Characterization of the vaccinia virus J3 protein as a positive transcription elongation factor

MISSING IMAGE

Material Information

Title:
Characterization of the vaccinia virus J3 protein as a positive transcription elongation factor
Physical Description:
xi, 160 leaves : ill. ; 29 cm.
Language:
English
Creator:
Latner, Donald Ray
Publication Date:

Subjects

Subjects / Keywords:
Vaccinia virus   ( mesh )
Viral Proteins   ( mesh )
Transcription Factors   ( mesh )
Transcription, Genetic   ( mesh )
Gene Expression   ( mesh )
Gene Expression Regulation   ( mesh )
Genre:
bibliography   ( marcgt )
theses   ( marcgt )
non-fiction   ( marcgt )

Notes

Thesis:
Thesis (Ph. D.)--University of Florida, 2001.
Bibliography:
Includes bibliographical references (leaves 144-159).
Statement of Responsibility:
by Donald Ray Latner II.
General Note:
Typescript.
General Note:
Vita.

Record Information

Source Institution:
University of Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
oclc - 54801269
ocm54801269
System ID:
AA00011180:00001

Full Text











CHARACTERIZATION OF THE VACCINIA VIRUS J3 PROTEIN AS A POSITIVE
TRANSCRIPTION ELONGATION FACTOR















By

DONALD RAY LATER II


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


2001




























Copyright 2001

by

Donald Ray Latner II


























This work is dedicated to all the members of my family who have desired to attend
college while lacking the appropriate opportunity. They have indeed been highly
educated by life itself and have obtained wisdom that cannot be found in any classroom.















ACKNOWLEDGMENTS

I would like to humbly take this opportunity to affirm before my scientific peers

that I believe in God and I acknowledge Him as the creator of our awe inspiring universe.

I choose to believe, not from ignorance of modern scientific facts and principles or as an

expression of moral elitism, but as an expression of my profound sense of amazement at

the realization that "I" exist. The existence of the human body as a conglomeration of

water, DNA, RNA, proteins, and fatty acids is astounding, but the coalescence of these

molecules in a fashion that provides an environment for our human emotions such as

love, joy, sadness, and our sense of wonder is to me, utterly incomprehensible. I am

grateful to God for the privilege to catch a glimpse of the beautiful inner workings of His

creation that few have ever seen.

I am especially thankful to my parents for so many things including the direction,

encouragement, and the mental and financial support that they have generously supplied

while I have been in college and graduate school. I have been well blessed just to know

them, but to identify them as my parents and to be called their son is truly an honor.

My graduate advisor, Dr. Rich Condit, is wonderful human being. He is not

simply an astute scientist, fantastic teacher, keen mentor, and diligent worker, but he is

patient, kind, compassionate, and generous. He is therefore a superb role model both as a

professional and as a good person. Being a student in his laboratory has been a great

delight and a rare privilege. I am certain that I could not have received a better education

in any other lab on the planet and I am respectfully grateful for this opportunity.









I acknowledge my colleagues Dr. Cari Lackner, Dr. Ying Xiang, Ms. Jackie

Fried, Dr. Nissin Moussatche, Dr. Penni Black, Dr. Susan D'Costa, Mr. Steve Cresawn,

and Dr. Cindy Prins for their friendship, patience, and camaraderie throughout my

experience in "The Condit Lab." Finally, the the help and guidance of Dr. Art Edison,

Dr. Bert Flanegan, Dr. Sue Moyer, Dr. Jim Resnick, and Dr. David Bloom as members of

my advisory committee has been greatly appreciated.
















TABLE OF CONTENTS

page

ACKNOWLEDGMENTS ............................................................................................ iv

LIST O F TA BLES........................................................ ...................................... viii

LIST O F FIGU RES ..................................................................................................... ix

ABSTRA CT.................. ................................................................................................ x

1 TRANSCRIPTION ELONGATION AND TERMINATION...................................

Introduction ................................................. ................ .............................................. 1
Regulation of E.coli RNA Polymerase Elongation and Termination............................ 4
Regulation of RNA Polymerase I Elongation and Termination.............................. 13
Regulation of RNA Polymerase III Elongation and Termination .......................... 18
Regulation of RNA Polymerase II Elongaiton and Termination............ ..... ... 23
Elongation and Termination in Context.................................... ................ 39
Vaccinia Introduction and Biology........................................................... 40
A 18.................................. ........................... ......................................................... 45
IB T ................................................... ...... ................ ............... .................. 46
G2........ ......................................................................... ................... 47


2 CHARACTERIZATION OF J3 AS A TRANSCRIPTION FACTOR.........................49

Introduction ............................... ................................................................. ............. 49
M materials and M ethods.......................................................................................... 50
Cells and Viruses ..................................................................... 50
Protein Pulse-Labeling...................................................................... ..... 51
Isolation of Total Cellular RNA ................................................ 52
N northern A analysis .................................................... .. ......................................... 52
DNA Sequence Analysis.... .................................................. ..... ................... 54
R FLP A nalysis.............................................................. ...................................... 55
DNA Clones & Marker Rescue ..................................................................56
W western Blot A analysis .......................................... .............................................. 56
Results ...................................................... 57
Isolation of IBT-Dependent Mutants..................................................................... 57
Western Blot Analysis of A18, J3, and G2 Proteins in Mutant Infections............... 58
Plaque A ssay ............................................................................... ........................ 59









One-Step Growth ................................................................................................ 60
Viral Protein Synthesis ........................................................................................ 61
Viral mRNA Synthesis ....................................................................................... 62
Analysis of Late Viral mRNA 3' Ends.............................................. ............ 64
D discussion .................................................................................................................... 66


3 J3 TRANSCRIPTION FACTOR ACTIVITY IS INDEPENDENT FROM ITS OTHER
TWO ROLES IN mRNA MODIFICATION................................................................89

Introduction .................................................................................................................. 89
Materials and Methods............................................................................................ 91
Cell Culture, Plaque Assay, One-Step Growth, Protein Pulse-Labeling, RNA
Isolation and Northern Analysis ........................................................... .... .. 91
Transient Dominant Selection................................................. ...................... 91
In Vivo Poly(A) Tail Measurements ................................................. .............. 93
Cap Marker Synthesis......................................................................................... 94
In Vivo Cap Labeling .......................................................................................... 95
C ap A analysis .................................................................... ................................... 96
R esults........................................................................................................................... 96
Construction of Site-Directed J3 Mutants........... .................... ............. 96
Plaque Phenotypes of Site-Directed Mutants .................................................. 99
One-Step Growth Analysis ............................................................................... 100
Viral Protein Synthesis .............................................. 101
Viral mRNA Synthesis .............................................................. 104
In Vivo Poly(A) Polymerase Stimulatory Activity .................................. 107
In Vivo 2'-o-Methyltransferase Activity ................................ .......................... 109
Discussion ........................................................................ ................................ 110


4 DISCUSSION .......................................................................... ..............................132

LIST OF REFERENCES ............................................................................... ............144

BIOGRAPHICAL SKETCH .......................................... ........................................... 160















LIST OF TABLES



Table Page

2-1 G2 IBTD Mutants...................................................................................................... 75

2-2 J3 IBTd Mutants........................................................................................................ 75

2-3 Sequence Context of J3 Deletion and Insertion Mutations .......................................... 76

3-1 Summary of J3 Site-Directed Mutants ....................................................................... 16















LIST OF FIGURES


Figure Pane

2-1 Western Blot Analysis of Al8, J3, and G2 Proteins.................................................. 77

2-2 Plaque Phenotypes of Mutant Viruses................................................................ 78

2-3 One-Step Growth Analysis of Mutant Viruses....................................... ............ .. 80

2-4 Protein Synthesis in Wt and Mutant-Infected Cells........................................................ 81

2-5 Northern Analysis of Wt and Mutant Infections .......................................... ........... 82

2-6 J3 Mutants Produce 3' Truncated mRNA ................................................ ............... 84

2-7 m RN A 5' Cap Structure ................................................ .......................................... 86

2-8 J3 Protein Crystal Structure ........................................................................ 88

3-1 Plaque Phenotypes of Mutant Viruses...................................................................... 118

3-2 One-Step Growth Analysis of J3 Site-Directed Mutants.................................................120

3-3 Protein Synthesis in Wt and Mutant-Infected Cells.........................................................121

3-4 Northern Analysis of RNA From Wt and Mutant Infected Cells .............................. 123

3-5 Analysis of Poly(A) Tail Lengths in Wt and Mutant Viruses ..................................... 125

3-6 Distribution of Poly(A) Tail Lengths in Wt, J3-7, and CF3C- Samples .................... 127

3-7 In Vivo 2'-o-Methyltransferase Assay .................................................. ....................129

3-8 J3 Crystal Structure............................................... ............................................. 131

4-1 NPH-I and H4 Interaction Domains ........................................................................142

4-2 Molecular Structure of Isatin-p-Thiosemicarbazone (IBT)...................................... 143















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

CHARACTERIZATION OF THE VACCINIA VIRUS J3 PROTEIN AS A POSITIVE
TRANSCRIPTION ELONGATION FACTOR

By

Donald Ray Lamer II

December 2001

Chairman: Dr. Richard C. Condit
Major Department: Molecular Genetics and Microbiology

Vaccinia virus is the prototypic orthopoxvirus. It encodes approximately two

hundred genes on a 194-kB linear double-stranded DNA genome and replicates strictly in

the cytoplasm of host cells. By necessity, the virus encodes many of the factors that are

required for nucleic acid metabolism, making it a good model system for studying

intricate cellular processes such as the regulation of transcription. Although much is

known about the regulation of transcription initiation in both eukaryotic organisms and

vaccinia virus, relatively little is understood about the regulation of transcript 3' end

formation in general. In attempt to identify proteins that influence vaccinia mRNA 3' end

formation, two independent genetic selections were utilized. In the first selection, a

mutation in the J3 gene was identified as an extragenic suppressor of a temperature

sensitive mutation in the Al 8R transcript release factor. In the second selection, several

J3 mutations were identified that cause the virus to be dependent upon the transcription

enhancing drug IBT. Biochemical inspection of these J3 mutants revealed that they fail









to produce large proteins at late times during infection because they make short, 3'

truncated postreplicative gene transcripts. By analogy with the previously described

mutations in the G2 transcription factor, this evidence indicates that J3 is also a

postreplicative positive transcription elongation factor.

Interestingly, the J3 protein has two previously described roles in mRNA

modification. It is a (nucleoside-2'-o-)methyltransferase that converts the cap-0 structure

at the 5' end ofmRNAs to the cap-1 form and at the 3' end it serves as the small

stimulatory subunit of the virally encoded poly(A) polymerase. Previous work has

demonstrated that the (nucleoside-2'-o-)methyltransferase and poly(A) polymerase

stimulatory activities are independent functions of the protein. To investigate the

relationship between the transcription elongation factor activity and the two other

activities, several site directed J3R mutant viruses were constructed and were evaluated

with respect to each of the three J3 functions. The analysis has shown that the positive

transcription elongation activity of J3R is a third independent activity of the protein that

can be genetically segregated from its two other roles in mRNA modification.
















CHAPTER 1
TRANSCRIPTION ELONGATION AND TERMINATION


Introduction

Life on earth manifests itself through a wonderfully diverse number of creatures.

Some current estimates suggest that there may be nearly ten million different species on

the planet (World Resource Institute 2001). Astonishingly, each of these organisms

subscribe to the central dogma of biology. That is, all of them physically exist as the

biochemical summation of their genetic makeup. Every living thing has its own

collection of genes that are exquisitely tuned for expression in precise temporal and

spatial patterns. Therefore, gene expression is regulated at many different levels

including transcription, mRNA splicing, translation, protein folding and modification,

and RNA or protein turnover. However, it is the regulation of transcription that provides,

by far, the most power and finesse to the control of gene expression.

The process of transcription would never occur without RNA polymerases, which

are the molecular machines that convert sequence information encoded by genes into

RNA transcripts. Three different types of RNA polymerases can be found in nature.

Most organisms, including bacteria, some viruses, and all eukaryotes, utilize multi-

subunit polymerases that specifically transcribe DNA templates. The other two types of

RNA polymerases that have been described are the single subunit DNA-dependent









polymerases and the RNA-dependent polymerases that are encoded by some

bacteriophage and viruses, neither of which will be discussed here.

The mechanical actions performed by all multi-subunit RNA polymerases during

transcription can be conceptually broken down into three main stages which are:

initiation, elongation, and termination (von Hippel 1998). During initiation, the subunits

of a polymerase are assembled on promoter sequences at the 5' end of a gene. This

process can be enhanced or prevented through the interaction of a wide variety of DNA-

binding protein factors and specific DNA sequences (Conaway et al. 1998a; Dvir et al.

2001). After a polymerase is assembled at the promoter, it requires stimulation from

initiation factors, some of which expend energy in the form of ATP, to unwind the DNA

template and begin transcription (Dvir et al. 1996). It has been observed that at the

beginning of transcription, the polymerase complex is relatively unstable until it has

transcribed approximately nine nucleotides. Thus, at each step of nucleotide addition

there is a competition between the dissociation of the complex from the template and

formation of the next phosphodiester bond. This process is often referred to as abortive

initiation (Conaway et al. 2000a). Escape from the promoter and the transition of the

polymerase into the elongation stage requires additional stabilizing protein factors that

are thought to increase the rate of nucleotide addition. In the case of eukaryotic pol II,

phosphorylation of the second-largest subunit of the polymerase is also required for the

transition from initiation to the elongation stage (Conaway et al. 2000a).

During elongation, the polymerase is quite stable, illustrated by the fact that it is

resistant to high salt concentrations in vitro. However, it is influenced by a variety of

sequence elements and protein factors that can either pause, arrest, or terminate









transcription (Conaway et al. 2000a). There are some subtle discrepancies in the

literature as to what defines a paused polymerase versus an arrested polymerase. For the

sake of consistency, a paused polymerase is defined here as one that has temporarily

halted transcription and is able to spontaneously continue elongation without the

influence of extrinsic factors. In contrast, an arrested polymerase is defined here as one

that has halted transcription and cannot continue elongation without the assistance of

additional factors that either cause termination or that assist the arrested complex so that

it can continue elongation. It has been observed that the 3' end of a nascent transcript in

a paused or in an arrested polymerase complex is often displaced from the catalytic site.

This phenomenon apparently results from the backward movement of the polymerase in

the 5' upstream direction and has thus been termed backtracking (Shilatifard 1998a;

Nudler 1999). A variety of proteins that help the polymerase readthrough a pause or

arrest site have been characterized over the last few years and some of these proteins, as

discussed later, are thought to help a backtracked polymerase re-align the transcript 3'

end in the catalytic site so that it can continue elongation (Wind and Reines 2000).

Conceivably, it may be impossible for some arrested polymerase complexes to continue

elongation due to the loss of an essential subunit or through destabilization of the

complex by nucleic acid secondary structure and other protein factors. The polymerase

then has no alternative but to release the transcript and the template in a process called

termination (Richardson 1993).

Transcription termination is defined as the irreversible release of the transcript

and polymerase complex from the template DNA. As described in more detail below, it

is known that for certain polymerases or for certain genes, termination occurs directly in









response to cis-acting signal sequences. However, termination of transcription often

occurs over a wide range of sequences downstream of a gene coding region and appears

almost random in nature (Proudfoot 1989a). In comparison to the process of initiation,

relatively little is understood about the sequences and factors that influence the general

process of termination. The primary reason for this, as mentioned later, is related to the

technical difficulties that are associated with designing experiments to address questions

about post-initiation events in transcription. However, some information about the

control of elongation and termination has accumulated through studies of model systems

that provide powerful genetic tools to take apart the transcription complex. The most

thoroughly examined polymerase systems are found in the bacteria Escherichia coli and

the budding yeast Saccharomyces cerevisiae. The following sections of this chapter

provide a summary of what is currently known about the different methods by which

bacterial and eukaryotic RNA polymerases carry out elongation and termination of

transcription. This summary is intended to generate a context for understanding the

regulation of post-initiation events in yet a third model system which is the subject of the

remainder of this work. Specifically, the investigation described in the following

chapters is focused on the discovery and characterization of the vaccinia virus J3 protein

which influences the process of viral transcript 3' end formation.


Regulation of E.coli RNA Polymerase Elongation and Termination

The E.coli RNA polymerase holoenzyme is composed of five subunits which

include P, 3', a (present in two copies), and a. The P, p', and two a subunits comprise

the core enzyme and are homologous to the core subunits found in the eukaryotic

polymerases I, II, and III. Several different a subunits exist and provide the core enzyme









with the ability to initiate transcription at various specific promoter sequences. Shortly

after the initiation of transcription, the core enzyme leaves the a subunit at the promoter

and enters the elongation phase of transcript synthesis (Lodish and Damell 1995).

Transcription elongation can be described as very dynamic or discontinuous

process (Conaway et al. 2000b). As previously mentioned, an actively transcribing

polymerase often pauses for a variety of reasons including: nucleotide starvation,

physical barriers such as DNA binding proteins, or in response to particular template

sequences. Some template sequences are barriers to elongation because they form weak

hybrids with the transcript or because they promote secondary structure in the transcript.

Additionally, stretches of homopolymeric residues may cause the polymerase to slip

during elongation and introduce mis-pairing between the RNA-DNA hybrid, thus leading

to a pause (Shilatifard 1998b). Regardless of the mechanism, it has been observed that a

paused polymerase often appears to slide backwards (Nudler 1999). When this occurs,

the polymerase cannot add more residues because the 3' end of the transcript is dislocated

from the catalytic site. E. coli encodes two elongation factors, called GreA and GreB,

that are important for resetting the transcript 3' end in the catalytic site and can thus help

a stalled polymerase continue elongation (Kulish, et al. 2000). GreA and GreB are

conserved in the bacterial kingdom and the E. coli proteins share 35% identity and 57%

similarity at the amino acid level. Both proteins have similar but slightly different effects

on a stalled polymerase complex. GreA and GreB both stimulate a backtracked

polymerase to cleave the nascent protruding transcript, and thereby restore the 3' end in

the catalytic site. However, GreA-induced transcript cleavage produces short RNAs that

are 2-3 nucleotides long whereas GreB-induced cleavage produces RNAs that are 2-18









nucleotides long (Kulish et al. 2000). Thus, GreA appears to be more specialized for

inducing cleavage by polymerases that have backtracked only short distances and GreB is

tuned to induce cleavage by polymerases that have backtracked greater distances.

Moreover, GreA is unable to induce cleavage in a preformed arrested complex, unlike

GreB. This suggests that GreA must be present in the polymerase complex before it

pauses, in order to induce cleavage. By inducing cleavage, both GreA and GreB can

reduce the amount of time spent at a pause-site. Less time spent dwelling at a pause-site

reduces the chance that the polymerase will become destabilized thus prevents premature

termination (Kulish et al. 2000). As discussed in later sections, the eukaryotic

polymerases also encode cleavage-inducing factors that have similar activities as GreA

and GreB.

There are two key mechanisms of termination in E.coli. One mechanism is called

factor-independent termination and it requires no other protein factors besides the core

polymerase itself to facilitate release of the elongation complex and transcript from the

template. The second mechanism is called factor-dependent termination and it requires

the action of a protein called rho to induce termination. In addition, two processes called

attenuation and antitermination are used to modulate the basic factor-independent and

dependent termination mechanisms. Specifically, attenuation leads to premature

termination of transcription while antitermination prevents it. Thus, the expression of

some bacterial genes can be regulated at the level of termination (Lodish and Darell

1995; Henkin 1996; Henkin 2000).

Factor-independent termination occurs when the polymerase transcribes a

particular sequence that has two characteristic features. First, these termination sites have









a short GC-rich section that can self-anneal and produce a stable hairpin structure.

Second, a stretch of 6 to 8 U residues is located just downstream of the hairpin (Lodish

and Darnell 1995; Mooney et al. 1998). The precise mechanism by which this sequence

induces termination is not completely understood. One model suggests that the hairpin

itself could destabilize the polymerase complex through direct interaction. Alternatively,

it could indirectly stimulate termination by disrupting the transcript/template hybrid or by

disrupting the interaction between the polymerase and the single stranded RNA that has

not yet emerged from the complex (Lodish and Darnell 1995). Some evidence supports a

direct interaction between the hairpin and the polymerase, but does not completely rule

out all of the possible indirect effects (Mooney et al. 1998). For example, the size of the

hairpins are conserved to a 5 to 9 nucleotide long stem with a 3 to 5 nucleotide long loop.

In some cases, it has been demonstrated that these hairpins can be crosslinked to the P

subunit of the polymerase. Additionally, it is known that factor-independent termination

sites are active even when the template is single stranded DNA. This evidence suggests

that neither the non-template strand nor the transcription bubble is required for

termination. It therefore seems likely that the hairpin could directly disrupt an interaction

between the transcript and a RNA binding site on the polymerase, thus destabilizing the

complex. The most probable mechanism by which factor-independent termination occurs

is that when the polymerase reaches the stretch of U residues, it pauses because of the

relatively weak nature of the transcript/template hybrid. Typically, a stalled complex

would backtrack along the template, cleave the nascent transcript in a fashion mediated

by GreA or GreB, and proceed to elongate. However, in this case, the hairpin could

prevent the complex from backtracking. The combination of the hairpin interaction with









a RNA binding site on the polymerase and the unstable nature of the U-rich transcript-

template hybrid could sufficiently destabilize the complex so that termination could

occur. Evidence supporting this model is provided by the observation that a terminator

site can be converted to a pause site by simply increasing the distance between the

hairpin and the U-rich stretch with a few additional nucleotides. Those extra nucleotides

would presumably allow the polymerase enough room to backtrack, cleave, and proceed

(Mooney et al. 1998).

As mentioned above, the termination mechanisms in E.coli can be modulated to

alter gene expression depending on the requirements of the cell. Factor-independent

termination can be modified by a system called attenuation that plays a role in the

expression of some bacterial genes including the operons that are required for amino acid

biosynthesis (Lodish and Darnell 1995). As an example, the tryptophan (trp) operon will

be considered here. Under conditions of relatively high tryptophan concentration, the

amino acid binds to a repressor protein that in turn binds to the trp operator sequence and

prevents the initiation of transcription. However, some transcription still occurs even in

the presence of tryptophan. To prevent those polymerases that actually initiate from

proceeding to transcribe the entire operon, a factor-independent terminator hairpin causes

the premature termination of transcription at a site located approximately 140 nucleotides

downstream of the initiation site. Interestingly, there are two sequence elements

upstream of the hairpin that modulate its efficiency as a terminator under varying

concentrations of tryptophan. The 5' most sequence element contains two successive

tryptophan codons. The second element is located between the tryptophan codons and

the terminator hairpin. This second element is capable of hybridizing to the bases located









in the 5' half of the terminator hairpin stem and can thus prevent the formation of the

terminator hairpin. As the transcript is being synthesized, a ribosome begins translating

it. Under high concentrations tryptophan, the ribosome can readily translate through the

region containing the tryptophan codons and cover the second sequence element. With

the second element obscured by the ribosome, nothing prevents the formation of the

terminator hairpin and premature termination occurs. Conversely, under low

concentrations of tryptophan, the ribosome pauses at the tryptophan codons in the 5'

element to search for trp-tRNAs. While the ribosome is paused, transcription continues

downstream and the second sequence element is synthesized. As the 5' half of the

terminator hairpin stem emerges from the polymerase complex, the second sequence

element binds to it and prevents the terminator hairpin from forming. The polymerase is

then free to continue transcribing the remainder of the operon (Lodish and Darnell 1995;

Korzheva and Mustaev 2001). This process of attenuation thus serves as yet another way

to fine tune gene expression based upon the metabolic needs of the cell.

Factor-dependent termination is the other major way that termination occurs in

E.coli. Approximately 50% of all terminator sequences in E.coli require the rho protein

(Lesnik et al. 2001). Rho-dependent termination was initially discovered during in vitro

transcription studies of X-phage DNA using purified E.coli RNA polymerase (Roberts

1969; Roberts 1975; Roberts 1988). The DNA template used for the transcription

reactions contained two X promoters called PL and PR. The purified polymerase

synthesized transcripts from the promoters that were several thousand nucleotides long.

It was known, however, that soon after a X infection, the transcripts synthesized in vivo

from these promoters were much shorter and were discrete in length; that is about 1000









and 500 nucleotides for PL and PR respectively. When extracts from uninfected cells

were added to the purified polymerase, the transcripts produced in vitro matched the

length of the transcripts produced in vivo. It was thus implied that there was a

component of the uninfected cell extract that caused the polymerase to terminate at the

discrete sites, called TL and TR. The termination factor was subsequently purified from

uninfected cell extracts and is now known as the rho protein (Roberts 1969; Roberts

1975; Roberts 1988). Interestingly, the 50-kDa rho protein shares 26% amino acid

identity and 58% similarity with the FI ATP synthase that is found in mitochondria (Stitt

2001). Although the rho crystal structure has not been solved, it is known that the protein

forms a hexamer that is composed of three homodimers and is therefore structurally very

similar to F1. In addition, the hexamer has three catalytic sites that can bind and

hydrolyze ATP in a RNA dependent fashion and it is able to wrap approximately 70-80

nucleotides of a nascent transcript around itself (Stitt 2001). Rho binds to sequences in

transcripts that are termed rut sites (for rho utilization). Many of these rut sites have

been identified in E.coli, but a comparison of the sequences has revealed no apparent

consensus with the exception of being very C-rich (Graham and Richardson 1998). The

precise mechanism by which rho induces termination is not clearly understood.

However, evidence suggests that the rho dimers are assembled around a nascent

transcript so that the RNA is actually threaded through the middle of the hexamer and is

additionally wrapped around the outside of the hexamer (Burgess and Richardson 2001).

The sequential hydrolysis of ATP bound in the three catalytic sites then drives the 5'-3'

translocation of rho along the transcript (Stitt 2001). It has been hypothesized that rho

travels down the RNA until it catches up to a polymerase complex that may be paused or









stalled. Upon reaching the polymerase, it is thought that rho facilitates the dissociation of

the complex by exerting a 5'-3' RNA-DNA helicase activity (Geiselmann et al. 1993;

Kim and Patel 2001). Thus, unlike factor-independent terminators, rho-dependent

terminators lack a precisely defined termination point (Richardson and Richardson 1996).

Additional studies of X-phage revealed yet another system of modulating

termination that in contrast to attenuation, prevents the termination of transcription and is

hence called antitermination (Lodish and Darnell 1995). In antitermination, the

polymerase is converted by protein factors to a termination resistant form that not only

reads through downstream terminators, but is less prone to pausing and arrest.

Antitermination in X is induced by two different proteins called N and Q. N prevents the

premature termination of transcription from the early promoters PL and PR, while Q

prevents termination from the late phage promoter (Henkin 1996). Although the

mechanism of action for N and Q are slightly different, only N will be considered here.

The N protein is expressed as the first open reading frame from the XPL promoter

and it functions to prevent rho-dependent termination at the TL and TR termination sites

described above, thereby allowing transcription of downstream genes at the appropriate

time during the phage life cycle (Lodish and Damell 1995). Certain X mutants have

demonstrated that N mediated antitermination requires a sequence element in the nascent

transcript, called a nut (for N utilization) site, that is located between the terminator and

the promoter. Nut sites are composed of two sequence elements, called BoxA and BoxB.

The BoxA consensus sequence is 12 nucleotides long and is located just upstream of the

BoxB element. BoxB forms a hairpin structure composed of a 5 base pair stem (of any

complimentary sequence) and a loop that must be 5'-GAAAA-3'. The N protein









specifically binds to the BoxB hairpin via an arginine-rich motif (ARM) that is conserved

among many RNA binding proteins. In addition to N, antitermination is coordinated by

several other host proteins which have been identified in studies ofE.coli mutants that are

resistant to X infection. These proteins are referred to as NusA, NusB, NusE, and NusG

(Nus stands for N utilization substance). The core antitermination complex is composed

of N, NusA, and the nut site. This core complex can prevent termination only over short

distances away from the nut site. However, a complex containing NusG, NusE, and

NusB can prevent termination over several kilobases downstream of the nut site. As the

polymerase elongates away from a nut site, the N and Nus proteins remain associated

with both the nut site and the polymerase. Thus, a loop of RNA is formed. The precise

mechanism by which antitermination occurs is not well understood, but several pieces of

information have provided hints about the general overall picture. It is known that NusA

is a normal component of the polymerase complex that serves to reduce the rate of

elongation and it weakly interacts with N. NusB binds to BoxA and is thought to recruit

NusE, which is also known as S10 and is a component of the small ribosomal subunit. In

addition, NusG has been shown to interact with both the polymerase and with rho. It is

hypothesized that N, while bound to BoxB, facilitates assembly of the Nus factors to the

polymerase complex and thus stabilizes the polymerase, converting it to a form that is

less prone to arrest and that is resistant to the effects of rho. Interestingly, N mediated

antitermination can suppress both factor-dependent and factor-independent termination

systems. This observation suggests that the stage at which termination is suppressed may

be common to both systems. It has therefore been hypothesized that N mediated

antitermination could stabilize the polymerase by preventing the disruption of









interactions between: 1) the template and transcript; 2) between the polymerase and

transcript; and/or 3) between polymerase and the template (Greenblatt et al. 1993; Lodish

and Darnell 1995; Weisberg and Gottesman 1999).


Regulation of RNA Polvmerase I Elongation and Termination

In addition to E.coli, the next most thoroughly understood termination mechanism

is that utilized by eukaryotic RNA polymerase I. Most of the information about pol I

termination comes from studies of S. cerevisiae, the frog Xenopus, and the mouse. Pol I

is composed of 14 subunits, including distinct homologues to the core subunits of the

E.coli enzyme. It is located in the nucleolus where it specifically transcribes the majority

of the ribosomal rRNA genes. Additionally, it is the most active polymerase in the cell,

accounting for 50-70% of all transcription (Lewin 1994; Lodish and Darnell 1995;

Reeder and Lang 1997).

To date, very little information has been published about the factors that regulate

the elongation stage of pol I transcription. However, it is known that pol I is served by a

cleavage-inducing elongation factor that is functionally analogous to the E.coli GreA

protein (Labhart 1997; Tschochner 1996). Although the identity of the pol I cleavage

factor has not yet been determined, the activity has been detected in both the Xenopus and

Saccharomyces cerevisiae systems. It is known, however, that the factor is not SII,

which is the eukaryotic RNA polymerase II cleavage and elongation factor that is

discussed in a later section. By analogy with GreA, it has been shown that the pol I

cleavage factor induces shortening of the transcript 3' end in a paused polymerase

complex by 1-2 nucleotides and thus stimulates the complex to continue elongation

(Tschochner 1996). In addition to the cleavage activity, a second pol I elongation factor









called TIF-IC has also been partially purified (Schnapp et al. 1994). TIF-IC has a native

molecular mass of 65-kDa, but it is not known if the factor is composed of more than one

protein. It has been shown that TIF-IC is required for pol I initiation, and that it

stimulates the overall rate of pol I elongation through an unknown mechanism. While it

is possible that both the pol I cleavage factor and TIF-IC may function to prevent

premature termination, it is not yet known if these two factors have any direct role in the

sequence specific pol I termination mechanism that is outlined below.

In contrast to the pol I elongation factors, more is known about the pol I

termination mechanism. In fact, pol I termination is relatively straightforward and is

thought to be well conserved among eukaryotes (Reeder and Lang 1997). Essentially,

pol I termination only requires three components: 1) a special bipartite DNA sequence; 2)

a sequence-specific DNA-binding protein; and 3) a transcript release factor. Although

more details will be provided below, a brief model of pol I termination suggests that the

polymerase stalls when it encounters the terminator protein bound to its specific site in

the DNA. The release factor then signals for release through binding the large subunit of

the polymerase, the terminator protein, and the 3' end of the nascent transcript. This

model is consistent with kinetic studies that have utilized magnetic bead-bound templates

which allow the separation of transcripts that have been released through termination

from those that are still bound to the template in a paused polymerase complex. These

types of experiments have shown that termination occurs in two phases where the

polymerase first pauses or arrests then second, the transcript is released. The pausing of

the polymerase is mostly controlled by the affinity of the terminator protein to its binding









site in the DNA. Release of the transcript is controlled by the presence of the release

factor and the sequence at the 3' end of the transcript (Reeder and Lang 1997).

The DNA sequence of all known pol I terminators is composed of two elements

(Reeder and Lang 1997). The first element is an 11-18 nucleotide long binding site for

the terminator protein. This binding site is located about 10 bases downstream of the

second element which is an A-rich section in the template strand that codes for the last

10-12 nucleotides of the transcript (Lang and Reeder 1995; Mason et al. 1997). The

terminator protein binding site facilitates the pausing stage of termination in an

orientation specific fashion. The sequences of the binding sites for the terminator

proteins found in different organisms do not appear to be conserved. However, the

terminator proteins themselves can mediate termination of pol I enzymes from other

organisms as long as they are supplied with their cognate binding site at the appropriate

location (Kuhn et al. 1990; Reeder and Lang 1997). The A-rich element facilitates the

release phase of termination. Although there is no consensus sequence for the A-rich

upstream element, replacement of the element with random DNA sequence abolishes

release. Briefly, there are two reasons for this. First, this sequence is required in the

nascent transcript for efficient binding of the release factor. Second, the sequence is

thought to cause limited polymerase slippage that in addition to the release factor,

mediates dissociation of the complex. It was hypothesized that replacing the A-rich

element with a homopolymeric stretch of A residues would promote more efficient

transcript release. However, this was surprisingly not the case (Jeong et al. 1996). When

this region is converted to all A residues, the polymerase slips and reiteratively

polymerizes thousands of U residues onto the 3' end of the transcript and is unable to









release. The insertion of a single non-homopolymeric residue into this region blocks

reiterative polymerase slippage and promotes termination, presumably by preventing

complete base-pairing between the RNA-DNA hybrid in the slipped complex. Without a

complete hybrid and with the terminator protein blocking further elongation, the complex

becomes destabilized and dissociates from the template. As a side note, it appears as if

RNA secondary structure plays no obvious role in pol I termination unlike factor-

independent termination in E.coli (Reeder and Lang 1997).

The S. cerevisiae and mouse pol I terminator proteins have been cloned and are

known as Reblp and TTF-1 respectively (Evers et al. 1995; Lang et al. 1994). The

ability of Reblp and TTF-1 to cause polymerase pausing is directly related to the ability

of the proteins to bind DNA. Both Reb p and TTF-1 have an 80 amino acid long DNA-

binding domain near the C-terminus that is related to the DNA binding motifs in other

transcription regulators such as the Myb oncoprotein, the SWI-SNF and ADA complexes,

the transcriptional co-repressor N-CoR, and the pol III transcription factor TFIIIB. It is

thought that the primary function of these proteins is to simply provide a roadblock to pol

I elongation that pauses the polymerase over the A-rich section in the terminator

sequence (Reeder and Lang 1997). Support for this hypothesis comes from evidence that

the non-homologous E.coli lac repressor protein and its binding sequence can substitute

for the activity of Reblp and facilitate termination in vitro. However, it was noted that

the release efficiency with the lac repressor is less than with Reb p (Jeong et al. 1995).

Importantly, these experiments were performed with pol I that was not highly purified.

When highly purified pol I was utilized in the lac terminator system, release was

dependent upon additional yeast protein fractions. This suggested that either Reblp









directly stimulated the polymerase to release or that there was another unidentified

protein which facilitated release in the absence of Reb p.

Subsequently, a release factor called PTRF (polymerase I transcript release factor)

was identified from the mouse by the two-hybrid system using TTF-1 as bait (Jansa et al.

1998). So far, homologues of PTRF have been identified in human and chicken. A

search of the yeast genome for a homologous protein has come up empty handed (Jansa

et al. 1999a). However, there is evidence indicating that there is a functional homologue

in yeast and it has been partially purified. In support of this, PTRF from the mouse can

release transcripts synthesized by yeast pol I that is halted by Reblp. Additionally, PTRF

mediates the release of transcripts synthesized by mouse pol I that is stalled by Reblp but

not from yeast pol I stalled by TTF-1. This suggests that some of the molecular

interactions required for release are conserved between mouse and yeast, whereas some

interactions are species specific. Co-immunoprecipitation experiments have shown that

PTRF interacts with both TTF-1 and the large subunit of pol I which is homologous to

the P' subunit of E.coli RNA polymerase, suggesting that PTRF forms a bridge between

the terminator protein and the polymerase. In addition, PTRF binds the 3' end of the

nascent transcript in a fashion that is dependent upon the U-rich sequence. Interestingly,

PTRF has functional properties that are similar to the La protein which has been

implicated as a pol III termination factor as discussed in the next section. Specifically,

both PTRF and La mediate transcript release by binding to the 3' end of the nascent

transcript. Additionally, both proteins can be isolated in two different forms that are

active or inactive for release. In the case of La, the activity is associated with reversible

phosphorylation. Unlike factor 2, which is a pol II transcript release factor discussed in a









later section, PTRF mediated transcript release is not ATP-dependent (Jansa et al. 1998;

Jansa and Grummt 1999b).

Interestingly, the 3' ends of pol I transcripts are subjected to minor nucleolytic

processing where the last 10 or so bases are removed from the transcript by a component

of the termination competent polymerase complex. It remains unclear exactly which

protein is responsible for this processing event, but it is known that it is not mediated by

TTF-1 (Kuhn et al. 1990). By analogy with the TFIIS pol II factor described later, it has

been speculated that PTRF could be responsible for the processing event or it may recruit

an additional processing factor. With this in mind, the following model has been

proposed: After pol I collides with TTF-1, it backtracks or slips revealing the last 3-4

nucleotides of the nascent transcript which are then bound by PTRF. The combination of

the slipped mis-paired hybrid and the initiation of 3' processing events destabilizes the

polymerase complex so that release can occur (Jansa et al. 1998;Jansa and Grummt

1999b; Jansa et al. 2001).


Regulation of RNA Polvmerase III Elongation and Termination

Eukaryotic RNA polymerase III is a 17 subunit enzyme found in the nucleus that

is responsible for producing a variety of small transcripts which fall into three different

classes based upon the structure and location of their promoters (Geiduschek and

Kassavetis 2001). Class I is represented by the 5S rRNA genes. Class II is represented

by the tRNAs, 7SL RNA, Alu repeat RNAs, the virus associated (VA) transcripts from

adenovirus, and some other small viral RNAs. Class III is represented by the small U6

and 7SK RNAs. The promoters of classes I and II are intragenic; that is they are found

downstream of the transcription initiation site and are transcribed as the 5' end of the









nascent RNA. Class III promoters are found upstream of the initiation site like pol I and

pol II promoters. Several pol III specific transcription factors are required for initiation

of each gene class. TFIIIA is specifically required for initiation of class I genes along

with TFIIIB and TFIIIC. Initiation of class II genes only requires TFIIIB and TFIIIC,

where as class III initiation requires TFIIIB and the factor SNAPc (Gunnery et al. 1999).

Pol III is unique among the RNA polymerases in that most of the transcripts it

synthesizes are only about 100-150 nucleotides long, in contrast to pol I and II which

transcribe genes that are thousands of nucleotides. In light of this, pol III requires an

efficient termination mechanism to rapidly recycle the polymerase for re-initiation of

transcription and is therefore, quite prone to termination. Although the mechanism of pol

III termination is unclear, some of the fundamental requirements have been suggested

(Geiduschek and Kassavetis 2001). It is thought that a small subunit of pol III, called

C11, and the second largest subunit, C128, are important for both elongation and

termination of transcription (Chedin et al. 1998). Cl 1 is a small essential subunit of yeast

pol III that shows homology to some small subunits of human pol I and II as well as the

TFIIS (also known as SII) subunit of pol II. By analogy to TFIIS and the E.coli

elongation factors GreA and GreB, C11 stimulates the pol III intrinsic 3' exonucleolytic

activity that shortens a nascent transcript in a paused complex to restore alignment of the

active site. As a side note, this pol III nucleolytic activity appears to be an intrinsic

property of the enzyme and thus appears more closely related to the intrinsic nucleolytic

activity of vaccinia virus RNA polymerase than to the TFIIS-dependent cleavage activity

of pol II or the GreA/GreB dependent cleavage of the E.coli enzyme (Hagler and Shuman

1993; Geiduschek and Kassavetis 2001). In the absence of C 1, pol III is actually less









prone to pausing and is strongly compromised in its ability to efficiently recognize

termination signal sequences. Evidence suggests that the C128 subunit is contains the

nucleolytic activity of the polymerase and is presumed to bind C 11.

It was initially thought that pol III termination simply resulted from the

recognition of a terminator sequence by the core polymerase. The terminator sequences

from most pol III genes is a short 4-6 base A-stretch in the template strand. However, it

was soon realized that the situation was more complicated because there are short A-

stretches in the middle of many pol III genes. In addition, a closer inspection of the

terminator signals found in several pol III genes revealed that there are important

differences between the signal sequences that correlate with gene classification (Gunnery

et al. 1999). For example, the 5S rRNA termination signal must be located in a GC-rich

sequence context for efficient termination to occur. The substitution of A for GC

residues located just upstream of the signal are deleterious to termination. By contrast,

the corresponding region just upstream of the termination signals for the U6 and tRNA

genes are 4-5 times more A-rich than the 5S rRNA signal. In addition, substitution of A

for G residues in the VA RNAI terminator from adenovirus-2 actually increases

termination efficiency. Thus, it seems as if class II and class III transcripts share a

similar termination mechanism that is different from the class I genes. It stands to reason

that if the pol III holoenzyme itself were sufficient for recognizing the termination

signals, all the signals would be the same. Since this is not the case, it has been

hypothesized that pol III termination is a factor-dependent process. It is plausible that the

differences among promoters of the various gene classes serve as the basis for recruiting

different termination factors, and could explain the variability among the sequence









context requirements for the different terminators. For example, TFIIIA is a class I

specific initiator and may recruit specific factors that are necessary for termination in a

GC-rich context. In contrast, TFIIIC or SNAPc could recruit termination factors that are

suited to the more A-rich context of the class II and III terminator sequences (Gunnery et

al. 1999; Geiduschek and Kassavetis 2001).

Several proteins have been shown to stimulate pol III termination although a

precise role has not been defined for any of them nor is it clear that they are required for

termination under all circumstances. Evidence suggests that the TFIIIC initiation factor

and some of its associated proteins enhance termination by human but not S. cerevisiae

pol III (Huang and Maraia 2001; Geiduschek and Kassavetis 2001). It is known that

TFIIIC can bind along the length of an entire pol III gene from its promoter through the

terminator sequence and is sufficient for release at some terminators. The binding of

TFIIIC to the terminator regions of some pol III genes has been shown to be facilitated by

the PC4 (positive cofactor 4) and topoisomerase I proteins as well as the heterogeneous

NF-1 (nuclear factor 1) family of proteins (Wang and Roeder 1998; Wang et al. 2000).

Interestingly, PC4 and topoisomerase I have been previously described as general

coactivators of pol II transcription that facilitate the formation of the TFIIA-TFIID

complex at the TATA box in the promoter. Additionally, topoisomerase I is important in

pol I transcription for relieving the torsional strain associated with elongation. The NF-1

family members bind to the consensus sequence 5'-YTGGCA(N3)TGCCAR-3' which is

found in two different terminators of the pol III VAl gene. Although it is known that

PC4, topo I, and NF-1 proteins enhance pol III termination efficiency through facilitating

TFIIIC binding to terminator regions, it is not known if they perform any other specific









function in directly inducing release of the transcript (Wang and Roeder 1998; Wang et

al. 2000; Geiduschek and Kassavetis 2001).

It has been reported that the human autoimmune antigen La is an essential pol III

termination factor although there has been published evidence to the contrary

(Geiduschek and Kassavetis 2001). La is a RNA binding phosphoprotein that has strong

affinity for RNAs having UUU-OH-3' as the last three nucleotides and thus commonly

associates with pol III transcripts. In addition, it can also bind to the 5'-ppp ends of

nascent transcripts and is found associated with the pol III holoenzyme. HeLa extracts

depleted of La loose up to 99% of their pol III transcription activity. Additionally, in

vitro transcription experiments with immobilized templates have suggested that the

unphosphorylated form of human La facilitates pol III recycling by stimulating release

and reinitiation of the polymerase from certain terminators (Maraia et al. 1994; Maraia

and Intine 2001). However, in contrast to the human La protein, evidence indicates that

La from Xenopus plays no role in pol III termination at all (Lin-Marq and Clarkson

1998). Thus, the significance of La as a pol III general termination factor remains

undetermined.

In summary, a simple model of pol III termination would predict that the pause-

release activity of the holoenzyme Cl 1 subunit is switched off by a variety of extrinsic

factors that are recruited based upon the sequence context in which the terminator is

located. It is possible that polymerase is stalled by either the terminator element itself or

by TFIIIC bound to the terminator. With the Cl 1 subunit unable help reset the active site

through induction of intrinsic cleavage, the complex is left to dissociate either on its own

or by the action of La (Geiduschek and Kassavetis 2001).









Regulation of RNA Polymerase II Elongation and Termination

Eukaryotic pol II is responsible for synthesizing the messenger RNAs (mRNAs)

that encode most cellular proteins. The pol II holoenzyme consists of twelve subunits,

including core subunits that are homologous to oa, P, and |3' of the E.coli enzyme and six

subunits that are shared with pol I and III. In addition to the holoenzyme, a multitude of

general and gene-specific factors that are required for pol II initiation have been

described. Pol II initiation minimally requires five general initiation factors which are:

TFIIB, TFIID, TFIIE, TFIIF, and TFIIH (Conaway et al. 2000b). Interestingly, TFIIF

participates in both initiation and elongation. As an initiation factor, TFIIF binds the

polymerase and stabilizes its interaction with the initiation factors TFIIB and TFIID. In

its role as an elongation factor, TFIIF increases the rate of nucleotide addition and thus

reduces abortive initiation and facilitates promoter escape (Conaway et al. 1998b)

(Moreland et al. 1999; Yan et al. 1999). Besides TFIIF, several other factors have been

described that either positively or negatively affect pol II elongation. As described in

more detail below, these factors fall into 4 categories based on their mechanism of action:

1) elongation rate enhancement; 2) transcript cleavage; 3) CTD modification; and 4)

chromatin remodeling.

In addition to TFIIF, three other proteins called ELL, elongin, and CSB have been

shown to increase the rate of pol II transcription, although the precise mechanism of

action for each remains unknown (Conaway et al. 2000b). The ELL elongation factor was

identified as a gene that is frequently translocated with the MLL gene in acute myeloid

leukemia (AML). It was discovered that ELL is part of a complex called holo-ELL that

is formed with three additional proteins called EAP20, EAP30, and EAP45. ELL has









been shown to bind pol II and suppress pausing by stimulating the catalytic rate of the

polymerase (Shilatifard 1998c). Elongin is a second factor that stimulates the elongation

rate of pol II and is composed of three subunits simply called A, B, and C. It has been

shown that elongin is able to increase the catalytic rate of pol II only after the first 8-9

nucleotides have been polymerized, suggesting that pol II undergoes some structural

change after leaving the promoter that makes it susceptible to elongin activation.

Additionally, elongin has been shown to increase the rate of transcript synthesis by the

polymerase regardless of the concentration of free ribonucleotides, suggesting that

elongin does not simply decrease the kcat or increase the KM of the enzyme. It has been

hypothesized that during transcription, a polymerase cycles between catalytically active

and inactive forms at each step of nucleotide addition. It is thought that elongin functions

either by directly converting an inactive polymerase to the active form or by locking an

active polymerase into the active conformation until the incoming ribonucleotide is

positioned in the active site and the phosphodiester bond is formed (Moreland et al.

1998). Finally, the Cockayne syndrome group B (CSB) protein is thought to play a role

in a human inherited developmental disorder that results in "cachectic dwarfism" (Selby

and Sancar 1997). Affected patients are mentally retarded due to impaired neurological

development and usually die by age 12. Cells from CS patients are defective for

transcription-coupled DNA repair, so it was originally hypothesized that CSB was a

transcription-repair coupling (TRC) factor. However, evidence now suggests that CSB

probably does not have a direct role in transcription-repair, but rather serves to stimulate

the rate of pol II elongation. By enhancing elongation, it is thought that CSB increases

the rate at which pol II becomes blocked at sites of DNA damage and elicits repair.









Interestingly, CSB has been shown to inhibit pol II cleavage activity induced by a factor

called TFIIS (described below) and is thought to directly recruit repair factors to sites of

DNA damage. It has been hypothesized that TFIIS may interfere with transcription-

repair coupling factors by inducing repeated shortening and elongation of the transcript.

Simultaneous inhibition of TFIIS and binding of repair factors would thus facilitate

readthrough by an arrested polymerase (Selby and Sancar 1997).

Like the E.coli polymerase and the eukaryotic polymerases I and III, pol II also

has a pause-suppressing transcript-cleavage factor with an activity that is analogous to

GreA and GreB. As just mentioned, the pol II cleavage factor is known as TFIIS (or SII)

(Wind and Reines 2000). TFIIS is a zinc-containing 35-kDa protein that stimulates the

intrinsic ribonucleolytic activity of pol II to reactivate it from an arrested state. Although

it is not known how TFIIS induces cleavage by the polymerase, it is known that it

directly binds to the polymerase and requires magnesium for activity. In addition to

assisting polymerases that have stalled due to intrinsic template sequences, it has been

shown that TFIIS also enables the polymerase to transcribe past some DNA-bound

proteins and small DNA-bound drugs. However, it will not enable the polymerase to

transcribe past a cyclobutane pyrimidine dimer, which is a common type of UV light

induced DNA damage (Wind and Reines 2000).

A third class of transcription elongation factors function by altering the carboxy-

terminal domain (CTD) of the second largest subunit of pol II (Conaway et al. 2000b).

The pol II CTD is characterized by the heptapeptide YSPTSPS that is repeated between

26 and 52 times from yeast to mammals respectively. Importantly, the CTD can be

highly phosphorylated and thus provides a means to regulate various aspects of









transcription. More specifically, the CTD is hypophosphorylated during initiation and

becomes hyperphosphorylated during elongation (Hirose and Manley 1998a). Early

efforts to identify the role of CTD phosphorylation in transcription utilized a drug called

5,6-dichloro-1-P-D-ribofuranosyl-benzimidazole (DRB), which is a protein kinase

inhibitor. Fractionation of DRB-sensitive transcription systems led to the isolation of one

DRB-sensitive positive-acting elongation factor called PTEF-b and two negatively acting

factors called NELF and DSIF (Conaway et al. 2000b). PTEF-b (positive transcription

elongation factor b) is a cyclin dependent kinase composed of the cyclin dependent

kinase Cdk9 (also referred to as PITLARE) and one of several cyclins including Tl, T2,

and K (Price 2000). Current evidence suggests that PTEF-b mediated phosphorylation of

the pol II CTD is required to prevent arrest of an elongating complex. In addition, PTEF-

b may play a similar role in termination because, as described later, the CTD serves as a

type of central signal processing center where many different transcript processing and

termination factors can bind depending on the phosphorylation status of the CTD (Price

2000). NELF (negative elongation factor) is a complex that is composed of at least five

novel proteins ranging from 46-66 kDa and DSIF (IDRB sensitivity-inducing factor) is a

heterodimer of 160 and 16 kDa subunits. Interestingly, NELF and DSIF bind to each

other and to pol II. Without both NELF and DSIF, purified pol II is not inhibited by

DRB. The exact mechanism by which DSIF and NELF modulate elongation is not

known. However, it has been shown that they suppress transcription elongation through

interactions with a polymerase that contains a hypo-phosphorylated CTD, and are thus

antagonized by PTEF-b (Wada et al. 1998; Yamaguchi et al. 1999).









Finally, the fourth class of pol II elongation factors stimulate elongation by

modifying chromatin to make it more accessible for the initiation and elongation stages

of transcription. Members of this class include the SWI/SNF, HMG-14, FACT, and the

elongator protein (Conaway et al. 2000b). SWI/SNF is actually a large family of proteins

that remodel nucleosomes and are conserved throughout eukaryotes (Sudarsanam and

Winston 2000). These proteins were originally discovered in yeast, where they are

important for expression of the HO endonuclease gene that is important for mating type

switching (S.Itching) and the SUC2 gene which is required for sucrose fermentation

(Sucrose Non-Fermenter -SNF). Although the mechanism of action for the SWI/SNF

complex is unknown, it has been shown that it changes the rotational phasing of DNA on

histone octamers in an ATP-dependent fashion so that the DNase I digestion pattern is

altered. Additionally, it has been shown that an ATP-dependent activity in fractions

containing the SWI/SNF complex can stimulate pol II elongation from the HSP70

promoter by remodeling nucleosomes downstream of the transcription start site

(Sudarsanam and Winston 2000; Conaway et al. 2000b). In addition to SWI/SNF, HMG-

14 is a non-histone protein that preferentially associates with active chromatin and

stimulates pol II elongation. It is thought that HMG-14 activates elongation by

interacting with the histone protein HI, which normally serves to condense chromatin

into a highly condensed, transcriptionally inactive form. Although the mechanism of

HMG-14 action is unknown, it appears to disrupt the interactions between adjacent HI

molecules to provide more space between nucleosomes and relax the chromatin structure

(Ding et al. 1997; Ding et al. 1994). FACT (facilitates chromatin transcription) is a third

protein that stimulates pol II elongation on chromatin templates that specifically lack the









histone HI protein. Once again, the mechanism of action is not clear, but FACT appears

to interact with histone H2A-H2B protein dimers to promote nucleosome disassembly

during transcription. The elongator protein has been shown to interact with an elongating

pol II that has a hyperphosphorylated CTD and the SII cleavage factor. In addition, it

also has histone acetyltransferase activity suggesting that it may stimulate elongation by

modifying and destabilizing nucleosomes that are blocking polymerase elongation

(LeRoy et al., 1998; Orphanides et al. 1998).

To summarize, a large number of factors that stimulate pol II elongation have

been discovered over the last few years. Although the precise mechanisms by which

many of the factors modulate elongation is not known, it seems that there are two major

ways that elongation factors work. First, transcript cleavage appears to be a fundamental

mechanism by which multi-subunit polymerases, including pol II, overcome pause and

arrest sites. This is demonstrated by the fact that all of the polymerases considered thus

far have the intrinsic ability to cleave the nascent transcript, and all but pol III have

known extrinsic factors that stimulate the cleavage activity when the polymerase

becomes paused. The second type of elongation factor appears to directly stimulate the

rate of elongation by a number of possible mechanisms. Some of the factors considered

here have been shown to directly bind pol II or alter its structural properties. By doing

so, these factors could convert or lock the polymerase into an active conformation that is

less prone to pausing between each step ofnucleotide addition. Finally, the proteins that

remodel chromatin have an obvious role in making a condensed template accessible and

in clearing the path for an elongating polymerase.









In contrast to pol I and III transcripts, most pol II transcripts are modified in

several ways both during and after synthesis. Not surprisingly, pol II termination is

thought to be linked to some of these modification steps (Lodish and Darnell 1995; Zhao

et al. 1999). Most pol II transcripts are capped and methylated at the 5' end. In addition,

primary pol II transcripts have large segments of non-coding sequence called introns that

are removed from the final messenger RNA by a process called splicing. The 3' ends of

mRNAs are not formed by termination as is the case for transcripts produced by the other

polymerases considered thus far. Rather, mRNA 3' ends are formed by a cleavage event

that is mediated by several proteins acting together in response to a conserved signal

sequence located in the transcript. Cleavage of the transcript frees what will become the

mature mRNA from the nascent RNA that is still associated with the pol II enzyme. The

mRNA 3' end is polyadenylated while pol II is left to continue elongating the nascent

transcript downstream. Pol II then terminates in a seemingly random fashion at various

places that may be up to four kilobases downstream of the cleavage/polyadenylation site

(Lodish and Darnell 1995). There are only two known classes of pol II transcripts that

are not polyadenylated or terminated in this fashion and they will be considered in more

detail later. How pol II decides to terminate is unclear. Progress in elucidating the pol II

termination mechanism has been hindered because the nascent transcripts, which could

perhaps be used to identify termination signal sequences and proteins, are highly

sensitive to degradation and are difficult to detect. However, several clues are beginning

to provide a framework for understanding the general termination mechanism and are

described in more detail below.









It is known that termination ofpol II transcription requires a functional

polyadenylation signal in addition to certain protein factors that mediate transcript

cleavage (Proudfoot 1989b; Lodish and Damell 1995; Zhao et al. 1999). Moreover, it

has been repeatedly observed that the efficiency of termination directly correlates with

the strength of the poly(A) signal. The core polyadenylation signal in mammals consists

of three sequence elements. First, there is a highly conserved sequence, AAUAAA, that

is found 10-30 bases upstream of the cleavage site. Second, there is a less-highly

conserved U or GU-rich element that is located within 30 bases downstream of the

cleavage site. Third, is the cleavage site itself which eventually becomes the site of

poly(A) addition and is essentially determined by the distance between the AAUAAA

and the U/GU-rich elements. Often, cleavage occurs on the 3' side of a CA-dinucleotide.

In addition to the core signal sequence, multiple protein factors are required for cleavage

and polyadenylation (Zhao et al. 1999). Cleavage in mammals requires the action of at

least five protein factors including CPSF (cleavage and polyadenylation specificity

factor) which is responsible for recognizing the AAUAAA sequence; CstF (cleavage-

stimulatory factor) which binds to the U/GU-rich element; CF Im and CF IIm (cleavage

factor Im and IIm), PAP (the poly(A) polymerase), and pol II itself. Polyadenylation

requires PAP, CPSF, and PAB II (poly(A)-binding protein II) (Zhao et al. 1999).

It is thought that the cleavage and polyadenylation machinery associates with pol

II at the promoter and is delivered by the polymerase to the 3' end of the transcript. In

fact, it has been shown that CPSF binds to the transcription initiation factor TFIID which

is important for assembly of the preinitiation complex at pol II promoters (Dantonel et al.

1997). CPSF can be found both in preinitiation complexes and in elongating complexes









formed in vitro, suggesting that the polyadenylation machinery is recruited by TFIID to

the preinitiation complex and is then transferred to the polymerase as it begins elongation

(Zhao et al. 1999). The association between the cleavage/poly(A) factors and pol II is

facilitated by the unique carboxy-terminal domain (CTD) of the largest pol II subunit

(Hirose and Manley 1998b). The CTD is characterized by the heptapeptide YSPTSPS

that is repeated between 26 and 52 times from yeast to mammals respectively.

Importantly, the CTD can be highly phosphorylated and thus provides a means to

regulate various aspects of transcription. More specifically, the CTD is

hypophosphorylated during initiation and becomes hyperphosphorylated during

elongation (Hampsey 1998). It has been shown that CPSF and CstF can bind to both the

hypophosphorylated and hyperphosphorylated forms of the CTD (McCracken et al.

1997). Two lines of evidence suggest that CstF and the CTD are required for

termination, although it is known that cleavage at the poly(A) site is not a prerequisite for

termination (Dye and Proudfoot 2001). First, experiments with yeast that contain

temperature sensitive mutations in CF IA, the homologue of mammalian CstF, have

shown that cleavage, polyadenylation, and termination are all inhibited at the non-

permissive temperature (Birse et al. 1998a). Second, analysis of CTD truncation mutants

show that the CTD is required for splicing, cleavage, polyadenylation and termination

(McCracken et al. 1997).

Insight to the requirements of the poly(A) signal and the role of various cleavage

factors in termination has been provided by a very recent examination of the human 3

and e-globin genes by Dye and Proudfoot (2001). They discovered that in addition to

poly(A) site cleavage, there is a heterogeneous and reiterative endonucleolytic cleavage









of the nascent transcript that is dependent upon poorly defined AT-rich sequence

elements in the 3' flanking region downstream of the poly(A) site. This type of cleavage

appears to chop off 5' pieces of the nascent transcript while the polymerase continues

elongation. They referred to this phenomenon as "pretermination cleavage" (PTC) and

demonstrated that PTC is required for termination from these two genes. It was shown

that PTC does not require a functional poly(A) signal and is independent of the

processing events at the poly(A) site. In addition, when PTC was abolished by deleting

segments of the 3' flanking region, processing at the poly(A) site appeared normal.

Furthermore, it was shown that the poly(A) signal is required for release of the transcript

and the polymerase from the template. These results are consistent with another recent

observation by Osheim et al. (Osheim et al. 1999) that suggests termination requires a

poly(A) signal, but does not require transcript cleavage at the poly(A) site. Although the

protein(s) that mediate PTC cleavage remain unidentified, it is quite possible that some of

the same proteins that are required for the poly(A) site cleavage are responsible for PTC

as well. Alternatively, PTC could be an intrinsic activity ofpol II that is analogous to the

activity mediated by the Cl 1 subunit ofpol III. In fact, it is known that the pol II

elongation factor TFIIS stimulates an intrinsic endonucleolytic activity to help the

polymerase through roadblocks during elongation. However, the type of cleavage

mediated by TFIIS in a paused complex effectively removes a 3' piece of the transcript,

allowing the polymerase to continue elongating the 5' portion. In the case of PTC, it

appears as if the 5' upstream piece of the transcript is removed while the polymerase

continues elongation of the 3' portion. Despite the fact that there has been no previously

described role for TFIIS in termination and while it seems unlikely from a mechanistic









standpoint, TFIIS activity could be modulated in some way to facilitate PTC and

termination (Dye and Proudfoot 2001).

Based on these new results, it appears as ifpol II termination may occur in two

steps (Dye and Proudfoot 2001). Hypothetically, the transcript first undergoes PTC in a

poorly-defined sequence-specific fashion. It is predicted that the PTC cleaved pre-

mRNA remains associated with the polymerase as it continues elongation of the nascent

transcript. This association could facilitate cleavage and polyadenylation at the upstream

poly(A) site. The 3' processing machinery, while bound to the poly(A) site, could

destabilize the polymerase through direct interaction and induce the second step of

termination, which is transcript release. This model is also not inconsistent with a

previously described model which proposes that an anti-termination factor is released

from the polymerase complex upon transcription of the poly(A) signal (Logan et al. 1987;

Proudfoot 1989b). While these exciting new results await independent confirmation,

they have offered insight to the role that the poly(A) signal plays in the termination

process. However, still unexplained by these results is the observation that termination

generally occurs over a broad range of thousands of bases downstream from the poly(A)

signal. PTC and 3' processing are probably only one part of the entire process. Indeed,

several other factors have been implicated in pol II termination and are described in more

detail below (Zhao et al. 1999; Aranda and Proudfoot 2001).

The hallmark of termination is the actual release of the transcript and polymerase

from the template. As just mentioned, it is known that the poly(A) signal is required for

release, but the mechanism is not understood. A protein called factor 2 was originally

characterized as a member of the Drosophilia N-TEF (negative transcription elongation









factor) complex and has been shown to facilitate transcript release during premature

termination that often occurs upstream of the poly(A) signal (Xie and Price 1997).

Although the mechanism of factor 2 mediated transcript release is not known, it has been

demonstrated that the protein is a double-stranded DNA dependent ATPase. In addition,

factor 2 has seven conserved helicase motifs that are characteristic of the helicase

superfamilies 1 and 2. However, it has been shown not to have helicase activity itself

(Zhao et al. 1999). Interestingly in this regard, it is similar to the vaccinia virus early

gene termination factor NPH-1 nucleosidee phospho-hydrolase 1) that is discussed in the

last section of this chapter (Xie and Price 1996). Factor 2 is also a member of the

SWI2/SNF2 protein family (Xie and Price 1998). It has been suggested that the

SWI2/SNF2 family members use ATP hydrolysis to disrupt protein-DNA interactions.

Regardless of its mode of action, the N-TEF complex promotes abortive transcription

initiation which is characterized by the reiterative synthesis of short transcripts as the

polymerase tries to escape the promoter. The activity of N-TEF is antagonized by the

influence of the P-TEF (positive transcription elongation factor) complex. Interestingly,

a component P-TEF, called P-TEFb, is a kinase that phosphorylates the CTD ofpol II

and thus promotes the transition from abortive initiation to processive elongation

(Hampsey 1998; Shilatifard 1998a). It could be that the phosphorylation of the CTD

disrupts a potential interaction with factor 2 in order to prevent premature termination.

Although it has not yet been demonstrated, factor 2 may play a similar role in mediating

transcript release during normal termination downstream of the poly(A) site and may

require the action of a yet unidentified CTD-specific phosphatase.









Given that there is a great deal of functional conservation between the prokaryotic

and eukaryotic transcription systems, it is surprising to note that based on sequence

homology, the bacterial termination factor rho does not have a eukaryotic homologue

(Richardson 1993; Platt 1994). It is possible, however, that a functional homologue

exists and in fact, there is some evidence to support it (Wu and Platt 1993; Lang et al.

1998). Purified yeast pol II can be induced to pause at both intrinsic DNA elements and

through the action of DNA binding proteins such as the pol I termination factor Reb lp or

the lac repressor protein. When pol II is paused in this manner, the addition of bacterial

rho protein causes the release of the polymerase in an ATP-dependent fashion if a rho

binding site is present in the transcript. Interestingly, rho has no effect on a paused pol I

or pol III complex. In conjunction with previous observations, this suggests that the

termination mechanism utilized by pol II more closely resembles bacterial rho-dependent

termination while the mechanism used by pol I and III appears more similar to rho-

independent termination. In addition, several eukaryotic proteins besides factor 2 have

helicase motifs and have been shown to play roles in various aspects of transcription from

chromatin remodeling and transcription initiation to transcription-coupled repair. By

analogy with the rho helicase, it is possible that one or more of these putative helicases

plays an important role in pol II termination (Zhao et al. 1999).

As just mentioned, it is known that pol II can be artificially paused by site-

specific DNA binding proteins and by sequence elements that intrinsically facilitate

pausing. By analogy with pol I, it is conceivable that pausing also plays an important

role in pol II termination. One model that is reminiscent of rho-dependent termination in

E.coli suggests that the 5' unprotected end of the nascent transcript may be subject to









attack by a 5'-3' exonuclease that could chase down the polymerase and disrupt the

elongation complex (Eisen and Lucchesi 1998; Zhao et al. 1999). This process could be

enhanced if the polymerase were paused at a downstream site and is not necessarily

inconsistent with the discovery ofpretermination cleavage. In fact, PTC endonucleolytic

cleavage could shorten the distance that a hypothetical 5'-3' exonuclease would have to

travel to catch up with pol II. Although there does not appear to be any sort of canonical

pause element that is required for termination from all pol II genes, a couple of pause

sites have been described that may be important for termination from at least two

different genes and are worth pointing out. The first example is a 92 basepair element

located just downstream of the poly(A) site in the human a2-globin gene which contains

six nearly perfect tandem repeats of the pentanucleotide CAAAA within a CG-rich

context on the template strand (Enriquez-Harris et al. 1991). This sequence weakly

stimulates intrinsic pausing and enhances but is not required for 3' processing at the

poly(A) site. Interestingly, it is functional in only one orientation. By analogy with TTF-

1/Reblp binding sites at the pol I terminator, this observation would suggest that the a2-

globin pause site may be bound by a protein. However, no such terminator proteins have

been found associated with this site nor is it predicted to promote secondary structure

formation in RNA or DNA. The second example of a pause element is the palindrome

sequence G5AGs which is located between the closely spaced human compliment genes

C2 and factor B (Ashfield et al. 1991; Yonaha and Proudfoot 1999). Originally, this site

was characterized as a sequence that binds the zinc-finger transcription factor MAZ

(Ashfield et al. 1994). It was first thought that MAZ acted as a roadblock to induce

pausing, but it was later demonstrated that the GsAG5 sequence was able to weakly









induce intrinsic pausing and stimulate 3' processing in the absence of MAZ (Yonaha and

Proudfoot 1999). The role of these two pause sites remains unclear. It is known that

termination occurs within a few hundred bases of these sites unlike most pol II genes

where termination occurs over thousands of nucleotides downstream of the poly(A)

signal. This observation makes sense in the case of the C2 gene, where termination must

occur close to the poly(A) site to prevent interference with the factor B promoter.

Mechanistically, it could be that a weak pause site might give the polymerase some extra

time to interact with the poly(A) site and 3' processing machinery. The 3' processing

factors could then more effectively induce release (Zhao et al. 1999).

Yet another mRNA processing activity that is linked to pol II termination is

splicing of the exon closest to the poly(A) site (Dye and Proudfoot 1999; Zhao et al.

1999). Specifically, the splice acceptor site that is located between the final intron/exon

boundary is required for normal termination efficiency. Interestingly, it has been shown

that the U2AF-65 splicing factor, which binds the poly-pyrimidine tract just upstream of

the splice acceptor, also binds to the carboxy-terminus of the poly(A) polymerase

(Vagner et al. 2000). Although once again the mechanistic details are not understood, it

appears as if many of the mRNA processing events are initmately associated. It is known

that factors involved in all steps of mRNA processing can bind to the CTD of pol II

(McCracken et al. 1997; Zeng and Berget 2000; Fong and Bentley 2001). Thus, the

CTD may functionally integrate signals from the processing machinery at all stages of

transcription to influence the decision of the complex to terminate. Such a common link

between 3' processing events may insure that termination does not occur prematurely and

may prevent mRNAs that are not correctly processed from leaving the nucleus.









As previously mentioned, there are two categories of transcripts that are

exceptions to the general scheme of pol II termination described above. First, are the

transcripts encoding histone proteins, which are the only known mRNAs that are not

polyadenylated. The 3' ends of histone transcripts are formed through a cleavage event

that is signaled by a 16 nucleotide long stem-loop followed by a purine-rich binding site

for the U7 snRNP. Cleavage occurs between the stem-loop and the U7 binding site while

transcription continues for several hundred bases downstream before the polymerase

terminates by a poorly defined mechanism. Although the details are unclear, it is known

that termination in this case depends upon cleavage at the 3' processing site, which

requires U7 snRNP and a stem-loop binding protein (SLBP) (Gick et al. 1986; Cotten et

al. 1988; Vasserot et al. 1989; Chodchoy et al. 1991; Gu and Marzluff 1996). The

second exception to the general termination mechanism is characterized by the U1, U2,

U4, and U5 snRNAs (small nuclear RNAs). These non-polyadenylated RNAs are

structural components of the snRNP particles that are involved in splicing pre-mRNA.

The 3' ends of these particular snRNAs appear to be formed under the direction of a

conserved signal sequence GTTTNo.3AAAPuNNAGA which is called the 3' box

(Hernandez and Weiner 1986; de Vegvar et al. 1986). It was originally thought that this

sequence may have directly stimulated termination. However, some new evidence

suggests that this sequence directs endonucleolytic cleavage and trimming of the

transcript while the polymerase continues transcribing downstream like it does in all

other cases. Interestingly, the 3' box fails to direct termination if the transcript is not

initiated from an authentic snRNA promoter. Limited footprinting analysis suggests that

the region downstream of the UI 3' box is bound by an unidentified protein(s) that could









pause the polymerase (Cuello et al. 1999). Thus, snRNA termination is also not well

understood. However, it seems that termination of histone and snRNA transcripts is

dependent upon cleavage like other pol II transcripts.

In summary, the mechanism of pol II termination remains the least understood of

all polymerases. However, it is apparent that nearly all events encompassing RNA

synthesis are integrated through the CTD ofpol II to influence termination efficiency

(McCracken et al. 1997; McCracken et al. 1998). By requiring signals from the promoter

and the 3' processing machinery, which must take into account alternative splicing and

polyadenylation sites, the polymerase is prevented from releasing a transcript that is not

correctly processed. In general, pol II termination is inhibited until the 3' processing

machinery has begun to act upon signals located at the prospective 3' end. While the 3'

end of the mature RNA is formed and modified, pol II continues to elongate the cleaved

nascent transcript. Evidence suggests that the 3' processing machinery directly interacts

with the polymerase to cause transcript release (McCracken et al. 1997; McCracken et al.

1998). However, the evidence does not rule out several other possibilities which include:

1) the loss of an anti-termination factor from the polymerase complex upon transcription

of the processing signal, 2) a 5'-3' exonuclease that travels down the nascent transcript to

dissociate the polymerase from the template, and 3) pausing induced by intrinsic

sequences and/or DNA-binding proteins that enhance the action of other termination

factors.


Elongation and Termination in Context

Knowing that there are many structural and functional similarities between all of

the multi-subunit polymerases described above, the lack of conservation between the









termination mechanisms is initially somewhat surprising. However, the differences

probably reflect overall strategies for polymerase regulation in the context of the entire

organism. For example, bacteria need simple ways to rapidly coordinate the expression

of several genes at once in response to metabolic requirements imposed by the

environment. To accomplish this, many genes in the same metabolic pathway are

expressed under one promoter as a polycistronic message (Lodish and Darnell 1995). As

a supplementary control to the regulation of initiation, termination can be modulated by

feedback inhibition loops which provide a straightforward way for bacteria to fine tune

gene expression. As another example, pol III must efficiently recycle to accommodate

the requirements of a growing cell for a large number of tRNAs and is thus highly

proficient at termination. In contrast, pol II must be resistant to termination in order to

synthesize very long, intricately modified transcripts. To prevent transcripts that have not

been correctly processed from leaving the nucleus, pol II must be assured of transcript

integrity by the processing machinery before termination can occur.


Vaccinia Introduction and Biology

Answering complicated questions about any process in molecular biology

requires model systems that are genetically malleable. In the field of transcription,

biologists have typically looked to bacteria, yeast, fruit flies, and some viruses as suitable

models. The prototypic orthopoxvirus, vaccinia, lends itself particularly well to

transcription studies because it quickly replicates in the cytoplasm of host cells and

encodes nearly all of the factors required for nucleic acid metabolism on its 192kB

double-stranded linear DNA genome (Conaway and Conaway 1994; Moss 1990a; Moss

1996). In addition, it provides unique and powerful genetic tools to specifically probe for









transcription factors, including those that are involved in termination. The background

information in the remainder of this chapter is a prelude to the remainder of this work

which is a characterization of the vaccinia J3 protein as a factor that influences 3' end

formation.

There are three unique classes of vaccinia virus gene expression. Vaccinia genes

are transcribed at early, intermediate, and late times post-infection by a virus encoded

RNA polymerase that is homologous to the eukaryotic polymerases in terms of size and

complexity (Baroudy and Moss 1980; Moss 1990b; Fields et al. 1996). Vaccinia

transcription can be visualized as a cascade in which the products of each gene class

initiate the expression of the succeeding class. Early gene transcription is promptly

stimulated after viral entry by initiation factors contained within the infecting virion

(Kates and Beeson 1970a; Kates and Beeson 1970b; Kates and McAuslan 1967). The

products of early genes serve as intermediate transcription factors or as proteins involved

in DNA replication. Intermediate gene expression begins after viral DNA replication has

begun. Some of the known intermediate gene products are involved in transactivation of

late gene expression. Late genes encode early gene transcription factors that are

packaged into the virion for utilization during the next infection cycle (Moss 1996).

Transcription initiation for each gene class is mediated by a unique upstream promoter

element. Each promoter consists of core and initiator sequences that have been defined

by saturation mutagenesis. All three types of promoters are A/T rich and are located in

the region upstream of the transcription initiation site (Davison and Moss 1989a;

Davison and Moss 1989b; Baldick et al. 1992). Like eukaryotic pol II transcripts,

vaccinia mRNAs are capped (Wei and Moss 1975) and polyadenylated (Kates and









Beeson 1970a). However, in contrast to pol II transcripts, they are not spliced. Capping

occurs during transcription when the nascent RNA reaches approximately 30 nucleotides

in length. A viral capping enzyme removes the 5' terminal phosphate, catalyzes the 5' to

5' ligation of a GMP residue, and methylates the N7 position of the terminal guanylate

residue (Martin and Moss 1975; Martin and Moss 1976). Then, a separate bi-functional

enzyme encoded by the J3 gene places a methyl group on the ribose moiety of the

penultimate base (Barbosa and Moss 1978a; Barbosa and Moss 1978b). Finally, the

transcript is polyadenylated by a virally encoded heterodimeric poly-A polymerase that

contains the J3 2'-o-methyltransferase protein as a processivity subunit (Schnierle et al.,

1992).

Early transcription initiation requires the activity of two proteins encoded by the

D6 and A7 genes (Gershon and Moss 1990). Together, they form a heterodimer called

Vaccinia Early Transcription Factor, or VETF, which binds the early promoter core

sequence (Broyles et al. 1991; Broyles and Li 1993). VETF has been found in complex

with the RNA polymerase, which suggests that it may recruit the polymerase to the

promoter (Li and Broyles 1993a). VETF has a DNA-dependent ATPase activity that is

necessary for elongation (Li and Broyles 1993b). The polymerase, a 94-kDa RNA

polymerase associated protein (RAP94, also known as H4), and VETF are required for

reconstituting specific in vitro transcription initiation and elongation of early genes (Ahn

et al. 1994; Gershon and Moss 1990). However, in vitro termination of early genes

requires the activity of the mRNA capping enzyme, which is a heterodimer of the Dl and

D12 proteins (Shuman et al. 1987; Broyles et al. 1988), and NPH-I nucleosidee

triphosphate phosphohydrolase I; Dl 1) which is a DNA-dependent ATPase (Mohamed









and Niles 2000). Termination occurs in response to a UsNU signal located in the

transcript. Upon transcribing the U5NU termination sequence, the polymerase terminates

approximately 30-50 nucleotides downstream (Yuen and Moss 1987). Although it is not

known precisely how termination occurs, it is known that C-terminus of NPH-I binds to

the H4 subunit of the polymerase and is required for transcript release (Mohamed and

Niles 2000; Mohamed and Niles 2001). This mechanism of termination produces RNAs

that are characteristically homogeneous in length.

Intermediate and late gene transcription is different from early transcription in a

number of ways. First, intermediate and late gene expression cannot occur until viral

DNA replication has begun (Vos and Stunnenberg 1988). Second, promoter sequences of

known intermediate and late genes have been used to propose model core elements that

are A/T rich and distinct both from early promoters and from one another (Baldick, Jr. et

al. 1992). There is however, a TAAA initiator sequence that is shared by intermediate,

late, and some early genes. This initiator sequence is hypothesized to cause the RNA

polymerase to slip and catalyze the addition of a short poly-A leader sequence on the 5'

end of transcripts (Ahn and Moss 1989; Ink and Pickup 1990). Third, intermediate and

late genes have their own unique set of initiation factors. Most of these factors have been

identified by reconstitution of in vitro transcription with successive fractionation of

infected cell extracts. Intermediate factors include the capping enzyme (Vos et al. 1991)

and two proteins called Vaccinia Intermediate Transcription Factors 1 and 2. VITF-1

was identified as a subunit of the RNA polymerase that is required in its free form,

although it is normally found as a complex with the polymerase (Rosales et al. 1994).

VITF-2 has been isolated from uninfected host nuclei, but its identity still remains a









mystery (Rosales et al. 1994). Several late transcription factors such as Al, A2, G8, and

H5 have been discovered. Al, A2 and G8 were identified by a reverse genetic approach.

Specifically, cloned vaccinia DNA fragments were co-transfected into infected cells with

a P-galactosidase reporter gene driven by the 11K late promoter. The cells were treated

with the DNA replication inhibitor araC to prevent expression of intermediate genes

originating from the infecting virus. By combining the cloned fragments containing the

Al, A2, and G8 genes, transcription from the reporter gene was reconstituted (Keck et al

1990). The H5 protein is an early gene product that has been purified from infected cell

extracts and shown to increase the efficiency of in vitro late transcription (Kovacs and

Moss 1996). Co-immunoprecipitation experiments suggest that H5 interacts with the

transcription elongation factors G2 and A18 (Black et al. 1998). VLTF-X, a factor that

was purified from uninfected cells, also acts to support late transcription in vitro

(Gunasinghe et al. 1998; Wright et al. 1998).

One stark contrast between early versus intermediate and late transcription is the

process of termination. A specific cis-acting termination sequence has not been

identified for genes that are expressed after DNA replication has begun. The UsNU

terminator sequence that operates at the end of early genes can be found scattered

throughout intermediate and late gene sequences, but apparently fails to be recognized by

the postreplicativetranscription system. If a cis-acting terminator sequence exists for

these genes, it must be degenerate in sequence and very inefficient in triggering 3' end

formation. As a result, the polymerase reads through the 3' end of the intermediate or late

coding sequence and terminates at numerous places downstream by an unknown

mechanism. This termination system produces mRNAs that are heterogeneous in length









(Moss 1996). The 3' ends of the transcripts can be found anywhere from one to four kilo-

bases downstream of the promoter. Compared to early genes, much less is known about

the mechanism by which intermediate and late gene transcription termination occurs.

However, genetic experiments have implicated three proteins in the process of

postreplicative transcription elongation and termination. These proteins are the products

of the A18, G2, and J3 genes (Bayliss and Condit 1993; Bayliss and Condit 1995; Black

and Condit 1996; Lackner and Condit 2000; Latner et al. 2000; Xiang et al. 2000a).

A18

In a previous search for genes involved in controlling the pattern of gene

expression, sixty-five temperature sensitive mutants were isolated. These mutants were

placed into thirty-two complementation groups and were screened for defects in DNA

and protein synthesis. All of the mutants in one complementation group had an

"abortive late phenotype" that was characterized at the non-permissive temperature by

protein synthesis that begins normally then stops abruptly at a late time point. Two of

these abortive late mutants, ts22 and ts23, were chosen for further characterization

(Condit and Motyczka 1981; Condit et al. 1983; Pacha and Condit 1985).

Marker rescue experiments mapped the Cts22 and Cts23 mutations to the Al 8

open reading frame (Pacha et al. 1990). The protein product is expected to be 57-kDa

and has some homology to the helicase motifs of the ERCC3 subunit of the pol II

transcription factor TFIIH. Northern blots demonstrated that the A18 gene is expressed

early and late during infection. Later work showed that the A18 protein is present in the

core particles and has DNA dependent ATPase and 3'-5' DNA helicase activities (Bayliss

and Condit 1995; Simpson and Condit 1994; Simpson and Condit 1995). Bayliss et al









discovered that an Al 8 mutant infection is characterized by promiscuous or aberrant

transcription (Bayliss and Condit 1993). Promiscuous transcription is defined as

transcription from regions of the genome that are not usually transcribed at late times in a

wild type infection. Xiang et al demonstrated that the observed promiscuous

transcription was due to readthrough from an upstream intermediate or late gene rather

than early promoter reinitiation or random initiation (Xiang et al. 1998). These

readthrough transcripts can hybridize to transcripts originating from downstream

promoters that initiate transcription in the opposite direction. This phenomenon creates

double stranded RNA, which can induce the host 2-5A pathway of RNA degradation

catalyzed by RNase L (Bayliss and Condit 1993). Degradation of the transcripts results

in the abortion of late protein synthesis (Pacha and Condit 1985). Recently, Lackner and

Condit demonstrated that the A18 protein is required in conjunction with an unknown

cellular factor to permit transcript release from the template in an in vitro transcription

assay (Lackner and Condit 2000). These observations indicate that A18 acts as a

postreplicative negative transcription elongation factor or more specifically, as a

transcript release factor.

IBT
Isatin-P-thiosemicarbazone (IBT) is an anti-poxviral drug that is structurally

composed of a six member and a five member ring with a short sulfur-containing side

chain and is thus similar to a purine (Katz 1987). Although the neither the target nor the

mechanism of IBT action is known, treatment of a wild type infection with IBT results in

a readthrough transcription phenotype, similar to that observed during an A18 mutant

infection (Meis and Condit 1991). Due to a high spontaneous mutation rate,

approximately one in 104-10-5 viruses in a wildtype infection will be either resistant to or









dependent upon IBT for growth. Several mutations conferring IBT dependence have

been mapped to transcription factors and are discussed below. For technical reasons, the

IBT resistance mutations are more difficult to map, but it is known that resistance can

result from mutation of the 132-kDa subunit of the polymerase (Condit et al. 1991), the

J3 2'-o-methyltransferase, and the G2 transcription elongation factor. IBT can therefore

be used as a tool to identify proteins that are involved in transcription.

G2

It was originally hypothesized that the direct target of IBT may be the A 18 protein

because mutation of Al8 results in a readthrough transcription phenotype that is similar

to treatment of a wildtype infection with IBT. Thus, several IBT dependent viruses were

identified and mapped by marker rescue with the expectation that Al 8 mutations would

be discovered. Surprisingly, none of the IBT dependent (IBTd) mutations mapped to

A 18. Each IBTd mutation mapped to the G2 gene instead (Meis and Condit 1991). The

26-kDa G2 protein is expressed early during infection, has no previously characterized

function, and is not homologous to any known proteins. It was shown that the G2

mutants have normal early protein expression, but synthesize reduced amounts of large

proteins at late times post-infection. It was postulated that the late large protein synthesis

defect was the result of aberrant transcription because the G2 mutants are dependent upon

IBT for growth. Analysis of steady state mRNA isolated from cells infected with a G2

mutant in the absence of IBT revealed that the mutant virus produces shorter than wild

type transcripts that are specifically truncated from the 3' end (Black and Condit 1996).

This observation logically follows the IBT dependent phenotype. IBT presumably









compensates for the short RNA synthesis defect in the G2 mutants and promotes

synthesis of transcripts that are of normal length.

Given that the mRNA synthesis phenotype of the G2 IBTd mutants is so distinctly

opposite from that of the A 18 mutants, it was proposed that a G2 null mutation could

serve as an extragenic suppressor of the Cts23 mutant Al8 allele. Viable Al8-G2 double

mutant viruses were isolated in two different ways. First, double mutants were isolated

from a mixed infection with both Cts23 and G2 deletion mutant viruses. Second, viable

A18-G2 double-mutants were isolated from a screen of Cts23 phenotypic revertants. The

viability of the A 18-G2 double mutant viruses suggest that each mutation compensates

for the defect in the other gene product (Condit et al. 1996). In summary, these

observations indicate that G2 is a positive postreplicative transcription elongation factor.

An interesting twist in the search for A 18-G2 double mutants was revealed when one of

the Cts23 phenotypic revertants was shown to contain a mutation that did not map to G2

as predicted. The characterization of this suppressing allele has brought about the

characterization of the J3 protein as a positive transcription elongation factor that is

similar to G2 and is described in the following chapters.














CHAPTER 2
CHARACTERIZATION OF J3 AS A TRANSCRIPTION FACTOR


Introduction

As described in the previous chapter, the observation that distinctly opposite

phenotypes are produced from defects in the transcription factors A 18 and G2 led to the

hypothesis that mutations in both genes could suppress each other. As mentioned, viable

Al8-G2 double mutants have been obtained by two different methods (Condit et al.

1996). First, a G2 deletion mutant was recombined with the Cts23 mutant allele in a

mixed infection. Second, mutant G2 alleles were found as second-site suppressors of

Cts23. During the search for G2 mutations as suppressors of Cts23, a virus called r51

was isolated that grew at 400C, was IBT sensitive, and formed slightly smaller than

wildtype plaques (Lamer et al. 2000). Previous experience with other G2 suppressor

mutations indicated that the suppressing allele in r51 might generate IBT dependence.

Therefore, r51 was crossed to wildtype virus to segregate the suppressor mutation from

the A18 mutation. An IBT dependent virus called r51x4 was isolated from this cross and

its mutation was mapped by marker rescue. Surprisingly, the IBTd mutation in r51x4 did

not map to the G2 gene. Instead, it was shown that the J3 gene in r51x4 was responsible

for IBT dependence. Sequence analysis revealed that the J3 gene in r51x4 had, in fact,

two mutations. The upstream mutation resulted in the exchange of a glycine at codon 96

with an aspartic acid residue (G96D). The downstream mutation resulted in the exchange

of an arginine for a lysine (R327K) in the portion of J3 that overlaps the adjacent J4









open-reading frame. Marker rescue with sub-clones of the J3 gene demonstrated that the

upstream G96D mutation was responsible for generating the IBT dependent phenotype.

A virus containing only the G96D mutation was isolated by crossing r51x4 to wildtype

virus and by screening the IBT dependent progeny by PCR and restriction fragment

length polymorphism analysis. This single mutant virus was designated J3x and is

phenotypically identical to r51x4. To prove that the G96D mutation was responsible for

the suppression of the Cts23 A 18 allele, the J3x virus was crossed with the Cts23 virus.

A viable double-mutant virus called J3x23 was isolated and is phenotypically the same as

r51. Like wildtype virus, r51 and J3x23 are ts+ and IBT sensitive. However, both

mutants form smaller than wildtype plaques and are difficult to grow to high titer. Given

that the J3x mutation can cause IBT dependence and suppress Cts23 just like mutations in

G2, it was hypothesized that J3 may also be a positive postreplicative transcription

elongation factor. Moreover, the realization that IBT dependence can arise from

mutation of another gene besides G2 suggested that other unidentified transcription

factors could be discovered by selecting for additional IBT dependent viruses (Latner et

al. 2000; Xiang et al. 2000a). This chapter reports the isolation and mapping of several

IBT dependent viruses and the characterization of J3 as a positive transcription

elongation factor.


Materials and Methods

Cells and Viruses

The continuous African green monkey kidney cell line BSC40 and conditions for

cell culture, vaccinia virus cultivation, infection, plaque assay, and one-step growth have

been previously described (Condit and Motyczka 1981; Condit et al. 1983). Wildtype









vaccinia virus strain WR, the G2 gene mutant G2A, the J3 mutants J3x, J3-7, and r51x4,

the genes J3 and A 18 double-mutant J3x23, and the conditions for their growth, infection,

and plaque titration have been previously described (Condit and Motyczka 1981; Condit

et al. 1983; Meis and Condit 1991; Black and Condit 1996; Latner et al. 2000; Xiang et

al. 2000a). Briefly, G2A is phenotypically IBT dependent (IBTd) and contains an

engineered 10-bp deletion in gene G2, resulting in a frameshift at codon 90 and

truncation of the 220-amino acid protein at position 93. J3x is phenotypically IBTd and

contains a missense mutation in codon 96 of the J3 gene (G96D). J3-7 is phenotypically

IBTd and contains a single nucleotide deletion in the J3 gene that causes a frameshift at

codon 49 and truncation of the 333-amino acid protein at position 58. r51x4 is

phenotypically IBTd and contains two missense mutations in the J3 gene, one in codon 96

of gene J3 (G96D), and the other in codon 327 of J3 (R327K) within an overlap with the

N terminus J4 open reading frame, where it affects codon 22 of gene J4 (D22N). J3x23

is phenotypically wt [tsW and IBT sensitive (IBTS)], but forms smaller plaques than wt.

J3x23 is a recombinant between J3x and the gene Al8 ts mutant Cts23. IBT was

prepared fresh before each use and applied at a final concentration of 45pM as previously

described (Pacha and Condit 1985).

Protein Pulse-Labeling

Pulse-labeling of proteins in virus infected cells was done as described previously

(Condit and Motyczka 1981). Briefly, confluent 35-mm dishes ofBSC40 cells were

infected with wt or mutant virus at a high multiplicity of infection (m.o.i.) in the absence

ofIBT and incubated at 37 or 400C as indicated in the figure legends. At various times

post-infection, cells were metabolically labeled with [35S]methionine for 15 min. Cells









were lysed on the dishes by addition of SDS-polyacrylamide gel electrophoresis (PAGE)

sample buffer, and solubilized proteins were analyzed by SDS-PAGE. The gels were

Coomassie blue stained, dried, and autoradiographed.

Isolation of Total Cellular RNA

Isolation of total cellular RNA was performed as previously described (Xiang et

al. 2000b). Briefly however, confluent 100 mm dishes ofBSC40 cells were infected with

wt or mutant virus at a high m.o.i. in the absence of IBT, and incubated at 370C or 40C

as indicated in figure legends. At various times after infection, total cellular RNA was

purified using RNeasy Total RNA purification columns as described by the manufacturer

(Qiagen, Inc., Chatsworth, CA). The RNA was eluted from column with DEPC-treated

H20 and quantified by measuring absorbance at 260 nm.

Northern Analysis

Northern analysis was performed as previously described (Xiang et al. 2000b).

Northern transfers were prepared as follows. Two gg of purified RNA in water was

adjusted to a final concentration of 0.36x MOPS buffer (Ix MOPS buffer = 20 mM

MOPS, 8 mM sodium acetate, 1 mM EDTA, pH 7.0), 1.6 M formaldehyde, 36 %

formamide, in a final volume of 13.75 pl. The samples were heated to 650C for 15

minutes, then chilled on ice. One p1 of a Img/ml ethidium bromide and 2 pl of RNA

loading buffer (50 % glycerol, 1 mM EDTA, 0.0 5% bromophenol blue, 0.0 5% xylene

cyanol) were added to each sample prior to loading on the gel. The samples were

electrophoresed at 80 volts through 1.2 % agarose gels containing a final concentration of

I x MOPS buffer and 0.37 M formaldehyde in an electrophoresis buffer containing 1 x

MOPS buffer and 0.23 M formaldehyde. RNA was transferred to GeneScreen membrane









(New England Nuclear) in a buffer containing 30 mM sodium phosphate, pH 6.5, and the

RNA was UV crosslinked to the membrane. Membranes were hybridized with either

uniformly labeled riboprobes, or with 5' end labeled DNA oligonucleotides as described

below.

Riboprobes were synthesized essentially as described in the Promega Protocols

and Applications Guide. Reactions (35 tl) contained lx optimized transcription buffer

(Promega), 11 mM DTT, 40 units RNase inhibitor (Promega), 0.4 mM ATP, GTP, and

UTP, 11 pM unlabeled CTP, 50 gCi [32P]-CTP (3000Ci/mmol), 1 gg linearized

template DNA, and 20 units ofT7 RNA polymerase. Reactions were incubated at 370C

for one hour. One unit of RNase-free DNase (Promega) was added and the reactions

were incubated for 15 minutes at 370C. 65 pl of STE/SDS (10mM Tris-HCl pH 8.0,

ImM EDTA, 0.1M NaCI, 0.1%SDS) was added and the samples were extracted with an

equal volume of phenol:chloroform. The aqueous phase was precipitated by addition of

100 pl 4 M ammonium acetate, 120 pC isopropanol, and 1 pl of 20 mg/ml glycogen, and

incubation at RT for 30 min. The precipitate was collected by centrifugation and

resuspended in 50 p1 DEPC treated water.

Anti-sense DNA oligonucleotide probes (45-56mers) used for northern analysis of

F17 gene transcripts were labeled as follows: lyophilized oligonucleotides (Genemed

Synthesis Inc., San Francisco, CA) were resuspended in water at a final concentration of

200 ng/pl. 200 ng of oligonucleotide was added to 11 pI water and warmed to 700C for

one minute, then chilled on ice. Reactions were adjusted to a final volume of 20 pl by

addition of 2 pl of 10x T4 polynucleotide kinase buffer (Promega), 50 pCi [y-32P]-ATP

(6000Ci/mmol), and 10 units of T4 polynucleotide kinase (Promega). Reactions were









incubated at 370C for 1 h. 1 pl of 0.5 M EDTA was added to stop the reaction followed

by the addition of 125 l of TE (10 mM Tris-HC1, pH 7.5, 1 mM EDTA).

Unincorporated label was removed by two centrifugations through sephadex G25 spun

columns essentially as described and the total TCA precipitable radioactivity in the final

eluate was determined.

For hybridization with riboprobes, membranes were pre-hybridized for 2 hours at

55C in 10 ml of buffer containing 50 mM Tris-HC1 pH 7.5, 1 M NaCI, 50 % formamide,

1 % SDS, 0.1 % sodium pyrophosphate, 10x Denhardt's [0.2 % BSA, 0.2 %

polyvinylpyrolidone, 0.2 % Ficoll], 10 % dextran sulfate, 0.1 mg/ml salmon sperm DNA.

Membranes were then hybridized overnight at 550C in the same buffer containing 107

cpm of riboprobe. Following hybridization, membranes were washed once at room

temperature in 0.1 % SDS, 0.1x SSC, three times at 650C in 1.0 % SDS, 0.1x SSC, and

exposed to film.

For hybridization with labeled DNA oligonucleotides, membranes were

prehybridized in 10 ml of buffer containing 6x SSC, 0.1 % SDS, 10x Denhardt's reagent,

and 100 ug/ml salmon sperm DNA for 2 hours at 420C, then hybridized overnight in the

same buffer containing 107cpm of labeled oligonucleotide probe. Membranes were

washed twice for 20 minutes at 500C in 5x SSC, 0.1 % SDS and exposed to film. The

amount of label hybridized to each sample was quantified after autoradiography using a

phosphorimager (Molecular Dynamics).

DNA Sequence Analysis

Sequence analysis was performed as described (Latner et al. 2000). Briefly

sequence of mutant virus DNA was obtained by sequencing PCR products amplified









from genomic DNA which was isolated by one of two different methods: (1) DNA was

isolated as described except the amounts were scaled down twenty-fold (Esposito et al.

1981). (2) Qiagen DNeasy miniprep spin columns (Qiagen Inc., Santa Clarita, CA) were

utilized to purify total infected cell DNA from 200 ul of infected cell lysate following the

manufacturer's instructions for isolating DNA from cells in culture. The complete J3 and

G2 coding sequences were PCR amplified with two different sets of primers that

hybridize just outside of the open reading frames. The J3 primer pair yields a 1197-bp

product and the G2 primer pair yields a 1067-bp product. Sequence was obtained from

both strands of DNA with the same primers used for amplification and with two

additional primers that hybridize in the middle of the coding sequence to give

overlapping products. Sequencing was performed by the University of Florida

Interdisciplinary Center for Biotechnology Research (ICBR) DNA Sequencing Core

Laboratory.

RFLP Analysis

RFLP analysis was performed as described (Lamer et al. 2000). Briefly, the

screen for the J3x single mutant virus from the r51x4 testcross was performed by

restriction fragment length polymorphism analysis of two different PCR products

generated from virus genomic DNA. Candidate mutant plaques were picked, grown, and

viral genomic DNA prepared as described above. A 379 bp PCR product that spanned

the G96D upstream mutation was amplified with appropriate primers, then digested with

Eag I. A downstream 522 bp PCR product that spanned the mutation in the J3/J4

overlapping region (J3:R327K/J4:D22N) was amplified with appropriate primers, then

digested with Bst YI. Restriction fragments were analyzed on 1 % MetaPhor agarose

(FMC BioProducts, Rockland, ME) in TBE. Both restriction enzymes cleave wild-type









sequence but not mutant sequence. A mutant virus was identified that was resistant to

Eag I in the 379 bp upstream PCR product but sensitive to Bst YI in the downstream 522

bp PCR product. Subsequent sequence analysis of the entire J3 open-reading frame

confirmed the presence of the upstream mutation and absence of the downstream

mutation. The single mutant virus was designated J3x and was utilized for further

characterization.

DNA Clones & Marker Rescue

Marker rescue was performed as previously described (Meis and Condit 1991;

Thompson and Condit 1986; Latner et al. 2000). The cosmid clones used for initial

marker rescue experiments have been previously characterized (Thompson and Condit

1986). The J fragment subclones pJ5, pJ6, and pJ7 used for J3 marker rescue were

generously supplied by Jerry Weir and have been described (Ensinger et al. 1985). The

clone pJ3R, which contains the precise J3 open reading frame cloned in pET14b, was a

gift from Ed Niles (SUNY Buffalo).

Western Blot Analysis

Western analysis was performed as previously described (Latner et al. 2000). 125

ul of virus lysate was combined with 250 ul of SDS-PAGE sample buffer. 35 ul of each

sample was electrophoresed on an 8 % polyacrylamide-SDS gel then the proteins were

transferred from the gel to nitrocellulose in 25 mM Tris-Base, 192 mM glycine, 20 %

methanol for 3 hours at 40C and 80 volts. The membrane was blocked with 5 % dry milk

in PBS for 1.5 hours, washed 3 times for 5 min with 0.05 % NP-40 in PBS, and incubated

for 1 hour with anti A 18, G2 and J3 primary antibodies diluted 1:10,000, 1:1,000, and

1:5,000 respectively in PBS plus 5 % dry milk. The monoclonal anti-Al8 and G2

antibodies have been previously described (Black and Condit 1996). The rabbit









polyclonal anti-J3 antibody was a gift from Ed Niles (SUNY Buffalo). The blot was then

washed 3 times for 5 min with 0.05 % NP-40 in PBS and incubated with secondary HRP

conjugated anti-rabbit and anti-mouse antibodies diluted 1:10,000 and 1:5,000

respectively for 1 hour. The blot was washed 3 times for 10 min with PBS plus 0.05 %

NP-40 and once for 2 min in PBS. Final detection was performed with an ECL western

detection kit (Amersham Pharmacia) according to the manufacturer's instructions.


Results

Isolation ofIBT-Dependent Mutants

Given that previously characterized mutants of the G2 gene are dependent upon

IBT for growth, additional genes encoding transcription elongation factors were sought

by selecting for novel spontaneous IBT-dependent mutants. Wildtype virus was plaqued

at 37C in the absence of drug and 10 well-isolated plaques were picked and grown to

create working stocks. This step was performed to ensure that any mutants derived from

these wt stocks would not be related to one another. The 10 wt lysates were then titered

in the presence and in the absence of IBT at 370C. In each of the 10 wt stocks, several

spontaneous mutant viruses that formed plaques in the presence of IBT were observed.

For each of the 10 original wt stocks, 10 plaques that grew in the presence of drug were

picked, giving a total of 100 viruses capable of growing in the presence of IBT. Next,

these 100 viruses were plaqued in the presence and in the absence of drug to determine

whether they were resistant to or dependent upon IBT for growth. At least one IBT-

dependent virus isolate was identified from 9 of the 10 original wt virus stocks. One

IBT-dependent plaque arising from each of these 9 wt stocks was chosen for in-depth

study. The mutation in each IBT-dependent virus was mapped by marker rescue in a









fashion similar to J3x and the region containing the mutation was sequenced. The results,

summarized in tables 2-1 and 2-2, show that two of the mutants contain deletions in gene

G2 and seven of the mutants contain alterations in gene J3. G2-5 contains a 3-nucleotide

in-frame deletion that removes a valine from position 105 of the G2 gene. G2-2 contains

a single base deletion that results in a frameshift at codon 209 and a premature

termination, yielding a truncated polypeptide 213 amino acids in length. All of the IBT-

dependent J3 mutants contain insertions, deletions, or nonsense mutations that result in

truncation of the protein significantly from its wt length of 333 amino acids.

Interestingly, each of the J3 insertion and deletion mutations is located in a region of the

coding sequence that contains a long stretch of A or T residues (table 2-3). Presumably,

these hot spots for deletion and insertion arise from slipped misparing during DNA

replication. One of the J3 mutant viruses, J3-7, was chosen for further characterization.

J3-7 contains a single base deletion at codon 49, resulting in a frameshift and a truncation

of the protein to 58 amino acids in length. In summary, these results confirm that, like

G2, null mutation of gene J3 results in IBT dependence and by analogy with G2 indicates

that the J3 gene plays a role in the regulation of postreplicative transcription elongation

during vaccinia virus infection.

Western Blot Analysis of A18, J3, and G2 Proteins in Mutant Infections

Western blot analysis was performed to confirm predictions derived from

sequence data regarding expression of the A18, G2, and J3 proteins in each mutant virus

infection (figure 2-1). Infected cell lysates were electrophoresed through 8% SDS

polyacrylamide gels and transferred to nitrocellulose. The blots were simultaneously

probed with anti-A 18, anti-G2, and anti-J3 antibodies and developed by

chemiluminescence. All three proteins are readily apparent in wildtype virus lysates.









Cts23 makes all three proteins, but the relative amount of A 18 protein is reduced,

consistent with previous results (Simpson and Condit 1994). The G2A control virus

encodes a frameshift in the G2 gene and, as previously described (Black et al. 1998), fails

to produce G2 protein. The J3x missense mutant produces detectable J3 protein while the

other IBT-dependent J3 truncation mutants, J3-1, J3-3, J3-4, J3-7, J3-8, J3-9, and J3-10,

produce no observable J3 protein. No G2 was observed in G2-2, which is missing a

valine from position 105, or in G2-5, which has a frameshift truncation of the C-terminal

11 amino acids of the G2 protein, indicating that these mutant proteins are unstable. Al8,

J3, and G2 proteins are all detectable in the J3x23 double-mutant but at very low levels,

presumably because this particular virus grows poorly and is therefore present in the

lysate at a very low concentration. In addition, the relative amount of A18 protein in the

J3x23 lysate is low, consistent with the presence of the Cts23 mutation in this virus. In

summary, the results of the Western blot analysis are consistent with the DNA sequence

analysis of these viruses, showing that the J3 protein of the J3x mutant is stable and that

the new IBTd J3 and G2 mutants produce no detectable J3 or G2 protein.

Plaque Assay

Plaque phenotypes of the J3x, J3x23, and J3-7 viruses are compared to parental

viruses in the assay shown in figure 2-2. Wildtype virus forms large plaques at 370C and

intermediate-sized plaques at 31 and 400C and is IBT sensitive. Cts23 is both temperature

sensitive and IBT sensitive. r51, the phenotypic revertant of Cts23 and parent of J3x, is

ts+ and IBT sensitive, but forms smaller than wt plaques at both 31 and 400C. J3x is IBT

dependent and phenotypically identical to its parent r51x4 (data not shown), confirming

that the downstream J3 R327K mutation in r514 does not contribute to the J3x mutant









plaque phenotype. J3x forms larger plaques at 370C relative to 31 and 400C, but is

somewhat leaky with respect to IBT dependence at both 31 and 370C. J3x23 is

phenotypically identical to r51, confirming that the J3 G96D mutation in J3x is sufficient

to suppress Cts23 and that the downstream J3 R327K mutation in r51 does not contribute

to the plaque phenotype of r51. J3-7, which contains a frameshifting deletion of the J3

gene, has a noticeably different phenotype when compared to the point mutant J3x virus.

J3-7 forms smaller plaques than J3x at 370C and is tighter with respect to IBT

dependence at 370C. Since J3-7 is likely to be a null mutant, this observation suggests

that the J3x virus may retain some J3 activity that contributes to its growth phenotype.

One-Step Growth

To characterize the growth phenotypes of each virus in more detail, one-step

growth experiments were performed. BSC40 cells were infected at an m.o.i. of 10 with

wt, Cts23, or J3-7, or at an m.o.i. of 5 with J3x23. The infections were incubated under

permissive and nonpermissive conditions appropriate for each virus, harvested at various

times postinfection, and then titered under permissive conditions appropriate for each

virus (figure 2-3). Wildtype virus growth was compared to J3x growth at 400C in the

presence and in the absence of IBT (figure 2-3 panel A). At 400C, wildtype virus yielded

1-5 PFU/cell, significantly higher than the To background, and growth was inhibited by

IBT. J3x produced only background levels of progeny in the absence of IBT and

approximately 1 PFU/cell in the presence of drug, slightly higher than background. This

result confirms and extends the plaque assay, showing that J3x is IBT dependent and

difficult to grow to high titer. J3-7 growth was compared to wildtype at 370C in the

presence and in the absence of IBT (figure 2-3 panel B). Wildtype grew to very high titer









in the absence of drug, and growth was inhibited by IBT. J3-7 yielded less than 1

PFU/cell in the absence of drug and slightly greater than 1 PFU/cell in the presence of

IBT, indicating that under one-step growth conditions J3-7 is moderately IBT dependent

and confirming that, like J3x, it is also difficult to grow. The growth ofJ3x23 was

compared to wt and Cts23 at both 31 and 400C in the absence of IBT. Both wt and Cts23

produced 4-10 PFU/cell at 31 C, but Cts23 produced only background levels of virus at

400C, consistent with plaque assay results. J3x23 generated 0.5-1 PFU/cell at both

temperatures, which is higher than background, but less than wildtype. These results

confirm that the J3x mutation suppresses Cts23 and show that J3x23 grows very poorly.

In summary, these experiments show that the one-step growth properties of all three

mutant viruses are generally consistent with the plaque assay phenotype and that the

mutant viruses all grow poorly under permissive conditions.

Viral Protein Synthesis

As an initial test of the prediction that the J3 mutant viruses would have an in vivo

biochemical phenotype similar to that of the previously described G2 mutants, a time

course of gene expression from the J3x, J3-7, and J3x23 viruses was compared with that

of the wt virus by metabolic labeling of proteins in infected cells. Infected cells were

pulse labeled with [35S]methionine at various times postinfection; the total infected cell

protein was analyzed by SDS-PAGE and autoradiography (figure 2-4). In the wt

infection, host protein synthesis is shut off by 4 hours post-infection (p.i.), synthesis of

early proteins begins by 2 h p.i. and subsequently decays, and synthesis of intermediate

and late viral proteins begins by 4 h p.i. and persists for the duration of the experiment.

In the J3x infection, host shutoff and synthesis of early viral proteins are









indistinguishable from those in the wt infection. Intermediate and late J3x protein

synthesis is initiated at the appropriate time relative to a wt infection, and low-MW

proteins are synthesized in normal amounts; however, large late proteins are synthesized

in reduced amounts relative to small J3x proteins and relative to the wt infection. In the

J3-7 infection, the schedule of host shutoff and early and late proteins synthesis is

somewhat delayed compared to the schedule in the wt infection. Early J3-7 proteins and

low MW J3-7 intermediate and late proteins are synthesized in slightly reduced

quantities; however, large late J3- 7 proteins are synthesized in greatly reduced amounts

relative to small late J3-7 proteins and relative to a wt infection. In the J3x23 infection,

the schedule of host shutoff and viral gene expression is delayed compared to that of

either the wt or the J3 single-mutant infections, however, proteins are synthesized in

relatively normal amounts. The delayed schedule of protein synthesis observed in the

J3x23 infection likely results from the fact that this infection was done at relatively low

m.o.i. and thus may be somewhat asynchronous. Most important, large late J3x23

proteins, although reduced somewhat in quantity relative to a wt infection, are

synthesized in increased amounts relative to the J3 single mutant infections. In

summary, the most prominent effect of J3 gene mutation on viral protein synthesis is a

reduction in synthesis of large late proteins, identical to the phenotype previously

reported for G2 mutants (Black and Condit 1996). The increase in synthesis of large late

proteins observed in J3x23 shows that suppression of the J3x mutation by the A18 Cts23

mutation correlates with restoration of a wt protein synthesis phenotype.

Viral mRNA Synthesis

It was hypothesized that the defect in protein synthesis observed in J3 mutant

infections is caused by synthesis of shorter than normal intermediate and late RNAs as









had been previously demonstrated for G2 mutants. This hypothesis was addressed by

conducting Northern blot analysis of mutant RNAs. Cells were infected with wt or

mutant viruses, and total infected cell RNA was prepared at various times postinfection,

electrophoresed on denaturing formaldehyde agarose gels, transferred to nylon

membranes, and hybridized with standard early (gene C 11), intermediate (gene G8), and

late (gene F17) gene riboprobes (figure 2-5). As previously described, wt virus produces

early RNAs that are homogeneous in size due to discrete transcription initiation and

termination events, whereas intermediate and late RNAs are heterogeneous in size due to

variation in 3' end sequence. Expression of the early RNA in a wt infection begins

immediately after infection, peaks at -3 h, and subsequently decreases to undetectable

levels. Wildtype intermediate and late RNAs appear between 3 and 6 h postinfection and

persist throughout the experiment. In a J3x infection, the pattern of early RNA synthesis

is indistinguishable from the wt infection in size, quantity, and kinetics. J3x intermediate

and late RNAs are heterogeneous in size, and they are synthesized in similar amounts and

with the same kinetics as a wt infection; however, the average chain length of both the

intermediate and late J3x RNAs is decreased relative to a wt infection. In the J3-7

infection, the schedule of synthesis of all three classes of RNA is slightly delayed relative

to a wt infection, but the amounts of RNA synthesized are similar to those in a wt

infection. The J3-7 early RNA is identical in size to wt RNA. Most important, like the

J3x infection, the J3-7 intermediate and late RNAs, although still heterogeneous in size,

have an average chain length that is decreased compared to wt RNA and similar to J3x

RNA. In the J3x23 infection, schedule of synthesis of all three classes of RNA is delayed

significantly relative to the wt infection, and the RNAs are synthesized in decreased









amounts, consistent with the J3x23 pattern of protein synthesis and diagnostic of a lower

m.o.i., slightly asynchronous infection. The J3x23 early RNA is the same size as wt

RNA. Importantly, the intermediate and late J3x23 RNAs, although somewhat reduced

in chain length relative to wt RNA, are nevertheless increased in size relative to the J3

single-mutant infections. In summary, mutation of the J3 gene results in synthesis of

intermediate and late RNAs that are reduced in size relative to a wt infection, identical to

what is observed in a G2 mutant infection (Black and Condit 1996). Suppression of the

J3x mutation by the A18 Cts23 mutation correlates with partial restoration of a wt RNA

synthesis phenotype.

Analysis of Late Viral mRNA 3' Ends

Based on the comparison with G2 mutants, it was hypothesized that J3 mutants

would produce intermediate or late transcripts that are truncated specifically from their 3'

ends. To test this hypothesis, wt and mutant F17 gene transcripts isolated 12 h p.i. were

once again inspected by Northern analysis, this time using as probes labeled anti-sense

DNA oligonucleotides that hybridize to various places downstream of the F17 promoter

(figure 2-6). The G2 null mutant virus G2A was included in this experiment as an

additional control. It is noteworthy that the wt F 17 late RNA is somewhat unusual

compared to most other late RNAs in that a relatively strong homogeneous 1.4-kb

transcript can be detected above the more heterogeneous background. This transcript is

detected with probes a-e and not with probe f, indicating that its 3' end is localized within

the region between 1160 and 1510 downstream from the F 17 promoter. It has been

determined that this predominant homogeneous 3' end is due to transcript cleavage by an

unknown virus induced factor (Susan D'Costa personal communication). Cleavage of

poxvirus transcripts is quite rare, but has been described for the cowpox ATI transcript









(Howard et al. 1999). Regardless of the cleavage event, F17 transcripts can be used to

gauge the average length of transcripts produced by each of the mutant viruses as

follows: Hybridization of probe a to wt and mutant RNAs shows that the F17 transcripts

are reduced in size in the J3x, J3-7, and G2A infections but normal in size in the J3x23

infections, consistent with the Northern blots described above. Close inspection of the

hybridization with probe a reveals discrete bands within the population of J3x, J3-7, and

G2A RNAs and also that the J3x RNAs are generally larger than the J3-7 and G2A

RNAs. As hybridization probes are moved progressively further downstream from the

F 17 promoter, hybridization to the smaller J3 and G2 mutant transcripts is lost until, with

probe e, only the longest transcripts remain, corresponding to the full-length major F17

transcript. This pattern of hybridization indicates that all of the short mutant transcripts

originate from the F17 promoter; that is, the short F17 mutant transcripts are truncated

from their 3' ends. Quantitative analysis of F17 transcription (figure 2-6 panel C) shows

that the total amount of hybridization to J3x, J3-7, or G2A RNA is equal to or greater

than wt near the F 17 promoter and decreases relative to the wt signal as a function of the

distance from the F17 promoter. Thus the quantification shows that initiation of

transcription of the F17 gene in the J3 mutant infections occurs at normal levels and

confirms that the F17 RNAs are 3' truncated. By contrast, the amount of hybridization to

J3x23 RNA, although reduced relative to wt RNA, remains constant as a function of

distance from the F 17 promoter, consistent with rescue of the J3 mutant phenotype in the

A18-J3 double mutant virus. Together, these observations show that the J3 single

mutants produce 3' truncated late transcripts and together with other evidence presented

support the hypothesis that the J3 protein affects the elongation or termination of









intermediate and late gene transcription. The existence of discrete RNA species (bands)

within the 3' truncated RNAs from mutant infections could reflect preferred promoter

proximal transcription pause or termination sites revealed by mutation of an elongation

factor. The fact that J3x RNAs are slightly longer than J3-7 or G2A RNAs may indicate

that relative to the null mutants, the J3x point mutant retains some elongation factor

activity.


Discussion

Based on previous phenotypic analysis of mutants in the vaccinia virus G2

postreplicative positive transcription elongation factor, two independent genetic

selections have been used to search for additional vaccinia genes involved in the

regulation of viral transcription elongation (Latner et al. 2000). In one selection, the J3x

G96D mutation was isolated as an extragenic suppressor of the Cts23 mutation in the

A18 transcript release factor. In the second selection, nine viruses were isolated that

contain spontaneous mutations which render the viruses dependent upon the anti-poxviral

drug IBT for growth. Consistent with previous results, two of these mutants have defects

in the G2 elongation factor. Mutations in the other seven IBTd selected viruses mapped

to the J3 gene. Examination of these J3 mutants reveals that although they have normal

early gene transcription, they produce short, 3' truncated postreplicative transcripts. The

production of 3' truncated postreplicative transcripts by the J3 mutants is consistent with

the absence of a positive transcription elongation factor (or anti-termination factor) in the

mutant infections. Generalized 3' truncation of postreplicative transcripts would account

for the observed synthesis of abnormally short intermediate and late RNAs, and

translation of abnormally short mRNAs would account for the observed specific decrease









in synthesis of large but not small intermediate and late proteins. The phenotype is also

consistent with genetic data: growth of the J3 mutants can be rescued by procedures that

enhance transcription elongation, specifically either treatment with the anti-poxviral drug

IBT or recombination with mutants in gene A18. By analogy with previous

characterization of the G2 gene (Meis and Condit 1991; Black and Condit 1996; Condit

et al. 1996), these results strongly suggest that the J3 gene is an essential positive

regulator ofpostreplicative gene transcription elongation.

The two different selections described, IBT dependence and Cts23 suppression,

may discriminate the two different types of J3 mutants isolated. Specifically, selection

for IBT dependence resulted in isolation entirely of null J3 mutants, while selection of

Cts23 resulted in isolation of the more subtle J3x missense mutation, which, as described

below, may retain some J3 protein activity. It is noteworthy in this regard that while

mutation of J3 suppresses Cts23 as judged by plaque formation, the resulting double-

mutant virus grows extremely poorly, as judged by one-step growth. Since J3 null

mutants are more defective in growth than J3x, it seems likely that null mutation of J3,

while it may compensate for the effects of Cts23, would leave a double-mutant virus too

crippled to grow at all, thus prohibiting isolation of J3 null mutant suppressors of Cts23.

Consistent with this idea, several attempts at constructing a J3- 7-Cts23 double-mutant by

recombination have been unsuccessful. By contrast with the J3 gene, previous results

show that null mutants of the G2 gene can suppress temperature-sensitive mutants in

A18, including both Cts23 and Cts22 (Condit et al. 1996). In addition, Western blot

analysis of three previously isolated G2 point mutant suppressors of Cts23 and Cts22

(r41, csl, and cs4) has shown that none of these mutants produce detectable G2 protein









(unpublished results). These observations could suggest that the G2 gene has a more

limited range of function than the J3 gene, such that a knockout of the G2 function can be

tolerated in the presence of an A 18 gene mutation.

Interestingly the J3 protein, also known as VP39 (vaccinia protein-39kDa), has

two previously characterized activities that modify both the 5' and 3' end of viral

transcripts. First, J3 is a (nucleoside-2'-o-)methytransferase that uses S-

adenosylmethionine (SAM) to methylate the 2' position of the 5' penultimate ribose found

in cap 0 mRNAs, thereby generating a cap 1 structure (illustrated in figure 2-7) (Barbosa

and Moss 1978a; Barbosa and Moss 1978b; Shi et al. 1996). Although the cap-0

structure has been shown to be important for mRNA stability and for efficient initiation

of translation, the purpose of the 2'-o-methylated cap 1 structure has yet to be determined.

J3 protein can be found in infected cells as a monomer and as a heterodimer completed

with the virus encoded El poly(A) polymerase (Schnierle et al. 1992). Both the

monomer and the heterodimer have (nucleoside-2'-o-)methytransferase activity. The

second function of J3 is to provide a stimulatory activity to the El poly(A) polymerase

(Schnierle et al. 1992). In vitro experiments have shown that El catalyzes the

polyadenylation of RNA 3' ends in two distinct and separable phases (Gershon 1998). In

the absence of J3 protein, El rapidly adds 30-35 A residues in an abrupt burst of

polymerization, then it converts to a much slower, non-processive mode ofpoly-A

synthesis. Upon addition of the J3 subunit, the polymerase converts once more to a

highly processive form that is competent for rapid poly(A) addition. Together, El and J3

rapidly synthesize poly(A) tails in vivo that are up to 200 nucleotides long. Interestingly,

the J3 crystal structure has been published and has revealed that the J3 molecule is an









oblate sphere with a characteristic cleft along one side (Hodel et al. 1996a). Previous

work has shown that the (nucleoside-2'-o-)methyltransferase activity resides on one

surface of the molecule and the binding site for El is found on the exact opposite face of

the molecule (figure 2-8) (Shi et al. 1997). Knowing the structural relationships between

the methyltransferase and El binding sites, it is no surprise that published site-directed

mutagenesis studies have shown that the (nucleoside-2'-o-)methyltransferase and El

stimulatory activities can be genetically separated (Gershon et al. 1998). Thus, J3 is

known to modify both the 5' and 3' ends ofmRNAs by providing at least two distinct

activities that are functionally independent. The new observation that J3 positively

affects postreplicative gene transcription elongation, as described above, is not

inconsistent with the intimate association between 3' processing and termination of pol II

transcription and begs the following question: Can the J3 transcription elongation activity

be separated from the other two mRNA modification activities of the protein or are there

any functional links?

The nature of the J3 mutations described above provides some initial clues to the

relationship between the putative J3 elongation factor activity and the other two

previously described activities. Both DNA sequence and Western blot analysis of the

seven new J3 mutants selected initially for IBT dependence show that these are null

mutants: each contains a chain-terminating nonsense or frameshift mutation, and none

synthesizes detectable J3 protein. Thus all of these seven mutants should be lacking in

both poly(A) polymerase stimulatory and (nucleoside-2'-o-)methyltransferase activities.

By contrast, J3x, which was initially isolated as a Cts23 suppressor but which is also IBT

dependent, contains a missense mutation (G96D) that does not affect the steady state









levels of J3 protein produced during infection. Under permissive conditions J3x forms

larger plaques than a representative J3 null mutation (J3- 7), suggesting that the J3x

mutant may retain some J3 protein function. Interestingly, the published crystal structure

of J3 shows that the J3x G96D mutation is localized very near the methyltransferase

active site, between a highly conserved aspartic acid at position 95 and an arginine at

position 97, both of which form hydrogen bonds with the methyl donor S-

adenosylmethionine (Hodel et al. 1996b). Replacement of the glycine, which forms a

kink in the alpha carbon backbone of J3 between the two charged residues, with an

additional aspartic acid residue could easily compromise binding of SAM to the enzyme.

Therefore, if the J3x protein is missing either of the previously identified J3 activities, it

seems most likely that it would be defective in methyltransferase and retain poly(A)

polymerase stimulatory activity.

Published preliminary experiments (Xiang et al. 2000a), conducted by Dr. Ying

Xiang and not shown here, have demonstrated that purified recombinant J3x protein is in

fact defective for methyltransferase activity in vitro. This result raised the intriguing

possibility that methyltransferase activity is somehow functionally coupled to

transcription elongation or termination. However, it did not prove a link between the

methyltransferase and transcription because of two remaining possibilities. First, it could

be that a cellular methyltransferase could replace the J3 activity in vivo, thus making it

impossible to link the two functions. Second, it could be that in addition to disrupting

methyltransferase activity, the G96D mutation could affect the surface charge of the

protein, and thus coincidentally affect interactions with other proteins hypothetically

involved in regulation of transcription elongation or termination. In addition to









examining the methyltransferase activity of J3x, it was also shown that the J3x protein is

normal for both in vitro and in vivo El stimulation and makes normal length poly(A)

tails. In contrast, it was shown that the J3-7 null mutant, as hypothesized, is defective for

El stimulation as it makes short poly(A) tails in vivo (Xiang et al. 2000a). This result

preliminarily indicated that El stimulation is not linked to the transcription elongation

activity since both J3x and J3-7 both make short 3' truncated transcripts. To more

directly investigate the relationship between the methyltransferase and transcription

elongation activities and to prove that El stimulation is not linked to J3 transcription

factor activity, it became necessary to construct site-directed mutants in attempt to

genetically and functionally segregate the three J3 activities as described in the next

chapter.

All of the analyses described in this chapter that were used to examine J3 mutant

transcripts measure steady-state RNA in vivo and therefore do not formally distinguish

whether the differences in RNA structure observed by comparing wt and J3 mutant

RNAs is attributable to abnormal RNA synthesis or to abnormal RNA turnover. In both

yeast and mammalian cells, RNA turnover mechanisms exist which degrade RNA

exonucleolytically from either the 5' or 3' end (Gallie 1998; van Hoof and Parker 1999).

Interestingly, the 5' to 3' pathway is influenced by both the RNA cap structure and the

poly(A) binding protein and thus bears provocative similarities to the system described

here that involves a viral function that interacts with both RNA 5' and 3' ends. However,

the 3' truncation of RNA observed here is both specific and limited, leaving wt quantities

of promoter proximal RNA in J3-mutant-infected cells. The persistence of normal

quantities of relatively stable 3'-truncated RNA seems inconsistent with any of the









degradation pathways heretofore described, thus the interpretation that the J3 protein

affects synthesis rather than turnover of RNA is favored.

Infections with J3 mutant viruses resulted in early gene expression that is

indistinguishable from that in a wt virus infection, demonstrating that the influence of the

J3 gene on transcription elongation is highly specific for intermediate and late genes.

This observation emphasizes further the fact that early poxvirus transcription elongation

and termination are mechanistically distinct from intermediate and late transcription

elongation and termination, which in turn seem to be mechanistically similar. The

vaccinia RNA polymerase exists in two forms, one that transcribes early but not late

genes and one that transcribes late genes but not early genes. The late-gene-specific

RNA polymerase contains eight core virus-coded subunits only (Wright and Coroneos

1995). The enzyme that transcribes early genes contains an additional subunit, the H4

(Rap94) gene product, which is required for initiation at early promoters and which

remains tightly associated with the RNA polymerase during elongation (Ahn et al. 1994;

Deng and Shuman 1994). Thus the subunit composition of early and late elongating

RNA polymerases reflects a memory of the class of gene that is being transcribed. Early

genes terminate transcription efficiently at discrete sites in response to a specific cis-

acing signal in an energy-dependent process that involves the viral heterodimeric capping

enzyme (genes Dl ad D12) and a viral DNA-dependent ATPase (gene D11) (Shuman et

al. 1987; Christen et al. 1998; Deng and Shuman 1998). The postreplicative elongation

machinery ignores early termination signals and terminates inefficiently at numerous sites

of unknown sequence composition (Cooper et al. 1981; Mahr and Roberts 1984).

Genetic and biochemical analyses suggest that elongation and termination of









postreplicative genes are influenced by as many as five different factors, four of which

are virus coded, one of which is host coded, and all of which are distinct from factors

regulating early gene transcription elongation and termination. Postreplicative elongation

is negatively regulated in vivo by the A18 gene product, which contains DNA-dependent

ATPase (Bayliss and Condit 1995), DNA helicase (Simpson and Condit 1995), and

transcript release activities (Lackner and Condit 2000), and thus behaves like a

transcription termination factor. Al8-catalyzed transcript release in vitro requires an

additional factor found in uninfected cells (Lackner and Condit 2000), thus implicating a

host factor in postreplicative vaccinia transcription termination. Positive transcription

elongation factors now include both the J3 and G2 gene products (Black and Condit

1996; Latner et al. 2000; Xiang et al. 2000a), the latter of which has no other known

function. Whether J3 and G2 contribute essential activities to the same process or are

functionally redundant remains to be determined. The G2 protein associates specifically

with the H5 gene product (Black et al. 1998), an abundant phosphoprotein implicated in

both late transcription and morphogenesis (Kovacs and Moss 1996; Beaud and Beaud

1997; DeMasi and Traktman 2000). Although the J3 protein does not specifically

associate with viral RNA polymerase isolated from virions (Broyles and Moss 1987),

evidence suggests that A18, G2, and H5 may associate with a larger complex in vivo

during infection (Black et al. 1998), raising the possibility that many or all of the

postreplicative viral transcription elongation/termination factors may exist in a large

elongation complex. A wide variety of vertebrate poxviruses, including variola

(Massung et al. 1994), alastrim (Shchelkunov et al. 2000), molluscum contagiosium

(Senkevich et al. 1997), Shope fibroma (Willer et al. 1999), and myxoma (Cameron et al.








1999), contain all three essential postreplicative elongation factors, A18, J3, and G2,

implying that the genes coevolved from a primordial vertebrate poxvirus as an integrated

elongation regulatory complex. Interestingly, the insect poxviruses Melanoplus

sanguinipes Entomopoxvirus (Afonso et al. 1999) and Amsacta moorei Entomopoxvirus

(Bawden et al. 2000) each contain both A18 and J3 but lack G2, suggesting that late gene

transcription may have evolved slightly differently for the insect poxviruses.

Despite the specificity of the J3 elongation activity for postreplicative genes, the

multifunctional J3 protein is present throughout infection (Nevins and Joklik 1977),

packaged in virions (Moss et al. 1975), and thus provides cap ribose methylase and

poly(A) stimulatory activities during the early as well as postreplicative stages of

vaccinia infection. Interestingly, the A18 (Simpson and Condit 1994) and H5 (Paula

Traktman, personal communication) proteins are also present in virions, though their

implied role in early gene expression remains to be determined. It is conceivable

therefore that the early and postreplicative transcription elongation complexes, while

displaying differences in composition and activity, also overlap in structure and function.

By contrast, the G2 gene product is synthesized early during infection, is present late

during infection, but is not packaged in virions and thus seems to be an exclusively

postreplicative gene specific factor (Meis and Condit 1991; Black et al. 1998). Further

comparisons of the structure and activity of the early and postreplication transcription

elongation complexes should reveal interesting similarities required for proper elongation

of all viral genes, and differences that account for the apparently different termination

mechanisms.
















Table 2-1: G2 IBTd Mutants


Isloate
Wild type
G2-5
G2-2


Mutation a
wt
deletion (3)
deletion (1)


Protein b
wt; 220aa
V105A; 219aa
fs 209; 213aa


a The number ofnucleotides affected by each mutation are included in parenthesis
b fs-# indicates the codon within which a frame shift occurs. "A" indicates deletion.



Table 2-2:J3 IBTd Mutants


Mutation a
wt
insertion (1)
insertion (1)
nonsense
deletion (1)
insertion (1)
nonsense
deletion (1)


Protein b
wt; 333aa
fs50; 50aa
fs50; 50aa
W183*; 182aa
fs49; 58aa
fs34; 50aa
S5*; 4aa
fs235;246aa


a The number ofnucleotides affected by each mutation are included in parenthesis
b fs-# indicates the codon within which a frame shift occurs. "*" indicates a stop
codon.


Isolate
Wild type
J3-1
J3-3
J3-4
J3-7
J3-8
J3-9
J3-10




















Table 2-3: Sequence context of J3 deletion and insertion mutations



Isolate Sequence Context

wt 135 AGAATTATTTTTT. CTTAGTAA
J3-1 135 AGAATTATTTTTTTCTTAGTAA
J3-3 135 AGAATTATTTTTTTCTTAGTAA
J3-7 135 AGAATTATTTTT. .CTTAGTAA

wt 87 GGTCGCAAAAAAA.CTGCCGTA
J3-8 87 GGTCGCAAAAAAAACTGCCGTA

wt 689 TAAATTATGAAAAAAAGATGTA
J3-10 689 TAAATTATGAAAAAA.GATGTA



Sequence of J3 insertion and deletion mutants from three different regions of the J3 gene
are compared in each case to wt sequence. The number to the left of the sequence is the
number of the first nucleotide in the sequence, setting the A in the J3 ATG initiation
codon as +1. Dots have been inserted into either wt or mutant sequence to facilitate
alignment as necessary.




















W u3 o





u r 0)
+1 c< -




o .
a s c













Nd 0) 0


c0 08
U 2



-o i









0 c> i co
% -o 4o






















) U. W /2


E 1-5
11 .


I I I I









31- 31+ 40- 40+


wt



Cts23



r51



J3x



J3x23


37- 37+


wt



J3x



J3-7



Figure 2-2. Plaque phenotypes of mutant viruses. Confluent monolayers of BSC40
cells in 60-mm dishes were infected with an appropriate dilution of virus and
incubated in the presence or in the absence of IBT under an agar overlay for 6 days.
Dishes were stained overnight with a second neutral red containing agar overlay. Agar
was then removed and cells were stained with crystal violet. The mutant used for
infection is indicated at the left of each row. Each column is labeled at the top to show
the temperature of incubation (31, 37, or 400C) and whether or not IBT was included
(+ or-).



























Figure 2-3. One-step growth analysis of J3 mutant viruses. Confluent monolayers of
BSC40 cells in 35-mm dishes were infected with the viruses indicated at a m.o.i. of 10
for wt, Cts23, J3x, and J3-7 or at an m.o.i. of 5 for J3x23. Infections were incubated in
liquid medium under varying conditions of temperature (31, 37, or 400C) in the presence
or in the absence of IBT (+ or -) and harvested at 0, 48, and 72 h, as indicated. Lysates
were harvested and plaque titrated under permissive conditions appropriate for each
virus: wt, 370C -IBT; Cts23, 31C -IBT; J3x, 400C +IBT; J3-7, 370C +IBT; J3x23, 40C
-IBT. In each panel, numerical data are presented at the left, and bar graphs of the same
data are shown on the right. (A) J3x is compared to wt. (B) J3-7 is compared to wt.
Note in the bar graph in B that the wt data have been truncated at 2 PFU/cell to aid in
visualization of the mutant data. (C) J3x23 is compared to wt and Cts23.

















A


J3x
Yield (pfu/cell)
Infection 0 hr 48 hr 72 hr


wt, 40-
wt, 40+
J3x, 40-
J3x, 40+


0.10
0.09
0.19
0.26


4.53
0.10
0.53
1.20


5.0
4.5
4.0
3.5
3.0
S2.5
2.0
1.5
1.0
0.5
0.0


1.39
0.02
0.22
1.12


B




J3-7
Yield (pfu/cell)
Infection 0hr 48 hr 72 hr


wt, 37-
wt, 37+
J3-7, 37-
J3-7, 37+


0.19
0.14
0.24
0.24


184.00
0.80
0.11
1.60


186.67
0.11
0.80
1.33


*0 hr
848 hr
872 hr


wt,40- wt,40+ J3x,40- J3x,40+
Infection


2.0
1.8
1.6
S1.4
1.2
1.0
| 0.8
? 0.6
0.4
0.2
0.0


*0 hr
*48 hr
*72 hr


wt, 37- wt, 37+ J3-7, 37- J3-7, 37+
Infection


J3x23
Yield (pfu/cell)
Infection 0 hr 48 hr 72 hr


wt, 31-
wt, 40-
ts23, 31-
ts23, 40-
J3x23, 31-
J3x23, 40-


0.15
0.10
0.27
0.27
0.05
0.04


8.00
4.53
8.00
0.35
0.67
0.43


12.53
1.39
4.00
0.05
0.88
0.80


wt,31- wt,40- ts23, ts23,
31- 40-
Infection


*Ohr
iS hr
*48 hr
872 hr


J3x23, J3x23,
31- 40-











wt


J3x


- 102-
- 72 -

- 36 -

- 25 -


10 12 14


0 2 4 6 8


J3-7


-


S1 1 1



0 2 4 6 8 10 12 14


iMM


0 2 4 6 8 10 12 14


J3x23


- 102 -
- 72 -

- 36 -

- 25 -


0 2 4 6 8 10 12 14


Figure 2-4. Protein synthesis in wt and mutant-infected cells. Confluent monolayers of
BSC40 cells in 35-mm dishes were infected at m.o.i.=10 with wt, J3x, or J3-7, or
m.o.i.=5 with J3x23, incubated at 40C (wt, J3x, J3x23) or 37"C (J3-7), and pulse
labeled for 15 min with [35S]methionine at various times after infection. Pulse-labeled
proteins were analyzed by SDS-PAGE and autoradiography; autoradiographs are
shown. The mutant used for the infection is indicated at the top of each autoradiogram.
The time at which the pulse label was done is indicated, in hours, at the bottom of each
autoradiogram. The migration of molecular weight markers, in kDa, is indicated
between the autoradiograms.


In















Early







Inter-
mediate








Late


wt J3x J3-7 J3x23
0 3 6 912 0 3 6 9 12 0 3 6 9 12 0 3 6 9 12


or w -2.4
*- 1.4

4 -0.2



-4.4
*-2.4

S- 1.4

0.2




4.4
2.4
S-- 1.4

0.2


Figure 2-5. Northern analysis of RNA from wt and mutant-infected cells. Confluent
monolayers of BSC40 cells in 100-mm dishes were infected at m.o.i. =10 with wt,
J3x, or J3-7, or m.o.i.=5 with J3x23, incubated at 40C (wt, J3x, J3x23) or 37"C (J3-
7). Total cellular RNA was purified from infected cells at various times
postinfection, indicated in hours above the autoradiograms, transferred to nylon
membranes and hybridized with radiolabeled antisense riboprobes specific for an
early (gene C 1), intermediate (gene G8), or late (gene F17) gene, as indicated to the
left of the autoradiograms. The migration of size markers, in kb, is indicated to the
right of the autoradiograms.























Figure 2-6. Structural analysis of the gene F17 late RNA from wt and mutant-infected
cells. (A) Confluent monolayers of BSC40 cells in 100-mm dishes were infected at
m.o.i.=10 with wt, J3x, J3-7, or G2A, or m.o.i.=5 with J3x23, incubated at 400C (wt, J3x,
J3x23, and G2A) or 370C (J3-7) as indicated above the autoradiograms. Total cellular
RNA was purified from infected cells at 12 h p.i., transferred to nylon membranes, and
hybridized with radiolabeled antisense DNA oligonucleotides a-f, as indicated above the
autoradiograms. The position of the middle of each oligonucleotide (average length 50
nt) relative to the F 17 promoter is shown. [In the F 17 gene, the first transcribed
nucleotide (+1) is coincident with the A in the translation initiation ATG.] The migration
of size markers, in kb, is indicated to the left of the autoradiograms. (B): A cartoon
showing (from top to bottom) an interpretation of the results shown in (A), with wt and
J3 mutant (J3-) transcripts indicated as arrows (representation of the J3 mutant transcripts
as a broken arrow indicates heterogeneity at the 3' end); a schematic of the F 17
transcription unit with the promoter indicated as an arrow, the 300-nu coding sequence
indicated as the leftmost open box, and the remainder of the sequence indicated as the
rightmost open box; the map positions of oligonucleotide probes a-f. (C) Quantification
of the data in (A). For each probe, the total radioactivity in each lane was measured, and
each mutant lane was then plotted as a percentage of the wt signal for a given probe.










a:27 b:267 c:627

+^^\?,""^ ^^^ Bd^^A^<^$$2Cc~


2.4- -
1.4-


0.2 -


d: 967

f^ ^V^~,~


e: 1163

-P .;b+ 0;


83.1 w*0*


F17 orf (300nt)

a: 26 b: 267 c: 627


d: 967 e: 1163


0 200 400 600 800 1000 1200
Distance from promoter to middle of probe in nucleotides


4.4-
2.4 -
1.4-


f: 1510

fr14A t


f: 1510








-e-J3x
-0-J3-7
S--J3x23
-- G2
























Figure 2-7. mRNA 5' cap structure. The 5' ends of eukaryotic and vaccinia transcripts
are modified. In vaccinia, a heterodimeric capping enzyme composed of the D and D12
proteins performs the first three steps in cap formation by removing the y-phosphate from
the 5' end of a transcript, then by catalyzing the addition of a G residue in an unusual 5'-
5' phosphotriester linkage which is resistant to normal ribonucleolytic activity. Last, the
capping enzyme methylates the G residue at the N7 position. The J3 protein performs the
last step in cap formation which is the methylation of the first transcribed nucleotide at
the ribose 2' position, thus converting a cap-0 structure to a cap-1 structure. The arrow
indicates the methyl group that is added by J3. The X can represent any base.

The steps in cap formation are as follows:
i) pppN(pN)n -4 ppN(pN)n + Pi
ii) pppG + ppN(pN)n ->G(5')pppN(pN)n + PPi
iii) AdoMet + G(5')pppN(pN)n -- m7G(5')pppN(pN)n + AdoHcy
iv) AdoMet + m7G(5')pppN(pN)n -> m7G(5')pppNm(pN)n + AdoHcy



















L


0

0~~;


o= p~_b
b
b
O=d-6
e>
b















to o I -
zo :o




g 00


S0 4 -.







a* a 0
C *" & Q
0 T 3
















.0 -,
a |o














l .ii
SI g s











0 .














3 U|SoU
Mrrcd a
0zi' g)
4- 4--- sJ


^^s ^^ s'


^^gl0















































Ia~t -L


*
0















CHAPTER 3
J3 TRANSCRIPTION FACTOR ACTIVITY IS INDEPENDENT FROM ITS OTHER
TWO ROLES IN mRNA MODIFICATION


Introduction


As described in chapter 2, the vaccinia J3 protein has been characterized as a

postreplicative positive transcription elongation factor. This description is based on two

lines of evidence. First, by analogy with the previously described G2 positive

transcription elongation factor, J3 mutants have been isolated by two independent genetic

selections that implicate a role for J3 in transcription (Lamer et al. 2000). Specifically, a

J3 point mutant was isolated as an extragenic suppressor of a temperature-sensitive

mutation in the A 18 transcript release factor. In addition, several J3 null mutants were

isolated based upon their dependence for the transcription elongation enhancing drug

IBT. Second, it was shown that all of these J3 mutants produce short 3' truncated

postreplicative gene transcripts and are thus phenotypically identical to mutants in the G2

gene (Xiang et al. 2000a).

Interestingly, J3 has two previously described roles in mRNA modification. First,

it is a (nucleoside-2'-o-)methyltransferase that places a methyl group from S-

adenosylmethionine on the 2' position of the first transcribed nucleotide at the 5' end of

an mRNA (see figure 2-7 in chapter 2) (Barbosa and Moss 1978a; Barbosa and Moss

1978b). Methylation at the 2' position on the penultimate nucleotide of transcripts is not

a novel phenomenon and is a common modification of most eukaryotic mRNA, although