The Structure and function of cytochrome P450 in the hepatopancreas of the Florida spiny lobster Panulirus argus

MISSING IMAGE

Material Information

Title:
The Structure and function of cytochrome P450 in the hepatopancreas of the Florida spiny lobster Panulirus argus
Physical Description:
xxi, 106 leaves : ill. ; 29 cm.
Language:
English
Creator:
Boyle, Sean Michael, 1966-
Publication Date:

Subjects

Subjects / Keywords:
Cytochrome P-450 Enzyme System -- physiology   ( mesh )
Cytochrome P-450 Enzyme System -- chemistry   ( mesh )
Cytochrome P-450 Enzyme System -- analysis   ( mesh )
Pancreas   ( mesh )
Liver   ( mesh )
Structure-Activity Relationship   ( mesh )
Lobsters   ( mesh )
Genre:
bibliography   ( marcgt )
theses   ( marcgt )
non-fiction   ( marcgt )

Notes

Thesis:
Thesis (Ph. D.)--University of Florida, 1997.
Bibliography:
Includes bibliographical references (leaves 93-104).
Statement of Responsibility:
by Sean Michael Boyle.
General Note:
Typescript.
General Note:
Vita.

Record Information

Source Institution:
University of Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
oclc - 48927452
ocm48927452
System ID:
AA00011217:00001

Full Text











THE STRUCTURE AND FUNCTION OF CYTOCHROME P450 IN THE
HEPATOPANCREAS OF THE FLORIDA SPINY LOBSTER, PANULIRUS ARGUS

















By


SEAN MICHAEL BOYLE


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY



UNIVERSITY OF FLORIDA


1997









This dissertation is dedicated to the memory of



Bridgette Bernadette Phillips














ACKNOWLEDGMENTS


Many people have rendered support to me over the years.

This section may prove to be a bit extensive.

I would like to first acknowledge my father, John Jude

Boyle. He has a master's degree in sociology, a degree in

medicine and was a Jesuit deacon. His analytical disposition

and extremely strong dedication to medicine served as a

constant example of qualities to be sought.

My mother, Donna Deloris Boyle, taught me lessons not

so analytical in nature. She demonstrated time and time

again that logic usually fails when applied to everyday

life, and that love and compassion are the tools of

existence. She is now in charge of a Hospice division in the

mountains of Georgia. Somewhat fitting for her, I think.

My siblings also helped shape and guided me through the

years. As children, my two older sisters, Michelle Davina

and Melissa Renee, would play a game in which they were

school teachers and my brother, Christopher David, and I,

were the students. When the two sisters tired of the game, I

would assume the role of teacher and subject my poor brother

to hours more of schooling. I now have two younger sisters,

Kelly Ann and Katie Marie. My stepmother, Donna, has given

me plenty of moral support throughout.









The first professional teacher to instill within me a

desire for knowledge was at the time a high school geometry

teacher named Ronald Blatnick. His sense of humor coupled to

the proficiency he enjoyed in the subject was the first

example I had encountered which illustrated that learning

could indeed be fun and rewarding. It was Ron who taught me

how to play chess and encouraged me to begin programming

computers. Programming skills would later greatly shape my

scientific career.

Other teachers in high school were also exemplary. Mike

Beistle taught world history, English, and theater. His

classes were filled with compassion and impromptu

interpretation of various subjects. Mike Muschamp was the

principle and he taught American history. He was part judge

and part teacher, but always fair and just. His example of

how a person with integrity handles all forms of life's

adversities, coupled with his rather strong Georgian accent,

still serves as a role model for me.

While obtaining an undergraduate degree, I was taking a

general biology class. One day it was announced that a

professor needed a few students to help culture Bryozoans. I

had no clue what such a creature was, but I went to see the

professor anyway. I found Frank Maturo, Jr. I soon found

that the questions he was asking about these small, colonial

sessile invertebrates were fascinating. I also found that he

was called "Doc". I spent most of my first 2 years of

college in his lab. The single most important lesson he









taught me was that a carefully planned experiment could

answer a question one has, and that exotic solutions to such

questions are usually not desirable. As a brief example, he

was interested in the question of whether or not a certain

species of Bryozoan could self-fertilize. He showed me a

proposal a graduate student had written to address this

question. It contained many complex biochemical experiments.

I told him that I thought it was a really "cool" proposal.

He then asked if I could think of a better way. Well, I

could not. He then said, "Why not put a colony in a jar, and

see if more criters' show up".

One day I was on my way to visit "Doc" when I noticed a

person in the closet across from Doc's lab. I said hello to

him and asked him what he was doing in the closet. He told

me his name was Mike Miyamoto and he was a new faculty

member in the Department of Zoology. He told me the

university had promised him a big laboratory, but instead

gave him that closet. I welcomed him to the University of

Florida. Mike did eventually get his lab and I went to work

with him using my programming skills to help manage the

mitochondrial DNA he was analyzing. Mike taught me to be as

thorough as possible when analyzing or proofing data. He

also introduced me to molecular biology.

Jon Reiskind, also a professor in zoology, helped me to

realize that scientific research need not only be filled

with hard work and stress, but can be viewed as a type of

art. He worked with the speciation of wolf spiders. These









are beautiful animals with very strict geographical

boundaries. I have fond memories of collecting specimens at

night, spotting the spider's eyes with a head light.

While completing my undergraduate degree in zoology, I

attended a lecture given by John Schell at the Whitney

Marine Laboratory for Biomedical Research, or something to

that effect. The name of the Lab has changed many times and

is now just the Whitney Lab, after Mr. Whitney, the man who

donated the money for the lab to be built. Mr. Whitney has

passed away, but his wife visits every year during the

annual review process. When I sat listening to John, I did

not know that I would be spending the next 7 or 8 years at

the Whitney Lab.

John was lecturing on the metabolism of benzo-a-pyrene

in the Florida spiny lobster. He mentioned that the lobsters

did not get cancer. This caught my attention. I applied to

an undergraduate program at the Whitney lab and asked to

work in John Schell's lab. I was told he actually worked for

a one Margaret O. James. I looked up a couple of her papers,

there were many, and I was hooked, line and sinker. I was

working for Michael Corbett at the time, and he spoke very

highly of Margaret James. I remember the time he took

explaining what the "Respiratory Burst" was to a kid who

barely knew what "WBC" meant. So, I asked him to write a

letter of recommendation for me. I was accepted (in the off

season) into the undergraduate research training program at









the Whitney Lab. This delayed my graduation by a year, but

as it turned out, it was the right thing to do.

Arriving at the Whitney Lab, I expected to first meet

Margaret. But instead, I met John Pritchard. He is a very

tall, NIH scientist and immediately began explaining my

project to me. I was to isolate apical membranes from the

spiny lobster hepatopancreas. When he was done, he asked if

I had any questions. I think I replied, "Dr. Pritchard was

it?". But it was my lack of even basic cellular physiology

that allowed me to first meet Bill Carr and Mike Greenberg.

Both would come into the lab late at night and ask if I knew

what the "hell" I was doing. They were both very kind in

explaining osmosis, concentration gradients, passive and

nonpassive uptake mechanisms. Eventually, I met all the

faculty this way, and learned that each was approachable. I

owe them all a great deal.

I met Robin Wallace also. I would eventually work for

him over the course of one summer. I packed up my car and

moved to St. Petersberg in order to work on the snook

project. My car was stolen soon after. Dr. Wallace trained

me to "Score" follicles from fish. The fish he used as an

example was Fundulus heteroclitus. These are really nice

fish because they are very small, but have huge follicles.

This job was going to be easy. I was wrong. I was to work on

Centropomus undecimalis, a huge fish, with tiny, little

follicles. Robin Wallace has a breadth of knowledge that is

wide: from classical music (did you know that Vivaldi was









known as the "Red Monk" because he had red hair?) to

paintings (Robin paints and sells art work) to science

(Robin wrote the book on Vitellogenin, several I think).

During this time, I did meet Margaret. But I had

learned my lesson with John Pritchard. I was ready with pen

and paper at my first meeting with the "Boss". I still have

those first 5 pages of notes. It took me about a week just

to work through them and prepare some questions. The answers

to those questions raised more questions: a cycle that has

been going on for 8 years. To date, she has not run out of

answers. She has the uncanny ability to solve problems in

fields that are not her specialty. She has on more than one

occasion solved problems I was having in molecular biology,

often with limited information. She possesses an insight and

understanding about Science in general that, as far as I

have seen, very few scientist achieve. I feel privileged to

have been her student.

As for the other members on my committee, I know little

of them on a personal level. But each was chosen because of

the respect they command in their given fields. Ray Bergeron

and his group are well known to both the medical and

industrial fields. He is difficult to keep up with in a

conversation and giving seminars with him around strikes

fear in the heart of many a graduate student. But more often

than not, his questions gently lead the student into deeper

contemplation of a given subject.









I first became aware of Bill Buhi and his lab when I

heard of some studies he was doing with a faculty member in

zoology. The study dealt with a protein oviductt secretary

protein?) that he was trying to detect in alligators and

pigs. Several years later, our lab would look at P450s in

various species with an antibody that he and Idania Alverez

helped produce. I thank Idania for her help.

I first became acquainted with Kathleen Shiverick's

work via a journal article. Later, I was to take several

classes she taught. Of the many courses I have taken, her

courses stand out in my mind as being the most clearly

taught. I admit I was anxious to learn the material. I was

very happy when she agreed to be a member of my committee.

The final member of my committee is Rob Greenberg. He

and a then postdoc named Clay Smith have taught me most of

what I know about molecular biology. Interestingly, they are

nearly opposite in technique and approach to molecular

biology, in my mind. I have had the advantage to incorporate

both styles and feel fairly confident in my molecular

biology skills. I hope to one day reach the level of

understanding both men have in not only the narrow field of

molecular biology, but in Science in general.

Hank Trapido-Rosenthal, a post-doctoral fellow working

in Dr. Carr's lab, was the first to teach me molecular

biology at the Whitney Lab. Hank was very patient and I am

very much in his debt. And a special thank you to Dave

Price. He was the first person to point out that certain









lambda vectors have chiral maps. I was using the wrong

enatiomer for about six months before he, quite by chance,

asked me how my work was progressing. After a few minutes

talking with Dave, my project began to work just fine.

Jason Li was the first graduate student I met in

Margaret's group. Jason and I quickly became friends. He

taught me a great deal about HPLC function and microsome

preparation. I owe a great deal to Dr. Li Chung-Li. His

kindness both in and out of the lab made my time as a

graduate student a very positive experience. He and his

wife, Gena, often fed me, and allowed me to play with their

two wonderful children.

Gary LaFleur was a graduate student under the

supervision of Robin Wallace. Gary always had a quietness

about him and could befriend an angry rattle snake. He was

always willing to help anyone who asked. This trait cost him

many a long night, as he would have to catch up with his

work. He is a kind soul and I am fortunate to know him and

his wife, Susanna.

The other students and post-docs at the Whitney Lab

were all helpful. Mike Jeziorski is a post-doc who will

actually stop what he is doing and look up an answer to a

question you might ask of him, if he does not already know

the answer. My guilt concerning this trait eventually caused

me to start asking questions of Rob instead of Mike. Rob now

tells me to look it up. Steve Munger was another student who

would without fail offer assistance if you asked. In fact,









he frequently offered assistance even if you did not ask.

But to be honest, I don't ever recall turning down his help.

Gena White, a technician, also never failed to help if

called upon. Her many years of experience were quite

valuable to me during my training. I have found that

technicians often know more than most.

I would like to thank both Louise McDonald and Shirley

Metts. Without their help over the years, I would not have a

place to live nor money to spend. I would like to also thank

Lynn Milstead and Jim Netherton III for their expertise in

graphics and photography. The Whitney Lab would be far less

than it is without these two artists. A very special thank

you to Jan Kallman, our department secretary. There is

nothing Jan can't do. And thanks to Nancy Rosa. She was

always busy, but could find time to help. And thanks to the

folks at the editorial department who read this

dissertation. Thank you "MDL".

And finally, I wish to acknowledge Mr. Billy Raulerson

and Mr. Bob Birkett. Mr. Raulerson is one of those people

who can build just about anything. Mr. Birkett can fix

anything. I have see them both do it many times. I came to

know Mr. Raulerson fairly well over the years. Often we

talked about science and more times than not his

experimental design would be far superior to whomever's

project design we were talking about. This might seem a bit

strange at first, but Mr. Raulerson could approach a problem

from the outside, unbiased and unaffected by what famous









groups had done before or what a protocol dictated. I

learned a great deal from him, more than he will ever know.

As unbelievable as it may be, I have left out many

people I wish to thank. I have edited my original

acknowledgments. Those I have left out are people more

involved in my personal life, but as most know, my personal

life is mostly taken up by research. I thank all my friends

who have tolerated my ways. Again, I have been fortunate.

Finally, thank you to Ali Farakabesh. Besides being one of

my closest friends, he gave me the computer I typed this

manuscript on. All of my friends are that giving. I am very

fortunate indeed.

And a special thanks to Mr. Lefty. His devotion, in

spite of Feline Leukemia, has been an inspiration to me and

everyone who knows him. He is truly a good kitty. And he is

still alive.









TABLE OF CONTENTS


page

ACKNOWLEDGMENTS...... ........... .. ..................... iii

TABLE OF CONTENTS ..................................... xiii

LIST OF TABLES ......... ....... ... ............. ......... xv

LIST OF FIGURES .......... ............... .......... xvi

KEY TO ABBREVIATIONS. ................................ ..xviii

ABSTRACT ..... .............. .. ................ .......... xx

CHAPTERS

1 CYTOCHROME P450: SOME BACKGROUND INFORMATION...... 1

Introduction ....................................... 1
Cytochrome P450 and Cytochrome P450 Reductase..... 6
Previous Characterization of Cytochrome P450 in
the Spiny Lobster............................... 12
A Preview ...................... ..... ............. 17

2 CROSS-REACTIVITY OF AN ANTIBODY TO SPINY LOBSTER
P450 2L WITH MICROSOMES FROM OTHER SPECIES....... 18

Introduction......... ............................ 18
Materials and Methods ............................ 20
Results and Discussion............................. 23

3 CDNA AND PROTEIN SEQUENCE OF A MAJOR FORM OF P450,
CYP2L, IN THE HEPATOPANCREAS OF THE SPINY
LOBSTER, PANULIRUS ARGUS ......................... 32

Introduction................... ................... 32
Material and Methods.................. ............. 35
Results and Discussion ............................ 41

4 CATALYTIC CHARACTERIZATION OF CYP2L1 IN BACTERIA
AND YEAST EXPRESSION SYSTEMS .................... 57

Introduction.......................................... 57
Materials and Methods ............................ 61
Results..................................... ...... 73
Discussion........................................... 79


xiii










TABLE OF CONTENTS, CONTINUED


5 SUMMARY OF RESULTS .............................. .. 89

REFERENCES............................................. 93

BIOGRAPHICAL SKETCH ............ ... ...................... 105








LIST OF TABLES


Table page

1.1 Some CYP families and their model substrates...... 3


2.1 Classification and P450 Contents of Hepatic
Microsomal Preparation of the Species Studied..... 25


3.1 The N-terminal Amino Acid Sequences in a P450-
containing fraction Isolated from Spiny Lobster
Hepatopancreas Microsomes......................... 43


3.2 Sequence of some of the Primers Used to Obtain
the cDNA Clones................................... 45


4.1 In vitro Steroid metabolism in crustaceans species.. 58


4.2 Monooxygenase Activity of Spiny Lobster Cytochrome
P450 Fractions in the Presence of NADPH and NADPH
Cytochrome Reductase from Rat Liver................ 60


4.3 Primer Sequences Used in this Study ................. 63


4.4 Expression Vectors Used in this Study and their
Attributes ....................... ............... 66












LIST OF FIGURES


Figure page

1.1 An example of a cytochrome P450 difference spectra... 8


1.2 Proposed reaction mechanism for P450 mediated
oxygen activation and oxygenation of a substrate...10


1.3 The anatomy of the Florida spiny lobster,
Panulirus argus.....................................13


1.4 Cross-section of the spiny lobster hepatopancreas....15


2.1 Immunoreactivity of microsomes from invertebrate
and vertebrate species with anti-CYP2L antibodies
generated in rabbit................................ 25


2.2 Composite picture of various Western blots done with
invertebrate and vertebrate microsomal fractions...28


2.3 Twenty micrometer cryo-sections of spiny lobster
hepatopancreas .....................................31


3.1 SDS-PAGE of a spiny lobster P450-containing
fraction stained with Coomassie blue...............42


3.2 Cloning strategy showing the clones used to meld
together a full-length cDNA sequence................47


3.3 Nucleotide and conceptualized protein sequence
of the spiny lobster cytochrome P450, CYP2L........48


3.4 Hydropathy plots of the rat CYP2B1, rat CYP2B2,
rat CYP2D4 and CYP2L. .............................. 50


xvi











LIST OF FIGURES, CONTINUED


3.5 Comparison of the deduced amino acid of CYP2L with
that of rat CYPs 2B1, 2B2, 2B4 and 2D4..............52


3.6 Northern blot total RNA isolated from the
hepatopancreas of the spiny lobster................55


3.7 RT-PCR of total RNA isolated from the spiny lobster
hepatopancreas .................. ................. 56


4.1 The oligonucleotide sequence of expression primers
MJ25, MJ24, and BRN1................................64


4.2 SDS-PAGE of induced bacterial cells (BL21) expressing
cytochrome P450 2L1 from the expression vector
pET28a.............................................74


4.3 Western blot of total cell lysate from BL21 bacterial
cells expressing the pET28a construct induced with
0.4 mM IPTG........................................75


4.4 SDS-PAGE of pET28a derived cytochrome P450 2L1
expressed in bacterial cells (BL21) and purified
using metal chelation chromatography...............76


4.5 Western blot of microsomes from yeast expressing the
cytochrome P450 2L1 insert......................... 77


4.6 TLC separation of progesterone and testosterone
metabolites produced by expressed cytochrome P450
2L1 .............................................. 84


4.7 TLC separation of progesterone and testosterone
metabolites produced by expressed cytochrome P450
2L1 ................................. ............... 87


xvii








LIST OF ABBREVIATIONS


cDNA complementary or copy DNA
CO carbon monoxide
CsCl cesium chloride
CYP cytochrome P450
Da dalton
dATP deoxyadenosine triphosphate
dCTP deoxycytidine triphosphate
dGTP deoxyguanosine triphosphate
DI sterile deionized water
DNA deoxyribonucleic acid
dNTP deoxynucleoside triphosphate
DTT dithiothreitol
dTTP deoxythymidine triphosphate
EDTA ethylenediaminetetraacetic acid
EtOH ethanol
FAD flavin adenine dinucleotide
FITC fluorescein isothiocyanate
FMN flavin mononucleotide
g gram
h hour
i.p. intraperitoneal
K' potassium
KC1 potassium chloride
kb kilobase
kD kilodalton
kg kilogram
M molar
MeOH methanol
mg milligram
MgC12 magnesium chloride
ml milliliter
mM millimolar
mRNA messenger ribonucleic acid
MW molecular weight
Mr molecular mass
Na sodium
NaCl sodium chloride
P-NAD beta nicotinamide adenine dinucleotide
NADPH nicotinamide adenine dinucleotide
phosphate
nmole nanomole
P450 cytochrome P450
PAGE polyacylamide gel electrophoresis
PCR polymerase chain reaction
pmol picomole
PMSF phenylmethylsulfonyl fluoride
PVDF polyvinylidene fluoride
RNA ribonucleic acid


xviii








LIST OF ABBREVIATIONS, CONTINUED


SDS sodium dodecyl sulfate
SRS substrate recognition site
Taq Thermus aquaticus
TBS tris-buffered saline
TCDD 2,3,7,8-tetrachlorodibenzo-p-dioxin
TLC thin layer chromatography
TRIS Tris[hydroxymethy]aminomethane
Tween-20 polyoxyethylene-20-sorbitan
ici microcurie
9g microgram
gl microliter
pm micrometer
v volume
w weight
YNB yeast nitrogen base


xix








Abstract of Dissertation Presented to the Graduate School of
the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

THE STRUCTURE AND FUNCTION OF CYTOCHROME P450 IN THE
HEPATOPANCREAS OF THE FLORIDA SPINY LOBSTER, PANULIRUS ARGUS

By

Sean Michael Boyle

May, 1997

Chairperson: Margaret O. James
Major Department: Medicinal Chemistry

Cytochrome P450s are a superfamily of enzymes which

participate in Phase I biotransformation reactions within a

cell. These monooxygenase enzymes are found in a variety of

plant and animal species, including the Florida spiny

lobster, Panulirus argus.

Using partially purified cytochrome P450 from the spiny

lobster hepatopancreas, polyclonal antibodies were obtained

from rabbit sera. The antibodies cross-reacted strongly with

cytochrome P450 from the spiny lobster hepatopancreas.

Cytochrome P450s from other species were examined for

immunoreactivity with the spiny lobster anti-P450

antibodies. Cross-reactivity was detected with the slipper

lobster, but not the American lobster or blue crab. The

killifish, among others, yielded strongly immunoreactive

proteins. In addition, phenobarbital-treated rats also

cross-reacted with the spiny lobster antibodies.

The cDNA encoding an isoform of this enzyme found in

the hepatopancreas of the spiny lobster was isolated from a









cDNA library made from this tissue. This novel cytochrome

P450 enzymes was designated as cytochrome P450 2L1. The

deduced protein shared 35% identity with rat isoforms in the

2B family. Cytochrome P450 2L1 contains amino acids that are

invariant in all known cytochrome P450s and has the highly

conserved heme-binding domain.

Cytochrome P450 2L1 was expressed in the methylotrophic

yeast, Pichia pastoris. Whole cell and microsomal fractions

from yeast that expressed cytochrome P450 2L1 were

catalytically active with radiolabeled testosterone and

progesterone in an NADPH-dependent manner.

The major finding reported within this dissertation is

the cDNA sequence of a novel cytochrome P450 isolated from

the Florida spiny lobster. This cytochrome P450 represents a

new subfamily, and shares structural features with

cytochrome P450s found in the cytochrome P450 gene 2 family.














CHAPTER 1
CYTOCHROME P450: SOME BACKGROUND INFORMATION


Introduction


Cytochrome P450s are monooxygenases capable of

oxidizing a wide variety of endogenous and exogenous

compounds (Gibson and Skett, 1986). Cytochrome P450s

comprise a superfamily of enzymes which are distributed in

microorganisms, plants, and animals. The endogenous

functions of P450s are varied. For example, in

microorganisms like Pseudomonas putida, cytochrome P450

enables the organism to use camphor as a carbon source

(Takemori et al., 1993). In plants, some cytochrome P450s

are involved in the metabolism of hormones, leading to the

ripening of fruit, such as in the avocado (Stegeman and

Hahn, 1994). In animals, mitochondrial P450s are involved in

steroid metabolism, such as the synthesis of estrogen in

humans (Stegeman and Hahn, 1994). When an exogenous compound

(a xenobiotic) enters into an organism, cytochrome P450s are

the primary enzymes which modify the compound in order to

facilitate excretion.

Cytochrome P450 was first discovered in 1955 at the

University of Pennsylvania by Drs. G. R. Williams and M.

Klingenberg (Omura, 1993). The two researchers independently









noted that when rat liver microsomes were bubbled with

carbon monoxide and then reduced with nicotinamide adenine

dinucleotide phosphate (NADPH), a peak at 450 nm was

observed. In 1962, Drs. T. Omura and R. Sato at Osaka

University confirmed that the enzyme contained a b-type

cytochrome and named the protein "P-450" for "a pigment with

absorption at 450 nanometers".

Cytochrome P450s are membrane-bound in eukaryotic

organisms and are found in the endoplasmic reticulum (or

microsomess" when the endoplasmic reticulum is disrupted and

forms aggregates) and in the mitochondria (Black, 1992). In

prokaryotic organisms, cytochrome P450s are soluble and are

found in the cytoplasm.

Cytochrome P450s are assigned to one of 74 gene

families based on the amino acid identity of the cytochrome

P450 in question to all other known cytochrome P450 amino

acid sequences (Nelson et al., 1993). If the apoprotein is

greater than 40% identical on the amino acid level to

cytochrome P450 apoproteins of a particular gene family,

then that cytochrome P450 is placed into that same gene

family. If the apoprotein is greater than 55% identical on

the amino acid level to cytochrome P450 apoproteins of a

particular gene sub-family, then that cytochrome P450 is

placed into that same gene subfamily. Table 1.1 lists a few

cytochrome P450 families and model substrates that are

metabolized by certain cytochrome P450 isoforms. The

substrates listed in table 1.1 are substrates that are










Table 1.1 Some CYP families and their model substrates.


CYP Model Substrate Structure


1Al Ethoxyresorufin /H520 o



1A2 Phenacetin



1Bl Estrone



2As Coumarin Q-0



2Bs Pentoxyresorufin co ;

0
2Cs Mephenytoin ,HC
N-CH3

NH
2Ds Debrisoquine N-""-NH

/

2E1 Ethanol /\OH




3As Testosterone




4As Lauric acid ,OH


Arrows indicate the position of monooxygenation by cytochrome P450
enzymes.









characteristically metabolized by a particular cytochrome

P450 enzyme or cytochrome P450 enzymes within that

subfamily, but does not exclude the possibility that these

same substrates are metabolized by cytochrome P450 enzymes

in other sub-families and families. In fact, cytochrome

P450s have a broad substrate preferences. An important

function of cytochrome P450 in families 1 to 4 is the

monooxygenation of exogenous compounds (xenobiotics).

The genes that encode mammalian cytochrome P450 enzymes

can be induced by various compounds. Benzo-a-pyrene or

2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), for example,

causes the increased transcription of the cytochrome P450

1Al gene (Fujii-Kuriyama, 1993). Phenobarbital causes

increased transcription of cytochrome P450 2B genes (Fujii-

Kuriyama, 1993). Other compounds may stabilize existing mRNA

levels, as is thought for cytochrome P450 2E1 induction by

EtOH (Fujii-Kuriyama, 1993).

Cytochrome P450s have been detected in most tissues (in

humans, erythrocytes and striated muscle lack cytochrome

P450). Cytochrome P450s exist as two general classes: a

group of enzymes localized in particular tissues involved

typically in steroidogenesis and a group involved in the

metabolism of xenobiotics (Gonzalez, 1992). Xenobiotics are

defined as molecules that are not utilized by the body for

energy or the normal regulation of a physiological process.

Cytochrome P450s are important in determining the duration

of action and toxicity of various drugs, such as










acetaminophen. How long a xenobiotic remains in the body is

often determined by cytochrome P450 metabolism, especially

if the xenobiotic is lipophilic.

The liver is the organ that generally contains the

highest levels of cytochrome P450 in most species. Buhler et

al. (1992) demonstrated that the rat liver regionally

expresses various forms of cytochrome P450. Anundi et al.

(1993) speculated (and demonstrated in the rat liver) that

acetaminophen toxicity may be centrilobulary restricted due

to localized expression of cytochrome P450 2E1. Others have

further defined the regional expression of cytochrome P450s

1A1/2, 2E1, 2B1/2, and 3A1/2 (Oinonen et al., 1996, 1994;

Anundi et al., 1993). Interestingly, cytochrome P450s

2C11/12 are not zone-restricted.

In the human brain, cytochrome P450s are important in

the detoxification of xenobiotics, including psychoactive

drugs, such as serotonin (5-hydroxytryptamine) uptake

blockers (Baumann and Rochat, 1995). It has been reported

that mutations in the cytochrome P450 2D6 gene have been

associated with Alzheimer's disease (Saitoh et al., 1995).

In microsomal fractions from rat brain, cytochrome P450s

2C7, 2C11, 2E1, 4A3, 4A8 and a 2D have been identified by N-

terminal microsequencing (Warner et al., 1994) and low

levels of cytochrome P450 17 protein expression have been

detected (Sanne and Kreuger, 1995).

Cytochrome P450s in the eye (Stoltz et al.,1994),

kidney (Ma et al., 1993), arteries (Escalante et al., 1993),










skin (Toda et al., 1994) and muscle (Pereira et al., 1994)

are important in the metabolism of arachadonic acid into

physiologically active metabolites known as eicosanoids

(Coon et al., 1992). Compounds derived from arachadonic

acid, such as 12-hydroxyeicosatetraenoic acid, lower

intraocular pressure in the eye and modulate activity of the

Na+/K+ ATPase in the eye, kidney and muscle.

Cytochrome P450s are found in both breast and ovarian

tissues, where they mediate estrogen biosynthesis. Estrogen

levels increase in the follicle as the follicle develops,

and decrease at ovulation (Tilly et al., 1992). Both

estrogen, and cytochrome P450 19 protein (the cytochrome

P450 enzyme that catalyzes the conversion of testosterone to

17p-estradiol), are elevated in breast tissues from breast

cancer patients (Brodie, 1993).


Cytochrome P450 and Cytochrome P450 Reductase


Cytochrome P450 is a phase I enzyme, a member of a

large group of diverse enzymes involved in the first steps

of xenobiotic metabolism. Cytochrome P450 utilizes molecular

oxygen and reducing equivalents derived from NADPH in order

to insert an oxygen atom into a substrate (Guengerich and

McDonald, 1990). Cytochrome P450 is a monomer and has a

molecular mass of approximately 45-60 kDa. The enzyme is

anchored (Brown and Black, 1989, Black, 1992) to the









endoplasmic reticulum and contains a non-covalently bound

iron protoporphyrin IX prosthetic group.

When the cytochrome P450 enzyme is reduced with a

reducing agent such as NADPH or diothionite, and then

completed with CO, a maximal absorbance at 450 nm is

observed (Omura and Sato, 1964, see figure 1.1). It is this

characteristic of these monooxygenase enzymes that accounts

for the name cytochromee P450".

Figure 1.2 outlines the reaction mechanism between

enzyme, substrate and oxygen. Cytochrome P450 binds both

molecular oxygen and substrate and requires electrons

(reducing equivalents) from cytochrome P450 reductase. It

is thought that when the substrate binds (step 2) to

cytochrome P450, a conformational change occurs within the

enzyme, allowing the first electron donation (step 3)from

the reductase (figure 1.2). Molecular oxygen then binds to

the reduced enzyme complex (step 4). Cytochrome P450

reductase is an oxidoreductase (molecular mass around 78

kDa) and is found in close association with the cytochrome

P450. The reductase accepts 2 electrons from NADPH (in the

form of reducing equivalents) and donates 2 electrons

sequentially to the cytochrome P450 (Smith et al., 1994).

Cytochrome P450 reductase contains both flavin adenine

dinucleotide and flavin mononucleotide (FAD and FMN

respectively) and uses these flavins in the oxidized and

reduced form (quinone and semiquinone states) to pass single

electrons to cytochrome P450. The second electron may also



























0.00-





-0.03 ,
400 450 500

Nanometers
Figure 1.1. An example of a cytochrome P450 difference
spectra. Spiny lobster microsomes (solubilized in 0.5%
cholic acid) were diluted to about 1 mg/ml and bubbled with
CO. A portion of the sample was then reduced with sodium
dithionite, and the other portion was used as a reference
solution. The spectrum was recorded from 500 to 400 nm. This
sample has a cytochrome P450 content of 1.28 nmol P450/mg
protein.









be donated by cytochrome bs in some instances (step 5).

Oxygen scission occurs (step 5), with loss of one of the

oxygen atoms to water.

Cytochrome P450s introduce oxygen into alkanes,

heteroatom-containing alkanes or t-bonded systems (step 6)

by variations on a radical type mechanism (Guengerich and

McDonald, 1990 and Koymans et al., 1993). In each case, a

radical is formed (on the substrate) either by hydrogen

abstraction or electron transfer followed by radical

recombination with a hydroxyl radical formed at the heme

site. Loss of a second hydrogen from the substrate would

form an unsaturated compound (Guengerich and McDonald,

1990). The cytochrome P450 enzymes is regenerated to the

ferric state when the hydroxylated product is released (step

1). Cytochrome P450 reductase and oxygen can be replaced

with an organic peroxide to complete the reaction (by going

to point 6 directly from point 2).

This dissertation concerns the CYP enzyme systems in

crustacea and describes the use of the Florida spiny

lobster, Panulirus argus, as an animal model. The spiny

lobster is a commercially important species in Florida due

to consumer demand of this sea food. Over 4 million Kg of

spiny lobster were harvested from the Florida Keys in 1992.

The shellfish industry represents an important fraction of

South Florida's economy. The spiny lobster offers an animal

model whose anatomy (figure 1.3) and presumably enzyme

systems are evolutionary divergent from our own and from



























1.

Fe3

P450


Monooxygenated
Substrate


2.
Fe3+
Substrate Fe

P450-Substra
Complex


NADPH NADP + I-

P450 eductase



e- Fe2+

te P450-Substrate
Complex


02


[FeO]3+ V [Fe ]+ [F O2]2+

P450-Substrate P4 Substrate P450-Substrate
Complex H20 2H Complex Complex
H20 2H+C-
6. 5. 4.
Figure 1.2. Proposed reaction mechanism for P450 mediated
oxygen activation and oxygenation of a substrate. ROOH, an
organic peroxide, can be used as an oxygen donor to
cytochrome P450.









other common animal models such as the rat or mouse. For

example, in mammals, certain cytochrome P450 genes are

inducible or upregulated by chemicals such as 3-

methylcholanthrene cytochromee P450s in the 1A gene

subfamily) and phenobarbital cytochromee P450s in the 2A, 2B

and 2C gene subfamilies), producing large amounts of the

particular cytochrome P450 protein. Fish do not undergo gene

upregulation in response to phenobarbital, but do respond to

3-methylcholanthrene by upregulating cytochrome P450 enzymes

in the 1A gene family. Crustacea do not respond to either 3-

methylcholanthrene (James, 1989) or phenobarbital (Stegeman

and Hahn, 1994).

Lobsters have been used as models in several studies.

FMRFamide-like peptides have been isolated from the American

lobster (Worden et al., 1995) and have been shown to

potentiate transmitter release in the nerve terminals to

muscle and cause muscle contraction directly. Crustaceans

have a primitive immune system, consisting of cellular and

humoral responses (Takahashi et al., 1995). Spiny lobsters

have been shown, like salmon and mole rats, to use polarity

as a means of navigation (Lohmann et al., 1995).

An intriguing reason to study the enzyme systems of the

spiny lobster is that the lobster is apparently resistance

to carcinogenesis. It is believed that crustacea do not

undergo carcinogenesis (Mix, 1986). An understanding of the

metabolic pathways, especially those leading to reactive









intermediates in both sensitive and resistant species, may

yield more insight into the mechanism of carcinogenesis.


Previous Characterization of P450 in the Spiny Lobster


The James group have characterized both phase I and II

systems in both the spiny lobster (James, 1990, Schell and

James, 1989) and in the American lobster (James et al.,

1989, Li and James, 1993).

The hepatopancreas is a fatty, digestive gland found in

all crustacea and consists of blind-ending tubules (figure

1.4). The primary function of the hepatopancreas is

secretion of digestive enzymes into the stomach and the

subsequent uptake of nutrients (Gibson and Barker,1979).

The hepatopancreas of the spiny lobster contains

cytochrome P450 in amounts comparable to those found in rat

liver (- 1 nmole P450/mg microsomal protein, James and

Little, 1980). The major site of xenobiotic

biotransformation in the spiny lobster is the

hepatopancreas, although cytochrome P450 has been detected

in the antennal gland and in the nose of this animal.

Cytochrome P450 has been partially purified from the

hepatopancreas of the spiny lobster (James,1990). Microsomes

prepared from the spiny lobster hepatopancreas contain high

levels of cytochrome P450. Solubilization of the microsomes

produces an enriched cytochrome P450 fraction termed the Ml

fraction or "red fraction" (James and Little, 1980). The red






















Pericardium


Intestine


Hepatopancreas


Figure 1.3. The anatomy of the Florida spiny lobster,
Panulirus argus. The hepatopancreas is an organ analogous to
the mammalian liver and contains large amounts of cytochrome
P450 (- 1 nmol cytochrome P450/ mg microsomal protein).









fraction can be resolved into partially purified P450s using

anion exchange, hydrophobic interaction and absorption

chromatography (James, 1990).

Reconstitution experiments using cytochrome P450

isolated from the hepatopancreas from the spiny lobster, and

substrates such as benzphetamine, progesterone, testosterone

and benzo-a-pyrene, demonstrated that the spiny lobster

cytochrome P450 is able to metabolize a diverse group of

substrates (James, 1989, James, 1990). Little activity was

reported with ethoxy- or pentoxy- resorufin, substrates

characteristically metabolized by cytochrome P450 enzymes in

the gene subfamilies 1A and 2B, or with ecdysone, the

molting hormone in spiny lobsters. (James, 1990).

The above studies were done using cytochrome P450

reductase from rat liver microsomes. To date, cytochrome

P450 reductase from spiny lobster hepatopancreas microsomes

has not been purified. Low cytochrome c reductase activity

has been detected (James and Little, 1980) in spiny lobster

hepatopancreas microsomes and hepatopancreas cytosol. The

ratio of cytochrome P450 to cytochrome P450 reductase in

mammals is in the range of 10:1 to 100:1; therefore

concentrations of cytochrome P450 reductase in the spiny

lobster may be very low. However, other artificial pathways

can be used to supply single electrons to cytochrome P450

(for example, the use of peroxides), so it is possible the

spiny lobster uses a novel pathway to pass electrons to

cytochrome P450 in vivo. Cumene hydroperoxide-dependent









































hepatopancreas. Tissues were frozen and 20 mm sections
cut. The circular structures are the blind-ending
tubules.









monooxygenation of several substrates was similar to NADPH-

dependent activity in M1 fractions (James, 1984). For

example, mollusks may use a NADPH-independent cytochrome

P450 pathway (Livingstone et al., 1989) to oxidize

xenobiotics. Another plausible reason for failure to isolate

cytochrome P450 reductase from the spiny lobster is that it

may have been degraded by digestive enzymes and bile salts

liberated during the isolation procedure (James, 1990).

Studies addressing the apparent resistance of spiny

lobster to chemical carcinogenesis have yielded some insight

into this phenomenon (James et al., 1992). Spiny lobsters

dosed with increasing amounts of the carcinogen benzo-a-

pyrene indicated a dose-dependency in DNA adduct formation.

Benzo-a-pyrene is metabolized into a reactive intermediate

which covalently binds to DNA. Interestingly, when the

southern flounder (Paralichthys lethostigma, a carcinogen

sensitive species) was fed hepatopancreas from a spiny

lobster dosed with radiolabeled benzo-a-pyrene, DNA adducts

were formed in the liver and the intestinal DNA of the fish

(James et al., 1991). These studies suggest trophic transfer

is a potential threat to consumers of this species and serve

to reinforce the use of the spiny lobster as a model system

for studying questions concerning carcinogenesis and

transfer of carcinogenic chemicals among species.










A Preview


In the following chapters, studies concerning the

structure and function of cytochrome P450 in the Florida

spiny lobster will be presented.

An antibody to spiny lobster cytochrome P450 has been

generated and used to screen microsomal fractions from other

invertebrate and vertebrate animals. The spiny lobster

cytochrome P450s seem to share epitopes with some

invertebrate and vertebrate species. There is preliminary

evidence that the cytochrome P450s in the spiny lobster

hepatopancreas may be localized to certain cell types in the

hepatopancreas.

The primary structure of one isoform of cytochrome

P450, cytochrome P450 2L1, has been determined and is most

similar to known cytochrome P450s found in rats. Hydropathy

plots reveal overall similarity in predicted secondary

structure as well. Northern blot and RT-PCR analysis

indicate that a possible alternatively spliced form of the

mRNA for cytochrome P450 2L1 may be present in the

hepatopancreas.

Cytochrome P450 2L1 was inserted into a vector and

transfected into the yeast Pichia pastoris. Upon incubation

with radiolabeled testosterone and progesterone, both intact

yeast and yeast microsomes yielded a 16C-hydroxylation

product.














CHAPTER 2
CROSS-REACTIVITY OF AN ANTIBODY TO SPINY LOBSTER P450 2L
WITH MICROSOMES FROM OTHER SPECIES


Introduction


Individual members of the superfamily of cytochrome

P450 enzymes catalyze the oxidation of a wide variety of

endogenous and xenobiotic substrates (Omura et al., 1993;

Ortiz de Montellano; 1986; Ruckpaul and Rein, 1984). Members

of one or more of the cytochrome P450 families have been

found in diverse species of both plant and animal kingdoms,

and the cytochrome P450 enzyme system is thought to be

widespread (Nelson et al., 1993). While the gene and protein

sequences of many mammalian cytochrome P450s are known

(Nelson et al., 1993), much less is known about cytochrome

P450s in fish and aquatic invertebrate species.

Fish cytochrome P450s have been cloned from rainbow

trout (Oncorhynchus mykiss cytochrome P450s 1A1, 2K1, 11A,

17 and 19) and plaice (Pleuronectes platessi, cytochrome

P450 1Al; Stegeman and Hahn, 1994). We recently cloned a

cytochrome P450 cytochromee P450 2L) from the Florida spiny

lobster, Panulirus argus (James et al., 1993). The only

other cytochrome P450 sequence that has been cloned from an

aquatic invertebrate to date is that of the pond snail

(Lymnea stagnalis, cytochrome P450 10, Nelson et. al.,









1993). Of the other invertebrate species (Nelson et al.,

1993), cytochrome P450 have been cloned from the house fly

(Musca domestic, cytochrome P450 6A1), fruit fly

(Drosophila melanogaster, cytochrome P450s 4D1, 4E1 and

6A2), butterfly (Papilio polyxenes, cytochrome P450 6B1)

and cockroach (Blaberus discoidalis, cytochrome P450 6C1).

The spiny lobster cytochrome P450 2L is the first complete

member of the cytochrome P450 2 gene family from an

invertebrate, and to date the second non-mammalian

cytochrome P450 2 gene family form.

In mammalian species, the cytochrome P450 2 gene

family is very important for monooxygenation of a wide range

of structurally diverse xenobiotics and endogenous

substrates (Omura et al., 1993; Ortiz de Montellano; 1986;

Ruckpaul and Rein, 1984; Nelson et al., 1993). Although

sequence identity of the spiny lobster cytochrome P450 2L

form with other cytochrome P450s was low, certain regions of

the primary sequence showed very high similarity to other 2

family members (James et al., 1996), suggesting that there

may be epitopes in common. Few studies have investigated the

cross-reactivity of invertebrate cytochrome P450s with

vertebrate cytochrome P450 antibodies. One study found

cross-reactivity of an anti-scup cytochrome P450 1A antibody

to microsomal fractions of the sea star, Asterias rubens

(den Besten et al., 1993). Another study found that

microsomes made from the mid-gut gland of the chiton

Cryptochiton stelleri cross-reacted with an antibody to









rainbow trout cytochrome P450s 2K1 and 1Al (Schlenk and

Buhler, 1989).

The objective of the present study was to investigate

whether an antibody to a microsomal cytochrome P450 isolated

from the hepatopancreas of the Florida spiny lobster would

cross-react with microsomal fractions isolated from

hepatopancreas and liver of other invertebrate and

vertebrate species.


Materials and Methods



Antibody Preparation


Partially purified cytochrome P450 (11.5 nmol

spectrally measured cytochrome P450/mg protein) was isolated

from microsomes prepared from hepatopancreas of the Florida

spiny lobster by ion-exchange, hydrophobic and absorptive

chromatography (James, 1990). Samples were subjected to SDS-

PAGE in one dimension (Laemmli, 1970). The major band from

SDS-PAGE (52.5 kD apparent molecular mass) was detected with

Coomassie blue dye and excised. Each gel slice contained

about 3.0 gg of cytochrome P450 as determined by difference

spectra (see below). Six micrograms of cytochrome P450 were

homogenized in 1 ml of a 50% Freunds complete adjuvant-

saline solution. The homogenate was then sheared with a 19

gauge needle. Pre-immunization serum was obtained from a

pathogen free, New Zealand White rabbit 2 weeks earlier. The









rabbit was immunized with four 0.25 ml injections along the

back. The rabbit received boosters of 6 gg of cytochrome

P450 in 1 ml of 50% Freunds incomplete adjuvant-saline every

2 weeks. A total of seven immunizations were given, with

detectable titers (as detected by Western blotting)

beginning after the third injection.


Microsome Preparation


The fish and invertebrates used in these studies (see

table 2.1) were locally caught, adult feral species of

either sex, with the exception of the channel catfish. The

channel catfish (Ictaluris punctatus) were obtained from the

LSU aquaculture facility and were 800+/-100 g body weight.

The rats were male, Sprague-Dawley strain, and were 200+/-20

g. The phenobarbital-induced rats were pretreated with 80 mg

phenobarbital/kg i.p. for 4 days before sacrifice on the

fifth day. Microsomes were prepared as described previously

(James, 1990). Briefly, tissues were removed from the animal

and homogenized in 0.05 M potassium phosphate (pH 7.4),

1.15% KC1, 0.1 mM EDTA, 0.2 mM PMSF. The homogenate was

centrifuged at 13,000g and the supernatant centrifuged at

176,000g to pellet the microsomes. Solubilized microsomes

(Ml fractions) were isolated from the invertebrates by

stirring the microsomes at 40C for 1 h in buffer containing

0.01 M potassium phosphate (pH 7.6), 20% v/v glycerol, 0.5%

w/v sodium cholate, 0.1 mM EDTA, 0.1 mM dithiothreitol, 0.2










mM PMSF (1 ml buffer/g wet weight hepatopancreas) and

centrifuging at 176,000g for 90 min. Protein contents were

determined by the method of Lowry et al. (1951).

Concentrations of cytochrome P450 in the samples were

determined by CO difference spectra (see table 2.1)

(Estabrook et al., 1972).


Western Blots


Samples of microsomal protein, 200 gg, were subjected

to SDS-PAGE on 4%-8.5% discontinuous gels in a Protean II

apparatus (BioRad). Proteins were electro-blotted onto

nitrocellulose using a Tris-glycine-methanol buffer system

(25 mM Tris base, 192 mM glycine, 20% v/v methanol). After

the transfer, the membranes were blocked in 3% gelatin-TBS

(Tris-buffered saline, 20 mM Tris, 500 mM NaC1, pH 7.5) for

1 h. The primary antibody (1:200 in 1% gelatin-TBS-0.05%

Tween-20) was applied for 2 h and secondary antibody (Biorad

goat-anti-rabbit alkaline phosphatase, 1:3000) was applied

for 1 h. Detection was by color development with 5-bromo-4-

chloro-3-indolyl phosphate and nitro blue tetrazolium

(BioRad).


Immunocytochemistry


Hepatopancreas was fixed overnight in Zamboni's

fixative (2% Paraformaldehyde and 0.15% picric acid in 0.1 M

potassium phosphate, pH 7.4). Tissues were then subjected to









increasing concentrations (0,10,20 and 30% (w/v)) of sucrose

(w/v) in PBS (phosphate buffered saline, 20 mM potassium

phosphate, pH 7.4, 500 mM NaCI) for 2 h at each

concentration, allowing the tissues to remain in 30% sucrose

in PBS overnight. Tissues were frozen in O.C.T compound (10%

(v/v) polyvinyl alcohol and 4% (v/v) polyethylene glycol,

Miles Inc.) and sectioned (20 pm) on a cryostat. Sections

were blocked in 1.0% (w/v) normal goat serum for 30 min.

Sections were washed once for 15 min in PBS and incubated

for 1 h with the primary antibody (1:50 in PBS/1% normal

goat serum). Sections were washed (2 X 15 min) in PBS and

the secondary antibody (goat-anti-rabbit fluorescein

isothiocyanate, 1:50) applied for 1 hr. Slides were viewed

with a fluorescent microscope.


Results and Discussion


Studies of the immunological relationships between

cytochrome P450s in aquatic species have mostly been done in

fish. We isolated microsomes from representative species in

both the cartilaginous and bony fish classes and in the

class crustacea. Table 2.1 list the systematics of the

species we screened with the anti-spiny lobster cytochrome

P450 antibody.

As expected, anti-spiny lobster cytochrome P450

antibody consistently cross-reacted with microsomal

fractions, solubilized fractions (Ml) and partially purified









cytochrome P450 from the hepatopancreas of the spiny

lobster. Three bands were usually detected, at high

molecular mass (not shown), at 52.5 kD (figure 2.1 and

figure 2.2) and at 30 kD (not shown). We have Northern blot

and RT-PCR evidence for what appears to be a splice variant

of about 1.5 kb of cytochrome P450 2L (James et al., in

preparation), and the 30 kD immunoreactive band may either

represent the translated product of this cytochrome P450 2L

truncated message, or perhaps is a breakdown product of

cytochrome P450. Under conditions used in this study,

cytochrome P450 2L can be detected at 0.05 pmol/lane.

With hepatopancreas microsomal preparations from the

other invertebrates studied, immunoreactivity at a similar

molecular mass to that of the spiny lobster cytochrome P450

was detected with the slipper lobster (figure 2.1 and figure

2.2). This lobster is in the same infraorder as the spiny

lobster. Cross-reactivity at higher molecular mass was

detected with samples from the American lobster, but there

was no detectable cross-reactivity with the other

invertebrate samples studied (figure 2.1 and figure 2.2).

Many factors effect the cytochrome P450 levels in marine

invertebrate species (Stegeman and Hahn, 1994). Failure to

detect immunoreactive proteins may be due not only to lower

levels of overall cytochrome P450 contained in the

hepatopancreas or digestive gland of the invertebrates

studied, but may also be related to differential expression

of a particular cytochrome P450 isoform.













Table 2.1
Classification and cytochrome P450 Contents of Hepatic Preparations
of the Species Studied

Classification cytochrome P450
content
(nmol/mg protein)
Phylum Arthropoda
Subphylum Chelicerata
Class Xiphosura
Limulus polyphemus, the horse shoe crab' 0.41
Subphylum Mandibulata
Class Crustacea
Order Decapoda
Suborder Dendrobranchiata
Infraorder Penaeidea
Superfamily Penaeoidea
Family Penaeidae
Penaeus aztecus, the brown shrimp' 0.10
Suborder Pleocyemata
Infraorder Palinura
Superfamily Palinuroidea
Family Palinuridae
Panulirus argus, the Florida spiny lobster' 1.30
Family Scyllaridae
Scyllarides nodifer, the slipper lobster' 0.06
Infraorder Astacidea
Superfamily Nephropoidea
Family Nephropidae
Homarus americanus, the American lobster2 0.91
Infraorder Brachyura
Superfamily Portunoidea
Family Portunidae
Callinectes sapidus, the blue crab' 0.33
Phylum Chordata
Class Chondrichthyes
Order Rajiformes
Family Rajidae
Raja eglanteria, the clear-nose skate' 0.53
Class Osteichthyes
Order Siluriformes
Family Ictaluridae
Ictalurus punctatus, the channel catfish' 0.23
Order Atheriniformes
Family Cyprinodontidae
Fundulus heteroclitus, the killifish' 0.36
Order Perciformes
Family Centropomidae
Centropomus undecimalis, the snook3 0.18
Class Mammalia
Order Rodentia
Family Muridae
Rattus rattus, control Sprague-Dawley rat' 1.10
phenobarbital-induced rat' 1.80

IMicrosomes prepared from fresh liver or hepatopancreas. Fractions prepared from
fresh hepatopancreas. 'Microsomes prepared from frozen livers.









Hepatic microsomes from the one member of the

chondrichthyes class that were screened, the clear-nose

skate, cross-reacted with the spiny lobster anti-cytochrome

P450 antibody (figure 2.2).

Hepatic microsomes from all of the bony fish studied

cross-reacted and gave signals in the 45-66 kDa region, with

the strongest signals from the killifish microsomal samples

followed by the catfish (figure 2.1 and figure 2.2). In

other experiments with different microsomal preparations

from the clear-nose skate and the snook, stronger signals

were observed than those shown in figure 2.1 (figure 2.2).

An antibody to rat cytochrome P450 2B1 and one to scup

cytochrome P450 2B have been shown to cross-react with

microsomes from the killifish, the little skate and the

channel catfish (Stegeman and Hahn, 1994).

Microsomal fractions from control and phenobarbital-

induced rats showed cross-reactivity to anti-cytochrome P450

2L in the 45-66 kDa range (figure 2.1 and figure 2.2).

Interestingly, of the cytochrome P450s available in the data

bank for comparison, cytochrome P450 2L shows the most

similarity to the rat cytochrome P450 2D4.

These results suggest that cytochrome P450 in the spiny

lobster hepatopancreas may share similar epitopes with

cytochrome P450s in the slipper lobster, and possibly the

American lobster, but that other invertebrates screened for

cytochrome P450s with similar epitopes were possibly not

present or were present in amounts below the limit of

















A

kD

66.2 -


45.0


B
kD
66.2 -


1 2 3 4 5 6










7 8 9 10 11 12 13


45.0 -


Figure 2.1. Western blots of microsomes from several
species, probed with anti-spiny lobster P450. In each
lane, 200 gg of protein was loaded. Lane 1, blue crab;
2, American lobster; 3, slipper lobster; 4, spiny
lobster; 5, brown shrimp; 6, horse-shoe crab; 7, spiny
lobster; 8, clear-nose skate; 9, catfish; 10,
killifish; 11, snook; 12, control rat; 13,
phenobarbital-induced rat. The migration of molecular
mass markers 45 and 66.2 is shown.























4 5 6 7 8 9 10 11 12 13


52.5 kDa-





Figure 2.2. Composite picture of various Western blots
done with invertebrate and vertebrate microsomal
fractions. Arrow point to the spiny lobster cytochrome
P450 at an apparent molecular mass of 52.5 kDa. Lane 1,
female spiny lobster M1 fraction; 2, slipper lobster
microsomes; 3, American lobster Ml fraction; 4, blue
crab M1 fraction; 5, brown shrimp microsomes; 6, horse-
shoe crab M1 fraction; 7, clear-nose skate microsomes;
8, snook liver microsomes; 9, catfish liver microsomes;
10, killifish liver microsomes; 11, empty lane; 12,
control rat liver microsomes; 13, phenobarbital-induced
rat liver microsomes.










detection. In vivo studies have shown that the American

lobster and the spiny lobster metabolize benzo(a)pyrene very

differently. Very slow cytochrome P450-dependent

monooxygenation of benzo(a)pyrene occurs in the American

lobster, but rapid monooxygenation of benzo(a)pyrene in the

spiny lobster (James and Little, 1980). These differences

probably reflect the cytochrome P450 composition of

hepatopancreas in the two species. It would be important to

isolate microsomes from other crustacea in the suborder

Pleocyemata and to determine if these cross-react with the

cytochrome P450 antibody to the spiny lobster form.

However, even with spiny lobster microsomes, the level

of cross-reactivity may be related to the molting stage of

the animal. Our laboratory has found wide variation in

cytochrome P450 content in the hepatopancreas of the spiny

lobster, and variations such as these may well affect

attempts at quantification using Western blot techniques. As

is apparent by examination of table 2.1, different amounts

of cytochrome P450 were present for electroblotting. It is

possible that some samples had levels of immunoreactive

cytochrome P450 below the detection limit. Nevertheless,

this antibody may be used to screen an expression library

from the slipper lobster or other species which demonstrate

cross-reactivity. Such heterologous probes are very valuable

where information about the primary sequence of the target

protein is unknown.









The spiny lobster antibody also cross-reacted with

microsomes from cartilaginous and bony fish and from rat.

Why these species would share an epitope with the spiny

lobster is unknown, but may be related to the incidence of

expression of the cytochrome P450 2 family. Immunlogical

relationships and other molecular data relating to

invertebrates will not only provide insight into the

phylogenetic relationships of invertebrates, but can serve

as out-groups in phylogenetic analysis of mammalian systems

(Nei, 1987).

The hepatopancreas of crustaceans is composed

principally of four cell types: the E (Embryonalenzellen=

embryonic), R (Restzellen= absorption), B (Blasenzellen=

proteases) and F (Fibrillenzellen= peroxidases; Gibson and

Barker, 1979). Immunocytochemical studies of the spiny

lobster hepatopancreas seem to reveal a defined distribution

pattern for cytochrome P450 (figure 2.3). Immuno-reactivity

appears to be localized in particular cells lining the

hepatopancreas. Furthermore, the reactivity appears to be

localized at the basal end of the cell. What functional

significance this localization may serve in vivo is unknown.

We can not at present identify the cell type or types in the

hepatopancreas that immuno-react with the spiny lobster

anti-cytochrome P450 antibody.



















































Figure 2.3. Twenty micrometer cryo-sections of spiny lobster
hepatopancreas. Sections were incubated with cytochrome P450
2L antibody and stained with an FITC-linked secondary
antibody. The lighter areas are cytochrome P450 in the spiny
lobster hepatopancreas and seem to localize in apical cells.















CHAPTER 3
cDNA AND PROTEIN SEQUENCE OF A MAJOR FORM OF P450, CYP2L, IN
THE HEPATOPANCREAS OF THE SPINY LOBSTER, PANULIRUS ARGUS


Introduction


Cytochrome P450s are a superfamily of important

monooxygenase enzymes that are found in many animal and

plant species of varying biological complexity (Nelson et

al., 1993). The major function of these enzymes is to

introduce oxygen into, or remove hydrogen from, an organic

substrate of either endogenous or exogenous origin, usually

increasing the hydrophilicity of the substrate and altering

its pharmacological or physiological activity (Guengerich

and Shimada, 1991). The monooxygenation of xenobiotics is

usually catalyzed by members of cytochrome P450 families 1-

4. The protein structure of individual members of the

cytochrome P450 superfamily, as it is related to catalytic

function, is an active current area of research.

Considerable advances have been made in deducing the amino

acid sequences and further structural details of bacterial,

fungal, and some mammalian cytochrome P450s (Ortiz de

Montellano, 1986; Gonzalez, 1990), but very little sequence

or structural information has been published for these in

nonmammalian animals (Nelson et al., 1993; Stegeman and

Hahn, 1994). The few invertebrate cytochrome P450 cDNA and










deduced amino acid sequences known fall into the families 4,

6, and 10 and include the neotropical cockroach, Blaberus

discoidalis (Bradfield et al., 1991), the fruit fly,

Drosophila melanogaster (Nelson et al., 1993), the house

fly, Musca domestic (Cohen et al., 1994), and the pond

snail, Lymnea stagnalis (Nelson et al., 1993). No cytochrome

P450 sequence information is available for crustacean

species. Obtaining sequence information from divergent

species may help to further characterize the phylogeny of

this enzyme superfamily, which probably arose from the

duplication of an ancestral gene (Nelson et al., 1993;

Stegeman and Hahn, 1994; Nelson and Strobel, 1987; Nebert

and Gonzalez, 1987; Nebert et al., 1989). Such an ancestral

gene may have had a very broad substrate pool and paralogues

might have evolved more specific substrate selectivites

(Nelson and Strobel, 1987).

This report concerns cytochrome P450 found in the

hepatopancreas, or digestive organ, of the spiny lobster,

Panulirus argus. The spiny lobster hepatopancreas cytochrome

P450 system has some interesting features (James and Little,

1984; James, 1989; James, 1990). Although microsomes

isolated from the hepatopancreas contain high concentrations

of spectrally measured cytochrome P450 (comparable to or

somewhat higher than cytochrome P450 concentrations found in

hepatic microsomes from control rats), no conclusive

evidence has yet been obtained for the presence of an NADPH-

cytochrome P450 reductase in spiny lobster hepatopancreas










microsomes, although low cytochrome c reductase activity is

present (James, 1989). The lack of measurable NADPH-

cytochrome P450 reductase may be because any cytochrome P450

reductase present undergoes proteolysis during the

preparation of microsomes (James, 1990). It has not been

possible to measure NADPH-cytochrome P450 reductase in spiny

lobster hepatopancreas microsomes by immunological methods,

as these microsomes do not contain any proteins which cross-

react with an antibody to rat or rabbit NADPH-cytochrome

P450 reductase (unpublished observations).

Additionally, there is no evidence that spiny lobster

cytochrome P450s can be induced by treatment with polycyclic

aromatic compounds, although polycyclic aromatic compounds

are rapidly metabolized by the spiny lobster (James and

Little, 1984; and James, unpublished observations).

In previous studies, a spiny lobster fraction (given

the trivial designation DI) was partially purified from

hepatopancreas microsomes by chromatography and the

catalytic activities of this cytochrome P450 with

benzphetamine, ethoxycoumarin, aminopyrine, testosterone,

progesterone, benzo(a)pyrene and resorufin ethers were

measured in the presence of rat NADPH cytochrome P450

reductase (James, 1990). The present paper reports a 39

amino acid N-terminal sequence of the cytochrome P450

protein found in the Di fraction and the sequence of a CYP

cDNA cloned from hepatopancreas mRNA by polymerase chain










reaction (PCR) techniques, using primers to this N-terminal

sequence.


Materials and Methods



Isolation of cytochrome P450 Samples for Sequence Analysis


A partially purified cytochrome P450 Di fraction (11.5

nmol spectrally measured cytochrome P450/mg protein) was

obtained from spiny lobster hepatopancreas microsomal

fractions by ion-exchange, hydrophobic, and absorption

chromatography as described previously (James, 1990).

Duplicate samples of the DI preparation were subjected to

SDS-PAGE in one dimension by the method of Laemmli (Laemmli,

1970), as shown in figure 3.1. One gel was stained with

Coomassie blue and analyzed densitometrically (ISCO Model

1312) to determine the percentage of protein in each band.

The major band, at molecular weight 52,500 (see figure 3.1),

was examined for sequence analysis.

Proteins were then electrophoretically transferred from

an unstained gel to an Immobilon PVDF (polyvinylidene

fluoride) membrane (Millipore, Bedford, MA) in the Towbin

buffer system (Towbin et al., 1979). Proteins were localized

on the PVDF membrane by Coomassie blue staining and the

membrane stored at -200C until sequencing. N-terminal amino

acid sequence analysis was carried out at the University of

Florida Protein Chemistry Core facility in the










Interdisciplinary Center for Biotechnology Research (ICBR).

The band of molecular mass 52,500 daltons from the PVDF

membrane (about 4.5 gg protein) was applied to an Applied

Biosystems Model 470A gas-phase protein sequencer with an

on-line analytical HPLC system. The peptide sequence data

was compared with sequences present in the Genetics Computer

Group (GCG, Madison, WI) protein database, using FASTA

computer programs (Dayhoff et al., 1983; Devereux et al.,

1984; Pearson and Lipmann, 1988), as well as the National

Center for Biotechnology Information (NCBI), using the BLAST

network service.


Preparation of RNA, mRNA, and cDNA


The hepatopancreas from a male spiny lobster was

removed and a l-g sample was homogenized in a guanidine

isothiocyanate-containing buffer following the methods of

Chirgwin et al. (Chirgwin et al., 1979). Total RNA was

isolated by centrifugation through a CsC1 cushion.

Polyadenylated RNA was fractionated using an oligo(dT)

affinity push column (Stratagene Cloning Systems, La Jolla,

CA). The mRNA, 5 jg, was incubated with reverse

transcriptase (1000 units, AMV, Life Technologies) in the

presence of 500 pm dATP, dCTP, dGTP, and dTTP (dNTP mix), 50

mM Tris-Cl, pH 8.3, 75 mM KC1, 3 mM MgC12, 10 mM

dithiothreitol, and 1 gg Not I primer/adapter (Life

Technologies, Inc., Gaithersburg, MD) in a total volume of









20 Ri (Okayama and Berg, 1982; Gubler and Hoffman, 1983).

After incubation at 420C for 80 min, the reaction mixture

was placed on ice. A sample, 18 Il, was added to 25 mM Tris-

Cl, pH 7.5, 100 mM KC1, 5 mM MgC12, 10 mM ammonium sulfate,

0.15 mM P-NAD', 0.25 mM dNTP mix, 1.2 mM dithiothreitol, 10

units of Escherichia coli DNA ligase, 40 units E. coli DNA

polymerase I, and 2 units E. coli RNAse H in a total volume

of 0.15 ml. After incubation at 160C for 2 h, 10 units of T4

DNA polymerase was added and the incubation continued for 5

min at 160C. The resulting blunt-ended cDNA was extracted

with an equal volume of phenol:chloroform:isoamyl alcohol,

25:24:1. The DNA in the aqueous phase of the extract was

precipitated by the addition of one-half vol of 7.5 M

ammonium acetate and 2 vol of ice-cold ethanol. The blunt-

ended cDNA was ligated to a Sal I adapter by incubating, in

a 50 il volume, with 50 mM Tris-Cl, pH 7.6, 10 mM MgC12, 1

mM ATP, 5% polyethylene glycol 8000, 1 mM dithiothreitol, 10

ig Sal I adapter, and 5 units T4 DNA ligase for 16 h at

160C. The cDNA in the reaction mixture was extracted and

precipitated as above. The cDNA was then incubated with 50

mM Tris-Cl, pH 8.0, 10 mM MgC12, 100 mM NaC1, and 1200

units/ml Not I endonuclease in a final volume of 0.05 ml for

2h at 370C. The cDNA was isolated as before and size-

fractionated on a Sephacryl-500 HR column. High-molecular

weight cDNA was ligated into Xgt22a using the Lambda

Superscript System (Life Technologies, inc.).









cDNA Library Screening


Degenerate primers HT23 and HT24 were designed against

the N-terminal sequence data derived from sequencing the

52,500 band of the Di fraction (see table 3.1).

The sequences of these primers, and other important

primers used, are shown in table 3.2. Using primers HT23 and

HT24 in a polymerase chain reaction (PCR)(Compton, 1990),

clone II was isolated. The relationships of the different

clones obtained to each other, and to the sequence of the

target cytochrome P450, are shown in figure 3.2. Clone II

was 117 base pairs and coded for 39 amino acids which

differed only by one residue from the N-terminal sequence of

the isolated cytochrome P450 in the Di fraction. Clone I was

then generated using an exact primer, HT26, obtained from

clone II and a vector primer to the 5' end of Xgt22a. Clone

I contained base pairs 1 to 93 of the target cytochrome

P450. Clone IV, which coded for 851 base pairs, was

generated using an exact primer, HT25, obtained from clone

II, and a vector primer to the 3' end of Xgt22a. Clone III,

which represents a cDNA corresponding to all of the coding

region of the mRNA of this cytochrome P450, was isolated

using HT23 and MJ10, primers derived from exact sequence

data in clone V (table 3.2). Clone VI was obtained using

this primer set, but represents an incomplete clone. All

coding regions of the target cytochrome P450 were

represented by at least three independent clones and all









clones were sequenced at least twice. In this manner, a

consensus sequence was obtained. The PCR tubes contained the

following: 5 gl cDNA library in 10 mM MgSO4 (2.9 X 1010

plaque-forming units/ml), 10 il of PCR buffer (500 mM KC1,

100 mM Tris-Cl, pH 8.4, 15 mM MgCl2, and 1 mg gelatin/ml), 1

gl of a solution containing 20 mM dNTP mix, and 100 pmol

each of the degenerate primers or 30 pmol each of

nondegenerate primers. The volume was made up to 99 1l with

sterile, deionized water and the reaction tubes were heated

at 940C for 5 min. Taq DNA polymerase (5 units, Promega,

Madison, WI) was then added for a final volume of 100 gl and

the reaction tubes were heated and cooled for 35 cycles

under the following temperature regime: 940C for 1 min

denaturingg), 510C for 2 min (annealing), and 720C for 3 min

(elongating). A final 10-min extension period at 720C was

included.


Cloning and Sequencing of PCR Products


PCR products were cloned into pGEM-T (Promega) and used

to transform competent JM109 cells. Plasmid templates were

prepared for sequencing using the Wizard Mini-Prep system

(Promega). Manual dideoxy sequencing was done using the

Sequenase Sequencing Kit (USB, Cleveland, OH). Additional

sequencing was done by the ICBR Sequencing Core located at

the University of Florida.










RT-PCR Experiments


Total RNA was isolated from the spiny lobster

hepatopancreas as described above. Ten micrograms of RNA

were used in the following reaction: 100 pmol of an oligo dT

primer to a final volume of 6 gl diethylpyrocarbonate-

treated water. The mixture was heated at 650C for 10 min and

then placed on ice. To this mixture was added 2 jl of PCR

buffer, 1g1 of 20 mM dNTP mix, 1 gl of RNase inhibitor

(Rnasin, Promega, Inc.), 1 1 of Superscript Reverse

Transcriptase (200 units, Life Technologies, Inc.) and the

reaction volume brought up to 20 il with DEPC water. The

reaction mixture was incubated at 420C for 2 hours. Portions

of this reaction, 1 l1, were used in the PCR reaction using

primers HT23 (figure 3.2, 100 pmol) and oligo dT (100 pmol)

under the reaction conditions described above, but with the

annealing temperature of 450C. A portion of the PCR product,

1 gl, was then nested using primers HT25 and MJ11 with an

annealing temperature of 510C.


Northern Blot Analysis


Ten micrograms of RNA isolated from the hepatopancreas

of the spiny lobster were denatured following the methods of

McMasters and Charmichael (1977). After electrophoresis in

1.1% agarose/ 10 mM sodium phosphate buffer, pH 7.0, the RNA

was transferred using a vacuum blotter to a .45 Jpm Magna










nylon membrane (MCI, Westborough, MA) using a vacuum

blotter. The membrane was probed with a 32P-dCTP labeled PCR

product corresponding to the first 705 base pairs of CYP2L.

This probe was labeled by random prime labeling (Pharmacia

oligo labeling kit). RNA in the blots was hybridized by

incubating in a solution containing 0.75 M NaC1, 0.05 M

NaH2PO4H20, 0.005 M EDTA, 0.1 mg/ml herring sperm DNA, 0.1%

SDS for 12 hrs at 680C. The membrane was washed three times

at 680C in 0.025 M NaC1, 0.001 M NaH2PO4H20, 0.1 mM EDTA and

exposed with intensifying screens to X-ray film for at least

12 hrs at -800C.


Results and Discussion



N-Terminal Sequence of Spiny Lobster cytochrome P450


One-dimensional SDS-PAGE showed that the Di preparation from

spiny lobster hepatopancreas microsomes contained a major

protein band of 52,500-Da and some minor bands (figure 3.1).

Densitometric analysis of the Coomassie blue-stained

bands (not shown) showed that the 52,500-Da bands accounted

for 80% of the protein in the Di fraction. Microsequence

analysis of about 5 gg protein from the 52,500-Da band in

the Di preparation showed that this band accounted for 75%

of the total protein. This peptide was sequenced through

residue 39 (table 3.1).




















1" 2 ::/
.:lk'd5L1 *-"&"si'


Figure 3.1. SDS-PAGE of the spiny lobster cytochrome
P450-containing fraction stained with Coomassie blue.
Lane 1, molecular weight standards. Lane 2, DI fraction,
11.5 nmol cytochrome P450/mg protein. The 52,500-Da band
was shown by densitometry to contain about 80% of the
total protein in this fraction.






























Table 3.1.
The N-Terminal Amino Acid Sequences in a
cytochrome P450-Containing fraction' Isolated from Spiny Lobster
Hepatopancreas Microsomes

Sequence Residues identified by microsequencingb

Major MLTGALLLLL VVVIVYLLDK KPSGLPPGIW GWPLVGRMP

Minor' (T)WIK(K)V(L)AM

a The cytochrome P450-containing fraction (Di
fraction) was isolated from spiny lobster
hepatopancreas microsomes as described previously
(James, 1990). The predominant protein band in this
fraction, of mol. wt 52,500 on one-dimensional SDS-PAGE
(see figure 1.3), was used for microsequencing.
b About 40 pmol was submitted for microsequencing as
described under Methods. The overall repetitive yield
was 94%. Parentheses indicate ambiguous amino acid
assignments in the minor sequence.
c The major sequence shown accounted for 75% of the
total protein in this band (30 pmol in the sample
sequenced). The minor sequence in the 52.5 kD DI band
accounted for 20% of the protein (8 pmol). The identity
of this protein is not known.









Partial N-terminal sequence information was obtained

for a minor peptide in the 52,500-Da band (table 3.1).

The first 39 amino acids obtained from N-terminal

sequencing of the 52,000-Da major band in the D1 preparation

included hydrophobic amino acids characteristic of membrane-

bound proteins (Black, 1992).

Comparison of this N-terminal sequence to the N-

terminal sequences of other proteins in the GCG database

revealed similarities to several mammalian cytochrome P450s

in the 2 family (Philips et al., 1983; Labbe et al., 1988;

Ueno and Gonzalez, 1990) and similarities to short stretches

of the N-terminal sequences of cytochrome P450s in the 1,3,

and 4 families (Kawajiri et al., 1986; Hardwick et al.,

1987; Aoyama et al., 1989). From the spectrally measured

cytochrome P450 content of DI (11.5 nmol/mg), the

calculated specific content of a pure cytochrome P450 of

molecular mass 52,500 Da (19 nmol/mg), and the percentage

of protein in the 52,500-Da band (80%), we would expect 76%

of the protein in the Di fraction to be cytochrome P450.

This number matched well with the observed value for the

major component of the Di preparation (75%) and provided

confidence that the 39 amino acid N-terminal sequence was

that of a cytochrome P450 from the spiny lobster

hepatopancreas.


































Table 3.2.
Sequence of some of the Primers Used to Obtain the cDNA Clones

Primer Sequence Type and Location
name


HT23 ATG (CT)TI ACI GGI GCI (CT)TI (CT)TI (CT)T
HT24 GGC ATI C(GT)I CCI ACI A(AG)I GGC CA
HT25 TTG CTG CTG GTG GTA ATA GTC TAC
HT26 TCC CCA TAT ACG TGG GGG AAG TCC
HT36 GTC AAG AAC TGG ATG GGC
MJ10 TGT CAG GAG TGG AGT TAT

Sa.a, amino acid


Degenerate, a.a' 1-8
Degenerate, a.a 39-32
Exact, a.a 9-16
Exact, a.a 31-24
Exact, a.a. 224-230
Exact, 3' to stop codon










cDNA Sequence


Degenerate primers were designed that corresponded to

regions of the 39 N-terminal amino acids of the D1

preparation. The sequences of the degenerate primers and

other selected primers used are shown in table 3.2.

The degenerate primers were used to PCR screen a spiny

lobster cDNA library. The process was repeated with exact

primers to obtain further cDNA sequences. A new exact primer

was required about every 200 base pairs. Sequences obtained

were melded to form a complete sequence (figure 3.2).

A separate clone which coded for all of the cytochrome

P450 sequence was obtained using primers HT23 and MJ10 (see

figure 3.2). This sequence has an open reading frame of 492

amino acids (calculated Mr of 56,669) and contains the heme-

binding signature, residues 429 to 438, that is conserved in

all CYPs (figure 3.3). The individual amino acids that are

invariant in all known cytochrome P450s are highlighted in

figure 3.3 with double underlining. The deduced amino acid

sequence of this clone differs by 1 amino acid in the first

39 amino acids from the microsequenced D1 peptide. Residue

11 of the clone was found to be leucine and not valine, as

in the peptide. Comparison of the deduced 492-amino acid

cytochrome P450 sequence with other protein sequences using

the BLAST program showed that the sequence was highly






















HT23 MJ10
180 360 540 720 900 1080 1260 1470,1530
I 1 1 I I1 I I I CYP2L

Clone I
Clone II
Clone III
Clone IV
Clone V
Clone VI
Figure 3.2. Cloning strategy showing the clones used to meld
together a full-length cDNA sequence. The primers HT23 and
MJ10 shown were used to generate a single clone (clone III)
representing the entire coding portion of the mRNA. The
sequence of these primers are shown in table 3.2.















ATGCTGACGGGGGCGCGCTTTTATTGCTGCTCGGTGTAATAGTCTACCTCCTCGACAAG CCATCAGGA


CTTCCCCCA


CTTAAGCAAC
LPP

GTTOAA0CAC
V K Q

TGCAACTTCA
C N F
CNhF

AAGCTTTTT
K L F
TTTATTCTA
F I L

GCCTGCCTGF
A C L
ACL

GTTCTCAAC
V L N

ACTCAGCTT
T Q L
TOL

CTTTTGATGJ
L L M

TTGAAGATT
L K D

TTGGACGCCT


G A L L L
GALLL

GTATATGGGGATGG
G I V G W

:TGCGTAAAAAGTA
L RK K Y

AATTGGTTAAGACG
K L V K T
KLVKT

GGAAGGCAACGAT
GE G N D

GCCAGCTAGGGAC
R 9 L R D

GTGCAGGACTGAA
V Q E L K
VQKEL(

TGATTTGGAAGCTT
VI W K L

TCACTACCACCACA
L T T T T

ATCACCCCAGACTTT
I T PD F

ACATGK TTTC
Y M K T F

ACCTGATAGATTTG
Y L I D L


CCACTGGTGGGU
PL V G

GGCGACATCAA
G D I I

GCTCTGTCCAAG1
ALKS
A L S X

GTTGGTGTCGTC
V G V V


L G M G


K H T D

GTTGCAGATCACC
V A D H

GACAACATGCAG<
D N M Q

GTCAAGAACTGG
V K N V

ATCAAGGAGCACC
I K E H

CAAGAGCGCAAU


VIVYLLD

OAiTGCCCTCGAGGTCAA
R P 3 R K

kCGTGGCGCATCGGAACCAGA
T W R I G T

TTCGATGCTCAGACAACCA
FECSDRP

CAGTTTT GG GA0420
F S H G V X V

AAGTCCAGACTGGAGGCC
K 5S R L E AA

CACCATGCCCCTACCAAAG
OPMPLPK
a P M P L P K

:GGTATTCGCTTCGATCAA
R Y SL 0 D

iGCTTTGCTTTGMCCTCTTC
GFALILY

TGGGCGTTAGGGTACTACGA
H G VR V L

AGGCCACGCTGGACCCGTCA
SA T L D P 5

PiAGTCCTCTCTCCACATG
E D P L S T


CATCTGG
H L

GTCAAT
V N

GrCTTCT
D F

-ACACGC
0 T

ATCCAGC
I Q

TCCATAI
SI

,AGGGTC
B G

AACTACC
N Y

GACGGG
D G

APCCCA
N P

qARCATTe


PSG

CCGRCCAG
AD o

GTATTCCTT
V F L

TACACtTTC
Y T F


HAR
CrGTCGC





kATAGCTT



Q Y F

TACCGTGG
L P W
LPV

TCTGCGAG
V C I
VCH

AGGACTTA
K D L

GAAACCGTT
ST V


CGAGCCGTGATCATGGACCTGTTTGGCGCTGGTACCGAACCACTTCACATGATACGATGGACATTCTC 936
R A V I M D L F G A G T Z T T 5 T H I R W T r L 312

TATTTGATGAAGTACCCCGAGGTGCAGGCCAGATMCCAGAAGA GAGATCGCCGTCCCTAGGCAC 1008
Y L M K Y P E V Q A K I 0 R E I D A A V P R G T 336

TTACCCTCTCTCGAACACAAGGATAAGTTGGCGTACTTTGAGGC CGATCCACGAGGCACCGCATTGTG 1080
L P S L E H K D K L A Y F K A T I H I V H A I V 360

TCTCTTGTTCCGCTTGGTGTATCCCACTACACCAACCAAGATACCGACTCGCCGGCTACAGACTTCCCAAG 1152
3 L V P L G V S H Y T H 0 D T Z L A G Y R L P K 384

GGGACGTGGTGATG0ATCATCTAGAGTTTCCACAGAGACCCAGTTACTGGG AGACCTA 1224
G T V V M S H L 0 C C H R D P S Y 1 8 K P N E F 408

TACCCGGAACATTTCCTGGACGACACGGGCAAACGTCAAG MCACCGTCAATCTCTTA 1296
Y P E H F L D D Q G K F V K E H L V N t V G 432

CGCCGGGTATGGTTGGGCGAGTCTCTGGCCAGGATGGAGCTCTTCGTCTTCCTGTCGGCGATACTGCAGAC 1366
R R V C V G E S L A R H L F V F L S A I L 0 Q 456

TTCACCTTCTCGGCCCCTAAGGGAGAGGTTGC ACACTGAGAAACCCGACAAATGCTATTCTCTTTT 1440
F T F S A P K G E V L H T E K D P Q Q H L F S F 40

CCCAAGCCCTATCAAGTTATATCAGGAGAG TAGTGTTCCTTTGAACCAGGM GCAACTCC 1512
P K P Y O V I I R E R E 492

ACTCCTGACATTTGGCAGTATAACAAGTTGATGTCCATTCTTGTAACTTATACTG TCATTSGBTACTGG 1584
ATGATA 1590


Figure 3.3. Nucleotide and deduced protein sequence of the spiny lobster
cytochrome P450, CYP2L. The open reading frame of 492 amino acids
defines a protein with a calculated molecular mass of 56,669 Da. The
heme-binding signature is underlined and invariant amino acids in all
known cytochrome P450s are bold and double underlined.











similar to cytochrome P450s in the 2 family but not to any

non-cytochrome P450 sequences. Rat CYPs 2B1, 2B2, and 2D4

were all 36% identical at the amino acid level to the spiny

lobster sequence. While several studies have shown the

catalytic activity of a cytochrome P450 is not necessarily

indicative of a particular cytochrome P450 family, it was of

interest that previous reconstitution experiments with the

Di cytochrome P450 showed good activity with substrates

commonly monooxygenated by cytochrome P450s in the 2B

family, such as testosterone (63 and 16a), progesterone

(16a), benzphetamine, and aminopyrine (James, 1990; James

and Shiverick, 1984).

Although the overall sequence identity of the spiny

lobster cytochrome P450 with cytochrome P450s in the 2

family was less than 40%, this new form was assigned to the

2 family by the CYP nomenclature committee and given a new

subfamily name, CYP2L.

Because the N-terminal sequence of the CYP2L described above

was 1 amino acid different from the cytochrome P450 sequence

in the DI fraction, obtained by microsequencing of the

protein, the spiny lobster hepatopancreas cDNA library was

rescreened by PCR with an exact probe to the N-terminal

sequence. Other positive clones were obtained and have been

partially sequenced. The deduced N-terminal amino acid

sequence of one of these clones was identical to the first

39 amino acids of the Di cytochrome P450 protein. This
















50 50
SA B
25



-25 -25
-2501 51

-50 ............... ......... ....... ......... -50 ,... .. ,,| ..... ... ... ... ... ..
S100 200 300 400 100 200 300 400
S50 50



25:14 25j



50 -50
-50 ......... |........ lii... .... .... .. .. ii -50 iirii .l ... i ...|. .lll|.. ...... l I. l.
100 200 300 400 500 100 200 300 400
Residue Number

Figure 3.4. Hydropathy plots of the rat CYP2B1 (Fujii-
Kuriyama et al, 1982; accession number J00719)(A), rat
CYP2B2 (Mizukami et al, 1983; accession number A21162)(B),
rat CYP2D4 (Matsunaga et al, 1990; accession number
P13108)(c), and spiny lobster CYP2L (accession number
U44826)(D). The hydropathy index computation was done using
PCGENE (Intelligenetics, Mountain View, CA) with an interval
(sliding window) of nine amino acids (Kyte and Doolittle,
1982).









suggests that there may be other closely related members of

the CYP2L subfamily in spiny lobster hepatopancreas.


Comparison With Other 2 Family CYPs


Comparisons of hydropathy plots of CYP2L and rat CYPs

2B1, 2B2, and 2D4 indicate several structural similarities

between these forms (figure 3.4). The peaks that line up in

all forms appear to correspond to alpha helical regions

present in 2 family members.

The alignment of primary sequences of CYP2L and rat CYPs

2B1, 2B2, and 2D4 are shown in figure. 3.5. Some regions of

the sequence of spiny lobster 2L and rat 2 family CYPs show

high homology, whereas other regions bear little similarity

to each other. It was remarkable that the string of leucines

at positions 6-11 of the spiny lobster CYP2L and the PPG

cluster at spiny lobster 2L residues 26-28 were found in

several members of the mammalian 2 family cytochrome P450s

(Philips et al., 1983; Labbe et al., 1988; Kawajiri et al.,

1986). These highly conserved portions probably contribute

to the hydrophobicity of the N-terminus and its ability to

associate with microsomal membranes (Black, 1992). Substrate

recognition sites (SRS) have been suggested for rat 2B2 at

positions 97-118 (SRS1), 199-206 (SRS2), 234-242 (SRS3),

287-305 (SRS4), 360-370 (SRS5), and 471-478 (SRS6) by Gotoh

(1992). The 2L sequence has residues in common with other 2

family members in several of these substrate recognition













RAT2B1 -- ep t aL-Vg- --1 vr ghp r gn-i pl l qldrg 49
RAT2B2 --eps LLLL-lvrgh n rpl Llqldrg 49
CYP2L --lt-------M-psrsk 43
RAT2D4 rmptgs paIft vdlmhrrqRw trLlqidfq 55
RAT2B1 lns Vftdt gqaeD tiavi 104
RAT2B2 &lnsf tQLPeKYG frvhIep t c tdt glgqaeoD sggtiavi 104
CYP2L D _dqv ELYGIfkl --Ec fyt 96
RAT2D4 nMpagfq LcR GfSlqLafes glpaLR seDR 1hfn 110
RAI2BI epi-t--l:Sq l1RL 155
RAT2B2 epi-f--kE REL 155
I LnD ': 149
RAT2D4 dqs 4Gqprs waIArys rq RR st f9 aG aEwVtef La 165
RAT2B1 E-sqga LdptflfQc ta csf gFdyqflrll yfslLs 210
RAT2B2 sLPJsqgaPLdptflfQci tllcsf gePFdytr qflrll s L5L 210
CYP2L pksINA adhgqyftq 204
RAT2D4 afadg sgffpntlLd AypNaqLfac Fey rfirll diEees 220
RAT2B1 sQlFfsgf ------a qIsknL JilI ghiVe TL 259
RAT2B2 -EsQF-f fsgky? .---. --ahIsknLE Y ghiVe aTLDP 259
CYP2L FylF ELitfVknwmg vLrd ktfl TLDP 259
RAT2D4 jp ylv -i ------1LgkVf sjpkafvamLdelLtvSA 268
RAT2B1 a Of IrYErMe ke nhhTefhhLmis LLStG tggl 313
RAT2B2 -? i '. rM rrr r.r LL TE i 313
CYP2L N- c~i s GTETT 313
RAT2D4 .p 3E~ek 323

RAT2B2 vIgsh 368
CYP2L L I aVprg PShKda EtHEivPLGs 368
RAT2D4 MIl I vIgqvr rleMadqaRMp Ft nuH adIL'LG_ p 378

RATB21 tt5 iy ssal YFD t EHFLt 1ls 423



RAT2B2 Ea MFGIILQNF hla-pkdiDl ees gI 477
CYP2L l EL hTE qm-L 477
RAT2D4 EL fTcrpDyg--ifga 486

RAT2B1 gk itYcfsaM- 491
RAT2B2 gk oIcfs- 491
CYP2L fS fYQ iirePe 492
RAT2D4 IT tRYLcasp- 500

Figure 3.5. Comparison of the deduced amino acid sequence of
CYP2L with that of rat CYPs 2B1, 2B2, 2B4 (accession number
S19172) and 2D4. Boxes show residues that are identical
between 2L and 2D4 or the 2B subfamily members, while
conserved amino acids are indicated by capital letters. For
the complete sequence, there were 115 amino acids (23.4%)
that were identical in all five forms and 64 additional
similar amino acids (13.0%). Comparing the C-terminal half
(residues 250-492) of CYP2L with the C-terminal halves of
2B1, 2B2, 2B4 and 2D4, there were 73 identical residues
(30.3%) and an additional 38 similar residues (15.8%). These
comparisons were made using CLUSTAL V.










sites. The GV residues at CYP2L positions 106-107 fall in

SRS1 and are identical in the sequences shown in figure 3.5.

In SRS2, the leucine at CYP2L position 195 and the T at

CYP2L position 199 are present in the rat sequences (figure

3.5). In SRS4 there were several residues found in all five

sequences, i.e., LF at 295-296, AG at 298-299, T at 302, and

ST at 304-305 (figure 3.5). In SRS5 residues P (364), GV

(366-367) and H (369) were common in the compared sequences.

It has been suggested that S at position 304 and V residues

at positions 363 and 367 may contribute to substrate binding

(He et al., 1994). The regions designated as SRS3 and SRS6

did not have common residues in the 2 family members that

were compared in figure 3.5. Other highly conserved regions

are found at residues 119-121, 252, 257-258, 325, 327-329,

408, 410-415, 438-439, 442-443, 445-447, 449, and 454-455

(figure 3.5). Several investigators have noted that regions

of the C-terminus of cytochrome P450 sequences show greater

homology overall than N-terminal regions (Kalb et al., 1988;

Lewis, 1995). This is true for the CYP2L sequence with

selected rat 2B and 2D sequences (figure 3.5).


Northern Blot and RT-PCR


Northern blot analysis reveals a primary transcript of

about 1.8 kB in size (figure 3.6).

This result serves to confirm that the message for

CYP2L1 is present in the spiny lobster hepatopancreas.










Furthermore, there is an indication of a second transcript

around 1.5 kb (figure 3.6). Experiments using RT-PCR also

suggest the existence of a second transcript (figure 3.7),

however these results require confirmation.

There are numerous examples of alternatively spliced

cytochrome P450 messages in the 2 family (Kimura et al.,

1989; Miles et al., 1989 Yamano et al., 1989; Lacroix et

al., 1990). What function such a transcript may serve is

unknown. Our lab consistently notes a 30 kDa band that

immunoreacts with a polyclonal antibody to CYP2L on Western

Blots (Boyle and James, 1996).

The only other invertebrate cytochrome P450s that have

been sequenced and assigned families to date have been from

insects and a pond snail and are in the 4,6, and 10 families

(Nelson et al, 1993). Thus, this is the first report of a 2

family cytochrome P450 in an invertebrate and extends the

incidence of this family in the animal kingdom.





















kb


2.4>


1.4>





Figure 3.6. Northern blot of total RNA isolated from the
hepatopancreas of the spiny lobster. Ten micrograms of total
RNA were blotted onto a nylon membrane and probed with a
32P-CTP-labeled probe, as described in Methods. Arrows mark
a possible 1.5 kb message (lower arrow) and about a 2.1 kb
message (upper arrow).




















kb

1.90






.95
.83

Figure 3.7. RT-PCR of total RNA isolated from the spiny
lobster hepatopancreas. RNA was primed with an oligo-dT
primer and reverse transcribed as described in Methods.
Using HT25 and MJ11, a primer just upstream to the poly-T
tail, two bands were detected. The band at around 1.8 kb
(upper arrow) is the expected product for a normal
transcript. The product around 1.0 kb (lower arrow) may
represent an alternatively spliced message.















CHAPTER 4
CATALYTIC CHARACTERIZATION OF CYTOCHROME P450 2L1 IN
BACTERIAL AND YEAST EXPRESSION SYSTEMS


Introduction


Cytochrome P450 enzymes catalyze the insertion of

oxygen into both endogenous and exogenous substrates found

in many animal and plant species (Nelson et al., 1993). In

its dual role, cytochrome P450s function as integral parts

of biosynthetic pathways, such as steroid biosynthesis, and

in the initial or phase I detoxification pathways of

xenobiotics.

Tissues from several crustacean species are able to

metabolize various steroid hormones in vitro (Table 4.1).

Studies have shown that invertebrates possess steroid

hormones similar or identical to those found in mammalian

species (Burns et al., 1984; Fairs et al., 1989). Tcholakian

and Eik-Nes (1971) reported that progesterone could be

metabolized to 11-deoxycorticosterone (21-

hydroxyprogesterone), androstenedione and to 20-

hydroxyprogesterone in the androgenicc gland" of the blue

crab, reactions that can be catalyzed by cytochrome P450.

Ovarian tissues from the crab, Portunus tritubeculatus,

hydroxylate progesterone in the 17a-position (Teshima and

Kanazawa, 1971). The shore crab, Carcinus maenas,

























Table 4.1. in vitro Steroid Metabolism in Crustacean Species

species organ substrate(s) products)


Blue crab
Callinectes sapidus

Crab
Portunus trituberculatus

shore crab
Carcinus maenas


AG P 210HP,200HP Tcholakian and
Andro Eik-Nes, 1971


Ovaries


Testes Andro


VD + AO estrone 17POHE


17cOHP Teshima and
Kanazawa, 1971

T Blanchet et al.
1978


American lobster
Homarus americanus

Shrimp
Penaeus monodon

Florida spiny lobster
Panulirus argus


Testes


Ovaries

purified
protein
from
HP


200HP


200HP


Burns et al.,
1984

Young et al.,
1992


T 16aOHT,160H3T James and
600HT Shiverick, 1984
P
16aOHP,6POHP
17aOHP,210HP


AnG Ec
200HEc

HP=hepatopancreas, VD=vas deferens, AG=androgenic gland, AnG=antennal gland.
P=progesterone, Andro=androstenedione, Ecdysone, 210HP=21-hydroxyprogesterone,
200HP=20-hydroxyprogesterone, 17aOHP=17a-hydroxyprogesterone, 17POHE=170-
estradiol, 16aOHT=16a-hydroxytestosterone, 1600HT=16j-hydroxytestosterone,
6pOHP=6p-hydroxyprogestererone, 200HEc=20-hydroxyecdysone.


reference










metabolizes androstenedione to testosterone and estrone to

17p-estradiol in vas deferens and testes tissue preparations

(Blanchet et al., 1978). Lachaise and Lafont (1984)

demonstrated that the shore crab could metabolize

ponasterone A (25-deoxy-20-hydroxyecdysone) to 25-

hydroxyecdysone. American lobster testes were shown to

metabolize progesterone to 20-hydroxyprogesterone (Burns et

al., 1984), and shrimp, Penaeus monodon, ovary was also

shown to metabolize progesterone to 20-hydroxyprogesterone

(Young et al., 1992).

James reported that the Ml fraction from the spiny

lobster hepatopancreas could metabolize a variety of

substrates (Table 4.2, James, 1990; James, 1989). Two

catalytically active fractions (D1 and D2) of cytochrome

P450 in the spiny lobster hepatopancreas were isolated

(James, 1990). The fractions have a similar apparent

molecular mass and overlapping substrate preferences for

benzo-a-pyrene, benzphetamine, ethoxycoumarin, testosterone

and progesterone (James, 1990; James and Shiverick, 1984).

Progesterone was hydroxylated in the 16a, 60, and 21

positions, while testosterone was hydroxylated in the 16a,

16p and 6p positions (Table 4.2, James, 1990, James and

Shiverick, 1984). Hydroxylation of progesterone or

testosterone at the 16 or 6 position diminishes the

biological activity of these steroids. The molting hormone,

ecdysone, was metabolized to 20-hydroxyecdysone in

mitochondria from spiny lobster antennal gland, as well as























Table 4.2. Monooxygenase Activity of Spiny Lobster Cytochrome P450
Fractions in the Presence of NADPH and NADPH-Cytochrome P450 Reductase
from Rat Liver.


P450

Substrate

Benzphetamine

Aminopyrine

7-Ethoxycoumarin

Methylphenoxazone

Ethylphenoxazone

Pentylphenoxazone

Benzylphenoxazone

Benzo(a)pyrene

Testosterone 16a-

6P-

Progesterone 16a-

6P-

21-


Nanomoles product formed/min/nmol cytochrome


M1

26.3+5.3 (8)

19.8

0.325+0.139 (4)

0.0189

0.0620.051 (5)

0.002

0.010

1.43+0.41 (5)

1.3

0.6

4.96+0.28 (8)

1.18+0.41 (8)

0.670.42 (8)


D1

50+15 (4)

40

0.1400.023 (3)

0.0040.001 (3)

0.0070.002 (4)

0.011+0.001 (3)

0.0040.001 (3)

1.97+0.83 (5)

8.6515.81 (3)

7.31+6.16 (3)

43.4+9.1 (3)

0.90.3 (3)

0.47+0.02 (3)


D2

122+62 (4)

76

0.183

0.005+0.001 (3)

0.00510.002 (3)

0.013+0.001 (3)

0.0030.001 (3)

1.540.39 (4)

4.1

3.4

21.1

6.2

0.41


Note: Values shown are means SD (n) or individual values. This data was
taken from (James, 1990). M1=solubilized microsomal fractions, D1 and D2
are chromatographic fraction of the M1 material.










in gonadal tissues and hepatopancreas mitochondria (James

and Shiverick, 1984).

We have cloned a cytochrome P450, cytochrome P450 2L1,

from the hepatopancreas of the spiny lobster (James et al.,

1996). The first 39 amino acids deduced from the DNA

sequence of cytochrome P450 2L1 are nearly identical to N-

terminal amino acid sequence data obtained from the D1

fraction, differing by only one amino acid (James et al.,

1996). This difference, a substitution of a leucine for a

valine, is a conservative change. However, a clone was

obtained in which this substitution was absent (James et

al., 1996).

The following study reports upon the expression of

cytochrome P450 2L1 in bacteria and yeast. Functional

cytochrome P450 2L1 was obtained from yeast and its

catalytic activity determined using testosterone and

progesterone substrates.


Materials and Methods



Spiny Lobster and Rat Protein Preparations


Microsomes were prepared from a male spiny lobster

hepatopancreas as described previously (James, 1990). The

"Ml" fraction was prepared by stirring the microsomal

fraction in 0.5% cholic acid for 1 hr at 4C. The mixture









was centrifuged at 110,000 x g for 90 min and the dense, red

liquid fraction isolated (Ml fraction, James, 1990).

Cytochrome P450 reductase was isolated from

phenobarbital-treated rats (80 mg/kg for 4 days) by the

method of Yasukochi and Masters (1976). Protein

concentration of the various preparations described in this

paper were done using the method of Lowry et al. (1951).

Spectral determination of cytochrome P450 content followed

the procedure of Estabrook (1972). SDS-PAGE was done using

the methods of Laemmli (1970).


Construct Preparation


Two cytochrome P450 2L1 constructs were prepared for

insertion into bacterial or fungal cells. The first

construct, AO, was designed to express the entire deduced

amino acid sequence of cytochrome P450 2L1. AO was

generated using primers MJ24 and MJ25 (table 4.3 and figure

4.1). A Xgt22a cDNA library made from spiny lobster

hepatopancreas (James et al., 1996) was screened using these

two primers in a polymerase chain reaction (Compton, 1990).

The PCR tubes contained the following: 5 li cDNA library in

10 mM MgSO4 (2.9 X 1010 plaque-forming units/ml), 10 gl of

PCR buffer (500 mM KC1, 100 mM Tris-Cl, pH 8.4, 15 mM MgC12,

and 1 mg gelatin/ml), 1 pl of a solution containing 20 mM

dNTP mix, and 30 pmol of each primer. The volume was made up

to 99 ig with sterile, deionized water and the reaction























Table 4.3. Primer Sequences Used in this Study.

Primer
Name Sequence Comments

BRN1 AGTCGAATTCCATATGGCTCTGTTATTA GCACTTTTTTTATTGCTG CTGGTG 5'-EcoR I,
M A L L L A V F L L L L V Nde I sites

AGTCGAATTCCATATGCTGACGGGGGCG CTGCT 5'-EcoR I,
MJ25 M L T G A L L Nde I sites

MJ24 GCGAATTCGTGCACTCACTCCCTCTCCCT GATGA 3'-EcoR I,
(- E R E R I I)' Sal I sites

M13 CGCCAGGGTT TTCCCAGTCA CGAC 5'-
polylinker
HT26 TCCCCATAT ACCTGGGGGAAGTCC 3'-antisense
G W I G PP LG

HT36 GTC AAG AAC TGG ATG GGC 5'-sense
V K N W M G

HT38 ATC TTT CAA CTC GCA GAC CCC 3'-antisense
(D K L E C V G)1

Ph94 GACTGGTTCC AATTGACAAG C 5'-AOX1 site
(5' to
polylinker)
Ph93 GGATGTCAGA ATGCCATTTG C 3'-AOX1 site
(3' to
polylinker)

'Residues in parenthesis are the inverse translation products















EcoR I M L T G A L L
MJ25 5' AGTCGAATTCCAT ATG CTG ACG GGG GCG CTG CT 3'
Nde I


EcoR I E R E
MJ24 5' GCGAATTCGTCGAC TCA CTC CCT CTC
Sal I


EcoR I M
BRN1 5' AGTCGAATTCCAT ATG
Nde I


R I I
CCT GAT GA 3'


A L L L A V
GCT CTG TTA TTA GCA GTT


F L L L L V
TTT TTA TTG CTG CTG GTG
CYP 2L1

Figure 4.1. The oligonucleotide sequence of expression
primers MJ25, MJ24, and BRN1. MJ25 and BRN1 both incorporate
unique EcoR I and Nde I endonuclease restriction sites to
enable ligation of the PCR product into expression vectors
that have these sites within the polylinker region. MJ24
incorporates unique EcoR I and Sal I sites into a PCR
product. The resulting PCR product contains 5' and 3' EcoR I
sites, and a 5' Nde I site and a 3' Sal I site.










tubes were heated at 940C for 5 min. Pmo I (5 units,

Boehrinher Mannheim, Inc.), a thermostable DNA polymerase

with proofreading capabilities, was then added for a final

volume of 100 il and the reaction tubes were heated and

cooled for 35 cycles under the following temperature regime:

940C for 1 min denaturingg), 600C for 2 min (annealing), and

720C for 3 min (elongating). A final 10-min extension period

at 720C was included. A full length clone was constructed

and ligated into pGEM-T (Promega).

A second construct was prepared, Al, and was designed

to replace the first 7 amino acids of cytochrome P450 2L1

with the amino acids MALLLAVF (the Barnes modification). Al

was generated using primers BRN1 and MJ24 (see table 4.3 and

fig 4.1) in a PCR reaction using conditions identical to

those used for 0A. Al was also ligated into pGEM-T.


Bacterial Expression Vectors


AO and Al were excised from pGEM-T using either Nde I and

Sal I endonucleases or only EcoR I endonuclease, depending

upon which bacterial expression vector was to be used (see

table 4.4 for characteristics of the various expression

vectors used in this study). The Nde I/Sal I endonuclease

pair was used for DNA products to be directionally inserted

into pET21c, pET28a or pCW. EcoR I Nde I/Sal I endonuclease

reactions were as follows: 1 gg of plasmid DNA containing

either the AO or Al construct was incubated in 50 mM Tris-
































Table 4.4. Expression Vectors Used in this Study and their
Attributes

Vector Polylinker Selection Bacterial Strain Tag Promoter
pMAL-p2 EcoR I Ampicillin DH5a C-MBP tac
pCW Nde I/Sal I Ampicillin DH5a C-PH (NU) tac
pPET21c Nde I/Sal I Ampicillin BL21 C-PH (NU) T7
pPET28a Nde I/Sal I Kanamycin BL21 N-PH T7
pPICZa EcoR I Zeocin GS115 none AOX1

C-MBP=C-terminal maltose binding protein; C-PH=C-terminal polyhistidine;
NU=not used; N-PH=N-terminal polyhistidine; AOXl=Alcohol Oxidase 1.










Cl, pH 8.0, 10 mM MgCl2, 100 mM NaC1, 1200 units/ml Nde I

and Sal I endonuclease in a final volume of 0.05 ml for 2h

at 370C. The excised DNA was gel purified and portions (1/10

of the total product recovered from the gel) ligated into

pCW, pET28a and pET21c vectors that had been digested and

gel purified in the same manner.

EcoR I endonuclease reactions were as follows: 1 gg of

plasmid DNA containing either the AO or Al construct was

incubated in 90 mM Tris-Cl, pH 7.5, 50 mM NaC1, 10 mM MgCl2,

1200 units/ml EcoR I in a final volume of 0.05 ml for 2h at

370C. The excised DNA was gel purified and a portion (1/10

of the total product recovered from the gel) was ligated

into pMAL-p2.

DH5a bacterial cells were transformed with pCW and

pMAL-p2 constructs, while BL21 cells were transformed with

the pET vectors (table 4.4). Positive colonies were

determined using PCR and either two internal primers (HT36

and MJ24 for directional inserts) or a 5' vector primer and

a internal primer (M13 and MJ24 for bi-directional inserts).


Yeast Expression Vector


AO was excised from pGEM-T using EcoR I endonuclease

and ligated into pPICZa, a bi-directional vector, as

described above. This plasmid was then transformed into

JM109 competent cells. Positive colonies were identified by

PCR using a primer to the cytochrome P450 2L1 sequence









(HT38) and a primer to the vector (Ph94, Table 4.3). The PCR

experiments were designed to identify the correct

orientation of the DNA insert for expression. Plasmid DNA

(Qiagen, Chatsworth, CA) from a positive colony was isolated

and a portion of the plasmid DNA used for sequencing in

order to confirm the correct orientation and sequence the

cDNA .

Twenty micrograms of the plasmid DNA was digested

overnight at 250C in 20 mM Tris-acetate, pH 7.9, 10 mM Mg-

acetate, 50 mM K-acetate, 1 mM DTT, 200 units/ml Pme I (New

England Bio Labs, Inc.) and sterile, deionized water to a

final volume of 100 il.

Constructs linearized with Pme I were used to transform

GS115 cells (Pichia pastoris) by electroporation (Gene

Pulser, BioRad, Hercules, CA). Transformed cells were grown

on 2% (w/v) agar plates containing 1.0 M sorbitol, 1.0%

(w/v) dextrose, 1.34% (w/v) yeast nitrogen base lacking

amino acids, 4 x 10-5% (w/v) biotin, 0.005% (w/v) amino acid

mixture (50 mg each glutamic acid, methionine, leucine,

lysine, and isoleucine per liter DI water), 0.004% (w/v).

Colonies were randomly picked and grown in 3 mls of a

solution (MGYH) containing 1.34% (w/v) yeast nitrogen base,

1.0% (v/v) glycerol, 4 x 10-5% (w/v) biotin, 0.004% (w/v)

histidine. An aliquot of the broth containing the colonies

(5 p1) was removed and subjected to PCR analysis (in order

to determine what colonies underwent successful integration

of the cytochrome P450 2L1 construct), using an internal










primer (HT38) to cytochrome P450 2L1 and a vector primer

(Ph94).


Expression of Cytochrome P450 2L1 in Bacteria


Positive colonies containing the cytochrome P450 2L1

constructs AO or Al were grown overnight at 370C in 1 ml of

LB (Luria-Bertani broth) containing either 1 Ig

ampicillin/ml LB (pCW and pMAL-p2 transformants,) or 1 gg

kanamycin/ml LB (pET transformants, see table 4.4 for

antibiotic requirements of the various expression vectors).

In all cases, the overnight culture was diluted 1:100

in 100 ml LB culture with the appropriate antibiotic, and

the bacteria grown to a cell density of ODsoo between 0.70 to

0.80. isopropyl thio-P-D-galactoside (IPTG) was added to the

culture to a final concentration of 0.4 mM. The cultures

were grown an additional 3 hrs and harvested by

centrifugation (5,000 x g for 5 min, 40C). Cell pellets were

resuspended in 10 mls of buffer A (10 mM potassium

phosphate, pH 7.5, 0.15 M NaC1).

Cell pellets were subjected to 20 second sonication

bursts while on ice until no viscosity was evident in the

solution (typically 3 to 4 bursts were required). The

ruptured cells were centrifuged at 12,000 x g for 15 min at

40C. The pellet, consisting of insoluble material or

"inclusion bodies", was resuspended in 10 mls of buffer A.

The supernatant, consisting of soluble proteins and cell










membrane, was centrifuged at 180,000 x g for 65 min at 4'C.

The pellet from this spin was solubilized in 0.5% cholic

acid for 1 hr and the mixture centrifuged at 180,000 x g for

65 min at 4C. In addition, the inclusion body fraction was

solubalized in 0.5% cholic acid, and centrifuged at 12,000 x

g for 15 min at 40C.

Cytochrome P450 2L1 expressed from the pET28a vector

was purified using metal chelation chromatography. A His-

Bind (Novagen) column was poured and inclusion bodies

solubilized in 6 M urea were passed over the column. The

pure protein was eluted in 1.0 M imidazole.


Expression of Cytochrome P450 2L1 in Yeast


A positive colony was grown in 200 mls of MGYH. After 2

days at 300C, cells were pelleted (1,500 x g for 10 min) and

brought up in 200 mls of a solution containing 1.34% (w/v)

yeast nitrogen base, 1 x 10-5% (w/v) biotin, 0.5% (v/v)

methanol, 0.005% (w/v) histidine. Two days later (at 300C),

the cells were pelleted and resuspended in 10 mls of buffer

containing .15 M KC1, 0.05 M potassium phosphate, pH 7.4,

0.1 mM EDTA, 0.2 mM PMSF. Microsomal fractions were prepared

as described previously (James, 1990) with the following

modifications: after the cells were lysed in a French press,

the ruptured cell solution was centrifuged at 30,000 x g to

fractionate the nuclear DNA and mitochondria. The

supernatant was centrifuged at 100,000 x g for 45 min at 4C









and the microsomal pellet was resuspended in 0.25 M sucrose,

0.05 M Kpi, pH 7.4, to a final concentration of about 12 mg

microsomal protein/mi buffer.


Testosterone and Progesterone Assays


Steroid metabolism studies (n=l) in both intact cells

and microsomal fractions was done following the procedures

of James and Shiverick (1984). Whole cells (-9.3 x 109, where

OD6oo= 5.0 x 107 cells/ml) or microsomes (.12 mg or .096

nmol/ml) were placed into a tube containing the following:

53 pM [14C]-testosterone (specific activity 57 pci/pmol,

Amersham, Arlington Heights) or 43 pIM [14C]-progesterone

(specific activity 56 gci/pmol), 0.05M KPi, pH 7.4, 5 mM

MgC12, and DI water to a final volume of .25 mis.

Reactions were initiated with the addition of NADPH (2

mM, Sigma Chemical Co.) and incubated at 300C for 20 min.

Ethyl acetate (3 X 1.5 mis) was used to terminate and

extract the reaction products. The ethyl acetate fractions

were evaporated under N2 and the residues brought up in 100

il for TLC analysis.

Linear K silica (LK5DF) gel TLC plates (Whatman Int.,

Maidstone, England) were predeveloped in 100% MeOH to remove

impurities and allowed to dry. Reaction product (50 2l) were

spotted and the plates developed three times in the

following system: 70:38:0.8:1.0 diethyl ether: toluene:

MeOH: acetone. The plates were allowed to dry and were









subjected to autoradiography. Steroid standards purchased

from Sigma Chemical CO. (St. Louis, MO) and Steraloids

(Wilton, NH) were used.


Immunoquantitation of cytochrome P450 in Yeast Microsomes


Microsomal protein, 1 and 5 jg, was subjected to SDS-

PAGE. The gel was electroblotted onto PVDF membrane as

described previously (James et al, 1996). A primary antibody

(10 lg serum/ml tris-buffered saline, 0.05% (v/v) tween-20;

a 1:500 dilution) to a major form of cytochrome P450 from

the spiny lobster hepatopancreas (Boyle and James, 1996) was

used to detect cytochrome P450 2L1 in yeast microsomes. This

antibody was incubated overnight at 40C with wild-type

microsomes (1 gg antibody to 4 gg microsomes) and

centrifuged the next day for 10 minutes at 14,000 x g. The

supernatant was used in the Western blot. The secondary

antibody was a goat-anti-rabbit antibody (1:3000

dilution)conjugated to alkaline phosphatase (BioRad).

Desitometric analysis of the Western blot and of the TLC

autoradiographs was done using an electrophoretic image

band analysis system (Bioimage).










Results



Bacterial and Fungal fractions


SDS-PAGE of bacterial whole cell lysates show an

inducible protein product with an apparent molecular mass of

approximately 50 kDa (figure 4.2). When western blot

analysis of whole cell lysates is done, an immunoreactive

band is seen in the 50 kDa region (figure 4.3).

Solubilization of the bacterial membranes with cholic

acid produces a protein with an apparent molecular mass

approximately 58.5 kDa (figure 4.2). In addition,

solubilization of the inclusion bodies also liberates a

protein of an apparent molecular mass approximately 58.5 kDa

(figure 4.2). Metal chelation chromatography with inclusion

bodies solubalized in 6 M urea produces the same results,

that is, a single band at an apparent molecular mass of 58.5

kDa (figure 4.4).

An estimate of the amount of cytochrome P450 present in

the yeast microsomes was obtained using a polyclonal

antibody to spiny lobster cytochrome P450 2L (Figure 4.5).

We estimate that the transformed yeast produce between 0.02

and 0.05 pmole of cytochrome P450 2Ll/Rg yeast microsomal

protein.
























kDa

66.2----- :

45.0506-


1 2 3 4 .5 6 7

Figure 4.2. SDS-PAGE of induced bacterial cells (BL21)
expressing cytochrome P450 2L1 from the expression vector
pET28a. Lane 1, 500 pl of bacterial cells in SDS-PAGE
running buffer; 2, 12,000 x g pellet of the culture; 3,
12,000 x g pellet solubalized in 0.5% cholic acid; 4,
12,000 x g supernatant from the lane 3 treatment; 5,
12,000 x g pellet from lane 3 treatment; 6, 180,000 x g
supernatant from lane 2 supernatant; 7, 180,000 x g
supernatant from lane 3 treatment. Arrows indicate a
protein approximately 58.5 kDa.























kDA

66.2 -. ,p.
50.6-
45.0




1 "2 3
Figure 4.3. Western blot of total cell lysate from BL21
bacterial cells expressing the pET28a construct induced
with 0.4 mM IPTG. Lane 1, uninduced culture; 2, culture 1
hr. 30 min. post-induction with IPTG; 3, culture 3 hr.
post-induction with IPTG.























kDa

66.2-- U -

50.6--
45.0--


1 2 3 4 5
Figure 4.4. SDS-PAGE of pET28a derived cytochrome P450
2L1 expressed in bacterial cells (BL21) and purified
using metal chelation chromatography. Inclusion bodies
were solubalized in 6 M urea and passed over a His-bind
column. The image was enhanced in order to see the pure
protein (arrow), with an apparent molecular mass of 58.5
kDa. Lane 1, material that passed through the column
while loading; 2, column wash; 3, first fraction
following elution in a 1.0 M imidazole buffer; 4, second
fraction; 5, the third fraction.
























1 2 3 4 5 6

52.4 Kd-- -




Fig. 4.5. Western blot of microsomes from yeast
containing the cytochrome P450 2L1 insert. Proteins were
subjected to SDS-PAGE and blotted onto a PVDF membrane as
described in the Methods section. Densitometric analysis
of the microsomes from yeast expressing cytochrome P450
2L1 indicate a cytochrome P450 concentration of about
0.02 pmol cytochrome P450/ig yeast microsomal protein.
Control microsomes were made from wild type yeast.
Purified cytochrome P450 was isolated from the
hepatopancreas of the Florida spiny lobster as described
previously (James, 1990). Lane 1, wild type yeast
microsomes, 5 gg; 2, microsomes from yeast expressing
cytochrome P450 2L1, 5 gg; 3, microsomes from yeast
expressing cytochrome P450 2L1, 1 lg; 4, purified
cytochrome P450, 0.35 pmol; 5, purified cytochrome P450,
0.25 pmol; 6, purified cytochrome P450, 0.15 pmol. The
expressed cytochrome P450 2L1 has an apparent molecular
mass of about 50 kDa.










Steroid Metabolism


[14C]-testosterone was hydroxylated in the 16c position

(1.37 nmol/min/nmol cytochrome P450 2L1 and 2.31

nmol/min/nmol cytochrome P450 2L1 in incubations fortified

with rat cytochrome P450 reductase) by microsomes from yeast

expressing cytochrome P450 2L1 (Figure 4.6). Two other polar

metabolites were produced in trace amounts. A more nonpolar

metabolite in reference to testosterone was produced in an

NADPH-dependent, rat cytochrome P450 reductase-independent

manner, but was not identified.

Intact whole yeast cells expressing cytochrome P450 2L1

incubated with [4C]-testosterone, produced 16a-

hydroxytestosterone, the two polar unknowns, and one

nonpolar unknown. Intact whole cells did not require the

addition of rat cytochrome P450 reductase nor NADPH (figure

4.7).

[14C]-progesterone produced a polar metabolite (2.93

nmol/min/nmol cytochrome P450 2L1 and 3.60 nmol/min/nmol

cytochrome P450 2L1 in incubations fortified with rat

cytochrome P450 reductase) that co-migrated with a 16a-

hydroxyprogesterone standard when incubated with microsomes

from yeast expressing cytochrome P450 2L1 (Figure 4.6). One

other polar metabolite was apparent, but was produced in

trace amounts and we were unable to accurately quantify it










using densitometric methods. A more nonpolar metabolite in

reference to progesterone was produced.

Intact whole cells expressing cytochrome P450 2L1

incubated with ['4C]-progesterone, produced 16a-

hydroxyprogesterone, the polar unknown, and a nonpolar

unknown. Intact whole cells, as with the testosterone

incubations, did not require the addition of rat cytochrome

P450 reductase nor NADPH (figure 4.7).

Intact whole yeast cells lacking the cytochrome P450

2L1 construct (wild type) and microsomes made from these

same wild type yeast, were incubated with [1(C]-testosterone

or [14C]-progesterone in separate experiments (figure 4.6

and 4.7).


Discussion



Bacterial experiments


Both AO and Al were expressed successfully in bacteria

with the various expression vectors used, with the exception

of pMAL-p2. In all cases, large amounts of cytochrome P450

2L1 were detected either by SDS-PAGE (figure 4.2) or by

immunoblotting with an antibody to spiny lobster cytochrome

P450 (figure 4.3). However, no functional enzyme, as

determined by cytochrome P450 difference spectra, was

obtained with any of the bacteria strains or expression

vectors used (data not shown).