The expression and potential function of bone morphogenetic proteins 2 and 4 in bovine trophectoderm
Full Citation
Permanent Link: http://ufdc.ufl.edu/AA00010685/00001
 Material Information
Title: The expression and potential function of bone morphogenetic proteins 2 and 4 in bovine trophectoderm
Series Title: Reproductive Biology and Endocrinology
Physical Description: Archival
Language: English
Creator: Pennington, Kathleen A.
Ealy, Alan D.
Publisher: BioMed Central
Publication Date: 2012
Subjects / Keywords: Paracrine factor
Abstract: Background: Bone morphogenetic proteins (BMPs) were first described for their roles in bone formation, but they now also are known to possess additional activities, including those relating to embryogenesis. The objectives of this work were to 1) determine if peri-attachment bovine conceptuses and bovine trophoblast cells (CT1) contain transcripts for BMP2 and 4, an innate inhibitor noggin (NOG), and BMP2/4 receptors (BMPRII, ACVR1, BMPR1A, BMPR1B), and 2) determine if BMP2 or 4 supplementation to CT1 cells affects cell proliferation, differentiation or trophoblast-specific gene expression. Methods: RNA was isolated from day 17 bovine conceptuses and CT1 cells. After RT-PCR, amplified products were cloned and sequenced. In other studies CT1 cells were treated with BMP2 or 4 at various concentrations and effects on cell viability, cell differentiation and abundance of IFNT and CSH1 mRNA were evaluated. Results: Transcripts for BMP2 and 4 were detected in bovine conceptuses and CT1 cells. Also, transcripts for each BMP receptor were detected in conceptuses and CT1 cells. Transcripts for NOG were detected in conceptuses but not CT1 cells. Cell proliferation was reduced by BMP4 but not BMP2 supplementation. Both factors reduced IFNT mRNA abundance but had no effect on CSH1 mRNA abundance in CT1 cells. Conclusions: The BMP2/4 ligand and receptor system presides within bovine trophectoderm prior to uterine attachment. BMP4 negatively impacts CT1 cell growth and both BMPs affect IFNT mRNA abundance. Keywords: Paracrine factor, Placenta, Conceptus, Interferon-tau
 Record Information
Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution.
Resource Identifier: doi - 1477-7827-10-12
System ID: AA00010685:00001


This item is only available as the following downloads:

Article ( PDF )

BioMed Central XML

Eprints Dublin Core METS ( XML )

Full Text


RESEARCH OpenAccessTheexpressionandpotentialfunctionofbone morphogeneticproteins2and4inbovine trophectodermKathleenAPenningtonandAlanDEaly*AbstractBackground: Bonemorphogeneticproteins(BMPs)werefirstdescribedfortheirrolesinboneformation,butthey nowalsoareknowntopossessadditionalactivities,includingthoserelatingtoembryogenesis.Theobjectivesof thisworkwereto1)determineifperi-attachmentbovineconceptusesandbovinetrophoblastcells(CT1)contain transcriptsfor BMP2 and 4 ,aninnateinhibitornoggin( NOG ),andBMP2/4receptors( BMPRII ACVR1 BMPR1A BMPR1B ),and2)determineifBMP2or4supplementationtoCT1cellsaffectscellproliferation,differentiationor trophoblast-specificgeneexpression. Methods: RNAwasisolatedfromday17bovineconceptusesandCT1cells.AfterRT-PCR,amplifiedproductswere clonedandsequenced.InotherstudiesCT1cellsweretreatedwithBMP2or4atvariousconcentrationsand effectsoncellviability,celldifferentiationandabundanceofIFNTandCSH1mRNAwereevaluated. Results: Transcriptsfor BMP2 and 4 weredetectedinbovineconceptusesandCT1cells.Also,transcriptsforeach BMPreceptorweredetectedinconceptusesandCT1cells.Transcriptsfor NOG weredetectedinconceptusesbut notCT1cells.CellproliferationwasreducedbyBMP4butnotBMP2supplementation.Bothfactorsreduced IFNT mRNAabundancebuthadnoeffecton CSH1 mRNAabundanceinCT1cells. Conclusions: TheBMP2/4ligandandreceptorsystempresideswithinbovinetrophectodermpriortouterine attachment.BMP4negativelyimpactsCT1cellgrowthandbothBMPsaffectIFNTmRNAabundance. Keywords: Paracrinefactor,Placenta,Conceptus,Interferon-tauBackgroundBonemorphogeneticproteins(BMPs)arepartofthe transforminggrowthfactorb (TGF b )superfamilyof paracrinefactors[1,2].TheBMPsmediatevariousphysiologicalanddevelopmental processes,includingplacentaldevelopment[3].TheBMP4familyoffactors, whichincludeBMPs2and4,appeartobeespecially importantinplacentaldevelopment.Inthemouse,conceptuseslackingBMP4undergodevelopmentalarrestat days6.5-9.5andlackmesodermandplacentalvasculature[4-6].Mesodermformationalsoisabsentinmice lackingBmpr2,theTypeIIreceptorforBMP4[7]. Interestingly,Bmpr2nullmicehaveamoreseverephenotypethanmicelackingBMP4,suggestingthepartial rescueoftheBMP4nullphenotypebyotherBMPs, suchasBMP2[8]. Bonemorphogeneticproteins2and4alsoregulate trophoblastlineagedevelopmentanddifferentiation. Trophoblastdevelopmentfromhumanembryonicstem cellsisinducedbyBMP2and4[9,10].Incattle,BMP4 supplementationimprovestheformationoftrophoblast celloutgrowthsfromblastocysts[11].Moreover,trophoblastcelllinesgeneratedfromtheseoutgrowthsproduce amultitudeoffactors,includinginterferon-tau(IFNT), thematernalrecognitionofpregnancyfactorinruminantsthatissecretedfrommononucleatedcells(MNCs) beforeplacentalattachmenttotheuterinelining[12]. SomeofthecelllinesderivedbyBMP4treatmentcontainlargequantitiesof IFNT mRNAwhereasotherlines containlittle IFNT andinsteadcontaingreaterquantitiesoftranscriptsdetectedindifferentiated,binucleate *Correspondence:ealy@ufl.edu DepartmentofAnimalSciences,UniversityofFlorida,POBox110910, Gainesville,FL,USAPenningtonandEaly ReproductiveBiologyandEndocrinology 2012, 10 :12 http://www.rbej.com/content/10/1/12 2012PenningtonandEaly;licenseeBioMedCentralLtd.ThisisanOpenAccessarticledistributedunderthetermsoftheCreative CommonsAttributionLicense(http://creativecommons.org/licenses/by/2.0),whichpermitsunrestricteduse,distribution,and reproductioninanymedium,providedtheoriginalworkisproperlycited.


cells(BNCs)afterplacentalattachment[11].Itremains unclearifBMP4maypromotetrophoblastcelldifferentiationduringculture. Theoverallgoalofthisworkwastodescribethe expressionandpotentialactionsoftheBMP4ligandreceptorsystemduringthepre-andperi-attachment periodofbovineconceptusdevelopment.Inthefirstset ofstudies,transcriptpatternsweredeterminedfor BMP2 BMP4 ,noggin( NOG ;aBMP2/4inhibitor)and BMP2/4receptors( BMPRII,ACVR1,BMPR1A, BMPR1B )inperi-attachmentbovineconceptuses(day 17ofgestation)andCT1cells,abovinetrophoblastcell linethatproducesIFNTbutnotBNCmarkergenes [13,14].Inthesecondsetofstudies,CT1cellswere treatedwithBMP2or4toexplorewhetherthesefactors impactgrowth,differentiationandgeneexpressionof thesecells.MethodsAnimaluseandtissuecollectionAllanimalusewascompletedwiththeapprovalofthe InstitutionalAnimalCareandUseCommitteeatthe UniversityofFlorida.Healthy,non-lactatingHolstein cows(n=12)werehousedattheUniversityofFlorida DairyUnit(Hague,FL)andfedadiettomeettheir maintenancerequirements (mixedrationcontaining corn,soybeanmealandhayl agealongwithcontinuous pasturegrazing).Elongated conceptuseswerecollected atday17post-estrusasdescribedpreviously[15].In brief,cowsweresuperovulated,bredviaartificialinseminationandslaughteredbycaptivebolttraumaand exsanguinationattheUniversityofFloridaMeats Laboratoryatday17post-estrus.Reproductivetracts wereexcisedanduterinehornswereflushedwithDulbecco sphosphate-bufferedsaline(DPBS;LifeTechnologies,GrandIsland,NY)tocollectconceptuses. Endometrialsampleswerecollectedfromnon-superovulatedcowsthatwerebredandverifiedpregnantby thepresenceofaconceptusasdescribedpreviously[16], andRNAwasextractedusingtheTrizolreagentand PureLinkPurificationColumns(LifeTechnologies).End-pointRT-PCRRNAconcentrationandintegritywereevaluatedusinga NanoDrop2000Spectrophotometer(ThermoScientific). Samples(250ng/reaction;A260/280ratio 1.8)were incubatedinRNase-freeDNase(NewEnglandBiolabs, Ipswich,MA)for30minat37Cfollowedbyheatinactivationfor10minat75C.TheSuperscriptIIIFirst StrandSynthesisSystem(LifeTechnologies)andrandomhexamerswereusedforreversetranscriptionat50 Cfor60min.ThermalAceDNAPolymerase(LifeTechnologies)wasusedtoamplifyDNA(35cycles;95C-1 min,55to59Cfor1min[dependingontheprimer pair;Table1],74C-1min).Non-reversetranscribed DNase-treatedRNAwasincludedasacontrolforgenomicDNAcontamination.Amplifiedproductswereelectrophoresedona1%[w/v]agarosegelcontaining0.5 g/mlethidiumbromideandvisualizedbyUVlight. BufferandresidualprimerswereremovedfromPCR ProductsbyusingthePureLinkPCRPurificationKit (LifeTechnologies)andDNAsequencingwascompleted attheUniversityofFloridaDNACoreFacility.CT1cultureThebovinetrophectodermce llline,CT1,previously developedandcharacterizedbyTalbotet.al[17]was culturedasdescribedpreviously[15-17].Inbrief,cells werepropagatedinDulbecco sModifiedEagle sMedium (DMEM)withhighglucose(5.5mM)containing10% fetalbovineserumandothersupplements(100 M non-essentialaminoacids,2mMglutamine,2mM sodiumpyruvate,55 M b -mercaptoethanol,100U/ml penicillinG,100 g/mlstreptomycinsulfate,and250 ng/mlamphoterinB;eachfromLifeTechnologies)on Matrigel BasementMembraneMatrix(appr.1mg/ml; BDBiosciences,Bedford,MA)at38.5Cin5%CO2in air.Cellswerepassagedmanuallybyscrapingcellsfrom theplatesandpassingthemthroughasmall-boreneedle toproducesmallclumpsofcells.Onthedaybefore supplementingBMPs,mediumwasreplacedwithmediumlackingFBS(serum-freemedium)andcontaininga serumsubstitute(ITS;LifeTechnologies).Allothersupplementswerekeptconstant.Serum-freemediumwas exchangedthenextdayimmediatelybeforeaddingBMP treatments.Recombinanthuman(rh)BMP2orrhBMP4 (R&DSystems,Minneapolis,MN)wasreconstituted accordingtomanufacturer sinstructionsandstoredat Table1Primersusedforend-pointRT-PCRGeneofInterestPrimerSequence(5 -3 ) BMP2 Forward Reverse CTTAGACGGTCTGCGGTCTC CGAAGCTCTCCCACCTACTG BMP4 Forward Reverse TGAGCCTTTCCAGCAAGTTT TACGATGAAAGCCCTGATCC NOG Forward Reverse GAACACCCGGACCCTATCTT ATGGGGTACTGGATGGGAAT BMPRII Forward Reverse AGACTGTTGGGACCAGGATG GTCTGGCCCACTGAATTGTT ACVR1 Forward Reverse AAATGGGATCGCTGTACGAC CTGTGAGTCTGGCAGATGGA BMPR1A Forward Reverse CAGGTTCCTGGACTCAGCTC CACACCACCTCACGCATATC BMPR1B Forward Reverse AGGTCGCTATGGGGAAGTTT CTCCCAAAGGATGAGTCCAA ACTBaForward Reverse CTGTCCCTGTATGCCTCTGG AGGAAGGAAGGCTGGAAGAGa[15]PenningtonandEaly ReproductiveBiologyandEndocrinology 2012, 10 :12 http://www.rbej.com/content/10/1/12 Page2of7


-20Cinsingle-usealiquots.Alltreatmentswerepreparedin0.1%[w/v]BSAsolutioninDMEMontheday ofsupplementation.Thecontrolscontainedvehicleonly.CT1cellnumberassayCT1cellswereseededatlowconfluency(1105cells/ ml)into24-wellMatrigel coatedplates(1mg/ml)and incubatedfor48htopermitcelladherencetothe Matrigel.Serum-freemediumcontaining0,0.1,1,10,or 100ng/mlrhBMP2orrhBMP4wasaddedtocultures(4 wells/treatment;3replicatestudies).Forty-eighthours laterthereductionofatetrazoliumcompound(MTS) intoacoloredformazonproductwasusedtoquantify viablecellnumbers.Colorintensityat490nmwasmeasuredafter30minincubation(CellTiter96Aqueous OneSolutionCellProliferationAssay;PromegaCorp., Madison,WI).Visualassessmentatthetimeofthe MTStreatmentindicatedthatconfluencywas>50%in eachreplicatestudy.Quantitative(q)RT-PCRRNAconcentrationandintegritywereevaluated,and samples(10ng/reaction;A260/280ratio 1.8)wereincubatedinRNase-freeDNase(NewEnglandBiolabs,Ipswich,MA)for30minat37Cfollowedbyheat inactivationfor10minat75 C.Reversetranscription andTaqManPCRwascompletedasdescribedpreviously[18]usingan IFNT primer-probesetthatrecognizesallknownbovine IFNT isoforms(aMNC-specific transcript)oraprimer-probesetspecificfor CSH1 (chorionicsomatomammotropichormone;alsoknown asplacentallactogen),abinucleatecell-specifictranscript[19](Table2).Bothprobeswerelabeledwitha fluorescent5 6-FAMreporterdyeand3 TAMRA quencher(LifeTechnologies).Reactionsalsoexamined 18S RNAabundance(referencecontrol)( 18S RNAControlReagentKit,5 -VIC-labeledprobe,LifeTechnologies).Thisreferencewaschosenbasedonprevious studies[18]andbecauseitsmRNAconcentrationswere notimpactedbytreatments.Afteraninitialactivation/ denaturationstep(50Cfor2min;95Cfor10min),40 cyclesofatwo-stepamplificationprocedure(60Cfor1 min;95Cfor15s)wascompletedusinga7300RealTimePCRSystem(AppliedBiosystems,LifeTechnologies).EachRNAsamplewasanalyzedintriplicate.A DNase-treatedRNAnotexposedtoreversetranscriptase wasincludedforeachsampleensuressampleswerefree ofgenomicDNAcontamination.The Ctmethodwas usedtoexaminetherelativeabundanceof IFNT and CSH1 transcriptswiththatof 18S RNA[18].StatisticalanalysesAllanalyseswerecompletedbyusingtheGeneralLinear ModelofanalysisofvariancefromtheStatisticalAnalysisSystem(SASInstitute,Cary,NC).ForqRT-PCRanalysis, CTvalueswereusedforanalysesanddatawere graphedbyexaminingfold-effect[15,16].Resultsare presentedasarithmeticmeansSEM.ResultsanddiscussionThefirstsetofstudiesexaminedwhetherthevarious componentsoftheBMP2/4ligand-receptorsystemwere expressedinelongatedconceptusesandCT1cells.A singlesampleofRNAcollectedfromendometriaof pregnantcowswasincludedasapositivecontrol. Transcriptsfor BMP2 and BMP4 werereadilydetectableinelongatedconceptusesandCT1cells(Figure 1A).Transcriptsfor NOG weredetectedinelongated conceptusesbutwereeitherabsentordetectedatvery lowlevelsinCT1cells(Figure1A).Ectodermandmesodermexpressionof NOG isevidentduringgastrulation inotherspecies[20],thereforeitseemslikelythatthe trophectodermisnotaprimarysourceof NOG .Itis interestingthattranscriptsfor NOG couldnotbeamplifiedfrombovineendometrium(Figure1A).Transcripts for NOG alsocouldnotbedetectedinotherendometrialpreparationsobtainedfromcowsinearlypregnancy (days14-17)(datanotshown).Transcriptsfor NOG can bedetectedwithinsituhybridizationinmouseendometriumaroundthetimeofimplantation,butthepattern ofexpressionisrestrictedtostromaimmediatelyunderlyingtheepithelium[21].Perhapstoolittle NOG mRNA existsinbovineendometriumforsuitableamplification usingconventionalRT-PCR.Alternatively,perhapsthe cowdiffersfrommiceandlacksendometrialNOG expression. TranscriptsforvariousBMP2and4receptorssubtypesalsoweredetectedinconceptusesandCT1cells (Figure1B).TheTGF b receptorsareheterodimeric complexescomprisedoftwoserine/threoninekinase receptorclasses(typeIandII).Afterligandbindingthe typeIIreceptorphosphorylatesthetypeIreceptor, whichtheninitiatesSmadsandotherintracellulartransductionsystems[22,23].Bonemorphogeneticproteins2 and4interactwithtwospecifictypeIreceptors,termed BMPR1A(ALK3)andBMPR1B(ALK6),andasingle Table2PrimerandprobesetsusedforqRT-PCRGeneofInterestPrimer/ Probe Sequence(5 -3 )aIFNTbForward Reverse Probe TGCAGGACAGAAAAGACTTTGGT CCTGATCCTTCTGGAGCTGG TTCCTCAGGAGATGGTGGTAGGGCA CSH1 Forward Reverse Probe GTGGATTTGTGACCTTGTTCGA CCTGGCACAAGAGTAGATTTGACA TCCTGCCTGCTCCTGCTGCTGGTAaEachprobewassynthesizedwitha6-FAMreporterdyeandTAMRAquencherb[15]PenningtonandEaly ReproductiveBiologyandEndocrinology 2012, 10 :12 http://www.rbej.com/content/10/1/12 Page3of7


Figure1 End-pointRT-PCRanalysisoftranscriptsforbovineBMPligandsandreceptorsintheperi-attachmentconceptus(day17 post-insemination),trophoblastcells(CT1)andendometrium(Endo.) .AfterRT-PCR,reactionswereelectrophoresedin1%[w/v]agarose containingethidiumbromideandampliconswerevisualizedusingUVlight.ThreedifferentconceptusandCT1RNApreparationswereusedin eachreactionbutonlyasingleendometriumRNAsamplecollectedfromcycliccowsatday17post-estruswasincluded.PanelAdepictsBMP ligandsandinhibitors.PanelBdepictsBMP2/4receptors.ACTBwasincludedasapositivecontrol. PenningtonandEaly ReproductiveBiologyandEndocrinology 2012, 10 :12 http://www.rbej.com/content/10/1/12 Page4of7


typeIIreceptortermedBMPRII[24,25].Bonemorphogeneticprotein2alsoreactswithathirdtypeIreceptor subunittermedACVR1(ALK2)[26].Transcriptsfor eachofthesereceptorsubtypesweredetectedinelongatedconceptusesandendometrium(Figure1B).The CT1cellsalsocontainedthereceptormachineryneeded torespondtoBMP2and4,althoughtheyappearedto containverylittle BMPR1B .Thisreceptorsubtypeisnot requiredfornormalplacentalformationinmice[27]. NewrolesforBMP4introphoblastlineagespecificationhaveemergedinthepastseveralyears.Trophoblast lineagesaregeneratedfromhumanESCsbyBMP4supplementation[28,29]andtrophoblastdevelopmentfrom bovineblastocystoutgrow thsisstimulatedbyBMP4 [11].However,potentialfunctionsforBMP2and4after trophoblastspecificationhavenotbeenexaminedincattle.ThefirststudyinthisseriesofexperimentsexaminedwhetherBMP2orBMP4supplementation influencedCT1cellgrowth(Figure2).Supplementation withBMP2didnotaffectviablecellnumbers,butsupplementationwith1,10or100ng/mlBMP4reduced(P <0.05)CT1cellnumberafter48h(Figure2).Cells treatedwithBMP4didnotdisplayanyovertmicroscopicevidenceofapoptosisornecrosis(detached,swollen/shriveledorpunctatedcells).Follow-upstudiesto quantifyapoptosisandproliferationrateswerenot completed. Anothersetofstudiesexa minedwhetherCT1cells underwentanydevelopmenta lmodificationsaftersupplementingserumfreemediumwith0.1,1,10or100 ng/mlBMP2orBMP4.Microscopicexaminationof CT1cellsinvariousstudiesfailedtodetectchangesin theincidenceofBNCformation(<2%inallgroups; datanotshown).Moreover, CSH1 transcriptscouldnot bedetectedinCT1cellsafter48or96hsupplementationwithBMP2or4(datanotshown).Amid-gestation placentalRNApreparationwasusedtoverifythatCSH1 primersworkedproperly.Thelackofdetectablechanges introphoblastmorphologyanddifferentiation-dependentgeneexpressionchangessuggeststhatthesefactors maynotbedirectlylinkedwit htrophoblastdifferentiation.However,limitedefforthasbeendevotedtouncoveringwaystomaximizeBNCformationandBNCspecificgeneexpressioninthesecells.Therefore,apossibleassociationbetweentheseBMPsandbovinetrophoblastdifferentiationcannotbedismissed. AfinalstudydeterminedthatexposuretoBMP2or4 decreased(P<0.05)therelativeabundanceof IFNT mRNA(Figure3).Theminimal effectiveconcentration neededtoachievethiseffectwaslessforBMP2(10ng/ ml)thanBMP4(100ng/ml).Expressionof IFNT was decreasedinadose-depen dentmannerbyBMP2but notbyBMP4.TheseoutcomessuggestthatBMP2may beamorepotentinhibitorof IFNT expressionthan BMP4.ChangesinthesynthesisandsecretionofIFNT proteinwerenotdeterminedsince IFNT mRNAabundanceisusuallyreflectiveofproteinproduction[16]. Interferon-tauexhibitsabiphasicexpressionpattern duringearlypregnancy,wheretheamountsofIFNT mRNAincreasedramaticallyaroundthetimeofconceptuselongation(day13-15incattle)anddecreaserapidly approximatelyoneweeklaterasimplantationbegins [30].Severaluterine-andconceptus-derivedfactors suchasfibroblastgrowthfactors(e.g.FGF2,10)andcolonystimulatingfactor2stimulateIFNTproduction frombovinetrophectoderm[16,18,31,32].Theseand Figure2 EffectofBMP2orBMP4supplementationonCT1cellsurvival .CT1cellsweresupplementedwithvariousconcentrationsofBMP2 (leftpanel)orBMP4(rightpanel)for48h,thenviablecellnumberswerequantifiedbyexaminingthemetabolismatetrazoliumcompound (MTS)intoacoloredformazonproductvisibleat490nm(n=4replicatestudiesforeachBMP).DifferentsuperscriptswithineachBMP treatmentdenotedifferences(P<0.05). PenningtonandEaly ReproductiveBiologyandEndocrinology 2012, 10 :12 http://www.rbej.com/content/10/1/12 Page5of7


otherfactorsmayplayapartintherapidincreasein IFNTproductionduringelongation.Theidentityof uterineandconceptusfactorsfunctioningasnegative regulatorsofIFNTexpressionremainedundetermined. PerhapsBMP2and4mayfunctionasimplantationdependentdownregulatorsofIFNTexpression.However,themagnitudeofthereductioninIFNTmRNA wasnotgreat(<2-foldreduction)anditisnotclear whetherthelargeamountsofBMPsupplementation neededtodetectthiseffecthaveanyphysiological relevance. Inconclusion,ligandsandreceptorsforBMP2and4 areexpressedinelongatingconceptusesandtheCT1 cellline.Nodetectablechangesincellmorphologyor differentiationweredetectedafterCT1exposureto theseBMPs.However,supplementationwithBMP2or4 decreasedcellgrowthratesand IFNT mRNAabundance.TheseobservationsimplicateBMP2and4as uterineandconceptusmediatorsoftrophoblastdevelopmentandIFNTproductionaroundthetimeof implantation.AuthorinformationCurrentaddressforDr.KathleenPennington;Division ofReproductiveandPerinatalResearch,Departmentof Ob-GYNandWomen sHealth,UniversityofMissouri, Columbia,MO65212Acknowledgements ThisprojectwassupportedbyNationalResearchInitiativeCompetitiveGrant no.2008-35203-19106fromtheUSDANationalInstituteofFoodand Agriculture. Authors contributions KAPassistedinthedesignofthestudies,completedeachofthestudies, participatedintheanalysisandinterpretationofthefindings,anddrafted themanuscript.ADEacquiredfundingfortheproject,assistedinthedesign ofthestudies,participatedintheanalysisandinterpretationofthefindings andgeneratedthefinaldraftofthemanuscript.Allauthorsreadand approvedthefinalmanuscript. Competinginterests Theauthorsdeclarethattheyhavenocompetinginterests. Received:29November2011Accepted:13February2012 Published:13February2012 References1.KitisinK,SahaT,BlakeT,GolestanehN,DengM,KimC,TangY,ShettyK, MishraB,MishraL: Tgf-Betasignalingindevelopment. SciSTKE 2007, 2007(399) :cm1. 2.RobertB: Bonemorphogeneticproteinsignalinginlimboutgrowthand patterning. DevGrowthDiffer 2007, 49(6) :455-468. 3.ShimasakiS,MooreRK,OtsukaF,EricksonGF: Thebonemorphogenetic proteinsysteminmammalianreproduction. EndocrRev 2004, 25(1) :72-101. 4.FujiwaraT,DunnNR,HoganBL: Bonemorphogeneticprotein4inthe extraembryonicmesodermisrequiredforallantoisdevelopmentand thelocalizationandsurvivalofprimordialgermcellsinthemouse. Proc NatlAcadSciUSA 2001, 98(24) :13739-13744. 5.MurohashiM,NakamuraT,TanakaS,IchiseT,YoshidaN,YamamotoT, ShibuyaM,SchlessingerJ,GotohN: AnFGF4-FRS2alpha-Cdx2axisin trophoblaststemcellsinducesBmp4toregulatepropergrowthofearly mouseembryos. StemCells 2010, 28(1) :113-121. 6.WinnierG,BlessingM,LaboskyPA,HoganBL: Bonemorphogenetic protein-4isrequiredformesodermformationandpatterninginthe mouse. GenesDev 1995, 9(17) :2105-2116. 7.MishinaY,SuzukiA,GilbertDJ,CopelandNG,JenkinsNA,UenoN, BehringerRR: Genomicorganizationandchromosomallocationofthe mousetypeIBMP-2/4receptor. BiochemBiophysResCommun 1995, 206(1) :310-317. 8.MishinaY,SuzukiA,GilbertDJ,CopelandNG,JenkinsNA,UenoN, BehringerRR: Genomicorganizationandchromosomallocationofthe mousetypeIBMP-2/4receptor. BiochemBiophysResCommun 1995, 206(1) :310-317. Figure3 EffectofBMP2andBMP4supplementationonIFNTmRNAabundanceinCT1cells .Cellsweresupplementedwithvarious concentrationsofBMP2(leftpanel)orBMP4(rightpanel)for24h,thenRNAwasextractedandqRT-PCRwascompleted.18sRNAwasusedas thereferencecontrol.Dataarepresentedasfold-differencesfromnon-treatedcontrols(n=4replicatestudiesforeachBMP).Different superscriptswithineachBMPtreatmentdenotedifferences(P<0.05). PenningtonandEaly ReproductiveBiologyandEndocrinology 2012, 10 :12 http://www.rbej.com/content/10/1/12 Page6of7


9.XuRH,ChenX,LiDS,LiR,AddicksGC,GlennonC,ZwakaTP,ThomsonJA: BMP4initiateshumanembryonicstemcelldifferentiationto trophoblast. NatBiotechnol 2002, 20(12) :1261-1264. 10.SchulzLC,EzashiT,DasP,WestfallSD,LivingstonKA,RobertsRM: Human embryonicstemcellsasmodelsfortrophoblastdifferentiation. Placenta 2008, 29 :S10-S16. 11.SuzukiY,KoshiK,ImaiK,TakahashiT,KizakiK,HashizumeK: Bone morphogeneticprotein-4acceleratestheestablishmentofbovine trophoblasticcelllines. Reproduction 2011, 142(5) :733-743. 12.EalyAD,YangQE: Controlofinterferon-tauexpressionduringearly pregnancyinruminants. AmJReprodImmunol 2009, 61(2) :95-106. 13.TalbotNC,CapernaTJ,EdwardsJL,GarrettW,WellsKD,EalyAD: Bovine blastocyst-derivedtrophectodermandendodermcellcultures: interferontauandtransferrinexpressionasrespectiveinvitromarkers. BiolReprod 2000, 62(2) :235-247. 14.TalbotNC,PowellAM,CampM,EalyAD: Establishmentofabovine blastocyst-derivedcelllinecollectionforthecomparativeanalysisof embryoscreatedinvivoandbyinvitrofertilization,somaticcellnuclear transfer,orparthenogeneticactivation. InVitroCellDevBiolAnim 2007, 43(2) :59-71. 15.CookeFNT,PenningtonKA,YangQ,EalyAD: Severalfibroblastgrowth factorsareexpressedduringpre-attachmentbovineconceptus developmentandregulateinterferon-tauexpressionfrom trophectoderm. Reproduction 2009, 137(2) :259-269. 16.MichaelDD,AlvarezIM,OconOM,PowellAM,TalbotNC,JohnsonSE, EalyAD: Fibroblastgrowthfactor-2isexpressedbythebovineuterus andstimulatesinterferon-tauproductioninbovinetrophectoderm. Endocrinology 2006, 147(7) :3571-3579. 17.TalbotNC,CapernaTJ,EdwardsJL,GarrettW,WellsKD,EalyAD: Bovine blastocyst-derivedtrophectodermandendodermcellcultures: interferontauandtransferrinexpressionasrespectiveinvitromarkers. BiolReprod 2000, 62(2) :235-247. 18.CookeFN,PenningtonKA,YangQ,EalyAD: Severalfibroblastgrowth factorsareexpressedduringpre-attachmentbovineconceptus developmentandregulateinterferon-tauexpressionfrom trophectoderm. Reproduction 2009, 137(2) :259-269. 19.HashizumeK,UshizawaK,PatelOV,KizakiK,ImaiK,YamadaO,NakanoH, TakahashiT: Geneexpressionandmaintenanceofpregnancyinbovine: rolesoftrophoblasticbinucleatecell-specificmolecules. ReprodFertilDev 2007, 19(1) :79-90. 20.KrauseC,GuzmanA,KnausP: Noggin. IntJBiochemCellBiol 2011, 43(4) :478-481. 21.PariaBC,MaW,TanJ,RajaS,DasSK,DeySK,HoganBL: Cellularand molecularresponsesoftheuterustoembryoimplantationcanbe elicitedbylocallyappliedgrowthfactors. ProcNatlAcadSciUSA 2001, 98(3) :1047-1052. 22.MassagueJ,SeoaneJ,WottonD: Smadtranscriptionfactors. GenesDev 2005, 19(23) :2783-2810. 23.NoheA,KeatingE,KnausP,PetersenNO: Signaltransductionofbone morphogeneticproteinreceptors. CellSignal 2004, 16(3) :291-299. 24.KoenigBB,CookJS,WolsingDH,TingJ,TiesmanJP,CorreaPE,OlsonCA, PecquetAL,VenturaFS,GrantRA, etal : Characterizationandcloningofa receptorforBMP-2andBMP-4fromNIH3T3cells. MolCellBiol 1994, 14(9) :5961-5974. 25.tenDijkeP,YamashitaH,SampathTK,ReddiAH,EstevezM,RiddleDL, IchijoH,HeldinCH,MiyazonoK: IdentificationoftypeIreceptorsfor osteogenicprotein-1andbonemorphogeneticprotein-4. JBiolChem 1994, 269(25) :16985-16988. 26.LeeKB,KhivansaraV,SantosMM,LambaP,YuenT,SealfonSC,BernardDJ: Bonemorphogeneticprotein2andactivinAsynergisticallystimulate follicle-stimulatinghormonebetasubunittranscription. JMolEndocrinol 2007, 38(1-2) :315-330. 27.GoumansMJ,MummeryC: FunctionalanalysisoftheTGFbetareceptor/ Smadpathwaythroughgeneablationinmice. IntJDevBiol 2000, 44(3) :253-265. 28.DasP,EzashiT,SchulzLC,WestfallSD,LivingstonKA,RobertsRM: Effectsof fgf2andoxygeninthebmp4-drivendifferentiationoftrophoblastfrom humanembryonicstemcells. StemCellRes 2007, 1(1) :61-74. 29.SchulzLC,EzashiT,DasP,WestfallSD,LivingstonKA,RobertsRM: Human embryonicstemcellsasmodelsfortrophoblastdifferentiation. Placenta 2008, 29(SupplA) :S10-S16. 30.EalyAD,YangQE: ControlofInterferon-Tauexpressionduringearly pregnancyinRuminants. AmJReprodImmunol 2009, 61(2) :95-106. 31.MichaelDD,WagnerSK,OconOM,TalbotNC,RookeJA,EalyAD: Granulocyte-macrophagecolony-stimulating-factorincreasesinterferontauproteinsecretioninbovinetrophectodermcells. AmJReprod Immunol 2006, 56(1) :63-67. 32.LoureiroB,BlockJ,FavoretoMG,CarambulaS,PenningtonKA,EalyAD, HansenPJ: Consequencesofconceptusexposuretocolony-stimulating factor2onsurvival,elongation,interferon-{tau}secretion,andgene expression. Reproduction 2011, 141(5) :617-624.doi:10.1186/1477-7827-10-12 Citethisarticleas: PenningtonandEaly: Theexpressionandpotential functionofbonemorphogeneticproteins2and4inbovine trophectoderm. ReproductiveBiologyandEndocrinology 2012 10 :12. Submit your next manuscript to BioMed Central and take full advantage of: Convenient online submission Thorough peer review No space constraints or color gure charges Immediate publication on acceptance Inclusion in PubMed, CAS, Scopus and Google Scholar Research which is freely available for redistribution Submit your manuscript at www.biomedcentral.com/submit PenningtonandEaly ReproductiveBiologyandEndocrinology 2012, 10 :12 http://www.rbej.com/content/10/1/12 Page7of7

!DOCTYPE art SYSTEM 'http:www.biomedcentral.comxmlarticle.dtd'
ui 1477-7827-10-12
ji 1477-7827
dochead Research
title p The expression and potential function of bone morphogenetic proteins 2 and 4 in bovine trophectoderm
au id A1 snm Penningtonmi Afnm Kathleeninsr iid I1 email penningtonka@health.missouri.edu
ca yes A2 EalyDAlanealy@ufl.edu
ins Department of Animal Sciences, University of Florida, PO Box 110910, Gainesville, FL, USA
source Reproductive Biology and Endocrinology
issn 1477-7827
pubdate 2012
volume 10
issue 1
fpage 12
url http://www.rbej.com/content/10/1/12
xrefbib pubidlist pubid idtype pmpid 22330732doi 10.1186/1477-7827-10-12
history rec date day 29month 11year 2011acc 1322012pub 1322012
cpyrt 2012collab Pennington and Ealy; licensee BioMed Central Ltd.note This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
kwdg kwd Paracrine factorPlacentaConceptusInterferon-tau
sec st Abstract
Bone morphogenetic proteins (BMPs) were first described for their roles in bone formation, but they now also are known to possess additional activities, including those relating to embryogenesis. The objectives of this work were to 1) determine if peri-attachment bovine conceptuses and bovine trophoblast cells (CT1) contain transcripts for it BMP2 and 4, an innate inhibitor noggin (NOG), and BMP2/4 receptors (BMPRII, ACVR1, BMPR1A, BMPR1B), and 2) determine if BMP2 or 4 supplementation to CT1 cells affects cell proliferation, differentiation or trophoblast-specific gene expression.
RNA was isolated from day 17 bovine conceptuses and CT1 cells. After RT-PCR, amplified products were cloned and sequenced. In other studies CT1 cells were treated with BMP2 or 4 at various concentrations and effects on cell viability, cell differentiation and abundance of IFNT and CSH1 mRNA were evaluated.
Transcripts for BMP2 and 4 were detected in bovine conceptuses and CT1 cells. Also, transcripts for each BMP receptor were detected in conceptuses and CT1 cells. Transcripts for NOG were detected in conceptuses but not CT1 cells. Cell proliferation was reduced by BMP4 but not BMP2 supplementation. Both factors reduced IFNT mRNA abundance but had no effect on CSH1 mRNA abundance in CT1 cells.
The BMP2/4 ligand and receptor system presides within bovine trophectoderm prior to uterine attachment. BMP4 negatively impacts CT1 cell growth and both BMPs affect IFNT mRNA abundance.
Bone morphogenetic proteins (BMPs) are part of the transforming growth factor-β (TGFβ) superfamily of paracrine factors abbrgrp abbr bid B1 1B2 2. The BMPs mediate various physiological and developmental processes, including placental development B3 3. The BMP4 family of factors, which include BMPs 2 and 4, appear to be especially important in placental development. In the mouse, conceptuses lacking BMP4 undergo developmental arrest at days 6.5-9.5 and lack mesoderm and placental vasculature B4 4B5 5B6 6. Mesoderm formation also is absent in mice lacking Bmpr2, the Type II receptor for BMP4 B7 7. Interestingly, Bmpr2 null mice have a more severe phenotype than mice lacking BMP4, suggesting the partial rescue of the BMP4 null phenotype by other BMPs, such as BMP2 B8 8.
Bone morphogenetic proteins 2 and 4 also regulate trophoblast lineage development and differentiation. Trophoblast development from human embryonic stem cells is induced by BMP2 and 4 B9 9B10 10. In cattle, BMP4 supplementation improves the formation of trophoblast cell outgrowths from blastocysts B11 11. Moreover, trophoblast cell lines generated from these outgrowths produce a multitude of factors, including interferon-tau (IFNT), the maternal recognition of pregnancy factor in ruminants that is secreted from mononucleated cells (MNCs) before placental attachment to the uterine lining B12 12. Some of the cell lines derived by BMP4 treatment contain large quantities of IFNT mRNA whereas other lines contain little IFNT and instead contain greater quantities of transcripts detected in differentiated, binucleate cells (BNCs) after placental attachment 11. It remains unclear if BMP4 may promote trophoblast cell differentiation during culture.
The overall goal of this work was to describe the expression and potential actions of the BMP4 ligand-receptor system during the pre- and peri-attachment period of bovine conceptus development. In the first set of studies, transcript patterns were determined for BMP2, BMP4, noggin (NOG; a BMP2/4 inhibitor) and BMP2/4 receptors (BMPRII, ACVR1, BMPR1A, BMPR1B) in peri-attachment bovine conceptuses (day 17 of gestation) and CT1 cells, a bovine trophoblast cell line that produces IFNT but not BNC marker genes B13 13B14 14. In the second set of studies, CT1 cells were treated with BMP2 or 4 to explore whether these factors impact growth, differentiation and gene expression of these cells.
Animal use and tissue collection
All animal use was completed with the approval of the Institutional Animal Care and Use Committee at the University of Florida. Healthy, non-lactating Holstein cows (n = 12) were housed at the University of Florida Dairy Unit (Hague, FL) and fed a diet to meet their maintenance requirements (mixed ration containing corn, soybean meal and haylage along with continuous pasture grazing). Elongated conceptuses were collected at day 17 post-estrus as described previously B15 15. In brief, cows were superovulated, bred via artificial insemination and slaughtered by captive bolt trauma and exsanguination at the University of Florida Meats Laboratory at day 17 post-estrus. Reproductive tracts were excised and uterine horns were flushed with Dulbecco's phosphate-buffered saline (DPBS; Life Technologies, Grand Island, NY) to collect conceptuses.
Endometrial samples were collected from non-superovulated cows that were bred and verified pregnant by the presence of a conceptus as described previously B16 16, and RNA was extracted using the Trizol reagent and PureLink Purification Columns (Life Technologies).
End-point RT-PCR
RNA concentration and integrity were evaluated using a NanoDrop 2000 Spectrophotometer (Thermo Scientific). Samples (250 ng/reaction; Asub 260/280 ratio ≥ 1.8) were incubated in RNase-free DNase (New England Biolabs, Ipswich, MA) for 30 min at 37°C followed by heat inactivation for 10 min at 75°C. The Superscript III First Strand Synthesis System (Life Technologies) and random hexamers were used for reverse transcription at 50°C for 60 min. ThermalAce DNA Polymerase (Life Technologies) was used to amplify DNA (35 cycles; 95°C 1 min, 55 to 59°C for 1 min [depending on the primer pair; Table tblr tid T1 1], 74°C 1 min). Non-reverse transcribed DNase-treated RNA was included as a control for genomic DNA contamination. Amplified products were electrophoresed on a 1% [w/v] agarose gel containing 0.5 μg/ml ethidium bromide and visualized by UV light. Buffer and residual primers were removed from PCR Products by using the PureLink PCR Purification Kit (Life Technologies) and DNA sequencing was completed at the University of Florida DNA Core Facility.
tbl Table 1caption Primers used for end-point RT-PCRtblbdy cols 3
c left
b Gene of Interest
Sequence (5'-3')
ACTBsup a
CT1 culture
The bovine trophectoderm cell line, CT1, previously developed and characterized by Talbot et. al B17 17 was cultured as described previously 151617. In brief, cells were propagated in Dulbecco's Modified Eagle's Medium (DMEM) with high glucose (5.5 mM) containing 10% fetal bovine serum and other supplements (100 μM non-essential amino acids, 2 mM glutamine, 2 mM sodium pyruvate, 55 μM β-mercaptoethanol, 100 U/ml penicillin G, 100 μg/ml streptomycin sulfate, and 250 ng/ml amphoterin B; each from Life Technologies) on Matrigel™ Basement Membrane Matrix (appr. 1 mg/ml; BD Biosciences, Bedford, MA) at 38.5°C in 5% CO2 in air. Cells were passaged manually by scraping cells from the plates and passing them through a small-bore needle to produce small clumps of cells. On the day before supplementing BMPs, medium was replaced with medium lacking FBS (serum-free medium) and containing a serum substitute (ITS; Life Technologies). All other supplements were kept constant. Serum-free medium was exchanged the next day immediately before adding BMP treatments. Recombinant human (rh) BMP2 or rhBMP4 (R&D Systems, Minneapolis, MN) was reconstituted according to manufacturer's instructions and stored at -20°C in single-use aliquots. All treatments were prepared in 0.1% [w/v] BSA solution in DMEM on the day of supplementation. The controls contained vehicle only.
CT1 cell number assay
CT1 cells were seeded at low confluency (1 × 105 cells/ml) into 24-well Matrigel™ coated plates (1 mg/ml) and incubated for 48 h to permit cell adherence to the Matrigel. Serum-free medium containing 0, 0.1, 1, 10, or 100 ng/ml rhBMP2 or rhBMP4 was added to cultures (4 wells/treatment; 3 replicate studies). Forty-eight hours later the reduction of a tetrazolium compound (MTS) into a colored formazon product was used to quantify viable cell numbers. Color intensity at 490 nm was measured after 30 min incubation (Cell Titer 96 Aqueous One Solution Cell Proliferation Assay; Promega Corp., Madison, WI). Visual assessment at the time of the MTS treatment indicated that confluency was > 50% in each replicate study.
Quantitative (q) RT-PCR
RNA concentration and integrity were evaluated, and samples (10 ng/reaction; A260/280 ratio ≥ 1.8) were incubated in RNase-free DNase (New England Biolabs, Ipswich, MA) for 30 min at 37°C followed by heat inactivation for 10 min at 75°C. Reverse transcription and TaqMan PCR was completed as described previously B18 18 using an IFNT primer-probe set that recognizes all known bovine IFNT isoforms (a MNC-specific transcript) or a primer-probe set specific for CSH1 (chorionic somatomammotropic hormone; also known as placental lactogen), a binucleate cell-specific transcript B19 19 (Table T2 2). Both probes were labeled with a fluorescent 5' 6-FAM reporter dye and 3' TAMRA quencher (Life Technologies). Reactions also examined 18S RNA abundance (reference control) (18S RNA Control Reagent Kit, 5'-VIC-labeled probe, Life Technologies). This reference was chosen based on previous studies 18 and because its mRNA concentrations were not impacted by treatments. After an initial activation/denaturation step (50°C for 2 min; 95°C for 10 min), 40 cycles of a two-step amplification procedure (60°C for 1 min; 95°C for 15 s) was completed using a 7300 Real-Time PCR System (Applied Biosystems, Life Technologies). Each RNA sample was analyzed in triplicate. A DNase-treated RNA not exposed to reverse transcriptase was included for each sample ensures samples were free of genomic DNA contamination. The ΔCt method was used to examine the relative abundance of IFNT and CSH1 transcripts with that of 18S RNA 18.
Table 2Primer and probe sets used for qRT-PCR
Gene of Interest
Sequence (5'-3')
aEach probe was synthesized with a 6-FAM reporter dye and TAMRA quencher
Statistical analyses
All analyses were completed by using the General Linear Model of analysis of variance from the Statistical Analysis System (SAS Institute, Cary, NC). For qRT-PCR analysis, ΔCT values were used for analyses and data were graphed by examining fold-effect 1516. Results are presented as arithmetic means ± SEM.
Results and discussion
The first set of studies examined whether the various components of the BMP2/4 ligand-receptor system were expressed in elongated conceptuses and CT1 cells. A single sample of RNA collected from endometria of pregnant cows was included as a positive control.
Transcripts for BMP2 and BMP4 were readily detectable in elongated conceptuses and CT1 cells (Figure figr fid F1 1A). Transcripts for NOG were detected in elongated conceptuses but were either absent or detected at very low levels in CT1 cells (Figure 1A). Ectoderm and mesoderm expression of NOG is evident during gastrulation in other species B20 20, therefore it seems likely that the trophectoderm is not a primary source of NOG. It is interesting that transcripts for NOG could not be amplified from bovine endometrium (Figure 1A). Transcripts for NOG also could not be detected in other endometrial preparations obtained from cows in early pregnancy (days 14-17) (data not shown). Transcripts for NOG can be detected with in situ hybridization in mouse endometrium around the time of implantation, but the pattern of expression is restricted to stroma immediately underlying the epithelium B21 21. Perhaps too little NOG mRNA exists in bovine endometrium for suitable amplification using conventional RT-PCR. Alternatively, perhaps the cow differs from mice and lacks endometrial NOG expression.
fig Figure 1End-point RT-PCR analysis of transcripts for bovine BMP ligands and receptors in the peri-attachment conceptus (day 17 post-insemination), trophoblast cells (CT1) and endometrium (Endo.)text
End-point RT-PCR analysis of transcripts for bovine BMP ligands and receptors in the peri-attachment conceptus (day 17 post-insemination), trophoblast cells (CT1) and endometrium (Endo.). After RT-PCR, reactions were electrophoresed in 1% [w/v] agarose containing ethidium bromide and amplicons were visualized using UV light. Three different conceptus and CT1 RNA preparations were used in each reaction but only a single endometrium RNA sample collected from cyclic cows at day 17 post-estrus was included. Panel A depicts BMP ligands and inhibitors. Panel B depicts BMP2/4 receptors. ACTB was included as a positive control.
graphic file 1477-7827-10-12-1
Transcripts for various BMP2 and 4 receptors subtypes also were detected in conceptuses and CT1 cells (Figure 1B). The TGFβ receptors are heterodimeric complexes comprised of two serine/threonine kinase receptor classes (type I and II). After ligand binding the type II receptor phosphorylates the type I receptor, which then initiates Smads and other intracellular transduction systems B22 22B23 23. Bone morphogenetic proteins 2 and 4 interact with two specific type I receptors, termed BMPR1A (ALK3) and BMPR1B (ALK6), and a single type II receptor termed BMPRII B24 24B25 25. Bone morphogenetic protein 2 also reacts with a third type I receptor subunit termed ACVR1 (ALK2) B26 26. Transcripts for each of these receptor subtypes were detected in elongated conceptuses and endometrium (Figure 1B). The CT1 cells also contained the receptor machinery needed to respond to BMP2 and 4, although they appeared to contain very little BMPR1B. This receptor subtype is not required for normal placental formation in mice B27 27.
New roles for BMP4 in trophoblast lineage specification have emerged in the past several years. Trophoblast lineages are generated from human ESCs by BMP4 supplementation B28 28B29 29 and trophoblast development from bovine blastocyst outgrowths is stimulated by BMP4 11. However, potential functions for BMP2 and 4 after trophoblast specification have not been examined in cattle. The first study in this series of experiments examined whether BMP2 or BMP4 supplementation influenced CT1 cell growth (Figure F2 2). Supplementation with BMP2 did not affect viable cell numbers, but supplementation with 1, 10 or 100 ng/ml BMP4 reduced (P < 0.05) CT1 cell number after 48 h (Figure 2). Cells treated with BMP4 did not display any overt microscopic evidence of apoptosis or necrosis (detached, swollen/shriveled or punctated cells). Follow-up studies to quantify apoptosis and proliferation rates were not completed.
Figure 2Effect of BMP2 or BMP4 supplementation on CT1 cell survival
Effect of BMP2 or BMP4 supplementation on CT1 cell survival. CT1 cells were supplemented with various concentrations of BMP2 (left panel) or BMP4 (right panel) for 48 h, then viable cell numbers were quantified by examining the metabolism a tetrazolium compound (MTS) into a colored formazon product visible at 490 nm (n = 4 replicate studies for each BMP). Different superscripts within each BMP treatment denote differences (P < 0.05).
Another set of studies examined whether CT1 cells underwent any developmental modifications after supplementing serum free medium with 0.1, 1, 10 or 100 ng/ml BMP2 or BMP4. Microscopic examination of CT1 cells in various studies failed to detect changes in the incidence of BNC formation (< 2% in all groups; data not shown). Moreover, CSH1 transcripts could not be detected in CT1 cells after 48 or 96 h supplementation with BMP2 or 4 (data not shown). A mid-gestation placental RNA preparation was used to verify that CSH1 primers worked properly. The lack of detectable changes in trophoblast morphology and differentiation-dependent gene expression changes suggests that these factors may not be directly linked with trophoblast differentiation. However, limited effort has been devoted to uncovering ways to maximize BNC formation and BNC-specific gene expression in these cells. Therefore, a possible association between these BMPs and bovine trophoblast differentiation cannot be dismissed.
A final study determined that exposure to BMP2 or 4 decreased (P < 0.05) the relative abundance of IFNT mRNA (Figure F3 3). The minimal effective concentration needed to achieve this effect was less for BMP2 (10 ng/ml) than BMP4 (100 ng/ml). Expression of IFNT was decreased in a dose-dependent manner by BMP2 but not by BMP4. These outcomes suggest that BMP2 may be a more potent inhibitor of IFNT expression than BMP4. Changes in the synthesis and secretion of IFNT protein were not determined since IFNT mRNA abundance is usually reflective of protein production 16. Interferon-tau exhibits a biphasic expression pattern during early pregnancy, where the amounts of IFNT mRNA increase dramatically around the time of conceptus elongation (day 13-15 in cattle) and decrease rapidly approximately one week later as implantation begins B30 30. Several uterine- and conceptus-derived factors such as fibroblast growth factors (e.g. FGF2, 10) and colony stimulating factor 2 stimulate IFNT production from bovine trophectoderm 1618B31 31B32 32. These and other factors may play a part in the rapid increase in IFNT production during elongation. The identity of uterine and conceptus factors functioning as negative regulators of IFNT expression remained undetermined. Perhaps BMP2 and 4 may function as implantation-dependent down regulators of IFNT expression. However, the magnitude of the reduction in IFNT mRNA was not great (< 2-fold reduction) and it is not clear whether the large amounts of BMP supplementation needed to detect this effect have any physiological relevance.
Figure 3Effect of BMP2 and BMP4 supplementation on IFNT mRNA abundance in CT1 cells
Effect of BMP2 and BMP4 supplementation on IFNT mRNA abundance in CT1 cells. Cells were supplemented with various concentrations of BMP2 (left panel) or BMP4 (right panel) for 24 h, then RNA was extracted and qRT-PCR was completed. 18 s RNA was used as the reference control. Data are presented as fold-differences from non-treated controls (n = 4 replicate studies for each BMP). Different superscripts within each BMP treatment denote differences (P < 0.05).
In conclusion, ligands and receptors for BMP2 and 4 are expressed in elongating conceptuses and the CT1 cell line. No detectable changes in cell morphology or differentiation were detected after CT1 exposure to these BMPs. However, supplementation with BMP2 or 4 decreased cell growth rates and IFNT mRNA abundance. These observations implicate BMP2 and 4 as uterine and conceptus mediators of trophoblast development and IFNT production around the time of implantation.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
KAP assisted in the design of the studies, completed each of the studies, participated in the analysis and interpretation of the findings, and drafted the manuscript. ADE acquired funding for the project, assisted in the design of the studies, participated in the analysis and interpretation of the findings and generated the final draft of the manuscript. All authors read and approved the final manuscript.
Author information
Current address for Dr. Kathleen Pennington; Division of Reproductive and Perinatal Research, Department of Ob-GYN and Women's Health, University of Missouri, Columbia, MO 65212
This project was supported by National Research Initiative Competitive Grant no. 2008-35203-19106 from the USDA National Institute of Food and Agriculture.
refgrp Tgf-Beta signaling in developmentKitisinKSahaTBlakeTGolestanehNDengMKimCTangYShettyKMishraBMishraLSci STKE20072007399cm110.1126/stke.3992007cm1link fulltext 17699101Bone morphogenetic protein signaling in limb outgrowth and patterningRobertBDev Growth Differ2007496455lpage 46810.1111/j.1440-169X.2007.00946.x17661740The bone morphogenetic protein system in mammalian reproductionShimasakiSMooreRKOtsukaFEricksonGFEndocr Rev20042517210110.1210/er.2003-000714769828Bone morphogenetic protein 4 in the extraembryonic mesoderm is required for allantois development and the localization and survival of primordial germ cells in the mouseFujiwaraTDunnNRHoganBLProc Natl Acad Sci USA20019824137391374410.1073/pnas.241508898pmcid 6111111707591An FGF4-FRS2alpha-Cdx2 axis in trophoblast stem cells induces Bmp4 to regulate proper growth of early mouse embryosMurohashiMNakamuraTTanakaSIchiseTYoshidaNYamamotoTShibuyaMSchlessingerJGotohNStem Cells201028111312119890878Bone morphogenetic protein-4 is required for mesoderm formation and patterning in the mouseWinnierGBlessingMLaboskyPAHoganBLGenes Dev19959172105211610.1101/gad.9.17.21057657163Genomic organization and chromosomal location of the mouse type I BMP-2/4 receptorMishinaYSuzukiAGilbertDJCopelandNGJenkinsNAUenoNBehringerRRBiochem Biophys Res Commun1995206131031710.1006/bbrc.1995.10437818535Genomic organization and chromosomal location of the mouse type I BMP-2/4 receptorMishinaYSuzukiAGilbertDJCopelandNGJenkinsNAUenoNBehringerRRBiochem Biophys Res Commun1995206131031710.1006/bbrc.1995.10437818535BMP4 initiates human embryonic stem cell differentiation to trophoblastXuRHChenXLiDSLiRAddicksGCGlennonCZwakaTPThomsonJANat Biotechnol200220121261126410.1038/nbt76112426580Human embryonic stem cells as models for trophoblast differentiationSchulzLCEzashiTDasPWestfallSDLivingstonKARobertsRMPlacenta200829S10S16233008118054384Bone morphogenetic protein-4 accelerates the establishment of bovine trophoblastic cell linesSuzukiYKoshiKImaiKTakahashiTKizakiKHashizumeKReproduction2011142573374310.1530/REP-11-027521862694Control of interferon-tau expression during early pregnancy in ruminantsEalyADYangQEAm J Reprod Immunol20096129510610.1111/j.1600-0897.2008.00673.x19143673Bovine blastocyst-derived trophectoderm and endoderm cell cultures: interferon tau and transferrin expression as respective in vitro markersTalbotNCCapernaTJEdwardsJLGarrettWWellsKDEalyADBiol Reprod200062223524710.1095/biolreprod62.2.23510642558Establishment of a bovine blastocyst-derived cell line collection for the comparative analysis of embryos created in vivo and by in vitro fertilization, somatic cell nuclear transfer, or parthenogenetic activationTalbotNCPowellAMCampMEalyADIn Vitro Cell Dev Biol Anim2007432597110.1007/s11626-007-9013-917570020Several fibroblast growth factors are expressed during pre-attachment bovine conceptus development and regulate interferon-tau expression from trophectodermCookeFNTPenningtonKAYangQEalyADReproduction2009137225926918996977Fibroblast growth factor-2 is expressed by the bovine uterus and stimulates interferon-tau production in bovine trophectodermMichaelDDAlvarezIMOconOMPowellAMTalbotNCJohnsonSEEalyADEndocrinology200614773571357910.1210/en.2006-023416574787Bovine blastocyst-derived trophectoderm and endoderm cell cultures: interferon tau and transferrin expression as respective in vitro markersTalbotNCCapernaTJEdwardsJLGarrettWWellsKDEalyADBiol Reprod200062223524710.1095/biolreprod62.2.23510642558Several fibroblast growth factors are expressed during pre-attachment bovine conceptus development and regulate interferon-tau expression from trophectodermCookeFNPenningtonKAYangQEalyADReproduction2009137225926918996977Gene expression and maintenance of pregnancy in bovine: roles of trophoblastic binucleate cell-specific moleculesHashizumeKUshizawaKPatelOVKizakiKImaiKYamadaONakanoHTakahashiTReprod Fertil Dev2007191799010.1071/RD0611817389137NogginKrauseCGuzmanAKnausPInt J Biochem Cell Biol201143447848110.1016/j.biocel.2011.01.00721256973Cellular and molecular responses of the uterus to embryo implantation can be elicited by locally applied growth factorsPariaBCMaWTanJRajaSDasSKDeySKHoganBLProc Natl Acad Sci USA20019831047105210.1073/pnas.98.3.10471470611158592Smad transcription factorsMassagueJSeoaneJWottonDGenes Dev200519232783281010.1101/gad.135070516322555Signal transduction of bone morphogenetic protein receptorsNoheAKeatingEKnausPPetersenNOCell Signal200416329129910.1016/j.cellsig.2003.08.01114687659Characterization and cloning of a receptor for BMP-2 and BMP-4 from NIH 3T3 cellsKoenigBBCookJSWolsingDHTingJTiesmanJPCorreaPEOlsonCAPecquetALVenturaFSGrantRAetal Mol Cell Biol1994149596159743591228065329Identification of type I receptors for osteogenic protein-1 and bone morphogenetic protein-4ten DijkePYamashitaHSampathTKReddiAHEstevezMRiddleDLIchijoHHeldinCHMiyazonoKJ Biol Chem19942692516985169888006002Bone morphogenetic protein 2 and activin A synergistically stimulate follicle-stimulating hormone beta subunit transcriptionLeeKBKhivansaraVSantosMMLambaPYuenTSealfonSCBernardDJJ Mol Endocrinol2007381-231533017293449Functional analysis of the TGFbeta receptor/Smad pathway through gene ablation in miceGoumansMJMummeryCInt J Dev Biol200044325326510853822Effects of fgf2 and oxygen in the bmp4-driven differentiation of trophoblast from human embryonic stem cellsDasPEzashiTSchulzLCWestfallSDLivingstonKARobertsRMStem Cell Res200711617410.1016/j.scr.2007.09.004263428919194525Human embryonic stem cells as models for trophoblast differentiationSchulzLCEzashiTDasPWestfallSDLivingstonKARobertsRMPlacenta200829Suppl AS10S16233008118054384Control of Interferon-Tau expression during early pregnancy in RuminantsEalyADYangQEAm J Reprod Immunol20096129510610.1111/j.1600-0897.2008.00673.x19143673Granulocyte-macrophage colony-stimulating-factor increases interferon-tau protein secretion in bovine trophectoderm cellsMichaelDDWagnerSKOconOMTalbotNCRookeJAEalyADAm J Reprod Immunol2006561636710.1111/j.1600-0897.2006.00390.x16792532Consequences of conceptus exposure to colony-stimulating factor 2 on survival, elongation, interferon-{tau} secretion, and gene expressionLoureiroBBlockJFavoretoMGCarambulaSPenningtonKAEalyADHansenPJReproduction2011141561762410.1530/REP-10-051121339286

xml version 1.0 encoding utf-8 standalone no
mets ID sort-mets_mets OBJID sword-mets LABEL DSpace SWORD Item PROFILE METS SIP Profile xmlns http:www.loc.govMETS
xmlns:xlink http:www.w3.org1999xlink xmlns:xsi http:www.w3.org2001XMLSchema-instance
xsi:schemaLocation http:www.loc.govstandardsmetsmets.xsd
metsHdr CREATEDATE 2012-03-21T16:06:35
name BioMed Central
dmdSec sword-mets-dmd-1 GROUPID sword-mets-dmd-1_group-1
epdcx:descriptionSet xmlns:epdcx http:purl.orgeprintepdcx2006-11-16 xmlns:MIOJAVI
epdcx:description epdcx:resourceId sword-mets-epdcx-1
epdcx:statement epdcx:propertyURI http:purl.orgdcelements1.1type epdcx:valueURI http:purl.orgeprintentityTypeScholarlyWork
epdcx:valueString The expression and potential function of bone morphogenetic proteins 2 and 4 in bovine trophectoderm
Bone morphogenetic proteins (BMPs) were first described for their roles in bone formation, but they now also are known to possess additional activities, including those relating to embryogenesis. The objectives of this work were to 1) determine if peri-attachment bovine conceptuses and bovine trophoblast cells (CT1) contain transcripts for BMP2 and 4, an innate inhibitor noggin (NOG), and BMP2/4 receptors (BMPRII, ACVR1, BMPR1A, BMPR1B), and 2) determine if BMP2 or 4 supplementation to CT1 cells affects cell proliferation, differentiation or trophoblast-specific gene expression.
RNA was isolated from day 17 bovine conceptuses and CT1 cells. After RT-PCR, amplified products were cloned and sequenced. In other studies CT1 cells were treated with BMP2 or 4 at various concentrations and effects on cell viability, cell differentiation and abundance of IFNT and CSH1 mRNA were evaluated.
Transcripts for BMP2 and 4 were detected in bovine conceptuses and CT1 cells. Also, transcripts for each BMP receptor were detected in conceptuses and CT1 cells. Transcripts for NOG were detected in conceptuses but not CT1 cells. Cell proliferation was reduced by BMP4 but not BMP2 supplementation. Both factors reduced IFNT mRNA abundance but had no effect on CSH1 mRNA abundance in CT1 cells.
The BMP2/4 ligand and receptor system presides within bovine trophectoderm prior to uterine attachment. BMP4 negatively impacts CT1 cell growth and both BMPs affect IFNT mRNA abundance.
Pennington, Kathleen A
Ealy, Alan D
http:purl.orgeprinttermsisExpressedAs epdcx:valueRef sword-mets-expr-1
http:purl.orgdcelements1.1language epdcx:vesURI http:purl.orgdctermsRFC3066
epdcx:sesURI http:purl.orgdctermsW3CDTF 2012-02-13
BioMed Central Ltd
http:purl.orgeprinttermsstatus http:purl.orgeprinttermsStatus
Pennington et al.; licensee BioMed Central Ltd.
http:purl.orgdctermsaccessRights http:purl.orgeprinttermsAccessRights
Reproductive Biology and Endocrinology. 2012 Feb 13;10(1):12
http:purl.orgdctermsURI http://dx.doi.org/10.1186/1477-7827-10-12
fileGrp sword-mets-fgrp-1 USE CONTENT
file sword-mets-fgid-0 sword-mets-file-1
FLocat LOCTYPE URL xlink:href 1477-7827-10-12.xml
sword-mets-fgid-1 sword-mets-file-2 applicationpdf
structMap sword-mets-struct-1 structure LOGICAL
div sword-mets-div-1 DMDID Object
sword-mets-div-2 File