Designing abiotic single nanotube membranes for bioanalytical and biomedical applications

MISSING IMAGE

Material Information

Title:
Designing abiotic single nanotube membranes for bioanalytical and biomedical applications
Physical Description:
xii, 114 leaves : ill. ; 29 cm.
Language:
English
Creator:
Harrell, Christopher Chad
Publication Date:

Subjects

Subjects / Keywords:
Chemistry thesis, Ph. D   ( lcsh )
Dissertations, Academic -- Chemistry -- UF   ( lcsh )
Genre:
bibliography   ( marcgt )
theses   ( marcgt )
non-fiction   ( marcgt )

Notes

Thesis:
Thesis (Ph. D.)--University of Florida, 2004.
Bibliography:
Includes bibliographical references.
Statement of Responsibility:
by Christopher Chad Harrell.
General Note:
Printout.
General Note:
Vita.

Record Information

Source Institution:
University of Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
aleph - 003163451
System ID:
AA00008992:00001

Full Text











DESIGNING ABIOTIC SINGLE NANOTUBE MEMBRANES FOR
BIOANALYTICAL AND BIOMEDICAL APPLICATIONS













By

CHRISTOPHER CHAD HARRELL


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


2004

























This document is dedicated to Tracy, Jodi, Otis, and Linda Harrell.














ACKNOWLEDGMENTS

I would like to thank Dr. Charles Martin and the entire Martin group members for

the opportunity to work with them over the course of my tenure. Dr. Martin was

continuously supportive in guidance throughout my scientific development at the

University of Florida. Also, I would like to thank Dr. Martin for teaching me the ability

to become an effective scientific communicator. The Martin group members have been

very supportive and terrific examples of ingenuity and perseverance. Drs. Punit Kohli,

Zuzanne Siwy, Marc Wirtz, and Sang Bok Lee showed great patience in offering many

hours of guidance and helpful ideas. Elizabeth Heins, Robbie Sides, Damian Odoms,

Dave Mitchell, and Buck Batson gave insightful advice on experimental ideas and design.

I would like thank Buck Batson, Chris Baker and Robbie Sides for helping me

enjoy my time during my stay at University of Florida. I would like to thank my loving

wife, Tracy Harrell, for all of her endless hours of love and support throughout my

graduate studies. Also, I want to thank my parents Otis, and Linda Harrell, and my sister,

Jodi Harrell, for their love and support. Finally, I want to thank my family and loved

ones for instilling in me the ambition to continuously grow and succeed in life.















TABLE OF CONTENTS
page

A CKN O W LED G M EN TS .............................................................................................. iii

LIST O F FIG U RES ....................................................................................................... vii

1 INTRODUCTION AND BACKGROUND ............................................................ 1

Introduction ..........................................................................................................1......
Background ..........................................................................................................2......
Ion Track-Etch Process ...................................................................................2...
Form ation of Latent Ion Tracks ......................................................................3...
Selective Etching of Ion Tracks ......................................................................3...
Tem plate Synthesis ..................................................................................................7...
Synthetic Strategies in Tem plate Synthesis ....................................................8...
Electroless D position ....................................................................................8...
Biological Ion Channels......................................................................................... 12
Potassium V oltage-G ated Ion Channel.................................................................. 13
Resistive-Pulse Sensing (Stochastic Sensing) ....................................................... 17
D issertation O verview ........................................................................................... 22

2 SYNTHETIC SINGLE NANOPORE AND NANOTUBE MEMBRANES...........25

Introduction ......................................................................................................... 25
Background ......................................................................................................... 26
Experim ental .......................................................................................................... 28
M materials ....................................................................................................... 28
Pore Etching.................................................................................................. 28
Isolating a Single N anopore.......................................................................... 28
Field-Emission Scanning Electron Microscopy (FESEM)...........................29
Electrochem ical M easurem ents.................................................................... 31
G old N anotube M em branes.......................................................................... 31
Results and D discussion .......................................................................................... 32
M icroscopy ................................................................................................... 32
Electrochem ical M easurem ents.................................................................... 34
A Single A u N anotube M em brane................................................................ 39
Conclusions ......................................................................................................... 41








3 FABRICATION OF ASYMMETRIC NANOTUBES WITHIN AN ABIOTIC
PLA T FO R M .............. ............................................................... ............................45

Introduction ......................................................................................................... 45
Experim ental.......................................................................................................... 46
M materials ............................................................................................... ....... 46
Conical Pore Etching ..........................................................................................47
Single Nanopore Membranes........................................................................47
Field-Emission Scanning Electron Microscopy (FESEM)...........................49
Results and Discussion-............................ .............................................................49
Membrane Characterization....................................................................... 49
Nanopore Geometry ............................................ ....................................... 51
C conclusion ................................................................................................. .......... 54

4 DNA-NANOTUBE ARTIFICIAL VOLTAGE-GATED ION CHANNELS .........56

Introduction ................................................................................... ......... ........... 56
Experim ental ........................................................................................... ............58
M materials ............................................................................................... ....... 58
Pore E thing .................................................... .. .........................................59
Single Conical Nanopore Membranes.................................................... ......59
Field-Emission Scanning Electron Microscopy (FESEM) ................ ........60
Conical Au Nanotube Membranes.............................................................61
DNA Modification........................................................................................61
Polylysine Modification................................................................................62
Electrochemical Measurements ............................................................... 62
R results and D discussion .............................................................................................63
Membrane Characterization.......................................................................63
DNA Modified Single Nanotube Membrane..............................................64
Polylysine Modified Au Nanotubes...................... .....................................71
Determination of Nanotube Permselectivity........................................... ...72
C conclusion ...................................................... .............. ................... .............. ....... .. 79

5 ABIOTIC NANOPORES FOR SINGLE MOLECULE DETECTION ............81

Introduction-. .................................................................................... ...................... ..8 1
E xperim ental-......................................................................................................... 82
M materials ....................................................... ............... .... ......... ............. 82
Conical Pore Etching ....................................................................................83
Single Nanopore Membranes........................................................................84
Electrochemical Measurements and Data Acquisition ..............................85
Results and Discussion .......................................................................................85
Membrane Characterization..........................................................................85
Single Stranded DNA Translocation Kinetics..............................................88
Discrimination of Single Stranded DNA and Plasmid DNA...........................94
C conclusion ..................................................................................................... ........97









5 CO N CLU SIO N ..................................................................................................... 99

LIST O F REFEREN CES............................................................................................... 102

BIO G RA PH ICA L SK ETCH ........................................................................................ 114














LIST OF FIGURES


Figure page


1-1. (a) Principle of ion track-etching technique. (b) Swift heavy ions forming latent
ion tracks in dielectric solid. (c) Selective etching, resulting in an array of etch
troughs, pores, or channels....................................................................................4...

1-2. Definition of cone half-angle ca, bulk etch rate vB and track etch-rate v-T................5

1-3. Chemical structure of polycarbonate (PC)............................................................6...

1-4. Scanning electron images of different nanostructured materials developed by the
ion-track-etching process. (a) PC (b) PET (c) Glass and (d) Mica......................7...

1-5. Scanning electron micrographs of template membranes. (a) Polycarbonate track-
etched membrane and (b) A1203 membrane. .........................................................9...

1-6. Schematic diagram of Au electroless plating procedure..................................... 10

1-7. Schematic illustration of Au nanotubes obtained from the use of the electroless
gold deposition m ethod....................................................................................... 11

1-8. Schematic representation of the functional units of a potassium voltage-gated ion
channel .......................................................................................................... 14

1-9. Electromechanical gating mechanism of the biological potassium voltage-gated
ion channel ................................................................................................. ......... 15

1-10. Current-voltage curve of ion current rectification within potassium voltage-gated
ion chann el ................................................................................................. ......... 16

1-11. Schematic illustration of resistive-pulse sensing ................................................18

1-12. Essential features of the staphylococcal a-hemolysin pore shown in a cross
section based on the crystal structure.................................................................. 20

2-1. A schematic diagram of the isolation process using fluorescence microscopy. ..30

2-2. A fluorescent and Scanning electron micrograph of single 30 nm nanopore using
the isolation process............................................................................................ 33








2-3. A fluorescent and scanning electron micrograph of single 55 nm nanopore.........34

2-4. A plot of observed pore diameter versus etching time in 12-micron thick
polycarbonate film s............................................................................................. 35

2-5. FESEM image of a complete (12-pm long) Au nanowire. Insets show magnified
view s of the nanow ire ends................................................................................. 36

2-6. A plot of measured and calculated values of ionic current versus number of pores
in the membrane with a pore diameter of 55 nm. ................................................37

2-7. A plot of ionic current versus applied potential across a single pore membrane
w ith a diam eter of 55 nm .................................................................................... 38

2-8. A plot of ionic current versus Pore diameter2 of single pore membranes ............39

2-9. A plot of ionic current versus applied potential across a single Au nanotube
m em brane.........................................................................................................40

3-1. Eletrochem ical etching cell................................................................................. 48

3-2. Scanning Electron micrographs of the large diameter of a single conical nanopore
fabricated under the conditions of (a) 0.0 V, (b) 15.0 V, and (c) 30.0 V applied
during the etching process. ................................................................................. 50

3-3. The change in pore diameter on the side exposed to the etching solution with
applied potential during the etching process.......................................................50

3-4. SEM of Au conical nanowires of pore geometry at (a) 0.0 V, (b) 15.0 V, and (c)
30.0 V applied during the pore etching process..................................................51

3-5. Rx/R for three conical pores with the same d,=20 nm and db equal 5 p.m (upper), 3
p.m (middle) and 1 pm (lower), respectively......................................................53

4-1. Scanning electron micrographs of a conical nanopore. (a) neutralizing side before
electroless gold plating, (b) etch side before electroless gold plating, (c) the shape
of single conical nanopore through the entire length of the membrane..............64

4-2. (a) The current-voltage characteristics of a single conical gold nanotube. (b)
Tailoring the rectification properties of the single conical gold nanotube
membrane by ssDNA modification. (c) Extent of rectification of ( ) 30-mer
hairpin DNA, (e) 30-mer HS-ssDNA and (-) unmodified single gold nanotube
m em bran e .......................................................................................................... 66

4-3. The effect of rectification by changing the pore diameter (*) 27 nm, (A) 39 nm,
( ) 59 nm, and (+) 98 nm single gold nanotube membrane. The diameter of the
large opening w as -5 pm .................................................................................... 69








4-4. I-V curve for a polylysine modified Au nanotube..............................................72

4-5. Current-voltage curve calculated from Eq. 4-2...................................................74

4-6. Current-voltage curve calculated for an ideally Cl permselective membrane ......75

4-7. Current-voltage curve calculated for a non-permselective membrane...............76

4-8. Current time traces of (a) no ssDNA present (b) 5 nM ssDNA non-complementary
to the ssDNA modified nanotube membrane and (c) 5 nM ssDNA that is
complementary to the ssDNA modified nanotube membrane............................78

4-9. A single blockade event of (a) 5 nM ssDNA non-complementary to the ssDNA
modified nanotube membrane and (b) 5 nM ssDNA that is complementary to the
ssDNA modified nanotube membrane................................................................ 78

5-1. FESEM image of the single nanopore membrane. (a) Surface image of the
nanopore that was exposed to the neutralizing solution. (b) Surface image of the
side of the membrane exposed to the etchant solution. (c) Au nanowire
representing the shape of the nanopore throughout the length of the membrane. .86

5-2. Current-time analysis of single nanopore membrane.(a) Ionic current
measurement of at 900 mV in the absence of ssDNA. (b) Blockade events of 10
nm ssDNA at an applied potential of 900 mV. (c) Single blockade event due to
the translocation of a single ssDNA molecule.................................................... 88

5-3. (a) Event diagram showing blockade level vs. translocation duration for 10 nM
ssDNA at 900 mV. (b) Current histogram for the above event diagram. (c) The
translocation duration histogram ......................................................................... 89

5-4. Concentration dependence of ssDNA translocation events. The ssDNA was
added to the small pore side with an applied potential to the large pore side of 900
m V ..........................................................................................................................9 0

5-5. Voltage characteristics of ssDNA translocation events. (a) Plot of event duration
vs. the inverse of the applied potential. (b) The characteristic shape of the
translocation event changes with the applied potential.......................................91

5-6. (a) Blockade events of 10 nm Plasmid DNA at an applied potential of 900 mV.
(b) Single blockade event due to the Bumping of a single Plasmid DNA molecule
at the m outh of the nanopore. .............................................................................. 92

5-7. (a) Event diagram showing blockade level vs. event duration for 10 nM Plasmid
DNA at 900 mV. (b) Current blockade histogram for the plasmid DNA bumping
events. (c) The event duration histogram for the plasmid DNA bumping............93

5-8. Blockade events of a mixture of Plasmid DNA and ssDNA at 10 nM with an
applied potential of 900 m V .............................................................................. 95








5-9. (a) Event diagram showing current blockade vs. event duration for the solution
mixture of Plasmid DNA and ssDNA. (b) The event duration histogram for the
plasmid DNA and ssDNA mixture at 10 nM with 900 mV applied potential. (c)
Current blockade histogram for the plasmid DNA and ssDNA mixture ............96














Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

DESIGNING ABIOTIC SINGLE NANOTUBE MEMBRANES FOR
BIOANALYTICAL AND BIOMEDICAL APPLICATIONS

By

Christopher Chad Harrell

December 2004

Chair: Charles R. Martin
Major Department: Chemistry

The goal of this research is to develop abiotic nanostructured sensor platforms for

bioanalytical and biomedical applications. The first part of this work is the fabrication of

synthetic single nanopore membranes within a polymeric support. We describe here an

alternative approach that we believe is easier and more accessible than previously

described methods. Fluorescence microscopy is used to identify and isolate single

nanopores within these membranes. Furthermore, an electroless plating method can be

used to deposit a gold nanotube within the single nanopore, and this provides a route for

further decreasing the inside diameter of the pore.

The second part relies on a method which allows one to prepare single asymmetric

nanopores with a tailored cone opening angle, therefore controlling the effective length of

the pores. This nanopore system is based on one sided chemical etching of heavy ion

irradiated dielectric films. This process offers the advantage of controlling not only the

pore diameter but the pore geometry as well. By controlling the pore dimensions it offers








one the ability to fine tune the nanopore system for the analysis of individual molecules.

The third part of this work describes a device which consisted of a single conically

shaped gold nanotube embedded within a polymeric membrane. This device mimics one

of the key functions of biological voltage-gated ion channels the ability to strongly

rectify the ionic current flowing through it. We report here artificial ion channels that

rectify the ion current flowing through them via an "electromechanical" mechanism. The

electromechanical response is provided by single-stranded DNA molecules attached to

the nanotube walls.

The final part of this work describes a nanodevice, which consisted of a single

abiotic nanopore system. This system is used to analyze single DNA molecules based on

the electrophoretic transport of the molecule through the single nanopore system.

Finally, this system was used to discriminate between two different types of DNA

molecules within a solution mixture. These nanopores show great promise for further

biomolecular sensing applications due to there inert and mechanically robust

characteristics.














CHAPTER 1
INTRODUCTION AND BACKGROUND

Introduction

Nanostructured materials constitute an emerging subdiscipline at the intersection of

the chemical and materials sciences.110 There is no universally agreed-upon definition of

what constitutes a nanomaterial. It is generally considered that at least one dimension (d)

must be less than or equal to 100 nm. Just larger than this are microscale materials, with

dimensions in the range of 100 nm < d < -~10 pm.

The preparation of nanostructured materials and understanding their functioning is

a big scientific challenge. The words of Richard Feynman, "There is plenty of room at

the bottom,"" suggest that when the dimensions of an object approach the nanometer

scale one might observe new properties occurring due to the restricted geometry. Among

nanostructured materials, nanopores play a very important role. Nanopores and mass

transport through nanopores have attracted a very large scientific interest because of the

relevance of these issues to systems in biotechnology and biology. Biological nanopores

such as channels and pores in biomembranes of cells are involved in almost all

physiological processes of a living organism.'2 These channels and pores are the

principal nanodevices mediating the communication of a cell with other cells via

exchange of ions and neutral molecules. Biological channels perform various

physiological fucntions.12-16 For example, there are channels that function as diodes for

ionic current they have a preferential direction of ion flow and block almost completely

ions moving in the other direction.4 One other example are the channels called ion








pumps. These channels are able to transfer ions against their concentration gradient at

the expense of energy coming from the hydrolysis of ATP.17 Many other channels are

highly selective for particular ions and can be controlled by an applied electric field, a

ligand binding event, or an applied mechanical stress.12

Building similar devices on the basis of solid-state nanopores would enable one to

combine the advantages of a robust synthetic system with the specificity and precision of

biological channels. On the other hand, preparing nanopores of transport characteristics

similar to biochannels could give new insight into the physical and chemical principles of

biological channel operations. Successful fabrication of synthetic nanopores that are more

stable and robust than biological channels would allow a wide variety of studies not

possible with fragile biological systems.

Nanoporous materials can be synthesized by using many different techniques. 1827

One such technique which has been used since the early 1970's for the production of

filtration membranes is the track-etch process. The primary focus of this dissertation is

the use of the track-etch process in preparing single nanopore systems for bioanalytical

and biomedical applications.

Background

Ion Track-Etch Process

The ion track etch process28'29 is based on the availability of accelerated heavy

ions. The technique enables one to prepare micro- and nano-pores with a high aspect ratio

and various shapes in many dielectric solids. Polymers are suited for practical

applications, due to their good mechanical and chemical strength, and their high

susceptibility for selective ion track etching. The resulting porous materials can be used

as critical apertures for filtration processes,28'29 as templates for nanowires,7,30 as








temperature-controlled31 and diode-like apertures32 with possible relevance to sensor and

biomedical applications.

Formation of Latent Ion Tracks

Heavy ion accelerators with specific ion energies above 1 MeV/nucleon create ion

beams of defined isotopic mass and energy suited for a well-defined generation of ion

tracks. Every ion hitting and potentially penetrating the polymer leads to a permanent

modification of its physical and chemical properties along its path. The result of this

modification is a latent ion track. The strength of the modification depends on the

deposited energy density, on the radiation sensitivity of the material, and on the storage

conditions of the polymer after the ion irradiation, such as environmental gases,

temperature, and illumination conditions.

Selective Etching of Ion Tracks

Latent ion tracks can be preferentially removed by chemical etching (Fig. 1-1). The

resulting shape depends on (1) the type of material, (2) the concentration of the etchant

and (3) the temperature of the etch bath. As the density of the material in the track core is

lower than the density of pristine polymer,33 the selective etching of the track core can be

attributed to its increased free volume34 corresponding to nanovoids with increased

freedom for rearrangements of the chain segments. The increased free volume facilitates

chain rupture under chemical attack. Preferential etching can be impeded by a cross-

linked zone around the track core. After removal of the cross-linked zone, the track radius

grows linear in time. The result is an etch trough, pore, or channel that can be used as a

selective gate for ions or fluid-suspended particles or may be used as a template for the

deposition of other materials.

















) b) c)

Figure 1-1 .(a) Principle of ion track-etching technique. (b) Swift heavy ions forming
latent ion tracks in dielectric solid. (c) Selective etching, resulting in an array
of etch troughs, pores, or channels.142

For large track etch velocities, the etch cone transforms into a cylinder. In general,

heavier ions induce a stronger modification, improving the local definition of the

modified zone and the selectivity of the etch process. After selective removal of the

strongly modified ion track core, etching can be retarded by a polymerized zone. Further

etching proceeds at bulk etch velocity, i.e., the track radius increases linear in time at the

same rate as the polymer surfaces recede. The etch process is finally interrupted by

replacing the etchant with water or with a diluted acid. The interruption can be induced

at a chosen time or at a chosen electrolytical conductivity across the membrane.35 The

quality of the etch process is characterized by the selectivity of track removal in

comparison with the removal of the bulk polymer.

The selectivity defined as VB / VT determines the half-angle of the etched track cone

(Fig. 1-2). The cone half-angle is defined by the relation sin or= VB / VT. For high track

etch ratio, sin a can be replaced by c. The track-etch-ratio usually is treated as constant

as long as the ion range exceeds the thickness of the material. It depends on the energy

density along the ion path, the radiation sensitivity, and the selectivity of the etch process,

i.e., its ability to differentiate between irradiated and pristine material.










original \(
..... ..................
surface










Figure 1-2.Definition of cone half-angle Qc, bulk etch rate VB and track etch-rate vT.142


The central figure-of-merit for ion track etching is the selectivity of the track-etch

process. It is given by the ratio of the etch velocity along the ion track, VT, and the etch

velocity of removing the bulk material, vB, the so-called track etch ratio, VT / vB. The

track etch ratio is also responsible for the shape of the porous structure. The shape is

defined as a self-organized process given by the energy deposition density, the direction

of etch attack, the material used, the etch medium, the etch time, and the etch

temperature. The rate of etching can be increased by raising the temperature, for

example, in high throughput development which is used in industrial applications. Also,

the concentration of the etchant influences (1) its bulk etch rate vB and (2) its track-etch

rate VT and thus (3) its selectivity s = vT / vB.

There are many different materials which are ideal candidates for preparing high

aspect ratio ion track-etch pores in a free standing membrane. These materials include

PC (polycarbonate), PET (polyethylene terephthalate), PP (polypropylene), PVDF

(polyvinylidenefluoride), PI (polyimide), and CR39

(polydiethyleneglycolbisallylcarbonate). The routine material of choice is PC (figure 1-









3), due to its high track etch ratio which enables one to produce extremely fine cylindrical

ion track etch channels. The alkaline etching of PC is described by equation 1.1.


0 CH3


CH-3


Figure 1-3.Chemical structure of polycarbonate (PC)


During alkaline etching of the pristine polymer, the main point of the etch attack is the

second oxygen in the monomer unit which is partially charged. The focus of etch attack

is the carbonate group, -O-COO-, on both sides of which chemical bonds can be



Equation (1.1) H- I4 -


o \NaOH

f n 0 0
H2O

ruptured, leading to the formation of carbonate ions, CO32- and diphenylol propane HO-

C6H4-C(CH3)2-C6H4-OH. Note that the phenol end groups of the etch products are

negatively charged in concentrated alkalis.

The use of ion tack-etching technology allows the opportunity for the production of

many different type of nanoporous material which is illustrated in Figure 1-4.28 29 These

different materials can then be used as templates for the development of a variety of other

nanostructured materials. One technique which entails the use of a template for the

production of nanostructured materials is a process called template synthesis.
































Figure 1-4. Scanning electron images of different nanostructured materials developed by
the ion-track-etching process. (a) PC (b) PET (c) Glass and (d) Mica1 2

Template Synthesis

In recent years, the Martin group has pioneered a general method for the

preparation of nanostructured materials called template synthesis.7' 9,36 In the template

synthesis method, the material of interest is deposited within the nanoporous material of a

host solid. The size and shape of the nanomaterial depend on the dimensions of the

nanocavities within the host template. Membrane based template synthesis entails

deposition of desired materials within the pores of a host solid. Depending on the

membrane and synthetic method used, the obtained nanostructured material can be solid

nanofibers or hollow nanotubes.

There are a variety of interesting and useful characteristics associated with template

synthesis. One of the most useful features of the method is that it is very general with








regards to the type of materials that can be prepared. This method has been used to

prepare nanofibers and nanotubes composed of metals,30,37-43 polymers,44-47 carbons,48-50

and semiconductors.51'52 Also, it is possible to prepare composite nanostructured

materials, both concentric tubular composites53'54 and segmented composite nanowires.55

This method has also been used to prepare materials with very small diameters. For

example, conductive polymer nanofibers with diameters of 3 nm have been prepared.56

Finally, template synthesized nanostructured materials can be assembled into a

variety of different architectures. For example, the nanostructured material can remain

inside the pores of the template membrane; or they can be freed from the template

membrane and collected by filtration. Alternatively, if the nanostructured-containing

membrane is attached to a surface and the membrane is removed, an ensemble of

nanostructures can protrude from the surface like the bristles of a brush.

Synthetic Strategies in Template Synthesis

There are two commonly used templates; organic ion track-etched polycarbonate

membranes and inorganic A1203 membranes (figure 1-5). There are a variety of different

synthetic strategies adapted from the preparation of bulk materials including chemical

vapor deposition,49'57, 58 electrochemical,59-61 and electroless deposition,62'63 chemical64

and electrochemical polymerization,65 and sol-gel chemistry.51'66 Special attention will

be given to the electroless deposition of polycarbonate track-etched membranes since this

is the chemistry used for the preparation of nanomaterials in chapters 2, 3, and 4.

Electroless Deposition

The electroless deposition method involves the use of a chemical reducing agent to

plate a metal from a solution onto a surface. Unlike electrochemical deposition, a

conductive surface is not necessary. The key requirement of electroless deposition is








arrangement of the chemistry such that the kinetics of homogeneous electron transfer

from the reducing agent to the metal ions is slow. This is extremely important because

otherwise the metal ions would simply be reduced in the bulk solution. One caveat of

,",* -,( -* b4M




ah mt ion. wl -oc "A t '.".t.,- wV la a






Figure 1-5.Scanning electron micrographs of template membranes. (a) Polycarbonate
track-etched membrane and (b) AO1203 membrane.

electroless deposition is that a catalyst is needed on the pore walls so that the reduction of

the metal ion will only occur at the pore surface. Figure 1-6 shows the schematic

representation of the electroless deposition chemistry that was used to prepare gold

nanowires and nanotubes within polycarbonate track-etched membranes. The

polycarbonate membrane is first exposed to a sensitizer (Sn2+). This is accomplished by

simply immersing the membrane for 45 minutes in a solution that is 0.026 M in SnC12and

0.07 M in trifluoroacetic acid in 50/50 methanol/water. The sensitizer binds to the pore

walls and the membrane surfaces via complexation with the amine, carbonyl and

hydroxyl groups.63 After sensitization, the membrane is rinsed thoroughly with methanol

and immersed into an aqueous solution of ammoniac silver nitrate (0.029 M Ag(NH3)2+)

for 5 minutes. A redox reaction occurs in which the surface bound tin (II) is oxidized to

tin (IV) and the Ag+ is reduced to elemental Ag. As a result, the pore walls and the









'- Sn2+ ,'Sn4+
a + SnCl2 --> + Ag2+ Ag
Sg Sn2sF- n
-- Ag

Ag + Au+ Au
Sn4+ > Sn4+
[Is n Ag Formaldehyde 40C n +Ag4
6 Sn4+ > Sn
Ag Au

Figure 1-6.Schematic diagram of Au electroless plating procedure.

membrane surface becomes coated with nanoscopic Ag particles. The membrane is again

thoroughly rinsed with methanol. The silver coated membrane is then immersed into a

gold plating bath that is 7.9 x 10-3 M in Na3Au(SO3)2, 0.127 M Na2SO3, and 0.625 M in

formaldehyde at 40C. The Au galvanically displaces the Ag particles because the

reduction potential of Au is more positive than that of Ag. As a result, the pore walls and

surfaces become coated with Au particles. These particles are excellent catalytic sites for

the oxidation of formaldehyde and the concurrent reduction of Au (I) to Au (0).63

Without a catalyst, the kinetics of the electron transfer from the reducing agent

(formaldehyde) to Au (I) is slow; therefore, the gold plating continues on the gold

particles instead of in bulk solution. The reaction can be represented as follows:


2Au(I) + HCHO + 30H -- HCOO' +2 H20 +2Au(0).


This method yields the Au nanowires or nanotubes within pores plus Au surface layers on

both faces of the membrane. These structures run through the entire thickness of the

template membrane (figure 1-7). By controlling the plating time, the inside diameter of

the nanotubes can be varied because the thickness of both the Au surface films and

nanotube walls increase with plating time.









Membrane Face


Pore Top View
/

Electroless
Plating '


Gold surface film


Au nanotubes
Side View lining the pores

S Electroless
Plating
Membrane Pores



Before Gold Plating After Gold Plating

Short
Plating
d Time di

t/ di Pore Gold Layer


Long
Plating -
Time i2d

d2 << di


Figure 1-7.Schematic illustration of Au nanotubes obtained from electroless gold
deposition

By controlling the plating time, the inside diameter (ID) of the nanotubes can be

varied, even as low as 1 nm in diameter.38 As a result, these membranes can be used in a

simple membrane permeation experiment to cleanly separate small molecules on the

basis of molecular size.38 Also, by chemisorbing appropriate thiols to the Au nanotube

walls based on the well known gold-thiol chemistry, the Au nanotube membranes can be

made to preferentially transport cations vs. anions and hydrophobic vs. hydrophilic








molecules.37, 41,42,67 In addition, Au nanotube membranes are electronically conductive

and can be charged electrostatically in an electrolyte solution.37 This introduces ion-

transport selectivity, allowing the Au nanotube membranes to be electromodulated

between ideal-cation and ideal-anion transport states.37 Thus these Au nanotube

membranes are ideal model systems for studying how pore size, chemistry, and charge

affect the transport selectivity at the nanometer scale.

The electroless gold deposition method has also been used in the study of ion

current rectification within single nanopore track-etched membranes.68 These systems can

be used as robust synthetic systems for the study of voltage-gating and ion current

rectification which is present in biological voltage-gated ion channels.24-27 These systems

have the potential of offering a greater understanding of the different functional

mechanisms which are present within biological ion channels. The fabrication of a

synthetic voltage-gated ion channel mimic will be discussed in chapter 4.

Biological Ion Channels

Biological ion channels are the principal nanodevices mediating the communication

of a cell with other cells via ion transport,12 and enable the functioning of a living

organism. There are three types of ion channels. The Ligand gated channel, the

mechanically gated channel, and the voltage-gated channel.12 The ligand gated channel is

unique in that it will open and close in response to the binding or unbinding of a

particular "ligand" or molecule. The mechanically gated ion channel open and closes by

the mechanical deformation of the cells of stretch receptors. The voltage-gated channel is

very unique in that it will open and close in response to the change in the transmembrane

potential. These voltage-gated ion channels also control the excitability of nerve, muscle,

endocrine and other cell types, thereby regulating a broad spectrum of cellular processes.








Potassium Voltage-Gated Ion Channel

Potassium channels conduct K ions across the cell membrane, down the

electrochemical gradient for K+. Potassium conduction underlies many different cellular

processes including cell volume regulation, hormone secretion, and electrical impulse

formation in electrically excitable cells.12 All known K+ channels are related members of

a single protein family. They are found in bacterial, archeal, and eukaryotic cells both

plant and animal and their amino acid sequences are very easy to recognize because

potassium channels contain a highly conserved segment called the K channel signature

sequence.69 This sequence forms a structural element known as the selectivity filter,

which prevents the passage of Na+ ions but allows K+ ions to conduct across the

membrane at rates approaching the diffusion limit. This is the hallmark of K channels:

nearly perfect selectivity for K+ ions over Na+ ions in the setting of very high K+

conduction rates.

New insights into the physiological functions and biophysical properties of these

channels have emerged with the determination of the molecular sequence and primary

structure of many of their protein components. Yet the mechanism by which these

proteins sense changes in membrane potential has remained elusive. Now, Youxing

Jiang, Roderick MacKinnon and colleagues have published the crystal structure of a full-

length voltage dependent K+ channel70 and described experimental tests for a mechanism

of voltage sensing in this channel.71 Their findings reveal an unexpected and surprisingly

simple design in the voltage sensor. The functional unit of a voltage-gated ion channel is

a tetramer (Figure 1-8). Each of the four subunits of the tetramer is a protein with six

transmembrane domains. Reason dictates that the voltage sensor would be a charged

sequence located within the cell membrane that would move from one side to the other in













Out













In









Out


*4*6
.:


/

/

'LI


Pore helix



Outer
helix


.-dw(
0
-* 't


Inner -
helix O
bundle


Inner helix


Figure 1-8.Schematic representation of the functional units of a potassium voltage-gated
ion channel7U


/
'4 7
I-








response to changes in potential across the membrane (Figure 1-9). The fourth

transmembrane domain, known as S4, is a likely candidate for the voltage sensor because

of two properties. First, it is hydrophobic, which indicates that it should be located within

the lipid bilayer of the membrane or embedded within the interior of a protein. Second,

S4 contains four to seven positive charges, depending on the channel type, which would

confer voltage sensitivity to this segment of the protein. For these reasons S4 has been the

focus of numerous studies on voltage sensing in ion channels.72

The Voltage Sensors Charged protein "paddles"
that swing from one side of the membrane to the Paddles Up
other in response to a change in the Channel Open





Lipid Bilayer
Membrane
+


Open OK Paddles Down
Closed Channel Closed

Figure 1-9.Electromechanical gating mechanism of the potassium voltage-gated ion
channel143

One of the main characteristics of potassium voltage-gated ion channel is that they

are ion current rectifiers. Rectifier is a term that comes from electronics, referring to

devices that conduct electrons only in one direction. These potassium voltage-gated ion

channels show a nonlinear current-voltage characteristic which says that they are ion

current rectifiers (Figure 1-10). Ion current rectification suggests that there is a

preferential flow of ions through these ion channels.









50-pA

40-

30-

20-

10-
mV
-200 -150 -100 -5 3 50 100 150 200


-20-

-30-

-40-
-50-


Figure 1- O.Current-voltage curve of rectification within potassium voltage-gated ion
channel70

Although the structure of these channels are known,73"75 there are still many aspects

of ion transport that are not yet well understood. The phenomenon of ion current

fluctuations is one of the unsolved puzzles.76 Also, there are open questions regarding

ion current rectification and pumping within these channels. These questions have

motivated researchers to design biosensors and learn more about ion transport within

nanochannels. To design biosensors and learn about ion transport in nanochannels, it

would be very helpful to have a synthetic, robust system that is much easier to understand

and describe. This would also allow researchers to perform experimental studies not

applicable to biological channels due to their fragile nature. First, however, we have to

determine whether synthetic pores can function as analogs of biological ion channels. In

other words, if we could prepare pores in a synthetic film of dimensions similar to those

of biological channels, would it be possible to observe similar transport properties, for

example, ion current fluctuations, rectification, and pumping?








Resistive-Pulse Sensing (Stochastic Sensing)

It has been shown that a protein nanopore (for example, the a-hemolysin channel)

can function as a biosensor for the detection of biomolecules, for example, DNA.77 The

sensing procedure used is based on a technique called resistive-pulse sensing. In the

simplest terms, this method is based on an electrochemical cell in which a small aperture

separates two ionically conductive salt solutions. Within each side of the cell an

electrode is placed and an ionic current is passed through the aperture. A charge analyte

species with a diameter that is comparable to that of the inside diameter of the single

aperture is electrophoretically driven through the aperture. When the analyte species

enters the aperture the channel pathway is partially obstructed. This obstruction causes a

change in the ionic current through the channel. This change in ionic current can be used

to determine the size, identity, surface charge and even the concentration of the analyte

species present within the system. Figure 1-11 show a schematic representation of how

this process works. Because many biomolecules are charged, this detection method can

potentially be very widely applied and does not require any chemical pretreatment of the

molecules, which is a big advantage over other detection techniques.

The classic example of a resistive-pulse sensor is the coulter counter (Beckman

Coulter, Fullerton, CA), a commercially available device used to count and size

biological cells and colloidal particles.78-80 The Coulter counter uses a small diameter

aperture (from -20 PIm to as large as 2 mm) separated by two electrolyte solutions and a

constant ionic current is passed through this aperture. The aperture is typically fabricated

through a man-made sapphire, the thickness of which is comparable to the diameter of

the aperture. An electrolyte solution is placed on each side of the aperture. The









SCrre Without analyte





-- time


le__ Current
With analyte
I Analyte with negative charge --]




time

Figure 1-1 1.Schematic illustration of resistive-pulse sensing

suspended biological cells (or other particles) to be counted are introduced on one side of

the aperture. This solution is then forced to flow through the aperture. Flow of the

solution is driven by a pressure gradient across the aperture, and with modem

instruments, the volume of liquid sampled can be precisely controlled.80

When a particle enters the aperture it effectively displaces a volume element of

electrolyte solution equivalent to the particle volume. As a result, the resistance through

the aperture increases during the obstructed time of the particle within the aperture. This

transient increase in the aperture resistance is monitored via the corresponding increase in

voltage drop across the aperture. The number of such voltage pulses provides a count of

the particles suspended in the electrolyte. The height of the pulse is proportional to the

volume of the particle within the aperture. Therefore, from this information the particle

size information can be obtained. Also, the distribution of pulse amplitudes reflects the

relative distribution of the volumes of the particles counted.79 This process can be used

to size several thousand particles per second. Commercially available instruments can








measure particles with diameters ranging from as small as -400 nm to as large as -1

mm.78-80 The diameter of the particle to be counted determines the diameter of the

aperture used in the instrument.

As would be expected, the smaller the particles to be counted, the smaller the

aperture used. Therefore, to detect smaller analyte species smaller aperture systems are

needed. The model system to date which is used in the stochastic sensing of individual

analytes is the use of a bioengineered a-hemolysin protein channel (figure 1-12).81'82

These channels have been used in the detection of divalent metal ions,83 84 organic

analytes,85 proteins,, 87 polymers, DNA,89-93 and peptides.94 Even though these

channel proteins have proven to be an instrumental tool in the development of a

molecular stochastic sensor they still possess limitations which need to be overcome for

future applications. The biggest limitation of this protein channel system is the stability

of the biological support system (lipid bilayer membrane). This limitation has sparked an

increased interest for researchers to develop a synthetic single nanopore system which

has similar sensing capabilities but overcomes the stability limitations encountered by

biological systems.

There has been a significant amount effort focused toward the development of a

synthetic single aperture system which would be able to analyze individual analytes at the

molecular level. The first system was demonstrated by DeBlois and Bean.95-97 They

used a system which incorporated a 500 nm diameter single pore within a track-etched

polycarbonate membrane. Because of the smaller aperture, this device could detect








vestibule/lcavity 3oA



cap

constriction 100ooA

transmembrane
(3 barrel

20A

Figure 1-12.Essential features of the staphylococcal a.-hemolysin pore shown in a cross
section based on the crystal structure.

particles with diameters as small as 60 nm. For example, virus particles were detected

with this device.95 Also, Li and Crooks developed a single nanopore device which was

made up of a single carbon nanotube embedded within a support material.98' 99 These

single nanotube systems had an aperture diameter of-60 nm and a path length of 1.0 um.

These systems have been used for analysis of nanoparticles.

There have been several single nanopore systems developed from inorganic solid-

state materials. One such system employs the use of a feedback-controlled sputtering

system, based on irradiating the materials with (argon) ion beams of several keV

energy.'18' 1 This technique allowed the preparation of a single nanopore in a Si3N4

support with diameters down to 1.8 nm. Another method used to produce pores in silicon

oxide with an aperture diameter of several nanometers was developed in the group of

Dees Dekker. The pores are manufactured by electron beam lithography and anisotropic

etching in combination with high-energy beam in transmission electron microscope.101

Also, there is a technique which uses classical lithographic methods combined with








micromolding of poly(dimethylsiloxanne). This approach has been used to produce must

larger channels of approximately 200 nm in diameter. 19'20 Finally, the track-etching

process has been used to produce single nanopore membranes in polyamide (Kapton 50

HN, DuPont).23 All of these systems have been used in the detection or discrimination of

individual double stranded DNA molecules.

Within this dissertation we will discuss some of the advantages of the fabrication of

a single conical nanopore within a polycarbonate film which are not currently available

within the present synthetic single nanopore systems. The first advantage is that we are

able to control the diameter of the nanopore over a very large diameter range. It has

shown that we can make single nanopores with diameters >200 nm and diameters as

small as 1.9 nm. Also, the length of the nanopore can be systematically altered for each

desirable experimental setup. By using the track-etch process to fabricate single

nanopore systems, the effective length of the nanopore can be changed from a large

effective length of 12 im to a value of <100 nm. This flexibility offer one the control

over a very important parameter within single nanopore systems which is the effective

detection zone within the channel. This detection zone is the area within the channel

which the particular analyte is detected. By reducing the length of this zone you are able

to then in turn detect smaller analytes.

The practical side of this system is that it allows the researcher the ease of

preparation. With the track-etch process there is no need for expensive equipment in

which a highly experience technician is needed to perform the task. This allows for a

more stream line process which is very important in future directions of mass production

of these single nanopore membranes. This system also has an advantage in








characterizing the nanopore. There has been a large amount of research directed at

studying nanopore track-etched membrane within the Martin group. This background

information has allowed for a more routine characterization of the single nanopores. We

can also take advantage of the electroless gold plating process,37 which was pioneered

within the Martin group, to exam this geometry of the nanopore system. Finally, maybe

the most important parameter which one needs to control is the surface chemistry

throughout the nanopore. Our system offers the ability to change the chemistry within a

nanopore by the use of gold-thiol interaction. This is one of the main advantages which

our system offers which the other synthetic single nanopore systems do not currently

posses.

Dissertation Overview

The goal of this research is to develop single nanopore and nanotube membranes by

the use of the track-etch process, and to investigate the transport properties and potential

applications of these single nanopore membranes in the biomedical and bioanalytical

fields. The previous part of chapter 1 has reviewed background information for this

dissertation including the ion track-etch process, membrane based template synthesis,

applications of gold nanotube membranes, biological ion channels, potassium voltage-

gated ion channels, and stochastic chemical sensing.

In chapter 2, a new method for isolating single nanopores in track-etched

membranes is demonstrated. Using this method, we have obtained membrane samples

containing from one to four nanopores with diameters ranging from as small as 30 nm to

as large as 200 nm. We have also shown that an Au nanotube can be electrolessly plated

within the single nanopore by using the template synthesis method. This process

provides a route for closing down the diameter of the nanopore to molecular dimensions.








Good agreement was obtained between the inside diameter determined electrochemically

for a single-nanotube membrane (1.9 nm) and the inside determined from a gas flux

measurement on an analogous high nanotube density membrane (2 nm). These data

suggest that the electrochemical method provides a convenient way to determine the

inside diameter of a nanotube in a single-nanotube membrane.

Chapter 3 deals with the issues of using the track-etch process in producing single

asymmetric nanopores within a polymeric support. A one sided anisotropic etching

process was developed with the introduction of applied voltage during the etching

process to improve on the asymmetric shape of the single nanopore. This asymmetric

shape nanopore allows for a very small nanometer sized pore with low membrane

resistance. Also, this method allows a route for controlling the effective length of the

membrane system. This control is essential in developing a synthetic single nanopore

system which is comparable to that of biological ion channels.

In chapter 4, these single asymmetric nanopore membranes were using in the

development of artificial voltage-gated ion channels. The template synthesis method was

used to produce a single gold conical nanotube. These single gold nanotube membranes

were modified with thiolated single stranded (HS-ssDNA) composed with different

number of bases ranging from 12-mer to 45-mer. These HS-ssDNA modified

membranes show a voltage gating response in the presence of an electric field. Also, the

degree of rectification is shown to increase with increasing number of bases. This

voltage-gated response is a similar response which is seen in potassium voltage-gated

channels. This in turn constitutes that the ssDNA chains are moving into the pore

producing a "closed" state at certain potential range, and the chain are moving out of the








pore producing an "open" state at the reverse polarity. Also, by decreasing the nanotube

diameter so that the HS-ssDNA chains are similar in size the extent of rectification can be

maximized. Finally, we have shown that these synthetic voltage-gating channels posses a

high degree of selectivity for recognizing complementary ssDNA versus non-

complementary ssDNA. This selectivity can be seen by examining the current time

traces exhibited by the translocation of the DNA molecule through the single nanotube.

In chapter 5, these single asymmetric nanopore membranes were used as a device

for stochastic chemical sensing. These single nanopore membrane systems were used to

detect individual single stranded DNA molecules without the use of analyte labeling.

Also, these membrane systems were used to discriminate between individual single

stranded and plasmid DNA molecules based on an electrochemical detection method.















CHAPTER 2
SYNTHETIC SINGLE NANOPORE AND NANOTUBE MEMBRANES

Introduction

There is increasing interest in measuring and investigating transport and

electrochemical phenomena in membrane samples that contain a single pore of

nanoscopic diameter.18', 83, 89, 102-105 One motivation for this interest stems from the fact

that selective ion transport in nanopores (protein-based ion channels) is used throughout

living systems for electrical signaling in nerves, muscles and synapses.12 Very recent

advances in making synthetic analogs of ion-channels based on single nanopore

membranes are shedding light on the mechanisms by which these naturally occurring

channels function.24'25,35 105 Another motivation for studying transport in single

nanopore systems comes from the work of Bayley et al. who have shown that

measurements of the ionic current through a single protein channel in a lipid bilayer

membrane can form the basis of a new and versatile method for single-molecule chemical

and biosensing sensing, called stochastic sensing.102104, 106 It has been recently shown

that synthetic single nanopore systems can also accomplish this single-molecule

stochastic sensing function.18

As the above examples indicate, there has been considerable recent success in

developing methods for preparing synthetic single nanopore membranes. Approaches

investigated to date include single nanopore membranes prepared by microfabrication

methods,'8 the track-etch method, .24,25, 35,105 and through incorporation of a single








fullerene nanotube within a synthetic membrane.99 We have developed an alternative

approach for making synthetic single nanopore membranes that we believe is easier and

more accessible than the previously described methods. This method is based on low

pore density track-etch membranes obtained from commercial sources and is a derivative

of a method described by Bean et al. in 1970.97 However, these authors made single-pore

membranes where the pore diameter was quite large (>200 nm). Our method yields

membranes with single nanopores having diameters as small as 30 nm, which can be

subsequently decreased to 2 nm by depositing a gold nanotube within this pore.63 107,108

We describe this method for making synthetic single nanopore membranes here.

Background

Because the membranes investigated here are prepared by the track-etch method,

we first briefly review this process. The track-etch method29 entails bombarding a solid

material (in this case 12 p.m-thick polycarbonate films) with a collimated beam of high-

energy nuclear fission fragments to create parallel damage tracks in the film. The

damage tracks are then etched into mono-disperse pores by exposing the tracked film to a

solution of aqueous base. The diameter of the pores is determined by the etch time and

the etch-solution temperature. The pore density (pores per cm2 of membrane area) is

determined by the exposure time to the fission-fragment beam. Filtration membranes of

this type with pore diameters ranging from as small as 10 nm to as large as 10 ptm are

sold commercially. These membranes have high pore densities, for example almost 109

pores cm-2 for the smallest pore-diameter commercial membranes.

Bean et al. recognized over three decades a go that a single-pore version of such

membranes would be technologically useful. They were interested in using such single-








pore membranes as CoulterV-type counters95-97 for identifying and counting small

particles, for example a bacteriophage with diameter of -100 nm.97 They obtained single

pores by first preparing a low track-density (-103 tracks cm-2) membrane, and then

etching the tracks to make 250 to 350 nm-diameter pores. A small square of this

membrane was then cutout and mounted with epoxy over a 0.3 mm-diameter hole in a

plastic disk. While the epoxy was still fluid, this sample was imaged under a 200 power

stereomicroscope with dark-field illumination, through which the individual pores in the

sample could be seen. The membrane square was moved around on the epoxy-coated

disk until all of the pores except one were coated with epoxy, and the epoxy was allowed

to harden.

While quite innovative, the downside of this method is immediately obvious.

Because the resolution of the light microscope is limited by the diffraction of visible

light, the minimal single-pore diameter that can be achieved by this method is on the

order of 200 nm. As will be discussed here, we have devised a fluorescence-based

method that circumvents this limitation and allows for much smaller (e.g., 30 nm

diameter) single-pore membranes to be prepared.

Finally, there is an alternative track-etch method for preparing single nanopore

membranes.35 This method is based on a special tracking process in which a small area

of the membrane to be tracked is isolated by a mask and placed between the heavy ion

source and a silicon surface-barrier particle detector. When a single particle traverses

through the membrane and is registered by the detector, an electromechanical shutter

system switches the beam off, thus yielding a portion of the membrane with a single

track, which can then be etched into a pore. A potential disadvantage of this method is








that special tracking equipment is needed and these single-track membranes cannot be

purchased commercially. In contrast, the membranes used here were obtained from

commercial sources.

Experimental

Materials

The tracked but not etched polycarbonate membranes were obtained by special

order from Osmonics (Bryan, TX). These membranes were 12 pm thick and had a track

density (as determined by field-emission electron microscopy after etching the tracks into

pores) of 50 tracks cm-2. A membrane with much higher track density (107 cm-2) was

also investigated here. This tracked membrane (also 12 pm thick) was obtained from

Whatman. Fluorescein isothiocyanate (FITC) was obtained from Aldrich, and a 1 mM

solution, dissolved in 1-propanol at pH = 9.0, was prepared; the pH of was adjusted with

triethylamine. All other chemical were of reagent grade or better and were used as

received. Purified water was obtained by passing house-deionized water through a

Bamstead E-pure model D4641 water purification system.

Pore Etching

Etching was done at room temperature (23 oC) by simply immersing the tracked

membrane into a glass beaker filled with 100 mL of 6M NaOH. After the desired etch

time, the membrane was removed from the etch solution and immersed into a 1 M formic

acid neutralizing solution. The membrane was left in this solution for one hour and then

immersed for one hour in purified water at 40 C. The membrane was then rinsed with

purified water and stored in air.

Isolating a Single Nanopore

A fluorescence microscopy method (Figure 2-1) employing a Zeiss Axioplan 2








microscope was used. A thin gold film (-10 nm thick) was first sputtered onto one face

of the etched polycarbonate membrane. A 20 p.L drop of the FITC solution was placed

on a glass microscope slide, and the membrane was immediately placed on this solution

drop with the Au film facing upward (Figure 2-1 B). The FITC solution wicked through

the nanopores forming droplets (larger than the pore diameter, vide infra) at the upper

surface of the membrane (Figure 2-1 C). These solution droplets were visualized via the

fluorescence microscope, using an excitation wavelength of 519 nm. To mark an area of

the membrane surface containing only a single nanopore the brightfield illumination of

the microscope was adjusted such that only this desired area was seen thorough the

microscope. An extra fine-point Sharpie (Sanford, Bellwood, IL) marking pen was then

used to circumscribe the portion of the membrane visible through the microscope. In

addition to isolating portions of membranes containing a single nanopore, this method

was used to isolate membrane portions containing two, three, and four nanopores.

The circumscribed portion of the membrane was then isolated by applying a piece

of tape (3M Scotch brand NO. 3750) with a 3 mm diameter hole punched through it. The

tape was applied such that the surrounding pores were under the tape and the selected

pore was in the area of the punch hole (Figure 2-1D). The membrane was then rinsed

thoroughly with 1-propanol to remove all of the FITC dye. The Au film was sputtered on

the membrane surface to insure that only the FITC that has wicked through the pores, and

not the solution between the membrane and the glass surface, was seen in the

fluorescence image.

Field-Emission Scanning Electron Microscopy (FESEM)

FESEM was used to measure the diameter of the nanopores obtained. A Hitachi









S-4000 FESEM with a resolving power of -1.5 nm was used. In addition, FESEM was

used to explore the geometry of the pores obtained from the etching process used here.

This is a critical issue because it has recently been shown that the pores in the

commercially available track-etched membranes are cigar-shaped;'09 that is, the pore is

cylindrical through most of the membrane thickness but tapers at both membrane faces to

conical tips. As per Schonenberger, et al.109 pore shape was investigated by plating Au

nanowires in the pores, dissolving the membrane and imaging the resulting nanowires.

Because of the larger number density of nanowires obtained, these analyses were

conducted on nanowires plated in the 107 pores cm-2 membrane.




W FITC dye
Nanopores




(A) (B)

FITC dye that has Isolated
wicked through nanopore Tape Mask
/ nanopore





(C) (D)

Figure 2-1.A schematic diagram of the isolation process using fluorescence microscopy.
(a) Low porosity polycarbonate membrane sputtered with gold. (b)
Membrane placed on top of a drop of FITC solution. (c) Dye solution
protrudes up through the pores essentially marking each pore. (d) One
nanopore is chosen and the other pores are masked off with a tape mask.

The electroless plating procedure described previously63' 107, 108 was used to plate

the Au nanowires. To obtain solid Au nanowires,63 as opposed to hollow Au

nanotubes,107,108 a plating time of 24 hours was employed. The plating procedure yields








both the nanowires within the pores and Au surface films covering both faces of the

membrane. After plating, the Au surface films were removed by mechanically polishing

with a cotton swab wetted with ethanol. The membrane was then dissolved by

immersion into methylene chloride. The resulting solution was filtered through a

branched-pore Anopore (Whatman) 0.02 Jpn alumina filter membrane to collect the

liberated nanowires. The polycarbonate from the dissolved membrane was removed by

rinsing the filter with copious quantities of methylene chloride. FESEM images of the

Au nanowires were obtained by imaging the surface of the Anopore filter.

Electrochemical Measurements

The membrane sample was clamped between the two halves of a U-tube cell,10

and each half-cell was filled with -5 mL of 1 M KC1. A Pt wire (1.0 mm diameter) was

inserted into each half-cell solution, and a potentiostat (EG&G 273) was used to apply a

constant transmembrane voltage. The resulting transmembrane current, carried by ion

migration through the nanopore(s), was measured. The resistivity of the 1 M KCI

electrolyte used here was measured using an Accumet AR50 conductivity meter. A

value of 13 Qcm was obtained.

Gold Nanotube Membranes

We have shown that when short plating times are used, the electroless plating

method yields hollow nanotubes (as opposed to solid nanowires) within the pores of such

track-etched membranes.'07' 108 This approach was used here to effectively decrease the

inside diameter of the nanopores. A membrane with a single 55 nm-diameter pore was

plated to obtain the corresponding single Au-nanotube membrane. A plating time of 4

hours was used. As per the nanowire case, the plating method yielded the Au nanotube








within the pore plus thin Au surface films covering both faces of the membrane. These

surface films do not block the mouths of the nanotube,107' 10s and as a result,

transmembrane ion currents can be measured without removing these surface layers. Ion

currents were measured in the U-tube cell described above; however, a Kiethley

instruments 6487 picoammeter/voltage source with exceLINX software was used to

apply the constant transmembrane voltage, and measure the resulting transmembrane ion

current.

Results and Discussion

Microscopy

Figure 2-2a shows a fluorescence microscopy image of a portion of a membrane's

surface that contained only a single nanopore. The pore is observed as a bright green

spot (FITC fluorescence) against a totally black background. This pore was obtained by

etching the membrane for 10 min. Figure 2-2b shows a FESEM image of the same pore.

Images of this type were used to determine the pore diameter, in this case 30 nm.

The spot size in the fluorescence microscopy image is significantly larger (-2.5

pm), indicating that a droplet of the FITC solution "blossoms" at the membrane surface

from the pore. Figure 2-3 shows analogous images for a pore that resulted from an etch

time of 30 min. The fluorescence microscopy image shows a FITC spot size of -3.6 tm,

and the FESEM image shows that this pore is 55 nm in diameter.

FESEM analyses of this type were done for membranes etched for times ranging

from 10 to 80 minutes. Because it was easier to find the pores in the FESEM images,

most of these analyses were done on membrane samples with 107 pores cm-2; however, to

confirm that the relationship between etch time and pore diameter was independent of








pore density, analyses were also done on the 50 pores cm-2 membranes (Figure 2-4).

These analyses show that pore diameter is linearly related to the etch time, increasing at a

rate of -25 nm min-1 (Figure 4), independent of pore density. As noted above, it has

recently been shown that the pores in commercially available track-etched filter

membranes are cigar-shaped.84 It has been suggested that this pore geometry arises

because the fission fragment that creates the damage track also generates secondary

electrons, which contribute to the damage along the track.109



(a) (b)












Figure 2-2.A fluorescent and Scanning electron micrograph of single 30 nm nanopore (a)
A fluorescence image of a single 30 nm pore isolated using the isolation
process. (b) A scanning electron micrograph of the same single 30 nm pore
isolated using the isolation process.

According to this hypothesis, the number of secondary electrons generated at the

faces of the membrane is less than in the central region of the membrane, and this is why

the pore has a larger diameter in the middle. Because pore shape is critical to any

application involving transport through, or measurements of ion current in, these

membranes, we have investigated the shape of the pores obtained by our etching process.
























Figure 2-3.A fluorescent and scanning electron micrograph of single 55 nm nanopore (a)
fluorescence image of a single 55 nm pore isolated using the isolation process.
(b) Scanning electron micrograph of the same single 55 nm nanopore.

Figure 2-5 shows a montage FESEM image of a typical Au nanowire that extended

through the entire thickness of the polycarbonate template membrane. i.e., the length of

the nanowire is equivalent to the thickness of the membrane, 12 pm. Such images show

that the nanowires have a constant diameter (in this case 55 nm) down their entire length.

Most importantly, these images show that conical tips are not present on the ends of the

nanowires. This is in clear contrast to analogous images obtained for Au nanowires pore

ends observed in the commercial membrane are not a consequence of the tracking

process, as suggested previously,109 but rather occur during pore etching. Apparently, the

plated in the commercially available membranes.109 These results show that the conical

etching solution used commercial contains additives that slow down the rate of etching at

the membrane surface.

Electrochemical Measurements

Assuming that the ionic resistivity (p) of the electrolyte within a nanopore is the

same as the resistivity of the bulk electrolyte solution, the ionic resistance of a single








nanopore (Rp) can be calculated from the pore diameter (dp) and the pore length (1) via

R = 4pl/dp22t (1)

The pore length is simply the thickness of the membranes (12 itm). If the

membrane sample contains N nanopores of diameter dp instead of a single pore, then the

net resistance of the sample (Rm) is given by

Rm = 4 pl/Ndp2 (2)

Assuming that each pore acts as a perfectly ohmic resistor, then the ionic current flowing

through the membrane sample (i) is related by Ohms law to the applied transmembrane

potential difference (AE). Combining Ohm's law with Equation 2 gives,

i =AE N dp2 / 4 pl (3)



E%200 .
M 175
150
4l 125i

75 1 0p porest/cn2

0 501 ,
0 25 A 5Oporeso'n2
0 ---- -- 1----....-----

0 10 20 30 40 50 60 70 80

time etched (nrn)


Figure 2-4.A plot of observed pore diameter versus etching time in 12-micron thick
polycarbonate films. The pore diameters were calculated with the use of
images taken from a Joel 6335F field emission scanning electron microscope.

To test Equation 3 membrane samples etched for 30 min were prepared with 1, 2, 3, and

4 nanopores in the sample. FESEM images showed the pores in such membranes were









55+3 nm in diameter. Figure 2-6 shows a plot of i vs. the number of nanopores in the

sample for an applied transmembrane potential difference of AE = 1.5 V. In

agreement with Equation 3, a linear relationship (correlation coefficient = 0.996) is

observed. If the FESEM-determined average pore diameter (55 nm) is used in Equation

3 to calculate the i vs. N data, the solid line in Figure 2-6 is obtained. There are no

adjustable parameters in these calculations, and the fit between the experimental and

simulated data is excellent (Figure 2-6). These results confirm that the bulk solution

resistivity value is applicable for the electrolyte in these 55-nm diameter pores. Because

55 nm is large relative to the diameters of the hydrated ions (-0.3 nm),l' This was the

expected result. We will have more to say about pore vs. bulk-solution electrolyte

resistivity below.



r



















Figure 2-5.FESEM image of a complete (12-pim long) Au nanowire. Insets show
magnified views of the nanowire ends
magnified views of the nanowire ends








Equation 3 also predicts that i for a membrane sample is linearly related to

magnitude of the applied transmembrane potential, AE. Figure 2-7 shows data of this

type for a single-nanopore membrane etched for 30 min. In agreement with Equation 3,

good linearity (correlation coefficient = 0.998) is obtained. However, if the average


10


8


6 Calculated


4-4


2 Experimental


0
0 1 2 3 4
# of pores

Figure 2-6.A plot of measured and calculated values of ionic current versus number of
pores in the membrane with a pore diameter of 55 nm.

FESEM-determined pore diameter (again, 55 nm) is used to calculate the i-vs.-AE plot,

the upper dashed line in Figure 2-7 is obtained. Good agreements between the

experimental and calculated data are observed at low values of AE, but the calculated line

lies above the experimental data at high values of AE.

If dp is used as an adjustable parameter in Equation 3 to fit the experimental and

simulated data, excellent agreement is obtained for dp = 53 nm (lower solid line in Figure

2-7). This electrochemically determined dp is more accurate than the FESEM value (55








nm) because the FESEM value is an average over a number of pores and because it was

obtained from surface images of the pore mouth only. In contrast, the electrochemical

measurement is for the pore question (i.e., not an average), and it interrogates the pore

down its entire length. The high sensitivity of the calculated current to pore diameter

results because the current is related to the square of dp (Equation 3). Interestingly, the

electrochemically determined value is within the standard deviation of


12
Calculated
10 (55 nm)

8


Calculated
4 (53 nm)

2 Experimental

0 -- -- -
0 2 4 6 8 10
Transmembrane Potential (V)


Figure 2-7.A plot of ionic current versus applied potential across a single pore membrane
with a diameter of 55 nm.

the FESEM value, indicating that the electrochemical method is both more accurate and

more precise. To confirm that the transmembrane current is related to the square of the

pore diameter, membrane samples having single pores with diameters ranging from 30 to

140 nm were prepared. The transmembrane current for these membranes was measured

at a constant transmembrane potential of 1.5 V. Figure 2-8 shows that in agreement with

Equation 3, i is linearly related to dp2 (correlation coefficient = 0.9996), and that the fit

between the experimental data and a line calculated using the FESEM-determined pore








diameters is very good. Note that this does not contradict what is said above because the

discrepancy between the FESEM dp value and the measured current was not observed in

Figure 2-7 until the transmembrane potential exceeded -2 V


14

12

10

i 8

6 Experimental
4
Calculated
2

0 -
0 5000 10000 15000 20000

Pore Diameter2 (nm2)



Figure 2-8.A plot of ionic current versus Pore diameter2 (nm2) of single pore membranes.

A Single Au Nanotube Membrane

For many of the applications that we envision for these single-nanopore membranes

(e.g., stochastic sensing),84,102-104 it is essential that the pore diameter approaches

molecular dimensions. We have already shown that this can be accomplished by

electrolessly plating Au nanotubes within the pores of such membranes.107' 108 However,

this prior work involved commercially available membranes with pore densities greater

than 108 cm-2. Au nanotubes have not been plated previously in single nanopore

membranes. A membrane sample containing a single 55 nm-diameter pore was

electrolessly plated for four hours to yield an Au nanotube within the pore. Figure 2-9

shows a plot of ion current vs. applied transmembrane potential for this single-nanotube






40


membrane sample. As would be expected from Equation 3, this plot is linear (correlation

coefficient = 0.999) and passes through the origin.

We have used a gas-flux method to determine the inside diameter of Au nanotubes

plated in the commercially available membranes.'07' 108 This is not possible here, because

the gas flux through a single nanotube would be immeasurably low with our apparatus.

Calculated
6 (2.0 nm)
Calculated
4 (1.9 nm) *,

2 \ Calculated
.,** (1.8 nm)
Experimental
a. ------ 0^ -
-3 -2 -1 ..* 0 1 2 3
-2

*O
,* -4

-6

Transmembrane Potential (V)


Figure 2-9.A plot of ionic current versus applied potential across a single Au nanotube
membrane.

However, we can use data obtained for nanotubes plated in the commercially available

membranes to approximate the nanotube inside diameter for this single-nanotube

membrane. Figure 2-2 in42 shows a plot of nanotube inside diameter vs. plating time for

Au nanotubes plated within the pores of a commercially available membrane with

nominally 30 nm diameter pores. A careful analysis of the pores in this membrane 112 has

shown that the cylindrical part of the pore that runs through most of the membrane

thickness is 55+4 nm in diameter, identical to the diameter of the single nanopore








membrane used here. A plating time of four hours in this commercial membrane yields

nanotubes with an inside diameter of 2 nm.42

The solid lines in Figure 2-9 were calculated from Equation 3 using nanotube

diameters of 2.0, 1.9 and 1.8 nm. The first point to note is the remarkable agreement

between the nanotube diameter obtained from the best-fit electrochemical data (1.9 nm)

and the diameter obtained from the gas flux measurement on Au nanotubes in the

commercial membrane (2 nm).42 These data suggest that the resistivity of the electrolyte

confined within these nanotubes is not appreciably different from that of the resistivity of

the bulk solution. We will have more to say about this point in the Conclusions section.

The second point to note from Figure 2-9 is, again, the sensitivity of the calculated

transmembrane current to nanotube diameter. Least squares analysis on the experimental

data in Figure 2-9 gives a slope and standard deviation of the slope of 2.31+0.01 pA V-'.

As indicated in Figure 9, this slope provides a nanotube diameter of 1.9 nm. The slope of

the lines calculated assuming a nanotube diameter of 2.0 nm and 1.8 nm are 2.62 pA V-

and 2.12 pA V-', respectively. These slope values fall well outside the boundaries of the

standard deviation of the slope of the experimental data, meaning that we can reliable

distinguish our experimentally determined diameter of 1.9 nm from a diameter of 2.0 and

1.8 nm.

Conclusions

We have demonstrated a new method for isolating single nanopores in track-etched

membranes. Using this method, we have obtained membrane samples containing from

one to four nanopores with diameters, determined using FESEM, ranging from as small

as 30 nm to as large as 200 nm. Ion current measurements were used to confirm and

refine the FESEM diameters. We have also shown that an Au nanotube can be








electrolessly plated within the single nanopore. As has been shown in our prior work,

this provides a route for closing down the diameter of the nanopore to molecular

dimensions. 108 Good agreement was obtained between the inside diameter determined

electrochemically for a single-nanotube membrane (1.9 nm) and the inside determined

from a gas flux measurement on an analogous high nanotube density membrane (2 nm).

These data suggest that the electrochemical method provides a convenient way to

determine the inside diameter of a nanotube in a single-nanotube membrane. This is

important because the previously used gas-flux method is not applicable to the single-

nanotube case.

There is, however, a caveat the electrochemical method makes the assumption

that the resistivity of the electrolyte confined within the nanotube is the same as the

resistivity of the bulk electrolyte, and this raises the question under what conditions is

this assumption valid? A good starting place for exploring this issue is the vast literature

on ionic-currents in naturally-occurring ion channels; Hille provides a comprehensive

review of this literature.12 These channels are water-filled pores with inside diameters

that can be less than 1 nm. Hille points out that the activation energy for ion transport in

some ion channels is equivalent to the activation energy for ion-transport in a bulk

aqueous electrolyte solution.12' 113 The gramicidin a channel, with an inside diameter of

0.4 nm, is an example.12' 113 This would suggest that the ionic conductivity of the

electrolyte in the channel is equivalent to that of the bulk electrolyte. However, this

agreement may be fortuitous and may reflect the evolutionary need to make ion-transport

in channels as rapid as possible.

The ionic migration term of the Nemst-Planck equation also provides a good








starting point for exploring this issue.13, 114 This equation relates the flux of an ion due

to migration (Jm, moles s"' cm-2) in an electric field (dE/dx) to the diffusion coefficient for

the ion (D), the concentration of the ion (C), and the charge on the ion (z).

Jm = (zF/RT) DC dE/dX (4)

The question then becomes how does confinement within a nanoscopic pore affect the

various terms of this equation? It is well known that when the diameter of a pore

becomes comparable to the diameter of the diffusing species, the diffusion coefficient

within the pore decreases relative to the bulk solution value hindered diffusion.14' 115

Theory predicts that for a pore with a diameter of 2 nm and ions of diameter 0.3 nm, the

pore diffusion coefficient should be about half of the bulk solution D value.114, 115

Equation 4 would suggest that this would lower the flux of the ion in the pore relative to

bulk solution. This diminution in D was recently observed in molecular dynamics

simulations of ion transport in nanopores.37, 115 However, in spite of this drop in the pore

D; the simulation predicts that the ionic conductivity of the electrolyte in the nanopore

can be higher than the bulk-solution value. For example, the simulation predicts that for

a nanopore that has a diameter 6.7 times larger than the diameter of the electrolyte ions

(as is the case for our 2 nm-diameter nanotube), the conductivity within the pore is -1.6

times higher than the bulk solution conductivity.37'115 The authors explain that this is due

to a decrease in the electrostatic interactions between the ions in the nanopore. At lower

values of the ratio of the nanopore-to-ion diameters, the conductivity became

dramatically lower than the bulk-solution value, as might be expected from the effect of

hindered diffusion on the magnitude of D.

The other factor to be considered is the concentration of ions in the nanopore. One








of the most interesting effects in this regard concerns ion concentrations in nanopores that

have fixed charge along the pore walls. (In Cl'-containing electrolytes, our Au nanotubes

are negatively charged.37' 116 Theory predicts that if the nanopore radius is comparable to

the thickness of the electrical double layer at the pore wall (clearly the case for a 2 nm-

diameter nanotube), the total ion concentration within the nanopore can be higher than in

the electrolyte solution in contact with the nanopore.116 This is because counterions must

be incorporated into the nanopore to neutralize the surface charge. Hence, one could

envision a case where the hindered diffusion diminution in D is compensated for by the

electrostatic enhancement in C (Equation 4) and the conductivity of the electrolyte in the

nanopore and the bulk solution are the same.

The bottom line is that the relationship between the conductivity of the electrolyte

in a nanopore and the conductivity of the bulk electrolyte is a very complicated issue.

Our nanotubes provide an opportunity to experimentally explore this issue.














CHAPTER 3
FABRICATION OF ASYMMETRIC NANOTUBES WITHIN AN ABIOTIC
PLATFORM

Introduction

There is increasing interest in the applications of single nanopore membranes in

analytical chemistry,98 specifically in the area of single molecule detection.89' 7 In the

previous work, the biological transmembrane protein nanopore ax-hemolysin has been

used and shown to be a versatile system for stochastic chemical sensing in single

nanopore systems.90, 92,118 The lipid bilayer membrane which supports the ca-hemolysin

possesses a major limitation in future applications. This limitation is due to the electrical

leakage currents, high capacitance per unit area and the physical instability of the lipid

bilayer membrane. These limitations confine the use of this nanopore system in future

application. This has motivated researchers to produce a more robust synthetic single

nanopore system."l9

There have been different approaches investigated to date for the fabrication of

synthetic single nanopore systems. The first approach employs a feedback-controlled

sputtering system, based on irradiating the materials with (argon) ion beams of several

keV energy.18' 00 This technique allowed the preparation of a single nanopore in a Si3N4

support with diameters down to 1.8 nm. The second technique uses classical lithographic

methods combined with micromolding of poly(dimethylsiloxanne). This approach has

been used to produce must larger channels of approximately 200 nm in diameter.20

Another method which produces pores in silicon oxide with diameters of several








nanometers was developed in the group of Dees Dekker. Theses pores are manufactured

by eelectron beam lithography and anisotropic etching in combination with a high-energy

beam used by a transmission electron microscope."1 Finally, the track-etching process

has been used to produce single nanopore membranes in polyamide films(Kapton 50 HN,

Dupont).23, 24 The technique is based on irradiation with swift heavy ions and subsequent

etching of the ions tracks. All of these nanopore systems have been used in the

productions of sensor platforms for the detection of single DNA molecules.

One of the issues, which one has to consider when building an abiotic platform for

single molecule sensing, is minimizing the effective length of the pore. The effective

length is the part of the pore, whose blockage is observed as a decrease in the ion current.

Therefore, the effective length determines the actual detection zone of the device. The

smaller the effective length the smaller the molecule (e.g. DNA) which can be probed.

Here we describe an approach that is a derivative of a method described by Apel et al.35

to prepare a single synthetic conical nanopore within a polymeric support. We

introduced a new possibility to tailor the entire geometry of the nanopore system,

focusing on diminishing of the pores effective length. Fine tuning the effective length

gives the opportunity of analyzing different types and sizes of molecules. Here we

describe the fabrication of a synthetic single nanopore system in which the effective

length, defined as a distance over which the pore resistance is focused, can be controlled

to less than 100 nm.

Experimental

Materials

The tracked but not etched polycarbonate membranes were obtained by special

order from Osmonics (Bryan, TX). These membranes were 12 pm thick and had a track








density (as determined by field-emission scanning electron microscopy after etching the

tracks into pores) of 50 tracks cm-2. All other chemicals were of reagent grade or better

and were used as received. Purified water was obtained by passing house-deionized

water through a Bamstead E-pure model D4641 water purification system.

Conical Pore Etching

To obtain conical pores the tracked but not etch polycarbonate films were placed

between two chambers of a conductivity cell (Figure 3-1) and etched at room temperature

(230) from one side with 9 M NaOH solution as described elsewhere.26'27,35 The other

chamber of the cell was filled with a stopping medium: 1 M KC1 + 1 M formic acid. To

change the effective length of the single nanopore a transmembrane potential of 0, 15 and

30V was applied across the film during etching for a desired period of time. The two

platinum electrode system was configured in way that the anode was placed within the

etching side (NaOH solution) and the cathode was placed within the neutralizing side.

This process essentially hinders the movement of OH' through the pore therefore

promoting a more asymmetric shape throughout the nanopore. It is especially important

at the moment of breakthrough, when the OHf ions are withdrawn from the pore by the

electric field.35 This process together with chemical neutralization by acidic stopping

medium assures for the preparation of asymmetric nanopores with a very small tip

diameter. After the desired etch time the membrane was removed from the conductivity

cell and immersed into a 1 M formic acid neutralizing solution. The membrane was left

in this solution for one hour and then immersed for one hour into purified water at 400C.

The membrane was then thoroughly rinsed with purified water and stored in air.

Single Nanopore Membranes

After the conical nanopore formation the polycarbonate membrane was mounted







on a standard 25 x 75 x 1 mm glass microscope slide. The membrane was then visually

analyzed with a Zeiss Axioplan 2 microscope. Due to the large asymmetric shape of the

I
( 1----I --





Etchant Stopping Solution






Figure 3-1.Eletrochemical etching cell
nanopore one can visually image the large diameter side of the nanopore with a

conventional bright-field microscope. Also, due to the low pore density of the

polycarbonate membranes the average distance between each pore was large enough to

isolate one nanopore at a time.120 To mark an area of the membrane surface containing

only a single nanopore the bright-field illumination of the microscope was adjusted such

that only this desired area was seen thorough the microscope. An extra fine-point
Sharpie (Sanford, Bellwood, IL) marking pen was then used to circumscribe the portion

of the membrane visible through the microscope. The circumscribed portion of the
membrane was then isolated by applying a piece of tape (3M Scotch brand NO. 3750)

with a 3 mm diameter hole punched through it. The tape was applied such that the
surrounding pores were under the tape and the selected single nanopore was within the
selected area exposed.








Field-Emission Scanning Electron Microscopy (FESEM).

FESEM was used to measure the diameter of the nanopores obtained. A Hitachi

S-4000 FESEM with a resolving power of -1.5 nm was used. In addition, FESEM was

used to explore the geometry of the pores obtained from the etching process used here.

The pore shape was investigated by plating Au nanowires within the pores, dissolving the

membrane and imaging the resulting nanowires. The electroless plating procedure

described previously37' 108 was used to plate the Au nanowires. To obtain solid Au

nanowires63,121 as opposed to hollow Au nanotubes37 108 a plating time of 24 hours was

employed. The plating procedure yields both the nanowires within the pores and Au

surface films covering both faces of the membrane. After plating, the Au surface film on

the small pore diameter side (neutralizing side) was removed by mechanically polishing

with a cotton swab wetted with ethanol. The gold plated membrane was them attached to

a double sided adhesive copper tape with the small pore diameter side facing upright. A

plasma etch method63' 121 was then used to remove the polycarbonate membrane and the

expose the Au nanostructure.

Results and Discussion-

Membrane Characterization

Figure 3-2a shows the FESEM micrograph of a single conical nanopore on the

side of the membrane which was exposed to the etching solution during the etching

process. This pore was obtained by etching the membrane from one side for 5 hrs and

applying 0.0 V across the membrane with the anode on the etching solution side and the

cathode on the neutralizing side. Figure 3-2b shows the FESEM of the large pore

diameter of the conical membrane etched at 5 hrs with 15.0 V applied during the etching

process. Figure 3-2c shows the large pore diameter of the conical nanopore membrane








prepared at 5 hrs etching time with 30.0 V applied potential during the etching process.








0.0 V 1.0 pm


15.0 V 2.0 pm



30.0 V 3.0 pm



Figure 3-2.Scanning Electron micrographs of the large diameter of a single conical
nanopore fabricated under the conditions of (a) 0.0 V, (b) 15.0 V, and (c) 30.0
V applied during the etching process.


8.00


6.00

4.00

2.00


0.00 .. -- ------ I-
0 5 10 15 20 25 30


Voltage Applied


Figure 3-3.The change in pore diameter on the side exposed to the etching solution with
applied potential during the etching process.








From the FESEM we are able to change the pore diameter just by changing the applied

potential during the etching process (Figure 3-3).

Nanopore Geometry

To investigate the exact shape of the nanopores throughout the length of the

membrane, the pores were electrolessly plated with Au to prepare metal replicas of the

pores.63,121 Figure 3-4a is a FESEM image of a conical Au nanowire, which was

deposited within the template of a single conical nanopore membrane which was

produced by etching for 5 hrs at 0.0 V applied potential during the etching process. The

image shows that the shape of the nanopore has a small amount of asymmetry throughout

the entire length of the nanopore with the large pore diameter being 1.0 pm and the small

opening measuring 50 nm in diameter. Figure 3-4b shows the FESEM of a conical Au

nanowire taken from the conical nanopore membrane template that was fabricated by









0.0 V 15.0 V 30.0 V


Figure 3-4.Scanning electron micrographs of Au conical nanowires of pore geometry at
(a) 0.0 V, (b) 15.0 V, and (c) 30.0 V applied during the pore etching process.

etching for 5 hrs with 15.0 V applied during the etching process. The Figure indicates

that the asymmetry of the nanopore increases with increasing applied potential. Also, we

were able to produce a highly asymmetric nanopore membrane shown in figure 3-4c, by

etching for 5 hrs at 30.0 V applied potential during the etching process. By keeping the

etching time constant and increasing the applied potential during the etch process we








were therefore able to vary the diameter of the pore exposed to the etching solution. The

half cone opening angle can be calculated as

P= arctan [(db -dt)/2L] eq. (3.1)

where L is the length of the pore, and db and d, stand for the large and small opening

diameters of the pore, respectively. For db>>d, the formula simplifies to:

P=arctan [db/2L] eq. (3.2)

For db=5 ltm, /~-12 degrees, while for db=l um, f/ is only 2.4 degrees.

Not only does the half opening cone angle change with applied potential, but the

effective length of the nanopore also will change. The effective length Leffis the part of

the pore over which the resistance of the pore is focused. Also, on this part of the

nanopore, the voltage drop is the greatest, which results in the strongest electric field.95

For a cylindrical pore L=Leff, because each slice of a cylindrical pore contributes to the

pore's resistance in an equal manor, resulting in a linear voltage drop inside the entire

length of the pore. On the other hand, the asymmetric, conical shape of the pore makes

the distribution of resistance (and electric field) over the length L nonlinear. Resistance of

a conical pore is given by the formula:

4L
R =- eq. (3.3)
mcdbd,

where Kcis conductivity of electrolyte (medium) in which the pore is placed. To

determine the effective length of a conical pore, we analyzed how the resistance is

distributed along the pore axis, from the tip of the nanopore towards the large pore

opening. In order to do that, we calculated resistance of cones Rx of length x e <0,L>,

big diameter dx e <0, db>, and small opening d,. d, can be expressed as the following








function of x:

1 (db d,)x + d,L eq.(3.4)
2 L

and the resistance Rx is then equal

R 4L [ 1 1 eq. (3.5)
xK(db -d,) dL (db -d,)x+Ld,

dx and Rx were calculated for various values of x. Dividing Rx by the total resistance of

the cone of length L, and opening diameters db and d, (eq.(3.3)) allows one to follow how

the resistance of a conical pore changes along its length.

Figure 3-5 shows Rx/R for three conical pores with the same d,=20 nm and db

equal 5 pm, 3 tim and 1 jim, respectively. One can see from the figure that in the case of




1-

0.75 //

RIR 0.5/


0.25 -


0 500 1000 1500 2000
X (nm)


Figure 3-5.Rx/R for three conical pores with the same dt=20 nm and db, equal 5 pm
(upper), 3 jpm (middle) and 1 im (lower), respectively

the cone with db=5 gtm, 50% of resistance of the pore is focused over the first 50 nm, and

80 % of the resistance is already reached at -200 nm. For db=l gm, on the other hand,

50% of the resistance is achieved over 235 nm length, and 80 % on 1.83 pm. If one is








able to reduce the diameter of the small opening to 5 nm, 80% of the pore with db=5 ptm

is achieved already over 50 runm length.

The mechanism of the effect of voltage, which was applied during etching, on

increasing the pore asymmetry is not fully understood yet. We presume that the strong

asymmetry of the pore is achieved due to a concentration gradient of OH ions, created

inside the conical nanopore. Also, close to the cone tip the electric field is at its

strongest,122 therefore OH" ions will be withdrawn from this part of the pore and

accumulated close to the large opening of the pore (side exposed to the etchant solution).

Conclusion

Strongly asymmetric nanopores were prepared by application of anisotropic

development of tracked polymer membranes. The electro-chemical stopping procedure

developed by Apel et al. was substantially improved by introducing of additional

parameter influencing the pore shape the voltage. We have shown that the introduction

of transmembrane potential difference can be used to fabricate a variety of different

asymmetric shapes within tracked polymer films. By changing the asymmetry of the

nanopore we are able to reduce the effective length of the nanopore membrane to below

100 nm. By reducing the effective length and producing a very small detection zone

within the nanopore this allows the synthetic nanopore systems to be comparable to that

of oa-hemolysin which consist of a very small constriction within the barrel of the protein.

This constriction is one of the key elements to stochastic chemical detection of individual

small molecules with single nanopore systems. It is important to note that the effective

length of the pores was significantly reduced although the membrane itself remains thick

and robust. By controlling the pore geometry, yet maintaining the stability of the






55


nanopore, it offers researchers the opportunity to endeavor future applications in single

nanopore systems which are not currently applicable with biological channels.














CHAPTER 4
DNA-NANOTUBE ARTIFICIAL VOLTAGE-GATED ION CHANNELS

Introduction

Mother Nature has created tiny, nanometer sized transport channels that are highly

selective for given ions and molecules. The channels mediate the transport across

otherwise impermeable cell membrane.12' 123 The channels, which control the transport of

ions open and close as a response to applied voltage, presence of a molecule a ligand,

which binds to the channel, or to a mechanical stimuli.123 The first group of channels

creates the so called family of voltage gated channels, which in recent years has attracted

a big interest. These voltage-gated ion channels are the principal nanodevices that

mediate communication of a cell with other cells via ion transport, and enable concerted

functioning of a living organism. Also, these nanodevices which are ion current rectifiers

are used by Mother Nature to detect and transport biomolecules.73 124, 125

These voltage-gated ion channels control electrical activity in nerve, muscle and

many other cells types.12'123 In recent accounts the crystal structure of a bacterial

voltage-gated ion channel has been revealed, solving the long-time mystery of its voltage

sensor characteristics.124-126 Mackinnon and colleagues124' 125 have shown that the voltage

sensors within a potassium voltage-gated ion channel are made up of charged "paddles"

that move through the membranes interior. These charged paddles are responsible for the

mechanism of gating (the process by which the pore opens and closes) within these

potassium channels. These findings have motivated us to investigate the possibility of








designing a synthetic voltage-gated pore, which would function according to similar

principles as biological voltage-gated channels. We decided to perform the studies on the

single channel level, and to introduce to the pore a gate of known structure. We then

studied the transport and electrochemical phenomena in synthetic analogues of voltage-

gated ion channels based on single nanopore membranes.

If successful we would obtain a nanodevice, which possesses the transport

properties of biochannels but it is characterized by a higher robustness and possibility of

incorporation into existing fluidic synthetic systems. In order to make the device even

more robust we decided to scale it up in its opening diameter to several tens of nm. One

reason for using synthetic nanopore membranes is that one of the main drawbacks to

using these biological channels for chemical and biology sensor devices is that they are

too small and delicate for everyday routine analysis. The gate, which was incorporated

into the nanotube, should be of electro-mechanical character. Electro-responsiveness is

necessary for making the pore voltage-gated; mechano-in that the size of pore changes.

As voltage-gated biochannels have been found to be asymmetric in shape and chemistry
124,127 for our voltage-gating pore we have also chosen an asymmetric shape. The easiest

realization of asymmetry as far as shape is to think of a cone. It is important to note that

many other biochannels are asymmetric. Let us mention here mechanosensitive

channels,128 nicotinic acetylcholine receptor128 and glycerol aquaporin.128

There is also a practical advantage of using conical pores. A conical pore offers a

much higher flux compared to a cylindrical pore of the same limiting diameter. In a

conical pore the resistance of the pore is focused exclusively at the tip and therefore the

effective length of the channel is decreased122 approaching the length of biochannels








(app. 10 nm). The use of single conical nanopores in designing ion current rectifiers have

recently been investigated using single asymmetric synthetic nanopore membranes.35' 128-
131 However, these authors used nanopore membranes with much smaller pore diameters

(several nm), and rather small opening angles. They were also limited solely by the

surface chemistry of the polymeric membrane after the pore formation.

We report on a voltage responsive synthetic single gold nanotube in the form of a

conical shaped nanotube within an impermeable polymeric membrane. Our conical tubes

are much more asymmetric with the opening angle reaching 25 degrees. This conical

gold nanotube system offers a more rigid and well define surface chemistry by which one

can take advantage of rich gold-thiol chemistry.37' This approach also allows one to

reproducibly fine-tune the surface functionality of the nanotube. We show that by

modifying the gold nanotube membranes with thiolated single stranded DNA (HS-

ssDNA), which plays a role of a voltage-sensor, a non-linear rectifying current voltage

curve is obtained. These HS-ssDNA modified nanotube membranes are ion current

rectifiers, which exhibit a high degree of selectivity for complementary ssDNA versus

non-complementary ssDNA.

Experimental

Materials

The tracked but not etched polycarbonate membranes were obtained by special

order from Osmonics (Bryan, TX). These membranes were 12 pm thick and had a track

density (as determined by field-emission scanning electron microscopy after etching the

tracks into pores) of 50 tracks cm-2. Thiolated single stranded DNA, abbreviated HS-

ssDNA was obtained from Alpha DNA (Montreal, Quebec), a 10 mm solution, dissolved

in phosphate buffer solution ([sodium phosphate] = 50mM, [NaCI] = 100 mM, and








[NaN3] = -0.09%) at pH=7.2. All other chemicals were of reagent grade or better and

were used as received. Purified water was obtained by passing house-deionized water

through a Barnstead E-pure model D4641 water purification system.

Pore Etching

To obtain conical pores the tracked but not etch polycarbonate films were place

between two chambers of a conductivity cell and etched at room temperature (230) from

one side with 9 M NaOH solution as described elsewhere.25-27,35 The other chamber of

the cell was filled with a stopping medium: 1 M KCl + 1 M formic acid. To promote a

more conical shape throughout the length of the membrane a transmembrane potential of

+30V was applied to the conductivity cell during etching for a desired period of time.

The two platinum electrode system was configured in way that the anode was placed

within the etching side (NaOH solution) and the cathode was placed within the

neutralizing side. This process essentially hinders the movement of OH- through the pore

therefore promoting a more asymmetric shape throughout the nanopore. It is especially

important at the moment of breakthrough, when the OH- ions are withdrawn from the

pore by electric field.35 This process together with chemical neutralization by acidic

stopping medium assures preparation of very small pores. After the desired etch time

(typically we etched for 3 hours), the membrane was removed from the conductivity cell

and immersed into a 1 M formic acid neutralizing solution. The membrane was left in

this solution for one hour and then immersed for one hour into purified water at 400C.

The membrane was then thoroughly rinsed with purified water and stored in air.

Single Conical Nanopore Membranes

After the conical nanopore formation the polycarbonate membrane was mounted a

standard 25 x 75 x 1 mm glass microscope slide. The membrane was then visually








analyzed with a Zeiss Axioplan 2 microscope. Due to the large asymmetric shape of the

nanopore one can visually image the large diameter side of the nanopore with a

conventional bright-field microscope. Also, due to the low pore density of the

polycarbonate membranes the average distance between each pore was large enough to

isolated one nanopore at a time.132 To mark an area of the membrane surface containing

only a single nanopore the bright-field illumination of the microscope was adjusted such

that only this desired area was seen thorough the microscope. An extra fine-point

Sharpie (Sanford, Bellwood, IL) marking pen was then used to circumscribe the portion

of the membrane visible through the microscope. The circumscribed portion of the

membrane was then isolated by applying a piece of tape (3M Scotch brand NO. 3750)

with a 3 mm diameter hole punched through it. The tape was applied such that the

surrounding pores were under the tape and the selected pore was in the hole.

Field-Emission Scanning Electron Microscopy (FESEM)

FESEM was used to measure the diameter of the nanopores obtained. A Hitachi S-

4000 FESEM with a resolving power of -1.5 nm was used. In addition, FESEM was

used to explore the geometry of the pores obtained from the etching process used here.

The pore shape was investigated by plating Au nanowires within the pores, dissolving the

membrane and imaging the resulting nanowires.

The electroless plating procedure described previously 37, 63, 108 was used to plate

the Au nanowires. To obtain solid Au nanowires,63 as opposed to hollow Au nanotubes,7'

37,38 a plating time of 24 hours was employed. The plating procedure yields both the

nanowires within the pores and Au surface films covering both faces of the membrane.

After plating, the Au surface film on the small pore diameter side (neutralizing side) was

removed by mechanically polishing with a cotton swab wetted with ethanol. The gold








plated membrane was them attached to a double sided adhesive copper tape with the

small pore diameter side facing upright. A plasma etch method121 was then used to

remove the polycarbonate membrane and the expose the Au nanostructure.

Conical Au Nanotube Membranes

We have shown that when short plating times are used, the electroless plating

method yields hollow nanotubes (as opposed to solid nanowires) within the pores of such

track-etched membranes. 7,37,38 This approach was used here to effectively decrease the

inside diameter of the nanopores, and allows one to fine-tune the surface functionality of

the nanotubes using rich gold-thiol chemistry. A membrane sample with a single conical

nanopore with a small diameter of 60 nm and a large pore diameter of 5 ptm was

electroless plated to obtain the corresponding single Au-nanotube membrane. A plating

time of 5, 7 and 8 hours were used to obtain a 40, 27 and 13 nm pore diameter

respectively. The plating process was performed at 4.0 C, and pH 10. A plating time of

5 hours resulted typically in formation of approximately 10 nm thick gold layers. As per

the nanowire case, the plating method yielded the Au nanotube within the pore plus thin

Au surface films covering both faces of the membrane. These surface films do not block

the mouths of the nanotube,7' 3738 and as a result, transmembrane ion currents can be

measured without removing these surface layers.

DNA Modification

The chemisorption of the oligonucleotides onto the surface of the gold nanotube

membrane was accomplished using thiolated-DNA, which can chemisorb to the gold

surface layers. 33 The gold nanotube membranes were incubated in a 10 .pM

oligonucleotide solution for 5 days at room temperature. Once the proper incubation time








was complete the membranes were thoroughly rinsed with phosphate buffer solution

([sodium phosphate] = 50mM, [NaCI] = 100 mM, and [NaN3] = -0.09%) at pH=7.2) for

4 hours, and then were dried in compressed dry nitrogen. The HS-ssDNA which was

used was a 12-mer with a sequence of 5' HS (CH2)6 CGA GTC CAT TCA 3', 15-mer

with 5' HS-(CH2)6 GAC CGA GTC CAT TCA 3', 30-mer with 5' HS (CH2)6

CGCGAGAAGTTACATGACCTGTAG ACGATC3', 45-mer with 5' HS (CH2)6 A45 3',

30-mer hairpin with HS(CH2)6CGCGAGAAGTTACATGACCTGTAG CTC GCG 3',

complementary 30-mer ssDNA with 3' GCG CTC TTC AAT GTA CTG GAC ATC

GAG CGC 5' and non-complementary 32-mer ssDNA with poly (T32).

Polylysine Modification

The Au surfaces were first modified with the amino-terminal thiol 11-amino-1-

undecanethiol (Dojindo Laboratories). This was accomplished by immersing the

membrane for 24 hours in a 1 mM ethanolic solution of the thiol. The membranes were

washed thoroughly with absolute ethanol three times and then washed in buffer (20 mM

sodium phosphate buffer solution, 0.15 M NaCl, pH = 7.5, PBS). The amino-modified

membranes were then incubated in bis(sulfosuccinimidyl) suberate (Pierce

Biotechnology, 5 mM in PBS). Bis(sulfosuccinimidyl) suberate is a water-soluble

bifunctional crosslinker reactive towards primary amines. In the final step, the

membranes were soaked in 10 mM polylysine solution in PBS for 1 hr at room

temperature. The polylysine-modified membranes were washed three times in PBS.

Electrochemical Measurements

The membrane sample was clamped between the two halves of a U-tube cell,'10 and

each half-cell was filled with -5 mL of 100 mM KC1, 10 mM phosphate buffer at pH =

7.0. A Ag/AgCl wire electrode (1.0 mm diameter, Bioanalytical systems) was inserted








into each half-cell solution. A Kiethley instruments 6487 picoammeter/voltage source

with exceLINX software was used to obtain the current-voltage characteristic, by

stepping the voltage by 100 mV for 5s. The resulting ionic current was then plotted as a

function of applied voltage. This protocol setup was used for both the unmodified single

gold nanotube membrane as well as the DNA modified single gold nanotube membrane.

The current time transients were measured using the same U-tube design, but the volume

of electrolyte was decreased to -1 mL on each side of the membrane sample. The axon

instruments Axopatch 200B amplifier (Axon Instruments, Foster City, CA) with data

collection software pClamp 9.0 was used to measure the corresponding current time

transients through the membrane sample and the data analysis was performed by

implementing Clampfit 9.0.

Results and Discussion

Membrane Characterization

Figure 4-la shows the FESEM micrograph of a single nanopore on the side of the

membrane which was exposed to the neutralizing solution during the etching process.

This pore was obtained by etching the membrane from one side for 3 hrs and applying 30

V across the membrane with the anode on the etching solution side and the cathode on

the neutralizing side. Images of this type were used to measure the pore diameter, in this

case 60 nm. In figure 4-lb the FESEM micrograph shows the pore opening on the side of

the membrane that was exposed to the etching solution. From the FESEM image the pore

diameter is 5.0 p in diameter and shows a strong asymmetric shape throughout the

length of the membrane.

To further investigate the exact shape of the nanopore throughout the length of the

membrane a typical Au nanowire was deposited throughout the length of the template








membrane.63 132 Figure 4-1c is a FESEM image of a conical Au nanowire, which was


Figure 4-1.Scanning electron micrographs of a conical nanopore. (a) neutralizing side
before electroless gold plating, (b) etch side before electroless gold plating, (c)
the shape of single conical nanopore through the entire length of the
membrane.

deposited within the template single conical nanopore membrane. The image shows that

the shape of the nanopore is highly asymmetric in that on one side of the membrane the

pore diameter is 5 [im and on the other side a pore diameter of 60 nm. Also, from figure

4-lc the resulting half-opening angle P of the conical nanopore can be calculated by P=

arcsin (vb/vt). By taking the large opening pore diameter to be 5 (Jm and the total length

of the pore / to be 12 ptm the conical nanopore exhibits an opening angle of -12.

DNA Modified Single Nanotube Membrane

The Au conical nanotube membranes were mounted between two half cells of a U-








tube apparatus and the current-voltage characteristics were measured for the resulting

single nanotube membranes. Figure 4-2A shows the current-voltage curve for a single

Au conical nanotube. The i-v curve shows a linear relationship with a slope = 1.73E-8

and a correlation coefficient = .9987. The resistance of the Au nanotube can be

calculated by equation 4.1.

R = 41 p/ t Di Db Equation (4.1)


Assuming that Db= 5.im, 1= 12 itm, electrolyte conductivity p= 80 0 cm and the pore

resistance R= 5.79E7 0, then D1 = 42 nm. The advantage of using electroless gold

deposition is to (1) improve the stability of the ionic current measurements, (2) to have a

more define surface chemistry, which can be used to modify and change the surface

chemistry.37 The Au gold surface layer gives one a defined homogeneous surface layer

compared to the more heterogeneous surface structure, which is present after heavy ion

irradiating and chemical etching in the cause of "bare" polymer. Also, the rigid Au

structure provides a starting point for building a voltage-gating channel, in that the

current-voltage characteristic is linear and hence there is no rectification present.

Also, by using the Au surface one can take advantage of the well established

gold-thiol chemistry in order to change the surface moieties along the walls of the Au

nanotube.37 As a voltage-gate we decided to introduce single-stranded DNA, which were

chemisorbed on the surface via thiol bonds. The HS-ssDNA was chosen because (1) it

posses a known structure (2) the exact charge and size of the molecule can be easily

changed according to the current application. Figure 4-2A also shows the current-voltage

characteristics of a single Au nanotube membrane modified with a 15-mer and 30-mer

HS-ssDNA, which have been chemisorbed to the gold surface layers along the nanotube








walls. The gate elements introduced had therefore length of 6.5 nm, and 12.9 nm

respectively. Note however that ssDNA were immobilized along the circumference of the




1 1 20 -
15 o
Chains out of Pore Mouth 0
Pore is "Open" 10 ]




i00 -1000 -50 ) 500 1000 1500




-20 -

-25 -
Chains in pore Mouth
Pore is "Closed"

Transmembrane Potential (mV)

Figure 4-2A.The current-voltage characteristics of a single conical gold nanotube. (*)
unmodified ( ) modified with 15-mer HS-ssDNA and (A) modified with 30-
mer HS-ssDNA

pore opening, therefore the actual gate length is twice the length of the DNA chain

introduced. This i-v curve shows that indeed by adding a highly charged, flexible

polymer chain the current-voltage characteristic becomes non-linear and thus rectification

is present. It is interesting to notice that for negative voltages, for which the gate opens

the pore, ion current values approach these for a gold tube, suggesting that the tube

becomes opened to its original value (insets of mechanisms in Figure 4-2A). Calculating

the pore diameter for positive voltages, assuming a constant diameter of the big opening,








we found out that for 1 V the tube diameter was reduced by ~ 20 nm and -~ 30 nm for 15-

mer DNA and 30-mer DNA, respectively, which stays in a reasonable agreement with the

total length of the gate introduced.

Since the length of the HS-ssDNA can easily be changed the next step was to

investigate the effect of rectification with the number of bases present within the HS-

ssDNA. Figure 4-2B shows a plot of absolute value of transmembrane potential (mV)

versus extent of rectification. Extent of rectification is defined as the absolute value of

the current at the negative potentials divided by the current at the positive potentials.

Figure 4-2B shows that by increasing the number of bases present within the HS-ssDNA

the extent of rectification also increases. The effect of a flexible molecule versus a more

rigid molecule with the same amount of charge was examined to look at the contribution

of the movement of the polymer chains within the presence of an applied potential.

Figure 4-2C shows the extent of rectification of the single Au nanotube modified with a

30-mer HS-ssDNA, which is highly "flexible" and a single Au nanotube modified with a

30-mer hairpin DNA, which is a more "rigid" molecule. The more rigid hairpin DNA

shows less rectification compared to the flexible HS-ssDNA. Thus, the mechanism by

which the non-linear i-v curve in the HS-ssDNA modified membranes can be attributed

to the movement of the highly charged polymer chains in the presence of an applied

potential. These HS-ssDNA membranes show a voltage-gating response and the extent

of that response can be tailored by increasing the length of the HS-ssDNA chains used.

To further look at the change in rectification the diameter of the single Au nanotube was

altered so that the extent of rectification could be maximized. Figure 4-3 shows the

extent of rectification with the change in nanotube diameter. The Au membranes were





68

modified with a 30-mer HS-ssDNA in all cases. The data shows that as the nanotube


C $ 2[ U u -

0 ,-..
0 200 400 600 800 1000 1200

Absolute Value of Transmembrane
Potential (mV)

Figure 4-2B.Tailoring the rectification properties of the single conical gold nanotube
membrane by ssDNA modification. The extent of rectification versus applied
potential for single conical gold nanotube membranes modified with (A) 12
mer, ( ) 15 mer, (*) 30 mer, (e) 45 mer ssDNA and (-) unmodified. *Degree
of rectification = Absolute value of I at -E divided by I at same +E



S5

4


0 *
p gl flD D CD DD


u0 ; I F"-- ----
0 200 400 600 800 1000 1200

Absolute Value of Transmembrane
Potential (mV)

Figure 4-2C.Extent of rectification of( ) 30-mer hairpin DNA, (e) 30-mer HS-ssDNA
and (-) unmodified single gold nanotube membrane. The diameter of the tube








openings are -5 pm and ~ 39 nm, respectively before DNA modification.
Degree of rectification = Absolute value of I at -E divided by I at same +E.

14

0 12
e *

o..

0 6 -



2 0 CA ] 0 0
o ? + + + + +

0 200 400 600 800 1000 1200

Absolute Value of Transmembrane
Potential (mV)

Figure 4-3.The effect of rectification by changing the pore diameter (*) 27 nm, (A) 39
nm, ( ) 59 nm, and (+) 98 nm single gold nanotube membrane. The diameter
of the large opening was ~5 tm.

become larger compared to the length of the HS-ssDNA the effect of chain movement is

unnoticeable. This remains in agreement with our model a relative change of the pore

opening caused by the DNA chains in case of 100 nm pore is -20%. On the other hand, if

the nanotube diameter is decreased to a value, which is comparable to the length of two

HS-ssDNA completely extend (-25.8 nm) the extent of rectification increases

dramatically, basically shutting off one branch of I-V curve. This fact is seen in the case

of the Au nanotube with an inside diameter of 27 nm.

As discussed previously, the electroless plating method yields the Au nanotubes

lining the pores in the membrane and Au surface films covering both faces of the

membrane.108 The Au surface films are so thin that they do not block the mouths of the









nanotubes at the membrane faces.08 However, we are specifically interested in knowing

how much thiolated ssDNA is present along the nanotube walls within the membrane.

The question then becomes how well of a monolayer is present on the walls of the

nanotube? From the dimensions of the single conical nanotube the total inner surface

area of the Au nanotube within the membrane can be calculated. For the membranes

used here this comes to value of 9.63x10-7 cm2 of Au surface area. This value assumes a

surface roughness of unity, and the actual surface roughness inside the Au nanotubes

might be higher. However, evaluating the roughness within these nanoscopic pores

would be experimentally quite challenging.

The number of ssDNA molecule which can be packed with a single conical gold

nanotube can be calculated based on the surface area of the cone and the radius of

gyration of the ssDNA molecule. The immobilized linear-ssDNA is a 30-mer, and the

radius of gyration for this 30-mer can be calculated via the standard methods."12 A radius

of gyration of-2.6 nm is obtained from this calculation. Hence, to a first approximation,

the footprint of an immobilized linear-ssDNA corresponds to a circle that is 5.2 nm in

diameter. If we assume that a complete monolayer corresponds to hexagonal packing of

these 5.2-nm diameter circles across all of the available Au surface area within the

nanotube. If a 30-mer ssDNA molecule is used to modify the gold nanotube and we

assume that they will have a hexagonal packing distribution we obtain a value of

3.63x 106 ssDNA molecules per single conical nanotube with the dimension described

previously. The number of molecules/cm2 on a planar Au surface has been shown to

-5xl013 (molecule/cm2) at room temperature (230C).144,145 This value was determined by

the correlation of FTIR and XPS analysis with 30-mer ssDNA modified planar Au








surface. In the case of a single conical Au nanotube, a value of 3.7x1012 (molecules/cm2)

was calculated.

If you compare the number of molecules needed to cover the surface of the

nanotube with the total number of ssDNA molecules present within solution (1.2x 1016)

one can see that there is in excess of ssDNA molecules available in order to completely

cover the single nanotube with a hexagonal packing orientation. In the case of a single

gold nanotube it becomes experimentally difficult to measure the number of ssDNA

moles observed, therefore it is very difficult to obtain an accurate value for the packing

efficiency within a single conical nanotube. It was shown by martin and coworkers that a

packing efficiency of 61% can be achieved within a cylindrical gold nanotubes modified

with a 30-mer thiolated ssDNA.33

Polylysine Modified Au Nanotubes.

If the model presented here is correct, analogous Au nanotubes containing

attached flexible polycationic chains should voltage gate with opposite polarity as the

DNA-containing nanotubes. To test this we modified the Au surfaces in an Au nanotube

(mouth diameter = 40 nm, large diameter opening = 5 p~m) with polycationic polylysine

chains (average degree of polymerization 18, Sigma). In analogy to DNA, the

polylysine chain contains one charged group cationicc protonated primary amine) per

monomer unit at pH 7.2. In addition to providing the charge, a primary amine on the

chain was used to attach the polylysine to the Au nanotube.

I-V curves for the polylysine-modified nanotube membranes were obtained as per

the DNA artificial ion channels. As shown in Figure 4-4, these polycationic artificial ion

channels voltage gate with polarity opposite that of the DNA-based ion channels. That is,








these channels show their on state at positive transmembrane potentials and their off state

at negative transmembrane potentials. In complete analogy to the shorter DNA chain-

length-based channels, the channel based on this -18-monomer unit chain shows a

modest rmax of 1.7.

20

15

10
5


-1200 -900 -6W5 300 600 900 1200

-10

-15
-20


Transmembrane Potential (mV)

Figure 4-4.1-V curve for a polylysine modified Au nanotube


Determination of Nanotube Permselectivity.

It was important to explore cation permselectivity in these DNA-functionalized

nanotube membranes. This is because if the DNA-functionalized nanotubes are cation

permselective, then the simple electrostatic model used to interpret rectification in our

prior work68 might be applicable to the DNA-functionalized nanotubes. A priori it

seemed unlikely that these nanotubes would be permselective because in order to be

permselective the mouth radius must be comparable to the thickness of the electrical

double layer associated with the fixed surface charge,37 in this case provided by the









chemisorbed DNA. The mouth radius of 20 nm used for the majority of our studies is

simply too large given the electrolyte concentration used, 0.1 M. Nevertheless, we used

the method of Goldman-Hodgkin-Katz (GHK)12 to explore the issue of cation

permselectivity in the DNA-functionalized nanotube membranes. We used a 30-mer

DNA-modified Au nanotube with mouth diameter = 40 nm and large-diameter opening =

5 gm; 1 M KCI (buffered at pH = 8) was placed on one side of the membrane and 0.1 M

KCI (buffered to pH 8) was placed on the other side. And again, as per the previous

experimental setup, Ag/AgCI reference electrodes were used to apply the transmembrane

potential videe infra) and measure the resulting transmembrane current. The only

difference between this experiment and the experiments described previously is that there

is a factor of 10 difference in salt concentration across the membrane here, whereas in the

previous experiment the same salt concentration was placed on both sides of the
+
membrane (0.1 M). If the membrane is perfectly cation (K ) permselective, any current

flowing through the nanotube must be carried by migrating potassium ions. This current

is called here I and according to GHK, I is related to the potential difference applied

across the membrane, E, via'2

[K*L [KIl exp(-nFE/RT)
IK = PK r(EP/RT) Eq. 4-2
1 exp(-nFE/RT)


where n is the charge on the potassium ion (1), PK is the permeability coefficient for the

+
potassium ion in the membrane, and the subscripts hi and lo refer to the 1.0 M K on one
+
side and the 0.1 M K on the other side of the membrane, respectively. Figure 4-5 shows
-5
the current voltage curve calculated from Eq 4-2 assuming an arbitrary value of PK = 10









Two key points can be seen from Figure 4.53. First, because the membrane transports

+ +
only K and because there is a K concentration gradient across the membrane, a finite
+
positive (transport of K from hi to lo) current is seen when the applied transmembrane

potential is zero mV. Conceptually, this current arises because while the applied potential

is zero, the membrane has an equilibrium potential (E equil) of +59 mV, given by the


Nemst equation (Eq 4-3), which, again, assumes perfect cation permselectivity.
+ +
Eequi = (RT/nF)ln [K ]hi / [K]lo Eq. 4-3


So conceptually, the Nernst potential for the perfectly cation-permselective
+
membrane drives K transport when the applied E is zero, and this is why there is a finite

current at E = 0. This leads to the second point from Figure 4-5. In order to obtain a

transmembrane current of zero, a reversal potential (Er) equal and opposite to the Nemst


potential must be applied (Figure 4-5). An equation analogous to Eq 4-2 can also be


written assuming the membrane is perfectly anion (Cl) permselective, and Figure 4-6


Figure 4-5. Current-voltage curve calculated from Eq. 4-2.









shows the calculated current voltage curve for this Cl selective membrane, again
-5
assuming an arbitrary value of P = 10 Again we see a finite (now negative) current

at E = 0, and since the Nemst potential for this ideally anion-permselective membrane is -

59 mV, the reversal potential is now +59 mV.

A key tenant of GHK is that if the membrane transports more than one ion, the total

current (Itot ) at any E is simply the sum of the individual currents calculated from the Eq

4-2 equations written for each of the transporting ions.12 So if the membrane is non-
+
permselective, and we assume that the dominate charge carriers are K and Cl we have

I =I +I
tot K Cl Eq. 4-4


Figure 4-7 shows this current-voltage curve for the non-permselective membrane (again,

we are assuming P = PcI)


Figure 4-6. Current-voltage curve calculated for an ideally Cl permselective membrane.



























Figure 4-7. Current-voltage curve calculated for a non-permselective membrane.


The key point to note is that now the current at E = 0 is zero. This is because both
+
K and Cl can move down their concentration gradients across the membrane, and as a

result transport does not cause charge separation and its resultant Nernst potential.

Hence, a key criterion for assessing permselectivity via GHK is to determine the

transmembrane current for an applied transmembrane potential difference of E = 0. If the

current is zero (Figure 4-7) the membrane is unequivocally non-permselective. This was

done for the 40 nm mouth diameter nanotube with the chemisorbed 30-mer under the

conditions noted above, and the measured current was zero. This analysis shows, as

expected, that these DNA-functionalized nanotubes are not permselective. Finally, it is
+
important to point out that if the permeability coefficients for K and Cl in the membrane
+
are different (due to a difference in either the K vs. Cl diffusion or partition

coefficients12, a small finite current will be observed at E = 0, even if the membrane is

non-permselective. However, the magnitude of this current, if present, was too small to

detect with our measurement system.








As well as being voltage-gating synthetic channels, these HS-ssDNA modified gold

nanotube membranes exhibit selectivity for recognizing complementary ssDNA over

non-complementary ssDNA. Figure 4-7 shows the current time transients for a HS-

ssDNA modified gold nanotube membrane. Figure 4-7a shows the single channel

recording of a ssDNA modified gold nanotube membrane at 400 mV in the absence of

ssDNA molecules. From the current signal one can see that there is steady current signal

attributed to the ionic current through the membrane. Figure 4-7b shows the current time

trace at 200 mV in the presence of 5 nM poly (T32) ssDNA (non-Complementary). A low

analyte interaction is observed which can be seen by the short lifetime deduced from the

current blockade events. In the presence of complementary ssDNA a strong analyte

binding interaction is observed. Figure 4-7c shows at 500 mV applied there is a strong

interaction of the complementary ssDNA with the ssDNA modified nanotube.

These stronger interactions can be examined by the current blockade events. These

current blockade events show a longer lifetime as well as a larger current blockage. At

500 mV the lifetime of the non-complementary translocation shown in figure 4-8a is 550

ms compared to the complementary translocations of 800 ms shown in figure 4-8c. Also,

thedegree of interaction can be seen from not only comparing the lifetime but also by the

magnitude of the current blockage. The current blockage event for the non-

complementary strand (figure 4-8a) has a Ai= 350 pA which is must smaller than the

Ai=2200 pA which was shown by the complementary ssDNA translocations (figure 4-

8b).






78





4200
0 20000 40000 60000

2100 '^ -. i dci lldB t llli ii l n


(pA) 2000
1900


W17T I I-I


0 20000 40000 60000
7000



4000 8000 12000 16000
Time (ms)


Figure 4-8.Current time traces of (a) no ssDNA present (b) 5 nM ssDNA non-
complementary to the ssDNA modified nanotube membrane and (c) 5 nM
ssDNA that is complementary to the ssDNA modified nanotube membrane.

STA 550 ms
interval


o Ai = 350 pA

1000 (ms)


-I j mS
interval

Ct Ni 2200
o pA


1000 (ms)

Figure 4-9.A single blockade event of (a) 5 nM ssDNA non-complementary to the
ssDNA modified nanotube membrane and (b) 5 nM ssDNA that is
complementary to the ssDNA modified nanotube membrane.









Conclusion

Strongly asymmetric pores were prepared by application of anisotropic

development of tracked polymer membranes. The electro-chemical stopping procedure

developed before was substantially improved by introducing of additional parameter

influencing the pore shape the voltage. We have shown that the introduction of

transmembrane potential difference can be used to fabricate a variety of different

asymmetric shapes within tracked polymer films. Also, these conical pores can be

electroless gold plated to form a corresponding gold nanotube, and that this provides a

route for systematically and reproducible changing the pore diameter to molecular

dimensions. This approach allows one to fine-tune the surface functionality of the

nanotubes using rich gold-thiol chemistry.

We have described here the first example of artificial ion channels where the extent

of rectification can be controlled at will by either a simple chemical mechanism

(controlling the DNA chain length) or a simple physical mechanism (controlling the

nanotube mouth diameter). Single Au nanotube membranes were modified with HS-

ssDNA composed with different number of bases ranging from 12-mer to 45-mer. These

HS-ssDNA modified membranes show a voltage gating response in the presence of an

electric field. Also, the degree of rectification is shown to increase with increasing

number of bases. To show the importance of the flexibility of the modified molecule to

the extent of rectification the membranes were modified with a 30-mer hairpin, which is a

more rigid molecule. The hairpin modified membrane shows a dramatic decrease in the

extent of rectification compare to the more flexible 30-mer HS-ssDNA. This in turn

constitutes that the ssDNA chains are moving into the pore producing a "closed" state at

certain potential range, and the chain are moving out of the pore producing an "open" at









the reverse polarity. Also, by decreasing the nanotube diameter so that the HS-ssDNA

chains are similar in size the extent of rectification can be maximized. Also, it has been

shown that the direction of ion current rectification can be switched within these Au

nanotubes by polycationic modification of the Au nanotubes.

In nature, ion channels are sensors sensing either specific molecules or the

magnitude of the transmembrane potential. Finally, we have shown that these synthetic

voltage-gating channels posses a high degree of selectivity for recognizing

complementary ssDNA versus non-complementary ssDNA. This selectivity can be seen

by examining the current time traces exhibited by the translocation of the DNA molecule.













CHAPTER 5
ABIOTIC NANOPORES FOR SINGLE MOLECULE DETECTION

Introduction-

One of the current goals in nanotechnology is the analysis of single molecules;

not only because of increased sensitivity but also because the analysis of bulk sampling

leads to an averaging of the information.89 Recent investigation of single molecules in

nanotechnology has been illustrated by the use of nanopores or protein ion channels. 8'83'

87,92,100, 102, 104, 117,134,135 The ion channel a-hemolysin (a-HL) a heptameric protein that

spontaneously assembles within a lipid bilayer membrane has proven to be a useful

system for studying single molecules. Bayley and coworkers have shown that Ca-HL can

be used to study many different individual analytes such as divalent metal ions,83 organic

analytes,104 proteins,87,136 polymers, and peptides.94 Also, there has been a great deal of

effort aimed at studying the translocation of DNA through the a-HL channel.177' 89-91,102,

103 The translocation kinetics of DNA through these biological nanopores has been

examined with great detail, but there are many limitations of this biological system for

future applications of DNA analysis. Although a-HL self-assembles with remarkable

fidelity and reproducibility, the physical, chemical, and electrical properties of this

protein nanopore limit the repertoire of experimental possibilities. The biggest limitation

of this protein channel system is the stability of the biological support system (lipid

bilayer membrane). This limitation has sparked an increased interest for researchers to

develop a synthetic single nanopore system which has similar sensing capabilities but

overcomes the stability limitations encountered by biological systems.









There have been several single nanopore systems developed from inorganic solid-

state materials. One such system employs the use of a feedback-controlled sputtering

system, based on irradiating the materials with (argon) ion beams of several keV

energy."s' "00 This technique allowed the preparation of a single nanopore in a Si3N4

support with diameters down to 1.8 nm. Another method used to produce pores in silicon

oxide with an aperture diameter of several nanometers was developed in the group of

Dees Dekker. The pores are manufactured by electron beam lithography and anisotropic

etching in combination with a high-energy beam that is used in transmission electron

microscopy.101 Finally, the track-etching process has been used to produce single

nanopore membranes in polyamide films (Kapton 50 HN, DuPont).23 Each one of these

systems has been used in the detection or discrimination of individual double stranded

DNA molecules.

Here we describe the study of the transport kinetics of individual single stranded

DNA through abiotic single asymmetric nanopore membranes created in polycarbonate

films. The synthetic membranes were produced by the use of the track-etch method.

This method allows one to systematically control not only the pore diameter but the

geometry of the nanopore.120 Here we describe a synthetic single nanopore system which

can be use not only in the analysis of individual DNA molecules, but can discriminate

between single stranded and plasmid DNA within a solution mixture.

Experimental-

Materials

The tracked but not etched polycarbonate membranes were obtained by special

order from Osmonics (Bryan, TX). These membranes were 12 tim thick and had a track

density (as determined by field-emission scanning electron microscopy after etching the









tracks into pores) of 50 tracks cm-2. Single stranded DNA, bacteriophage M13mpl8

Escherichia coli JM101 and Col El plasmid DNA from Escherichia coli strain C600 were

purchased from Sigma-Aldrich. All other chemicals were of reagent grade or better and

were used as received. Purified water was obtained by passing house-deionized water

through a Bamstead E-pure model D4641 water purification system.

Conical Pore Etching

To obtain conical pores the tracked but not etch polycarbonate films were placed

between two chambers of a conductivity cell and etched at room temperature (230) from

one side with 9 M NaOH solution as described elsewhere.24-26,35, 68 The other chamber of

the cell was filled with a stopping medium: 1 M KCl + 1 M formic acid. To achieve a

large opening angle of the conical nanopore, therefore to reduce the effective length of

the pore, a transmembrane potential of 30V was applied across the film during etching

for a desired period of time. The two platinum electrode system is configured in way that

the anode was placed within the etching side (NaOH solution) and the cathode was

placed within the neutralizing side. This process essentially hinders the movement of

OH' through the pore therefore promoting a more asymmetric shape throughout the

nanopore. It is especially important at the moment of breakthrough, when the OH- ions

are withdrawn from the pore by electric field.35 This process together with chemical

neutralization by acidic stopping medium assures for the preparation of asymmetric

nanopores with a very small tip diameter. After the desired etch time the membrane was

removed from the conductivity cell and immersed into a 1 M formic acid neutralizing

solution. The membrane was left in this solution for one hour and then immersed for one

hour into purified water at 400C. The membrane was then thoroughly rinsed with

purified water and stored in air.









Single Nanopore Membranes

After the conical nanopore formation the polycarbonate membrane was mounted

on a standard 25 x 75 x 1 mm glass microscope slide. The membrane was then visually

analyzed with a Zeiss Axioplan 2 microscope. Due to the large asymmetric shape of the

nanopore one can visually image the large diameter side of the nanopore with a

conventional bright-field microscope. Also, due to the low pore density of the

polycarbonate membranes the average distance between each pore was large enough to

isolate one nanopore at a time.132 To mark an area of the membrane surface containing

only a single nanopore the bright-field illumination of the microscope was adjusted such

that only this desired area was seen thorough the microscope. An extra fine-point

Sharpie (Sanford, Bellwood, IL) marking pen was then used to circumscribe the portion

of the membrane visible through the microscope. The circumscribed portion of the

membrane was then isolated by applying a piece of tape (3M Scotch brand NO. 3750)

with a 3 mm diameter hole punched through it. The tape was applied such that the

surrounding pores were under the tape and the selected single nanopore was within the

selected area exposed.

FESEM was used to measure the diameter of the nanopores obtained. A Joel

JSM-6335F FESEM with a resolving power of ~1.5 nm was used. In addition, FESEM

was used to explore the geometry of the pores obtained from the etching process used

here. The pore shape was investigated by plating Au nanowires within the pores,

dissolving the membrane and imaging the resulting nanowires. The electroless plating

procedure described previously37' 108 was used to plate the Au nanowires. To obtain solid

Au nanowires63 as opposed to hollow Au nanotubes37,108 a plating time of 24 hours was

employed. The plating procedure yields both the nanowires within the pores and Au









surface films covering both faces of the membrane. After plating, the Au surface film on

the small pore diameter side (neutralizing side) was removed by mechanically polishing

with a cotton swab wetted with ethanol. The gold plated membrane was them attached to

a double sided adhesive copper tape with the small pore diameter side facing upright. A

plasma etch method63 was then used to remove the polycarbonate membrane and the

expose the Au nanostructure.

Electrochemical Measurements and Data Acquisition

The membrane sample was clamped between the two halves of a U-tube cell,"10

and each half-cell was filled with -2 mL of 1 M KC1, 10 mM Tris-HCl, and 1 mM EDTA

at pH = 8.0. An Ag/AgCl reference electrode was inserted into each half-cell solution,

and a potential was applied to across the membrane. The resulting transmembrane

current, carried by ion migration through the nanopore, was monitored at a 10 ps

sampling rate using an Axopatch 200B amplifier (Axon Instruments, Foster City, CA)

with data collection software pClamp 9.0. Data analysis was implemented using Origin

7.0 and Clampfit 9.0.

Results and Discussion

Membrane Characterization

Figure 5-la shows the FESEM micrograph of a single nanopore on the side of the

membrane which was exposed to the neutralizing solution during the etching process.

This pore was obtained by etching the membrane from one side for 1 hr and applying 30

V across the membrane with the anode on the etching solution side and the cathode on

the neutralizing side. Images of this type were used to measure the pore diameter in this

case 40 nm. In figure 5-lb the FESEM micrograph shows the pore opening on the side of

the membrane that was exposed to the etching solution. From the FESEM image the pore









diameter is 1.5 nim in diameter and shows a strong asymmetric shape throughout the

length of the membrane.


Figure 5-1.FESEM image of the single nanopore membrane. (a) Surface image of the
nanopore that was exposed to the neutralizing solution. (b) Surface image of
the side of the membrane exposed to the etchant solution. (c) Au nanowire
representing the shape of the nanopore throughout the length of the
membrane.

Also, the small tip diameter can be estimated based on the resistance of the single

nanopore. For a nanopore with a perfectly conical shape, R is related to ds, di, the

conductivity of the electrolyte in the nanotube, K, and the length of the nanotube

(membrane thickness, 1) via35

R = 41 / 7t Kds di (Eq 5-1)
We designate the large diameter opening of the nanopore as di and the small diameter

opening (mouth diameter) as ds. The value di for all of the nanopores investigated here









was 1.5 [pm, as determined by scanning electron microscopy. The values of ds were

determined from the linear current-voltage curves and eq. (5-1). For measurements of ds,

1.0 M KCI was used as the electrolyte in both of the half-cells. The inverse of the slope

of the linear current-voltage curve is the ionic resistance of the nanopore, R.132 The

conductivity of the electrolyte was measured as described previously.132 With this value

and the membrane thickness, 1 = 12 ptm, Eq 5-1 can be solved to provide the diameter of

the mouth of the nanotube, ds.

The accuracy of this analysis was checked in two ways. First, for a nanopore

where ds is -40 nm or larger, scanning electron microscopy (SEM) can be used to obtain

an independent measurement of ds. This allows us to compare ds obtained via Eq 5-1

with the value determined by SEM. For nanotubes where the SEM provided ds = 40 nm,

the analysis based on Eq 5-1 provided ds = 44 nm. Eq 5-1 has also been calibrated for

smaller mouth-diameter (5:5 nm) nanopores via size-exclusion-based transport

experiments using poly(ethylene glycol) (PEG) chains of know radius of gyration25'137-139

The general strategy was to monitor the blockage of the ion current through the nanopore

caused by the translocating PEG as a function of PEG radius of gyration. When the PEG

chain was too large to enter the mouth of the nanopore, current blockage was not

observed. Hence, the radius of gyration of the PEG can be used as a yardstick to obtain

an approximate value of ds. Good agreement was obtained between ds determined in this

way and ds determined via Eq 5-1.25, 137-139

To further investigate the exact shape of the nanopore throughout the length of the

membrane a typical Au nanowire was deposited throughout the length of the template

membrane.63,120,132 Figure 5-1c is a FESEM image of a conical Au nanowire, which was









deposited within the template single conical nanopore membrane. The image shows that

the shape of the nanopore is highly asymmetric in that on one side of the membrane the

pore diameter is 1.5 um and on the other side a pore diameter of 40 nm. Also, from


T


800 f .
pA


- .T ~


o1000 ms
-I- IOOO ms *I ** '

Atd = 15.3 ms
(c)

Alb = 575



Figure 5-2.Current-time analysis of single nanopore membrane. (a) Ionic current
measurement of at 900 mV in the absence of ssDNA. (b) Blockade events of
10 nm ssDNA at an applied potential of 900 mV. (c) Single blockade event
due to the translocation of a single ssDNA molecule.

figure 5-1c the resulting half-opening angle P of the conical nanopore can be calculated

by P= arcsin (vbvt). By taking the large opening pore diameter to be 1.5 Jim and the total

length of the pore I to be 12 ipm the conical nanopore exhibits an opening angle of -3.50.

Single Stranded DNA Translocation Kinetics

In the absence of DNA molecules, applying a potential of 900 mV to the large

side of the nanopore resulted in single channel current values that were free of transient

blockade events (figure 5-2a). With the addition of the ssDNA to the small pore side

numerous short lived blockade events occurred. Figure 5-2b shows a current-time trace


0-i 4. LruM air t i A,,f ...... .,r... -1 .... ifmi....r -