a05 OfC 3.; 1.3iT Oii B.ill3It; .lt. 33. LBL3l,:iAX B3 B. B'i .I lS. li..y2I


2160 r i'B ll... i2. 1 .. T i iL -.3 ; l L .. i .. .. .L eirl Iar 1: Ki L illn v T A rm f









208 53[U3 Ql2f E12 L, LL3330-;fII fI1D&r5i23EL2S0L. .*'C,. 3L5. .513T3f.
2115276 1Trg'rmoxg L.sll. : T i3TL.5I L. D5n. BLD t;2.8 N3 ,f3 5 '. L m F12 u5




























2209 3 1b.r- ,' 2&0...T,3r fT- Er( f.7.. l.' :LS0 L2 I .. 3- 5 .L 3i B. :LB0:1m:.3 oat5 3 l' 3 *L3.73 rT0 2 ri
200517 .-l T.L A AI. .. OA. ...... .....
2201 Q ..ol 5.-H. 2 IQ. A- 3 ....r3,



















2911 R232.4L 130813258 T-M I- PIINAs
2001 53330L155 2LL- ----------
11I IP*~L~PlllYUPP s-----------


Figure 7--continued








completely unrepresented in the other IP3Rs identified to date: amino acids 1159-1186, a
lysine-rich, hydrophilic stretch, is not present in any other IP3R (Figure 7). Searches of
GenBank with this amino acid sequence revealed no matches with known proteins which
might unveil a possible function for this portion of the protein.


Ribonuclease Protection Assay

To verify that the source of the IP3R cDNA was indeed olfactory organ RNA, a
3P-labeled riboprobe representing a portion of the cloned IP3R ribonuclease protection

assay was used to probe for the IP3R message in extracts of olfactory organ poly(A)+

RNA. A riboprobe translated from the original 203 bp product was incubated with

olfactory organ total RNA under high stringency conditions, producing a protected band

of the appropriate size (Figure 8). A protected band was also seen in an assay of total

RNA from brain. No protected bands of the appropriate size were seen when control

hybridizations were done with yeast RNA controls.


Discussion

The cDNA identified in this study shows much structural similarity to known

vertebrate and invertebrate IP3Rs. As with other IP3Rs, the greatest conservation is seen

at the amino end, the location of the IP3-binding domain, and the carboxyl end, the site of

the channel portion of the molecule. A greater degree of variability is seen in the central,

modulatory domain. Six hydrophobic domains correspond to the putative transmembrane

regions of other IP3Rs (Figure 7). The putative pore-forming region between the final

two transmembrane regions, M5 and M6 (Michikawa et al., 1994), shows almost no

sequence conservation: why a family of channels with a presumably similar ion

selectivity exhibit such divergence in the pore sequence is unknown. There are three

protein kinase A substrate consensus motifs, numerous protein kinase C and casein kinase

II motifs, as well as one extracellular site for N-glycosylation and a site for tyrosine





























Figure 8. A ribonuclease protection assay, probed with a 203 bp riboprobe transcribed
from a portion of the lobster IP3R. An appropriate sized protected band is seen in nose
poly(A)+ RNA (1.5 and 3 gg) and in brain total RNA (5 and 10 ig) (indicated by arrow),
but not in the yeast + RNase control. A strong, smaller sized band is seen both in the
experimental and the yeast control lanes. A yeast control with no RNase treatment shows
the undigested probe; residual undigested probe is seen in all experimental lanes running
at 350 bp.
















<



bases -
700
600-
500 -
400 -
300- ,


200 -





100-









phosphorylation; whether or not these sites are functional in the native protein remains to

be determined.The IP3R encoded by this cDNA is structurally consistent with those

characterized by Fadool and Ache (1992) and Hatt and Ache (1994). Both groups saw

channels with similar physiological and pharmacological properties to those of ER IP3Rs

(e.g. Bezprozvanny and Erhlich, 1994), including similar conductances and a sensitivity

to heparin. However, the lobster olfactory IP3Rs are insensitive to ATP (Fadool and

Ache, 1992), which is known to modulate vertebrate IP3Rs by increasing the channel

open probability (Bezprozvanny and Erhlich, 1993). The cloned lobster IP3R described

here has no consensus motif for ATP-binding, though it does share an NAD/FAD-binding

site (Sternberg and Taylor, 1984; Zheng et al., 1993) with other IP3Rs (the Drosophila

IP3R also lacks an apparent ATP-binding site, but its ATP sensitivity is unknown). This
insensitivity to ATP may be typical of calcium-release channels in lobsters, or arthropods

in general, rather than be representative of plasma membrane IP3Rs, as a ryanodine

receptor characterized in American lobster is also insensitive to ATP (Seok et al, 1992).

The ribonuclease protection assay shows that the IP3R message is expressed in

both olfactory organ and brain (Figure 9), though at much higher levels in the latter. As

the probe was directed against a somewhat conserved region of the coding sequence, it is

possible that these tissues are expressing similar, but different, messages. Proteins need

not be olfactory-specific to be important for olfactory transduction: expression in neural

tissue outside the nose is seen for several olfactory transduction-related genes, including

Gof (Drinnan et al., 1991) and the cAMP-gated channel (Kingston et al., 1996).
One region of the lobster cDNA does represent a protein sequence unique to IP3Rs
(Figure 7). Although the function of this peptide is unknown, it does resemble some

nuclear localization signals (Dingwall and Laskey, 1991); IP3Rs have been localized to

nuclear membranes (e.g., Sullivan et al., 1995) This region also contains a protein kinase C

consensus phosphorylation site (KI 160). Heterologous expression of this cDNA will not

only allow the characterization of this IP3R, but also the functional analysis of this unique









region. It is also critical to determine whether the spiny lobster expresses other IP3Rs, and

if so, whether these other IP3Rs share this same unusual sequence.

Though this IP3R shares some structural features consistent with the functional

properties of those characterized by Fadool and Ache (1992) and Hatt and Ache (1994), it

remains unproven that this cDNA encodes one of those proteins. There are no known

structural motifs indicating that a particular protein is involved in olfactory transduction.

The promoter region of the gene for this IP3R is uncharacterized, so whether it contains an

olfactory system-related transcription factor-binding site as is seen in vertebrates with Olf-1

(Wang and Reed, 1993; Wang et al., 1993) is unknown. While integral membrane proteins

contain signal sequences for insertion into membranes, none that differentiate between

endoplasmic reticulum and the plasma membrane are known. However, there is good

evidence that plasma membrane IP3Rs are similar in structure (e.g., Cunningham et al.,

1993), if not identical (Khan et al., 1996) to those localized to the ER. Therefore, the

similarity of the lobster IP3R to other IP3Rs cannot be seen as evidence for localization to

either the endoplasmic reticulum or plasma membrane. Antibodies against the encoded

protein must now be used to localize it to cellular compartments within the ORNs; in

addition, the channel must be heterologously expressed so that its functional properties can

be compared with those of the native channels.














CHAPTER 3
MOLECULAR CHARACTERIZATION OF AN OLFACTORY ORGAN GQ PROTEIN


Introduction

The transduction of many extracellular stimuli, such as neurotransmitters or light,

can be mediated by a signaling pathway that links receptors and downstream effectors

(e.g., ion channels or enzymes). Heterotrimeric GTP-binding proteins (G proteins) often

serve to couple these two signaling components (Neer, 1995; Hamm and Gilchrist, 1996).

Composed of a, P and y subunits, these G proteins bind to the activated receptor as well

as affect the downstream enzyme or channel, with many of the targeted enzymes

synthesizing second messengers (e.g. IP3 or cyclic nucleotides). The a subunits are the

best characterized of the subunits; they have been classified into four categories based on

sequence homologies: Gs, Gi, Gq and G12 (each family contains numerous members;

Neer, 1995). Although the a subunit was previously thought to be exclusively

responsible for the signaling capabilities of the G protein trimer, it is now established that

the py complex can itself activate downstream effectors in many systems (Clapham and

Neer, 1993; Hamm and Gilchrist, 1996).

No G protein has yet been functionally implicated in olfactory transduction. Well

before the discovery of a family of putative olfactory receptors (Buck and Axel, 1991)--

all members of a superfamily of G protein-coupled receptors that includes rhodopsin--the

mediation of at least some aspects of olfactory transduction by G proteins was established

(Pace et al, 1985; Sklar et al., 1986; Bruch and Kalinowski, 1987; Bruch, 1990). A

vertebrate G protein a-subunit, Gof (a member of the Gs family), has been cloned and

localized to the cilia of the olfactory receptor neurons (ORNs; Jones and Reed, 1989).









Golf is thought to activate a type III adenylyl cyclase that sythesizes the second messenger

adenosine 3',5'-cyclic monophosphate (cAMP); cAMP can then activate a cyclic

nucleotide-gated (CNG) channel in the ORN cilia plasma membrane. Other G protein a-

subunits are present in the vertebrate olfactory epithelium (Jones et al., 1988; Jones and

Reed, 1989; Menco et al., 1992; Abogadie et al., 1995a; Dellacorte et al., 1996); some of

them are unlikely to couple to adenylyl cyclase. In both vertebrates and invertebrates IP3

(in addition to cAMP) serves as an olfactory second messenger (Restrepo et al., 1990;

Breer et al., 1990; Boekhoffet al., 1990; Bruch and Teeter, 1990; Dionne, 1992; Ivanova

and Caprio, 1992; Miyamoto et al., 1992; Michel and Ache, 1992; Fadool and Ache,

1992; Lucero et al., 1992; Ronnett et at, 1993; Bacigalupo etal., 1993; Lischka et al.,

1995; Boekhoffet al., 1994; Lucero and Piper, 1994). Therefore, more than one G protein

a-subunit subtype might be involved in olfactory transduction. In the spiny lobster

ORNs, odor-evoked elevations of cAMP and IP3 mediate opposing conductances, with

cAMP triggering the inhibitory outward current, and IP3 the excitatory inward current

(Fadool and Ache, 1992; Michel and Ache, 1994; Boekhoffet al., 1994). Recently,

Fadool and colleagues (1995) used electrophysiological and biochemical techniques to

demonstrate that different G proteins mediate these two conductances. Although the G

protein involved in the inhibitory pathway remains unknown, two different a-subunits

were implicated in excitatory odor transduction: a Ga, from the Gi family and a Gaq or

Ga1l from the Gq family.

The precise nature of this Gq-like a-subunit must be characterized. In this

chapter, I present evidence for the presence of a Gq-like protein in the lobster olfactory

organ; this protein is consistent in structure and localization with the Gq-like a-subunit

previously implicated in the excitatory odor response in the spiny lobster, Panulirus

argus.

Portions of this work have previously appeared in abstract form (Munger et al.,

1997).












Methods

RNA Extraction Olfactory organs (100 antennules per isolation) were harvested
into a dry ice/ethanol bath, transported from the Florida Keys to the Whitney Lab on dry

ice, and stored at -800C until used. The antennules were homogenized in liquid nitrogen
by mortar and pestle, then the powder was homogenized by polytron in a GTC/P-
mercaptoethanol solution (sarkosyl added to 2% after homogenization). After removing
cuticle by centrifugation, the homogenate was layered onto a 5.7M CsCI cushion for

ultracentrifugation (24 hours, 200C, 30,000 rpm in a Beckman SW-41 rotor). The RNA
pellet was resuspended in 10 mM Tris-HCI (pH 8.0), 1 mM EDTA-SDS,

spectrophotometrically quantified and stored in ethanol with 0.3 M sodium acetate, pH
5.5, at-200C.

RT-PCR: RT-PCR experiments were done as described in Chapter 2 Methods
except as noted. Briefly, degenerate oligonucleotide primers were designed to a portion

of the Switch II region common to Ga's [amino acids KWIHCFE, sense primer AA(AG)
TGG AT(ATC) CA(CT) TG(TC) TT(TC) GA] and to the common carboxyl tail of Gaq
and GaoI [amino acids KEYNLV, antisense primer (ACTG)AC IA(AG) (AG)TT
(AG)TA (TC)TC (TC)TT, where I=inosine]. Total RNA from nose (10pg) was reverse
transcribed, as described, using the antisense primer. Each primer (100 pmol), along

with 1/20 of the reverse transcription reaction, was used in a touchdown PCR. The PCR
cycling profile was as follows: [940C, 5 min; 50*C, 2min; 720C, 1.5 min] x 1 cycle;
[94C, 30 sec; 49*C (-1 C/cycle), 30 sec; 720C, 1.5 min] x 9 cycles; [940C, 30 sec; 400C,
30 sec; 720C, 1.5 min] x 30 cycles. The PCR product was diluted 1:1000 and served as
template for a second, identical PCR. The resulting 435 bp product was gel purified,
ligated into the plasmid pGem-T, and transformed into JM109 cells for subcloning.









Control RNA samples, which were treated as above except for receiving no reverse

transcriptase, showed no product. After colonies were screened by PCR for inserts of

appropriate size, individual clones were selected for sequencing by standard chain

termination methods. One clone (RTG-4) was fully sequenced.

3'-RACE (Rapid Amplification ofcDNA Ends): The 3'-RACE technique was

performed as described in Chapter 2 Methods, except as noted. After reverse transcribing

10 utg of olfactory organ total RNA with an oligo-dT,7 oligonucleotide, the resulting

cDNA served as template for the first round of PCR amplification; one primer was

directed against a portion of the oligo-dT primer, the second was specific to clone RTG-4.

The PCR product then served as template for a second round of PCR amplification using

the a nested oligo-dT primer and a nested RTG-specific primer. The resulting product of

250 bp was purified, subcloned and sequenced as described above. Control RNA

samples, which were treated as above except that no reverse transcriptase was added,

showed no product.

5'-RACE (Rapid Amplification of cDNA Ends): 5'-RACE was performed as

described, except as noted. Total RNA from nose (10 jg) was reverse transcribed as

above using an RTG-4-specific antisense primer, and a poly(C)+ tail was added to the 3'-

end of the antisense single strand cDNA with terminal transferase. The resulting cDNA

served as template for the first round of PCR amplification; a nested antisense RTG-4-

specific primer and an anchor primer to the poly(C)+ tail were used. These PCR products

then served as template for a second round of PCR amplification where the same anchor

primer and a second nested RTG-4-specific primer were. The resulting products were

purified, subcloned and sequenced as described above. Control RNA samples, which

were treated as above except for receiving no reverse transcriptase or no terminal

transferase, showed no product. PCR cycling times were as follows: [94C, 5 min;

490C, 2 min; 720C, 3 min] x 1 cycle; [94C, 30 sec; 490C, 30 sec; 720C, 2 min] x 30









cycles. Sequencing, translation, assembly and analysis was done as above. A single

clone, 5RHl, was fully sequenced.

To control for errors that may have resulted from the actions of the DNA

polymerases or the reverse transcriptase, two independent clones, which spanned the

entire contig from the 5'- to the 3'-untranslated regions, were amplified in duplicate RT-

PCR reactions, sequenced, and a consensus sequence translated for analysis.

Northern Hybridization: Total RNA from nose (150 tg) was denatured with 15%

glyoxal:DMSO (1:1) then run overnight at 20 V on a 1.1% agarose gel in sodium

phosphate buffer (pH 7.0). The gel was blotted to MagnaPlus nylon (MSI) by capillary

action in 20x SSC. The blotted RNA was UV-crosslinked to the membrane. The

membrane was prehybridized for 1 hour at 600C in: 50% formamide, 5x SSPE, 5x

Denhardt's reagent, 0.5% SDS and 100 gig/ml herring sperm DNA. The membrane was

then hybridized to a 32P-labeled riboprobe (transcribed from clone RTG-4) overnight in

fresh hybridization solution. The next day, the membrane was washed 3 x 15 min in lx

SSPE/0.5% SDS and IX 15 min in 0.1x SSPE/0.5% SDS, both at 600C. The membrane

was exposed to X-ray film for 4 days at -800C with intensifying screens.


Results


cDNA cloning

Using RT-PCR and degenerate oligonucleotide primers, I was able to amplify a

435 bp cDNA product; this product was subcloned, sequenced, and conceptually

translated. A comparison of the deduced amino acid sequence with sequences in the

GenBank database revealed that this product was homologous to members of the Gq

family of G proteins. This product was extended to the 5'-UTR by 5'-RACE, and to the

3'-UTR by 3'-RACE. To control for possible sequence errors induced by the reverse









transcriptase or DNA polymerases, two additional independent full length clones were
isolated by RT-PCR (data not shown), and the consensus sequence across all three clones

was taken.

The assembled full-length clone has an open reading frame of 1059 bp coding for
353 amino acids (Figure 9). The predicted protein has a calculated molecular weight of

41.5 kDa. The deduced amino acid sequence for the full-length clone shows a high

degree of identity to other known Gaq proteins [Figure 10--NCBI sequence

identifications in parentheses; Drosophila: 84% (944923); Limulus: (Munger et al., in

press; mouse: 82% (193502)], and is less similar to other G types [e.g. bovine Gail: 47%

(121019)]. The position of the initiating methionine (Figure 9) was selected for several

reasons: it is the first methionine in the open reading frame; there is a well conserved

consensus initiation sequence (Kozak, 1991); initiating transcription at this position

results in a protein of identical length to most Gq proteins (Figure 10).

Sequence analysis of the lobster Gq protein shows it to contain several motifs

characteristic of other Gq proteins (Figure 9; Strathmann and Simon, 1990; Simon et al,

1991; Wedegaertner et al., 1995), including putative sites for palmidylation, two N-

terminal cysteines (CC4); an absence of N-terminal myristylation sites (though putative

myristylation sites do exist at several sites in the middle of the protein); a putative

cholera toxin ADP ribosylation site (R177), but no cysteine at the C-terminal subject to

pertussis toxin ADP ribosylation; and the G40TGES "GAG-box" sequence which is

present in the GTP-binding domain of other Gq proteins. The sequences of the Switch I,

II and III regions, all involved in GTP-dependent conformational changes of the a-
subunit (Lambright et al., 1994), are all highly conserved.




























figure 9. The nucleotide and deduced amino acid sequence of the cloned lobster Gq
cDNA. The 1059 bp coding region encodes a 353 amino acid protein. Gray shading and
arrows indicate the sequences to which the degenerate PCR primers were designed. Also
indicated are consensus motifs for cholera toxin-dependent ADP ribosylation (filled
circle) and palmidylation (arrowheads), as well as the "GAG" box (box), all characteristic
of Gq proteins. Amino acids in common with the Geo decapeptide (LDRIGAADYQ)
that served as antigen for one antibody that blocked the excitatory odor response (Fadool
et at, 1995) are indicated with stars.




















1 CAAGACCCCGGCTGTTCTCCCGAGCAGATCCTTCCCCGGCAACGCTGCTCACTTTACGGAATTATTCGGCCAAAAGCCCT
81 TTAGTGACAGCACGAAGCCTGTGAAGTGACACTAACTAAGTAAGAGAGGCAACAGAGGCAGCAGTTAATCCTGTATATAA
161 GGGAGCGTCAACTGGGAAGCAGAAATCAGCGAGCGGGGAGGCGCCACACTCAGTATACTTGGCTGCACGAAGCAAAAACCCCACCC
241 CATTTGGCTTAGATTTGACCTGTGTGAAGGAAATAACCAAAAATTGAGAAAATTCCCCGATTACGCGCCGCTTTCCCTTC
321 GCGGAGAAAGGCGGCGAAAGAGGAAGAAGATAATTTAGTAAGGAGATTGTGGTGAAAGTTGTCAAAATTAACGC
V
1 M A C C L S E E A K EQ K RI N Q E
401 GATAATATTAGGAT A ATCAGCAAACATGGCGTGCTGCCTAAGCGAAGAAGCCAAGGAACAGAAGAGGATAAACCAAGAGAT

20 E R Q L R K D K R D A R R E L K L L L L IG T aG E S
GGTGES
481 AGAACGACAATTACGGAAGGATAAGCGAGATGCCAGGAGAGAACTTAAACTACTGTTATTGGGCACTGGAGAATCAGGAA

46K S T F I K Q M R I I H G A G Y S D E D K R G F I K L
561 AGTCAACTTTTATTAAGCAGATGCGTATTATCCATGGTGCTGGTTACAGCGATGAAGACAAGCGAGGGTTTATCAACTG

73 V F Q N I F M A M Q S M I R A M D L L Q I S Y G D S A
641 GTCTTCCAGAATATTTTCATGGCTATGCAGTCTATGATAAGAGCCATGG G GGGATCTTCTCCAGATATCATATGAGATTCAGC

100 N I E H A D L V R G V D Y E S V T T F E E P Y V T A
721 TAATATTGAACATGCAGATCTAGTACGAGGAGTAGACTATGAATCAGTAACTACATTTGAGGAGCCATATGTGACTGCCA

126M K S L W Q D T G I Q H C Y D R R R E Y Q L T D S A K
801 TGAAATCCTTATGGCAAGATACAGGCATCCAACACTGCTACGACCGGCGTAGAGAGTATCAGCTCACAGATTCTGCAAAA
**** ** 0
153 Y Y L T D L D R I A A T D Y V S T L Q D I L R V R A P
881 TACTATTTAACAGATTTAGACCGCATAGCTGCCACGGACTATGTTTCCACACTACAAGACATTCTAAGAGTGGAGCACC

180 T T G I I E Y P F D L E E I R F R M V D V G G Q R S
961 CACAACAGGCATTATAGAGTATCCCTTTGACCTAGAAGAAATCAGATTTAGATGGTAGATTGGGTGGTCAGCGATCTG

206 E R R i. I 4 C F 'I V T S I I F L V A L S E Y D Q I
1041 AGCCGAAAGTGGATCCACGC GAGAGACTATCTCATCTTCCTGGTTGCTCTTTCAGAATATGATCAAATT

233 L F E S D N E N R M E E S K A L F K T I I T Y P W F Q
1121 CTGTTTGAATCTGACAATGAGAATCGGA'GAGGAATCTAAGGCCCTCTTCAAGACGATCATCACATACCCATGGTTTCA

260 H S S V I L F L N K K D L L E E K I M Y S H L V D Y
1201 GCACTCCTCAGTTATCCTTTTCCTTAATAAGAAGGATCTGTTAGAAAGAAGATCATGTACTCACATCTTGTGGACTATT

286F P E Y D G P R K D A I A A R E F I L R M F V E L N P
1281 TCCCAGAGTATGATGGCCAAGGAAGGATGCAATTGCAGCTCGGGAGTTCATCCTACGGATGTTTGTAGAATTAAATCCC

313 D P E K I I Y S H F T C A T D T E N I R F V F A A V K
1361 GACCCTGAGAAGATTATCTATTCCCATTTCACATGTGCGACAGACACTGAGAATATAAGGTTCGTTTCGCTGCTGTCAA

340 D T I L Q L N L i I N L ''
1441 AGACACAATTCTGCAGCTAAATCTAAAGGAATACAACTTGGTGTAATGTAGAGTTATGCCCAACTGGCTGAGAGTGAACA

1521 TTAGATGAAGTGACAGCATGTATCCTTCTCAGTGTAGGGGCTGTGACCTAAGGACATTTCTTCATCACCCCTTACATGAC
1601 ACCATACCAATTTTGTAAACAAGGCAGTCATATTTTGCATCTACAAACCCATATTCAGTGTCCCAAAGAAATAAAGGTTC
1681 TATGTTGTT-poly(A)+






























Fige 10. Alignment of the lobster Gq protein with Gq proteins (NCBI ID in
parentheses) from Drosophila (dGqa-3: 944923), Limulus (Munger et al., in press), and
mouse (193502). Shading indicates amino acids conserved between the lobster protein
and at least one of the other three proteins.


























Lobster ---_
Sobster 1 M-- ACCL- SEAKRQKRINMQISRQLEKDRD&ARRLKLLLLLQTOBOKSTrXKQI
Dros. dGa3--- 1i ..... MECCLfrFAKZKRIElQEIEQLRRDRDARRBLRKLLLGLTGBGSESTYZIQMR
Limulus -. I-* 1 MA CCLBEE GRZQS BINQI IRQLRDXRDAIMiLKLLLLGTGGaSTITrQMRIo
.I .1 iLE IlMACCLSEWKLIAPlINDUIRUWJRFDKRDARNWLKLLLLGTGiSGEBTFIZQUI
Mouse

55 LIBOAGOYSDDKRGPIRLVFQNIVzMAugBIRAMULLQZBYaDSAlIZEADLVRUVDxZS
55 ITHGSGoSDZDKRGO IKLvFQIfrMAMUBMlAMDNLF.B!OQGEs!SELADLVMSIDfNT
55 ZIHG GTBDDDS YI ILVYQMI IKAQSMNFMUMEMLKI TKRDPNMIXNAEIVLSVUBT
61 irEGOGTBDKDR OPTiVVYQEHITAMQAMItRADTLEI F TRKYEBll HAQLVWSVDVME


115 vrTrpEpiVTL &MRBLW DrargIBCYDnRRTQLTTDBAIKTLTDLDJIAATDTVSTLODIL
115 VTTFDPLNAiFTLMDDAGaQBCTDRSATQLbTDBAXrTLDLDXVAQPAyLPTBOL
115 VrTFDrPIVTAIRISLWVDF IECTYDRRRITQLTDlARTILNDIDRZA.PNTLPTWQOI.




175 RV
175 RRVEPTTGINXTPFDLEEIRFRMVDYGGORSBZRRWEBCFVMiVTSIIPLVALLBMFDIW
175 RVBVPTTGIZIETVPFIL RSI flHVDVGOQOSfRizrCTaVTZSIZrViALSOIfP
181 RVBVPTTGQZIYPFDLQJV IFRVDVUaQRsRRXRWZBcrPmWVTBMrLV&LUSv ROVLV


235 ISDHERRMZSBRALF TIZTTZWrFPQ BVIZLFEXDLLZXZIYMTELVDTriVITfplP
235 SDUIRfIRnl SALFVTIITZTPWFNBSBVZLFV.LRDLLZEKIMTSBINVDlPPUl
235 SDIMIRRMRUSBALrSTIITTPWlQNBVrILFLUXlDLLUMXIMFSELVrr7EVF3 E
241 EHD:HZnMIXBF.ALrTIZTTPWFTQIBBVrLFrENZIDLLERMINMTBLVDTPTADQR


295 DAIAARErILRMFVEIjHPDF'BKEZTfBHTC&TDT3WrW'AVflAIVKDflQLUi V
295 DAZTAREFELRMvDADZEFCAWDVDW
295 DA'ITGRurKLUFVPDL1PD 3zE rT:ECIAWDTXXrTXBfX.AVIDlEQ
301 DAQAAMiriLFIFVDLMPDSDKZIIIIBTCATDTZIEflRR LAVKDMXLQL lni










Northern Hybridization

A Northern blot of lateral antennule total RNA was probed with a riboprobe
transcribed from clone RTG-4 (nucleotides 1049-1483 of the complete clone) at high

stringency. A single band of 4.6 kb is seen (Figure 11).


Discussion

The cDNA identified in this study shows the greatest similarity to known
vertebrate and invertebrate Gq proteins, particularly the Ga, and Gall types (Figure 9).

The Gq family of a-subunits is highly conserved in primary structure. This high degree

of identity allows little speculation about the functional consequences of structural

motifs. While a few basic regions mediating some functions of the G protein a-subunit

have been identified (Neer, 1994), such as interaction with the py complex at the amino-

end of the a-subunit, or interaction with the receptor at the carboxyl end, these regions

are not well defined, and it is difficult to pair a particular effector or receptor to an a-
subunit, simply by examining primary structure. Therefore, the isolated cDNA might, or

might not, encode an "olfactory" or "sensory" Gq, but until more rigid structure-function

relationships are established by mutational analyses and heterologous expression, the role

of the protein remains obscure.

Localization of the message to the olfactory organ (Figure 11) is consistent with
this cDNA encoding the native protein characterized by Fadool et al. (1995): any

transduction-related protein must be localized to the olfactory organ. Northern blot

analysis shows that the Gq message expressed in the olfactory organ is very large
compared to the coding sequence. This indicates large 5'- and 3'-UTRs on the mRNA

which are over three times the length of the coding region. The significance of this large
noncoding region is unknown, but is not unheard of for this family of proteins (e.g.






























Figure 1.A Northern blot of nose total RNA (150 Ipg) probed with a 32P-labeled
riboprobe transcribed from a portion of the lobster Gq protein. A single 4.6 kb band
(arrow) is seen after a 96 hour exposure.























kb

9.5)-
7.5-


4.4-



2.43


1.4









Wilkie et al., 1991). Other tissues were not probed for the expression of this message.

Although the question of tissue specificity is an interesting one, it has no bearing on the

role of any protein in olfactory transduction. Indeed, each of the principal components of

the vertebrate cAMP-mediated olfactory transduction pathway are seen in non-olfactory

regions of the nervous system. Nevertheless, the transcript must be localized to ORNs if

a link between this message and the native protein is to be established definitively.

This isolated Gq was compared with the one previously implicated in excitatory

odor transduction in the spiny lobster. In their study, Fadool and colleagues (1995) found

that an antibody against a common sequence of Gatq/, recognized a 45 kDa protein in the

dendrites of lobster ORNs. This same antibody, when perfused into cultured lobster

ORNs, was able to block the inward odor-evoked current, though it had no effect on the

outward odor-evoked current. Furthermore, both inward and outward currents were

insensitive to the presentation of either pertussis or cholera toxins. Proteins of the Gq

family are not sensitive to either pertussis or cholera toxin (Strathmann and Simon,

1990). Together, these data clearly implicated a Gq-like protein in spiny lobster

excitatory odor transduction. But although this protein shares immunological and

pharmacological properties with known Gq proteins, its membership in the Gq family

remained in question. The cDNA isolated from olfactory organ is consistent in primary

structure with the Gq-like protein described by Fadool et al. (1995). The C-terminal

amino acids that served as the epitope for the Gcaq/ antibody used in that study are

precisely conserved in the protein encoded by the cDNA isolated here; this epitope is

conserved in most Gaq/,, proteins, but is noticeably different in two Gq proteins from

another arthropod, Drosophila (Lee et al., 1990). The computed molecular weight, which

is consistent with other Gq proteins, is just slightly smaller than the 45 kDa protein seen

by Fadool and colleagues (1995) on Western blots; this discrepancy may be due to lipid

modifications of the native protein (Spiegel et al., 1991) or to anomalous migration of the

protein in SDS-PAGE. The sequence also reveals a lack of the C-terminal cysteine that









serves as the site of pertussis toxin ribosylation (Simon et al., 1991). These features

demonstrate that a Gq protein that could be the one characterized functionally by Fadool

and colleagues (1995) is expressed in the nose of the spiny lobster. However, of the

several other G protein antibodies screened in that study, one raised against a peptide

from a mammalian Ga, could also block the inward odor-evoked current, though this

Gao antibody did not recognize any proteins on Western blots of ORN dendritic

membrane. Members of the Gi family are pertussis toxin-sensitive (Simon et al., 1991),

further complicating interpretation of the physiological experiment. Note that the epitope

of the Gao antibody, the antigenic peptide LDRIGAADYQ (Goldsmith et a., 1988), is

somewhat conserved in the Gq sequence isolated here (Figure 9), suggesting that

crossreactivity of the Gao antibody with the native Gq protein led to the equivocal results

seen by Fadool and colleagues (1995). However, no attempt was made to isolate a Gao

cDNA from this tissue, so the possibility that the olfactory organ expresses both types of

a-subunit cannot be excluded. To find multiple G proteins involved in the same

signalling pathway would be unprecedented in olfaction, but this has been seen in other

systems. Some receptors can be coupled to multiple effectors via different G proteins

[e.g. human thyrotropin receptors activate both Gas and Gaq/i in intact cells (Allgeier et

al., 1994)]. As each ORN was tested with only one of the antibodies, the prospect

remains that individual ORNs could express either or both of the a-subunits. The finding

by Fadool et al. (1995) that the inward and outward currents are mediated by different G

proteins is consistent with previous studies that implicated separate second messenger

cascades in excitatory and inhibitory odor transduction in this animal (Fadool and Ache,

1992; Michel and Ache, 1994; Boekhoff et al., 1994). If more than two G proteins were

to be implicated in one of these pathways, it would imply a complexity of signaling

pathways that is not yet understood.

Gq proteins are seen in ORNs of both vertebrates and invertebrates (Abogadie et

al., 1995a; Talluri et al., 1995; Dellacorte et al., 1996), including one cloned from the






53


olfactory organ of the American lobster (Xu et al., 1997). Gq-like immunoreactivity has

also been observed in neurons of the vomeronasal organ but was deemed too faint to be

of significance for sensory transduction in these cells (Berghard and Buck, 1996). While

evidence for a role of the IP3 pathway in vertebrate olfactory transduction is growing, no

role for a Gq has been identified. In fact, Boekhoffand colleagues (1990) have

implicated a pertussis toxin-sensitive G protein in IP3-mediated olfactory transduction. It

is possible that in vertebrate ORNs, the IP3 pathway is coupled to a Ga, or to some

member of the Gq family not recognized by antibodies against Gaq or Galn (e.g. Gal4,

Ga.15 or Ga16).














CHAPTER 4
SUMMARY

Inositol 1,4,5-trisphosphate (IP3) has been implicated as a second messenger

involved in olfactory transduction for a variety of species (review: Breer and Boekhoff,

1992; Ache and Zhainazarov, 1995), though its precise role remains controversial,

especially in vertebrates. Several laboratories report that they have failed to identify IP3-

gated conductances in ORNs of amphibians (e.g. Firestein et al., 1991; Nakamura et al.,

1994; Kleene et a., 1994). The work of Nakamura and colleagues (1996) may imply that

IP3- and cyclic nucleotide-gated channels (CNGs) are in different cellular compartments,

with only the CNG residing in the membrane of ORN cilia. Most recently, gene

knockout experiments with the mouse olfactory CNG show that the absence of this

channel causes total anosmia in neonates (Brunet et al., 1996). These results contradict

those of Restrepo et al. (1990), Miyamoto et al. (1992) and Lischka et al. (1995) who

have demonstrated the presence of IP3-gated conductances in the ORNs of rats and

catfish. As has been described extensively in the previous chapters, there is also

biochemical evidence for odor-stimulated generation of IP3 in ORNs, as well as emerging

immunological and molecular evidence placing components of an IP3 signaling pathway

in dendrites of these cells. These conflicting data leave the precise role of P3 in

vertebrate olfactory transduction somewhat ambiguous: IP3 has been proposed by some

to be either a modulatory factor or a necessary cofactor for the better characterized

transduction pathway mediated by adenosine 3',5'-cyclic monophosphate (cAMP); others

believe it to have a role equivalent, but not identical, to cAMP.

A key to understanding the functional intricacies of the cAMP pathway was the

molecular isolation and characterization of components of this signaling cascade in









olfactory receptor neurons. This was done, not by random chance, but by taking

advantage of perceived similarities of the olfactory cAMP transduction cascade to the

cGMP signaling pathway in vertebrate photoreceptors. Homologous (e.g. the olfactory

CNG) and analogous (e.g. Gojf) proteins were identified by narrowing the search to

molecules like those seen to be involved in the much better characterized photoresponse.

In this dissertation I have taken a similar tack, using the better characterized IP3-mediated

olfactory transduction pathway in ORNs of the spiny lobster as a source of information

about the functioning of IP3 in olfactory transduction in general.

In the spiny lobster, Panulirus argus, electrophysiological studies have implicated
an IP3-gated channel, the IP3 receptor (IP3R), as the target of IP3 generated upon

excitatory odor-stimulation. A Gq-type GTP-binding protein a-subunit (Gq protein) has

also been implicated in the excitatory odor response, serving to link the activated odor

receptor with the enzyme that generates IP3 (Figure 12). This dissertation describes the

molecular cloning of cDNAs for two components of an IP3 signaling cascade from the

olfactory organ (nose) of the spiny lobster: an IP3 receptor (Chapter 2) and a Gq protein

(Chapter 3). These two proteins, both of which have been physiologically implicated in

the excitatory odor response in lobsters, share many structural characteristics with those

isolated from other species and tissues. The IP3 receptor cDNA encodes a protein that is

approximately 50% identical to many of those isolated from Drosophila and several

vertebrates. The Gq protein shows an even greater similarity to other Gq proteins (70-

80%). The messenger RNAs for these two molecules are both expressed in the olfactory

organ, making them candidates for roles in olfactory transduction. The isolation of these
two cDNAs is a critical step in our understanding of both the role of IP3 in olfactory
signaling and the complexity of odor transduction in all animals.

Much work remains to be done with both of these molecules to establish that each
plays a role in olfactory transduction, rather than elsewhere. Both proteins are quite

similar to ones seen in a variety of neural and nonneural cells, so some form of cellular































Figure 12. The proposed lobster excitatory odor transduction pathway, with a Gq protein
coupling the odor receptor to a phospholipase C, and IP3 directly gating a plasma
membrane channel.






57














EXCITATORY
PATHWAY


0Na
Na+
Ca++









localization, such as in situ hybridization, is necessary to demonstrate that these

particular genes are expressed in ORNs (while ORNs are the principal cell type in the

olfactory epithelium, other neuronal and nonneuronal cell types are present). The Gq

protein has already been shown to be present in the ORN dendrites (Fadool et al., 1995).

Two polyclonal antibodies directed against a conserved and a nonconserved region of the

IP3R have been generated, and are currently being characterized. The presence of
antigen for both of these antibodies in the ORN dendrites would provide a strong link

between the cloned channel and those first characterized by Fadool and Ache (1992).

Heterologous expression of both these proteins would permit comparisons to those native

proteins previously characterized (Fadool and Ache, 1992; Hatt and Ache, 1994; Fadool

et al., 1995). Such experiments would also permit mutational and chimeric studies of

these proteins, which might provide insight into numerous structural and functional

questions, the most obvious of which is the role for the novel hydrophilic sequence in the

modulatory domain of the lobster IP3R.

Of course, while characterization of these molecules provides great insight into

the functional properties of the molecules themselves, the advantage of a comparative

approach is the clues it can provide about other systems. If these two molecules are

shown to be involved in olfactory transduction in the spiny lobster, the next step would

be an attempt to clone and localize equivalent molecules in vertebrate ORNs. Towards

this end, a partial cDNA encoding the carboxyl end of a novel IP3R has been cloned from

Xenopus olfactory epithelium (Munger, Rust, Ache and Greenberg, unpublished data).

Isolation of similar molecules does not guarantee similar roles for the IP3 pathway in

lobsters and vertebrates, but it will simplify the testing of various hypotheses.

While I have concentrated on the IP3 pathway in ORNs as it relates to primary

olfactory transduction (coupling an odor-bound receptor to a change in membrane

conductance), activation of this pathway can have additional consequences for the cell

and its response to odors. For example, Ca2+ entering the cell through the IP3R, along









with diacylglycerol cogenerated with IP3 by activated phospholipase C, could activate

protein kinase C, which could, in turn, phosphorylate numerous cellular proteins. The

mechanisms of olfactory transduction already appear to be subject to complex regulation.

Gaseous messengers such as nitric oxide (NO) and carbon monoxide (CO) and the cyclic

nucleotide guanosine 3',5'-cyclic monophosphate (cGMP) appear to have modulatory

effects on the CNG channel (Breer et al., 1992; Lischka and Schild, 1993; Leinders-

Zufall et al., 1995; Zufall, 1996; Broillet and Firestein, 1996). As in most systems, Ca2
seems to have numerous biochemical and physiological effects that may modify the odor

response (e.g. Anholt and Rivers, 1990), including playing a large role in the

amplification of the initial odor-induced current via the direct gating of a chloride channel

(Kleene, 1993; Lowe and Gold, 1993; Kurahashi and Yau, 1994). There is even evidence

for a Na -gated channel playing a similar amplification role in the lobster (Zhainazarov

and Ache, 1995; Zhainazarov et al, 1997). While the existence of these additional

transduction mechanisms does not diminish the need to understand the cAMP and IP3-

mediated systems, none of these mechanisms operates in isolation from the others.

However, to understand the interactions between these multiple pathways, the

components of each pathway must be understood, for each component is a possible site of

interaction with another.














LIST OF REFERENCES


Abogadie, F. C., Bruch, R. C. and Farbman, A. I. (1995a). G protein subunits expressed
in catfish olfactory receptor neurons. Chem. Senses. 20: 199-206.

Abogadie, F.C., Bruch, R.C., Wurzburger, R., Margolis, F.L. and Farbman, A.I. (1995b)
Molecular cloning of a phosphoinositide-specific phospholipase C from catfish
olfactory rosettes. Mol. Brain. Res. 31: 10-16.

Ache, B.W. (1994). Towards a common strategy for transducing olfactory information.
sem. Cell Biol. 5: 55-63.

Ache, B.W. and Carr, W.E.S. (1989). Chemoreception in aquatic invertebrates. In:
Neural Mechanisms in Taste. Boca Raton: CRC Press, Inc. 97-117.

Ache, B.W. and Zhainazarov, A. (1995). Dual second-messenger pathways in olfactory
transduction. Curr. Opin. Neurobiol. 5: 461-466.

Anholt, R.R.H. and Rivers, A.M. (1990) Olfactory transduction: cross-talk between
second-messenger systems. Biochem. 29: 4049-4054.

Asanuma, N. and Nomura, H. (1991). Cytochemical localization of adenylate cyclase
activity in rat olfactory cells. Histochem. J. 23: 83-90.

Bacigalupo, J., Morales, B., Ugarte, G., Delgado, R., Jorquera, O. and Labarca, P. (1993).
Electrophysiological studies in toad olfactory receptor neurons. Chem. Senses.
18: 525.

Bakalyar, H.A. and Reed, R.R. (1990). Idnetification of a specialized adenylyl ccyclase
that may mediated odorant detection. Science. 250: 1403-1406.

Berridge, M.J. (1993). Inositol trisphosphate and calcium signalling. Nature. 361: 315-
325.

Bezprozvanny, I. and Ehrlich, B.E. (1993). ATP modulates the function ofinositol 1,4,5-
trisphosphate-gated channels at two sites. Neuron. 10: 1175-1184.








Bezprozvanny, I. and Ehrlich, B.E. (1994). Inositol (1,4,5)-trisphosphate (InsP3)-gated
Ca channels from cerebellum: conduction properties for divalent cations and
regulation by intraluminal calcium. J. Gen. Physiol. 104: 821-856.

Blondel, O., Takeda, J., Janssen, H., Seino, S. and Bell, G.I. (1993). Sequence and
functional characterization of a third inositol 1,4,5-trisphophate receptor subtype,
IP3R-3, expressed in pancreatic islets, kidney, gastrointestinal tract, and other
tissues. J. Biol. Chem. 268: 11356-11363.

Boekhoff, I., Michel, W.C., Breer, H. and Ache, B.W. (1994). Single odors differentially
stimulate sual second messenger pathways in lobster olfactory receptor cells. J.
Neurosci. 14: 3304-3309.

Boekhoff, I., Tareilus, E., Strotmann, J. and Breer, H. (1990). Rapid activation of
alternative second messenger pathways in olfactory cilia in rats by different odors.
EMBOJ. 9: 2453-2458.

Bradley, J., Li, J., Davidson, N., Lester, H.A. and Zinn, K. (1994) Heteromeric olfactory
cyclic nucleotide-gated channels: a subunit that confers increased sensitivity to
cAMP. Proc. Natl. Acad Sci. USA. 91: 8890-8894.

Breer, H. and Boekhoff, I. (1992). Second messenger signalling in olfaction. Curr.
Opin. Neurobiol. 2: 439-443.

Breer, H., Boekhoff, I. and Tareilus, E. (1990). Rapid kinetics of second messenger
formation in olfactory transduction. Nature. 344: 65-68.

Breer, H., Klemm, T., and Boekhoff, I. (1992) Nitric oxide formation of cyclic GMP in
the olfactory system. NeuroReport. 3: 1030-1032.

Broillet, M.-C. and Firestein, S. (1996). Direct activation of the olfactory cyclicc
nucleotide-gated channel through modification of sulfhydryl groups by NO
compounds. Neuron. 16: 377-385.

Bruch, R.C. (1990). Signal transducing GTP-binding proteins in olfaction. Comp.
Biochem. Physiol. [A]. 995: 27-29.

Bruch, R.C. and Kalinowski, D.L. (1987). Interaction of GTP-binding regulatory
proteins with chemosensory receptors. J. Biol. Chem. 262: 2401-2404.

Bruch, R.C. and. Teeter, J.H (1990). Cyclic AMP links amino acid chemoreceptors to
ion channels in olfactory cilia. Chem. Senses. 15: 419-430.








Brunet, L.J., Gold, G.H. and Ngai, J. (1996). General anosmia caused by a targeted
disruption of the mouse olfactory cyclic nuecleotide-gated channel. Neuron. 17:
681-693.

Buck, L. and Axel, R. (1991). A novel multigene family may encode odorant receptors:
a molecular basis for odor recognition. Cell. 65: 175-187.

Carr, W.E.S., Avhe, B.W. and Gleeson, R.A. (1984). Chemoreceptors of crustaceans:
similiraties to receptors for neuroactive substances in internal tissues. Environ.
Health Pers. 71: 31-46.

Clapham, D.E. and Neer, E.J. (1993). New roles for G protein py dimers in
transmembrane signalling. Nature. 365: 403-406.

Cunningham, A.M., Ryugo, D.K., Sharp, A.H., Reed, R.R., Snyder, S.H. and Ronnett,
G.V. (1993). Neuronal inositol 1,4,5-trisphosphate receptor localized to the
plasma membrane of olfactory cilia. Neurosci. 57: 339-352.

Dellacorte, C., Restrepo, D., Menco, B.P.M., Andreini, I. and Kalinowski, D.L. (1996).
Gaq/Ga 1: immunolocalization in the olfactory epitheliumn of the rat (Rattus
rattus) and the channel catfish (Ictalurus punctatus). Neurosci. 74: 261-273.

Dhallan, R.S., Yau, K. Schrader, K.A. and Reed, R.R. (1990). Primary structure and
fictional expression of a cyclic nucleotide-activated channel from olfactory
neurons. Nature. 347: 184-187.

Dingwall, C. and Laskey, R.A. (1991). Nuclear targeting sequences--a consensus?
Trends Biochem. Sci. 16: 478-481.

Dionne, V.E. (1992). Chemosensory responses in isolated olfactory receptor neurons
form Necturus maculosus. J. Gen. Physiol. 99: 415-433.

Dionne, V.E. (1994). Emerging complexity of odor transduction. Proc. Natl. Acad. Sci.
USA. 91: 6253-6254.

Drinnan, S.L., Hope, B.T., Snutch T.P. and Vincent, S.R. (1991). Gof in the basal
ganglia. Mol. Cell. Neurosci. 2: 66-70.

Fadool, D.A. and Ache, B.W. (1992). Plasma membrane inositol 1,4,5-trisphophate-
activated channels mediate signal transduction in lobster olfactory receptor
neurons. Neuron. 9: 907-918.








Fadool, D.A. and Ache, B.W. (1994). Mediation of opposing transduction cascades in
lobster olfactory receptor neurons by cAMP and IP3. In: Olfaction and Taste XI.
eds. Kurihara, K., N. Suzuki and H. Ogawa. Tokyo, Springer-Verlag. 178-182.

Fadool, D. A., Estey, S. E. and Ache, B. W. (1995). Evidence that a Gq-protein mediates
excitatory odor transduction in lobster olfactory receptor neurons. Chem. Senses.
20: 489-498.

Fadool, D.A., Michel, W.C. and Ache, B.W. (1993). Odor sensitivity of cultured lobster
olfactory neurons is not dependent on process formation. J. exp. Biol. 174: 215-
233.

Ferris, C.D. and Snyder, S.H. (1992). Inositol 1,4,5-trisphosphate-activated calcium
channels. Ann. Rev. Physiol. 54: 469-488.

Firestein, S., Darrow, B. and Shepherd, G.M. (1991). Activation of the snesory current in
salamander olfactory receptor neurons depends on a G-protein-mediated cAMP
second messenger system. Neuron. 6: 825-835.

Frohman, M.A., M.K. Dush and G.R. Martin (1988). Rapid production of full-length
cDNAs from rare transcripts: amplification using a single gene-specific
oligonucleotide primer. Proc. Natl. Acad. Sci. USA. 85: 8998-9002.

Fujimoto, T., Nakade, S., Miyawaki, A., Mikoshiba, K. and Ogawa, K. (1992).
Localization of inositol 1,4,5-trisphosphate receptor-like protein in plasmalemmal
caveolae. J. Cell Biol. 119: 1507-1513.

Furuichi, T., Kohda, K., Miyawaki, A. and Mikoshiba, K. (1994). Intracellular channels.
Curr. Opin. Neurobiol. 4: 294-303.

Furuichi, T., Yoshikawa, S., Miyawaki, A., Wada, K., Maeda, N. and Mikoshiba, K.
(1989). primary structure and functional expression of the inositol 1,4,5-
trisphosphate-binding protein P400. Nature. 342: 32-38.

Goldsmith, P., Backlund, Jr., P.S., Rossiter, K., Carter, A., M illigan, G., Unson, C.G.
and Spiegel, A. (1988). Purification ofheterotrimeric GTP-binding proteins from
brain: identification of a novel form of Go. Biochem. 27: 7085-7090.

Goulding, E.H., J. Ngai, R.H. Kramer, S. Colicos, R. Axel, S.A. Siegelbaum and A.
Chess (1992). Molecular cloning and single-channel properties of the cyclic
nucleotide-gated channel from catfish olfactory neurons. Neuron. 8: 45-58.

Grilnert, U. and Ache, B.W. (1988). Ultrastructure of the aesthetasc (olfactory) sensilla
of the spiny lobster, Panulirus argus. Cell Tissue Res. 251: 95-103.








Hamm, H.E. and Gilchrist, A. (1996) Heterotrimeric G proteins. Curr. Opin. Cell Biol.
8: 189-196.

Hatt, H. and Ache, B.W. (1994). Cyclic nucleotide- and inositol phosphate-gated ion
channels in lobster olfactory receptor neurons. Proc. Natl. Acad Sci. USA. 91:
6264-6268.

Ivanova, T.T. and Caprio, J. (1992). Odorant receptors activated by amino acids in
sensory neurons of the channel catfish Ictaluruspunctatus. J Gen. Physiol. 102:
1085-1105.

lyengar, R. and Bimbaumer, L. (1990). Roles of G proteins and G protein subunits in
signal transduction. Lymphokine Res. 9: 533-537.

Jones, D.T., Barbosa, E. and Reed, R.R. (1988). Expression of G-protein a-subunits in
rat olfactory epithelium: candidates for olfactory signal transduction. Cold
Spring Harbor Symp. Quant. Biol. 53: 349-354.

Jones, D.T. and Reed, R.R. (1989). Golf: an olfactory neuron-specific G protein
involved in odorant signal transduction. Science. 244: 790-795.

Kalinowski, D.L., Aldinger, S.B., Boyle, A.G., Huque, T., Marecek, J.F., Prestwich, G.D.
and Restrepo, D. (1992). Characterization of an novel inositol 1,4,5-trisphosphate
receptor in isolated olfactory cilia. Biochem. J. 281: 449-456.

Khan, A.A., Soloski, M.J., Sharp, A.H., Schilling, G., Sabatini, D.M., Li, S.-H., Ross,
C.A. and Snyder, S.S. (1996). Lymphocyte apoptosis:mediation by increased
type 3 inositol 1,4,5-trisphosphate receptor. Science. 273: 503-507.

Khan, A.A., Steiner, J.P., Klein, M.G., Schneider, M.F. and Snyder, S.H. (1992). IP3
receptor: localization to plasma membraen of Tcells and cocapping with the T
cell receptor. Science. 257: 815-818.

Kingston, P.A., Zufall, F. and Bamstable, C.J. (1996). Rat hippocampal neurons express
genes for both rod retinal and olfactory cyclic nucleotide-gated channels: novel
targets for cAMP/cGMP function. Proc. Natl. Acad. Sci. USA. 93: 10440-10445.

Kleene, S.J. (1993) Origin of the chloride current ni olfactory transduction. Neuron. 11:
123-132.

Kleene, S.J., Gesteland, R.C. and Bryant, S.H. (1994). An electrophysilogical survey of
frog olfactory cilia. J. Exp. Biol. 195: 307-328.








Kozak, M. (1991). Structural features in eukaryotic mRNAs that modulate the initiation
of translation. J. Biol. Chem. 266: 19867-19870.

Kume, S., Muto, A., Aruga, J., Nakagawa, T., Michikawa, T., Furuichi, T., Nakade, S.,
Okano, H. and Mikoshiba, K. (1993). The Xenopus IP3 receptor: Structure,
function and localization in oocytes and eggs. Cell. 73: 555-570.

Kuno, M., Maeda, N. and Mikoshiba, K. (1994). IP3-activated calcium-permeable
channels in the inside-out patch of cultured cerebellar Purkinje cells. Biochem.
Biophys. Res. Comm. 199: 1128-1135.

Kurahashi, T. and Yau, K.-W. (1994) Co-existence of cationic and chloride components
in odorant-induced current of vertebrate olfactory cells. Nature. 363: 71-74.

Labarca, P., Simon, S.A. and Anholt, R.R.H. (1988). Activation by odorants of a
multistate cation channel from olfactory cilia. Proc. Natl. Acad. Sci. USA. 85:
944-947.

Lambright, D.G., Noel, J.P., Hamm, H.E. and Sigler, P.B. (1994). Structural
determinants for activation of the a-subunit of a heterotrimeric G protein. Nature.
369: 621-628.

Lee, Y.-J., Dobbs, M.B., Verardi, M.L. and Hyde, D.R. (1990) dgq: a Drosophila gene
encoding a visual system-specific G molecule. Neuron. 5: 889-898.

Leinders-Zufall, T., Shepherd, G.M. and Zufall, F. (1995). Regulation of cyclic
nucleotide-gated channels and membrane excitability in olfactory receptor cells
by carbon monoxide. J. Neurophysiol. 74: 1498-1508.

Liman, E.R. and Buck, L.B. (1994). A second subunit of the olfactory cyclic nucleotide-
gated channel confers high sensitivity to cAMP. Neuron. 13: 611-621.

Lischka, F.W. and Schild, D. (1993). Effects of nitric oxide upon olfactory receptor
neurones inXenopus laevis. NeuroReport. 4: 582-584.

Lischka, F.W., Honda, E., Teeter, J.H. and Restrepo, D. (1995). Characterization of an
InsP3-activated channels in reconstituted membranes and excised patches from rat
olfactory neurons. Chem. Senses. 20: 733.

Lowe, G. and Gold, G.H. (1993). Nonlinear amplification by calcium-dependent chloride
channels in olfactory receptor cells. Nature. 366: 283-286.








Lowe, G., Nakamura, T. and Gold, G.H. (1989). Adenylate cyclase mediates olfactory
transduction for a wide variety of odorants. Proc. Natl. Acad Sci. USA. 86:
5641-5645.

Lucero, M.T., Horrigan, F.T. and Gilly, W.F. (1992). Electrical responses to chemical
stimulation of squid olfactory receptor cells. J. Exp. Biol. 162: 231-249.

Lucero, M.T. and Piper, D.R. (1994). IP3 and cyclic nucleotides elicit opposite
membrane potential changes in squid olfactory receptor neurons. Chem. Senses.

McClintock, T.S. and Ache, B.W. (1989). Hyperpolarizing receptor potentials in lobster
olfactory receptor cells: implications for transduction and mixture suppression.
Chem. Senses. 14: 637-647.

McDonald, T.V., Premack, B.A. and Gardner, P. (1993). Flash photolysis of caged
inositol 1,4,5-trisphosphate activates plasma membraen calcium current in human
T cells. J. Biol. Chem. 268: 3889-3896.

Menco, B.P., Bruch, R.C., Dau, B. and Danho, W. (1992). Ultrastructural localization of
olfactory transduction components: the G protein Golf alpha and type III adenylyl
cyclase. Neuron. 8: 441-453.

Michel, W.C. and Ache, B.W. (1992). Cyclic nucleotides mediate an odr-evoked
potassium conductance in lobster olfactory receptor cells. J. Neurosci. 12: 3979-
3984.

Michel, W.C., McClintock, T.S. and Ache, B.W. (1991). Inhibition of lobster olfactory
receptor cells by an odor-activated potassium conductance. J. Neurophysiol. 65:
446-453.

Michikawa, T., Hamanaka, H., Otsu, H., Yamamoto, A., Miyawaki, A., Furuichi, T.,
Tashiro, Y. and Mikoshiba, K. (1994). Transmembrane topology and sites of N-
glycosylation of inositol 1,4,5-trisphosphate receptor. J. Biol. Chem. 269: 9184-
9189.

Mignery, G.A., Newton, C.L., Archer III, B.T. and Siidhof, T.C. (1990). Structure and
expression of the rat inositol 1,4,5-trisphosphate receptor. J. Biol. Chem. 265:
12679-12685.

Mikoshiba, K. (1993). Inositol 1,4,5-trisphosphate receptor. Trends Pharm. Sci. 14: 86-
89.

Miyamoto, T., Restrepo, D., Cragoe, E.J. and Teeter, J.H. (1992). IP3- and cAMP-
induced responses in isolated olfactory receptor neurons from the channel catfish.
J. Membr. Biol. 127: 173-183.









Mourey, R.J., Estevez, V.A., Maracek, J.F., Barrow, R.K., Prestwich, G.D. and Snyder,
S.H. (1993). Inositol 1,4,5-trisphosphate receptors: labelling the inositol 1,4,5-
trisphosphate binding site with photoaffinity ligands. Biochem. 32: 1719-1726.

Munger, S.D., Ache, B.W. and Greenberg, R.M. (1995) Cloning and sequencing of an
IP3-receptor cDNA from lobster olfactory organ. Soc. Neurosci. Abstr. 21: 1127.

Munger, S.D., Rust, N.C., Ache, B.W. and Greenberg, R.M. (1997) Cloning and
molecular characterization of two components of the IP3 pathway from lobster
olfactory organ. Chem. Senses. In press.

Nakade, S., Maeda, N. and Mikoshiba, K. (1991). Involvement of the C-terminus of the
inositol 1,4,5-trisphosphate receptor in Ca2+ release using region-specific
monoclonal antibodies. BiochemJ. 277: 125-131.

Nakamura, T. and Gold, G.H. (1987). A cyclic nucleotide-gated conductance in olfactory
receptor cilia. Nature. 325: 442-444.

Nakamura, T. Lee, H.-H., Kobayashi, H. and Satoh, T.-O. (1996). Gated conductances in
native and reconstituted membranes from frog olfactory cilia. Biophys. J. 70:
813-817.

Nakamura, T., Tsuru, K. and Miyamoto, S. (1994). Regulation of Ca2+ concentration by
second messengers in newt olfactory receptor cell. Neurosci. Lett. 171: 197-200.

Neer, E.J. (1995). Heterotrimeric G proteins: organizers oftransmembrane signals. Cell.
80: 249-257.

Pace U., Hanski, E., Salomon, Y. and Lancet, D. (1985). Odorant-sensitive adenylate
cyclase may mediate olfactory reception. Nature. 316: 255-258.

Restrepo, D., Miyamoto, T., Bryant, B.P. and Teeter, J.H. (1990). Odor stimuli trigger
influx of calcium into olfactory neurons of the channel catfish. Science. 249:
1166-1168.

Restrepo, D., Teeter, J.H., Honda, E., Boyle, A.G., Marecek, J.F., Prestwich, G.D. and
Kalinowski, D.L. (1992). Evidence for an InsP3-gated channel protein in isolated
rat olfactory cilia. Am. J. Physiol. 32: C667-C673.

Restrepo, D., Teeter, J.H. and Schild, D. (1996). Second messenger signalling in
olfactory transduction. J. Neurobiol. 30: 37-48.








Ronnett, G.V., Cho, H., Hester, L.D., Wood, S.F. and Snyder, S.H. (1993). Odorants
differentially enhance phosphoinositide turnover and adenylyl cyclase in olfactory
receptor neuronal cultures. J. Neurosci. 13: 1751-1758.

Ross, C.A., Danoff, S.K., Schell, M.J., Snyder, S.H. and Ullrich, A. (1992). Three
additional inositol 1,4,5-trisphosphate receptors: Molecular cloning and
differential localization in brain and peripheral tissues. Proc. Natl. Acad Sci.
USA. 89: 4265-4269.

Sanger, F. and Coulson, A.R. (1977). A rapid method for determining sequences in DNA
by primed synthesis with DNA polymerase. J. Mol. Biol. 13: 373.

Schild, D., Lischka, F.W. and Restepo, D. (1995). InsP3 causes an increase inapical
[Ca2+]i by activating two distinct current components in vertebrate olfactory
receptor cells. J. Neurophysiol. 73: 862-866.

Schmiedel-Jakob, I., Anderson, P.A.V. and Ache, B.W. (1989). Whole cell recording
from lobster olfactory receptor cells: responses to current and odor stimulation.
J. Neurophysiol. 61: 994-1000.

Schmiedel-Jakob, I., Michel, W.C., Anderson, P.A.V. and Ache, B.W. (1990). Whole
cell recording form lobster olfactory receptor cells: multiple ionic bases for the
receptor potential. Chem. Senses. 15: 397-405.

Seok, J.-H., Xu, L., Kramarcy, N.R., Sealock, R. and Meissner, G. (1992). The 30 S
lobster skeletal muscle Ca2+ release channel (ryanodine receptor) has functional
properties distinct from the mammalian channel proteins. J. Biol. Chem. 267:
15893-15901.

Sharp, A.H., S.H. Snyder and S.K. Nigam (1992). Inositol 1,4,5-trisphosphate receptors:
localization in epithelial tissue. J. Biol. Chem. 267: 7444-7449.

Shepherd, G.M. and Firestein, S. (1991). Making scents of olfactory transduction. Curr.
Biol. 1: 204-206.

Shepherd, G.M. (1994). Discrimination of molecular signals by the olfactory receptor
neuron. Neuron. 13: 771-790.

Shinohara, H., Kato, K. and Asano, T. (1992). Differential localizationof G proteins, Gi
and Go, in the olfactory epithelium and the main olfactory bulb of the rat. Acta
Anat. 144: 167-171.

Simon, M.I., Strathmann, M.P. and Gautam, N. (1991) Diversity of G proteins in signal
transduction. Science. 252: 802-808.








Sklar, P.B., Anholt, R.R. and Snyder, S.H. (1986).The odorant-sensitive adenylate
cyclase of olfactory recptor cells. Differential stimulation by distinct classes of
odorants. J. Biol. Chem. 261: 15538-15543.

Stehno-Bittel, L., Ltickhoff, A. and Clapham, D.E. (1995). Calcium release form the
nucleus by InsP3 receptor channels. Neuron 14: 163-167.

Stemberg, M.J.E. and Taylor, W.R. (1984). Modelling the ATP-binding site of oncogene
products, the epidermal growth factor and related proteins. FEBSLett. 175: 387-
392.

Strathmann, M. and Simon, M.I. (1990) G protein diversity: a distinct class of subunits
is present in vertebrates and invertebrates. Proc. Nat. Acad. Sci. USA, 87, 9113-
9117.

Siidhof, T.C., Newton, C.L., Archer, B.T., Ushkaryov, Y.A. and Mignery, G.A. (1991).
Structure of a novel InsP3 receptor. EMBOJ. 10: 3199-3206.

Sullivan, K.M.C., Lin, D.D., Agnew, W. and Wilson, K.L. (1995). Inhibition of nuclear
vesicle fusion by antibodies that block activation of inositol 1,4,5-trisphosphate
receptors. Proc. Natl. Acad Sci. USA. 92: 8611-8615.

Talluri, S., Bhatt, A. and Smith, D.P. (1995). Identification of a Drosophila G protein a
subunit (dGqc-3) expressed in chemosensory cells and central neurons. Proc.
Natl. Acad. Sci. USA. 92: 11475-11479.

Vodyanoy, V. and Murphy, R. (1983). Single-channel fluctuations in biomolecular lipid
membranes induced by rat olfactory epithelium homogenates. Science 220: 717-
719.

Wang, M.M. and Reed, R.R. (1993). Molecular cloning of the olfactory neuronal
transcription factor Olf-1 by genetic selection in yeast. Nature. 364: 121-126.

Wang, M.M., Tsai, R.Y., Schrader, K.A. and Reed, R.R. (1993). Genes encoding
components of the olfactory signal transduction cascade contain a DNA binding
site that may direct neuronal expression. Mol. Cell. Biol. 13: 5805-5813.

Wedegaertner, P.B., Wilson, P.T. and Bourne, H.R. (1995). Lipid modifications of
trimeric G proteins. J. Biol. Chem. 270: 503-506.

Wilkie, T.M., Scherle, P.A., Strathmann, M.P., Slepak, V.Z. and Simon, M.I. (1991).
Characterization of G-protein alpha subunits in the Gq class: expression in
murine tissues. Proc. Natl. Acad. Sci. USA. 88: 10049-10053.








Xu, F., Quintero, J., Gress, A.M. and McClintock, T.S. (1997). Molecular cloning of two
guanine nucleotide binding proteins from American lobster olfactory organ.
Chem. Senses Abstract. In press.

Yamada, N., Makino, Y., Clark, R.A., Pearson, D.W., Mattei, M.-G., GuJnet, J.-L.,
Ohama, E., Fujino, I., Miyawaki, A., Furuichi, T. and Mikoshiba, K. (1994).
Human inositol 1,4,5-trisphosphate type-1 receptor: structure, function,
regulation expression and chromosomal localization. Biochem. J. 302: 781-790.

Yoshikawa, S., Tanimura, T., Miyawaki, A., Nakamura, M., Yuzaki, M., Furuichi, T. and
Mikoshiba, K. (1992). Molecular cloning and characterization of the inositol
1,4,5-trisphosphate receptor in Drosophila melanogaster. J. Biol. Chem. 267:
16613-16619.

Zhainazarov, A.B. and Ache, B.W. (1995). Na+-activated nonselective cation channels in
primary olfactory neurons. J. Neurophysiol. 73: 1774-1781.

Zhainazarov, A.B., Doolin, R.E. and Ache, B.W. (1997). Odors activate a sodium-gated
cation conductance in lobster olfactory neurons. [submitted].

Zheng, J., Knighton, D.R., Ten Eyck, L.F., Karlsson, R., Xuong, N., Taylor, S.S. and
Sowadski, J.M. (1993). Crystal structure of the catalytic subunit of cAMP-
dependent protein kinase completed with MgATP and peptide inhibitor.
Biochem. 32: 2154-2161.

Zufall, F., Firestein, S. and Shepherd, G.M. (1994). Cyclic nucleotide-gated ion channels
and sensory transduction in olfactory receptor neurons. Annu. Rev. Biophys.
Biomed. Struct. 23: 577-607.














BIOGRAPHICAL SKETCH


Steven Dunn Munger was born on November 26, 1966, in Richmond, Virginia.

His parents Peter and Joan Munger moved to Charlottesville, Virginia, 6 months later,

taking Steven with them. His only brother, David, was born in 1970. Steven attended

Venable and Greenbrier Elementary Schools, Walker Middle School and Charlottesville

High School, graduating from the latter in June of 1985. That fall he enrolled at the

University of Virginia, where he graduated with a Bachelor of Arts in Biology 4 years

later. During his stay at U.Va., Steven worked with Dr. DeForest "Mike" Mellon on a

project concerning the projection of olfactory neurons from the nose to the brain. This

was his first exposure to olfaction, and served to whet his appetite.

After graduating from U.Va., Steven worked for one year as a technician in the

laboratory of Dr. Sally Moody and Dr. Steve Klein. This laboratory focused on

development, including development of the nervous system, another influence that would

be felt later on.

Steven enrolled as a graduate student at the University of Florida Department of

Neuroscience in the fall of 1990, and immediately started to work in the laboratory of Dr.

Barry Ache at the Whitney Laboratory. There, after a series of failed projects, he

succeeded in isolating two cDNAs from the lobster nose that may play a role in olfactory

transduction. While at the Whitney Laboratory, he also collaborated with the laboratory

of Dr. Barbara-Anne Battelle on a study characterizing a component of the horseshoe

crab visual transduction cascade.

Steven and his new dog Weaver now leave St. Augustine for Baltimore,

Maryland, where Steven will take a postdoctoral fellowship with Dr. Randall Reed at the






72


Howard Hughes Medical Institutes and the Department of Molecular Biology and

Genetics, Johns Hopkins University Medical School (Weaver will just play with tennis

balls).








I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philoso



Barry e, Chair
Professor of Neuroscience

I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.



Barbara Anne Battelle, Cochair
Professor of Neuroscience

I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully equat cope nd quality,
as a dissertation for the degree of Doctor of Phil/




rofes f gy
an rapeut

I certify that I have read this study nd that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Phil ophy.



Peter A. nderson
Professor of Physiology
and Neuroscience







I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.



Gerard Shaw
Professor of Neuroscience

I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.



ert M. G/eenberg
Assistant Scientist in
Molecular Biology

This dissertation was submitted to the Graduate Faculty of the College of
Education and to the Graduate School and was accepted as partial fulfillment of the
requirements for the degree of Doctor of Philosophy.


May, 1997 / '4 ,
Dean, College of Medicine



Dean, Graduate School











































3 1262 08554 630611 ll
3 1262 08554 6308