Citation
Molecular characterization of two components of the IP3 signalling pathway in the lobster olfactory organ

Material Information

Title:
Molecular characterization of two components of the IP3 signalling pathway in the lobster olfactory organ
Creator:
Munger, Steven D., 1966-
Publication Date:
Language:
English
Physical Description:
viii, 72 leaves : ill. ; 29 cm.

Subjects

Subjects / Keywords:
Cell membranes ( jstor )
Complementary DNA ( jstor )
Lobsters ( jstor )
Neurons ( jstor )
Odors ( jstor )
Olfactory organs ( jstor )
Pain ( jstor )
Proteins ( jstor )
Receptors ( jstor )
RNA ( jstor )
Inositol 1,4,5-Trisphosphate ( mesh )
Mice ( mesh )
Olfactory Pathways ( mesh )
Olfactory Receptor Neurons ( mesh )
Receptors, Odorant -- analysis ( mesh )
Receptors, Odorant -- genetics ( mesh )
Receptors, Odorant -- isolation & purification ( mesh )
Genre:
bibliography ( marcgt )
theses ( marcgt )
non-fiction ( marcgt )

Notes

Thesis:
Thesis (Ph. D.)--University of Florida, 1997.
Bibliography:
Includes bibliographical references (leaves 60-70).
General Note:
Typescript.
General Note:
Vita.
Statement of Responsibility:
by Steven D. Munger.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright [name of dissertation author]. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Resource Identifier:
48663429 ( OCLC )
ocm48663429
002287057 ( ALEPH )

Downloads

This item has the following downloads:


Full Text











MOLECULAR CHARACTERIZATION OF TWO COMPONENTS OF THE IP3
SIGNALLING PATHWAY IN THE LOBSTER OLFACTORY ORGAN









By


STEVEN D. MUNGER


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY



UNIVERSITY OF FLORIDA


























Copyright 1997

by

Steven D. Munger




























To Peter and Joan Munger, for everything.















ACKNOWLEDGMENTS


I would like to thank my mentor, Dr. Barry Ache, for his patience when all looked

bleak, and for trusting me enough to allow me to pursue projects that may not have

shown the greatest likelihood of success. I have learned much of how science, in the

broadest sense, should be approached.

I thank Dr. Barbara-Anne Battelle for her support and for her excellent lessons in

how to properly construct an experiment. If I am half as rigorous a scientist, I will be

quite happy. I would also like to thank her for treating me like a colleague as well as a

student. I consider myself her graduate student as well. My thanks go to Dr. Robert

Greenberg, for rarely getting frustrated when I was the 37th person that hour to ask him a

question. He has been a good teacher and a good friend. Sincere thanks and appreciation

to all the other members of my committee: Dr. Peter Anderson, Dr. Gerry Shaw and last

minute-substitute and slumlord Dr. Michael Greenberg. All of you have been invaluable

to my education and to my enjoyment of the Whitney Lab.

Of course, I cannot neglect all of those Whitney folks, past and present, who have

made my stay at the Laboratory such a joy (at least, compared to graduate school

anywhere else). As everyone has helped me in so many different ways over the last

several years, I will not make a laundry list of good deeds. Everyone knows how they

helped in one way or the other. But here is the honor roll, in no particular order: Lynn

Milstead, Jim Netherton, Karen Kempler, Gary and Susanna LaFleur, Dave Price,

Gerhard Reich, Louise MacDonald, Shirley Metts, Gina White, Chris Brink, Scan Boyle,

Chuck Peterson, Luke Dunlap, Paul Linser, Anne Andrews, Jeri-Lynn Schremser, Chris









Williams, Rick Gleeson, Bill Carr, Hank Trapido-Rosenthal, Debi and Jim Fadool, Russ

Buono, Billy Raulerson, Bob Birkett, Mike Jeziorski, Asl Zhainazarov, Elisabeth Wiese,

Mike Michel, Matt Wachowiak, Manfred Schmidt, Aurea Orozco-Rivas, Nicole Rust and

all of those other REU students, the Sandpiper and, of course, Cornelius Vanderbilt

Whitney.

Finally, I thank my parents, for their support and encouragement. Nothing would

have been possible for me without all that they have done and all that they have been.















TABLE OF CONTENTS


ACKNOWLEDGMENTS ............................. ..... ............. ............................ iv

ABSTRACT............................................................................................................... vii

1 INTRODUCTION .......................... ...................................... ...................................

Olfactory Processing............................................................... .................................
Multiple Transduction Pathways in Olfaction........................... .......... .............. 2
The Lobster as an Olfactory Model System......................................................3
Both cAMP and IP3 Underlie Lobster Olfactory Transduction.................................... 8
The Lobster Olfactory IP3 Receptors..........................................................13
G proteins Mediate Lobster Olfactory Transduction.............. ..........................14
Specific Aims............................ ..........................................................................15

2 MOLECULAR CHARACTERIZATION OF AN OLFACTORY ORGAN IP3
RECEPTOR......................................................................... ..................................17

Introduction.......................................................................... ..................................17
M ethods............................................................................. .....................................22
Results............................................................................. ................................ ......25
Discussion............................................................................ ..................................33

3 MOLECULAR CHARACTERIZATION OF AN OLFACTORY ORGAN GQ
PROTEIN............................................................................. ..................................38

Introduction....................................................................... .....................................38
M ethods...................................................................... .................................. ......40
R esults.............................................................................. .....................................42
D discussion ........................................................................... ...................................50

4 SUMMARY............................................................................ .................................54

LIST OF REFERENCES.................................. .....................................................60

BIOGRAPHICAL SKETCH........................ ....................................71














Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy


MOLECULAR CHARACTERIZATION OF TWO COMPONENTS OF THE IP,
SIGNALLING PATHWAY IN THE LOBSTER OLFACTORY ORGAN

By

Steven D. Munger

May, 1997




Chairman: Barry W. Ache
Major Department: Neuroscience


Olfactory transduction is a complex biochemical process that transforms odor

signals from the environment into neural signals that can be interpreted by the brain,

triggering appropriate behavioral and physiological responses in the organism. Inositol

1,4,5-trisphosphate (IP3) has been implicated, in a variety of species, as a second

messenger involved in olfactory transduction, though its precise role remains

controversial. IP3 has been proposed by some to be either a modulatory factor or a

necessary cofactor for the better characterized transduction pathway mediated by

adenosine 3',5'-cyclic monophosphate (cAMP); others believe it to have a role

equivalent, but not identical, to cAMP. A key to understanding the funtional intricacies

of the cAMP pathway was the molecular isolation and characterization of components of

this signalling cascade in olfactory receptor neurons (ORNs). Unfortunately, few









components of the IP3 pathway of ORNs have been characterized. In the spiny lobster,

Panulirus argus, electrophysiological studies have implicated an IP3-gated channel, the

IP3 receptor (IP3R), as the target of IP3 generated by excitatory odor-stimulation. A Gq
protein a-subunit, a member of the family of heterotrimeric GTP-binding proteins, has

also been implicated in the excitatory odor response, serving to link the activated odor

receptor with the enzyme that generates IP3. This dissertation describes the molecular

cloning of cDNAs for two components of an IP3 signalling cascade from the olfactory

organ (nose) of the spiny lobster: an IP3 receptor and a Gq protein. These two proteins,

both implicated in the excitatory odor response in lobsters, share many structural

characteristics with those isolated from other species and tissues. The IP3 receptor cDNA

encodes a protein that is about 50% identical to those isolated from Drosophila and

several vertebrates. The Gq protein shows an even similarity to other Gq proteins (70-

80%). The messenger RNAs for these two molecules are both expressed in the olfactory

organ, making them candidates for roles in olfactory transduction. The isolation and

characterization of these two cDNAs is a critical step in the understanding of both the

role of IP3 in olfactory signalling and the complexity of odor transduction in all animals.














CHAPTER 1
INTRODUCTION


Olfactory Processing


Most odors are complex mixtures of compounds, and it is the role of the olfactory

system to transduce these chemical stimuli into neural signals that reflect the complex

nature of the odor. The olfactory system does this by doing more than just assigning each

odor component a neural signature, reflected as a change in membrane potential. The

system also processes the signals to reflect such information as concentration and mixture

composition. This processing could take place at several possible levels. In the

extracellular environment, access of odor molecules to olfactory receptor binding sites on

the surface of olfactory receptor neurons could be regulated by odorant binding proteins

or enzymes that degrade odor molecules, or there could be competition between odor

molecules for olfactory receptor binding sites. In olfactory receptor neurons that contain

multiple transduction cascades, the activation of olfactory receptors of different

specificity could activate more than one transduction pathway, providing ample targets

for biochemical cross-talk that might modulate the function of either cascade. The best

characterized site of olfactory processing is at the level of synaptic processing, beginning

at the point of contact between olfactory receptor neurons contact second order neurons in

the olfactory bulb (vertebrates) or lobe (invertebrates) and continuing in higher neural

centers; here, the activity of numerous olfactory receptor neurons is shaped by the

integration of activity across the population. Although each of these levels is a

potentially critical step in the coding and processing of odor information, this

dissertation will concentrate on some of the mechanisms of olfactory transduction.









Through the better understanding of these mechanisms in cells that express multiple

transduction cascades, it may be possible to decipher how individual receptor neurons

could begin to process multiple odor stimuli at the level of the single receptor cell.


Multiple Transduction Pathways in Olfaction

Olfactory transduction is thought to occur through standard G protein-mediated

second messenger systems (reviews: Breer and Boekhoff, 1992; Ache and Zhainazarov,

1995; Restrepo et al., 1996; but see Vodyanoy and Murphy, 1983; Labarca et al., 1988).

In such a system, a receptor is coupled to second messenger-metabolizing enzymes (e.g.

adenylyl cyclase, which synthesizes cAMP from ATP) by a heterotrimeric GTP-binding

protein (G protein). Evidence in rat (Breer et al., 1990; Boekhoff et al., 1990; Ronnett et

al., 1993), amphibian (Dionne, 1992; Bacigalupo et al., 1993; Lowe et al., 1989; Lischka

et al., 1995), catfish (Ivanova and Caprio, 1992; Miyamoto et al., 1992; Restrepo et al.,

1990; Bruch and Teeter; 1990), lobster (Michel and Ache, 1992; Fadool and Ache, 1992;

Boekhoff et al., 1994) and squid (Lucero et al., 1992; Lucero and Piper, 1994) points to

multiple olfactory transduction mechanisms, and implicates adenosine 3',5'-cyclic

monophosphate (cAMP) and inositol 1,4,5-trisphosphate (IP3) as olfactory second

messengers (review: Ache, 1994). However, the functional consequences of cAMP and

IP3 vary between species. For example, while cAMP and IP3 both depolarize ORNs in
the catfish (Ivanova and Caprio, 1992), the two messengers mediate opposing

conductances in the lobster (Fadool and Ache, 1992; Michel and Ache, 1992). cAMP

and IP3 both appear to act by directly gating ion channels in the plasma membrane

(Nakamura and Gold, 1987; Zufall et al., 1994; Fadool and Ache, 1992; Hatt and Ache,

1994; Lischka et al., 1994), though some have challenged the findings of a plasma-

membrane IP3-gated channel (Brunet et al., 1996; Nakamura et al., 1996). There is now

growing evidence for a multitude of modulatory and amplifying factors that may act on









one or both of these two pathways, including the gaseous messengers nitric oxide and

carbon monoxide (Lischka and Schild, 1993; Leinders-Zufall et al., 1995; Zufall, 1996;

Broillet and Firestein, 1996), Ca2+ (e.g. Anholt and Rivers, 1990; Kleene, 1993; Lowe

and Gold; 1993; Kurahashi and Yau, 1994) and cGMP (Breer et al., 1992) (Figure 1).

The advent of molecular biology has afforded the opportunity to identify many of

the molecules that compose these olfactory transduction pathways, permitting better

characterization of their functions and their distributions. Most of the major components

of the olfactory cAMP pathway have been cloned from mammals: a type III adenylyl

cyclase (Bakalyar and Reed, 1990); a G protein a-subunit, Golf (Jones and Reed, 1989);

and two subunits of the cAMP-gated channel (Dhallan et al., 1990; Bradley et al., 1994;

Liman and Buck, 1994). The IP3 pathway is not nearly as well characterized, with only a

catfish phospholipase C (Abogadie et al., 1995a), a lobster IP3-gated channel (Munger et

al., 1995; Munger et al., 1997; Chapter 2), two lobster Gq proteins (Munger et al., 1997;

Chapter 3; Xu et al., 1997) and a Drosophila Gq protein (Talluri et al., 1995) having been

cloned.


The lobster as an olfactory model system

One advantage of the spiny lobster, Panulirus argus, as a model system for the

study of olfactory transduction is the extensive characterization of behaviorally-relevant

odors. Many of these odors are small hydrophilic compounds, such as amino acids,

quatenary ammonium compounds, nucleotides, and amines (review: Carr et al., 1987;

Ache and Carr, 1989), present in the flesh of the animal's typical prey.

Electrophysiological and biochemical of the ORNs to many of these odors, as well as

behavioral responses of the animal, have been well characterized.

The olfactory organ, or the "nose," of the spiny lobster is the two lateral filaments

of paired, bifurcated antennules (Figure 2). The somata of the olfactory receptor neurons























Figure .. Proposed pathways in olfactory transduction. (A) A vertebrate olfactory receptor
neuron (ORN). Odor transduction takes place in the dendritic cilia, while the axon projects
to the CNS, where it makes its first synapse. Invertebrate ORNs have a similar structure
(see Figure 2). (B) These biochemical pathways have been proposed in a variety of
organisms to mediate olfactory transduction. The better characterized pathway involves the
activation of adenylyl cyclase (AC) after odor activation of a receptor (R), via a G protein
(G). The AC generates cAMP, which then directly gates a membrane channel. The second,
parallel pathway, involves separate receptors, G protein, and the metabolizing enzyme
phospholipase C (PLC), which generates the messengers IP3 (or InsP3) and diacylglycerol.
IP3 (InsP3) can also directly gate its own membrane channel. Several potential modulatory
and amplification pathways are also proposed, including the activation of protein kinase A
(PKA), protein kinase C (PKC) and a G protein-coupled receptor kinase (GRK). Ca2+,
entering the cell through either second messenger-gated channel, can act both through
calmodulin (CAM), such as by acting on phosphodiesterase (PDE), and by directly gating
other channels. Finally, IP3 (InsP3) can be phosphorylated by a 3-kinase into InsP4, which
may also gate a channel. From Ache and Zhainazarov, 1995, with permission.









A


L





























Figre 2. (A) The lateral filament of the antennule of P. argus is the olfactory organ. The
expanded view at right (B) shows the aesthetase sensilla between two rows of guard hairs.
The sensilla contain the dendrites of the ORNs, while the ORN somata lie within the
antennular lumen. (C) A cross section of a single aesthetasc sensillum shows the cluster of
somata surrounded by auxiliary cells, projecting their dendrites into the shaft of the
aesthetasc. The axons of the ORNs project to the olfactory lobe of the brain, where they
make their first synapse.


































































Inner
dendritic
segment





lOO.r









(ORNs) are clustered like bunches of grapes on the ventral aspect of the antennular

lumen. The ciliated dendrites of these bipolar neurons extend into porous cuticular

sensilla (aesthetascs), while the axons project to the CNS. Each sensillum has a cluster of

about 320 associated ORNs, and there are some 1500 aesthetascs per antennule (Grlnert

and Ache, 1988). The outer dendritic segment of the ORN is the site of olfactory

transduction and consists of only plasma membrane surrounding microtubules and

cytoplasm (no endoplasmic reticulum or mitochondria are present) (Grilnert and Ache,

1988).


Both cAMP and IP3 underlie lobster olfactory transduction

Individual odor molecules can either excite or inhibit a single ORN, but show

both capabilities across the ORN population (McClintock and Ache, 1989; Michel et a.,

1991). These opposing effects are due to the activation of different conductances: a K

conductance mediates the suppressive effect (Michel et al, 1991), while a non-selective

cation conductance underlies excitation (Schmiedel-Jakob et al., 1989; 1990).

These opposing conductances are mediated by cAMP and IP3 (Figure 3) (review

Fadool and Ache, 1994). Rapid kinetic measurements of second messenger production in

vitro show the elevation, in the dendrites, of both cAMP and IP3 in response to odor

exposure (Boekhoffet al., 1994) (Figure 4). Drugs targeting the cAMP pathway perturb

the inhibitory response (Michel and Ache, 1992), and cAMP directly gates a K+

conductance in ORN dendritic plasma membrane (Hatt and Ache, 1994), linking cAMP

to the inhibitory response. The excitatory response is affected by drugs targeting the IP3

pathway (i.e., heparin) (Fadool and Ache, 1992). Intracellular injection of IP3 mimics

the excitatory response (Fadool and Ache, 1992). IP3 directly gates two conductances of

different magnitudes in inside-out patches of cultured ORN somatic plasma membrane

(Fadool and Ache, 1992) and ORN dendritic plasma membrane blebs (Hatt and Ache,




























Figure 3. The lobster ORN dendritic plasma membrane supports at least two transduction
pathways, one mediated by cAMP and one by IP3. In both of these cases, odors activate the
enzymes adenylyl cyclase or phospholipase C via a receptor/G protein cascade. The evoked
messenger molecules then directly gate ion channels in the membrane. Na+ entering the cell
(possibly via the IP3-gated channel) activates an additional membrane channel, and may
serve to amplify the odor-evoked receptor potential. In the IP3 cascade, diacylglycerol
(DAG) is produced, along with IP3, with the hydrolysis of the membrane phospholipid
phosphatidylinositol 4,5-bisphosphate (PIP2).
















calcium selective
non-selective Na activated
cation channel channel


10:7


D


INHIBITORY EXCITATORY
PATHWAY PATHWAY
t d n/
Net depolarization




























Figure 4. Fast kinetic measurements of the second messengers cAMP and IP3 in ORN
dendrites as elicited by the odors taurine (A) and proline (B). Dendritic membrane
preparations were stimulated by individual odors before quenching the reactions and
measuring second messenger levels by radioimmunoassay. Both odors elevate both
messengers. However, the odor more likely to excite ORNs across the population (taurine)
elevates IP3 to a greater extent than cAMP, while the odor more likely to inhibit ORNs
across the population prolinee) elevates cAMP to a greater extent than IP3. From Boekhoff
et al.(1994), with permission.




































IP3 [pmol/mg
-800 81





600 6





400 4


-200 -100 0 100 200 300 400 500 600
Time [msecl

100o M Ta-urne


B
cAMP Ipmol/mg)


IP3 Ipmol/mg]


00 800





00- 600





00 400





00 0








-200 -100 0 100 200 300 400 500 600
Time [msec


100 pM Prol.n


cAMP Ipmol/mgi


2









1994). When a cell-free patch containing a large conductance IP3R was inserted into the

cytoplasm of a second cultured ORN ("patch-cram"), application of odor to the ORN

induced channel activity in the inside-out patch (Fadool and Ache, 1992), implying odor

induced generation of IP3 in the recipient ORN, an observation confirmed by Boekhoff

and colleagues (1994). Together, these data implicate IP3 as the "excitatory" second

messenger.


The lobster olfactory IP, receptors

The IP3-gated conductances described by Fadool and Ache (1990) and Hatt and

Ache (1994) must be definitively localized to either the dendritic plasma membrane or to

the endoplasmic membrane (the best understood location of IP3Rs). This is an important

point, as it would have great implications for the nature of the excitatory odor response:

the elicited IP3 could directly gate a plasma membrane channel, depolarizing the ORN by

increasing the conductance of ions across the membrane, or it could release Ca" from

intracellular stores, and this tertiary messenger would indirectly depolarize the ORN.

While one could argue that patches from cultured ORN somata might include ER

membrane, the patch recordings from dendritic blebs takes advantage of the

morphological feature that the outer dendrite contains no membranous structures other

than plasma membrane (Grilnert and Ache, 1988). Additionally, the drug thapsigargin,

which blocks the Ca -ATPase responsible for refilling IP3-depleted Ca2+ stores, did not

affect the odor response (Fadool and Ache, unpublished results), as would be expected if

this response were mediated by the release of Ca+ from intracellular stores. It is

therefore unlikely that the lobster olfactory IP3Rs are localized to the endoplasmic
reticulum.

Lobster ORNs express two different IP3Rs. In inside-out patches from cultured
ORN plasma membrane, the two IP3-gated channels showed conductances of 74 pS (large









channel) and 30 pS (small channel) (Fadool and Ache, 1992); two IP3-gated channels of

similar conductances (64 pS and 27 pS) were recorded in situ from dendritic membrane

(Hatt and Ache, 1994). The large and small conductance channels were found in the

same patch of membrane only twice, and exhibited different voltage dependencies of the

open probability (Fadool and Ache, 1992; Hatt and Ache, 1994). Both of these findings

are consistent with the hypothesis that the two IP3Rs are differentially expressed across

the population of ORNs. Whether these two IP3Rs are the products of different genes,

splice variants of the same gene, or are modified (e.g. phosphorylated) forms of the same

protein is unclear.

Structural similarity between the IP3Rs in the plasma membrane of the lobster

ORNs and the mammalian cerebellum is implied by immuno-crossreactivity. A

polyclonal antibody, raised against the carboxyl-tail of the rat cerebellar type 1 IP3R,

increased the odor-evoked current over 400% when injected into the soma of cultured

ORNs and, when copresented with 10-7 M IP3, the antibody increased the probability of

opening and the mean open time of both large and small conductance channels without

affecting the channel conductance (Fadool and Ache, 1992).

Lobster olfactory IP3Rs display important functional differences and similarities
with vertebrate IP3Rs. The lobster IP3Rs are functionally insensitive to ATP (Fadool and

Ache, 1992), even at high concentrations (up to 50 mM), unlike mammalian and

amphibian IP3Rs (Bezprozvanny and Ehrlich, 1994; Stehno-Bittel et al., 1995).

Preliminary evidence indicates that the lobster IP3Rs mediate nonspecific cation

conductances (Fadool and Ache, unpublished data) similar to intracellular IP3Rs
(Bezprozvanny and Ehrlich, 1994; Stehno-Bittel et al., 1995).








G proteins mediate lobster olfactory transduction

As described above, both the cAMP and the IP3 second messenger cascades rely

on a heterotrimeric GTP-binding protein (G protein) composed of a-, P- and y-subunits to

transduce the signal between the ligand-activated receptor and a downstream

metabolizing enzyme (e.g., adenylyl cyclase for cAMP or phospholipase C for IP3). In

lobster ORNs, the use of nonhydrolysable GTP analogs has demonstrated the necessity of

such proteins in olfactory transduction (Fadool et al., 1995). The identity of the G

protein involved in the inhibitory odor response has not been identified [though it is

clearly not the same as the one involved in the excitatory odor response (Fadool et al.,

1995)]. Two candidate a-subunits have been implicated in the excitatory odor response

(Fadool et al., 1995): a Gaq/ll of the Gq family, and a Geo of the Gi family. Only the

Gaq/,i protein has been localized to the ORN dendrites. These studies involved the use
of antibodies to conserved regions of these proteins, so the G proteins that may function

in the excitatory pathway must be isolated and characterized.


Specific Aims

In this project, I have attempted to address the following question: Is the

excitatory odor response in lobster ORNs mediated by common components of an IP3

signaling cascade? This dissertation presents a series of experiments designed to isolate

and partially characterize two components of the lobster excitatory odor transduction

pathway: an IP3 receptor and a Gq protein. I have used a cloning strategy based on

homology to known proteins to isolate and determine the primary structure of cDNAs for

these two molecules from the lobster olfactory organ. I have demonstrated that these two

molecules are expressed, as messenger RNAs, in the olfactory organ, a requirement for

any protein involved in olfactory transduction. Together, these data demonstrate two

fundamental principles: first, two transduction molecules, physiologically implicated in






16


the excitatory odor response, are present in the olfactory organ; and second, these

molecules appear to share many features of primary structure with similar proteins in

other IP3 signaling cascades. These two molecules are the first components of the IP3-

mediated olfactory transduction pathway to have both structure and function

characterized .














CHAPTER 2
MOLECULAR AND IMMUNOLOGICAL CHARACTERIZATION OF AN
OLFACTORY ORGAN IP3 RECEPTOR


Introduction

Physiological and biochemical evidence implicates inositol 1,4,5-trisphosphate

(IP3) as well as adenosine 3',5'-cyclic monophosphate (cAMP) as olfactory second
messengers (reviews: Breer and Boekhoff, 1992; Ache, 1994). Though IP3 plays a

primary transduction role in many invertebrates, the precise functional role of IP3 is less

clear in vertebrate ORNs (e.g. Firestein et al., 1991; Nakamura et al., 1994; Kleene et al.,

1994; Nakamura et al., 1996; Brunet et al., 1996), where this messenger may serve as a

modulatory factor, a required cofactor, or as an excitatory or inhibitory second messenger

acting in parallel to the cAMP pathway. But in contrast to the cAMP transduction

pathway, where many of the major molecular components have been cloned, sequenced

and localized to the transduction zone (Jones and Reed, 1989; Bakalyar and Reed, 1990;

Dhallan et al., 1990; Bradley etal., 1994; Liman and Buck, 1994), the IP3 pathway has

been minimally characterized at the molecular level. Notable exceptions include a

phospholipase C from catfish (Abogadie et al., 1995b) and Gq proteins from two species

of lobster ( Caribbean spiny lobster: Munger et al., 1997; American lobster: Xu et al.,

1997) and Drosophila (Talluri et al., 1995).

In olfactory systems, the binding of some odor molecules to G protein-associated

receptors is thought to activate the enzyme phospholipase C, which hydrolyses the

membrane lipid phosphatidylinositol 4,5-bisphosphate into IP3 and diacylglycerol (Breer

et al., 1990; Boekhoff et al., 1990; Berridge, 1993; Ronnett et al., 1993; Boekhoff et al.,

1994). The IP3 can then gate the intrinsic channel of IP3 receptors (IP3Rs) on the plasma









membrane of ORN cilia or outer dendrites (Fadool and Ache, 1992; Hatt and Ache, 1994;

Restrepo et al., 1990; Restrepo et al., 1992; Lischka et al., 1995). IP3Rs have been

traditionally thought to be principally localized to the ER and nuclear membranes

(reviews: Furuichi et al., 1994; Ferris and Snyder, 1992), but there is growing evidence

for the presence of IP3Rs in the plasma membrane (e.g. Restrepo et al., 1990; Fadool and

Ache, 1992; Fujimoto et a., 1992; Restrepo et a., 1992; Khan et al., 1992; Sharp et al.,

1992; Hatt and Ache, 1994; Lischka et al., 1994; Kuno et al., 1994; Khan et al., 1996)

including the immunological localization of an IP3R to the cilia (as well as other

compartments) of rat ORNs (Cunningham et al., 1993) and the description of a protein in

catfish ORNs affinity labeled by an 125I-IP3 analogue (Kalinowski etal., 1992); this latter
protein, however, is half the size (107 kDa) of all other known IP3Rs.

The primary structure of numerous vertebrate IP3Rs has been determined by cDNA

cloning (e.g. Yamada et al., 1994; Yamamoto-Hino et a., 1994; Maranto, 1994; Furuichi et

al., 1989; Mignery et a., 1990; Sudhof et a., 1991; Blondel et a., 1993; Kume et al., 1993)

as well as Drosophila (Yoshikawa et al., 1992). All of these cloned IP3Rs are homologous,

sharing the same basic structural motifs (Figure 5). Multiple isoforms, types 1, 2 and 3,

have been identified in mammals; they possess 60-70% sequence identity and appear to

vary only in sensitivity to modulation, affinity for IP3 binding and tissue distribution. The

IP3R proteins consist of 2693-2833 amino acids, coded for by an mRNA of 9-10 kb, and
have three functional domains: an IP3-binding domain, a central modulatory domain, and an

ion channel domain. The IP3-binding domain lies within the first 650 amino acids of the

IP3R [amino acids 476-501 are labeled by photoaffinity ligands (Mourey etal., 1993)]. The
type 1 IP3R contains the first of two short, alternatively spliced regions (SI) within the IP3-
binding domain. The modulatory domain lies between the IP3-binding and channel

domains, and may contain consensus sites for ATP binding and protein kinase A

phosphorylation, along with several calcium related signals and the second






























Figre 5. IP3Rs all contain three principle domains: a ligand binding domain (IP3) at the
amino end of the protein, a central modulatory domain, and a channel domain with six
transmembrane regions (MI-M6) and a putative pore-forming region. Both the amino and
carboxyl termini are extend into the cytoplasm (this is true for receptors on the endoplasmic
reticulum as well as on the plasma membrane). The channel is thought to be a nonselective
cation channel. Modified from Mikoshiba, 1993.















Ca2+/Na+


HOOC





cytoplasm


extracellular/luminal


After K. Mikoshiba, 1993.









splice site (SII; in type 1); the number and types of these consensus sites varies among IP3R

types and among species, and some sites (i.e., protein kinase C phosphorylation sites) are

as yet undefined (review: Furuichi et a., 1994). The channel domain contains six putative

transmembrane regions [as defined by hydrophobicity and N-linked glycosylation sites

(Michikawa et al., 1994)] and a carboxyl tail thought to be involved in calcium release

(Nakade et al., 1991). The channel pore is thought to lie between the last two

transmembrane regions, 5 and 6 (Michikawa et al., 1994). It is the final two transmembrane

regions and the carboxyl tail that show the greatest similarity in protein sequence to another

intracellular calcium release channel, the ryanodine receptor. Although these cation

channels are relatively nonselective (Bezprozvanny and Ehrlich, 1994; Stehno-Bittel et

al., 1995; but see McDonald et al., 1993), their main role is thought to be the release of

calcium from intracellular stores in response to an IP3-mediated extracellular signal

(review: Berridge, 1993).

Lobster olfactory IP3Rs display important functional differences and similarities

with vertebrate IP3Rs. The lobster IP3Rs are insensitive to ATP (Fadool and Ache, 1992),

even at high concentrations (up to 50 mM), unlike mammalian and amphibian IP3Rs

(Bezprozvanny and Erhlich, 1993). Preliminary evidence indicates that the lobster IP3Rs

mediate nonspecific cation conductances, similar to intracellular IP3Rs (Fadool and Ache,

unpublished data).

Cunningham and colleagues (1993) provided evidence that rat ORNs express an

IP3R in cilia that is somewhat similar to the cerebellar type-I IP3R But the antibodies used

in these studies cross-react with all three IP3R subtypes; so we cannot be sure whether the
IP3R in ORN cilia is the same as that expressed in cerebellum, or if the olfactory IP3R is

similar yet not identical IP3R form. In this chapter, I describe the isolation of an IP3R

cDNA from the olfactory organ of the spiny lobster, Panulirus argus. This IP3R is

expressed in both olfactory organ and brain. Attempts to localize this IP3R to the ORN

dendrites--the site of olfactory transduction--are inconclusive, so the involvement of this









particular IP3R is involved in shaping the initial odor response remains unproven. Portions

of this work have previously appeared in abstract form (Munger et al., 1995; Munger et al.,

1997).


Methods

RNA extraction: Olfactory organs (100 antennules per isolation) were harvested

into a dry ice/ethanol bath, transported from the Florida Keys to the Whitney Lab on dry

ice, and stored at -800C until used. The antennules were homogenized in liquid nitrogen

by mortar and pestle, then the powder was homogenized by polytron in a GTC/P-

mercaptoethanol solution (sarkosyl added to 2% after homogenization). After removing

cuticle by centrifugation, the homogenate was layered onto a 5.7M CsCI cushion for

ultracentrifugation (24 hours, 20C, 30,000 rpm in a Beckman SW-41 rotor). The RNA

pellet was resuspended in 10 mM Tris-HCl (pH 8.0), 1 mM EDTA-SDS,

spectrophotometrically quantified, and stored in ethanol with 0.3 M sodium acetate, pH

5.5, at-200C.

RT-PCR: IPJ-R Degenerate oligonucleotide primers were designed to match

regions of conserved nucleotide sequence within the final putative transmembrane region

(amino acids FFVMVIIIV, sense primer) and the carboxyl tail (amino acids

EHNMWHY, antisense primer) of known IP3Rs. Total RNA from nose (10 pg) was

reverse transcribed with SuperScript II M-MLV reverse transcriptase, using the antisense

primer. The resulting cDNA served as template for touchdown polymerase chain reaction

(PCR) amplification. The PCR reaction mixture contained 100 pmol of each primer, 5%

of the reverse transcription reaction volume, 2.5 units of a 60:1 mixture of Taq:pfu

polymerases, 1.5 mM MgCl2, 500 mM KC1, 100 mM Tris-HC1, pH 9.0 and 1% Triton X-

100. The PCR cycling profile was as follows: [94C, 5 min; 600C 2 min; 72C, 3 min]

x 1 cycle; [94C, 1 min; 590C (- PC/cycle), 1 min; 720C, 2 min] x 9 cycles; [940C, 1









min; 520C, 1 min; 720C, 2 min] x 30 cycles. The resulting 203 bp product was gel

purified, ligated into the TA-cloning vector pGem-T (Promega), and transformed into

JM109 competent E. coli for subcloning. Control RNA samples, which were treated as

above except for receiving no reverse transcriptase, showed no product. After screening

colonies for appropriately sized inserts by PCR, individual clones were selected for

sequencing by standard chain termination methods (Sanger et al., 1977). Seven clones

(78/79-1 through 78/79-7) were fully sequenced, and the cDNA sequences were

translated, assembled and analyzed with GeneRunner (Hastings Software, Inc.) and

Biolmage DNA Sequence Film Reader software (Biolmage). The deduced amino acid

sequences were compared with all known proteins using BLAST software (NCBI,

Altshul et al., 1990).

3-RACE (Rapid Amplification of cDNA Ends): The 3'-RACE technique is

modified from Frohman et al. (1988). Total RNA from nose (10 ig) was reverse

transcribed with an oligo-dT17 /Not I oligonucleotide. The resulting cDNA served as

template for the first round of PCR amplification; the oligo-dT primer and a primer

specific to clone 78/79-1 were used. The PCR product then served as template for a

second round of PCR amplification in which the same oligo-dT primer and a nested

78/79-1-specific primer were used. The resulting product of 643 bp (clone 3R2A) was

purified, subcloned and sequenced as described above.

Creation of cDNA minilibrary and library screening: A unidirectional cDNA
minilibrary was constructed in the bacteriophage Xgt22A vector system (Gibco-BRL

Lambda System) from olfactory organ poly(A)+ RNA. cDNA ligated into the X arms
was reverse transcribed with the antisense degenerate primer (see above) coupled to a

Not Iadapter. The library was screened by plaque hybridization at high stringency
(600C) using clone 78/79-1 as probe. A 1707 bp clone (1111-2), which overlaps with

clone 3R2A, was isolated. Clone 1111-2 maintains homology to other IP3Rs. Three









more overlapping clones (56/25H3, 1272 bp, 62/25N2, 938 bp, and 3/144H2, 2386 bp)

were also isolated from the library by PCR.

5'-RACE (Rapid Amplification of DNA Ends): 5'-RACE was modified from
Frohman et al. (1988) with the 5'-RACE kit (Life Technologies). Total RNA from nose

(10 tg) was reverse transcribed as above with an IP3R-specific antisense primer, and a

poly(C)+ tail was added to the 3'-end of the antisense single strand cDNA with terminal
transferase. The resulting cDNA served as template for the first round of PCR

amplification using a nested antisense IP3R-specific primer and an anchor primer to the

poly(C)+ tail (Sal I-Spe I-GTACGGGIIGGGIIGGGIIG, where I = inosine). The same
anchor primer and a second nested IP3R-specific primer were then used in a second round

of PCR amplification with the PCR products serving as template. The resulting products

were purified, subcloned and sequenced as described above. Control RNA samples,

which were treated as above, except that they received no reverse transcriptase or no

terminal transferase, showed no product. PCR reagents for both reactions were: 50 pmol

of each primer, 20% of the tailed cDNA (or 0.1% of the first PCR reaction), 1.5 mM
MgCl2, 500 mM KCI, 100 mM Tris-HC1, pH 9.0 and 1% Triton X-100. PCR cycling

times were as follows: [94C, 5 min; 490C, 2 min; 720C, 3 min] x 1 cycle; [940C, 30

sec; 490C, 30 sec; 720C, 2 min] x 30 cycles. Sequencing, translation, assembly and

analysis was done as above. A second 5'-RACE reaction was performed for the IP3R to

reach the 5'-UTR. Sequencing, translation, assembly and analysis was done as above;

some clones were sequenced by the University of Florida's Interdisciplinary Center for

Biotechnology DNA Sequencing Core Laboratory using the Taq DyeDeoxy Terminator
and Dyeprimer Cycle sequencing protocols, developed by Applied Biosystems, and the
Applied Biosystems Model 373A DNA Sequencer.

To control for errors which may have resulted from the actions of the DNA
polymerases or the reverse transcriptase, four overlapping clones, which together spanned









the entire contig from the 5'- to the 3'-untranslated regions, were amplified in duplicate,

independent RT-PCR reactions, and a consensus sequence was taken.

Ribonuclease Protection Assay (RPA): This assay was done according to the
protocols accompanying the RPA II kit (Ambion). RNA samples (1.5 and 3 fg nose

poly(A)+ RNA and 5 and 10 pg brain total RNA, along with yeast RNA controls) were
hybridized in solution to a 32P-labeled antisense riboprobe transcribed from clone 79/79-

1. The RNA samples were then subjected to RNase digestion (RNase A and T1) and

separated on an 8M urea/5% acrylamide gel. One of the yeast controls did not undergo

RNase digestion. The gel was exposed to X-ray film for 18 days at -800C with

intensifying screens.


Results


cDNA cloning

The 203 bp cDNA product obtained from the initial RT-PCR was subcloned,
sequenced, and conceptually translated. Seven separate clones (79/78-1 through 79/78-7)

were sequenced and were found to be identical in nucleotide sequence. A comparison of

the deduced amino acid sequence with sequences in the GenBank database revealed that

these products are homologous to previously cloned IP3Rs (they are less similar to the

ryanodine receptors, which share some primary structure with IP3Rs). The clone was

extended to the 3'-untranslated region (UTR) by 3'-RACE (clone 3R2A). To obtain the

remainder of the clone extending into the 5'-UTR, a cDNA minilibrary was constructed
in Xgt22A from olfactory organ poly(A)+ RNA reverse transcribed with the antisense
degenerate primer used in the initial RT-PCR experiment. This library was screened by

a combination of plaque hybridization and PCR to isolate a series of overlapping clones.
The minilibrary apparently contained no clones that extended to the 5' UTR, so 5'-









RACE was used to isolate the remainder of the coding sequence. Four overlapping

clones, which together spanned the entire open reading frame, were amplified in duplicate

RT-PCR reactions (data not shown), and the consensus sequence across all three clones

was taken. One of the original partial clones (1111-2) contained an intron that was not

present in any of the subsequent confirmatory clones; this was the only intron sequence

isolated from any of the clones, and no alternatively-spliced variant was ever isolated.

The assembled full-length clone has an open reading frame of 8409 bp coding for

2803 amino acids (Figure 6). The predicted protein has a calculated molecular weight of

320 kDa. The initiating methionine selected is the first methionine in the open reading

frame, and a consensus intiation sequence (Kozak, 1991) is present at this point. The

protein contains several residues predicted to be subject to posttranslational modification,

including one consensus site for extracellular N-glycosylation (N2310), three possible sites

for phosphorylation by protein kinase A (S1001, S1051, S2509, the latter of which is present

in the predicted pore-forming region of the channel) and one putative site for tyrosine

phosphorylation (Y 32). All these sites await experimental evidence as to their relevance

for the native protein. However, unlike many vertebrate IP3Rs, there is no consensus

sequence for ATP binding, though there is a related NAD/FAD consensus binding

sequence.

The deduced amino acid sequence for the full-length clone is homologous to

other IP3Rs [Figure 7--NCBI sequence identification numbers in parentheses;

Drosophila: 51% (266387); human type 1: 49% (1362832)]; it shows equivalent

similarity to type 2 IP3Rs, but is less similar to type 3 IP3Rs, and is clearly only distantly

related to ryanodine receptors, with the greatest similarity seen in the channel regions.

Like other IP3Rs, the putative pore-forming region of the channel domain (between the

fifth and sixth membrane-spanning regions), is poorly conserved. The entire lobster IP3R

sequence seems to maintain the distribution of conserved and variable regions that has

been seen in the other IP3Rs. One portion of the sequence, however, stands out as being





























Fige 6. The nucleotide and deduced amino acid sequence of the lobster IP3R cDNA.
The coding region of 8409 bp encodes 2803 amino acids. The target sites of the
degenerate primers used in the initial isolation are indicated in gray with arrows. The six
predicted transmembrane regions (Ml-M6) are indicated by underlines. Consensus
motifs for one putative N-glycosylation site (arrowhead), 3 potential sites for protein
kinase A phosphorylation (stars) and a putative tyrosine phosphorylation site (filled
circle) are seen.














IEiTeacCTO YUUmeTmeanoranTWea a acIaonmarcmanaamraam~ahucn

1)1 II~VCU~LTCICTCI~~CTNIorIeas~ms

lin ATTamUIEnetarc~mCroman~mcr~mWarIcntr~cmLmmcasaa a anoamCen4Tcc

(4 a" ;dd odod7lva1 oa e oomrmmn .cie~. r












.2."1 4 Tda."r/n' 4, LC I=,"LL2C U7 e ided.. .7 J

2 a a c sa e naTw s as n m n r
111 C* or noTUIICevrosysvpIssTzTsIrsFIeUr IT*
xula n ran cunr0m mm n uaaxrar a ec m r m


lei CULTarmersarsovTvUTxCynoIoran-rseveUxRAKK





1Isa m(LacaTCCLTTesErcmmncaansummammammIuwan To

dr iwed ,i cm e J! '-41 A lodi. .

1 ranc A came Aac cm Amamma c~m ma~lT~n 7 ewo m









2~ manan axTM Tcucans Ts acancqu e sma ccar






2 TonDw swammmount ma~LI nrCrms aic nmrmman Tomm

*s .A IIOUSOF* aIrl ea 4id eeald.^ ."""d.les"o

19^11 7 L ".J.^ J..'.. ."."J..7.7? 7. "cl ". .^.7.117,17













re1 ~aramTUa T IICman 7 CPG mA maLTcTmaaam c

mT rlr a can a s rmaea as rmur c

Tco c an ar~rr~c rr~om AT canmrmanaM mc








29






















































"- M3
B1e LTCAmAL L Im r l IIuFr N VTc V ThDN 1 A T A AGTOOUCI





v1 -. m -. -. ... .. .. ,. .
I A I I T I I

T14* 1 TG TIGIaTn C aG T I I T IIa IIM I T


















I I V I g I I I I L T L ._Y V I r L f






-- M


Figure 6--continued





























Figure 7 The lobster IP3R protein is aligned with an IP3R from Drosophila (NCBI ID:
266387) and a type 1 IP3R from human (NCBI ID: 1362832). Shading indicates amino
acids conserved between the lobster protein and at least one of the other two proteins.
The six transmembrane regions (M1-M6) are indicated by underlining. A unique
hydrophilic region, rich in lysine residues, is seen at amino acids 1159-1186.

























Lobster ,.. I ...-1s600606,L00108v007I5L v06610w 00101601,Lr00S13fl00w,1s
Drosophila I II0-- l iaIIBVSS LBOOIVBLTAV S vclSaTL6OLV0DMTVVCtPZOAC1PL rflSC-LB 5 ISTBaX* r Qaxat..H
Human I KD -L nL

9i L1BL U0SS0I0S23ZNEIaL O5500T100000- I XI 85lt 00vVLPSLLI Si.lll~flfDl085I1015NI701110i0


1077 iL fL t AAhT lAI.L t la.-. I S LuI r aS-LZn. 61n 2.r 1flXh... ...* L 3..B.tat1 ..OU f ..5

2Si ...f...Ti 6IA ia i BL'iO I li 'iVLM a rit. dui fi 6 T ;



ill 1,.HTiLIIiVTiDa1:0I i1 ib- IIi. l i a ll A.*..rLAA I L 1 : 1 .U1.. .Ip 6D .
231 .rv-t6 i6 .f It l !I-ifk 6Lir. i6 t Cl lriir0i tf l f l -l..Li.. i6. .i6i.





158 Ll "fi 61.IaDb 'Saf P.6ftlF r: -.iL ni A: I D r *. ;i- t l i i i. Ml- ili
si7 a:I tLLdLP : 6 Q0L6 I.: 5 1600 : .6..fl6,.T .IrwL n .6 -6i6 .rLia :Ic i y6,ojyv61.6z fii l.,riBYs6.6 66U *. *.flhfN i



f I I IQ T.... I L.fl. 1 -ar 3i6&06*T,6 .9 b064.*50

50 *LI rtS ;50flDa 0106f 16t, 06016d6'50f0I 1.fla6t0 oIasfll qaL t ylltT l m OL G ; I.6fl50rLLS8




63a 1S. SL!IIfA 60i.i O'U.li6i i 6i e.V-li.f 6i 6l rIWi3 ISI I il-Yi i LJlIA E 'Sl

513 -LL* 1-0': m*T. 7LD6r60L .i 651 L-I itT.*L LN5a_ _A :B.- LI .I;a L .6S mlf n




1167ll I E ifl nlnLI Di &&Ar lWl l aIP. .:iDLiB 6 IP *.3 Sl" P I U
605 6aKaS5*650A66i 7506.506 5'I 6 *kflflU.J rIn. IT i i 6 IQMLTlSAiaI'A SKaPE







l64e6661 6l3Mu lr!1 1. l.6* ... Is D 6.B6 .6 66 n L T lZ*a L
71T4 aia6"aA1i.Oa i.ii-in.a. 6 hai 'lul6 ". : ALCA .66, Ii6 E*ifF O 6.f
















1167 _:Ta'5'i6Y6..IIP ii. a'6L03.i666 a.6.aaaOLLLO6*lDbV




11061610 75*66TF~aP'61L36*153011.aa6101a.070616 160.55Y~i P165610...*5 Dp77fl5
























( ~~1 -. 1 0 Rnv00L00l3Tl0V011501rR1 a sICV0 QL1519DVLV7ERAsr0M50116 1ll3MA32R1ML1 0S0PL0y0vBI0LLt cC7KrltlA



LIe_ IT .... IPLLOTIV I. .... I. .....LVB.S..R LDD .S-LTMILV LVT
1460 01307 T1020.0OI0C0aL 0DI !eBC2 VK2A0017N20580030 li3 0iISL3i2lV21L 5010f l11050.25i52I0

1523 01051CB7L7NLDD8IV5lCBETCKEl20vnLtL7ICIDTE03E3RVflOC05lTBI1a50BIB5I50- klsolOnsu.

1581 0G0551.LLG03P19flO2I1000UIf2L L011000C5 LS0LGOR2FV3NCZ1T11S3K0RS0AL X5L31 T8S0TALT
1482 Bl 2Vei5VT P7S BaTTL3RQPVVQ0LL0VRVyH Lw3LBSaQ SVSCIRBD sKRAZIAIPVDcDSOVtNLr;saV

1611 TR*85sKWSBRLT0RDAs SS00laGHM688 2 L0V DNSVV0v5010006l8VA103LB0 L 2 1I5fl70R2 ROBai3KC1l0SR25 I IIaC

1573 l-TA .RLSRA IRRDSVL.AASRD~ L ai RE llV ,. '-ZR ,DIII, ,l ,l Er RI








11t2 12 6621 ,* ; r. .. .. .. *. L .'.. .. i .F I .

11i6 L 4. MI ...I ..i3 -3 5: l 2..5-.r" ii5 3 5 '101 "3.- 3n333 332112 *.r *w5i 5 3A m








1321 .a05 OfC 3.; 1.3iT Oii B.ill3It; .lt. 33. LBL3l,:iAX B3 B. B'i .I lS. li..y2I


2160 r i'B ll... i2. 1 .. T i iL -.3 ; l L .. i .. .. .L eirl Iar 1: Ki L illn v T A rm f









208 53[U3 Ql2f E12 L, LL3330-;fII fI1D&r5i23EL2S0L. .*'C,. 3L5. .513T3f.
2115276 1Trg'rmoxg L.sll. : T i3TL.5I L. D5n. BLD t;2.8 N3 ,f3 5 '. L m F12 u5




























2209 3 1b.r- ,' 2&0...T,3r fT- Er( f.7.. l.' :LS0 L2 I .. 3- 5 .L 3i B. :LB0:1m:.3 oat5 3 l' 3 *L3.73 rT0 2 ri
200517 .-l T.L A AI. .. OA. ...... .....
2201 Q ..ol 5.-H. 2 IQ. A- 3 ....r3,



















2911 R232.4L 130813258 T-M I- PIINAs
2001 53330L155 2LL- ----------
11I IP*~L~PlllYUPP s-----------


Figure 7--continued








completely unrepresented in the other IP3Rs identified to date: amino acids 1159-1186, a
lysine-rich, hydrophilic stretch, is not present in any other IP3R (Figure 7). Searches of
GenBank with this amino acid sequence revealed no matches with known proteins which
might unveil a possible function for this portion of the protein.


Ribonuclease Protection Assay

To verify that the source of the IP3R cDNA was indeed olfactory organ RNA, a
3P-labeled riboprobe representing a portion of the cloned IP3R ribonuclease protection

assay was used to probe for the IP3R message in extracts of olfactory organ poly(A)+

RNA. A riboprobe translated from the original 203 bp product was incubated with

olfactory organ total RNA under high stringency conditions, producing a protected band

of the appropriate size (Figure 8). A protected band was also seen in an assay of total

RNA from brain. No protected bands of the appropriate size were seen when control

hybridizations were done with yeast RNA controls.


Discussion

The cDNA identified in this study shows much structural similarity to known

vertebrate and invertebrate IP3Rs. As with other IP3Rs, the greatest conservation is seen

at the amino end, the location of the IP3-binding domain, and the carboxyl end, the site of

the channel portion of the molecule. A greater degree of variability is seen in the central,

modulatory domain. Six hydrophobic domains correspond to the putative transmembrane

regions of other IP3Rs (Figure 7). The putative pore-forming region between the final

two transmembrane regions, M5 and M6 (Michikawa et al., 1994), shows almost no

sequence conservation: why a family of channels with a presumably similar ion

selectivity exhibit such divergence in the pore sequence is unknown. There are three

protein kinase A substrate consensus motifs, numerous protein kinase C and casein kinase

II motifs, as well as one extracellular site for N-glycosylation and a site for tyrosine





























Figure 8. A ribonuclease protection assay, probed with a 203 bp riboprobe transcribed
from a portion of the lobster IP3R. An appropriate sized protected band is seen in nose
poly(A)+ RNA (1.5 and 3 gg) and in brain total RNA (5 and 10 ig) (indicated by arrow),
but not in the yeast + RNase control. A strong, smaller sized band is seen both in the
experimental and the yeast control lanes. A yeast control with no RNase treatment shows
the undigested probe; residual undigested probe is seen in all experimental lanes running
at 350 bp.
















<



bases -
700
600-
500 -
400 -
300- ,


200 -





100-









phosphorylation; whether or not these sites are functional in the native protein remains to

be determined.The IP3R encoded by this cDNA is structurally consistent with those

characterized by Fadool and Ache (1992) and Hatt and Ache (1994). Both groups saw

channels with similar physiological and pharmacological properties to those of ER IP3Rs

(e.g. Bezprozvanny and Erhlich, 1994), including similar conductances and a sensitivity

to heparin. However, the lobster olfactory IP3Rs are insensitive to ATP (Fadool and

Ache, 1992), which is known to modulate vertebrate IP3Rs by increasing the channel

open probability (Bezprozvanny and Erhlich, 1993). The cloned lobster IP3R described

here has no consensus motif for ATP-binding, though it does share an NAD/FAD-binding

site (Sternberg and Taylor, 1984; Zheng et al., 1993) with other IP3Rs (the Drosophila

IP3R also lacks an apparent ATP-binding site, but its ATP sensitivity is unknown). This
insensitivity to ATP may be typical of calcium-release channels in lobsters, or arthropods

in general, rather than be representative of plasma membrane IP3Rs, as a ryanodine

receptor characterized in American lobster is also insensitive to ATP (Seok et al, 1992).

The ribonuclease protection assay shows that the IP3R message is expressed in

both olfactory organ and brain (Figure 9), though at much higher levels in the latter. As

the probe was directed against a somewhat conserved region of the coding sequence, it is

possible that these tissues are expressing similar, but different, messages. Proteins need

not be olfactory-specific to be important for olfactory transduction: expression in neural

tissue outside the nose is seen for several olfactory transduction-related genes, including

Gof (Drinnan et al., 1991) and the cAMP-gated channel (Kingston et al., 1996).
One region of the lobster cDNA does represent a protein sequence unique to IP3Rs
(Figure 7). Although the function of this peptide is unknown, it does resemble some

nuclear localization signals (Dingwall and Laskey, 1991); IP3Rs have been localized to

nuclear membranes (e.g., Sullivan et al., 1995) This region also contains a protein kinase C

consensus phosphorylation site (KI 160). Heterologous expression of this cDNA will not

only allow the characterization of this IP3R, but also the functional analysis of this unique









region. It is also critical to determine whether the spiny lobster expresses other IP3Rs, and

if so, whether these other IP3Rs share this same unusual sequence.

Though this IP3R shares some structural features consistent with the functional

properties of those characterized by Fadool and Ache (1992) and Hatt and Ache (1994), it

remains unproven that this cDNA encodes one of those proteins. There are no known

structural motifs indicating that a particular protein is involved in olfactory transduction.

The promoter region of the gene for this IP3R is uncharacterized, so whether it contains an

olfactory system-related transcription factor-binding site as is seen in vertebrates with Olf-1

(Wang and Reed, 1993; Wang et al., 1993) is unknown. While integral membrane proteins

contain signal sequences for insertion into membranes, none that differentiate between

endoplasmic reticulum and the plasma membrane are known. However, there is good

evidence that plasma membrane IP3Rs are similar in structure (e.g., Cunningham et al.,

1993), if not identical (Khan et al., 1996) to those localized to the ER. Therefore, the

similarity of the lobster IP3R to other IP3Rs cannot be seen as evidence for localization to

either the endoplasmic reticulum or plasma membrane. Antibodies against the encoded

protein must now be used to localize it to cellular compartments within the ORNs; in

addition, the channel must be heterologously expressed so that its functional properties can

be compared with those of the native channels.














CHAPTER 3
MOLECULAR CHARACTERIZATION OF AN OLFACTORY ORGAN GQ PROTEIN


Introduction

The transduction of many extracellular stimuli, such as neurotransmitters or light,

can be mediated by a signaling pathway that links receptors and downstream effectors

(e.g., ion channels or enzymes). Heterotrimeric GTP-binding proteins (G proteins) often

serve to couple these two signaling components (Neer, 1995; Hamm and Gilchrist, 1996).

Composed of a, P and y subunits, these G proteins bind to the activated receptor as well

as affect the downstream enzyme or channel, with many of the targeted enzymes

synthesizing second messengers (e.g. IP3 or cyclic nucleotides). The a subunits are the

best characterized of the subunits; they have been classified into four categories based on

sequence homologies: Gs, Gi, Gq and G12 (each family contains numerous members;

Neer, 1995). Although the a subunit was previously thought to be exclusively

responsible for the signaling capabilities of the G protein trimer, it is now established that

the py complex can itself activate downstream effectors in many systems (Clapham and

Neer, 1993; Hamm and Gilchrist, 1996).

No G protein has yet been functionally implicated in olfactory transduction. Well

before the discovery of a family of putative olfactory receptors (Buck and Axel, 1991)--

all members of a superfamily of G protein-coupled receptors that includes rhodopsin--the

mediation of at least some aspects of olfactory transduction by G proteins was established

(Pace et al, 1985; Sklar et al., 1986; Bruch and Kalinowski, 1987; Bruch, 1990). A

vertebrate G protein a-subunit, Gof (a member of the Gs family), has been cloned and

localized to the cilia of the olfactory receptor neurons (ORNs; Jones and Reed, 1989).









Golf is thought to activate a type III adenylyl cyclase that sythesizes the second messenger

adenosine 3',5'-cyclic monophosphate (cAMP); cAMP can then activate a cyclic

nucleotide-gated (CNG) channel in the ORN cilia plasma membrane. Other G protein a-

subunits are present in the vertebrate olfactory epithelium (Jones et al., 1988; Jones and

Reed, 1989; Menco et al., 1992; Abogadie et al., 1995a; Dellacorte et al., 1996); some of

them are unlikely to couple to adenylyl cyclase. In both vertebrates and invertebrates IP3

(in addition to cAMP) serves as an olfactory second messenger (Restrepo et al., 1990;

Breer et al., 1990; Boekhoffet al., 1990; Bruch and Teeter, 1990; Dionne, 1992; Ivanova

and Caprio, 1992; Miyamoto et al., 1992; Michel and Ache, 1992; Fadool and Ache,

1992; Lucero et al., 1992; Ronnett et at, 1993; Bacigalupo etal., 1993; Lischka et al.,

1995; Boekhoffet al., 1994; Lucero and Piper, 1994). Therefore, more than one G protein

a-subunit subtype might be involved in olfactory transduction. In the spiny lobster

ORNs, odor-evoked elevations of cAMP and IP3 mediate opposing conductances, with

cAMP triggering the inhibitory outward current, and IP3 the excitatory inward current

(Fadool and Ache, 1992; Michel and Ache, 1994; Boekhoffet al., 1994). Recently,

Fadool and colleagues (1995) used electrophysiological and biochemical techniques to

demonstrate that different G proteins mediate these two conductances. Although the G

protein involved in the inhibitory pathway remains unknown, two different a-subunits

were implicated in excitatory odor transduction: a Ga, from the Gi family and a Gaq or

Ga1l from the Gq family.

The precise nature of this Gq-like a-subunit must be characterized. In this

chapter, I present evidence for the presence of a Gq-like protein in the lobster olfactory

organ; this protein is consistent in structure and localization with the Gq-like a-subunit

previously implicated in the excitatory odor response in the spiny lobster, Panulirus

argus.

Portions of this work have previously appeared in abstract form (Munger et al.,

1997).












Methods

RNA Extraction Olfactory organs (100 antennules per isolation) were harvested
into a dry ice/ethanol bath, transported from the Florida Keys to the Whitney Lab on dry

ice, and stored at -800C until used. The antennules were homogenized in liquid nitrogen
by mortar and pestle, then the powder was homogenized by polytron in a GTC/P-
mercaptoethanol solution (sarkosyl added to 2% after homogenization). After removing
cuticle by centrifugation, the homogenate was layered onto a 5.7M CsCI cushion for

ultracentrifugation (24 hours, 200C, 30,000 rpm in a Beckman SW-41 rotor). The RNA
pellet was resuspended in 10 mM Tris-HCI (pH 8.0), 1 mM EDTA-SDS,

spectrophotometrically quantified and stored in ethanol with 0.3 M sodium acetate, pH
5.5, at-200C.

RT-PCR: RT-PCR experiments were done as described in Chapter 2 Methods
except as noted. Briefly, degenerate oligonucleotide primers were designed to a portion

of the Switch II region common to Ga's [amino acids KWIHCFE, sense primer AA(AG)
TGG AT(ATC) CA(CT) TG(TC) TT(TC) GA] and to the common carboxyl tail of Gaq
and GaoI [amino acids KEYNLV, antisense primer (ACTG)AC IA(AG) (AG)TT
(AG)TA (TC)TC (TC)TT, where I=inosine]. Total RNA from nose (10pg) was reverse
transcribed, as described, using the antisense primer. Each primer (100 pmol), along

with 1/20 of the reverse transcription reaction, was used in a touchdown PCR. The PCR
cycling profile was as follows: [940C, 5 min; 50*C, 2min; 720C, 1.5 min] x 1 cycle;
[94C, 30 sec; 49*C (-1 C/cycle), 30 sec; 720C, 1.5 min] x 9 cycles; [940C, 30 sec; 400C,
30 sec; 720C, 1.5 min] x 30 cycles. The PCR product was diluted 1:1000 and served as
template for a second, identical PCR. The resulting 435 bp product was gel purified,
ligated into the plasmid pGem-T, and transformed into JM109 cells for subcloning.









Control RNA samples, which were treated as above except for receiving no reverse

transcriptase, showed no product. After colonies were screened by PCR for inserts of

appropriate size, individual clones were selected for sequencing by standard chain

termination methods. One clone (RTG-4) was fully sequenced.

3'-RACE (Rapid Amplification ofcDNA Ends): The 3'-RACE technique was

performed as described in Chapter 2 Methods, except as noted. After reverse transcribing

10 utg of olfactory organ total RNA with an oligo-dT,7 oligonucleotide, the resulting

cDNA served as template for the first round of PCR amplification; one primer was

directed against a portion of the oligo-dT primer, the second was specific to clone RTG-4.

The PCR product then served as template for a second round of PCR amplification using

the a nested oligo-dT primer and a nested RTG-specific primer. The resulting product of

250 bp was purified, subcloned and sequenced as described above. Control RNA

samples, which were treated as above except that no reverse transcriptase was added,

showed no product.

5'-RACE (Rapid Amplification of cDNA Ends): 5'-RACE was performed as

described, except as noted. Total RNA from nose (10 jg) was reverse transcribed as

above using an RTG-4-specific antisense primer, and a poly(C)+ tail was added to the 3'-

end of the antisense single strand cDNA with terminal transferase. The resulting cDNA

served as template for the first round of PCR amplification; a nested antisense RTG-4-

specific primer and an anchor primer to the poly(C)+ tail were used. These PCR products

then served as template for a second round of PCR amplification where the same anchor

primer and a second nested RTG-4-specific primer were. The resulting products were

purified, subcloned and sequenced as described above. Control RNA samples, which

were treated as above except for receiving no reverse transcriptase or no terminal

transferase, showed no product. PCR cycling times were as follows: [94C, 5 min;

490C, 2 min; 720C, 3 min] x 1 cycle; [94C, 30 sec; 490C, 30 sec; 720C, 2 min] x 30









cycles. Sequencing, translation, assembly and analysis was done as above. A single

clone, 5RHl, was fully sequenced.

To control for errors that may have resulted from the actions of the DNA

polymerases or the reverse transcriptase, two independent clones, which spanned the

entire contig from the 5'- to the 3'-untranslated regions, were amplified in duplicate RT-

PCR reactions, sequenced, and a consensus sequence translated for analysis.

Northern Hybridization: Total RNA from nose (150 tg) was denatured with 15%

glyoxal:DMSO (1:1) then run overnight at 20 V on a 1.1% agarose gel in sodium

phosphate buffer (pH 7.0). The gel was blotted to MagnaPlus nylon (MSI) by capillary

action in 20x SSC. The blotted RNA was UV-crosslinked to the membrane. The

membrane was prehybridized for 1 hour at 600C in: 50% formamide, 5x SSPE, 5x

Denhardt's reagent, 0.5% SDS and 100 gig/ml herring sperm DNA. The membrane was

then hybridized to a 32P-labeled riboprobe (transcribed from clone RTG-4) overnight in

fresh hybridization solution. The next day, the membrane was washed 3 x 15 min in lx

SSPE/0.5% SDS and IX 15 min in 0.1x SSPE/0.5% SDS, both at 600C. The membrane

was exposed to X-ray film for 4 days at -800C with intensifying screens.


Results


cDNA cloning

Using RT-PCR and degenerate oligonucleotide primers, I was able to amplify a

435 bp cDNA product; this product was subcloned, sequenced, and conceptually

translated. A comparison of the deduced amino acid sequence with sequences in the

GenBank database revealed that this product was homologous to members of the Gq

family of G proteins. This product was extended to the 5'-UTR by 5'-RACE, and to the

3'-UTR by 3'-RACE. To control for possible sequence errors induced by the reverse









transcriptase or DNA polymerases, two additional independent full length clones were
isolated by RT-PCR (data not shown), and the consensus sequence across all three clones

was taken.

The assembled full-length clone has an open reading frame of 1059 bp coding for
353 amino acids (Figure 9). The predicted protein has a calculated molecular weight of

41.5 kDa. The deduced amino acid sequence for the full-length clone shows a high

degree of identity to other known Gaq proteins [Figure 10--NCBI sequence

identifications in parentheses; Drosophila: 84% (944923); Limulus: (Munger et al., in

press; mouse: 82% (193502)], and is less similar to other G types [e.g. bovine Gail: 47%

(121019)]. The position of the initiating methionine (Figure 9) was selected for several

reasons: it is the first methionine in the open reading frame; there is a well conserved

consensus initiation sequence (Kozak, 1991); initiating transcription at this position

results in a protein of identical length to most Gq proteins (Figure 10).

Sequence analysis of the lobster Gq protein shows it to contain several motifs

characteristic of other Gq proteins (Figure 9; Strathmann and Simon, 1990; Simon et al,

1991; Wedegaertner et al., 1995), including putative sites for palmidylation, two N-

terminal cysteines (CC4); an absence of N-terminal myristylation sites (though putative

myristylation sites do exist at several sites in the middle of the protein); a putative

cholera toxin ADP ribosylation site (R177), but no cysteine at the C-terminal subject to

pertussis toxin ADP ribosylation; and the G40TGES "GAG-box" sequence which is

present in the GTP-binding domain of other Gq proteins. The sequences of the Switch I,

II and III regions, all involved in GTP-dependent conformational changes of the a-
subunit (Lambright et al., 1994), are all highly conserved.




























figure 9. The nucleotide and deduced amino acid sequence of the cloned lobster Gq
cDNA. The 1059 bp coding region encodes a 353 amino acid protein. Gray shading and
arrows indicate the sequences to which the degenerate PCR primers were designed. Also
indicated are consensus motifs for cholera toxin-dependent ADP ribosylation (filled
circle) and palmidylation (arrowheads), as well as the "GAG" box (box), all characteristic
of Gq proteins. Amino acids in common with the Geo decapeptide (LDRIGAADYQ)
that served as antigen for one antibody that blocked the excitatory odor response (Fadool
et at, 1995) are indicated with stars.




















1 CAAGACCCCGGCTGTTCTCCCGAGCAGATCCTTCCCCGGCAACGCTGCTCACTTTACGGAATTATTCGGCCAAAAGCCCT
81 TTAGTGACAGCACGAAGCCTGTGAAGTGACACTAACTAAGTAAGAGAGGCAACAGAGGCAGCAGTTAATCCTGTATATAA
161 GGGAGCGTCAACTGGGAAGCAGAAATCAGCGAGCGGGGAGGCGCCACACTCAGTATACTTGGCTGCACGAAGCAAAAACCCCACCC
241 CATTTGGCTTAGATTTGACCTGTGTGAAGGAAATAACCAAAAATTGAGAAAATTCCCCGATTACGCGCCGCTTTCCCTTC
321 GCGGAGAAAGGCGGCGAAAGAGGAAGAAGATAATTTAGTAAGGAGATTGTGGTGAAAGTTGTCAAAATTAACGC
V
1 M A C C L S E E A K EQ K RI N Q E
401 GATAATATTAGGAT A ATCAGCAAACATGGCGTGCTGCCTAAGCGAAGAAGCCAAGGAACAGAAGAGGATAAACCAAGAGAT

20 E R Q L R K D K R D A R R E L K L L L L IG T aG E S
GGTGES
481 AGAACGACAATTACGGAAGGATAAGCGAGATGCCAGGAGAGAACTTAAACTACTGTTATTGGGCACTGGAGAATCAGGAA

46K S T F I K Q M R I I H G A G Y S D E D K R G F I K L
561 AGTCAACTTTTATTAAGCAGATGCGTATTATCCATGGTGCTGGTTACAGCGATGAAGACAAGCGAGGGTTTATCAACTG

73 V F Q N I F M A M Q S M I R A M D L L Q I S Y G D S A
641 GTCTTCCAGAATATTTTCATGGCTATGCAGTCTATGATAAGAGCCATGG G GGGATCTTCTCCAGATATCATATGAGATTCAGC

100 N I E H A D L V R G V D Y E S V T T F E E P Y V T A
721 TAATATTGAACATGCAGATCTAGTACGAGGAGTAGACTATGAATCAGTAACTACATTTGAGGAGCCATATGTGACTGCCA

126M K S L W Q D T G I Q H C Y D R R R E Y Q L T D S A K
801 TGAAATCCTTATGGCAAGATACAGGCATCCAACACTGCTACGACCGGCGTAGAGAGTATCAGCTCACAGATTCTGCAAAA
**** ** 0
153 Y Y L T D L D R I A A T D Y V S T L Q D I L R V R A P
881 TACTATTTAACAGATTTAGACCGCATAGCTGCCACGGACTATGTTTCCACACTACAAGACATTCTAAGAGTGGAGCACC

180 T T G I I E Y P F D L E E I R F R M V D V G G Q R S
961 CACAACAGGCATTATAGAGTATCCCTTTGACCTAGAAGAAATCAGATTTAGATGGTAGATTGGGTGGTCAGCGATCTG

206 E R R i. I 4 C F 'I V T S I I F L V A L S E Y D Q I
1041 AGCCGAAAGTGGATCCACGC GAGAGACTATCTCATCTTCCTGGTTGCTCTTTCAGAATATGATCAAATT

233 L F E S D N E N R M E E S K A L F K T I I T Y P W F Q
1121 CTGTTTGAATCTGACAATGAGAATCGGA'GAGGAATCTAAGGCCCTCTTCAAGACGATCATCACATACCCATGGTTTCA

260 H S S V I L F L N K K D L L E E K I M Y S H L V D Y
1201 GCACTCCTCAGTTATCCTTTTCCTTAATAAGAAGGATCTGTTAGAAAGAAGATCATGTACTCACATCTTGTGGACTATT

286F P E Y D G P R K D A I A A R E F I L R M F V E L N P
1281 TCCCAGAGTATGATGGCCAAGGAAGGATGCAATTGCAGCTCGGGAGTTCATCCTACGGATGTTTGTAGAATTAAATCCC

313 D P E K I I Y S H F T C A T D T E N I R F V F A A V K
1361 GACCCTGAGAAGATTATCTATTCCCATTTCACATGTGCGACAGACACTGAGAATATAAGGTTCGTTTCGCTGCTGTCAA

340 D T I L Q L N L i I N L ''
1441 AGACACAATTCTGCAGCTAAATCTAAAGGAATACAACTTGGTGTAATGTAGAGTTATGCCCAACTGGCTGAGAGTGAACA

1521 TTAGATGAAGTGACAGCATGTATCCTTCTCAGTGTAGGGGCTGTGACCTAAGGACATTTCTTCATCACCCCTTACATGAC
1601 ACCATACCAATTTTGTAAACAAGGCAGTCATATTTTGCATCTACAAACCCATATTCAGTGTCCCAAAGAAATAAAGGTTC
1681 TATGTTGTT-poly(A)+






























Fige 10. Alignment of the lobster Gq protein with Gq proteins (NCBI ID in
parentheses) from Drosophila (dGqa-3: 944923), Limulus (Munger et al., in press), and
mouse (193502). Shading indicates amino acids conserved between the lobster protein
and at least one of the other three proteins.


























Lobster ---_
Sobster 1 M-- ACCL- SEAKRQKRINMQISRQLEKDRD&ARRLKLLLLLQTOBOKSTrXKQI
Dros. dGa3--- 1i ..... MECCLfrFAKZKRIElQEIEQLRRDRDARRBLRKLLLGLTGBGSESTYZIQMR
Limulus -. I-* 1 MA CCLBEE GRZQS BINQI IRQLRDXRDAIMiLKLLLLGTGGaSTITrQMRIo
.I .1 iLE IlMACCLSEWKLIAPlINDUIRUWJRFDKRDARNWLKLLLLGTGiSGEBTFIZQUI
Mouse

55 LIBOAGOYSDDKRGPIRLVFQNIVzMAugBIRAMULLQZBYaDSAlIZEADLVRUVDxZS
55 ITHGSGoSDZDKRGO IKLvFQIfrMAMUBMlAMDNLF.B!OQGEs!SELADLVMSIDfNT
55 ZIHG GTBDDDS YI ILVYQMI IKAQSMNFMUMEMLKI TKRDPNMIXNAEIVLSVUBT
61 irEGOGTBDKDR OPTiVVYQEHITAMQAMItRADTLEI F TRKYEBll HAQLVWSVDVME


115 vrTrpEpiVTL &MRBLW DrargIBCYDnRRTQLTTDBAIKTLTDLDJIAATDTVSTLODIL
115 VTTFDPLNAiFTLMDDAGaQBCTDRSATQLbTDBAXrTLDLDXVAQPAyLPTBOL
115 VrTFDrPIVTAIRISLWVDF IECTYDRRRITQLTDlARTILNDIDRZA.PNTLPTWQOI.




175 RV
175 RRVEPTTGINXTPFDLEEIRFRMVDYGGORSBZRRWEBCFVMiVTSIIPLVALLBMFDIW
175 RVBVPTTGIZIETVPFIL RSI flHVDVGOQOSfRizrCTaVTZSIZrViALSOIfP
181 RVBVPTTGQZIYPFDLQJV IFRVDVUaQRsRRXRWZBcrPmWVTBMrLV&LUSv ROVLV


235 ISDHERRMZSBRALF TIZTTZWrFPQ BVIZLFEXDLLZXZIYMTELVDTriVITfplP
235 SDUIRfIRnl SALFVTIITZTPWFNBSBVZLFV.LRDLLZEKIMTSBINVDlPPUl
235 SDIMIRRMRUSBALrSTIITTPWlQNBVrILFLUXlDLLUMXIMFSELVrr7EVF3 E
241 EHD:HZnMIXBF.ALrTIZTTPWFTQIBBVrLFrENZIDLLERMINMTBLVDTPTADQR


295 DAIAARErILRMFVEIjHPDF'BKEZTfBHTC&TDT3WrW'AVflAIVKDflQLUi V
295 DAZTAREFELRMvDADZEFCAWDVDW
295 DA'ITGRurKLUFVPDL1PD 3zE rT:ECIAWDTXXrTXBfX.AVIDlEQ
301 DAQAAMiriLFIFVDLMPDSDKZIIIIBTCATDTZIEflRR LAVKDMXLQL lni










Northern Hybridization

A Northern blot of lateral antennule total RNA was probed with a riboprobe
transcribed from clone RTG-4 (nucleotides 1049-1483 of the complete clone) at high

stringency. A single band of 4.6 kb is seen (Figure 11).


Discussion

The cDNA identified in this study shows the greatest similarity to known
vertebrate and invertebrate Gq proteins, particularly the Ga, and Gall types (Figure 9).

The Gq family of a-subunits is highly conserved in primary structure. This high degree

of identity allows little speculation about the functional consequences of structural

motifs. While a few basic regions mediating some functions of the G protein a-subunit

have been identified (Neer, 1994), such as interaction with the py complex at the amino-

end of the a-subunit, or interaction with the receptor at the carboxyl end, these regions

are not well defined, and it is difficult to pair a particular effector or receptor to an a-
subunit, simply by examining primary structure. Therefore, the isolated cDNA might, or

might not, encode an "olfactory" or "sensory" Gq, but until more rigid structure-function

relationships are established by mutational analyses and heterologous expression, the role

of the protein remains obscure.

Localization of the message to the olfactory organ (Figure 11) is consistent with
this cDNA encoding the native protein characterized by Fadool et al. (1995): any

transduction-related protein must be localized to the olfactory organ. Northern blot

analysis shows that the Gq message expressed in the olfactory organ is very large
compared to the coding sequence. This indicates large 5'- and 3'-UTRs on the mRNA

which are over three times the length of the coding region. The significance of this large
noncoding region is unknown, but is not unheard of for this family of proteins (e.g.






























Figure 1.A Northern blot of nose total RNA (150 Ipg) probed with a 32P-labeled
riboprobe transcribed from a portion of the lobster Gq protein. A single 4.6 kb band
(arrow) is seen after a 96 hour exposure.























kb

9.5)-
7.5-


4.4-



2.43


1.4









Wilkie et al., 1991). Other tissues were not probed for the expression of this message.

Although the question of tissue specificity is an interesting one, it has no bearing on the

role of any protein in olfactory transduction. Indeed, each of the principal components of

the vertebrate cAMP-mediated olfactory transduction pathway are seen in non-olfactory

regions of the nervous system. Nevertheless, the transcript must be localized to ORNs if

a link between this message and the native protein is to be established definitively.

This isolated Gq was compared with the one previously implicated in excitatory

odor transduction in the spiny lobster. In their study, Fadool and colleagues (1995) found

that an antibody against a common sequence of Gatq/, recognized a 45 kDa protein in the

dendrites of lobster ORNs. This same antibody, when perfused into cultured lobster

ORNs, was able to block the inward odor-evoked current, though it had no effect on the

outward odor-evoked current. Furthermore, both inward and outward currents were

insensitive to the presentation of either pertussis or cholera toxins. Proteins of the Gq

family are not sensitive to either pertussis or cholera toxin (Strathmann and Simon,

1990). Together, these data clearly implicated a Gq-like protein in spiny lobster

excitatory odor transduction. But although this protein shares immunological and

pharmacological properties with known Gq proteins, its membership in the Gq family

remained in question. The cDNA isolated from olfactory organ is consistent in primary

structure with the Gq-like protein described by Fadool et al. (1995). The C-terminal

amino acids that served as the epitope for the Gcaq/ antibody used in that study are

precisely conserved in the protein encoded by the cDNA isolated here; this epitope is

conserved in most Gaq/,, proteins, but is noticeably different in two Gq proteins from

another arthropod, Drosophila (Lee et al., 1990). The computed molecular weight, which

is consistent with other Gq proteins, is just slightly smaller than the 45 kDa protein seen

by Fadool and colleagues (1995) on Western blots; this discrepancy may be due to lipid

modifications of the native protein (Spiegel et al., 1991) or to anomalous migration of the

protein in SDS-PAGE. The sequence also reveals a lack of the C-terminal cysteine that









serves as the site of pertussis toxin ribosylation (Simon et al., 1991). These features

demonstrate that a Gq protein that could be the one characterized functionally by Fadool

and colleagues (1995) is expressed in the nose of the spiny lobster. However, of the

several other G protein antibodies screened in that study, one raised against a peptide

from a mammalian Ga, could also block the inward odor-evoked current, though this

Gao antibody did not recognize any proteins on Western blots of ORN dendritic

membrane. Members of the Gi family are pertussis toxin-sensitive (Simon et al., 1991),

further complicating interpretation of the physiological experiment. Note that the epitope

of the Gao antibody, the antigenic peptide LDRIGAADYQ (Goldsmith et a., 1988), is

somewhat conserved in the Gq sequence isolated here (Figure 9), suggesting that

crossreactivity of the Gao antibody with the native Gq protein led to the equivocal results

seen by Fadool and colleagues (1995). However, no attempt was made to isolate a Gao

cDNA from this tissue, so the possibility that the olfactory organ expresses both types of

a-subunit cannot be excluded. To find multiple G proteins involved in the same

signalling pathway would be unprecedented in olfaction, but this has been seen in other

systems. Some receptors can be coupled to multiple effectors via different G proteins

[e.g. human thyrotropin receptors activate both Gas and Gaq/i in intact cells (Allgeier et

al., 1994)]. As each ORN was tested with only one of the antibodies, the prospect

remains that individual ORNs could express either or both of the a-subunits. The finding

by Fadool et al. (1995) that the inward and outward currents are mediated by different G

proteins is consistent with previous studies that implicated separate second messenger

cascades in excitatory and inhibitory odor transduction in this animal (Fadool and Ache,

1992; Michel and Ache, 1994; Boekhoff et al., 1994). If more than two G proteins were

to be implicated in one of these pathways, it would imply a complexity of signaling

pathways that is not yet understood.

Gq proteins are seen in ORNs of both vertebrates and invertebrates (Abogadie et

al., 1995a; Talluri et al., 1995; Dellacorte et al., 1996), including one cloned from the






53


olfactory organ of the American lobster (Xu et al., 1997). Gq-like immunoreactivity has

also been observed in neurons of the vomeronasal organ but was deemed too faint to be

of significance for sensory transduction in these cells (Berghard and Buck, 1996). While

evidence for a role of the IP3 pathway in vertebrate olfactory transduction is growing, no

role for a Gq has been identified. In fact, Boekhoffand colleagues (1990) have

implicated a pertussis toxin-sensitive G protein in IP3-mediated olfactory transduction. It

is possible that in vertebrate ORNs, the IP3 pathway is coupled to a Ga, or to some

member of the Gq family not recognized by antibodies against Gaq or Galn (e.g. Gal4,

Ga.15 or Ga16).














CHAPTER 4
SUMMARY

Inositol 1,4,5-trisphosphate (IP3) has been implicated as a second messenger

involved in olfactory transduction for a variety of species (review: Breer and Boekhoff,

1992; Ache and Zhainazarov, 1995), though its precise role remains controversial,

especially in vertebrates. Several laboratories report that they have failed to identify IP3-

gated conductances in ORNs of amphibians (e.g. Firestein et al., 1991; Nakamura et al.,

1994; Kleene et a., 1994). The work of Nakamura and colleagues (1996) may imply that

IP3- and cyclic nucleotide-gated channels (CNGs) are in different cellular compartments,

with only the CNG residing in the membrane of ORN cilia. Most recently, gene

knockout experiments with the mouse olfactory CNG show that the absence of this

channel causes total anosmia in neonates (Brunet et al., 1996). These results contradict

those of Restrepo et al. (1990), Miyamoto et al. (1992) and Lischka et al. (1995) who

have demonstrated the presence of IP3-gated conductances in the ORNs of rats and

catfish. As has been described extensively in the previous chapters, there is also

biochemical evidence for odor-stimulated generation of IP3 in ORNs, as well as emerging

immunological and molecular evidence placing components of an IP3 signaling pathway

in dendrites of these cells. These conflicting data leave the precise role of P3 in

vertebrate olfactory transduction somewhat ambiguous: IP3 has been proposed by some

to be either a modulatory factor or a necessary cofactor for the better characterized

transduction pathway mediated by adenosine 3',5'-cyclic monophosphate (cAMP); others

believe it to have a role equivalent, but not identical, to cAMP.

A key to understanding the functional intricacies of the cAMP pathway was the

molecular isolation and characterization of components of this signaling cascade in









olfactory receptor neurons. This was done, not by random chance, but by taking

advantage of perceived similarities of the olfactory cAMP transduction cascade to the

cGMP signaling pathway in vertebrate photoreceptors. Homologous (e.g. the olfactory

CNG) and analogous (e.g. Gojf) proteins were identified by narrowing the search to

molecules like those seen to be involved in the much better characterized photoresponse.

In this dissertation I have taken a similar tack, using the better characterized IP3-mediated

olfactory transduction pathway in ORNs of the spiny lobster as a source of information

about the functioning of IP3 in olfactory transduction in general.

In the spiny lobster, Panulirus argus, electrophysiological studies have implicated
an IP3-gated channel, the IP3 receptor (IP3R), as the target of IP3 generated upon

excitatory odor-stimulation. A Gq-type GTP-binding protein a-subunit (Gq protein) has

also been implicated in the excitatory odor response, serving to link the activated odor

receptor with the enzyme that generates IP3 (Figure 12). This dissertation describes the

molecular cloning of cDNAs for two components of an IP3 signaling cascade from the

olfactory organ (nose) of the spiny lobster: an IP3 receptor (Chapter 2) and a Gq protein

(Chapter 3). These two proteins, both of which have been physiologically implicated in

the excitatory odor response in lobsters, share many structural characteristics with those

isolated from other species and tissues. The IP3 receptor cDNA encodes a protein that is

approximately 50% identical to many of those isolated from Drosophila and several

vertebrates. The Gq protein shows an even greater similarity to other Gq proteins (70-

80%). The messenger RNAs for these two molecules are both expressed in the olfactory

organ, making them candidates for roles in olfactory transduction. The isolation of these
two cDNAs is a critical step in our understanding of both the role of IP3 in olfactory
signaling and the complexity of odor transduction in all animals.

Much work remains to be done with both of these molecules to establish that each
plays a role in olfactory transduction, rather than elsewhere. Both proteins are quite

similar to ones seen in a variety of neural and nonneural cells, so some form of cellular































Figure 12. The proposed lobster excitatory odor transduction pathway, with a Gq protein
coupling the odor receptor to a phospholipase C, and IP3 directly gating a plasma
membrane channel.






57














EXCITATORY
PATHWAY


0Na
Na+
Ca++









localization, such as in situ hybridization, is necessary to demonstrate that these

particular genes are expressed in ORNs (while ORNs are the principal cell type in the

olfactory epithelium, other neuronal and nonneuronal cell types are present). The Gq

protein has already been shown to be present in the ORN dendrites (Fadool et al., 1995).

Two polyclonal antibodies directed against a conserved and a nonconserved region of the

IP3R have been generated, and are currently being characterized. The presence of
antigen for both of these antibodies in the ORN dendrites would provide a strong link

between the cloned channel and those first characterized by Fadool and Ache (1992).

Heterologous expression of both these proteins would permit comparisons to those native

proteins previously characterized (Fadool and Ache, 1992; Hatt and Ache, 1994; Fadool

et al., 1995). Such experiments would also permit mutational and chimeric studies of

these proteins, which might provide insight into numerous structural and functional

questions, the most obvious of which is the role for the novel hydrophilic sequence in the

modulatory domain of the lobster IP3R.

Of course, while characterization of these molecules provides great insight into

the functional properties of the molecules themselves, the advantage of a comparative

approach is the clues it can provide about other systems. If these two molecules are

shown to be involved in olfactory transduction in the spiny lobster, the next step would

be an attempt to clone and localize equivalent molecules in vertebrate ORNs. Towards

this end, a partial cDNA encoding the carboxyl end of a novel IP3R has been cloned from

Xenopus olfactory epithelium (Munger, Rust, Ache and Greenberg, unpublished data).

Isolation of similar molecules does not guarantee similar roles for the IP3 pathway in

lobsters and vertebrates, but it will simplify the testing of various hypotheses.

While I have concentrated on the IP3 pathway in ORNs as it relates to primary

olfactory transduction (coupling an odor-bound receptor to a change in membrane

conductance), activation of this pathway can have additional consequences for the cell

and its response to odors. For example, Ca2+ entering the cell through the IP3R, along









with diacylglycerol cogenerated with IP3 by activated phospholipase C, could activate

protein kinase C, which could, in turn, phosphorylate numerous cellular proteins. The

mechanisms of olfactory transduction already appear to be subject to complex regulation.

Gaseous messengers such as nitric oxide (NO) and carbon monoxide (CO) and the cyclic

nucleotide guanosine 3',5'-cyclic monophosphate (cGMP) appear to have modulatory

effects on the CNG channel (Breer et al., 1992; Lischka and Schild, 1993; Leinders-

Zufall et al., 1995; Zufall, 1996; Broillet and Firestein, 1996). As in most systems, Ca2
seems to have numerous biochemical and physiological effects that may modify the odor

response (e.g. Anholt and Rivers, 1990), including playing a large role in the

amplification of the initial odor-induced current via the direct gating of a chloride channel

(Kleene, 1993; Lowe and Gold, 1993; Kurahashi and Yau, 1994). There is even evidence

for a Na -gated channel playing a similar amplification role in the lobster (Zhainazarov

and Ache, 1995; Zhainazarov et al, 1997). While the existence of these additional

transduction mechanisms does not diminish the need to understand the cAMP and IP3-

mediated systems, none of these mechanisms operates in isolation from the others.

However, to understand the interactions between these multiple pathways, the

components of each pathway must be understood, for each component is a possible site of

interaction with another.














LIST OF REFERENCES


Abogadie, F. C., Bruch, R. C. and Farbman, A. I. (1995a). G protein subunits expressed
in catfish olfactory receptor neurons. Chem. Senses. 20: 199-206.

Abogadie, F.C., Bruch, R.C., Wurzburger, R., Margolis, F.L. and Farbman, A.I. (1995b)
Molecular cloning of a phosphoinositide-specific phospholipase C from catfish
olfactory rosettes. Mol. Brain. Res. 31: 10-16.

Ache, B.W. (1994). Towards a common strategy for transducing olfactory information.
sem. Cell Biol. 5: 55-63.

Ache, B.W. and Carr, W.E.S. (1989). Chemoreception in aquatic invertebrates. In:
Neural Mechanisms in Taste. Boca Raton: CRC Press, Inc. 97-117.

Ache, B.W. and Zhainazarov, A. (1995). Dual second-messenger pathways in olfactory
transduction. Curr. Opin. Neurobiol. 5: 461-466.

Anholt, R.R.H. and Rivers, A.M. (1990) Olfactory transduction: cross-talk between
second-messenger systems. Biochem. 29: 4049-4054.

Asanuma, N. and Nomura, H. (1991). Cytochemical localization of adenylate cyclase
activity in rat olfactory cells. Histochem. J. 23: 83-90.

Bacigalupo, J., Morales, B., Ugarte, G., Delgado, R., Jorquera, O. and Labarca, P. (1993).
Electrophysiological studies in toad olfactory receptor neurons. Chem. Senses.
18: 525.

Bakalyar, H.A. and Reed, R.R. (1990). Idnetification of a specialized adenylyl ccyclase
that may mediated odorant detection. Science. 250: 1403-1406.

Berridge, M.J. (1993). Inositol trisphosphate and calcium signalling. Nature. 361: 315-
325.

Bezprozvanny, I. and Ehrlich, B.E. (1993). ATP modulates the function ofinositol 1,4,5-
trisphosphate-gated channels at two sites. Neuron. 10: 1175-1184.








Bezprozvanny, I. and Ehrlich, B.E. (1994). Inositol (1,4,5)-trisphosphate (InsP3)-gated
Ca channels from cerebellum: conduction properties for divalent cations and
regulation by intraluminal calcium. J. Gen. Physiol. 104: 821-856.

Blondel, O., Takeda, J., Janssen, H., Seino, S. and Bell, G.I. (1993). Sequence and
functional characterization of a third inositol 1,4,5-trisphophate receptor subtype,
IP3R-3, expressed in pancreatic islets, kidney, gastrointestinal tract, and other
tissues. J. Biol. Chem. 268: 11356-11363.

Boekhoff, I., Michel, W.C., Breer, H. and Ache, B.W. (1994). Single odors differentially
stimulate sual second messenger pathways in lobster olfactory receptor cells. J.
Neurosci. 14: 3304-3309.

Boekhoff, I., Tareilus, E., Strotmann, J. and Breer, H. (1990). Rapid activation of
alternative second messenger pathways in olfactory cilia in rats by different odors.
EMBOJ. 9: 2453-2458.

Bradley, J., Li, J., Davidson, N., Lester, H.A. and Zinn, K. (1994) Heteromeric olfactory
cyclic nucleotide-gated channels: a subunit that confers increased sensitivity to
cAMP. Proc. Natl. Acad Sci. USA. 91: 8890-8894.

Breer, H. and Boekhoff, I. (1992). Second messenger signalling in olfaction. Curr.
Opin. Neurobiol. 2: 439-443.

Breer, H., Boekhoff, I. and Tareilus, E. (1990). Rapid kinetics of second messenger
formation in olfactory transduction. Nature. 344: 65-68.

Breer, H., Klemm, T., and Boekhoff, I. (1992) Nitric oxide formation of cyclic GMP in
the olfactory system. NeuroReport. 3: 1030-1032.

Broillet, M.-C. and Firestein, S. (1996). Direct activation of the olfactory cyclicc
nucleotide-gated channel through modification of sulfhydryl groups by NO
compounds. Neuron. 16: 377-385.

Bruch, R.C. (1990). Signal transducing GTP-binding proteins in olfaction. Comp.
Biochem. Physiol. [A]. 995: 27-29.

Bruch, R.C. and Kalinowski, D.L. (1987). Interaction of GTP-binding regulatory
proteins with chemosensory receptors. J. Biol. Chem. 262: 2401-2404.

Bruch, R.C. and. Teeter, J.H (1990). Cyclic AMP links amino acid chemoreceptors to
ion channels in olfactory cilia. Chem. Senses. 15: 419-430.








Brunet, L.J., Gold, G.H. and Ngai, J. (1996). General anosmia caused by a targeted
disruption of the mouse olfactory cyclic nuecleotide-gated channel. Neuron. 17:
681-693.

Buck, L. and Axel, R. (1991). A novel multigene family may encode odorant receptors:
a molecular basis for odor recognition. Cell. 65: 175-187.

Carr, W.E.S., Avhe, B.W. and Gleeson, R.A. (1984). Chemoreceptors of crustaceans:
similiraties to receptors for neuroactive substances in internal tissues. Environ.
Health Pers. 71: 31-46.

Clapham, D.E. and Neer, E.J. (1993). New roles for G protein py dimers in
transmembrane signalling. Nature. 365: 403-406.

Cunningham, A.M., Ryugo, D.K., Sharp, A.H., Reed, R.R., Snyder, S.H. and Ronnett,
G.V. (1993). Neuronal inositol 1,4,5-trisphosphate receptor localized to the
plasma membrane of olfactory cilia. Neurosci. 57: 339-352.

Dellacorte, C., Restrepo, D., Menco, B.P.M., Andreini, I. and Kalinowski, D.L. (1996).
Gaq/Ga 1: immunolocalization in the olfactory epitheliumn of the rat (Rattus
rattus) and the channel catfish (Ictalurus punctatus). Neurosci. 74: 261-273.

Dhallan, R.S., Yau, K. Schrader, K.A. and Reed, R.R. (1990). Primary structure and
fictional expression of a cyclic nucleotide-activated channel from olfactory
neurons. Nature. 347: 184-187.

Dingwall, C. and Laskey, R.A. (1991). Nuclear targeting sequences--a consensus?
Trends Biochem. Sci. 16: 478-481.

Dionne, V.E. (1992). Chemosensory responses in isolated olfactory receptor neurons
form Necturus maculosus. J. Gen. Physiol. 99: 415-433.

Dionne, V.E. (1994). Emerging complexity of odor transduction. Proc. Natl. Acad. Sci.
USA. 91: 6253-6254.

Drinnan, S.L., Hope, B.T., Snutch T.P. and Vincent, S.R. (1991). Gof in the basal
ganglia. Mol. Cell. Neurosci. 2: 66-70.

Fadool, D.A. and Ache, B.W. (1992). Plasma membrane inositol 1,4,5-trisphophate-
activated channels mediate signal transduction in lobster olfactory receptor
neurons. Neuron. 9: 907-918.








Fadool, D.A. and Ache, B.W. (1994). Mediation of opposing transduction cascades in
lobster olfactory receptor neurons by cAMP and IP3. In: Olfaction and Taste XI.
eds. Kurihara, K., N. Suzuki and H. Ogawa. Tokyo, Springer-Verlag. 178-182.

Fadool, D. A., Estey, S. E. and Ache, B. W. (1995). Evidence that a Gq-protein mediates
excitatory odor transduction in lobster olfactory receptor neurons. Chem. Senses.
20: 489-498.

Fadool, D.A., Michel, W.C. and Ache, B.W. (1993). Odor sensitivity of cultured lobster
olfactory neurons is not dependent on process formation. J. exp. Biol. 174: 215-
233.

Ferris, C.D. and Snyder, S.H. (1992). Inositol 1,4,5-trisphosphate-activated calcium
channels. Ann. Rev. Physiol. 54: 469-488.

Firestein, S., Darrow, B. and Shepherd, G.M. (1991). Activation of the snesory current in
salamander olfactory receptor neurons depends on a G-protein-mediated cAMP
second messenger system. Neuron. 6: 825-835.

Frohman, M.A., M.K. Dush and G.R. Martin (1988). Rapid production of full-length
cDNAs from rare transcripts: amplification using a single gene-specific
oligonucleotide primer. Proc. Natl. Acad. Sci. USA. 85: 8998-9002.

Fujimoto, T., Nakade, S., Miyawaki, A., Mikoshiba, K. and Ogawa, K. (1992).
Localization of inositol 1,4,5-trisphosphate receptor-like protein in plasmalemmal
caveolae. J. Cell Biol. 119: 1507-1513.

Furuichi, T., Kohda, K., Miyawaki, A. and Mikoshiba, K. (1994). Intracellular channels.
Curr. Opin. Neurobiol. 4: 294-303.

Furuichi, T., Yoshikawa, S., Miyawaki, A., Wada, K., Maeda, N. and Mikoshiba, K.
(1989). primary structure and functional expression of the inositol 1,4,5-
trisphosphate-binding protein P400. Nature. 342: 32-38.

Goldsmith, P., Backlund, Jr., P.S., Rossiter, K., Carter, A., M illigan, G., Unson, C.G.
and Spiegel, A. (1988). Purification ofheterotrimeric GTP-binding proteins from
brain: identification of a novel form of Go. Biochem. 27: 7085-7090.

Goulding, E.H., J. Ngai, R.H. Kramer, S. Colicos, R. Axel, S.A. Siegelbaum and A.
Chess (1992). Molecular cloning and single-channel properties of the cyclic
nucleotide-gated channel from catfish olfactory neurons. Neuron. 8: 45-58.

Grilnert, U. and Ache, B.W. (1988). Ultrastructure of the aesthetasc (olfactory) sensilla
of the spiny lobster, Panulirus argus. Cell Tissue Res. 251: 95-103.








Hamm, H.E. and Gilchrist, A. (1996) Heterotrimeric G proteins. Curr. Opin. Cell Biol.
8: 189-196.

Hatt, H. and Ache, B.W. (1994). Cyclic nucleotide- and inositol phosphate-gated ion
channels in lobster olfactory receptor neurons. Proc. Natl. Acad Sci. USA. 91:
6264-6268.

Ivanova, T.T. and Caprio, J. (1992). Odorant receptors activated by amino acids in
sensory neurons of the channel catfish Ictaluruspunctatus. J Gen. Physiol. 102:
1085-1105.

lyengar, R. and Bimbaumer, L. (1990). Roles of G proteins and G protein subunits in
signal transduction. Lymphokine Res. 9: 533-537.

Jones, D.T., Barbosa, E. and Reed, R.R. (1988). Expression of G-protein a-subunits in
rat olfactory epithelium: candidates for olfactory signal transduction. Cold
Spring Harbor Symp. Quant. Biol. 53: 349-354.

Jones, D.T. and Reed, R.R. (1989). Golf: an olfactory neuron-specific G protein
involved in odorant signal transduction. Science. 244: 790-795.

Kalinowski, D.L., Aldinger, S.B., Boyle, A.G., Huque, T., Marecek, J.F., Prestwich, G.D.
and Restrepo, D. (1992). Characterization of an novel inositol 1,4,5-trisphosphate
receptor in isolated olfactory cilia. Biochem. J. 281: 449-456.

Khan, A.A., Soloski, M.J., Sharp, A.H., Schilling, G., Sabatini, D.M., Li, S.-H., Ross,
C.A. and Snyder, S.S. (1996). Lymphocyte apoptosis:mediation by increased
type 3 inositol 1,4,5-trisphosphate receptor. Science. 273: 503-507.

Khan, A.A., Steiner, J.P., Klein, M.G., Schneider, M.F. and Snyder, S.H. (1992). IP3
receptor: localization to plasma membraen of Tcells and cocapping with the T
cell receptor. Science. 257: 815-818.

Kingston, P.A., Zufall, F. and Bamstable, C.J. (1996). Rat hippocampal neurons express
genes for both rod retinal and olfactory cyclic nucleotide-gated channels: novel
targets for cAMP/cGMP function. Proc. Natl. Acad. Sci. USA. 93: 10440-10445.

Kleene, S.J. (1993) Origin of the chloride current ni olfactory transduction. Neuron. 11:
123-132.

Kleene, S.J., Gesteland, R.C. and Bryant, S.H. (1994). An electrophysilogical survey of
frog olfactory cilia. J. Exp. Biol. 195: 307-328.








Kozak, M. (1991). Structural features in eukaryotic mRNAs that modulate the initiation
of translation. J. Biol. Chem. 266: 19867-19870.

Kume, S., Muto, A., Aruga, J., Nakagawa, T., Michikawa, T., Furuichi, T., Nakade, S.,
Okano, H. and Mikoshiba, K. (1993). The Xenopus IP3 receptor: Structure,
function and localization in oocytes and eggs. Cell. 73: 555-570.

Kuno, M., Maeda, N. and Mikoshiba, K. (1994). IP3-activated calcium-permeable
channels in the inside-out patch of cultured cerebellar Purkinje cells. Biochem.
Biophys. Res. Comm. 199: 1128-1135.

Kurahashi, T. and Yau, K.-W. (1994) Co-existence of cationic and chloride components
in odorant-induced current of vertebrate olfactory cells. Nature. 363: 71-74.

Labarca, P., Simon, S.A. and Anholt, R.R.H. (1988). Activation by odorants of a
multistate cation channel from olfactory cilia. Proc. Natl. Acad. Sci. USA. 85:
944-947.

Lambright, D.G., Noel, J.P., Hamm, H.E. and Sigler, P.B. (1994). Structural
determinants for activation of the a-subunit of a heterotrimeric G protein. Nature.
369: 621-628.

Lee, Y.-J., Dobbs, M.B., Verardi, M.L. and Hyde, D.R. (1990) dgq: a Drosophila gene
encoding a visual system-specific G molecule. Neuron. 5: 889-898.

Leinders-Zufall, T., Shepherd, G.M. and Zufall, F. (1995). Regulation of cyclic
nucleotide-gated channels and membrane excitability in olfactory receptor cells
by carbon monoxide. J. Neurophysiol. 74: 1498-1508.

Liman, E.R. and Buck, L.B. (1994). A second subunit of the olfactory cyclic nucleotide-
gated channel confers high sensitivity to cAMP. Neuron. 13: 611-621.

Lischka, F.W. and Schild, D. (1993). Effects of nitric oxide upon olfactory receptor
neurones inXenopus laevis. NeuroReport. 4: 582-584.

Lischka, F.W., Honda, E., Teeter, J.H. and Restrepo, D. (1995). Characterization of an
InsP3-activated channels in reconstituted membranes and excised patches from rat
olfactory neurons. Chem. Senses. 20: 733.

Lowe, G. and Gold, G.H. (1993). Nonlinear amplification by calcium-dependent chloride
channels in olfactory receptor cells. Nature. 366: 283-286.








Lowe, G., Nakamura, T. and Gold, G.H. (1989). Adenylate cyclase mediates olfactory
transduction for a wide variety of odorants. Proc. Natl. Acad Sci. USA. 86:
5641-5645.

Lucero, M.T., Horrigan, F.T. and Gilly, W.F. (1992). Electrical responses to chemical
stimulation of squid olfactory receptor cells. J. Exp. Biol. 162: 231-249.

Lucero, M.T. and Piper, D.R. (1994). IP3 and cyclic nucleotides elicit opposite
membrane potential changes in squid olfactory receptor neurons. Chem. Senses.

McClintock, T.S. and Ache, B.W. (1989). Hyperpolarizing receptor potentials in lobster
olfactory receptor cells: implications for transduction and mixture suppression.
Chem. Senses. 14: 637-647.

McDonald, T.V., Premack, B.A. and Gardner, P. (1993). Flash photolysis of caged
inositol 1,4,5-trisphosphate activates plasma membraen calcium current in human
T cells. J. Biol. Chem. 268: 3889-3896.

Menco, B.P., Bruch, R.C., Dau, B. and Danho, W. (1992). Ultrastructural localization of
olfactory transduction components: the G protein Golf alpha and type III adenylyl
cyclase. Neuron. 8: 441-453.

Michel, W.C. and Ache, B.W. (1992). Cyclic nucleotides mediate an odr-evoked
potassium conductance in lobster olfactory receptor cells. J. Neurosci. 12: 3979-
3984.

Michel, W.C., McClintock, T.S. and Ache, B.W. (1991). Inhibition of lobster olfactory
receptor cells by an odor-activated potassium conductance. J. Neurophysiol. 65:
446-453.

Michikawa, T., Hamanaka, H., Otsu, H., Yamamoto, A., Miyawaki, A., Furuichi, T.,
Tashiro, Y. and Mikoshiba, K. (1994). Transmembrane topology and sites of N-
glycosylation of inositol 1,4,5-trisphosphate receptor. J. Biol. Chem. 269: 9184-
9189.

Mignery, G.A., Newton, C.L., Archer III, B.T. and Siidhof, T.C. (1990). Structure and
expression of the rat inositol 1,4,5-trisphosphate receptor. J. Biol. Chem. 265:
12679-12685.

Mikoshiba, K. (1993). Inositol 1,4,5-trisphosphate receptor. Trends Pharm. Sci. 14: 86-
89.

Miyamoto, T., Restrepo, D., Cragoe, E.J. and Teeter, J.H. (1992). IP3- and cAMP-
induced responses in isolated olfactory receptor neurons from the channel catfish.
J. Membr. Biol. 127: 173-183.









Mourey, R.J., Estevez, V.A., Maracek, J.F., Barrow, R.K., Prestwich, G.D. and Snyder,
S.H. (1993). Inositol 1,4,5-trisphosphate receptors: labelling the inositol 1,4,5-
trisphosphate binding site with photoaffinity ligands. Biochem. 32: 1719-1726.

Munger, S.D., Ache, B.W. and Greenberg, R.M. (1995) Cloning and sequencing of an
IP3-receptor cDNA from lobster olfactory organ. Soc. Neurosci. Abstr. 21: 1127.

Munger, S.D., Rust, N.C., Ache, B.W. and Greenberg, R.M. (1997) Cloning and
molecular characterization of two components of the IP3 pathway from lobster
olfactory organ. Chem. Senses. In press.

Nakade, S., Maeda, N. and Mikoshiba, K. (1991). Involvement of the C-terminus of the
inositol 1,4,5-trisphosphate receptor in Ca2+ release using region-specific
monoclonal antibodies. BiochemJ. 277: 125-131.

Nakamura, T. and Gold, G.H. (1987). A cyclic nucleotide-gated conductance in olfactory
receptor cilia. Nature. 325: 442-444.

Nakamura, T. Lee, H.-H., Kobayashi, H. and Satoh, T.-O. (1996). Gated conductances in
native and reconstituted membranes from frog olfactory cilia. Biophys. J. 70:
813-817.

Nakamura, T., Tsuru, K. and Miyamoto, S. (1994). Regulation of Ca2+ concentration by
second messengers in newt olfactory receptor cell. Neurosci. Lett. 171: 197-200.

Neer, E.J. (1995). Heterotrimeric G proteins: organizers oftransmembrane signals. Cell.
80: 249-257.

Pace U., Hanski, E., Salomon, Y. and Lancet, D. (1985). Odorant-sensitive adenylate
cyclase may mediate olfactory reception. Nature. 316: 255-258.

Restrepo, D., Miyamoto, T., Bryant, B.P. and Teeter, J.H. (1990). Odor stimuli trigger
influx of calcium into olfactory neurons of the channel catfish. Science. 249:
1166-1168.

Restrepo, D., Teeter, J.H., Honda, E., Boyle, A.G., Marecek, J.F., Prestwich, G.D. and
Kalinowski, D.L. (1992). Evidence for an InsP3-gated channel protein in isolated
rat olfactory cilia. Am. J. Physiol. 32: C667-C673.

Restrepo, D., Teeter, J.H. and Schild, D. (1996). Second messenger signalling in
olfactory transduction. J. Neurobiol. 30: 37-48.








Ronnett, G.V., Cho, H., Hester, L.D., Wood, S.F. and Snyder, S.H. (1993). Odorants
differentially enhance phosphoinositide turnover and adenylyl cyclase in olfactory
receptor neuronal cultures. J. Neurosci. 13: 1751-1758.

Ross, C.A., Danoff, S.K., Schell, M.J., Snyder, S.H. and Ullrich, A. (1992). Three
additional inositol 1,4,5-trisphosphate receptors: Molecular cloning and
differential localization in brain and peripheral tissues. Proc. Natl. Acad Sci.
USA. 89: 4265-4269.

Sanger, F. and Coulson, A.R. (1977). A rapid method for determining sequences in DNA
by primed synthesis with DNA polymerase. J. Mol. Biol. 13: 373.

Schild, D., Lischka, F.W. and Restepo, D. (1995). InsP3 causes an increase inapical
[Ca2+]i by activating two distinct current components in vertebrate olfactory
receptor cells. J. Neurophysiol. 73: 862-866.

Schmiedel-Jakob, I., Anderson, P.A.V. and Ache, B.W. (1989). Whole cell recording
from lobster olfactory receptor cells: responses to current and odor stimulation.
J. Neurophysiol. 61: 994-1000.

Schmiedel-Jakob, I., Michel, W.C., Anderson, P.A.V. and Ache, B.W. (1990). Whole
cell recording form lobster olfactory receptor cells: multiple ionic bases for the
receptor potential. Chem. Senses. 15: 397-405.

Seok, J.-H., Xu, L., Kramarcy, N.R., Sealock, R. and Meissner, G. (1992). The 30 S
lobster skeletal muscle Ca2+ release channel (ryanodine receptor) has functional
properties distinct from the mammalian channel proteins. J. Biol. Chem. 267:
15893-15901.

Sharp, A.H., S.H. Snyder and S.K. Nigam (1992). Inositol 1,4,5-trisphosphate receptors:
localization in epithelial tissue. J. Biol. Chem. 267: 7444-7449.

Shepherd, G.M. and Firestein, S. (1991). Making scents of olfactory transduction. Curr.
Biol. 1: 204-206.

Shepherd, G.M. (1994). Discrimination of molecular signals by the olfactory receptor
neuron. Neuron. 13: 771-790.

Shinohara, H., Kato, K. and Asano, T. (1992). Differential localizationof G proteins, Gi
and Go, in the olfactory epithelium and the main olfactory bulb of the rat. Acta
Anat. 144: 167-171.

Simon, M.I., Strathmann, M.P. and Gautam, N. (1991) Diversity of G proteins in signal
transduction. Science. 252: 802-808.








Sklar, P.B., Anholt, R.R. and Snyder, S.H. (1986).The odorant-sensitive adenylate
cyclase of olfactory recptor cells. Differential stimulation by distinct classes of
odorants. J. Biol. Chem. 261: 15538-15543.

Stehno-Bittel, L., Ltickhoff, A. and Clapham, D.E. (1995). Calcium release form the
nucleus by InsP3 receptor channels. Neuron 14: 163-167.

Stemberg, M.J.E. and Taylor, W.R. (1984). Modelling the ATP-binding site of oncogene
products, the epidermal growth factor and related proteins. FEBSLett. 175: 387-
392.

Strathmann, M. and Simon, M.I. (1990) G protein diversity: a distinct class of subunits
is present in vertebrates and invertebrates. Proc. Nat. Acad. Sci. USA, 87, 9113-
9117.

Siidhof, T.C., Newton, C.L., Archer, B.T., Ushkaryov, Y.A. and Mignery, G.A. (1991).
Structure of a novel InsP3 receptor. EMBOJ. 10: 3199-3206.

Sullivan, K.M.C., Lin, D.D., Agnew, W. and Wilson, K.L. (1995). Inhibition of nuclear
vesicle fusion by antibodies that block activation of inositol 1,4,5-trisphosphate
receptors. Proc. Natl. Acad Sci. USA. 92: 8611-8615.

Talluri, S., Bhatt, A. and Smith, D.P. (1995). Identification of a Drosophila G protein a
subunit (dGqc-3) expressed in chemosensory cells and central neurons. Proc.
Natl. Acad. Sci. USA. 92: 11475-11479.

Vodyanoy, V. and Murphy, R. (1983). Single-channel fluctuations in biomolecular lipid
membranes induced by rat olfactory epithelium homogenates. Science 220: 717-
719.

Wang, M.M. and Reed, R.R. (1993). Molecular cloning of the olfactory neuronal
transcription factor Olf-1 by genetic selection in yeast. Nature. 364: 121-126.

Wang, M.M., Tsai, R.Y., Schrader, K.A. and Reed, R.R. (1993). Genes encoding
components of the olfactory signal transduction cascade contain a DNA binding
site that may direct neuronal expression. Mol. Cell. Biol. 13: 5805-5813.

Wedegaertner, P.B., Wilson, P.T. and Bourne, H.R. (1995). Lipid modifications of
trimeric G proteins. J. Biol. Chem. 270: 503-506.

Wilkie, T.M., Scherle, P.A., Strathmann, M.P., Slepak, V.Z. and Simon, M.I. (1991).
Characterization of G-protein alpha subunits in the Gq class: expression in
murine tissues. Proc. Natl. Acad. Sci. USA. 88: 10049-10053.








Xu, F., Quintero, J., Gress, A.M. and McClintock, T.S. (1997). Molecular cloning of two
guanine nucleotide binding proteins from American lobster olfactory organ.
Chem. Senses Abstract. In press.

Yamada, N., Makino, Y., Clark, R.A., Pearson, D.W., Mattei, M.-G., GuJnet, J.-L.,
Ohama, E., Fujino, I., Miyawaki, A., Furuichi, T. and Mikoshiba, K. (1994).
Human inositol 1,4,5-trisphosphate type-1 receptor: structure, function,
regulation expression and chromosomal localization. Biochem. J. 302: 781-790.

Yoshikawa, S., Tanimura, T., Miyawaki, A., Nakamura, M., Yuzaki, M., Furuichi, T. and
Mikoshiba, K. (1992). Molecular cloning and characterization of the inositol
1,4,5-trisphosphate receptor in Drosophila melanogaster. J. Biol. Chem. 267:
16613-16619.

Zhainazarov, A.B. and Ache, B.W. (1995). Na+-activated nonselective cation channels in
primary olfactory neurons. J. Neurophysiol. 73: 1774-1781.

Zhainazarov, A.B., Doolin, R.E. and Ache, B.W. (1997). Odors activate a sodium-gated
cation conductance in lobster olfactory neurons. [submitted].

Zheng, J., Knighton, D.R., Ten Eyck, L.F., Karlsson, R., Xuong, N., Taylor, S.S. and
Sowadski, J.M. (1993). Crystal structure of the catalytic subunit of cAMP-
dependent protein kinase completed with MgATP and peptide inhibitor.
Biochem. 32: 2154-2161.

Zufall, F., Firestein, S. and Shepherd, G.M. (1994). Cyclic nucleotide-gated ion channels
and sensory transduction in olfactory receptor neurons. Annu. Rev. Biophys.
Biomed. Struct. 23: 577-607.














BIOGRAPHICAL SKETCH


Steven Dunn Munger was born on November 26, 1966, in Richmond, Virginia.

His parents Peter and Joan Munger moved to Charlottesville, Virginia, 6 months later,

taking Steven with them. His only brother, David, was born in 1970. Steven attended

Venable and Greenbrier Elementary Schools, Walker Middle School and Charlottesville

High School, graduating from the latter in June of 1985. That fall he enrolled at the

University of Virginia, where he graduated with a Bachelor of Arts in Biology 4 years

later. During his stay at U.Va., Steven worked with Dr. DeForest "Mike" Mellon on a

project concerning the projection of olfactory neurons from the nose to the brain. This

was his first exposure to olfaction, and served to whet his appetite.

After graduating from U.Va., Steven worked for one year as a technician in the

laboratory of Dr. Sally Moody and Dr. Steve Klein. This laboratory focused on

development, including development of the nervous system, another influence that would

be felt later on.

Steven enrolled as a graduate student at the University of Florida Department of

Neuroscience in the fall of 1990, and immediately started to work in the laboratory of Dr.

Barry Ache at the Whitney Laboratory. There, after a series of failed projects, he

succeeded in isolating two cDNAs from the lobster nose that may play a role in olfactory

transduction. While at the Whitney Laboratory, he also collaborated with the laboratory

of Dr. Barbara-Anne Battelle on a study characterizing a component of the horseshoe

crab visual transduction cascade.

Steven and his new dog Weaver now leave St. Augustine for Baltimore,

Maryland, where Steven will take a postdoctoral fellowship with Dr. Randall Reed at the






72


Howard Hughes Medical Institutes and the Department of Molecular Biology and

Genetics, Johns Hopkins University Medical School (Weaver will just play with tennis

balls).








I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philoso



Barry e, Chair
Professor of Neuroscience

I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.



Barbara Anne Battelle, Cochair
Professor of Neuroscience

I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully equat cope nd quality,
as a dissertation for the degree of Doctor of Phil/




rofes f gy
an rapeut

I certify that I have read this study nd that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Phil ophy.



Peter A. nderson
Professor of Physiology
and Neuroscience







I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.



Gerard Shaw
Professor of Neuroscience

I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.



ert M. G/eenberg
Assistant Scientist in
Molecular Biology

This dissertation was submitted to the Graduate Faculty of the College of
Education and to the Graduate School and was accepted as partial fulfillment of the
requirements for the degree of Doctor of Philosophy.


May, 1997 / '4 ,
Dean, College of Medicine



Dean, Graduate School











































3 1262 08554 630611 ll
3 1262 08554 6308




Full Text

PAGE 1

MOLECULAR CHARACTERIZATION OF TWO COMPONENTS OF THE IP 3 SIGNALLING PATHWAY IN THE LOBSTER OLFACTORY ORGAN By STEVEN D. MUNGER A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 1997

PAGE 2

Copyright 1997 by Steven D. Munger

PAGE 3

To Peter and Joan Munger for everything.

PAGE 4

ACKNOWLEDGMENTS I would like to thank my mentor Dr Barry Ache, for his patience when all looked bleak and for trusting me enough to allow me to pursue projects that may not have shown the greatest likelihood of success. I have learned much of how science, in the broadest sense should be approached I thank Dr. Barbara Anne Battelle for her support and for her excellent lessons in how to properly construct an experiment. If I am half as rigorous a scientist, I will be quite happy. I would also like to thank her for treating me like a colleague as well as a student. I consider myself her graduate student as well. My thanks go to Dr. Robert Greenberg, for rarely getting frustrated when I was the 37th person that hour to ask him a question. He has been a good teacher and a good friend. Sincere thanks and appreciation to all the other members of my committee: Dr. Peter Anderson, Dr. Gerry Shaw and last minute-substitute and slumlord Dr Michael Greenberg. All of you have been invaluable to my education and to my enjoyment of the Whitney Lab. Of course I cannot neglect all of those Whitney folks, past and present, who have made my stay at the Laboratory such a joy (at least, compared to graduate school anywhere else). A s everyone has helped me in so many different ways over the last several years I will not make a laundry list of good deeds Everyone knows how they helped in one way or the other. But here is the honor roll in no particular order: Lynn Milstead Jim Netherton Karen Kempler Gary and Susanna Lafleur, Dave Price Gerhard Reich Louise MacDonald Shirley Metts Gina White, Chris Brink, Sean Boyle Chuck Peterson Luke Dunlap Paul Linser, Anne Andrews Jeri-Lynn Schremser, Chris IV

PAGE 5

Williams Rick Gleeson Bill Carr Hank Trapido-Rosenthal Debi and Jim Fadool, Russ Buono Billy Raulerson Bob Birkett Mike Jeziorski Asl Zhainazarov, Elisabeth Wiese Mike Michel Matt Wachowiak Manfred Schmidt Aurea Orozco-Rivas Nicole Rust and all of tho s e other REU s tudents the Sandpiper and of course Cornelius Vanderbilt Whitney. Finally, I thank my parent s, for their support and encouragement. Nothing would have been possible for me without all that they have done and all that they have been. V

PAGE 6

TABLE OF CONTENTS ACKNOWLEDGMENTS lV ABSTAA C T ........ . .. .. .. ........ .. .. .. .. . ... .. .. .......................... .. .... .... .. .............. ..... .... .. . Vll 1 INTRODU C T.ION ..... .. ..... .. .. .. .. .. .. .. .. .. .. . .. .. .. .. .. .. .. .... ........................ . . ........... 1 0 !factory Proce s sing .... . .. .. .. .. .. .............. ... .... .. .... .. .. .. .. . .. .... ..................... .... . ..... I Multiple Transduction Pathways in Olfaction .. ..... .. ................ .... .... ................... .... 2 The Lobster as an Olfactory Model Sy s tem ......... .. .. ..... .. ............................................ 3 Both cAMP and IP 3 Underlie Lobster Olfactory Transduction ..................................... 8 The Lobster O I factory IP 3 Receptors . .. .. .. ..... . ... ......... .................. ....................... 13 G proteins Mediate Lobster Olfactory Transduction ................................................... 14 Specific Aims ... .. .. ............... ............ . .. .... ... ... . . .. .. .. .. ............ ..................... ... . .. ... 15 2 MOLECULAR CHARACTERIZATION OF AN OLFACTORY ORGAN IP 3 REC E PTOR ....... ... .. .. .. ..... .. .. ...... . ... .. .... .. .. ........... ............... .................................... ...... .. .. 17 Introduction .. .. .. .. .. .. I I .. .. I I .. I .. I I .. .. .. I .. .. I .. .. .. .. .. .. .. .. .. .. .. I .. .. .. .17 Methods. I .. I I .. I .. I .. .. .. .. .. .. e .. .. .. .. .22 Results .. . .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. 25 Di s cu ss ion ...... ...... .. ................... ... .. ...... ... .. .. .. .. . .. . .... .. ..... .. .. .. ... . ........... ................................... .............. 33 3 MOLECULAR CHARACTERIZATION OF AN OLFACTORY ORGAN GQ PROTEIN .. .. .. . .. .. ............. .. .. ... ..... .. .. . .. ... ... .. .................. ........................................................... 38 Introduction . .. .. .. . . . .. . . . . .. . .. .. .. . . . . . . .. . .. . .. . . . . .. . . . .. . . .. .. . .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. . . . .... .. ...... .. 3 8 Method s .. .. . . . . . . .. . . . . . .. . . . . . . . . . . . .. . .. . .. .. . . . . . . . .. .. .. . .. .. .. .. .. .. .. .. .. .. .. .. .. .. . .. .. .. . . .. .. .... . .... .. .. 40 Re s ul ts .. ..... .. .. . .. . ....... .. .......... ............ ... .... ... .. .. . .. .. .. .. ....... .. . .. . . .. .. .. . . .. .. .. .. . . . .. .. .. .. .. . .. .. .. .. 4 2 D . 1scuss1on ............................ . . . .. .. .. . .. ......... .. ............ .. .. ... .. ... .. .. .. .. . .... ... ...... .. .... .. ........ .. ...................................... 50 4 s y .. ....... .. .. ..... ... .. . .. .... ... .. .... ... .. ..... . .... .. .. .. .. ................... ..... .. ....... .............. .. ... .. ....... 54 LIST OF REF E RE N CES ...... ......... .. .. .. .. ... ........... ..... .. ....... .. ...... ... ..... .. ........................ .. ....... ... .... 60 BIOGAAPHICAL S'KET C H . . .. .. ..... ..... .. .. .. .. . .... ............... .. ..... ....... . .. ............................. .... ... ... 71 Vl

PAGE 7

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy MOLECULAR CHARACTERIZATION OF TWO COMPONENTS OF THE IP 3 SIGNALLING PATHWAY IN THE LOBSTER OLFACTORY ORGAN By Steven D Munger May 1997 Chairman: Barry W. Ache Major Department: Neuroscience Olfactory transduction is a complex biochemical process that transforms odor signals from the environment into neural signals that can be interpreted by the brain triggering appropriate behavioral and physiological responses in the organism. Inositol 1 4 5-trisphosphate (IP 3 ) has been implicated in a variety of species, as a second messenger involved in olfactory transduction though its precise role remains controversial. IP 3 has been proposed by some to be either a modulatory factor or a necessary cofactor for the better characterized transduction pathway mediated by adenosine 3 ', 5 -cyclic monophosp hate ( cAMP); others believe it to have a role equivalent but not identical to cAMP. A key to understanding the funtional intricacies of the cAMP pathway was the molecular isolation and characterization of components of this signalling cascade in olfactory receptor neurons (ORNs) Unfortunately, few Vll

PAGE 8

components of the IP 3 pathway of ORNs have been characterized. In the spiny lobster, Panulirus argus electrophysiological studies have implicated an IP 3 -gated channel, the IP 3 receptor (IP 3 R), as the target of IP 3 generated by excitatory odor-stimulation. A Gq protein a-subunit a member of the family ofheterotrimeric OTP-binding proteins, has also been implicated in the excitatory odor response, serving to link the activated odor receptor with the enzyme that generates IP 3 This dissertation describes the molecular cloning of cDNAs for two components of an IP 3 signalling cascade from the olfactory organ (nose) of the spiny lobster: an IP 3 receptor and a Gq protein~ These two proteins, both implicated in the excitatory odor response in lobsters, share many structural characteristics with those isolated from other species and tissues. The IP 3 receptor cDNA encodes a protein that is about 50o/o identical to those isolated from Drosophila and several vertebrates. The Gq protein shows an even similarity to other Gq proteins (70803/o ). The messenger RNAs for these two molecules are both expressed in the olfactory organ making them candidates for roles in olfactory transduction. The isolation and characterization of these two cDNAs is a critical step in the understanding of both the role ofIP 3 in olfactory signalling and the complexity of odor transduction in all animals V111

PAGE 9

CHAPTER 1 INTRODUCTION Olfactory Processin~ Most odors are complex mixtures of compounds, and it is the role of the olfactory system to transduce these chemical stimuli into neural signals that reflect the complex nature of the odor. The olfactory system does this by doing more than just assigning each odor component a neural signature, reflected as a change in membrane potential. The system also processes the signals to reflect such information as concentration and mixture composition This processing could take place at several possible levels In the extracellular environment access of odor molecules to olfactory receptor binding sites on the surface of olfactory receptor neurons could be regulated by odorant binding proteins or enzymes that degrade odor molecules or there could be competition between odor molecules for olfactory receptor binding sites. In olfactory receptor neurons that contain multiple transduction cascades, the activation of olfactory receptors of different specificity could activate more than one transduction pathway providing ample targets for biochemical cross-talk that might modulate the function of either cascade. The best characterized site of olfactory processing is at the level of synaptic processing, beginning at the point of contact between olfactory receptor neurons contact second order neurons in the olfactory bulb (ve rtebrate s) or lobe (invertebrates) and continuing in higher neural centers ; here the activity of numerou s olfactory receptor neurons is shaped by the integration of activity across the population. Although each of these levels is a potentially critical ste p in the coding and processing of odor information, this dissertation will concentrate on some of the mechanisms of olfactory transduction. 1

PAGE 10

2 Through the better understanding of these mechanisms in cells that express multiple transduction cascades it may be possible to decipher how individual receptor neurons could begin to process multiple odor stimuli at the level of the single receptor cell. Multiple Transduction Pathways in Olfaction Olfactory transduction i s thought to occur through standard G protein-mediated second messenger systems (reviews: Breer and Boekhoff 1992; Ache and Zhainazarov 1995 ; Restrepo e ta! ., 1996 ; but s ee Vodyanoy and Murphy 1983 ; Labarcaetal ., 1988). In such a sys tem a receptor is coupled to second messenger-metabolizing enzymes ( e.g. adenylyl cycla s e which synthesizes cAMP from ATP) by a heterotrimeric OTP-binding protein (G protein) Evidence in rat (Breer et al. 1990 ; Boekhoff et al. 1990; Ronnett et al ., 1993 ), amphibian (Dionne, 1992 ; Bacigalupo et al. 1993; Lowe et al ., 1989; Lischka e t al ., 1995) catfish (lvanova and Caprio, 1992 ; Miyamoto et al. 1992; Restrepo et al ., 1990 ; Bruch and Teeter ; 1990) lob s ter (Michel and Ache 1992; Fadool and Ache 1992 ; Boekhoff e t al ., 1994 ) and squid ( Lucero et al 1992 ; Lucero and Piper 1994) points to multiple olfactory tran s duction mechanisms and implicates adenosine 3' 5'-cyclic monophosphate ( cAMP) and ino s itol 1 4 5-tri s phosphate (IP 3 ) as olfactory second messenger s ( review : Ache, 1994). However the functional consequences of cAMP and IP 3 vary between species. For example, while cAMP and IP 3 both depolarize ORNs in the catfi s h (lvanova and Caprio, 1992 ), the two messengers mediate opposing conductances in the lobster ( Fadool and Ache 1992 ; Michel and Ache 1992). cAMP and IP 3 both appear to act by directly gating ion channels in the plasma membrane (Nakamu ra and Gold 1987 ; Zufall e t al., 1994 ; Fadool and Ache 1992; Hatt and Ache, 1994 ; Lischka et al ., 1994) though some have challenged the findings of a plasma membrane IP 3 -gated channel (Brunet e t al., 1996 ; Nakamura et al ., 1996). There is now growing evidence for a multitude of modulatory and amplifying factors that may act on

PAGE 11

3 one or both of these two pathways including the gaseous messengers nitric oxide and carbon monoxide (Lischka and Schild 1993; Leinders-Zufall et al 1995; Zufall 1996 ; Broillet and Firestein 1996) Ca 2 + ( e.g Anholt and Rivers 1990 ; Kleene 1993; Lowe and Gold ; 1993 ; Kurahashi and Yau 1994 ) and cGMP (Breer et al 1992) (Figure 1). The advent of molecular biology has afforded the opportunity to identify many of the molecules that compose these olfactory tran s duction pathways pern1itting better characterization of their function s and their distributions. Most of the major components of the olfactory cAMP pathway have been c l oned from mammals: a type III adenylyl cycla se (Bakalyar and Reed 1990 ); a G protein a-subunit G 0 1 f (Jones and Reed 1989); and two s ubunits of the cAMP-gated channel (Dhallan e t al 1990 ; Bradley et al ., 1994 ; Liman and Buck 1994) The IP 3 pathway is not nearly as well characterized with only a catfish phospholipa s e C (Abogadie et al ., 1995a) a lobster IP 3 -gated channel (Munger et al ., 1995 ; Munger e t al ., 1997 ; Chapter 2 ) two lobster Gq proteins (Munger et al 1997 ; Chapter 3 ; Xu et al. 1997) and a Drosophila Gq protein (Talluri et al 1995) having been cloned. The lobster as an olfactory model system One advantage of the s piny lobster Panulirus argus as a model system for the study o f olfactory transduction is the extensive characterization of behaviorally-relevant odors. Many of the s e odors are s mall hydrophilic compounds such as amino acid s, quatenary ammonium compound s, nucleotides and amines ( review : Carr et al ., 1987 ; Ache and C arr 1989 ), present in the fle s h of the animal 's typical prey. Electrophysiological and biochemical of the ORNs to many of these odors as well as behavioral responses of the animal have been well characterized The olfactory organ or the '' no s e ," of the spiny lobster is the two lateral filaments of paired bifurcated antennule s ( Fi g ure 2) The somata of the olfactory receptor neurons

PAGE 12

Fi~e 1, Proposed pathways in olfactory transduction. (A) A vertebrate olfactory receptor neuron (ORN). Odor transduction takes place in the dendritic cilia, while the axon projects to the CNS where it makes its first synapse. Invertebrate ORNs have a similar structure (see Figure 2). (B) These biochemical pathways have been proposed in a variety of organisms to mediate olfactory transduction. The better characterized pathway involves the activation of adenylyl cyclase (AC) after odor activation of a receptor (R) via a G protein (G). The AC generates cAMP, which then directly gates a membrane channel. The second, parallel pathway, involves separate receptors G protein, and the metabolizing enzyme phospholipase C (PLC), which generates the messengers IP 3 (or InsP 3 ) and diacylglycerol. IP 3 (InsP 3 ) can also directly gate its own membrane channel. Several potential modulatory and amplification pathways are also proposed, including the activation of protein kinase A (PK.A) protein kinase C (PKC) and a G protein-coupled receptor kinase (GRK). Ca 2 + entering the cell through eitl1er second n1essenger-gated channel, can act both through calmodulin (CAM) such as by acting on pl1osphodiesterase (PDE), and by directly gating other channels. Finally, IP 3 (InsP 3 ) can be phosphorylated by a 3-kinase into InsP 4 which may also gate a channel. From Ache and Zhainazarov 1995 with pennission.

PAGE 13

A environment fluid layer o lfac tory epithel iu m lo CNS i B . . . . ... . . . . . ... ... .. . .. A . .. . ( e .->-PKA .. .. .. .. . ... AC 5 .. .... Na+ ., .. . . . . . .. . . . . .. .. .. . . cAMP ../ """"" + PIP2 ... -. 9 1 ----:: ::J \ lnsP 3 ', AMP , ,. ,I ; , , ~+-K ~ I , .. ... i ;' I I I er ..... f . ' . I \ I I I I ,; .-I ' ' ', t .... ., PLC .. G .. .. e A

PAGE 14

Fii!ure 2. (A) The lateral filament of the antennule of P argus is the olfactory organ The expanded view at right (B) shows the aesthetasc sensilla between two rows of guard hairs. The sensilla contain the dendrites of the ORNs while the ORN somata lie within the antennular lumen. (C) A cross section of a single aesthetasc sensillum shows the cluster of somata surrounded by auxiliary cells, projecting their dendrites into the shaft of the aesthetasc. The axons of the ORNs project to the olfactory lobe of the brain where they make their first synapse.

PAGE 15

A Antenna \ /A n l ennule t .. i A..-1\ /1 f, ,,_~ t ' 4 t l t ....._~ ,,... .. 1 .a ,, .. . 1 i,,.,-:.,,. t . 7 B 400m C ou te r dendr i tic Inner dendrltic segment IOOm ~ "'""' ~~-oux iliory cell loyer ~~-somoto cluster oxon bundle

PAGE 16

8 (ORNs) are clustered like bunches of grapes on the ventral aspect of the antennular lumen. The ciliated dendrites of these bipolar neurons extend into porous cuticular sensilla (aesthetascs), while the axons project to the CNS. Each sensillum has a cluster of about 320 associated ORNs, and there are some 1500 aesthetascs per antennule (Grunert and Ache 1988). The outer dendritic segment of the ORN is the site of olfactory transduction and consists of only plasma 1nembrane surrounding microtubules and cytoplasm (no endoplasmic reticulum or mitochondria are present) (Grunert and Ache 1988) Both cAMP and IP 1 underlie lobster olfactory transduction Individual odor molecules can either excite or inhibit a single ORN, but show both capabilities across the ORN population (McClintock and Ache, 1989; Michel et al., 1991) These opposing effects are due to the activation of different conductances: a K + conductance mediates the suppressive effect (Michel et al ., 1991 ), while a non-selective cation conductance underlies excitation (Schmiedel-Jakob et al ., 1989; 1990) Tl1ese opposing conductances are mediated by cAMP and IP 3 (Figure 3) (review Fadool and Ache 1994 ) Rapid kinetic measurements of second messenger production in vitro show the elevation in the dendrites of both cAMP and IP 3 in response to odor exposure (Boekhoff et al., 1994) (Figure 4) Drugs targeting the cAMP pathway perturb the inhibitory response (Michel and Ache, 1992) and cAMP directly gates a K + conductance in ORN dendritic plasma membrane (Hatt and Ache, 1994), linking cAMP to the inhibitory response. The excitatory response is affected by drugs targeting the IP 3 pathway (i.e., heparin) (Fadool ai1d Ache 1992) Intracellular injection ofIP 3 mimics the excitatory response (Fadool and Ache 1992). IP 3 directly gates two conductances of different magnitudes in inside-out patches of cultured ORN somatic plasma membrane (Fadool and Ache 1992) and ORN dendritic plasma membrane blebs (Hatt and Ache,

PAGE 17

Fi2]lfe 3. The lobster ORN dendritic plasma membrane supports at least two transduction pathways one mediated by cAMP and one by IP 3 In both of these cases, odors activate the enzymes adenylyl cyclase or phospholipase C via a receptor / G protein cascade. The evoked messenger molecules then directly gate ion channels in the membrane. Na + entering the cell (possibly via the IP 3 -gated channel) activates an additional membrane channel, and may serve to amplify the odor-evoked receptor potential. In the IP 3 cascade, diacylglycerol (DAG) is produced along with IP 3 with tl1e hydrolysis of the membrane phospholipid phosphatidylinositol 4,5-bisphosphate (PIP 2 ).

PAGE 18

potassium c h a nn e l K + 10 odor molecules \ ; adenylate cycl;ise INHIBITORY PATHWAY water cell membrane cytoso l Net dep olarizat i on pho s ph o lipa se C EXCITATORY PATHWAY / ca l ci um se le ctive non -se lective ca ti o n c h a nn el Na+ Ca ++ Na+ Na+ activated c h a nn el Na+ Ca++

PAGE 19

Fi~e 4. Fast kinetic measurements of the second me s sengers cAMP and IP 3 in ORN dendrites as elicited by the odors taurine (A) and proline (B). Dendritic membrane preparations were stimulated by individual odors before quenching the reactions and measuring second messenger levels by radioimmunoassay Both odors elevate both messengers. However the odor more likely to excite ORNs across the population (taurine) elevates IP 3 to a greater extent than cAMP while the odor more likely to inhibit ORNs across the population (proline) elevates cAMP to a greater extent than IP 3 From Boekhoff et al (1994), with pennission.

PAGE 20

A cAMP (pmol/mgl 800 600 400 200 0 ._ ...... __... -200 -100 0 100 11M Tao ri ne 12 B IP 3 [pmol/mgl cAMP (pmol/mg) 800 800 cAMP 600 600 4 00 4 00 200 200 o o ._ __ _.. 100 200 300 400 500 600 Time (msecl -200 -100 0 100 1,1M Pro1 ine IP 3 (pmo l /mg) 800 cAMP 600 400 200 0 1 00 200 300 400 500 600 Time [msec)

PAGE 21

13 1994) When a cell-free patch containu1g a large conductance IP 3 R was inserted into the cytoplasm of a seco nd cultured ORN (''patch -cram ''), application of odor to the ORN induced channel activity in the in s ide-out patch (Fadool and Ache 1992) implying odor induced generation of IP 3 in the recipient ORN, an observation confirmed by Boekhoff and colleagues ( 1994 ). Together these data implicate IP 3 as the ''excitatory'' second messenger. The lobster olfactory IP :1 receptors The IP 3 -gated conductances de s cribed by Fadool and Ache (1990) and Hatt and Ache ( 1994) must be definitively locali ze d to either the dendritic plasma membrane or to the endoplasmic membrane (the best understood location of IP 3 Rs) This is an important point as it would have great implications for the nature of the excitatory odor response: the elicited IP 3 could directly gate a plasma membrane channel, depolarizing the ORN by increasing the conductance of ions across the membrane or it could release Ca 2 + from intracellular stores and this tertiary messenger would indirectly depolarize the ORN. While one could argue that patches from cultured ORN somata might include ER membrane the patch recordings from dendritic blebs takes advantage of the morphological feature that the outer dendrite contains no membranous structures other than pla s ma membrane (Grunert and Ache 1988) Additionally, the drug thapsigargin, which blocks the Ca 2 + -ATPase responsible for refilling IP 3 -depleted Ca 2 + stores, did not affect the odor response (Fadool and Ache, unpublished results) as would be expected if this response were mediated by the relea se of Ca 2 + from intracellular stores It is therefore unlikely that the lob s ter olfactory IP 3 Rs are localized to the endoplasmic reticulum Lobster ORNs express two different IP 3 Rs. In inside-out patches from cultured ORN plasma membrane the two IP 3 -gated channels showed conductances of 74 pS (large

PAGE 22

14 channel ) and 30 pS ( small channel) ( Fadool and Ache 1992 ); two IP 3 -gated channels of similar conductance s ( 64 pS and 27 pS ) were recorded in situ from dendritic membrane (Hatt and Ache 1994 ) The large and small conductance channels were found in the s ame patch of membrane only twice and exhibited different voltage dependencies of the open probability (Fadool and Ache 199 2; Hatt and Ache 1994) Both of these findings are consi s tent with the h y pothe s i s that the two IP 3 Rs are differentially expressed across the population of ORN s. Whether these two IP 3 Rs are the products of different genes s plice variants of the s ame gene or are modified (e.g. phosphorylated) for1ns of the same pr o tein i s unclear Structural similarity between the IP 3 Rs in the pla s ma membrane of the lobster ORN s and the mammalian cerebellum is implied by immuno-crossreactivity A polyclonal antibody rais e d again s t the carboxyl-tail of the rat cerebellar type 1 IP 3 R increased the odor-evoked current over 400 % when injected into the soma of cultured ORNs and when copresented with 10 7 M IP 3 the antibody increased the probability of opening and the mean open time of both large and small conductance channels without affecting the channel conductance (Fadool and Ache 199 2 ). Lob s ter olfactory IP 3 Rs di s play important functional differences and similarities with vertebrate IP 3 Rs The lob s ter IP 3 Rs are functionally insensitive to ATP (Fadool and Ache 1992) even at high concentrations ( up to 50 mM) unlike mammalian and amphibian IP 3 Rs (Bezpro z vann y and Ehrlich 1994 ; Stehno-Bittel et al ., 1995). Preliminary evidence indicate s that the lobster IP 3 Rs mediate nonspecific cation conductances ( Fadool and Ache unpubli s hed data ) s imilar to intracellular IP 3 Rs (Be z prozvanny and Ehrlich 1994 ; Stehno-Bittel e t al ., 1995)

PAGE 23

15 G proteins mediate lob ster olfactory transduction As described above both the cAMP and the IP 3 secon d messenger cascades rely on a heterotrimeric GTP-binding protein (G protein) composed of a, Pand y-subunits to transduce the signal between the li gand-activated receptor and a downstream metabolizing enzyme (e.g adenylyl cyclase for cAMP or phospholipase C for IP 3 ). In lobster ORNs, the use of nonhydrolysable GTP analogs has demonstrated the necessity of such proteins in olfactory transduction (Fadool et al ., 1995). The identity of the G protein involved in the inhibitory odor response has not been identified [though it is clearly not the s ame as the one involved in the excitatory odor response (Fadool et al ., 1995)]. Two candidate a-subunits have been implicated in the excitatory odor response (Fadoo l et al ., 1995): a Gaq 1 11 of the Gq family and a Ga 0 of the Gi family. Only the Gaq 1 11 protein has been localized to the ORN dendrites. These studies involved the use of antibodies to conserved regions of these proteins so the G proteins that may function in the excitatory pathway must be isolated and characterized. Specific Aims In this project I have attempted to address the following question: Is the excitatory odor response in lob s ter ORNs mediated by common components of an IP 3 signaling cascade? This dissertation presents a series of experiments designed to isolate and partially characterize two components of the lobster excitatory odor transduction pathway: an IP 3 receptor and a Gq protein I have used a cloning strategy based on homology to known proteins to isolate and determine the primary structure of cDNAs for these two molecule s from tl1e lob ster olfactory organ I have demonstrated that these two molecules are expressed as messenger RNA s, in the olfactory organ a requirement for any protein involved in olfactory transduction. Together these data demonstrate two fundamental principles : fir s t two transduction molecules, physiologically implicated in

PAGE 24

16 the excitatory odor response are present in the olfactory organ ; and second, these molecules appear to share many feature s of primary structure with similar proteins in other IP 3 s ignaling cascades. The s e two molecules are the first components of the IP 3 mediated olfactory transduction pathway to have both structure and function characterized

PAGE 25

CHAPTER2 MOLECULAR AND IMMUNOLOGICAL CHARACTERIZATION OF AN OLFACTORY ORGAN IP 3 RECEPTOR Introduction Physiologica l and biochemical evidence implicates inositol 1,4 5 trisphosphate (IP 3 ) as well as adenosine 3 ',5 -cyclic monophosphate ( cAMP) as olfactory second messengers (reviews: Breer and Boekhoff 1992; Ache, 1994). Though IP 3 plays a primary transduction role in many invertebrates the precise functional role of IP 3 is less clear in vertebrate ORNs (e.g. Firestein et al ., 1991; Nakamura et al ., 1994; Kleene et al. 1994 ; Nakamura et al ., 1996 ; Brun et et al ., 1996), where this messenger may serve as a modulatory factor a required cofactor or as an excitatory or inhibitory second messenger acting in parallel to the cAMP pathway But in contrast to the cAMP transduction pathway where many of the major molecular components have been cloned, sequenced and localized to the transduction zone (Jones and Reed, 1989; Bakalyar and Reed, 1990; Dhallan et al ., 1990; Bradley et al. 1994; Liman and Buck, 1994) the IP 3 pathway has been minimally characterized at the molecular level. Notable exceptions include a phospholipase C from catfish (Abogadie et al ., 1 995b) and Gq proteins from two species of lobster ( Caribbean spiny lobster: Munger et al 1997; American lobster: Xu et al ., 1997) and D,osophila (Talluri et al ., 1995). In olfactory systems, the binding of some odor molecules to G protein-associated receptor s is thought to activate the enzyme phospholipase C, which hydrolyses the me1nbrane lipid phosphatidylinositol 4 5 bisphosphate into IP 3 and diacylglycerol (Breer et al. 1990 ; Boekhoff et al ., 1990 ; Berridge, 1993; Ronnett et al ., 1993; Boekhoff et al ., 1994) The IP 3 can then gate the intrinsic channel of IP 3 receptors (IP 3 Rs) on the plasma 17

PAGE 26

18 membrane of ORN cilia or outer dendrites (Fadool and Ache 1992; Hatt and Ache, 1994; Restrepo et al ., 1990 ; Restrepo et al ., 1992; Li s chka et al ., 1995). IP 3 Rs have been traditionally thought to be principally localized to the ER and nuclear membranes (reviews: Furuichi et al ., 1994; Ferris and Snyder 1992) but there is growing evidence for the presence of IP 3 Rs in the plasma membrane (e.g. Restrepo et al, 1990 ; Fadool and Ache 1992 ; Fujimoto et al. 1992 ; Restrepo et al 1992; Khan et al ., 1992; Sharp et al ., 1992 ; Hatt and Ache 1994; Lischka e t al ., 1994; Kuno et al ., 1994 ; Khan et al 1996) including the immunological localization of an IP 3 R to the cilia (as well as other compartments) of rat ORNs (Cunningham et al ., 1993) and the description of a protein in catfish ORNs affinity labeled by an L 25 1-IP 3 analogue (Kalinowski et al., 1992) ; this latter protein, however, is half the size (107 kDa) of all other known IP 3 Rs. The primary structure of numerous vertebrate IP 3 Rs has been determined by cDNA cloning ( e.g. Yamada et al. 1994; Y amamoto-Hino et al ., 1994; Maranto 1994; Furuichi et al ., 1989 ; Mignery e t al. 1990; Sudhof et al ., 1991; Blonde! et al ., 1993; Kume et al 1993) as well as Drosophila (Yoshikawa e t al ., 1992) All of these cloned IP 3 Rs are homologous sharing the same basic structural motifs (Figure 5). Multiple isoforms types 1, 2 and 3 have been identified in mammals ; they possess 6070% sequence identity and appear to vary only in sensitivity to modulation, affinity for IP 3 binding and tissue distribution. The IP 3 R proteins consist of2693-2833 amino acids coded for by anmRNA of 9-10 kb and have three functional domains: an IP 3 -bindin g domain a central modulatory domain, and an ion channel domain. The IP 3 -binding domain lies within the first 650 amino acids of the IP 3 R [amino acids 476-501 are labeled by photoaffinity ligands (Mourey et al. 1993)]. The type 1 IP 3 R contains the frrst of two s l1ort, alternatively spliced regions (Sn within the IP 3 binding domain. The modulatory domain lies between the IP 3 -binding and channel domains and may contain consensus sites for ATP binding and protein kinase A phosphorylation along with s everal calcium related signals and the second

PAGE 27

Fi~ 5. fP 3 Rs all contain three principle domains: a ligand binding domain (IP 3 ) at the amino end of the protein a central modulatory domain, and a channel domain with six transmembrane regions (Ml-M6) and a putative pore-forming region Both the amino and carboxyl termini are extend into the cytoplasm (this is true for receptors on the endoplasmic reticulum as well as on the pla s ma membrane). The channel is thought to be a nonselective cation channel. Modified from Mikoshiba, 1993.

PAGE 28

20 extracellular /1111ninal r r r r . r \_J) \0 ~ Iii m ::s I ::s ::s ::s ::s "-: I ' . ,\. .... I~ HOOC ) (' J C ~' C J cytoplasm C. IP3 ... H 2 N After K. Mikoshiba 1993.

PAGE 29

21 splice site (SII ; in type 1); the nwnber and types of these consensus sites varies among IP 3 R types and among species, and some sites (i.e., protein kinase C phosphorylation sites) are as yet undefined (review: Furuichi et al., 1994). The channel domain contains six putative transmembrane regions [ as defined by hydrophobicity and N-linked glycosylation sites (Michikawa et al ., 1994)] and a carboxyl tail thought to be involved in calcium release (Nakade et al ., 1991) The channel pore is thought to lie between the last two transmembrane regions 5 and 6 (Michikawa et al ., 1994). It is the final two transmembrane regions and the carboxyl tail that show the greatest similarity in protein sequence to another intracellular calcium release channel, the ryanodine receptor. Although these cation channels are relatively nonselective (Bezprozvanny and Ehrlich, 1994 ; Stehno-Bittel et al. 1995 ; but see McDonald et al ., 1993 ), their main role is thought to be the release of calcium from intracellular stores in response to an IP 3 mediated extracellular signal (review: Berridge 1993). Lobster olfactory IP 3 Rs di s play important functional differences and similarities with vertebrate IP 3 Rs The lobster IP 3 Rs are insensitive to ATP (Fadool and Ache 1992), even at high concentrations (up to 50 mM) unlike mammalian and amphibian IP 3 Rs (Bezprozvanny and Erhlich, 1993) Preliminary evidence indicates that the lobster IP 3 Rs mediate nonspecific cation conductances similar to intracellular IP 3 Rs (Fadool and Ache, unpubli s hed data). Cunningham and colleagues (1993) provided evidence that rat ORNs express an IP 3 R in cilia that is somewhat similar to the cerebellar typeI IP 3 R But the antibodies used in these s tudies cross-react with all three IP 3 R subtypes; so we cannot be sure whether the IP 3 R in ORN cilia is the same as that expressed in cerebellwn or if the olfactory IP 3 R is similar yet not identical IP 3 R form In this chapter, I describe the isolation of an IP 3 R cDNA from the olfactory organ of the spiny lobster Panulirus argus This IP 3 R is expressed in both olfactory organ and brain. Attempts to localize this IP 3 R to the ORN dendrite s the site of olfactory transduction--are inconclusive, so the involvement of this

PAGE 30

22 particular IP 3 R is involved in shaping the initial odor response remains Wlproven. Portions of this work have previously appeared in abstract form (MW1ger et al ., 1995; Munger et al ., 1997 ) Methods RNA extraction: Olfactory organs ( 100 antennules per isolation) were harvested into a dry ice /e thanol bath transported from the Florida Keys to the Whitney Lab on dry ice and stored at -80C until used. The antennules were homogenized in liquid nitrogen by mortar and pe s tle then tl1e powder was homogenized by polytron in a GTC / mercaptoethanol solution (sarkosyl added to 2% after homogenization). After removing cuticle by centrifugation, the homogenate was layered onto a 5. 7M CsCl cushion for ultracentrifugation (24 hours 20C 30,000 rpm in a Beckman SW-41 rotor). The RNA pellet wa s re s uspended in 10 mM Tris-HCl (pH 8.0), 1 mM EDT A-SOS, spectrophotometrically quantified and stored in ethanol with 0.3 M sodium acetate, pH 5.5 at -20 C. RT-PCR: IP :i & Degenerate oligonucleotide primers were designed to match regions of conserved nucleotide se quence within the final putative transmembrane region (amino acids FFVMVIIIV sense primer ) and the carboxyl tail ( amino acids E Y anti se nse primer) of known IP 3 R s. Total RNA from nose (10 g) was reverse transcribed with SuperScript II M-ML V reverse transcriptase using the antisense primer The re s ulting cDNA s erved as template for touchdown polymerase chain reaction (PCR) amplification The PCR reaction mixture contained 100 pmol of each primer, 5% of the reverse tran s cription reaction volume, 2.5 units of a 60 : 1 mixture of Taq:pfu polymera ses, 1 .5 mM MgC1 2 500 mM KCl 100 mM Tris-HCI pH 9.0 and 1 % Triton X100 The PCR cycling profile wa s as follows: [94 C, 5 min ; 60C 2 min; 72C 3 min] x 1 cycle ; [94 C, I min ; 59C (1 C/ cycle) I min ; 72C 2 min] x 9 cycles; [94 C, I

PAGE 31

23 min; 52C, 1 min; 72C 2 min] x 30 cycles. The resulting 203 bp product was gel purified ligated into the TA-cloning vector pGem-T (Promega), and transformed into JMI 09 competent E coli for subcloning. Control RNA samples, which were treated as above except for receiving no reverse transcriptase showed no product. After screening colonies for appropriately sized inserts by PCR individual clones were selected for sequencing by standard chain termination methods (Sanger et al., 1977). Seven clones (78 / 79-1 through 78 / 797) were fully sequenced, and the cDNA sequences were translated assembled and analyzed with GeneRunner (Hastings Software Inc.) and Biolmage DNA Sequence Film Reader software (Biolmage ). The deduced amino acid sequences were compared with all known proteins using BLAST software (NCBI, Altshul et al. 1990) 3'-RACR (Rapid Amplification of cDNA Ends): The 3'-RACE technique is modified from Frohman et al (1988). Total RNA from nose (10 g) was reverse transcribed with an oligo-dT 1 7 /Not I oligonucleotide. The resulting cDNA served as template for the first round of PCR amplification; the oligo-dT primer and a primer specific to clone 78 / 79-1 were used. The PCR product then served as template for a second round of PCR amplification in which the same oligo-dT primer and a nested 78 / 79-1-specific primer were used. The resulting product of 643 bp ( clone 3R2A) was purified subcloned and sequenced as described above. Creation of cDNA minilibrary and library screenin2: A unidirectional cDNA minilibrary was constructed in the bacteriophage Agt22A vector system (Gibco-BRL Lambda System) from olfactory organ poly(A) + RNA cDNA ligated into the "A arms was reverse transcribed with the antisense degenerate primer (see above) coupled to a Not I adapter. The library was screened by plaque hybridization at high stringency (60C) using clone 78 / 79-1 as probe A 1707 bp clone (1111-2) which overlaps with clone 3R2A was isolated. Clone 1111-2 maintains homology to other IP 3 Rs. Three

PAGE 32

24 more overlapping clones (56 / 25H3 1272 hp, 62 / 25N2 938 bp and 3 / 144H2, 2386 bp) were also isolated from the library by PCR. 5'-RACE (Rapid Amplification of cDNA Ends): 5'-RACE was modified from Frohman et al (1988) with the 5'-RACE kit (Life Technologies). Total RNA from nose (10 g) was reverse transcribed as above with an IP 3 R-specific antisense primer, and a poly(C) + tail was added to the 3'-end of the antisense single strand cDNA with terminal transferase. The resulting cDNA served as template for the first round of PCR amplification using a ne sted antisense IP 3 R-specific primer and an anchor primer to the poly(C) + tail (Sal 1-Spe J-OTACGGGIIGGGIIGGGIIG, where I = inosine). The same anchor primer and a second nested IP 3 R-specific primer were then used in a second round of PCR amplification with the PCR products serving as template The resulting products were purified, subcloned and sequenced as described above. Control RNA samples, which were treated as above e xcept that they received no reverse transcriptase or no terminal traosferase showed no product. PCR reagents for both reactions were: 50 pmol of each primer, 20% of the tailed cDNA ( or 0 1 % of the first PCR reaction), 1.5 mM MgCl2 500 mM KCl 100 mM Tris-HCl pH 9 0 and 1 % Triton X-100. PCR cycling times were as follows: [94C 5 min; 49C 2 min; 72C, 3 min] X 1 cycle; [94C, 30 sec ; 49 C 30 sec ; 72C, 2 min] x 30 cycles Sequencing, translation, assembly and analysis was done as above. A second 5'-RACE reaction was performed for the IP 3 R to reach the 5'-UTR. Sequencing, translation assembly and analysis was done as above; some clones were sequenced by the University of Florida's Interdisciplinary Center for Biotechnology DNA Sequencing Core Laboratory using the Taq DyeDeoxy Tenninator and Dyeprimer Cycle sequencing protocols developed by Applied Biosystems, and the Applied Biosystems Model 373A DNA Sequencer. To control for errors which may have resulted from the actions of the DNA polymerases or the reverse transcriptase four overlapping clones, which together spanned

PAGE 33

25 the entire contig from the 5 to the 3 -untranslated regions, were amplified in duplicate, independent RT-PCR reactions and a consensus sequence was taken. Ribonuclease Protection Assay (RPA): This assay was done according to the protocols accompanying the RP A II kit (Ambion) RNA san1ples (1.5 and 3 g nose poly(A) + RNA and 5 and 10 g brain total RNA along with yeast RNA controls) were hybridized in solution to a 32 P-labeled antisense riboprobe transcribed from clone 79 / 791 The RNA samples were then subjected to RNase digestion (RNase A and Tl) and separated on an 8M urea/5 o/ o acrylamide gel. One of the yeast controls did not undergo RN ase digestion. The gel was exposed to X-ray film for 18 days at -80C with intensifying screens Results cDNA clonin~ The 203 hp cDNA product obtained from the initial RT-PCR was subcloned, sequenced and conceptually translated. Seven separate clones (79 / 78-1 through 79 / 787) were sequenced and were found to be identical in nucleotide sequence. A comparison of the deduced amino acid sequence with seque11ces in the GenBank database revealed that these products are homologous to previously cloned IP 3 Rs (they are less similar to the ryanodine receptors which share some primary structure with IP 3 Rs). The clone was extended to the 3'-untranslated region (UTR) by 3' -RA CE (c lone 3R2A). To obtain the remainder of the clone extending into the 5 -UTR a cDNA minilibrary was constructed in 11,gt22A from olfactory organ poly(A) + RNA reverse transcribed with the antisense degenerate primer used in the initial R T-PCR experiment. This library was screened by a combination of plaque hybridization and PCR to isolate a series of overlapping clones. The minilibrary apparently contained no clones that extended to the 5' UTR, so 5

PAGE 34

26 RACE was used to isolate the remainder of the coding sequence. Four overlapping clones which together spanned the entire open reading frame, were amplified in duplicate RT-PCR reactions (data not shown) and the consensus sequence across all three clones was taken. One of the original partial clones (1111-2) contained an intron that was not present in any of the subsequent confirmatory clones ; this was the only intron sequence isolated from any of the clone s, and no alternatively-spliced variant was ever isolated. The assembled full-length clone has an open reading frame of 8409 bp coding for 2803 amino acids (Figure 6). The predicted protein has a calculated molecular weight of 320 kDa. The initiating methionine selected is the first methionine in the open reading frame and a consensus intiation sequence (Kozak 1991) is present at this point. The protein contains several residues predicted to be subject to posttranslational modification, including one consensus site for extracellular N-glycosylation (N 2 3 10 ), three possible sites h h 1 b k' A(s 1 00 1 s 1 05 1 s 2 5 0 9 h 1 f hi h' 1or p osp ory ation y protem mase , t e atter o w c 1s present in the predicted pore-forming region of the channel) and one putative site for tyrosine phosphorylation (Y 18 32 ). All these sites await experimental evidence as to their relevance for the native protein However, unlike many vertebrate IP 3 Rs, there is no consensus sequence for ATP binding though there is a related NAD/F AD consensus binding sequence. The deduced amino acid sequence for the full-length clone is homologous to other IP 3 Rs [Figure 7--NCBI sequence identification numbers in parentheses; Drosophila: 51 % (266387); human type 1: 49% (1362832)]; it shows equivalent similarity to type 2 IP 3 Rs but is less similar to type 3 IP 3 Rs, and is clearly only distantly related to ryanodi11e receptors with the greatest similarity seen in the channel regions. Like other IP 3 Rs the putative pore-forming region of the channel domain (between the fifth and sixth membranes panni11g regions) is poorly conserved. The entire lobster IP 3 R sequence seems to maintain the distribution of conserved and variable regions that has been seen in the other IP 3 Rs One portion of the sequence, however, stands out as being

PAGE 35

Fi~ure 6. The nucleotide and deduced amino acid se quence of the lobster IP 3 R cDNA. The coding region of 8409 bp encodes 2803 amino acids. The target sites of the degenerate primers used in the initial isolation are indicated in gray with arrows. The six predicted transmembrane regions (Ml-M6) are indicated by underlines Consensus motifs for one putative N-glycosylation site (arrowhead) 3 potential sites for protein kinase A phosphorylation (stars) and a putative tyrosine phosphorylation site (filled circle) are seen.

PAGE 36

2 8 l AGTGTTOCTCCTGACGAGCCTTCCTTTGTGTGGTTGTGACAAACTGATTI'CCGAGTAAAATGACTAAATGATGACAGTCATGAATACTGTGGTIU>TGATGACTTGGTCCTGACATCATAC H G P B G S A S 121 ATTMOGGCCACCJ\TCAGGTGTGAACTACGTAAGGTCATGCCCCTGGTGTGACCCAGATAAAGGGACAGACTTGAGGAMTTMGMGGCAGTCJ\GCATGGGGCCTGAAGGATCTGCCTC 9 F L H H G O I V S L Y A E G S V S G F l 6 T I, G L V D A R C V V N P E A G D L S 2 4 1 CTTCT1'GCATATGGGCGACAIIUTGTCCCTCTATGCAGAAGGCAGTGTTTCGGGATTCATCAGTACCCTTGGCCTGGTGGATGCTCGTTGTGTGGTAAACCCAGAGGCAGGTGACCTTAG 49 T p p K K F R O C L F S l C P S N R Y S A O K O F W K A A R S G N S T T D P S 3 61 CACC:CCACCTAAGAAATTCAGAGACTGCTTGTTCAGTATCTGCCCCAGTAACCGGTA1'TCAGCCCAGAAACAli I Tl l'GGAAAGCAGCAAAGCATAGTC-GCAACTCCACCACTGACCCGAG 89 L L N R L H O A A K T E K R O N E A E S K K L M G T V I N V G I T I O L L H L K 48 1 CTTACTCAACCGTCTTCACGATGCGGCTAAGACGGAGAAAAGACAGAATGAAGCAGAGAGTAAGAAGCTTATGGGTACTGTTATTAAT'tACGGTATTACCATTCAGTTACTTCACTTGM 129 S N K Y L T V N K R L P A L L E K N A H R V Y L O A N G N E G S W P Y I N P Y Y 601 GTCCAACAAGTACCTGACAGTAAACAAGCGACTACCAGCACTGCTGGAGAAGAATGCCATGCGAGTATACCTGGATGCTMTGGCAATGAGGGCTCATOOTTCT ATATCAA CCCTT ACTA 169 K L R N p G O N V V V G O K V I L S P V N A G O O L H V S S T H D L R O H P G C 721 CAAGCTTCGTAATCCTGG1'CACAACGTGGTAGTTGGGGACAAAGTTATTCTAAGTCCAGTGAATGCAGGACAGCAACTTCACGTGTCAAGCACACACGACCTGAGGGATCATCCAGGATC 209 K E V N V L N S N T C W K I S L f L E H K E N L E G V L K C G D V I R L F R A E 841 CAAAGAGGTTAATGTGTTAAATTCAAATACATGffGGAAGAT AT CATTATTCCTGGAGCATAAGGAAAATCTGGAAGGTGTATTGAAGGGAGGGGATGTGATCCGTCTCTTCC ATGCTGA 2 4 9 0 E K P L T M O E Y K K K O H V F L R T T G R T T A T A A T S S K A L W E V E V 961 GCAAGACAAATTTCTTACAATGGATGAGTACAAAAAGMGCAACAT1>i I I f'ICTCAGGACAACTGGACGAACCACTGCCACTUCTGCAACTTCCAGCMGGCATTATGGGllAGTTGAGGT 289 V Q H O P S R G G A G H W N S L F R F K R L A T G H Y L A A E I D O D P T P D P 1081 TOTACAGCACGACCCATCTCGGGGTGGAGCAGGTCACTOOAATTCATTGTTTCGCTTTAAGCATCTTGCCACTGGTCATTACCTGGCTGCTG AAATTGATGATGACCCTACTCCGGATCC 319 T R T K L R O P N G G P V Y O L V S V P L S N O I A 6 I P E L E P T T L I R G D 1101 AACAAGAACAAAGCTAAGAGATCCTAATGGGGGTCCAGTCTATCAGCTGCTCTCAGTGCCATTAACTAATOATATTCCATCTATCTTCGAGCTTGAGCCTACCACTTTAATACGGGGTGA 369 S H V P Q S S Y V R L R H L C T S T W V H S T S l P l D K E E O K P V H S K V C 1121 TTCTATGGTCCCACAGTCTTCATJ\TGTGAGATTACCACACTTATCCACATCTACATGGGTCCACTCMCTTCCATACCCATTOACAAAGAGGAGCATAAGCCTGTAATGTCAAAGGT100 409 C A P I K S O K E A F S L V P V H A K E V R O L O F A H O A S E V L A K H A K K 1441 TTGTGCCCCCAl'CAAACAGGATAAGGAAGCTTTCTCATTAGTTCCAGTTCATCCCAAACAAGTGAGACATCTACATTTTGCCCATCATGCCAGTGAAGTTTTACCCAAACATCCOAACM 449 L E K C S I T O A E R R S L H L L L L D L V Y P T A E K E H E O N K S 6 S L A L 1561 ACTAGAAAAAGGGTCTATAACACAAGCTGAGAGAAGGTCGTTAATGCTUTTGCTTTTAGATCTAGTCTATTTCACTGCTGAGMGGAACATOMCAAAACAACAGTGMTCACTTGCATT 489 A L E V T N P N R D R O K L L R E O S I L K O I F K I L R A P P T E T O G G D G 1681 GGCTCTGGAAGTCACTAATCCT MCAGACAT CGTCAGAAGCTTCTC AGAGJU\CAGAGTAIIITAAAACACAIIIIIAJ\GATTCTTAGAGCACCATTCACTGAAACTCAJ\GGAGGTOATGG 529 P L L R I O E L N D P R H S A Y K N 1 F R L C Y R L L R L A O O G Y R K N O S H 1801 TCCTCTCCTCCGGATTGATCAACTGAATGACCCACGACACTCTGCTTACAAGAACATTTTTCGTCTOTGTTATAGACTCCTOllGCCTTGCCCAACAGGGTTATAGAAAAAACCAGGAACA 569 I A O H F G F H Q K Q I G I O I L A E T l T A L L H N N R K L L E I H I T A T 19 21 TATTGCACMCAC'I I IGGTTTTATGCAAAAACAAATTOGGATAGAC A! I I I <.iGCGGAAGAAACCATCACAGCTCTTCTTCAl'AACAACCGCAAACTJI.CTGGAGATCCATATCACAOCTAC 609 S t e T F V G L V R K N H H K W O W R F L D Y L K V L C I S N N O A I P R T O S 2041 AGAAATTGAAACATTTGTAGGATTGGTCCGGAAAAATATGCACAAA TGGGACTGGAGATTCCTTGATTATCTTAAGCT I l"l'GT
PAGE 37

29 1449 4 561 A M V E H K O C I P E V K E A Y I N F L N H C Y I O T E V E H K E I Y N S H H I GGCTATGGTAGAGCACAACGATTGTATCCCTGAGG'l'TAAAGAAGCTTACATCAA'ITTCCTCAACCACTGTTACA'M'GACACTGAGcTTGAAATGMGGAAAT ATACAA CTCTCATCACAT 14 89 4681 W S L F E K S P L V O M G R V A T A P P D R R H A O K A L E N Y V I N S L M T I TTGGAGCTTCTTTGAGAAGTCA(ll'IICCTGGACATGGGTCGAGTGGCCACAGCTCCACCTGACCGGAGACATGCTGACAAAGCACTGGAGAACTATGTGATCAACTCACTCATGACAAT 1529 4801 I T T r F N S P P S O O S O T I Q T R O P V F V O L L H A V Y R V S Q A V H G H CATCACTACTTTCTTCAACAGTCCATTCTCAGATCAGAGTCAAACTATCCAGACACGCCAGCCAGTIIJTl'CTGCIIGCTCCTCCATGCTG'ITTACAGGGTCAGCCAAGCAGTCATGGGTCA 1569 4 921 Q R V N V N C I K T L T V A R K H N I S I P V O L E A O V V S H S Q R T T S CCAGAGAGTTAATGTGGAGAACTGC A TTAAGACTCTCACTGAAGTTGCTCGCAAGCATAACATATCCATCCCAG'M'G A CTTCCAOOCTCAAGTGGTAAGCATGTCTCAGCGCACCACTAG 1609 S0 4 1 I M T R T A S K W S N R A T R R D A S S S S L S G R H O H L V I E O O F N S V V TATCATGACACGCACAGCCTCCAAGTGOAGTAATCGAGCCACACGACGTGATGCCTCATCCTCTTCTCTTTCTGGAAGAATGCACCATT'roGrtATTGAACA/\OAI l l'CAACTCTGTTGT 16 4 9 5161 S V L A E L R P L V A A E L S V L V D l L Y Q P H R L F R P O S E A S I K C K GT'CACTTCTAGAAGCAGAGCTTCGTCCATTGGTTGCAGCAGAGCTCTCCGTCTTAGTAGACATACTTTACCAGCCACAT A GGTTGTTTAG A CCAGACAGTGAGGCTAGCATCAACTGCAA 1689 5281 N G G F I S R L I R H C R K L L E E E D 6 K L C I Q V L K T L K O M I T O S E Y AAATOOTCCCTTTATTTCCAGATTGATTCGTCATTG'l'GAAAAATTACTAGAAGAAGMGATGAAAAACTGTGCATCCAGGTTCTCAAGACTCTAAAAGACATGATAACGGATTCAGAGTA 1729 5401 G K G O A L R N L L L T R Y F D O Y P W S K K E A A E L R A R Q P Q H V G P G TGGGGAAAACGGAG A TGCTCTTCG AAA CTTACTGCTG A CACGATACTTTG ATCA GTATCCATCGTCAAAAAAGGAAGCTGCTGAATTAAGGGCTCGCCAACCACAAMTGTTGGACCAGG 1769 5S21 D V V O R R S G K S L S Y Q C O L A K K G A A N L V U O L V M K S O N R H R I AGATGTAGTCCAACGACGTTCTGGAAAGTCCCTGTCTGAGGTACAGTGTGATCTAGCAAAAAAAGGGGCAGCAAATCTGGTGGTGGACCTTGTGATGMAAGCCAAAATCGCCATCGGAT 1809 5 6 41 F V E A v E L G I A P L e G G N R D I O O H L Y T K L O E s D T S O N F F K V F TTTTGTAG A GGCAGTGOAACTAGGAATAGCTCCTTTGG A GGGTGGCAACACGG A CATTCAAGACATGTTGT A TACCAAACTTCAGGAGAGTGA TACATCACAAM CT TTTTCAA GGTATT 18 4 9 5761 1889 S881 1929 6001 2009 62 4 1 2049 6361 2089 6481 2129 6601 2169 6721 2209 68 4 l 22 4 9 6961 2289 7081 2329 7201 2369 7321 2449 7561 2 4 89 1681 2529 7801 2S69 7921 0 N K H S A Q Q l R N T V T V N T S O L S A K S S D B K O G P K E G K L N TGATAATAAAATGGAGGAGGCCCAGCAAG AGA T ACGAAATA CTGTTACAGTCAATACTTCTGATTTGAGCGCCAAAAGCJ\GTG AT GAAAAGGATGG A CCAMIIGAAOGAGAG AA GTTAAA R K K G G H K P N G L U M N O E I R L S V A A S V T S O A Y T N l R A G S T TAGAAAGAAAGGAGGACACAAGCCCAATGGATTAGTT A TGAATG A CG A G ATT CGGGAAGAGCTGT'CTGTCGCTGCATCTGTTACTTCGC MGCTTACACAAATATTA G AGCTGGCAGCA C G D D N N S C L G L N T L E U G E N Y G G R S N K O A N A D N P K L S P K l T AGGAGATGACAACAACTCTTGTCTAGGCCTCAACACGCTGGAGGAAGTGGGCGAGAACTATGGAGGCCGTAGCAATAAGGATGCTAATGCAGATMCCCCAAACTTTCTCCAAAGATTJ\C V M E P V L R F L O L L C E N H N L Y L O I F L R N O K S K T N Y N L V S K T L TGTGATGGAACCTGTTCTTCCCTTCTTGCAGCTTCTCTGTGAAAATCATAACTTATATCTCCAGATAIIITTACGTAATCAGAAGAGCAAGACAAACTACAATCTAGTCAGCAAAACTCT H F L O C 1 C G S T T G O L G L L G L Y I N B H N V S L l N O T L E T L T E y C CATGTTTTTGGATTGT ATAT GTGGGTCC A C AA C'TGGTOOGTT AGGA CTCCTTGGTCTGTAT A TCAATGAACACAATGTCTCTCTT ATCAATCAGA CCCTGOAG ACA CTCACTG AA TATTG Q G P C H S N O N C I A T H E S N G L H l I T A L I L S O I N P L A K A R M D L TCAGGGACCATGCC AT GAAMCCAAAACTGC ATTG CAACTCATG AA TCCAA TGGA CTTCACATCAT AACAGCACTTATA CTTAGTGACATCAACCCGTTGGCAAAGGCTCGT ATGG ATCT V L E L K N N A S K L L L A I H E S R A O S E N A E R I L O S M H I D O L L D V TGTATTAGAGTTGAAG AA CAATGCTTCT AA GTTGCTGTTAGCCAT AATGGAAT CACGAGCAGACTCAG MAAT GCAGAACG AATTCTTCAAT CGATGCA TATT GACCAACTGCT-GG A TGT U C N L Y H Q E S H O D D B F F E D G S S D O D G V S P K B V G H N I Y I L C H AGTGTGCAACl lCTACCATCAAGAGAGT ATGGA TG A. TGATGAATI CI I l\lAAGATGGCTCTTCTGATGACGAl'GGAGTI'TCCCCAAAAGMGTGGGCCACAACATATJ\CATCTTGTGTCA 0 L A K H H K G L E E L L S K S G N E K L S K A L T H Y R E N T A O I E I V R S CCAGCTGGCTAAGCATC A CAAAGGCTTAGAGGMCTGCTG AGTAAAA GTGGCAATGAAAAATTGAGCAAGGCTCTC ACT C AT"tATCGOOAAAATACAGCTCAGATTGA GAJ"TGIICGTAG 0 R T H E O l V F P l P E I C N Y L T K E T K O R V Y N T A E R D E O G T K V T TGACCGTACAATGGAACAGA t ltn'<.TTTCCT A TCCCAG AMT CTGCAA'l'T AT CTCACTAAAGAAACAAAACAACGTG 11 IACAACACAGCGOAACGGGATGAACAGGGAACCAAAGTCAC 0 F F E K C N O H F I E M Q W O K K L K S Q A V L S T I S N Y H S L W S R L L F AGATI,CIIIGAAAAGTGTAATGATAT\illl'ATAGAAATGCAGTGGCAAAAGAAGTTAAAAAGTCAAGCAGTGTTGTCAACAATTAGTAACTACA T GTCCTT ATGGAGCA GATT A CTCTT M1 Y M 2 L L A L H V N L I U A L F Y P Y T S H L P N I S G H L N G L L W V V L L I G L A CTTATTAGCACTGATGGTCAACCTCATTGTTGCACTCTTCT AT CCATAT A CTAGTCA'ITTGCCAAAT ATTAGTGGT CA TTTAAATGG CCTGCTGTGOGTGGTTCTTCTGATAGGCCTTCC M 3 I U V S F O O O l P I Y L L G S I S V V R L I F S U G P B P T L W L L G S A N V CATTGTTGTAAGTTTCCAGCAGCAAATCTTCAT ATA CCTCCTGGGGTCAATATCTGT AGT GCGTCTC A T ATT CTCTGTTGGACCAG AA CCTACAC IIIGl.i~TAC'l'GGGTAGTG CCAA TGT M4 L I K G I H L V S L H G N K G T F A K R L E O Q V T O G E L L Y H U I Y L V F C CTTMTAAAAGGTATCCACTTAGTGAGTCTMTGGGGAACAAAGGAACCTTTGCCAAGAGGTTAGAGCAGCAGG T GACAGATGGGGAGCTCCTTTATCACGTCAT ATACCT CCTGTTCTG V L C L S V H P F C Y S U L L F O V V Y R E S T L L N V I R S V T R N G W S I I TGTTCTCGGCCTCTCTGTTCATCCCTTCTGCT A CTCAGTTCTGCTGTTTGACGTGOTCTATAGAGAGGAGACACTGCTGMTGTGATTAGATCAGTAACACGT AA TGGCTGGTCTATCAT MS L T A A L A L t L V Y H F S I I G Y M F F R N D F 1 Y D V T O N O I O W O T I Q CTTAACAGCTGCTCTAGCCCTCATATTGGTTTACATGTTCTCCATCA'M'GGCT ATAIGTTCTT CAGG AAT G ATTTCATTGTAOATGTTA CTCACAACGATA'l" TGA TTCCG ATACAATT CA K H I N O R I 6 S Y V T T S L S V K K N S V E O T C E M G V O C T E E O S S N L GAAGCACATTAATCAGCGTATTGAGAGCTACGTG ACAA CTAGCTTGTCAGTTAAG MAAA TT'CAGTGGAGGACACATGCG A GATGGGGGTAG A CTGCACTGAAGAAGACTCCTCAAATCT V V V O S l T K E V M U E V g O A K E E A C S T L L M C I V T S L N H G L R S TTATAATGTTGTTGATAGCATMCAAAAGAAGTAA TGGTTGAA GTTGAGGATGCAAAGGAAGAAGCGTGCTCAACACTTCTCATG T GCAT A GTGACCTCTCTTAACCATGG ATTA CGGAG G G G I G D I L R A P S N K E N L F A A R V I Y D L L F p t' Y V f J; V LM~ L I TGGAGGGGGCATTGGTCA TA TCCTGAGAGCTCCATCCAATAAGG AAAA CTTATTTGCTGCC<;GTGTCATCTATGACCTTCTCTTC1"1'CTTCGTTGTCATCATCATTGTCCTAAACCTCAT 2609 F G V I I D T F A D L R S E K O N S E E 1 L K N S C F I C G L T R S S F D N K A 8041 CTTTGGTGTC AT CATTGACAC 1111 OCTGACCTT A G AA GTGAAAAACAAAATTCAGAAGAGATTCTGAAAAATTCCTGCTTTAT.Al'GTGGATT AA CTCGTTCTM I I I IGACAATAAAGC 264 9 V N F 6 0 H I K R IC It 11' ., M If .' I{ Y L Y F Y V Q V N V K D P T E F T G P E S Y V Y L 816 1 AGTCAATTTCGAAGACCACATTAAACCTGAGCACAACATGTGGCACTA(.C I I I AC'rt l"l ACGTTCAGGTAAATGTAAAGGATCCAACAGAGTTCACTGGACCTGAAAGTTATGTTTACCT 2689 L V K E K O L N W F P R M R A M S L S I G E T E G B M N E U R C L N A K L O P. T 8291 CTTAGTGAAGGAGAAAGATTTAAATTGulllCCTCGG AT GCGAGCAATGTCACTGAGCATTGGAGAG A CAGAAGGGG AAA TGAATGAAGTCCG A TGTCTCAATGCCAAGCTGGACCGCAC 2729 0 A L Y O S L V Y O L T L K D E M T K O O K Y R N R R G I L S T T S N Y N S H 8401 TCAGGCTI'TAGTCGACAGCCTTGTTTATCMCTT A CAGAOCTTAAGGATGAGATGACAAAGCAGCAAAAGTACCGTAATCGACGTGGGATCCTCAGCACCACCAGTAACTATAATAGTCA 2769 Q Y G L P G G P H E P O H Y H 8521 TCAGTACGGTCTACCTGGTOGACCCATGGAACCTCAGCATTACCATTAAAATGCTGATGGTIIIATGGGTGGAAAACTTATCACCTTATGCTCCAGGTACTGAATGTCCTTAGCAGGATG 8641 AAGCTTAC-poly(A)+ F i g ure 6-c ontinued

PAGE 38

Fiaure 7 The lobster IP 3 R protein is aligned with an IP 3 R from Drosophila (NCBI ID: 266387) and a type 1 IP 3 R from human (NCBI ID : 1362832). Shading indicates amino acids conserved between the lobster protein and at least one of the other two proteins. The six transmembrane regions (Ml M6) are indicated by underlining. A unique hydrophilic region rich in lysine residue s, is seen at amino acids 1159 1186.

PAGE 39

31 Lobster --' NGP -EGSASPLBMGDIVSLYABGSVSG.l'ISTLGLVDARCVVNP&AGDLSTPPXltYRDCLPSICPSJllllYSAQKQFWJtllAltBSGNSTTDPS Dr osophila --+1 MGDN I I GSAS J'LBLGDIVSLYAZGSV C G.l'LSTLGLVDDll TVVC PBAGDLS C P PJCJCJ'llDCL I KI CPMNll Y SAQltQ.l'Wlt AA ltQS A S SNTDPN --~ l M SD --KMSS PLll "IGDICSLY AltGS TNGJ'ISTLGLV DDll CVVQPZTGDLNNPPlt lt.l'RDCLJ''Jt LCPM NRYSAQJtQ!'WKAAlt PGA NSTTDA V HumanJs9 LLJllllLBDAAKTB:kRQ NB ABSULMGTVINYG -I TIQLLRLltS NltY LTVNltRLP AL L SltNkNllVYL D ARGd GSW.l'YINPYYltLRNPGD N 91 LLKRLBB AA EI Blt ltQ NE TBNJCJtLLGTSIQYGRAVVQLL B Llt SNltY LT Vlltlt lluPSLLSltJII ANllVYLDANGUGSWJ'YI KPPYltLsIGDYV 88 L LNltLBHUDLBltKQ JIIB T BNllltLLGTVIQYG NVIQLLBLltSUYLTVNltllLPALLBXNANllVTLDEAGNSG~WJ'YIQP.l'YltLR SI GD -S 177 VVVGDltVILSPVIIAG QQLB.V SST S DLRDHPGClt SVIIIV L III S IIIT CWltISLJ'LBB.lt SN L S GV LltGQDV I RLJ'BABQtl'LTllD BYltltJtQ B Vl' 181 VVVGD1tV:n.SPV11ADQQNLBVAANTELPDNPGCltSVSVLRSSTSWltISLJ'M:Sa1tBRQB~ILltOGDVVRLJ'BABQSltJ'LTNDSY1tltQ Y BVJ' 176 VVXGDJCVVLNPVRAG -(2P LH ASSBQLVDNPGCNSVRSVN C NT SW X IVLJ'MXWSD N ltDDI LltGGD VV llLrBAB(2BXJ'LT CDBHRXltQBVJ' 266 LRTTGllTTil.TAATSSltALWSVSVVQBDPSllOGAGBWIIISLJ'JlJ'ltBLATGBYLAASJ:DDDP ----------------------TP DPT 271 LllTTOllT S ATllTSSXALWS I SVVQB'D SC llGGAG D WRSLYRJ'ltBLATGBYLAABAE 'IDVS A G AM S A TS A SGHDLHLGDCSltDSGLSCSTM 26, LllTTGllQSATSATSSltALWBVSVVQRDPCRGGAGYWNSLJ'llJ'ltBLATGBTLJU.SVDPDFEEECLEFQPSVDP -----------DQ DA S 330 361 N STIN DKPXGKQTRLVSVPYSA,DIA&VYVLDATTKARPDSLVPQSSYVRLQBICSNTWVBA'l'Sil1DADDDWPVN8MYCCS1'Ilt.DltSAP 3,1 R SR LRNAQEKKVYSLVSVPEGNDISSIJ'SLDPTTLRGQDSLVPRNSYVll.LRBLCTNTWVBSTNIPlDKBBEltPVNLltIGT S PVJtBDUA.P 20 51 AL I PV S PV SVJtDLDrANDA CltVL A T VT S ltL l>N GS I S X NURAL 'I S LLQD I VYJ' I A G MSN.Qll1t -T x,r.LEFT l: I RDRQJtLLJlBQ Y lL 31 GI:lrP V SP ABVllDLDl'ANDASKVL GSI AGKLSJtG T ITQNWRJlS VTX LLEDLVT-P'V TGGTNSGQD----VLEVV P SK PDEJlQllKRSQ NI L 510 539 517 6 0 0 629 605 68 719 L A TL All DPGDD S DRSDVQSTSTTT T1' DSASLNEDDGTPSTGDXYEIBLltWTGQPTSRS MADLA SC DQQB LE AA ILNfflla Q LNLJ'8DCL 687 7 S D;RQ.TLAlRPLSPLLlt H NS IADTD l\'.HAANH:ST ZA!AET 8 0 9 NlllQYLll,LNB LS 1' R lj DXDL I Llt C N S D &~.JI P TELU S J'CJlLNLB L BVD JID PQSPV'l'l'VKT &LWIJS :t P S ltlfS'l Q DTD Glt NQ Q PD QNKQAC RA 1 1 8 3 3 TJ'KDVIVJ'VS 11:YLCNVVDltMWS J'SD C &QHLTJ'&VVJtLAll YLIY!'G J'Y SrNDLLRL TltTLLSlLD YSFDTDSKY .l' SNS-J:PQ QTA S 8 9 9 ltJ'CNTTIArVBNYLC NVA TltVWL F T D Q SQllltI,Tl' 'SVVXLAR DLI Y.l'GJ'YSr S DLLRLTltTLLS I LD CV S OT S SGE .I' AS TDIDSVE.l!:ETNAE 8 3 3 918 A KG GV IK S L GDMOAVVTNLALGTTRMGPRLGGGSSP!CKlt VGATE -JtSDTLVll'DTltLICl:IILBJ'IL.-vllLDYlllSOLLSil'ltltSSD&N 989 AEGGVLRS I GD I NTVM~SLALGSVGQA'IAAPTISLQQRltSVSQLM -ltSYPLVIIDTKLltil.ILQJ'l'.LDVRLDYRJ:SCLLSIFltR&.l'Das 917 1005 PSSLTG S GISQGLltNK N ----------------VEN'IWAQAQ Sl:FD ETSGLGLVWSSSQRltPSLQTSSCSllN SSL DLDGBGQX XJ' LaV 1077 BVPL'RPL AMRQ VSSSR NN RNRRRLAAPMRLIPST'GQGGllTl'Lav 1006 A IP RTSSTSSGNSSQEG ---------------------PSNVPGALDP.l!:HXEEQAEGXJ'GGSSENTPLDLDDBQQRTl'LRV 1077 1167 LL~L IN ll DY API,V SG AL H L'LJ'llBJ'SQRQSVLQA J\R QVQLLV S D S DVBQYltQiltSDLDILllQSVSltSllLWVTXAltA"DSLG -------1O66 LLB LTIIB D YPPLV SGALQ LLrllBJ'SQllQBVLQAJl'ltQVQLLV TSQDVDN YltQilt Q D LDQ L& SI VBUSLWVYlt GQGP DB TKDG116 7 ltDDDEDDALSKP KKPPAPKLT A QDltQE S A l: DLGLGPPDEP B QAD HYJtRI Q QI LVltlDJJ!;LCVTQ S S HGNLS PKRNBQllLLllllNGIK S V 12 7 -A TDAGGD A VSLEYNAALSQBQRNE:r RXVKEILIUDFCVTASGPGSVVIP(PRltHS.QRLLairvo v11T V 11 4 8 -----------------AS G ENEHKXTEEGNNKPQXHBST SSY NYRVVXBILIJlLSltLCVQESASVRKS --R KQQ(2RL LJlRNGABA V 125. VLSLLQlPYDRltEDKRNN BL IEL AH Q l'LQllll' CLGDRA NQA LLYltSil>L J'LRPG LL BAltTVCA V J'JtDII SHLCSJVSBRVIQ BJ' l: ~CIBTBG 131 4 vt.DLLQN~YDEltDDBLIUl'.BliMCL ABEl'LQlll'CLQN QQ N QV LL HNBLDLJ' LNPG 'IL BAltTVCA I J'KDRLALC NBVTDKVV BJ'V1l CI.IHQ 1216 ~LBLLQlPTEltABDTKNQBXMRL AB J: FLQIDCAGN QQ lfQAL LKXHrNL J'LRl'G IL SA V TM QHIFMN ll 1"QL.CSBINBJlVVQ BrvB C1ST110

PAGE 40

I 1 ,h,ri:r -1 .3 44 I >1111of'i11/11 __.. 1 o 3 I l u111 .1 11 1 1306 1433 1493 1393 15:23 1581 148:Z 1 611 1 671 1 572 1 701 1 761 1 662 1 778 1 850 1 752 18 68 194 0 1841 1 958 2 029 191 5 2 0 9 2 119 2 0 0 5 2 138 2 209 2 095 2 216 2 299 2 170 2 306 2 389 2 260 :Z393 2 4 76 2350 2 4 83 2564 2 44 0 32 RBVQYLKFLQTIVKAEGQFLRRSQDIVMOBLVNAQEDVLVFYNERASFNMPIEMMJl:ADRNRMDFD DSSPLRYBIELVltLLACCTEGKNA RUVAYLQPLQTVVAABNQF I RR C QDMVMQBLINSGEDVLVFYN DKG SPNHPVQMMQQQMLGMEKLSDDSPLKYBVBLVltLLACCTMGlCNV RNVQYIKPLQTI\111:AEG~F IKKC QDMVMAZLVNSGBDVLVFYNDRASP'QTLIQMMRSERDRMDEN --SPLMYHIHLVELLAVCTBG!CRV S 'l'ZllCCBSLLPLDDIVAMVl!:BKDCIPBVlCBAYJ:NP't.NHCY:rt>TEVBM!tBIYNSHBIWSLP'l'JlCSJ'LVDMGRVATAPPDRRBAI>JtALENYVI YTZilCCNNLLSLDDIVTIICBPLCMPEVlCBAYVDFLNBCYinTEVEMlGllYASGIIMWSLPBXSJ'LVDINQLITNPA.AASNXTLQAYVL YTEIKCNSLLPLDDIVRVVTBEDCIPBV!CIAYINPLNBCYVDTEVEMKEIYTSNBM W !CLVEN FLVDICRACNNTSDRKBADS I LEKYVT N SL M TIITTFFNSP PSDQSQT I QTRQPVPVQLLHAV YRVSQAVMG--BQRV NVSNCnTLTEVA RKB NISIPVDLBAQV VS MS QRTTSIM N GVTNLLGS PFASPPSDQSAIVQSRQL I PVQ LLQ AA HRITQCRWLSLGDRF NVBNCI RTLTBS AKM RSIAL P PELEQQVAT MS SK TAM LT EIVMSIVTTPFSSPPSDQSTTLQTRQPV PVO LLQGVPRVYHCNWLMPSQUSVBSC I RVLSDVAXSR AIAIPVDL DS QVNN L PLKSHSIV TR TA SK W S NRA TRRD A SSSSLSGRMDHLV IEQ DPNSV VS V LEAELRPLVAAELSVLVDILYQP HRL P RPDSB A Si lCCKNGQPI SRt.IR R C RQTTKWLLASKQPKYEAQQAASLMRWDRS I IEGLQDI VS LL B DQLK P VVE ABLS LL VDILYR SEL LP P A GT BA RKROES GGPIIUtLIKHT QK~ AMNW RLS A RNAARRDSVLAASRDYR NI IERLQDI VSAL& DRL RPLV Q AX LSVLVDVLHRPELLl'PENTDARRKCl!:SQQPICKLIKHT BXLLBBE DEKLCIQVLKT L KD M ITD SE YGBXGDALRN LLLT RYP D QYPWSK.lCE ------AA ELRARQPQN----V GPGDVVQRRSG~ EJCl,LEE KE B R M CVKVLRT L RE M MAIDVNYGBltGD ALR QTLLLRYPQTKSTPRLPEDEVPLL AA PLMDPAKQNHLVT BGPGAKYLQRAGlC KQLL BE NE EKL CIK VL QTLRE MMT K D RG YGB.lCGE A LR QVLVN RYY GNVRPSGRRESLTSFGNGP L S A GG P GKPGGGGGGS G SSS M S R GEM SL S BVQC D LAltKQAANLVV D LVM'lCSQNRHRil'VB A VBLGI.APLEGGNRDIQ D MLYTlCLQBSDTSQN PPlCVP DN Kll EE A QQ l:I RNTVTV.llfT T L R EHO N H L DR EG A S DLVVEL V I X S VB S P N Il'VB .I. VSLG:t A L t.BGGNP I 1JQ.1C G !tF Q JtF L SD D L NQA l'l'ICVI' F ERNKD A QQ l:I lt S TV'l'VIIT SLABVQCHLD1CECASNLVIDLiltNVS-SDRV 7HB SILLAI .A L LBGGNTTIQHSFFC~LTKDK1CSEKl' PK VPYDR N 1CV AOQl:I lCA'l' VTV .T TDI A .AJt ABEBKQ DTNLELDKI A RKHQLJl:SIIIGVVI TESLKR BL HN A GLAIJ.' A R AYGIIARN I H S GEES SA I SV N SP L B D I L Al!llt L EKB JCDSR Sl)LGNlt--KKDDEVDRDAPSRltK AKEPTTQITEBVRDQLLE A SAA T R!C APT TFRREADPDDH---------YQPGEGTQ A TADKA DQRNQ LSNlC VLV II QPILR J'IiOLLCl:JfJIR PDM O NL LRWO NN lt'J'NNRLVSBTt.llJ'LDCICGSTTGGLQLLQLTIRS.DLALl.QTLaAL'l'aT MDD 1:> El'J' B DGSSDDD -G VSP 1 1Cl:VQJl llf:tTIL CBQL.P.ltBBl,tGLEELLSK8GNE ltLSlCALTHJ\RE-NTAQiai:VJlSDJlTUQJ: LI D EQDDGD B PDAGS DDDD AT VSPRJS,VGBiaJ:Y:tLCBQL,ll, Q SNJt'.ELA G LL lC ASE DPQS A SFD AJt T S Q llN Y 'rATBTAQIS:tVJlNDJl'IPL SQi VEl".E ------DCil ENGB D -G AABPRNVCilB.IIIYI_L#.RQ L.lliRlfN E .E LQ SM I!JtP G GQV D----GDEALB P TAlC .H T.llQJ:S.:tVJtLDano:r M1 rr 7D VJ'PVPiSll: Cl!lPLTltB S K L ll I TYll'T JIRDBQQ S lt I NDJ'J'LRS EDL PNl:IINWQUL RA Q !P YL YWC ARNJf 8 PW8 SI V&J' Lll'PL!C M 2 M 3 SHL P N I SGBLNCilLLlfVVLLIGLA:tVVSl"QOQil"JYLL GSisVV ,LJ:l'SVQPl:PT~W1,LGI SA !IIV Lr JSG:EBJ!~8 L !GNltG1'1'A~ -~BQQ N TV P EL~SBISLLPlfI ITI Psivt*LALPRESGIRTPIGSVIL~P~l'LLGIPSS'l' C LLGVV T VT L~S VJI I ~i I NOUG'l' LE K --Q L ilCI GVRGGTLBP B WS GLLlf TGM LI S LGitV,I GLP NPH GiEJRA 1 LIGSTILRLJ:J'8VQSQPALPLLCfAPNVC1CJtIIl'LM8J'VGNCG'l'l''1'RGYRAJIVL M4 M5 I TD --PSTYT A LYSVLLLRjLI PBPJ'FTS! L LLJ'DVVTJlUTL V NVXRBVTJl .. Q R Sfvi.ia. v ULILVY L F8J:IQYJll'J'K D Dl'L S V Dll'B B Q M 6 2573 GD ILR.APS llUNLJ' U RVIYD L LFF J' VVII IVLIIILil'G VIIDTl' ADLR SICKQNSBBILltNSCPXC QL T8 S SPD N1C AVNP E D Ri ltRB BlllW 2 6 3 7 GDIL JtAP SSK.l:GL PVARVIYDLLJ'J'l' IV I I :tV I, RLil'G V :t ID~ J'A D LRS ZKQQJtB.AI'L.JtTTC l'I OS t. N RSAJDIIIJt TVS l'.ill !!H IltSl!:B ~ 2 52 1 GDVLRltPSltE&PLPA.ARVIYDLLJ'J'J'MVIIIVLRLXl'GVIIDTPADLRSBKQK Jt EBILK. TTCl' I CGLBRDK l'DNK TVT P&EHIICEBHNNW 2663 BYYl'YVQVNV1CDPTBPTGPBSYVY LL V1CBKDLNlfl'l'RNRAIISL SIG E T EGltMNBVR CL NAK.LDRTQALVD SLVY QLTBLJtDENTJtQQK. Y 2727 2 6 11 HYL C I' IVL V lCVlCDSTBYTQP BSY VAEMiltBRNLDlfP l'RNRAN SLV S SDS .BGBQ NB LRllLQEKLESTMKL V TNLS GQLS BLXDQNTEQRgQ 2753 RN R RGII,S TT S III Y N S HQYGLPGGPMEPQBYH 2817 RQ.LGLLN~ TAH SLLPl"Q---------2701 lCQ~MOLLGHPPHMNVNPQQ P A -------Figure 7--continued

PAGE 41

33 completely unrepresented in the other IP 3 Rs identified to date: amino acids 1159-1186, a lysine-rich hydrophilic stretch is not present in any other IP 3 R (Figure 7). Searches of GenBank with this amino acid sequence revealed no matches with known proteins which might unveil a possible function for this portion of the protein. Ribonuclease Protection Assay To verify that the source of the IP 3 R cDNA was indeed olfactory organ RNA a 32 P -labeled riboprobe representing a portion of the cloned IP 3 R ribonuclease protection assay was used to probe for the IP 3 R mes s age in extracts of olfactory organ poly(A)+ RNA. A riboprobe translated from the original 203 hp product was incubated with olfactory organ total RNA under high stringency conditions, producing a protected band of the appropriate size (Figure 8). A protected band was also seen in an assay of total RNA from brain. No protected bands of the appropriate size were seen when control hybridizations were done with yeast RNA controls. Discussion The cDNA identified in this study shows much structural similarity to known vertebrate and invertebrate IP 3 Rs As with other IP 3 Rs, the greatest conservation is seen at the amino end the location of the IP 3 -binding domain and the carboxyl end, the site of the channel portion of the molecule. A greater degree of variability is seen in the central modulatory domain. Six hydrophobic domains correspond to the putative transmembrane regions of other IP 3 Rs (Figure 7) Tl1e putative pore-forming region between the fmal two transmembrane regions, MS and M6 (Michikawa et al 1994), shows almost no sequence conservation: why a family of channels with a presumably similar ion selectivity exhibit such divergence in the pore sequence is unknown. There are three protein kinase A substrate consensus motifs numerous protein kinase C and casein kinase II motifs as well as one extracellular site for N-glycosylation and a site for tyrosine

PAGE 42

Figure 8. A ribonuclease protection assay, probed with a 203 bp riboprobe transcribed from a portion of the lobster IP 3 R. An appropriate sized protected band is seen in nose poly(A) + RNA (1.5 and 3 g) and in brain total RNA (5 and 10 g) (indicated by arrow ), but not in the yeast+ RNase control. A stro ng smaller sized band is seen both in the experimental and the yeast control lanes. A yeast control with no RNase treatment shows the undigested probe; residual undi ges ted probe is seen in all experimental lanes running at 350 bp

PAGE 43

0 0 y I\) 0 0 y v.) 0 0 y 01 0) -...J 0 0 00 ui o ooo m y yyy (/) Markers Nose Poly A + RNA Brain Total RNA + RNAase I Yeast RNAase I RNA w VI

PAGE 44

36 phosphorylation ; whether or not these sites are functional in the native protein remains to be detern1ined. The IP 3 R encoded by this cDNA is structurally consistent with those characterized by Fadool and Ache (1992) and Hatt and Ache (1994). Both groups saw channels with similar physiological and pharmacological properties to those of ER IP 3 Rs ( e.g Bezprozvanny and Erhlich 1994 ), including similar conductances and a sensitivity to heparin. However the lobster olfactory IP 3 Rs are insensitive to ATP (Fadool and Ache 1992 ), which is known to modulate vertebrate IP 3 Rs by increasing the channel open probability (Bezprozvanny and Erhlich, 1993). The cloned lobster IP 3 R described here ha s no consensus motif for ATP-binding though it does share an NAD/F AD-binding site (Sternberg and Taylor 1984 ; Zheng et al., 1993) with other IP 3 Rs (the Drosophila IP 3 R al so lacks an apparent ATP-binding site but it s ATP sensitivity is unknown) This insen s tivity to ATP may be typical of calcium-release channels in lobsters or arthropods in general rather than be representative of plasma membrane IP 3 Rs, as a ryanodine receptor characterized in American lobster is also insenstive to ATP (Seok et al. 1992). The ribonuclea s e protection assay s hows that the IP 3 R message is expressed in both olfactory organ and brain (Figure 9) though at much higher levels in the latter. As the probe was directed again s t a so mewhat conserved region of the coding sequence it is possible that these tissues are expre ss ing similar but different messages Proteins need not be olfactory-specific to be important for olfactory transduction: expression in neural tissue outside the no s e is seen for several olfactory transduction-related genes including G 0 1 f( Drinnan e t al ., 1991 ) and tl1e cAMP-gated channel (Kingston et al ., 1996) One re gio n of the lob ste r cDNA doe s repre s ent a protein sequence unique to IP 3 Rs (Figure 7). Although the function of thi s peptide i s unknown it does resemble some nuclear localization signals (Dingwall and Laskey, 1991 ); IP 3 Rs have been localized to nuclear membrane s ( e.g. Sullivan e t al ., 1995 ) This region also contains a protein kinase C consensu s phosphorylation s ite ( Kl 160) Heterologous expression of thi s cDNA will not only allow the characterization of thi s IP 3 R but also the functional analysis of this unique

PAGE 45

3 7 region It is also critical to determine whether the s piny lob s ter expresses other IP 3 Rs and if s o whether the s e other IP 3 Rs s hare this s ame unusual s equence Though thi s IP 3 R share s so me structural features consi s tent with the functional propertie s of tho s e characteri z ed by Fadool and Ache ( 199 2) and Hatt and Ache ( 1994 ), it remains unproven that this cDNA encode s one of those proteins. There are no known structural moti fs indicating that a particular protein is involved in olfactory transduction. The promoter regi o n of the g ene for thi s IP 3 R i s uncharacterized, so whether it contains an olfactory s y s tem-related tran s cription factor-binding s ite as i s s een in vertebrates with Olf-1 ( Wan g and Reed 1 9 93 ; Wan g e t al 1993 ) i s unknown While integral membrane proteins contain s ignal sequence s for insertion into membranes none that differentiate between endopla s mic reticulum and the pl as ma membran e are known. However there is good evidence that pla s ma membran e IP 3 Rs are s imilar in s tructure (e.g., Cunningham et al ., 1993 ), if not identic a l ( Khan e t al. 1996) to tho s e localized to the ER. Therefore the similarity of the lob s ter IP 3 R to other IP 3 Rs c annot be s een as evidence for localization to either the endopl as mic reticulum or plasma membrane. Antibodies against the encoded protein mu s t now b e used to local iz e it to cellular compartments within the ORNs; in addition the channel mu s t b e h e t e r o lo g ou s l y e x pre s sed s o that its functional properties can be compared with tho s e of the nativ e channel s.

PAGE 46

CHAPTER3 MOLECULAR CHARACTERIZATION OF AN OLFACTORY ORGAN GQ PROTEIN Introduction The transduction of many extracellular stimuli such as neurotransmitters or light, can be mediated by a signaling pathway that l inks receptors and downstream effectors (e.g., ion channels or enzymes) Heterotrimeric OTP-binding proteins (G proteins) often serve to couple these two signaling components (Neer, 1995; Hamm and Gilchrist, 1996). Composed of a, and y subunits, these G proteins bind to the activated receptor as well as affect the downstream enzyme or channel, with many of the targeted enzymes synthesizing second messengers (e.g. IP 3 or cyclic nucleotides). The a subunits are the best characterized of the subunits ; they have been classified into four categories based on sequence homologies: Gs Gi Gq and G 12 ( each family contains numerous members; Neer 1995). Although the a subunit was previously thought to be exclusively responsible for the signaling capabilities of the G protein trimer, it is now established that the ~y complex can itself activate downstream effectors in many systems (Clapham and Neer, 1993 ; Hamm and Gilchrist 1996). No G protein has yet been functionally implicated in olfactory transduction. Well before the discovery of a family of putative olfactory receptors (Buck and Axel, 1991) all members of a superfamily of G protein-coupled receptors that includes rhodopsin--the mediation of at lea s t some aspects of olfactory transduction by G proteins was established (Pace e t al. 1985 ; Sklar et al. 1986 ; Bruch and Kalinowski, 1987; Bruch, 1990). A vertebrate G protein a subunit, G 0 1 r (a member of the Gs family) has been cloned and localized to the cilia of the olfactory receptor neurons (ORNs; Jones and Reed 1989). 38

PAGE 47

39 G 0 1 r is th ought to activate a type ill adenylyl cyclase that sythesizes the second messenger adeno s ine 3 ', 5 -cyclic monopho s phate ( cAMP) ; cAMP can then activate a cyclic nucleotide-gated (CNG) channel in the ORN cilia plasma membrane. Other G protein subunits are pre s ent in the vertebrate olfactory epithelium ( Jones et al. 1988; Jones and Reed, 1989 ; Menco e t al ., 1992 ; Abogadie e t al ., 1995a; Dellacorte et al ., 1996); some of them are unlikely to couple to adenylyl cyclase. In both vertebrates and invertebrates IP 3 (in addition to cAMP ) serve s as an o lfa ctory se cond messenger (Restrepo et al ., 1990 ; Breer et al 1990 ; Boekhoff e t al 1990 ; Bruch and Teeter 1990; Dionne 1992; Ivanova and Caprio, 1992; Mi y amoto et al., 1992 ; Michel and Ache 1992 ; Fadool and Ache 1992; Lucero e t al ., 1992 ; Ronnett e t al., 1993 ; Bacigalupo et al ., 1993 ; Lischka et al ., 1995 ; Boekhoff et al., 1994 ; Lucero and Piper 1994 ). Therefore, more than one G protein a-subunit subtype might be involved in olfactory tran s duction. In the spiny lobster ORNs odor-evoked elevations of cAMP and IP 3 mediate opposing conductances with cAMP triggering the inhibitory outward current, and IP 3 the excitatory inward current (Fadool and Ache 1992 ; Michel and Ache 1994 ; Boekhoff e t al ., 1994) Recently Fadool and colleagues (1995) used electrophysiological and biochemical techniques to demon s trate that different G proteins mediate these two conductances. Although the G protein involved in the inhibitory pathway remains unknown two different a-subunits were implicated in excitatory odor transduction: a Ga 0 from the Gi family and a Gaq or Ga 1 1 from the Gq family. T he preci se nature of thi s Gq-like a-subunit must be characterized. In this chapter I pre s ent evidence for the pre se nce of a Gq-like protein in the lobster olfactory organ ; this protein i s consistent in s tructure and localization with the Gq-like a-subunit previou s ly implicated in the excitatory odor re s ponse in the spiny lobster Panulirus argu s. Portions of this work have previously appeared in abstract fo11n (Munger et al ., 1997)

PAGE 48

40 Methods RNA Extraction: Olfactory organs (I 00 antennules per isolation) were harvested into a dry ice / etl1anol bath, transported from the Florida Keys to the Whitney Lab on dry ice, and stored at -80C until used. The antennules were homogenized in liquid nitrogen by mortar and pestle, then the powder was homogenized by polytron in a GTC/P mercaptoethanol solution (sarkosyl added to 2% after homogenization). After removing cuticle by centrifugation the homogenate was layered onto a 5.7M CsCl cushion for ultracentrifugation (24 hours, 20C 30 000 rpm in a Beckman SW-41 rotor). The RNA pellet was resuspended in 10 mM Tris-HCl (pH 8.0), 1 mM EDTA-SDS, spectrophotometrically quantified and stored in ethanol with 0.3 M sodium acetate pH 5.5 at -20 C. RT-PCR: RT-PCR experiments were done as described in Chapter 2 Methods except as noted. Briefly degenerate oligonucleotide primers were designed to a portion of the Switch II region common to Ga s [amino acids KWIHCFE, sense primer AA(AG) TGG AT(ATC) CA(CT) TG(TC) TT(TC) GA] and to the common carboxyl tail of Gaq and Ga 11 [amino acids KEYNLV antisense primer (ACTG)AC IA(AG) (AG)TT (AG)TA (TC)TC (TC)TT where I = inosine]. Total RNA from nose (IOg) was reverse transcribed as described using the antisense primer. Each primer (100 pmol) along with 1 / 20 of the reverse transcription reaction, was used in a touchdown PCR. The PCR cycling profile was as follows: [94C 5 min ; 50C, 2rnin; 72C, 1.5 min] x 1 cycle; [94C 30 sec; 49C (-l C / cycle) 30 sec; 72C, 1 5 min] X 9 cycles; [94C 30 sec; 40C, 30 sec; 72C 1.5 min] x 30 cycles. The PCR product was diluted 1:1000 and served as template for a second, identical PCR The resulting 435 bp product was gel purified, ligated into the plasmid pGem-T and transformed into JMl 09 cells for subcloning.

PAGE 49

41 Control RNA samples, which were treated as above except for receiving no reverse transcriptase, showed no product After colonies were screened by PCR for inserts of appropriate size individual clones were selected for sequencing by standard chain tertnination methods. One clone (RTG-4) was fully sequenced. 3'-RACB (Rapid Amplification of cDNA Ends): The 3'-RACE technique was performed as described in Chapter 2 Methods, except as noted. After reverse transcribing 10 g of olfactory organ total RNA with an oligo-dT 1 7 oligonucleotide the resulting cDNA served as template for the first round of PCR amplification ; one primer was directed against a portion of the oligo-dT primer the second was specific to clone RTG-4 The PCR product then served as template for a second round of PCR amplification using the a nested oligo-dT primer and a nested RTG-specific primer. The resulting product of 250 hp was purified s ubcloned and sequenced as described above. Control RNA samples which were treated a s above except that no reverse transcriptase was added, showed no product. 5'-RACE (Rapid Amplification of cDNA Ends): 5'-RACE was performed as described except as noted. Total RNA from nose (10 g) was reverse transcribed as above using an RTG-4-specific antisense primer, and a poly(C) + tail was added to the 3' end of the antisense single strand cDNA with terminal transferase. The resulting cDNA served as template for the first round of PCR amplification; a nested anti sense RTG-4specific primer and an anchor primer to the poly(C) + tail were used. These PCR products then served as template for a s econd round of PCR amplification where the same anchor primer and a second nested R TG-4-specific primer were. The resulting products were purified subcloned and sequenced as described above Control RNA samples which were treated as above except for receiving no reverse transcriptase or no terminal transfera s e showed no product. PCR cycling times were as follows: [94 C, 5 min; 49C, 2 min; 72 C 3 min] X 1 cycle; [94 C 30 sec ; 49 C 30 sec; 72C, 2 min] X 30

PAGE 50

42 cycles. Sequencing translation assembly and analysis was done as above. A single clone, 5RH1 was fully sequenced To control for errors that ma y have resulted from the actions of the DNA polymerases or the reverse transcriptase two independent clones which spanned the entire contig from the 5 to the 3 -untran s lated regions, were amplified in duplicate RT PCR reaction s, sequenced, and a consensus sequence translated for analysis. Northern Hybridization: Total RNA from nose (150 g) was denatured with 15% glyoxal : DMSO (1: 1) then run overnight at 20 V on a 1 1 % agarose gel in sodium phosphate buffer (pH 7.0) The gel was blotted to MagnaPlus nylon (MSI) by capillary action in 20x SSC. The blotted RNA was UV-crosslinked to the membrane. The membrane was prehybridized for 1 hour at 60 C in: 50% formamide 5x SSPE, 5x Denhardt s reagent 0.5% SDS and 100 / ml herring sperm DNA. The membrane was then hybridized to a 32 P-labeled riboprobe (transcribed from clone RTG 4) overnight in fresh hybridization solution. The next day the membrane was washed 3 x 15 min in 1 x SSPE / 0 5 o/ o SDS and IX 15 min in O.lx SSPE / 0.5% SDS both at 60C. The membrane was exposed to X-ray film for 4 da ys at -80 C with intensifying screens Results cDNA cloning U s ing RT-PCR and degenerate oligonucleotide primers I was able to amplify a 435 bp cDNA product ; this product wa s s ubcloned sequenced and conceptually translated. A comparison of the deduced amino acid sequence with sequences in the GenBank database revealed that thi s product was homologous to members of the Gq family of G protein s This product wa s extended to the 5'-UTR by 5'-RACE and to the 3 -UTR by 3 -RACE. To control for possible sequence errors induced by the reverse

PAGE 51

43 transcriptase or DNA polymerases two additional independent full length clones were isolated by RT-PCR (data not shown), and the consensus sequence across all three clones was taken. The assembled full-length clone has an open reading frame of 1059 bp coding for 353 amino acids (Figure 9). The predicted protein has a calculated molecular weight of 41.5 kDa The deduced amino acid sequence for the full-length clone shows a high degree of identity to other known Gaq proteins [Figure 10--NCBI sequence identifications in parentheses; Drosophila: 84 % (944923); Limulus : (Munger et al ., in press ; mouse: 82% (193502)], and is less similar to other G types [ e.g. bovine Gai 1 : 47% ( 121019)] The position of the initiating methionine (Figure 9) was selected for several reasons: it is the first methionine in the open reading frame; there is a well conserved consensus initiation sequence (Kozak, 1991 ); initiating transcription at this position results in a protein of identical length to most Gq proteins (Figure 10). Sequence analysis of the lobster Gq protein shows it to contain several motifs characteristic of other Gq proteins (Figure 9 ; Strathmann and Simon 1990 ; Simon et al, 1991; Wedegaertner et al., 1995) including putative sites for palmidylation two terminal cysteines (CC4); an absence ofN-tenninal myristylation sites (though putative myristylation sites do exist at several sites in the middle of the protein); a putative cholera toxin ADP ribosylation site (Rl 77), but no cysteine at the C-terminal subject to pertussis toxin ADP ribosylation ; and the G40TGES '' GAG-box '' sequence which is present in the OTP-binding domain of other Gq proteins. The sequences of the Switch I II and III regions all involved in OTP-dependent conformational changes of the subunit (Lambright et al ., 1994 ), are all highly conserved.

PAGE 52

Fi~ure 9. The nucleotide and deduced amino acid sequence of the cloned lobster Gq cDNA. The 1059 bp coding region encodes a 353 amino acid protein Gray shading and arrows indicate the sequences to which the degenerate PCR primers were designed. Also indicated are consensus motifs for cholera toxin-dependent ADP ribosylation (filled circle) and palmidylation (arrowheads) as well as the ' GAG'' box (box), all characteristic of Gq proteins. Amino acids in common with the Ga 0 decapeptide (LDRIGAADYQ) that served as antigen for one antibody that blocked the excitatory odor response (Fadool et al., 1995) are indicated with stars

PAGE 53

45 1 CAAGACCCCGGCTGTTCTCCCGAGCAGATCCTTCCCCGGCAACGCTGCTCACTTTACGGAATTATTCGGCCAAAAGCCCT 81 TTAGTGACAGCACGAAGCCTGTGAAGTGACACTAACTAAGTAAGAGAGGCAACAGAGGCAGCAGTTAATCCTGTATATAA 161 GGGAGCGTCAACTGGGAAGCAGAAATCAGCGAGCGGGGAGGCGCCACACTCAGTATACTTGGCTGCACGAAACCCCACCC 241 CATTTGGCTTAGATTTGACCTGTGTGAAGGAAATAACCAAAAATTGAGAAAATTCCCCGATTACGCGCCGCTTTCCCTTC 321 GCGGAGAAAGGCGGCGAAAGAGAAGAGGAAGAAGGATAATTTAGTAAGGAGATTGTGGTGAAAGTTGTCAAAATTAACGC y y 1 M A C C L S E E A K E Q K R I N Q E I 401 GATAATATTAGTTGATCAGCAAACATGGCGTGCTGCCTAAGCGAAGAAGCCAAGGAACAGAAGAGGATAAACCAAGAGAT 20 E R Q L R K n K R o A R R E L K L L L L l a T G E s ) G 481 AGAACGACAATTACGGAAGGATAAGCGAGATGCCAGGAGAGAACTTAAACTACTGTTATTGGGCACTGGAGAATCAGGAA 46 K S T F I K Q M R I I H G A G Y S D E D K R G F I K L 561 AGTCAACTTTTATTAAGCAGATGCGTATTATCCATGGTGCTGGTTACAGCGATGAAGACAAGCGAGGGTTTATCAAGCTG 73 V F Q N I F M A M Q S M I R A M D L L Q I S Y G D S A 641 GTCTTCCAGAATATTTTCATGGCTATGCAGTCTATGATAAGAGCCATGGATCTTCTCCAGATATCATATGGAGATTCAGC 100 N I E H A D L V R G V D Y E S V T T F E E P Y V T A 721 TAATATTGAACATGCAGATCTAGTACGAGGAGTAGACTATGAATCAGTAACTACATTTGAGGAGCCATATGTGACTGCCA 126 M K S L W Q D T G I Q H C Y D R R R E Y Q L T D S A K 801 TGAAATCCTTATGGCAAGATACAGGCATCCAACACTGCTACGACCGGCGTAGAGAGTATCAGCTCACAGATTCTGCAAAA * * * 153 Y Y L T D L D R I A A T D Y V S T L Q D I L R V R A P 881 TACTATTTAACAGATTTAGACCGCATAGCTGCCACGGACTATGTTTCCACACTACAAGACATTCTAAGAGTGAGAGCACC 180 T T G I I E Y P F D L E E I R F R M V D V G G Q R S 961 CACAACAGGCATTATAGAGTATCCCTTTGACCTAGAAGAAATCAGATTTAGAATGGTAGATGTGGGTGGTCAGCGATCTG 2 0 6 E R R :: ir. =:(:(:\ ~ : ~ }:::} $. }::::: ff. :i:\::: f :::::\:: iii :::(:: F f ::::: N V T S I I F L V A L S E Y D Q I . -t1r .'. '. ~ --. ~ ... ....... ' .. ,.. ... . . . . . . . . . . . . . . . .... 1041 AGCGACGGAAGTGGATCCACTGCTTTGAGAATGTTACTTCCATCATCTTCCTGGTTGCTCTTTCAGAATATGATCAAATT 233 L F E S D N E N R M E E S K A L F K T I I T Y P W F Q 1121 CTGTTTGAATCTGACAATGAGAATCGGATGGAGGAATCTAAGGCCCTCTTCAAGACGATCATCACATACCCATGGTTTCA 260 H S S V I L F L N K K D L L E E K I M Y S H L V D Y 1201 GCACTCCTCAGTTATCCTTTTCCTTAATAAGAAGGATCTGTTAGAAGAGAAGATCATGTACTCACATCTTGTGGACTATT 286 F P E Y D G P R K D A I A A R E F I L R M F V E L N P 1281 TCCCAGAGTATGATGGCCCAAGGAAGGATGCAATTGCAGCTCGGGAGTTCATCCTACGGATGTTTGTAGAATTAAATCCC 313 D P E K I I Y S H F T C A T D T E N I R F V F A A V K 1361 GACCCTGAGAAGATTATCTATTCCCATTTCACATGTGCGACAGACACTGAGAATATAAGGTTCGTCTTCGCTGCTGTCM 340 1441 1521 TTAGATGAAGTGACAGCATGTATCCTTCTCAGTGTAGGGGCTGTGACCTAAGGACATTTCTTCATCACCCCTTACATGAC 1601 ACCATACCAATTTTGTAAACAAGGCAGTCATATTTTGCATCTACAAACCCATATTCAGTGTCCCAAAGAAATAAAGGTTC 1681 TATGTTGTT-poly(A)+

PAGE 54

Fi~ure 10. Alignment of the lobster Gq protein with Gq proteins (NCBI ID in parentheses ) from Drosophila (dG q a 3: 944923) Limulus (Munger et al in press) and mouse (193502) Shading indicates amino acids conserved between the lobster protein and at least one of the other three protein s.

PAGE 55

47 Lobster ----.... 1 MACCLSEEAKEQKR :t N QEI:BRQLRKDKRDARRELKLLLLG'l'GBSGKS'l'l':IKQJIR Dros. dGa.-3 1 MEccLsEEAKEQltRINQZ':IBKQLRRDKllDARRBLKLLLLGTGBSGKSTP:tKQIIR L [ 1 MACCLSEEGKEQKRINQB:IBRQli RKDKRDARRBLKLLLLG'l'GJISGKS'l'l':IKQIIR imu us l MT LES IMACCLSEEAKEARRINDE:IBRHVRRDKRDARRBLKLLLLGTGESGKSTJ'I:KQIIR M o u se 55 IIBGAGYSDBDKRGFJ:JCLVFQN:tl'MANQSNIRANDLLQISYGDSANIBBADLVRGVDYBS 5 5 I J:BGS GY SDEDKRGY J:KLVFQNI:l'MAMQSNI KANDMLlt:t SYGQGEHSELADLVMS IDYBT 55 XI:J!QQGYSDDDKKSYIJCLVYQN:IIIIAIIQSNNKiUIEMLK.XSYKDRNN:tllNAELVLS:V:DYBT 61 IIBGSGYSDBDJCRGP'TJCLVYQNIPTANQA.XRANDTLK'IPYKYEHRKABAQLVREVDVB'K 115 VTTl'EEPYVT~KSLWQDTG;tQHCYDRRRE:t"QL'l'DS~JCYYLTDLDRJ:AATDYVSTLQDIL 115 VTTPEDPYLNAI KTLWDDAG:t QE CYDRRRB:YQL~DSAKYYLKDLDRVAQ PAYLPTBQDXL 115 VT'l'FDSPYVEAJ:KSLWVDPG:IQECYDRRRBYQX.~DSAJCYY:LNDIDltIA:VPNYLP'J'QQDJ:L ll l VSA FB NPYVDAIKS-LWNDPG:IQ 1 ECYDRRR;J:Y QLSDSTltY~LNDLD.RVADPSYLP'l'QQDVL 175 RVRAP'l'~GIIBYPFDLBB:CRPRNVDVGGQRS3RRKWXBCPBRV'l'SXIPLVALS.YDQILP 175 RVRVB'l'TGI!BYPl'DLEBillPRIIVI)VGGQRSBRRJCWl:BCPBlllVTS:t:tl'LVALSBYDQJ:l,I' 175 RVRVP'l''l'GIIBYPFILDSXI!'RNVDVGGQRSBRllKW:IBCFBlfVTSX~PLVALSBYDQXLP 1 I 1 RVRVP'l'TGXI.EYPFDL QSVIFRIIVDVGGQRSZRR:ltWI.BCFBNVTSIMl'LVALSBYDQVLV l35 BSDBBRRKBZSltALPltTl::I'l'~PWl'QH~SVILF~JCKDLLBBJCXNYSBLVDYFPBYDGPR~ l 3 5 ZSDNimNRHBBSJCALl'R1'Il:TYPWlf'QN~SVILFLRKJCDLL Bm,1tJ1'YSBLVDYl'PB'YDGPQR l 3 5 BSDNBNRXBESJCALFlt'l' :t IT't PWl'LNiS SV1LPLNJCJ;:DLLBBlt:IIIF SJlLVDYl'PBYJ>GPKlt :z, 1 BSDNBHRMB](SKALP'RTI.:ITYPWJ'Q NSS'1VrLPLRltltDLLBBK:IIIYSBLVDY-PPBYDGPQR 295 DAI.AAREF:ILRNFVELNPDPBJCJ:t~SBl'TCA'l'DTBIJXRFVFAAVJCDT:ILQLRLKBYRLV l95 DAITARBFILRIIPVDLHPDSB:I:IYS.FTCATDTBR:IRFVJ'AAVKDT1LQS.LltBYRLV l95 301 DAQAARBl'ILKIIFVDLNPDSDlt:IXYSBPTCATDTBRlltPVl'AAVJCDTJ:,l,,QLlllLKBYRLY

PAGE 56

48 Northern Hybridization A Northern blot of lateral antennule total RNA was probed with a riboprobe trruiscribed from clone RTG-4 (nucleotides 1049-1483 of the complete clone) at high stringency. A single band of 4 6 kb is seen (Figure 11). Discussion The cDNA identified in this study shows the greatest similarity to known vertebrate and invertebrate Gq proteins particularly the Gaq and Ga 11 types (Figure 9). The Gq family of a-subunits is highly conserved in primary structure. This high degree of identity allows little speculation about the functional consequences of structural motifs. While a few basic regions mediating some functions of the G protein a-subunit have been identified (Neer, 1994), such as interaction with the py complex at the amino end of the a-subunit, or interaction with the receptor at the carboxyl end, these regions are not well defmed and it is difficult to pair a particular effector or receptor to an a. subunit simply by examining primary structure. Therefore, the isolated cDNA might, or might not encode an ''o lfactor y'' or ''se nsory'' Gq but until more rigid structure-function relationships are established by mutational analyses and heterologous expression, the role of the protein remains obscure. Localization of the message to the olfactory organ (Figure 11) is consistent with this cDNA encoding the native protein characterized by Fadool et al. (1995): any transduction-related protein must be localized to the olfactory organ. Northern blot analysis shows that the Gq message expressed in the olfactory organ is very large compared to the coding sequence. This indicates large 5 and 3 '-UTRs on the m.RNA which are over three times the length of the coding region. The significance of this large noncoding region is unknown, but is not unheard of for this family of proteins ( e.g.

PAGE 57

Fi~re 11. A Northern blot of nose total RNA (150 g) probed with a 3 2 P-labeled riboprobe transcribed from a portion of the lobster Gq protein A single 4.6 kb band (arrow) is seen after a 96 hour expo s ure

PAGE 58

50 kb

PAGE 59

51 Wilkie et al 1991 ). Other tissues were not probed for the expression of this message. Although the question of tissue specificity is an interesting one it has no bearing on the role of any protein in olfactory transduction Indeed, each of the principal components of the vertebrate cAMP -mediated olfactory transductio11 pathway are seen in non-olfactory regions of the nervous system Neverthe le ss, the transcript must be localized to ORNs if a link between this message and the native protein is to be established definitively. This isolated Gq was compared with the one previously implicated in excitatory odor transduction in the spiny lobster. In their study, Fadool and colleagues (1995) found that an antibody against a common se quence of Ga q 1 11 recognized a 45 kDa protein in the dendrites of lobster ORNs. This same antibody, when perfused into cultured lobster ORNs was able to block the inward odor-evoked current though it had no effect on the outward odor evoked current Furthermore both inward and outward currents were insensitive to the presentation of either pertussis or cholera toxins. Proteins of the Gq family are not sensitive to either pertussis or cholera toxin (Strathmann and Simon, 1990). Together these data clearly implicated a Oq-like protein in spiny lobster excitatory odor transduction But although this protein shares immunological and pharmacological propertie s with known Gq proteins its membership in the Gq family remained in question The cDNA isolated from olfactory organ is consistent in primary structure with the Gq-like protein described by Fadool et al. (1995). The C-terminal amino acids that served as the epitope for the Gaq 1 11 antibody used in that study are precisely conserved in the protein encoded by the cDNA isolated here; this epitope is conserved in most Gaq 1 1 1 proteins but is noticeably different in two Gq proteins from another arthropod Drosophila (Lee et al ., 1990). The computed molecular weight which is consistent with other Gq proteins is just slightly smaller than the 45 kDa protein seen by Fadool and colleagues (1995) on We s tern blots ; this discrepancy may be due to lipid modifications of the native protein (S piegel et al ., 1991) or to anomalous migration of the protein in SOS-PAGE. The sequence al so reveals a lack of the C -terrninal cysteine that

PAGE 60

52 serves as the site of pertussis toxin ribosylation (Simon et al. 1991 ). These features demonstrate that a Gq protein that could be the one characterized functionally by Fadool and colleagues (1995) is expressed in the nose of tl1e spiny lobster. However, of the several other G protein antibodies screened in that study one raised against a peptide from a mammalian Ga 0 could also block the inward odor-evoked current though this Ga 0 antibody did not recognize any proteins on Western blots of ORN dendritic membrane. Members of the Gi family are pertussis toxin-sensitive (Simon et al. 1991) further complicating interpretation of the physiological experiment. Note that the epitope of the Ga 0 antibody the antigenic peptide LDRIGAADYQ (Goldsmith et al ., 1988), is somewhat conserved in the Gq sequence isolated here (Figure 9), suggesting that crossreactivity of the Ga 0 antibody with the native Gq protein led to the equivocal results seen by Fadool and colleagues (1995) However no attempt was made to isolate a Ga 0 cDNA from this tissue, so the possibility that the olfactory organ expresses both types of a-subunit cannot be excluded To fmd multiple G proteins involved in the same signalling pathway would be unprecedented in olfaction ~ but this has been seen in other systems. Some receptors can be coupled to multiple effectors via different G proteins [e.g. human thyrotropin receptors activate both Ga 5 and Gaq 1 11 in intact cells (Allgeier et al ., 1994)]. As each ORN was tested with only one of the antibodies, the prospect remains that individual ORNs could express either or both of the a-subunits. The finding by Fadool et al (1995) that the inward and outward currents are mediated by different G proteins is consistent with previous studies that implicated separate second messenger cascades in excitatory and inhibitory odor transduction in this animal (Fadool and Ache 1992 ; Michel and Ache, 1994 ; Boek.hoff et al 1994). If more than two G proteins were to be implicated in one of these patl1ways it would imply a complexity of signaling pathways that is not yet understood Gq proteins are seen in ORNs of both vertebrates and invertebrates (Abogadie et al. 1995a; Talluri et al ., 1995; Dellacorte et al ., 1996) including one cloned from the

PAGE 61

53 olfactory organ of the American lobster (Xu et al ., 1997). Gq-like immunoreactivity has also been observed in neurons of the vomeronasal organ but was deemed too faint to be of significance for sensory transduction in these cells (Berghard and Buck, 1996). While evidence for a role of the IP 3 pathway in vertebrate olfactory transduction is growing, no role for a Gq has been identified In fact Boekhoff and colleagues ( 1990) have implicated a pertussis toxin-sensitive G protein in IP 3 -mediated olfactory transduction. It is possible that in vertebrate ORNs the IP 3 pathway is coupled to a Ga 0 or to some member of the Gq family not recognized by antibodies against Gag or Ga 11 (e.g. Ga 14 Ga. 15 or Ga 16 ).

PAGE 62

Inositol 1 4 5-trisphosphate (IP 3 ) has been implicated as a second messenger involved in olfactory transduction for a variety of species (review: Breer and Boekhoff 1992 ; Ache and Zhainazarov 1995), though its precise role remains controversial, especially in vertebrates. Several laboratories report that they have failed to identify IP 3 gated conductances in ORNs of amphibians (e g. Firestein et al ., 1991; Nakamura et al ., 1994; Kleene et al ., 1994) The work of Nakamura and colleagues (1996) may imply that IP 3 and cyclic nucleotide-gated channels (CNGs) are in different cellular compartments with only the CNG residing in the membrane of ORN cilia. Most recently, gene knockout experiments with the mouse olfactory CNG show that the absence of this channel causes total anosmia in neonates (Bnmet et al 1996). These results contradict those of Restrepo e t al (1990) Miyamoto et al (1992) and Lischka et al (1995) who have demonstrated the presence ofIP 3 -gated conductances in the ORNs of rats and catfish. As has been described extensively in the previous chapters, there is also biochemical evidence for odor-stimulated generation of IP 3 in ORNs as well as emerging immunological and molecular evidence placing components of an IP 3 signaling pathway in dendrites of these cells. These conflicting data leave the precise role ofIP 3 in vertebrate olfactory transduction somewhat ambiguous: IP 3 has been proposed by some to be either a modulatory factor or a necessary cofactor for the better characterized transduction pathway mediated by adenosine 3 ', 5 -cyclic monophosphate (cAMP); others believe it to have a role equivalent but not identical, to cAMP. A key to under s tanding the functional intricacies of the cAMP pathway was the molecular isolation and characterization of components of this signaling cascade in 54

PAGE 63

55 olfactory receptor neurons This was done, not by random chance, but by taking advantage of perceived similarities of the olfactory cAMP transduction cascade to the cGMP signaling pathway in vertebrate photoreceptors. Homologous ( e.g. the olfactory CNG) and analogous (e.g. G 0 1 r) proteins were identified by narrowing the search to molecules like those seen to be involved in the much better characterized photoresponse. In this dissertation I have taken a similar tack, using the better characterized IP 3 -mediated olfactory transduction pathway in ORNs of the spiny lobster as a source of information about the functioning ofIP 3 in olfactory transduction in general. In the spiny lobster, Panulirus argus, electrophysiological studies have implicated an IP 3 -gated channel the IP 3 receptor (IP 3 R) as the target of IP 3 generated upon excitatory odor-stimulation. A Gq-type OTP-binding protein a-subunit (Gq protein) has also been implicated in the excitatory odor response serving to link the activated odor receptor with the enzyme that generates IP 3 (Figure 12) This dissertation describes the molecular cloning of cDNAs for two components of an IP 3 signaling cascade from the olfactory organ (nose) of the spiny lobster : an IP 3 receptor (Chapter 2) and a Gq protein (Chapter 3). These two proteins, both of which have been physiologically implicated in the excitatory odor response in lobsters, share many structural characteristics with those isolated from other species and tissues The IP 3 receptor cDNA encodes a protein that is approximately 50% identical to many of those isolated from Drosophila and several vertebrates. The Gq protein shows an even greater similarity to other Gq proteins (7080% ) The messenger RN As for these two molecules are both expressed in the olfactory organ making them candidates for roles in olfactory transduction The isolation of these two cDNAs is a critical step in our understanding of both the role of IP 3 in olfactory signaling and the complexity of odor transduction in all animals. Much work remains to be done with both of these molecules to establish that each plays a role in olfactory transduction rather than elsewhere. Both proteins are quite similar to ones seen in a variety of neural and nonneural cells, so some form of cellular

PAGE 64

Fi're 12. The proposed lobster excitatory odor transduction pathway with a Gq protein coupling the odor receptor to a phospholipa s e C and IP 3 directly gating a p l asma membrane channel

PAGE 65

\ 57 EXCITATORY PATHWAY pho s ph o lipa se C Na+ Ca++ -'-t--'-----7 ) N a+ Ca ++ IP 3 R eceptor

PAGE 66

58 localization, such as in situ hybridization is necessary to demonstrate that these particular genes are expres s ed in ORNs (while ORNs are the principal cell type in the olfactory epithelium other neuronal and nonneuronal cell types are present). The Gq protein has already been shown to be present in the ORN dendrites (Fadool et al 1995). Two polyclonal antibodies directed against a conserved and a nonconserved region of the IP 3 R have been generated and are currently being characterized. The presence of antigen for both of these antibodies in the ORN dendrites would provide a strong link between the cloned channel and those first characterized by Fadool and Ache (1992). Heterologous expression of both tl1ese proteins would permit comparisons to those native proteins previously characterized (Fadool and Ache, 1992; Hatt and Ache, 1994; Fadool et al ., 1995). Such experiments would also permit mutational and chimeric studies of these proteins, which might provide insight into numerous structural and functional questions, the most obvious of which is the role for the novel hydrophilic sequence in the modulatory domain oftl1e lobster IP 3 R. Of course while characterization of these molecules provides great insight into the functional properties of the molecules themselves, the advantage of a comparative approach is the clues it can provide about other systems. If these two molecules are shown to be involved in olfactory transduction in the spiny lobster, the next step would be an attempt to clone and localize equivalent molecules in vertebrate ORNs. Towards this end a partial cDNA encoding the carboxyl end of a novel IP 3 R has been cloned from Xenopus olfactory epithelium (Munger Rust Ache and Greenberg, unpublished data). Isolation of similar molecules does not guarantee similar roles for the IP 3 pathway in lobsters and vertebrates but it will simplify the testing of various hypotheses. While I have concentrated on the IP 3 pathway in ORNs as it relates to primary olfactory transduction ( coupling an odor-bound receptor to a change in membrane conductance) activation of this pathway can have additional consequences for the cell and its response to odors. For example Ca 2 + entering the cell through the IP 3 R, along

PAGE 67

59 with diacylglycerol cogenerated with IP 3 by activated phospholipase C could activate protein kinase C which could in turn phosphorylate numerous cellular proteins. The mechani s m s of olfactory transduction already appear to be subject to complex regulation. Gaseous mes s engers such as nitric oxide (NO ) and carbon monoxide (CO) and the cyclic nuc l eotide guano s ine 3 ', 5 cyclic monopho s phate ( cGMP ) appear to have modu l atory effects on the CNG channel (Breer e t al ., 1992 ; Lischka and Schild 1993; Leinders Zufall e t al ., 1995 ; Zufall 1996 ; Broillet and Firestein 1996). As in most systems Ca 2 + seems to have numerou s biochemical and physiological effects that may modify the odor respon s e ( e.g Anholt and Rivers, 1990 ) including playing a large role in the amplification of the initial odor-induced current via the direct gating of a chloride channel (Kleene 1993 ; Lowe and Gold 1993; Kurahashi and Yau 1994). There is even evidence for a Na + -gated channel playing a similar amplification role in the lobster (Zhainazarov and Ache 1995 ; Zhainazarov e t al ., 1997) While the existence of these additional transduction mechanisms does not diminish the need to understand the cAMP and IP 3 mediated systems, none of the s e mechanisms operates in isolation from the others. However to under s tand the interaction s between these multiple pathways the compon e nt s of each pathway mu s t be under s tood for each component is a possible site of interaction with anoth e r

PAGE 68

LIST OF REFERENCES Abogadie F C., Bruch R. C. ar1d Farbman A I (1995a). G protein subunits expressed in catfish olfactory receptor neurons C hem Sen ses. 20 : 199-206 Abogadie F.C. Bruch R.C. Wurzburger R. Margolis F.L. at1d Farbman A.I. (1995b) Molecular cloning of a pho s phoino s itide-specific pbospholipase C from catfish olfactory rosettes. Mo/. Brain R es. 31: 10-16. Ache B. W. (1994) Towards a common strategy for transducing olfactory information. se m Cell Biol 5: 55-63. Ache B.W. at1d Carr W.E.S (1989). Chemoreception in aquatic invertebrates. In : Neural Mechanisms in Tast e. Boca Raton: CRC Press, Inc 97-117. Ache B.W. at1d Zhainazarov, A. (1995). Dual second-messenger pathways in olfactory transduction. C urr. Opin Neurobiol 5: 461-466 Anholt R.R.H and Rivers A M ( 1990) Olfactory tran s duction: cross-talk between second-messenger systems. Bioch e m. 29: 4049-4054. Asanuma N. and Nomura, H. ( 1991 ). Cytochemical localization of adenylate cyclase activity in rat olfactory cells. Histochem J 23 : 83-90 Bacigalupo J. Morales B. Ugarte G ., Delgado R ., Jorquera 0 and Labarca P (1993). Electrophysiological studies in toad olfactory receptor neurons. Chem Senses. 18: 525 Bakalyar H A. and Reed R.R (1990). Idnetification of a specialized adenylyl ccyclase that may mediated odorant detection. Science. 250: 1403-1406. Berridge M.J. (1993). Inositol tri s pho s phate and calcium signalling. Nature. 361: 315325. Bezprozvanny I and Ehrlich B .E ( 1993) ATP modulates the function of inositol 1 4 5trisphosphate-gated channel s at two sites. Neuron. I 0 : 1175-1184. 60

PAGE 69

61 Bezprozvanny I. and Ehrlich, B.E. (1994). Inositol (1 4 5)-trisphosphate (InsP 3 )-gated Ca channels from cerebellum: conduction properties for divalent cations and regulation by intraluminal calcium. J Gen Physiol 104: 821-856. Blonde! 0. Takeda, J. Janssen H ., Seino S and Bell G.I. (1993). Sequence and functional characterization of a third inositol 1 4 5-trisphophate receptor subtype IP 3 R-3 expressed in pancreatic islets kidney gastrointestinal tract and other ti s sues. J Biol Chem 268 : 11356-11363. Boekhoff I. Michel W C. Breer H. and Ache B.W. (1994). Single odors differentially stimulate sual second messenger pathways in lobster olfactory receptor cells. J. N e urosci 14: 3304-3309 Boekhoff I ., Tareilu s, E. Strotmann J and Breer H (1990) Rapid activation of alternative second mes s enger pathways in olfactory cilia in rats by different odors. EMBO J 9 : 2453-2458. Bradley J Li J ., Davidson N Lester H A. and Zinn K. (1994) Heteromeric olfactory cyclic nucleotide-gated channels : a subunit that confers increased sensitivity to cAMP. Pro c. Natl Acad Sci USA 91: 8890-8894. Breer, H and Boekhoff I. ( 1992). Second messenger signalling in olfaction. Curr Opin Neurobiol. 2: 439-443. Breer H. Boekhoff I and Tareilus E. (1990). Rapid kinetics of second messenger formation in olfactory transduction. Nature 344 : 65-68 Breer, H. Klemm T. and Boekhoff I. (1992) Nitric oxide formation of cyclic GMP in the olfactory system NeuroReport. 3: 1030-1032. Broillet M -C and Firestein S (1996). Direct activation of the olfactory cyclicc nucleotide-gated channel through modification of sulfbydryl groups by NO compounds. Neuron 16 : 377-385 Bruch R C (1990). Signal transducing GTP-binding proteins in olfaction. Comp Biochem Physiol. [A] 995 : 27-29 Bruch R C and Kalinowski D.L ( 1987) Interaction of GTP-binding regulatory proteins with chemo s en s ory receptors J Biol C hem 262: 2401-2404. Bruch R C. and. Teeter J.H (1990) Cyclic AMP links amino acid chemoreceptors to ion channels in olfactory cilia. C h e m Senses 15 : 419-430

PAGE 70

62 Brunet L.J., Gold, G.H. and Ngai J (1996) General anosmia caused by a targeted disruption of the mouse o lfactor y cyclic nuecleotide-gated channel. Neuron. 17: 681 -6 93. Buck, L and Axel R. (1991 ). A novel multigene family may encode odorant receptors: a molecular basis for odor recognition. Cell. 65: 175-187. Carr, W.E.S. Avhe, B.W. and Gleeson R.A. (1984). Chemoreceptors of crustaceans: similiraties to receptors for neuroactive substances in internal tissues. Environ HealthPers 71: 31-46. Clapham, D.E. and Neer, E.J. (1993). New roles for G protein py dimers in transmembrane signalling. Nature. 365: 403-406. Cunningham, A M. Ryugo, D K. Sharp A.H., Reed, R.R ., Snyder S.H. and Ronnett, O.V. (1993) Neuronal inositol 1 4 5-trisphosphate receptor localized to the plasma membrane of olfactory cilia. Neurosci. 57: 339-352. Dellacorte C., Restrepo D., Menco B.P M. Andreini I. and Kalinowski, D.L. (1996). Gaq/Ga 11 : immunolocalization in the olfactory epitheliumn of the rat (Rattus rattus) and the channel catfish (Jctalurus punctatus). Neurosci. 74: 261-273 Dhallan, R.S. Yau K. Schrader K A. and Reed R R. (1990). Primary structure and fuctional expression of a cyclic nucleotide-activated channel from olfactory neurons. Nature. 347: 184-187. Dingwall C. and Laskey, R A ( 1991 ). Nuc lear targeting sequences --a consensus? Trends Biochem Sci. 16: 478-481 Dionne V .E (1992). Chemosensory responses in isolated olfactory receptor neurons forrn Necturus maculosus. J Gen. Physiol 99 : 415-433 Dionne V.E (1994). Emerging complexity of odor transduction. Proc Natl Acad Sci USA. 91 : 6253-6254 Drinnan S.L., Hope B T. Snutch T.P. and Vincent, S R (1991). G 0 1 f in the basal ganglia. Mol. Ce ll Neurosci 2: 66-70. Fadool D.A and Ache B. W. ( 1992) Plasma membrane inositol 1 4,5-trisphophate activated channels mediate s ignal transduction in lobster olfactory receptor neurons. Neuron 9 : 907 918.

PAGE 71

63 Fadool, D.A. and Ache, B.W. (1994). Mediation of opposing transduction cascades in lobster olfactory receptor neurons by cAMP and IP 3 In: Olfaction and Taste XI. eds. Kurihara, K., N. Suzuki and H. Ogawa. Tokyo Springer-Verlag. 178-182. Fadool, D. A., Estey, S. E. and Ache, B. W. ( 1995). Evidence that a Gq-protein mediates excitatory odor transduction in lobster olfactory receptor neurons. Che m. Senses. 20: 489-498. Fadool, D.A. Michel W.C. and Ache B.W. (1993). Odor sensitivity of cultured lobster olfactory neurons is not dependent on process fortnation. J exp Biol. 174: 215233. Ferris, C.D and Snyder, S.H. (1992). Inositol 1 4,5-trisphosphate-activated calcium channels. Ann Rev. Physiol. 54: 469-488. Firestein S ., Darrow B. and Shepherd G.M (1991). Activation of the snesory current in salamander olfactory receptor neurons depends on a G-protein-mediated cAMP second messenger system Neuron. 6 : 825-835. Frohman M.A. M.K. Dush and G.R. Martin (1988). Rapid production of full-length cDNAs from rare transcript s: amplification using a single gene-specific oligonucleotide primer. Proc. Natl Acad Sci. USA. 85: 8998-9002. Fujimoto T. Nakade S. Miyawaki A ., Mikoshiba, K. and Ogawa, K. (1992). Localization of inositol 1 4 5-trisphosphate receptor-like protein in plasmalemmal caveolae. J. Cell Biol 119 : 1507-1513 Furuichi T. Kohda ~ K., Miyawaki A and Mikoshiba K. (1994). Intracellular channels Curr. Opin. Neurobiol. 4 : 294-303 Furuichi T. Yoshikawa, S., Miyawaki A ., Wada, K., Maeda, N. and Mikoshiba, K. (1989). primary structure and functional expression of the inositol 1 4 ,5 trisphosphate-binding protein P 400 Nature. 342: 32-38. Goldsmith, P. Backlund, Jr. P.S. Rossiter K. Carter, A. Milligan, G. Unson, C.G. and Spiegel A. (1988). Purification of heterotrimeric OTP-binding proteins from brain: identification of a novel form of G 0 Biochem. 27 : 7085-7090. Goulding E.H J. Ngai, R.H. Kramer S Colicos R. Axel S.A. Siegelbaum and A. Chess (1992). Molecular cloning and single-ch .annel properties of the cyclic 11ucleotide-gated channel from catfish olfactory neurons. Neuron 8: 45-58. Grunert, U. and Ache, B.W. ( 1 988). Ultrastructure of the aesthetasc (olfactory) sensilla of the spiny lobster, Panulirus argus. Cell Tissue Res. 251: 95-103.

PAGE 72

64 Hamm H.E. and Gilchrist A. (1996) Heterotrimeric G proteins. Curr Opin. Cell Biol. 8 : 189-196. Hatt H. and Ache B. W. ( 1994). Cyclic nucleotideand inositol phosphate-gated ion channels in lobster olfactory receptor neurons Proc Natl Acad Sci USA. 91: 6264-6268. lvanova T T and Caprio J. (1992). Odorant receptors activated by amino acids in sensory neurons of the channel catfish Jctalurus punctatus. J Gen Physiol 102: 1085-1105. Iyengar R. and Birnbaumer L. (1990) Roles of G proteins and G protein subunits in s ignal transduction L y mphokin e Res 9: 533-537. Jones D.T ., Barbosa E and Reed R.R. (1988). Expression of G-protein a-subunits in rat olfactory epithelium : candidates for olfactory signal transduction. Cold Spring Harbor Symp Quant Biol 53: 349-354. Jones D.T. and Reed R.R. (1989). Golf: an olfactory neuron-specific G protein involved in odorant signal transduction. Science. 244: 790-795. Kalinowski D.L., Aldinger, S.B. Boyle A.G. Huque, T. Marecek, J.F., Prestwich, G.D. and Restrepo D. (1992). Characterization of an novel inositol 1 4,5-trisphosphate receptor in isolated olfactory cilia. Biochem J 281: 449-456. Khan A.A ., Soloski M.J. Sharp A.H. Schilling, G ., Sabatini D.M. Li, S.-H., Ross, C.A. and Snyder S.S. (1996) Lymphocyte apoptosis:mediation by increased type 3 inositol 1,4 5-trisphosphate receptor. Science. 273: 503-507. Khan A.A. Steiner J P Klein M G ., Sclmeider M.F. and Snyder S.H. (1992). IP 3 receptor : localization to plasma membraen ofTcells and cocapping with the T cellreceptor. Science 257: 815-818. Kingston P A. Zufall F and Barn stable C.J. (1996). Rat hippocampal neurons expres s genes for both rod retinal and olfactory cyclic nucleotide-gated channels: novel targets for cAMP / cGMP function. Proc Natl. Acad Sci USA. 93: 10440-10445. Kleene S.J. (1993) Origin of the chloride current ni olfactory transduction. Neuron. 11: 123-132 Kleene S.J Gesteland R C. and Bryant S.H. (1994) An electrophysilogical survey of frog olfactory cilia. J Exp Biol 195: 307-328.

PAGE 73

65 Kozak, M. (1991). Structural features in eukaryotic mRNAs that modulate the initiation of translation. J Biol Chem 266: 19867-19870. Kume, S. Muto A. Aruga J ., Nakagawa T. Michikawa, T Furuichi, T., Nakade, S., Okano H. and Mikoshiba K. (1993) The Xenopus IP 3 receptor: Structure function and localization in oocytes and eggs. Cell. 73: 555-570. Kuno M. Maeda N. and Mikoshiba K. (1994). IP 3 -activated calcium-permeable channels in the inside-out patch of cultured cerebellar Purkinje cells Biochem. Bio phys Res Comm 199: 1128-113 5 Kurahashi T. and Yau K. W. ( 1994) Co-existence of cationic and chloride components in odorant-induced current of vertebrate olfactory cells. Nature. 363: 71-74. Labarca P. Simon, S.A. and Anholt R.R.H. (1988). Activation by odorants of a multistate cation channel from olfactory cilia. Proc. Natl Acad Sci. USA. 85: 944-947. Lambright D G. Noel J.P. Hamm H.E. and Sigler P.B. (1994). Structural determinants for activation of the a-subunit of a heterotrimeric G protein. Nature. 369: 621-628. Lee, Y -J Dobbs M.B. Verardi M.L. and Hyde D.R. (1990) dgq: a Drosophila gene encoding a visual system-specific G molecule. Neuron. 5: 889-898. Leinders-Zufall T. Shepherd G M. and Zufall, F (1995). Regulation of cyclic nucleotide-gated channel s and membrane excitability in olfactory receptor cells by carbon monoxide. J. N e urophysiol 74: 1498-1508. Liman E R. and Buck L.B. (1994) A second subunit of the olfactory cyclic nucleotide gated channel confers high sensitivity to cAMP. Neuron 13: 611-621. Lischka, F.W. and Schild D (1993) Effects of nitric oxide upon olfactory receptor neurones inXenopus laevi s. NeuroReport. 4 : 582-584 Lischka, F.W. Honda, E. Teeter J.H. and Restrepo, D. (1995). Characterization of an InsP3-activated channels in reconstituted membranes and ex c cised patches from rat olfactory neurons. Chem Senses 20: 733. Lowe G. and Gold, G.H. (1993 ) Nonlinear amplification by calcium-dependent chloride channels in olfactory receptor cells. Nature. 366: 283-286.

PAGE 74

66 Lowe, G., Nakamura T and Gold G.H (1989). Adenylate cyclase mediates olfactory transduction for a wide variety of odorants. Proc Natl. Acad. Sci USA 86: 5641-5645. Lucero M.T., Horrigan, F.T. and Gilly, W.F. (1992). Electrical responses to chemical stimulation of squid olfactory receptor cells. J. Exp. Biol 162: 231-249. Lucero, M.T. and Piper, D R. (1994). IP 3 and cyclic nucleotides elicit opposite membrane potential changes in squid olfactory receptor neurons. Chem Senses. McClintock, T.S. and Ache B W. (1989). Hyperpolarizing receptor potentials in lobster olfactory receptor cells: implications for transduction and mixture suppression Chem Senses. 14: 637-647. McDonald T V., Premack B.A. and Gardner, P. (1993). Flash photolysis of caged inositol 1 4 5-trisphosphate activates plasma membraen calcium current in human T cells. J. Biol Chem. 268: 3889-3896. Menco, B P., Bruch, R.C. Dau B. and Danho W. (1992). Ultrastructural localization of olfactory transduction components: the G protein Golf alpha and type ill adenylyl cyclase. Neuron. 8: 441-453. Michel W C. and Ache, B.W (1992). Cyclic nucleotides mediate an odr-evoked potassium conductance in lobster olfactory receptor cells. J. Neurosci. 12: 39793984. Michel W.C. McClintock T.S. and Ache, B.W. (1991). Inhibition of lobster olfactory receptor cells by an odor-activated potassium conductance. J. Neurophysiol. 65: 446-453. Michikawa T. Hamanaka, H Otsu H. Yamamoto, A. Miyawaki A., Furuichi T., Tashiro Y. and Mikoshiba K. (1994) Transmembrane topology and sites ofN glycosylation of inositol 1 4 5-trisphosphate receptor. J. Biol Chem 269: 91849189 Mignery G.A Newton C.L. Archer III B.T. and Sudhof, T.C. (1990). Structure and expression of the rat inositol 1 4 5-trisphosphate receptor. J. Biol. Chem 265: 12679-12685. Mikoshiba, K (1993). lnositol 1,4,5-trisphosphate receptor. Trends Pharm Sci. 14: 8689. Miyamoto T Restrepo D. Cragoe E.J. and Teeter J.H. (1992). IP 3 and cAMP induced responses in isolated olfactory receptor neurons from the channel catfish. J. Membr Biol 127: 1 73-183

PAGE 75

67 Mourey R.J. Estevez V A ., Maracek J F. Barrow R.K., Prestwich, G.D. and Snyder S.H. (1993). Inositol 1 4,5-trisphosphate receptors: labelling the inositol 1 4,5trisphosphate binding site with photoaffinity ligands. Biochem 32: 1719-1726. Munger S D. Ache B.W and Greenberg R.M. (1995) Cloning and sequencing of an IP 3 -receptor cDNA from lobster olfactory organ Soc Neurosci. Abstr 21: 1127 Munger S.D. Rust N .C Ache B W and Greenberg R.M. (1997) Cloning and molecular characterization of two components of the IP 3 pathway from lobster olfactory organ. C h e m Sens es. In press Nakade S., Maeda N. and Miko s hiba, K. (1991). Involvement of the C-ter1ninus of the inositol 1 4 ,5 -trispho s phate receptor in Ca 2 + release using region-specific monoclonal antibodies Biochem J. 277: 125-131 Nakamura T. and Gold G.H. (1987). A cyclic nucleotide-gated conductance in olfactory receptor cilia. Nature. 325: 442-444 Nakatnura T. Lee H.-H. Kobayashi H. and Satoh T.-0. (1996). Gated conductances in native and reconstituted membranes from frog olfactory cilia. Biophys J. 70: 813-817. Nakamura T ., Tsuru, K. and Miyamoto S. (1994). Regulation of Ca 2 + concentration by s econd messengers in newt olfactory receptor cell. Neurosci. Lett 171: 197-200. Neer E.J. ( 1995). Heterotrimeric G proteins : organizers of transmembrane signals. Cell. 80 : 249-257. Pace U., Han s ki E., Salomon, Y and Lancet D. (1985). Odorant-sensitive adenylate cyclase may mediate olfactory reception. Nature. 316: 255-258. Restrepo D ., Miyamoto T ., Bryant B.P and Teeter, J.H. (1990). Odor stimuli trigger influx of calcium into olfactory neurons of the channel catfish. Science 249: 1166-1168. Restrepo D. Teeter J.H. Honda E., Boyle A G. Marecek J .F., Prestwich, G.D. and Kalinowski, D.L (1992). Evidence for an InsP 3 -gated channel protein in isolated rat olfactory cilia. Am. J. Physiol 32: C667-C673. Restrepo D. Teeter J H. and Schild D. (1996). Second messenger signalling in olfactory transductio11 J. Neurobiol. 30: 37-48.

PAGE 76

68 Ronnett G.V. Cho, H. Hester L D. Wood, S.F. and Snyder, S.H. (1993). Odorants differentially enhance phosphoinositide turnover and adenylyl cyclase in olfactory receptor neuronal cultures. J Neurosci 13 : 1751-1758. Ross C.A ., Danoff S K ., Schell M.J., Snyder S.H. and Ullrich A. (1992). Three additional inositol 1,4 5-trisphosphate receptors: Molecular cloning and differential localization in brain and peripheral tissues. Proc. Natl. Acad. Sci. USA 89: 4265-4269. Sanger F and Coulson A R. (1977). A rapid method for determining sequences in DNA by primed synthesis with DNA polymerase. J Mol Biol 13: 373 Schild, D. Lischka F.W. and Restepo D. (1995) InsP 3 causes an increase inapical [Ca 2 + ] i by activating two distinct current components in vertebrate olfactory receptor cells J Neurophysiol 73 : 862-866. Schmiedel-Jakob I ., Anderson P.A.V and Ache B.W. (1989). Whole cell recording from lobster olfactory receptor cells: responses to current and odor stimulation. J Neurophysiol. 61: 994-1000 Schmiedel-Jakob I ., Michel W.C ., Anderson P.A.V and Ache B.W. (1990). Whole cell recording form lobster olfactory receptor cells: multiple ionic bases for the receptor potential. Chem S e nses. 15 : 397-405. Seok J.-H. Xu, L. Kramarcy, N.R ., Sealock R. and Meissner G. (1992). The 30 S lobster skeletal muscle Ca2 + release channel (ryanodine receptor) has functional properties distinct from the mammalian channel proteins. J Biol Chem. 267: 15893-15901. Sharp, A.H. S.H. Snyder and S.K Nigam ( 1992). Inositol 1 4,5-trisphosphate receptors: localization in epithelial tissue. J Biol Chem. 267: 7444-7449. Shepherd G.M. and Firestein S. (1991) Making scents of olfactory transduction. Curr. Biol l : 204-206. Shepherd G.M. (1994) Discrimination of molecular signals by the olfactory receptor neuron. Neuron 13: 771-790. Shinohara, H ., Kato K. and Asano T (1992). Differential localizationof G proteins, Gi and G 0 in the olfactory epithelium and the main olfactory bulb of the rat. Acta Anat 144: 167-171. Simon, M.I., Strathmann M.P and Gautam N. (1991 ) Diversity of G proteins in signal transduction. Science. 252: 802-808.

PAGE 77

69 Sklar P.B. Anholt R.R. and Snyder S.H. (1986).The odorant-sensitive adenylate cyclase of olfactory recptor cells. Differential stimulation by distinct classes of odorants. J Biol Ch e m 261: 15538-15543. Stehno-Bittel L ., Ltickhoff A. and Clapham D.E. (1995). Calcium release form the nucleus by In s P 3 receptor channels. N e uron 14: 163-167. Sternberg M J.E and Taylor W R. ( 1984 ) Modelling the ATP-binding site of oncogene product s, the epidermal growth factor and related proteins. FEBS Lett 175: 387392 Strathmann M. and Simon M.I. ( 1990 ) G protein diversity : a distinct class of subunits i s present in vertebr a tes and invertebrates. Proc Nat A c ad S c i USA 87 91139117. Sudhof T. C Newton, C L. Archer B T. U s hkaryo v, Y A. and Mignery G.A. (1991). Structure of a novel InsP 3 receptor. EMBO J 10 : 3199 3206. Sullivan K.M.C. Lin D D. Agnew W. and Wilson K.L ( 1995). Inhibition of nuclear ve s icle fusion by antibodies that block activation of inositol 1 4 5-trisphosphate receptors. Proc Natl. A c ad S c i U SA 92: 8611-8615 Talluri S. Bhatt A and Smith, D.P ( 1995). Identification of a Drosophila G protein a s ubunit ( dGqa-3 ) expres s ed in chemosensory cells and central neurons. Proc N atl A c ad. S c i U SA 9 2: 11475 11479 Vodyanoy V. and Murphy R ( 1983 ) Single channel fluctuations in biomolecular lipid membranes induced by rat olfactory epithelium homogenates. Science 220: 717719. Wang M.M and Reed R.R. ( 199 3 ). Molecular cloning of the olfactory neuronal transcription factor Olf-1 by g enetic s election in yeast. Nature. 364: 121-126 Wang M.M. T s ai R Y. Schrader K.A and Reed R.R. (1993). Genes encoding components of the olfactory signal tran s duction cascade contain a DNA binding s ite that may direct neuronal expression. Mo! C e ll Biol 13: 5805-5813. Wedegaertner P.B. Wil s on P T. and Bourne H R. (1995) Lipid modifications of trimeric G proteins. J. Biol C h e m. 2 70 : 503 506. Wilkie T.M. Scherle P A ., Strathmann M.P ., Slepak V Z. and Simo~ M.I. (1991 ) Characterization of G-protein alpha subunits in the Gq class: expression in murine tissue s Proc Natl Ac ad S c i US A 88: 10049-10053.

PAGE 78

70 Xu, F. Quintero J. Gress A.M. and McClintock T.S. (1997). Molecular cloning of two guanine nucleotide binding proteins from American lobster olfactory organ. Chem. Senses Abstract. In press. Yamada N., Makino Y. Clark, R A ., Pearson, D.W ., Mattei M.-G ., GuJnet J.-L., Ohama E., Fujino, I ., Miyawaki A., Furuichi, T and Mikoshiba, K. ( 19 94). Human inositol 1 4,5-trisphosphate type-I receptor: structure, function, regulation expression and chromosomal localization. Biochem J. 302: 781 790. Yoshikawa S. Tanimura, T Miyawaki A. Nakamura, M. Yuzaki M. Furuichi, T. and Mikoshiba K (1992). Molecular cloning and characterization of the inositol 1 ,4, 5-trisphosphate receptor in Dro sop hila melanogaster. J. Biol Chem. 267: 16613-166 I 9. Zhainazarov, A.B. and Ache B.W (1995). Na+-activated nonselective cation channels in primary olfactory neurons J. Neurophysiol 73: 1774-1781 Zhainazarov A.B. Doolin R.E. and Ache B.W. (1997). Odors activate a sodium-gated cation conductance it1 lobster olfactory neuron s [submitted]. Zheng J. Knighton, D.R ., Ten Eyck, L .F., Karlsson R. Xuong, N. Taylor S.S. and Sowadski, J.M. (1993). Crystal s tructure of the catalytic subunit of cAMP dependent protein kinase complexed with MgA TP and peptide inhibitor. Biochem 32: 2154-2161. Zufall F., Firestein, S and Shepherd, G.M. (1994). Cyclic nucleotide-gated ion channels and sensory transduction in olfactory receptor n eurons. Annu Rev Biophys Biomed Struct. 23: 577 607.

PAGE 79

BIOGRAPHICAL SKETCH Steven Dunn Munger wa s born on November 26 1966 in Richmond, Virginia. His parents Peter and Joan Munger moved to Charlottesville Virginia 6 months later, taking Steven with them. His only brother David, was born in 1970. Steven attended Venable and Greenbrier Elementary Schools, Walker Middle School and Charlottesville High School graduating from the latter in June of 1985. That fall he enrolled at the University of Virginia, where he graduated with a Bachelor of Arts in Biology 4 years later. During his stay at U Va ., Steven worked with Dr. DeForest 'Mike' Mellon on a project concerning the projection of olfactory neurons from the nose to the brain. This was his first exposure to olfaction and served to whet his appetite After graduating from U.Va. Steven worked for one year as a technician in the laboratory of Dr. Sally Moody and Dr Steve Klein. This laboratory focused on development including development of the nervous system, another influence that would be felt later on. Steven enrolled as a graduate student at the University of Florida Departrnent of Neuroscience in the fall of 1990, and immediately started to work in the laboratory of Dr. Barry Ache at the Whitney Laboratory There after a series of failed projects, he succeeded in isolating two cDNAs from the lobster nose that may play a role in olfactory transduction While at the Wlutney Laboratory he also collaborated with the laboratory of Dr. Barbara-Alme Battelle on a study characterizing a component of the horseshoe crab visual transduction cascade Steven and his new dog Weaver now leave St. Augustine for Baltimore, Maryland where Steven will take a po s tdoctoral fellowship with Dr. Randall Reed at the 71

PAGE 80

72 Howard Hughes Medical Institutes and the Department of Molecular Biology and Genetic s, John s Hopkins Univer s ity Medical School (Weaver will just play with tennis ball s)

PAGE 81

I certify th at I have read thi s s tudy and that in my opinion it conform s to acceptabl e standards of s cholarly pre se ntation and is fully adequate, in sc ope and quality as a di sse rtation for the degree of Doctor of Phil o ~ s :...: o ~h__._..... _-rz:. :::::::--I --~---Barry Profe sso r of Neuroscience I certify that I have read thi s s tud y and that in my opinion it conform s to accept ab l e s tandard s of sc holarl y pre se ntation and i s fully adequate, in sc ope and quality as a di sse rtation for th e degr ee of Doct o r of Phil oso phy .,,, ...,,.-.c:;;;? Barbara Anne Battelle Cochair Prof esso r of Neuroscience I certify that I have read thi s s tudy and that in my opll}ion it conforms to acceptable st andard s of sc l1olarly pr ese ntation and i s fully ;mequat cope nd quality as a di sse rtation for the d eg re e of D octor of Philv~:,v ~a f P a an rapeut1L~ I certify that I have read thi s s tudy nd that in my opinion it conforms to acceptable sta ndard s of scholarly pr ese ntation and i s fully adequate, in sco pe and quality as a di sse rtati o n for the d eg re e of D octo r of Phil ophy. Pet e r A. d e r so n Profe sso r of Phy s iolo gy and Neuroscience

PAGE 82

I certify that I have read this study and that in my opinion it conforrns to acceptable standards of scholarly pre se ntation and is fully adequate, in scope and quality as a dissertation for the degree of Doctor of Philosophy Gerard Shaw Prof esso r of Neuroscience I certify that I have read thi s study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the de g ree of Doctor of Philo so phy ~YV/Vert M. G eenberg Assistant Scientist in I Molecular Biology This dissertation was submitted to the Graduate Faculty of the College of Education and to the Gradtiate School and was accepted as partial fulfillment of the requirement s for the degree of Doctor of Philo sop hy. May, 1997 Dean, College of Medicine Dean Graduate School

PAGE 83

UNIVERS I TY OF FLOR ID A I II I I Ill I l l ll l ll l l lll I I I II I II I I II II I I I ll ll 111111 1 111 1 111 1 3 1262 08554 6306


xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID EVXOPS9YZ_W6ZW3B INGEST_TIME 2012-06-26T21:36:42Z PACKAGE AA00011222_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES