Transcriptional analysis of late ripening stages of grapevine berry

MISSING IMAGE

Material Information

Title:
Transcriptional analysis of late ripening stages of grapevine berry
Series Title:
BMC Plant Biology
Physical Description:
Mixed Material
Language:
English
Creator:
Guillaumie, Sabine
Fouquet, Romain
Kappel, Christian
Camps, Céline
Terrier, Nancy
Moncomble, Dominique
Dunlevy, Jake D.
Davies, Christopher
Boss, Paul K.
Delrot, Serge
Publisher:
BioMed Central
Publication Date:

Notes

Abstract:
Background: The composition of grapevine berry at harvest is a major determinant of wine quality. Optimal oenological maturity of berries is characterized by a high sugar/acidity ratio, high anthocyanin content in the skin, and low astringency. However, harvest time is still mostly determined empirically, based on crude biochemical composition and berry tasting. In this context, it is interesting to identify genes that are expressed/repressed specifically at the late stages of ripening and which may be used as indicators of maturity. Results: Whole bunches and berries sorted by density were collected in vineyard on Chardonnay (white cultivar) grapevines for two consecutive years at three stages of ripening (7-days before harvest (TH-7), harvest (TH), and 10- days after harvest (TH+10)). Microvinification and sensory analysis indicate that the quality of the wines made from the whole bunches collected at TH-7, TH and TH+10 differed, TH providing the highest quality wines. In parallel, gene expression was studied with Qiagen/Operon microarrays using two types of samples, i.e. whole bunches and berries sorted by density. Only 12 genes were consistently up- or down-regulated in whole bunches and density sorted berries for the two years studied in Chardonnay. 52 genes were differentially expressed between the TH-7 and TH samples. In order to determine whether these genes followed a similar pattern of expression during the late stages of berry ripening in a red cultivar, nine genes were selected for RT-PCR analysis with Cabernet Sauvignon grown under two different temperature regimes affecting the precocity of ripening. The expression profiles and their relationship to ripening were confirmed in Cabernet Sauvignon for seven genes, encoding a carotenoid cleavage dioxygenase, a galactinol synthase, a late embryogenesis abundant protein, a dirigent-like protein, a histidine kinase receptor, a valencene synthase and a putative S-adenosyl-L-methionine: salicylic acid carboxyl methyltransferase. Conclusions: This set of up- and down-regulated genes characterize the late stages of berry ripening in the two cultivars studied, and are indirectly linked to wine quality. They might be used directly or indirectly to design immunological, biochemical or molecular tools aimed at the determination of optimal ripening in these cultivars.
General Note:
Publication of this article was funded in part by the University of Florida Open-Access publishing Fund. In addition, requestors receiving funding through the UFOAP project are expected to submit a post-review, final draft of the article to UF's institutional repository, IR@UF, (www.uflib.ufl.edu/ufir) at the time of funding. The Institutional Repository at the University of Florida (IR@UF) is the digital archive for the intellectual output of the University of Florida community, with research, news, outreach and educational materials

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
All rights reserved by the source institution.
Resource Identifier:
doi - 10.1186-1471-2229-11-165
System ID:
AA00008946:00001


This item is only available as the following downloads:


Full Text

PAGE 1

RESEARCHARTICLE OpenAccessTranscriptionalanalysisoflateripeningstagesof grapevineberrySabineGuillaumie1,2 ,RomainFouquet1,2 ,ChristianKappel1,2,ClineCamps1,2,NancyTerrier3, DominiqueMoncomble4,JakeDDunlevy5,ChristopherDavies6,PaulKBoss6andSergeDelrot1,2*AbstractBackground: Thecompositionofgrapevineberryatharvestisamajordeterminantofwinequality.Optimal oenologicalmaturityofberriesischaracterizedbyahighsugar/acidityratio,highanthocyanincontentintheskin, andlowastringency.However,harvesttimeisstillmostlydeterminedempirically,basedoncrudebiochemical compositionandberrytasting.Inthiscontext,itisinterestingtoidentifygenesthatareexpressed/repressed specificallyatthelatestagesofripeningandwhichmaybeusedasindicatorsofmaturity. Results: WholebunchesandberriessortedbydensitywerecollectedinvineyardonChardonnay(whitecultivar) grapevinesfortwoconsecutiveyearsatthreestagesofripening(7-daysbeforeharvest(TH-7),harvest(TH),and10daysafterharvest(TH+10)).Microvinificationandsensoryanalysisindicatethatthequalityofthewinesmadefrom thewholebunchescollectedatTH-7,THandTH+10differed,THprovidingthehighestqualitywines. Inparallel,geneexpressionwasstudiedwithQiagen/Operonmicroarraysusingtwotypesofsamples,i.e.whole bunchesandberriessortedbydensity.Only12geneswereconsistentlyup-ordown-regulatedinwholebunches anddensitysortedberriesforthetwoyearsstudiedinChardonnay.52genesweredifferentiallyexpressed betweentheTH-7andTHsamples.Inordertodeterminewhetherthesegenesfollowedasimilarpatternof expressionduringthelatestagesofberryripeninginaredcultivar,ninegeneswereselectedforRT-PCRanalysis withCabernetSauvignongrownundertwodifferenttemperatureregimesaffectingtheprecocityofripening.The expressionprofilesandtheirrelationshiptoripeningwereconfirmedinCabernetSauvignonforsevengenes, encodingacarotenoidcleavagedioxygenase,agalactinolsynthase,alateembryogenesisabundantprotein,a dirigent-likeprotein,ahistidinekinasereceptor,avalencenesynthaseandaputativeS-adenosyl-L-methionine: salicylicacidcarboxylmethyltransferase. Conclusions: Thissetofup-anddown-regulatedgenescharacterizethelatestagesofberryripeninginthetwo cultivarsstudied,andareindirectlylinkedtowinequality.Theymightbeuseddirectlyorindirectlytodesign immunological,biochemicalormoleculartoolsaimedatthedeterminationofoptimalripeninginthesecultivars.BackgroundGrapevine( Vitisvinifera L.)isanonclimactericfruit speciesusedastablefruit,driedraisins,andforvinification(wines)anddistillation(liquors).In2007,eightmillionhectaresofgrapevinesproduced31billionbottles ofwinefromvineyardsthroughouttheworld.Between 2003and2008,globalconsumptionofwinehas increasedby6%(InternationalOrganizationofVineand Wine(OIV)statistics).Thecompositionofthegrape berryatharvestisamajordeterminantofwinequality. Itdependsontheinteractionsbetweenthegenotypesof therootstockandofthevarietywiththeglobalenvironmentaroundtheplantandthemicroenvironment aroundtheberries. Grapedevelopmentisdividedintothreephasesi.e. twogrowthphasesseparatedbyalagphase[1].The firstgrowthperiod,alsocalledtheherbaceousphase,is characterizedbyembryodevelopmentandcelldivisions. Duringthisphase,varioussolutes(malicandtartaric acids,tannins,hydroxycinnamicacidsandaromacompounds)accumulateinthedifferenttissuesofthe *Correspondence:serge.delrot@bordeaux.inra.fr Contributedequally1Univ.Bordeaux,ISVV,EcophysiologieetGnomiqueFonctionnelledela Vigne,UMR1287,F-33140Villenaved Ornon,France FulllistofauthorinformationisavailableattheendofthearticleGuillaumie etal BMCPlantBiology 2011, 11 :165 http://www.biomedcentral.com/1471-2229/11/165 2011Guillaumieetal;licenseeBioMedCentralLtd.ThisisanOpenAccessarticledistributedunderthetermsoftheCreative CommonsAttributionLicense(http://creativecommons.org/licenses/by/2.0),whichpermitsunrestricteduse,distribution,and reproductioninanymedium,providedtheoriginalworkisproperlycited.

PAGE 2

berries[2].Allthesecompoundsareimportantforwine quality.Tartaricandmalicacidsdeterminewineacidity, andhydroxycinnamicacids areprecursorsofphenolic volatiles.Tanninsareresponsibleforthebitterand astringenttasteofredwines. Thephasecalledvraisonisatransitionphasecharacterizedbyachangeofberryskincolor,fromgreento whiteorred,dependingonthevariety,bythebeginning ofberrysoftening,andbyasuddenincreaseintherate ofsugaraccumulation.Theendofvraisoncoincides withtheonsetofmaturation,whichrepresentsthesecondperiodofberrygrowth,mainlyduetowaterinflux andcellenlargement.Thematurationphaseischaracterizedbydramaticchangesinberrycomposition[2]. Theconcentrationofsomesolutes(e.g.malicacid) whichareaccumulatedduring thefirstgrowthperiod, declineonaper-berrybasiswhiletheconcentrationsof othermolecules(sugars,anthocyanins)stronglyincrease. Manyaromaandflavorcompoundsessentialforwine typicityareproducedatalatestageduringgrapevine ripening. Severalrelativelysubjectivedefinitionscanbeusedto characterizegrapeberryripeness:physiological,technological,aromatic,polypheno licandoenological.Physiologicalripenesscorrespondstothetimewhentheberry isreadytobedisseminatedforplantsexualreproductionandpropagation.Technologicalmaturityisthe timepointbeyondwhichberriesdonotaccumulate moresugarsanddonotloseanymoreacidity.Aromatic maturityischaracterizedbytheoptimalconcentration ofaromaandvolatilecompounds.Phenolicmaturity takesintoaccountthequantit ativeandqualitativeevolutionoftheberrypolyphenolsintheskin(anthocyaninsandtannins)andseeds(tannins). However,noneofthemisreallysatisfactorybecause fewbiochemicalmarkersareavailable,andripeness dependsontheircombinationandinteractions.The winegrowersonlyconsidertheoenologicalmaturityin ordertodeterminetheoptimaldateofharvest.The oenologicalmaturitytriestotakeintoaccountandoptimizealltheformsofmaturitypreviouslydescribed whilepreservingthedesiredtypicityofwines.Therefore, thegrapevineberriesharvestedatoenologicalmaturity showahighsugar/acidityratio,highanthocyanincontentintheskin,andlowastr ingency.However,harvest timeisstillmostlydeterminedempirically,basedon crudebiochemicalcomposition(sugarandacidcontent, andtotalpolyphenol)andonberrytasting.Itisthereforeimportanttounderstandthephysiologicaland molecularbasisofgrapevineberryripeningthatmay leadtooenologicalmaturity. Theavailabilityofthegrapevinegenome[3,4]has boostedlarge-scalemRNAexpressionprofilingstudies ofwaterandsalinitystress[5],berrydevelopmentand ripening[6-8],resistanceagainstpathogenicfungi[9-11] orcontrolofstilbeneaccumulation[12]usingcDNAor oligonucleotidemicroarrays. Severalmultigenicfamiliescontrolthebiosynthesisof moleculesinvolvedinthegrapeberryripening.Theyare mostlyrelatedtocell-wallcomposition,sugarandwater import,organicacidmetabolismandstorage,andflavonoidsynthesis[7,8].Oneofthemajordifficultiescurrentlyfacedbythewinegrowersisthelackofaccurate descriptorstopredictthephysiologicalstateofberries. Eventhoughsomeresearchershaveanalyzedtranscriptionchangesduringberrydevelopmentandripening [6-8],comprehensivetranscriptprofilinghasneverbeen usedtoinvestigatethelaststepsofgrapevineripening inrelationtowineorganolepticproperties.Thus,the signalingnetworksinvolvedinregulationofthelast stagesofberryripeningarestillunknown. Thepresentstudydescribesadetailedanalysisofgene expressioninChardonnayberriessampledatthreedifferentstagesduringlateripe ning.Biochemicalanalysis ofgrapevineberriesandgustatoryappraisalsofmicrovinificationswerealsomade.Alimitedsetofgeneswere consistentlydifferentiallyexpressedinChardonnayberrieswhosedifferentripeningstagesresultedindifferent qualitiesofwine.Theexpressionprofilesofsomeof thesegeneswerealsostudiedandconfirmedinthered cultivarCabernetSauvignon.Theexpressionofthese candidategenesisclearlyalteredduringthelaststages ofripeningandthusmaybeconsideredaspotential indicatorsoflateripeningforbothcultivars.ResultsandDiscussionCharacterizationofChardonnaysamplesThe Vitisvinifera cv.Chardonnayberrysampleswere harvestedoverthecourseofberryripeningfromthe CIVCvineyardinChampagne(France)duringfall2005 and2006.Totakeintoaccounttheheterogeneityof berryripeninginavineyard,sampleswereharvested bothasdensimetricallysortedberries(DSB)andwhole bunchberries(WBB)forbettercomparison.Samples werecollected7-daysbeforeharvest(TH-7),attheoreticalharvest(TH)and10-daysafterharvest(TH+10). AccordingtoDSB,themostrepresentativeclasswas selectedfortherestofthestudyandtheirdensityvaried from120to150g/LNaCl(Figure1).Berryweight,total solublesolids(BRIX)andpotentialalcoholcontentof DSBharvestedsamplesaregiveninTable1.TheevolutionofthemeanberryweightofthemajorDSBclass dependsontheclimateoftheyear.Meanberryweight remainedconstantin2005,whereasitincreasedin 2006,particularlyattheTH+10stage.Accordingtothe CIVCwine-makingprocedures,thetechnologicalmaturitycorrespondedtoi)berriesfreeofdisease,particularly freeofgraymold( Botrytiscinerea )andpowderymildewGuillaumie etal BMCPlantBiology 2011, 11 :165 http://www.biomedcentral.com/1471-2229/11/165 Page2of27

PAGE 3

( Uncinulanecator ),ii)apotentialalcoholcontentof 10.0%volandiii)atotalacidcontentof8gH2SO4/L. Inpractice,apotentialalcoholcontenthigherthan9.0% volandlowerthan12.0%vol(over-ripe)oratotalacid contentbetween6gH2SO4/Land9gH2SO4/Lcan expressahighlevelofthequalitativepotentialinChampagnewines.Thecombinationandadjustmentofthe levelofthesethresholdstothehighestqualityofwines isbasedonsensoryanalysisbenchmarks.Thepotential alcoholandthetotalacidcontentsofChardonnayharvestedsamplesfromtheCIVCvineyardduringfall2005 and2006rangedbetween10.19to11.60%vol(Table1) and5.6to8.3gH2SO4/L(Table2)respectively.Therefore,TH-7,THandTH+10WBBandDSBsamplescorrespondedtoanadequatetimespanforthestudyof ripening(Tables1and2).MicrovinificationassaysandsensoryanalysisMicrovinificationandsensoryanalysesweredoneto assessthequalityofthewineproducedfromtheberries harvestedattheTH-7,THandTH+10stages.These analyseswereperformedtodeterminewhetherwines madefromtheTH-7,THandTH+10samplescouldbe discriminated.Theoverallobjectiveofthesecombined analyseswastoshowwhichharvesttimepointisthe bestforproducingaqualityChampagnewinebetween theTH-7,THandTH+10ha rveststages,andthusto associateatranscriptomicprofilewiththehighestwine quality. Thephysicochemicalpara metersdeterminedonthe decantedmustandbasewinesforChardonnaywines aregiveninTable2.Similarpatternsfortotalsugarand alcoholcontentswerefoundin2005and2006fordecantedmustwinesderivedfromTH-7,THandTH+10 samples.Thesamewastrueforthetotalacidcontents indecantedmustandbasewines.Duringtheripening process,thesugarandalcoholcontentsincreasedin decantedmustwineswhereasthetotalacidcontents decreasedindecantedmustandbasewines.Thesugar toacidratioisnotusedintheChampagneareato determinetheoptimalharvestdate,butitiscommonly usedasaqualityindexingrapevine[2].Thechangesin totalsugar/totalacidratiooftheChardonnaydecanted mustsduringgrapevineberrylateripeningaretherefore Berry percentage A B Berry percentage B Berry percentage 80 90 100 110 120 130 140 150 160 80 90 100 110 120 130 140 150 160 Densit y classes (g /L NaCl ) Densit y classes (g /L NaCl ) TH-7 TH TH+10 Figure1 RepresentativityofberryclassesseparatedaccordingtotheirdensityatthreestagesofChardonnayripening .In2005(A)and 2006(B),onethousandberrieswereharvestedateachofthethreeharvestdateandwereseparatedintoclassesaccordingtotheirdensity.TH7,7-daysbeforetheoreticalharvest;TH,theoreticalharvest;TH+10,10-daysafterharvest. Table1Physiologicalcharacteristicsofdensimetricallysortedberries(DSB)of Vitisvinifera L.cv.Chardonnaygrown inEpernay,France,inthe2005and2006seasons,atthreeripeningstagesHarvestdate Density (g/LNaCl) Berryweight (g) Totalsolublesolids(BRIX)Potentialalcohol (%vol) 09/19/2005(TH-7) 120-130 1.55 18.2 10.19 09/26/2005(TH) 130-140 1.57 19.2 10.86 10/05/2005(TH+10) 130-140 1.55 20.0 11.40 09/14/2006(TH-7) 130-140 1.38 19.3 10.93 09/20/2006(TH) 130-140 1.45 19.2 10.86 10/02/2006(TH+10) 140-150 1.54 20.3 11.60TH-7,7-daysbeforetheoreticalharvest;TH,theoreticalharvest;TH+10,10-daysafterharvest.Guillaumie etal BMCPlantBiology 2011, 11 :165 http://www.biomedcentral.com/1471-2229/11/165 Page3of27

PAGE 4

showninTable2.Thetotalsugar/totalacidratio increasedduringthelaststagesofripeningprocessand rangedfrom24.5to34.5duringfall2005andfrom20.8 to31duringfall2006.Attheharveststage(TH),the totalsugar/totalacidratiowasdifferentbetweenthe decantedmustwinesderivedfromsamplesharvested duringfall2005and2006.Theyvariedfrom29.5(TH2005)to24.6(TH-2006).However,andifthe2005and 2006vintagesareconsideredasrepetitive,anaverage increaseof16.6%1.6ofthesugartoacidratiowas observedbetweentheTH-7andTHmusts.Asimilar pattern,i.e.anincreaseof17.4%4.2,wasalsonoticed betweentheTH+10andTHmusts.Thus,ariseof 31.2%2.2wasobservedintheoveralltotalsugar/total acidratiobetweentheTH-7andTH+10stages.Incontrast,totalSO2,tartaricandL-malicacids,totalnitrogen,ammoniacalnitrogenandcalciumcontentsin decantedmustwinesandpotassiumcontentinbase winesshoweddifferenttrendsin2005and2006vintages.Amongtheaminoacidcontents,nodifference andconsistentevolutionwa snoticedexceptforproline indecantedmustwinesof2005and2006vintages.Prolineisnotusedbyyeasts,butisclassicallyhighinthe Chardonnaycultivar.Amon gallphysicochemical parametersinvestigatedindecantedmustandbase wines,therelativecontentinproline(%comparedtoall aminoacids),thesugar,alcoholandtotalacidcontents andconsequentlythesugartoacidratioweretheonly parametersdisplayinganevolutionwhichcanberelated tothelateripeningprogressofChardonnayberries. Asensoryanalysiswasperformedtodistinguishthe basewineselaboratedwithberriesharvestedattheTH7,THandTH+10stages(Table3).Foreachgrowing seasonstudied,atriangulartestwasconducted.The datadidnotrevealanysignificantdifferencebetween thebasewineselaboratedwiththeTH-7andTHberries ofthetwogrowingseasons.However,thesamecomparisonbetweenTHandTH+10orTH-7andTH+10base winesindicatedsignificantvariationsforeachyear.Sensoryanalysisdemonstratesthatwineselaboratedfrom theTHberrysamplesexhibittypicalsensoryproperties ofChampagnewines(Table3).TheTH-7andTH+10 winesdisplayaromasthatarelesstypicalornottypical atall. Theglobalgeneexpressionanalysisinthedifferent berrysamples(i.e.WBBandDSB)andripeningstages provideduswithafingerprintofthegrapevinelate ripeningtranscriptome.Inthisway,weidentified(1) Table2PhysicochemicalparametersofmicrovinificationsHarvestyear 2005 2006 Winestage DMU BW DMU BW Harvestdate TH-7THTH +10 TH-7THTH +10 TH-7THTH +10 TH-7THTH +10 Totalsugarcontent(densimetrictitration,g/L)170.0183.0193.0---173.0180.0192.0--Alcoholcontent(densimetrictitration,%vol)10.110.911.4---10.310.711.4--pH 3.03.12.93.13.13.22.93.13.13.13.13.2 Totalacidcontent(potentiometrictitration,gH2SO4/ L) 7.06.25.65.04.64.18.37.36.25.14.74.1 TotalenzymaticSO2content(Lisamethod,mg/L)13.029.029.033.037.049.034.020.029.037.037.049.0 Tartaricacid(g/L) 7.07.66.23.73.32.96.87.48.93.52.52.7 L-malicacid(g/L) 5.34.83.6---5.55.45.4--Totalsugar:totalacidratio 24.329.534.5---20.824.631.0--Totalnitrogen(mgN/L) 227.0261.0237.0138.0203.0198.0454.0223.0222.0171.0197.0186.0 Ammoniacalnitrogen(Lisamethod,mgN/L)42.041.059.0---49.047.034.0--Glucose+fructose(Lisamethod,g/L) ---0.80.90.9---0.80.81.1 Absatomicpotassium(mg/L) 1310.01100.01480.0565.0477.0484.01603.01563.01823.0503.0563.0502.0 Absatomiccalcium(mg/L) 82.057.053.0---47.099.080.0--Serine(%) 7.27.1----9.86.8---Threonine(%) 4.54.1----0.60.6---Asparagine(%) 0.91.0----1.11.0---Glutamine(%) 11.58.2----19.817.1---Proline(%) 28.336.7----26.835.5---Alanine(%) 19.513.9----17.816.0---y-aminobutyricacid(%) 6.45.0----5.05.9---Arginine(%) 5.54.5----9.07.6----Exceptprolinewhichisnotusedbyyeast,allaminoacidsnoticedabovecorrespondto80%ofyeastnitrogenneeds. -,nottested;BW,basewine;DMU,decantedmust;TH-7,7-daysbeforetheoreticalharvest;TH,theoreticalharvest;TH+10,10-daysafterharvest.Guillaumie etal BMCPlantBiology 2011, 11 :165 http://www.biomedcentral.com/1471-2229/11/165 Page4of27

PAGE 5

genesthataretemporallyco -expressed,and(2)individualgenefamilymembersthatarepreferentially expressedinaparticularberrysampleorripeningstage.DifferentialgeneexpressioninChardonnayberriesduring lateripeningTranscriptomicanalysiswasconductedwiththedifferentberrysamples(i.e.WBBandDSB).SamplescollectedattheTHstagewerecomparedtotheTH-7and TH+10stagesrespectivelyinordertoemphasizeevolutionsofgeneexpressionaroundtheTHstage. Amongthe14,562investigatedgenes,5and7genes wereconsistentlydown-regulatedorup-regulated throughoutthelaststepsofgrapevineripeninginboth WBBandDSB(Figure2;Table4)andforthetwoyears studied. Thesegenesbelongtofivefunctionalcategories, includingaroma-,dessication-orpathogenesis-related genesandphenylpropanoidmetabolism(Table4).These putativefunctionswereattributedonthebasisof homologywithgrapeand Arabidopsisthaliana genes. Themosthomologous Arabidopsisthaliana and Vitis vinifera genesofeachgrapeoligonucleotidearealso indicatedinTable4.Amongthe12genesdifferentially expressedthroughoutthelastphasesofgrapevineripening(TH-7,TH,TH+10),threedidnothaveanyknown function.AromarelatedgenesAromaisimportantforwinequality,anditistherefore interestingthatonegenepredictedtoencodeaputative carotenoidcleavagedioxygenase(CCD)wasupregulatedduringChardonnayripening(Table4andFigure3).Indeed,carotenoidsareapocarotenoidprecursors whichplayaroleintheproductionofphytohormones (i.e.abscisicacid)andsomeflavorsandaromas.ApocarotenoidsaremostlygeneratedbythecleavageofacarotenoidmoleculebyenzymesoftheCCDfamily[13-15]. Amongthecarotenoids,thelevelsofbeta-carotene, lutein,flavoxanthinandneoxanthindecreaseaftervraisoningrapevineberries[16].Thesecarotenoids undergobreakdownreactionsthatproduceC13norisoprenoidcompoundsinvolvedinthetypicalaromasof somegrapevinecultivars[17]aswasdemonstratedwith VvCCD1[18].Theincreasedtranscriptabundanceof VvCCD4a couldberelatedtothepresenceofapocarotenoidsduringtheendoftheripeningprocess.Ingrape, four CCD4 geneshavebeenidentified insilico [19],but nonehasbeenfunctionallycharacterized.Accordingto Huangetal.[20],plantsproduceatleasttwodifferent formsofCCD4enzymes. AmongtheCCD4proteinsalreadycharacterizedfor otherplants,the Malusdomestica and Rosaxdamascena CCD4proteins(MdCCD4andRdCCD4)arethe closesttoVvCCD4a. Invivo assaysanalyzedbySPMEGC-MSshowedthatMdCCD4andRdCCD4cleave b carotenetoyield b -ionone[20].However,nocleavage productswerefoundwhen MdCCD4 and RdCCD4 geneswereco-expressedin E.coli strainsthataccumulatedlinearcarotenoidssuchascis-z-caroteneorlycopene[20].Weperformedisolationandcloningofthe VvCCD4a geneintopGEXexpressionvector.InasimilarwaytovariousCCD4ssuchasMdCCD4orRdCCD4 Table3WinesensoryanalysisinChardonnaybasewinesfrom7-daysbeforetheoreticalharvest(TH-7),theoretical harvest(TH)and10-daysaftertheoreticalharvest(TH+10)samplesofthe2005and2006growingseasonsTriangular tests SamplesMajorsensorydescriptors 2005 TH-7/THTH-7 Slightmilk,lively TH Fruity (cherry), round slightbitterness TH/TH+10*TH Milk (yoghurt,toffee,butter), round TH+10 Reductivecharacter (sulfur),more vegetal thansmokedandroasted, lively TH-7/TH+10*TH-7 Acid lively aggressive TH+10 Vegetal lessacid versusroundandflatmouth, bitterness 2006 TH-7/THTH-7 Acid (aggressive) TH Reductivehint (animal), lessacid TH/TH+10*TH Reductivecharacter (cauliflower), moreacidthanastringentandbitter TH+10 Reductivecharacter (hydrocarbon,rubber,burntwood,vegetablestockversusanimal), acid (moreaggressive), bitter, short TH-7/TH+10*TH-7 Reductivehint acid (fresher,harder,aggressive), aqueousmouth TH+10 Roastedandreductivecharacter (sulfur,animal,smoke,putrid), acid (hard,lively,slightacidity), round bitterTastingdescriptorsrepresentasummaryofsensorydescriptorsemployedbyatastingpanelof13tasterstoqualifyChardonnaybasewines.*correspondto significantcomparisonanalysisperformed(P<0.05).Boldsensorydescriptorsarethemostrepresentativeonesdistinguishingtwodefinedbasewines.Guillaumie etal BMCPlantBiology 2011, 11 :165 http://www.biomedcentral.com/1471-2229/11/165 Page5of27

PAGE 6

[20],theco-expressionof VvCCD4a geneinthestrains accumulatingcisz -carotene,lycopene, b -carotene,and zeaxanthindidnotcausealackofpigmentationinthese cultures(datanotshown).AlthoughsomeCCD4proteinshavebeenshowntocleavecarotenoidsubstratesat the9,10and9 ,10 positions,theymighthavedifferent biochemicalfunctionsastheymayacceptdifferent(apo) carotenoidsandshowvariousexpressionprofiles. AsubcellularlocalizationstudyofVvCCD4aprotein revealedthechloroplastlocalizationoftheVvCCD4a enzyme(datanotshown).Thisisinagreementwiththe deducedaminoacidsequencesofallCCD4proteins, includingVvCCD4a,whichcontainaplastid-targeting transitpeptideattheN-terminus[19].Furthermore,the Crocussativus and Arabidopsis CCD4s,havebeen showntoresideinplastids, wheretheirsubstratesare localized,suggestingadirectinvolvementinvolatileformation[19].Altogether,thissuggestsapotentialrole forVvCCD4ainberrycolor,flavorandaromaduring lateripeningofChardonnayberries.PhenylpropanoidpathwayTwogenescalled VvPAL1 and VvPAL2 encodingphenylalanineammonia-lyase(PAL;EC4.3.1.5)wereup-regulatedthroughoutthelastperiodsofChardonnay ripening(Table4).PALcatalyzesthefirststepinthe phenylpropanoidpathwaybyremovingtheNH3radical fromL-Phetoproducetrans-cinnamicacidandother phenoliccompounds.Ingrapevineberry,PALislocated inepidermalcellsaswellasintheseeds[reviewedin [21]].PALactivitywithinthegrapevineskinismaximal atthefirststagesofdevelopment,anddecreasesupto vraison.Incoloredgrapevines,PALactivityintheskin WBB TH vs TH-7 WBB TH+10 vs TH DSB TH vs TH-7 DSB TH+10 vs THpvalue<0.05 37 148 108 12 52 53 23 97 167 Figure2 VenndiagramsummaryofdifferentiallyexpressedgenesidentifiedinChardonnayatthreestagesofripening .Chardonnay wholebunchesanddensimetricallysortedberrieswereharvestedatthe7-daysbeforeharvest(TH-7),theoreticalharvest(TH)and10-daysafter harvest(TH+10)stagesduringthe2005and2006years.ComparisonsoftheexpressionprofilesofTHversusTH-7andTH+10versusTHwere madeforwholebunchesanddensimetricallysortedberries.Thetotalnumbersofgenesdifferentiallyexpressedareindicatedinrespective circles(P<0.05, 1.75-fold).Thecombinednumberofgenessimultaneouslyup-ordown-regulatedisgiveninintersectionsbetweencircles. Twelvegenesweredifferentiallyexpressedatallstagesoflateripening;somegeneswerestageorsampletypespecificwhileotherswere overlappingintwostageorsamplecomparisons(forgeneidentity,seeTables4,5and6andAdditionalfiles1and2(TablesS1andS2)).WBB, wholebunchberries;DSB,densimetricallysortedberries. Guillaumie etal BMCPlantBiology 2011, 11 :165 http://www.biomedcentral.com/1471-2229/11/165 Page6of27

PAGE 7

Table4Differentiallyexpressedgenes(P<0.05, 1.75-fold)inChardonnaygrapevineberriesallalongtheinvestigatedripeningperiodsofthe2005and 2006growingseasonsPutativefunctionGrapeMicroarray Accession Number(Vv_#) GrapeNucleotide Accession Number(mRNA) GrapeGene Accession Number (GSVIVT#) Most Homologous Arabidopsis Sequence WBB average ratio(THvs TH-7) p-valueWBBaverage ratio(TH+10 vsTH) p-valueDSB average ratio (THvs TH-7) p-valueDSB average ratio (TH+10 vsTH) p-value Aromarelated genes Carotenoid cleavage dioxygenase4a (VvCCD4a) Vv_10003015XM_002268368GSVIVT01036862001At4g191700.9992.00E-041.2199.00E-051.0710.000411.0180.00022 Phenylpropanoid/ ligningenes Phenylalanine ammonialyase (VvPAL1) Vv_10000977XM_002281763GSVIVT01025703001At2g370401.6916.00E-051.0767.00E-041.0520.001071.4970.00031 Phenylalanine ammonialyase (VvPAL2) Vv_10000978AB015871GSVIVT01024306001At3g532601.8580.000131.0460.000691.2340.000251.5780.00024 Responseto dessication Galactinolsynthase (VvGolS) Vv_10000327XM_002262669GSVIVT01017634001At1g56600-1.3070.00057-0.990.00142-1.4620.00057-1.1070.00053 Late embryogenesis abundantprotein (VvLEA1) Vv_10001081XM_002283966GSVIVT01033739001At3g53040-1.113.00E-04-1.1930.00118-1.3782.00E-04-1.0710.00041 Late embryogenesis abundantprotein Vv_10001082AM474201GSVIVT01033739001At3g53040-1.2710.00053-1.30.00017-1.5590.00016-1.271.00E-04 Pathogenesisrelatedgenes Pathogenesisrelatedprotein10 Vv_10010887XM_002274581GSVIVT010350590011.9570.001782.0770.00221.3750.000372.1150.00055 Dirigent-like protein (VvDIR-like) Vv_10002588XM_002285641GSVIVT01025392001At3g136501.9790.000871.810.000531.3770.004561.7344.00E-04 Hormonalcontrol Histidinekinase receptor(VvHKR) Vv_10014467FJ822975GSVIVT01030060001At5g35750-0.9430.00023-0.8450.00031-0.8260.00033-0.940.00032 Unknown function UnknowngeneVv_10014451XM_002270095GSVIVT01010993001At4g250102.2633.00E-050.9820.000211.7573.00E-051.4716.00E-05 UnknowngeneVv_10002806XM_002273032GSVIVT01038103001At1g652601.3750.000140.8840.001061.010.001221.0950.00058 UnknowngeneVv_10011055XM_002284158 -0.8490.00238-0.8110.00091-0.8380.00113-1.0320.00115Genesareorganizedinfunctionalcategories.Ratiovaluesarepresentedaslog2.DSB,densimetricallysortedberries;TH-7,7-daysbeforetheoreticalharvest;TH,theoreticalharvest;TH+10,10-daysafterharvest;WBB, wholebunchberries.Guillaumie etal BMCPlantBiology 2011, 11 :165 http://www.biomedcentral.com/1471-2229/11/165 Page7of27

PAGE 8

showsasecondpeakaftervraison[reviewedin[21]]. Thereisacloserelationshipbetweenitsactivityandthe colorintensityofcoloredgrapevines[22].NoPALisoenzymeisdetectedintheskinofnon-coloredberries suchasChardonnayduringthelateripening[23],noris thereanyPALtranscriptpresent[24].Thus,PALactivityseemstoplayanessentialroleinanthocyaninaccumulationonlyincoloredgrapevineberries.Todate,the putativefunctionsofVvPAL1andVvPAL2inripening ofwhitegrapevineberriesarestillunknown.In Arabidopsisthaliana,AtPAL1andAtPAL2arerelatedtothe lignificationprocess[25]. AtPAL1 and AtPAL2 are responsivetoenvironmentalfactorslikenitrogendepletionorpathogens[26].Suchrolescanalsobehypothesizedfor VvPAL1 and VvPAL2 .ResponsetodessicationGalactinolsynthase(GolS;EC2.4.1.123)isamemberof theglycosyltransferasefamily8(GT8)[27]andcatalyzesthefirstcommittedstepinthebiosynthesispathwayofraffinosefamilyoligosaccharides(RFOs).GolS synthesizesgalactinol,wh ichservesasadonortoform solublegalactosyl-Succarbohydrates.Accumulationof RFOsisusuallyassociatedwithabioticstresssuchas cold,heatordehydration[28].Attheproteinlevel, VvGolS(GSVIVP00019670001;Table4)exhibited69% identity/78%similaritywith Arabidopsis GolS1. AtGolS1 transcriptsweredetecteddu ringseedmaturationand maybeimplicatedinseedosmoprotection[29].However,RFOsalsoconstituteasignificantcomponentof phloem-transportedsugarsinsomeplants[30]. Twogenesencodinglateembryogenesisabundant proteins(LEA)werealsodown-regulatedduringthelast stagesofgraperipening(Table4). LEA expressioncould berelatedtotheacquisitiono fdessicationtolerancein seeds;butmanyLEAproteinsareinducedbycold, osmoticstressorexogenousabscisicacid,orcaneven beexpressedconstitutively[31].Pathogenesis-relatedgenesPRproteinsareinducedinresponsetoseveralpathogen agents(bacteria,virusesandfungi)duringthehypersensitiveresponse(HR)andsystemicacquiredresistance (SAR)[32].ThePRproteinsformaheterogeneous familyincluding17groups(PR-1toPR-17)distinguishedonthebasisofstructuralhomologies[32,33]. However,thebiologicalandbiochemicalfunctionsof theseproteinsduringthedefensereactionsanddevelopmentalprocessesarestillunclear. Thepathogenesis-relatedp roteins(PR)comprisethe vastmajorityofwineproteinsandadverselyaffectthe clarityandstabilityofwines[34].Theexpressionofone geneencodingaPR-10proteinwasup-regulatedduring thelaterstagesofgrapevineripening,andespeciallyat theTH+10stage(Table4).Ingeneral,PR-10proteins exhibitallergenic,anti-fungalandribonucleaseactivities. Robertetal.[35]emphasizedtheaccumulationofPR10proteinsingrapevineafter Pseudomonassyringae infection,whichwasascribedtoHR.Up-regulationof PR-10expressionmaybeduetoattacksof Botrytis cinerea whichoccurredinChampagnevineyardsduring thelaststagesofripeningin2005and2006. 0 0.020.04 0.060.08 0.1 0.12 0.140.160.18 2005 2006 VvCCD4a relative expression Figure3 Bardiagramof Vitisviniferacarotenoidcleavagedioxygenase4a ( VvCCD4a )transcriptabundance:acomparisonofqRT-PCR dataofChardonnaywholebunchanddensimetricallysortedberriesharvestedatthreeripeningstagesin2005and2006 .ThemRNA levelwasexpressedrelativetocontrols(setat1),referencegene EF1a .RT-PCRdataarereportedasmeansSE(errorbars)ofn=3technical replicates.DSB,densimetricallysortedberries;TH-7,7-daysbeforetheoreticalharvest;TH,theoreticalharvest;TH+10,10-daysafterharvest;WBB, wholebunchberries. Guillaumie etal BMCPlantBiology 2011, 11 :165 http://www.biomedcentral.com/1471-2229/11/165 Page8of27

PAGE 9

Inaddition,onegeneencodingaputativedirigent-like protein(DIR-like)wasup-regulatedduringtheberrylate ripening(Table4).ThisgenedisplayssequencehomologytomembersoftheDIR-bsubfamilyi.e.PDIR3, PDIR7andPDIR20of Piceaglauca engelmanni Picea glauca and Piceasitchensis respectively[36].Theability ofDIRproteinstodirectthestereoselectiveformationof lignanshasbeenpreviouslydemonstratedwith invitro assaysforseveralmembersoftheDIR-asubfamilyfrom Forsythiaintermedia [37].However,thebiochemical functionsforthemembersofDIR-b,DIR-c,DIR-dand DIR-esubfamiliesarenotknownsothatthemembersof thesesubfamiliesarereferredtoasDIR-like.InSitka sprucetrees,theexpressionofseveral DIR geneswas alteredbybioticandabioticstresses,suggestingtheir implicationinplantdefense[37].HormonalcontrolInthepresentstudy,onlyonegene(FJ822975,termedas VvCyt1 )encodingacytokininhistidine-kinasereceptor, relatedtohormonemetabolismandregulationofberry developmentandripening,wasdown-regulatedthroughoutthelaststepsofripening(Table4).The ARABIDOPSIS HISTIDINEKINASE2 ( AHK2 )geneistheclosesthomologueto VvCyt1.Cytokininsregulatethedevelopmentof vascularbundlesininflorescencestemsof Arabidopsis thaliana viatheAHK2signalingpathway[38].Cytokinin activityissignificantduringtheearlystagesofgrapevine berrydevelopmentbutdecreaseslateronduringripening [2].Todate,theputativefunctionsofVvCyt1duringthe grapevineberryripeningremaintobeclarified. Insummary,atotalof12geneshavebeenshownto beconsistentlyregulatedthroughoutthelaststepsof theripeningprocessandcanbeconsideredasnewindicatorsoflateripeninginChardonnay.Withregardto thefivedown-regulatedgenes,anaveragedown-regulationof2-foldwasobservedbetweentheTHandTH-7 samplesandalsobetweentheTH+10andTHones. Similarly,anaverageup-regulationof3.4-foldand2.6foldwasobservedintheTHversusTH-7andinTH +10versusTHsamplesrespectively.Theseaverage expressionratioscouldberelatednotonlytothe increaseofthesugartoacidratio(Table2)throughout thelaststepsofgrapevineripeningbutalsotothesensoryanalysisperformed(Table3).Theformationofflavorsintheripeninggrapeberryresultsfromthebalance ofthesugartoacidratioaswellassynthesisofflavor andaromaticcompounds[2].Thepresentstudylinks thesugartoacidratio,thes ensorycharacteristicsand theexpressionprofilesofsomespecificgenes.THversusTH-7differentialgeneexpressionin ChardonnayberriesThiscomparisonallowsgenesthataredifferentially expressedjustbeforetechnologicalmaturitytobe identified.AmongthegenesexpressedattheTH-7and THstagesinWBBandDSB,52genesweredifferentially regulatedinTHversusTH-7berries.Inadditiontothe 12previouslymentionedasup-ordown-regulated throughoutallthestagesofripeningprocess,20more genesassociatedtoaputativefunctionweredifferentiallyexpressedinTHversusTH-7WBBandDSBsamples(Table5).Genesrepresentinghypotheticalproteins ofunknownfunctionareshowninAdditionalfile1 (TableS1).Cellwall-relatedgenesFruitdevelopmentandripeninginvolvetheactionofa complexsetofenzymesandproteinsassociatedwith thedisassemblyofprimarycellwallandreductionin cell-celladhesion[39].Theexpansins,xyloglucanendotransglycosylases/hydrolasesandgalacturonosyltransferasesbelongtothissetofenzymes. Theexpansinsareabletoplasticizethecellulosehemicellulosenetworkofplantcellwall.Intheliterature,threeputative EXP genes, Vlexp1 Vlexp2 ,and Vlexp3 havebeenisolatedfromKyohogrape( Vitislabrusca x Vitisvinifera)berriesandtheirexpressionwas monitoredatninestagesofberrydevelopment[40]. Vlexp1 istheclosesthomologuetothegrapevine EXPA gene(GSVIVT01007987001),whichisdifferentially expressedbetweentheTH-7andTHstages(Table5). Vlexp1 expressionincreasedwithberrydevelopmentup tothehalf-coloredstageandthendecreasedduringthe laterstagesofmaturation[40].Instrawberry, FaEXPA4 (DQ183068)istheclosesthomologueof VvEXPA.At theproteinlevel,VvEXPA(Table5)exhibited79%identity/88%similaritywithFaEXPA4. FaEXP4 mRNAis stronglyexpressedthrough outfruitdevelopmentand ripening,andexhibitsaslightdecreaseattheendof maturityinSelvafruits,thefirmestcultivarconsidered inthestudyofDottoetal.[41].Thissuggeststhat VvEXPA couldbeassociatedwiththecellexpansion andgrapevineberryripening(Table5). Changesinthepectinmatrixareregardedasan importantfactorthataffectsthecellwallstructureduringthefruitripeningandsenescence[42]. a -(1,4)Galacturonosyltransferasescatalyzetheadditionof(1,4)linked a -D-galacturonosylresi duesontothenonreducingendofhomogalacturonanchains[43].Onegene encodingsuchaputativegalacturonosyltransferasewas down-regulatedattheTHstageincomparisonwiththe TH-7one. Xyloglucanistheprincipalhemicellulosecomponent intheprimarycellwallsofnon-graminaceousplants, andaccountsfor10%ofthecellwallcompositionin grapevineberries[44].Duringthefruitripeningprocess, xyloglucandegradationistheterminalcellwalldegradationthatoccurs[45].Xyloglucanendotransglycosylases/ hydrolases(XTH)areinvolvedinsplittingand/orGuillaumie etal BMCPlantBiology 2011, 11 :165 http://www.biomedcentral.com/1471-2229/11/165 Page9of27

PAGE 10

Table5Differentiallyexpressedgenes(P<0.05, 1.75-fold)inChardonnaygrapevineberriesbetweentheoreticalharvestdate(TH)andoneweekbefore (TH-7)ofthe2005and2006growingseasons.Putativefunction GrapeMicroarray AccessionNumber(Vv_#) GrapeNucleotide AccessionNumber(mRNA) GrapeGeneAccession Number(GSVIVT#) MostHomologous ArabidopsisSequence WBB average ratio p-valueDSB average ratio p-value Cellwallrelatedgenes Alpha-expansin Vv_10001623 XM_002284822 GSVIVT01007987001 At1g69530 -1.140.00032-0.8290.00246 Polygalacturonate4-alphagalacturonosyltransferase Vv_10003714 XM_002271124 GSVIVT01020141001 At1g70090 -1.5010.00027-1.5850.00022 Xyloglucan endotransglycosylase/hydrolase Vv_10011203 XM_002274118 GSVIVT01029170001 At5g57550 -0.8840.00045-0.7990.00062 Xyloglucan endotransglycosylase/hydrolase Vv_10011021 XM_002274791 GSVIVT01029162001 At5g57560 -1.2230.00014-1.20.00018 Xyloglucan endotransglycosylase/hydrolase Vv_10010901 XM_002262725 GSVIVT01031601001 At3g23730 -1.10.00033-1.360.00014 Xyloglucan endotransglucosylase/ hydrolase Vv_10011290 XM_002274516 GSVIVT01029166001 At4g25810 -1.4726.00E-05-1.4757.00E-05 Bioticandabioticstress relatedproteins Pathogenesis-relatedprotein 10 Vv_10003874 XM_002274749 GSVIVT01035055001 1.5420.001561.0860.00016 Miraculin-likeprotein Vv_10011266 XM_002266394 GSVIVT01012922001 At1g17860 -2.4099.00E-05-0.9940.00104 Transporters Sulfatetransporter Vv_10001315 XM_002279177 GSVIVT01018028001 At3g51895 -1.2070.00084-0.9070.00169 Transcriptionfactors TCPtranscriptionfactor Vv_10010249 XM_002272192 GSVIVT01012766001 At1g72010 -1.2330.00021-1.0380.00014 bZIPtranscriptionfactor Vv_10007432 XM_002285275 GSVIVT01014246001 At3g58120 -1.4997.00E-05-1.5355.00E-05 Miscellaneous Phosphate-inducedproteinVv_10000589 XM_002285726 GSVIVT01009065001 At4g08950 -2.3420.00021-1.8852.00E-04 Phosphate-inducedproteinVv_10000871 XM_002282859 GSVIVT01023873001 At2g17230 -1.1410.00157-1.1840.00098 beta-ketoacyl-CoAsynthaseVv_10004485 XM_002284950 GSVIVT01015472001 At2g26640 -0.8450.00211-0.8830.00212 MetalionbindingproteinVv_10004892 XM_002281195 GSVIVT01022185001 At4g39700 -1.0450.00016-1.3250.00011 AAA-typeATPasefamily protein Vv_10010867 XM_002268820 GSVIVT01023336001 At3g28600 -1.280.00026-1.1760.00015 AAA-typeATPasefamily protein Vv_10012487 XM_002280929 GSVIVT01015385001 At3g24530 -0.8050.00072-0.8590.00099 Aspartylproteaseprotein Vv_10002995 XM_002265735 GSVIVT01036694001 At3g12700 -2.06.00E-05-1.9753.00E-05 Proteaseinhibitor Vv_10001691 XM_002266266 GSVIVT01012936001 At1g17860 -3.0461.00E-05-0.8720.00418 PS60protein/multicopper oxidase Vv_10000492 XM_002282178 GSVIVT01023902001 At1g76160 -0.9220.00088-0.8460.00141Genesareorganizedinfunctionalcategories.Ratiovaluesarepresentedaslog2.DSB,densimetricallysortedberries;TH-7,7-daysbeforetheoreticalharvest;TH,theoreticalharvest;WBB,wholebunchberries.Guillaumie etal BMCPlantBiology 2011, 11 :165 http://www.biomedcentral.com/1471-2229/11/165 Page10of27

PAGE 11

reconnectingxyloglucancross-linksinanewposition, andtheiractionhelpssatisfythecontradictoryneedsof growingand/ordifferentiatingtissues[46].Nunanetal. [47],Delucetal.[7]andGlissantetal.[48]havealready reportedtheinvolvementofafewXTHgenesduring thegrapevineberrydevelo pment.However,noneof themcorrespondstothefourXTH(XM_002274118, XM_002274791,XM_002262725andXM_002274516), whicharedown-regulatedbetweenTH-7andTHstages (Table5).ThefourXTHarecloselyrelatedtothe tomato LeXTH3 or SiXTH3 [49](XM_002274118, XM_002274791),litchi LcXET3 [50](XM_002262725) andCharentaismelon CmXTH3 [51](XM_002274516) genesrespectively.Theexpressionprofilesofthese genessuggesttheirinvolvementinthedepolymerization ofxyloglucanfractioninrelationtofruitsoftening. Whiletheenzymaticbasisofthisprocesshasnotbeen established,cellwall-modifyingproteinshavebeensuggestedtoplayasynergisticroleintherestructuringof thecellulose-xyloglucan-pectinnetworkduringthefruit ripening[45].PlantdefenseproteinsAnotherPR-10geneisup-regulatedduringthegrapevineripening,especiallybetweenTH-7andTHstages. Amongthestress-relatedgenes,onegenehomologous toamiraculin-likeproteinisalsodown-regulated(Table 5).Amiraculinisaplantproteinpurifiedfromextracts of miraclefruit berries( Synsepalumdulcificum )which isabletomodifyasourtasteintoasweettaste[52].In Citrusand Poncirustrifoliata ,a miraculin homologueis down-regulatedbycoldstress(whichreduceswater availability)[53].Incoffee, Coffea miraculin( CoMir ) expressionwasprominentduringtheearlystagesof fruitdevelopmentandthenrepressedthroughoutfruit maturation[54].Liketheup-regulationofVvGolS(see above),thedown-regulationofthegrapevine miraculinlike genemaybearesponsetoadecreaseofwater availability.TransporterproteinAlargenumberofgenesencodingproteinswithfunctionsinthetransportofwater,ions,sugars,andnonspecificsubstratesshowdiff erentialexpressionduring berryripening[7,55,56]. Amongthesecompounds,inorganicsulfateisacquired fromthesoilasamajorsourceofsulfurnutrientin higherplants.Thelongdistancetransportofsulfurisin partmediatedbyphloemtranslocationofsulfateorsulfur-containingmetabolites,suchasglutathioneandSmethyl-Met[57].Amemberofthegroup3sulfate transporters(XM_002279177)isdown-regulatedatthe THstagecomparedtoTH-7(Table5).Theexpression ofgroup3sulfatetransportersisnotaffectedbythesulfatestatusoftheplant[58].Theroleofsuchatransporteringrapevineberryripeningisstillunknownalthough threeothersgroup3sulfatetransporterswerealready identifiedasdifferentiallyexpressedintissuesofgrapevineberry[55].TranscriptionfactorsTwogenesencodingabasicleucinezipper(bZIP)anda TCPtranscriptionfactorsexhibitedlowerexpressionat theTHstagecomparedwiththeTH-7one(Table5). AlthoughtheTeosinteBranched1,CycloideaandPCF (TCP)domainproteinfamilies,whichbelongtothe familyofbHLH-typetranscriptionfactors,arethought tobekeyregulatorsofmorphologicaltraits[59],no dataareavailableabouttheinvolvementofsuchatranscriptionfactorintheregulationoffruitripening.TH+10versusTHdifferentialgeneexpressionin ChardonnayberriesAmongthegenesexpressedattheTH+10andTH stagesinWBBandDSB,53genesweredifferentially expressedinTH+10versusTHberries.Inadditionto the12previouslymentionedasup-ordown-regulated duringalltheendoftheripeningprocess,24other genesassociatedtoaputativefunctionweredifferentiallyexpressedinTH+10versusTHWBBandDSB samples(Table6).Amongthe53genesdifferentially expressedinTH+10versusTHberries,someofthem didnothaveanyknownfunctionandtheyareshownin Additionalfile2(TableS2).AromaandflavorrelatedgenesSeveralflavorandaromacompounds,suchaspyrazines, terpenesorshikimicacidderivatives,areresponsiblefor thecharacterofwinesandcontributetotheirquality [60,61].Amongthem,theterpenoidvolatileswhich derivefromisopreneunitsarecrucialforthefruityand floralaromasandflavorsofwine.Furthermore,the higherterpenesmayalsoberesponsibleforthedieselor fueloff-flavorsofwines.DuringChardonnayberry ripening,thetranscriptabundanceofthe(+)-valencene synthase( VvValCS ;FJ696653/AY561843)gene,encoding anenzymeinvolvedinsesq uiterpenebiosynthesis, increasedsignificantlyintheTH+10berriescompared withtheTHsamples(WBBandDSB)(Table6).The VvValCS expressionpatternwasvalidatedbyqRT-PCR (Figure4).Theincreasedtranscriptabundanceofthe VvValCS geneislikelyanindicatorforthesynthesisof somearoma-relatedcompoundsatthelateststagesof theripeningprocess.Delucetal.[62]investigatedthe expressionprofileofthe VvValCS geneduringgrapevine berrydevelopmentundernormalandwaterstresscultureconditionsinChardonnayandCabernetSauvignon cultivars.Attheendofripening,the VvValCS transcript profilefoundinChardonnaywassimilartoourresult. Lckeretal.[63]alsodemonstratedtheimportanceof VvValCS transcriptintheproductionofterpenoidcompoundsduringthelateripeningstagesofGuillaumie etal BMCPlantBiology 2011, 11 :165 http://www.biomedcentral.com/1471-2229/11/165 Page11of27

PAGE 12

Table6Differentiallyexpressedgenes(P<0.05, 1.75-fold)inChardonnaygrapevineberriesbetween10-daysaftertheoreticalharvest(TH+10)and theoreticalharvestdate(TH)ofthe2005and2006growingseasons.Putativefunction GrapeMicroarray AccessionNumber(Vv_#) GrapeNucleotide AccessionNumber(mRNA) GrapeGeneAccession Number(GSVIVT#) MostHomologous Arabidopsis Sequence WBB average ratio p-valueDSB average ratio p-value Aromarelatedgenes Valencenesynthase(VvValCS)Vv_10004183 FJ696653/AY561843GSVIVT01036322001 At5g23960 2.0312.00E-051.8232.00E-05 Pathogenesis-relatedgenes Pathogenesis-relatedprotein1 (PR-1) Vv_10011243 AJ536326 GSVIVT01037015001 At2g14580 2.0493.00E-051.5580.00024 Pathogenesis-relatedprotein1 (PR-1) Vv_10004981 XM_002274239 GSVIVT01037014001 At2g14610 2.0590.000161.6370.00029 Beta-1,3-glucanase(PR-2) Vv_10010418 AF239617 GSVIVT01035013001 At4g16260 1.5660.000140.9940.00133 Thaumatin-likeprotein(PR-5)Vv_10000872 XM_002282994 GSVIVT01019840001 At4g11650 1.3370.000181.2730.00019 Leucine-richrepeatproteinVv_10000077 XM_002263817 GSVIVT01032059001 At3g20820 -1.260.00015-1.6680.0012 Stress-relatedgenes Heatshockprotein Vv_10011030 XM_002281184 GSVIVT01016426001 At5g59720 -1.1570.00016-1.3990.00027 Heatshockprotein Vv_10000006 XM_002281358 GSVIVT01016429001 At3g46230 -0.9510.00788-1.1330.00038 Heatshockprotein Vv_10011029 XM_002281318 GSVIVT01016428001 At3g46230 -1.1367.00E-04-1.3510.00013 Growthanddevelopmentrelatedgenes TFL1Cprotein Vv_10003390 XM_002278819 GSVIVT01010598001 At5g62040 0.9290.000231.2080.00025 RapidALkalinizationFactor-like protein Vv_10004862 XM_002282632 GSVIVT01022118001 -0.9620.00191-1.0670.00235 Cellwall-modifyingenzymes Polygalacturonase-likeproteinVv_10013430 XM_002278894 GSVIVT01019405001 At4g23500 1.3760.000661.3350.00031 Pectatelyase(VvPL1) Vv_10010773 AY043234 GSVIVT01029048001 At1g04680 -1.0140.00031-1.6770.00043 Hormonemetabolismand regulation Auxin-responsiveprotein Vv_10002615 XM_002284085 GSVIVT01018099001 At5g43700 1.080.000320.9460.00047 Auxin-responsiveprotein Vv_10009542 XM_002279919 GSVIVT01021779001 At1g04240 1.7367.00E-051.4150.00045 Gibberellin2-oxidase Vv_10009047 XM_002268137 GSVIVT01012628001 At4g21200 -1.1970.00069-1.0460.00037 Transportersandtrafficking Aquaporin(TIP1;2) Vv_10003817 DQ834702 GSVIVT01033677001 At2g36830 -0.8020.00097-1.2860.00022 Vacuolarpyrophosphatase (vpp2) Vv_10000514 AJ557256 GSVIVT01012841001 At1g15690 -0.9970.00018-0.9110.00048 Miscellaneous Homeoboxleucinezipper protein Vv_10004955 XM_002262914 GSVIVT01027407001 At3g61890 -1.0650.00029-1.0763.00E-04 Heavy-metal-associated domain-containingprotein Vv_10002809 XM_002277832 GSVIVT01025598001 At5g02600 -0.9750.00029-0.950.00046Guillaumie etal BMCPlantBiology 2011, 11 :165 http://www.biomedcentral.com/1471-2229/11/165 Page12of27

PAGE 13

Table6Differentiallyexpressedgenes(P?
PAGE 14

Gewrztraminercultivar.Thus,VvValCSmayplayakey roleinflavorandaromavolatileproductionofatleast twoaromaticwhitegrapevinecultivars;andthisindependentlyofclimaticconditionsandvintages.Pathogenesis-relatedgenesFivegenesrelatedtopathogenattackresponseswere identifiedasdifferentiallyexpressedbetweenTH+10 andTHphases(Table6).Amongthem,thegenes encodingtwoPR-1(AJ536326,XM_002274239),a b 1,3-glucanase(PR-2;AF239617)andathaumatin-like protein(PR-5;XM_002282994)displayedsimilartranscriptprofilesandwereup-regulatedattheTH+10 stage(versustheTHperiod).Aputative leucine-rich repeat ( LRR ;XM_002263817)genewasdown-regulated. Ingrapevineberry,somePRgenesareexpressedata constitutivelevelthroughoutberrydevelopmentwhereas othersareonlyinducedatthevraisonstage,forexamplesomeofgraperipening-inducedproteins(GRIP) [64].AmongthePRproteins,thesubfamilyPR-1is comprisedoflow-molecular-weightproteinsof unknownbiochemicalfunction,butmaybeinvolvedin theresponsetoenvironmentalstresses[32]. Thetranscriptlevelofa b -1,3-glucanase(AF239617) wasup-regulatedattheTH+10stagecomparedwiththe THsamples.The b -1,3-glucanasesrepresentoneofthe mostinvestigatedfamilies ofPRproteinsingrapevine [55,65,66].Thus,isozymesofglycosylhydrolasefamily 17hydrolyze b -1,3-glucanpolysaccharidesfoundinthe cellwallmatrixofplantsandfungi,enablingtheseplant enzymestofulfilldiversebio logicalfunctionsinplant defenseandplantdevelopment.Ingrapevine,the b -1,3glucanasesareusuallyassociatedwiththeresponseand defensetopathogenattacks.AccordingtoRoyChoudhuryetal.[67], b1,3-glucanasesalsoplayaroleinfruit ripeningand/orsoftening.Duringgrapeberrydevelopmentandinpost-harvest, thepresenceofabundant activePRproteinsinCabern etSauvignonberryskins, especially b -1,3-glucanases,isnotsufficienttoprotect berriesfrompathogeninfection[66].Moreover,the abundanceof b -1,3-glucanaseproteinsintheberryproteomeisnotwellcorrelatedwithenzymaticactivity [66].Inthepresentexperiments,althoughseveralberriesofharvestedbunchesweredamagedbypathogens, especiallyby Botrytiscinerea ,allberriesselectedfor RNAextractionswerehealthy.Itisnotpossibletoconcludeunequivocallyonwhetherthis b1,3-glucanase playsaroleduringthelatestageoffruitripeningorin defenseagainstpathogens. Ingrapevine,severalthaumatin-likeorosmotin-like proteins(PR-5proteins)we reidentified[68,69]and theirpowerfulanti-fungal activitywasestablished in vitro .Thethaumatin-likeprote in(XM_002282994)upregulatedattheTH+10stagemaybeinvolvedinantifungalresponseand/ortoosmoticadjustment. Inplants,theLRRproteinsmediateprotein-protein interactionandparticipateinmanybiologicallyimportantprocesses,suchashormone-receptorinteractions, trafficking,plantdevelopmentororgandifferentiation [70].Furthermore,theinvolvementofLRRproteinsis essentialinplantdefensea ndresistancetodiseasesor pathogenattacks[70,71].Itcanbehypothesizedthat genesencodingLRRproteinsareinducedorup0 0.020.040.06 0.08 0.1 0.12 0.14 0.160.18 2005 2006 VvValCS relative expression Figure4 Bardiagramof Vitisvinifera(+)-valencenesynthase ( VvValCS )transcriptabundance:acomparisonofqRT-PCRdataof Chardonnaywholebunchanddensimetricallysortedberriesharvestedatthreeripeningstagesin2005and2006 .ThemRNAlevelwas expressedrelativetocontrols(setat1),referencegene EF1a .RT-PCRdataarereportedasmeansSE(errorbars)ofn=3technicalreplicates. DSB,densimetricallysortedberries;TH-7,7-daysbeforetheoreticalharvest;TH,theoreticalharvest;TH+10,10-daysafterharvest;WBB,whole bunchberries. Guillaumie etal BMCPlantBiology 2011, 11 :165 http://www.biomedcentral.com/1471-2229/11/165 Page14of27

PAGE 15

regulatedattheonsetofpathogeninfections.LRRproteinsmayplayaroleinthesignaltransductioncascades whichup-regulatePRgenes.Thedown-regulationof oneLRR,observedattheTH+10stageversustheTH one,couldberelatedtoanegativefeedback.Stress-relatedgenesTheexpressionofthreegenesencodingheatshockproteins(HSP)(XM_002281184,XM_002281358, XM_002281318)isdown-regulatedattheTH+10stage (Table6).TheyaremembersofclassIsmHSPs(small HSP)andshare95%identity.Inplants,thesmHSPsare induceduponstressandplanttolerancetostress, includingdrought,salin ityorlowtemperatures [reviewedin72].Itwassuggestedthatbesidestheir functionduringthestressresponse,smHSPsare involvedinspecificbiologicalprocessesofplantdevelopment.InadditiontoprotectingphotosystemIIfroma temperature-dependentoxidativestress,thetomato smHSP21alsopromotescolorchangesduringfruit maturation[73].Thethreegrapevine smHSP downregulatedduringthelastphaseofmaturationareclosely relatedtothestrawberry smHSPnjjs4 (U63631)gene [74],whosetranscriptsareaccumulatedinfruits(receptacle),butnotinroots,flowersandleaves[74].The njjs4 geneexpressionisnotonlyorgan-specificbutalso stage-specific.Itsexpressionprofilesuggeststhatnjjs4 smHSPplaysanimportantfunctioninfruitdevelopment,especiallyduringtheearlyfruitripeningprocess. Asimilarrolecanbehypothesizedforthegrapevine berry smHSP XM_002281184,XM_002281358and XM_002281318.Growthanddevelopment-relatedgenesAmongthegeneswithup-regulatedexpressionbetween TH+10andTHstages,thepresenceofthe VvTFL1C and RapidALkalinizationFactor-like ( RALF-like )genes, potentiallyinvolvedinplantdevelopment,canbehighlighted(Table6). The FLOWERINGLOCUST/TERMINALFLOWER1 ( FT/TFL1 )genefamilyencodesproteinswithsimilarity tophosphatidylethanolaminebindingproteinswhich functionasfloweringpromotersandrepressors[75].The FTandTFL1proteinsdisplayoppositefunctionalroles. VvFT transcriptismainlyexpressedininflorescencesand berries;itsroleinpromotingfloweringhasbeendemonstrated,butitsroleinfruitdevelopmentremainsunclear [76].Carmonaetal.[75]haveinvestigatedthegene expressionpatternsof FT/TFL1 genefamilyingrapevine. The VvTFL1C transcriptlevelisinagreementwitharole ofthisgeneinvegetativedevelopmentandmaintenance ofmeristemindetermination.Moreover, VvTFL1C mRNAisweaklydetectedduringthephaseIIIofberry developmentcorrespondingtothematurationperiod. However,theroleandespeciallytheup-regulationofthis geneattheTH+10stageremainstobeunderstood. TheRapidALkalinizationFactor(RALF)proteinsare smallpeptideswhichwereinitiallyassociatedwithplant woundordefenseresponses.However,recentstudies showtheinabilityof RALF genestobeinducedby pathogensorstresselicitorsandsuggestthatRALF couldplayotherroles inplanta [77].Thecharacterizationof RALF-like genesfrom Solanumchacoense supportstheviewofadevelopmentalroleforthis multigenicfamilyinplants[77].The ScRALF3 gene from Solanumchacoense isthemosthomologous sequencetothegrapevine RALF-like gene (XM_002282632).The ScRALF3 geneappearedtobe expressedalmostexclusively inovarytissuesandfruits whereitstranscriptsbecamelessabundantduringfruit maturation.Theexpressionprofileof ScRALF3 isconsistentwiththegrapevine RALF-like one.Cellwall-modifyingenzymesCellwalldisassemblyandmodificationstothepectin fractionaresomeofthemostapparentchangesthat occurinthecellwallduringtheripeningprocess[78]. Duringgrapevineberryripening,theprogressivedepolymerisationofcellwallpectin structureoccursthrough theactionofpolysaccharidehydrolasesincludingpolygalacturonases(PG).PG,animportantpectolyticglycanase,istheprimaryenzymeplayingasignificantrolein pectindissolution invivo .Intheskinofdeveloping grapevineberries, VvPG1 transcriptslevelscorrelate withberrysoftening,and VvPG1 and VvPG2 transcript levelsincreaseduringtheskinripening[42].Table6 revealsshowsthatagene(XM_002278894)encodinga putativePG-likeproteinisup-regulated.Todate,data availableaboutthecontributionofPG-likeproteinsduringthelaststepsoffruitripeningprocessarescarce. Amongthecellwall-modifyingenzymes,thepectate lyases(PL,EC4.2.2.2)alsopossessapectinolyticactivity.Theycatalyzetheeliminativecleavageofde-esterifiedpectinandgenerateoligosaccharideswith unsaturatedgalacturonosylresidues. Variousstudiesrelatedtobiochemicalandphysiologicalchangesoccurringduringthesofteningandripening ofclimacteric(mango[79])andnon-climactericfruits (grape[47],strawberry[80]),suspectedaroleforpectate lyasesinpectindegradationthroughoutpulpsoftening andfruitripening.DuringChardonnayripening,the grapevine VvPL1 gene(AY043234)issignificantlydownregulatedattheTH+10stagecomparedtotheharvest phase.Nunanetal.[47]previouslyshowedasimilar expressionpatterninMus catGordoBlancoripening berries.Ahighlevelof VvPL1 mRNAwaspresentduringthematurationprocess,particularlyatthevraison, followedbyaprogressivedecreaseof VvPL1 transcript leveluntilover-maturationphase[47].Furthermore,the VvPL1 geneishomologoustothemango MiPel (AY987389)[79]andstrawberry plC (AF339025)[80]Guillaumie etal BMCPlantBiology 2011, 11 :165 http://www.biomedcentral.com/1471-2229/11/165 Page15of27

PAGE 16

genes.Theonsetofmangosofteningandripeningis closelyrelatedtoanincreaseinthe MiPel PLgene expression,PLactivityandpe ctinsolubilization[79]. Takentogether,thesedatasuggestacrucialroleof VvPL1 geneduringtheberryripeningofwhitegrapevinecultivars.HormonemetabolismandregulationAmongthehormone-relatedgenes,onlytwogenesassociatedwithauxinandgibberellicacidmetabolismand signalingweredifferentiallyexpressedbetweentheTH +10andTHharveststages,i.e.an auxin-responsive gene anda gibberellin2-oxidase1 gene(Table6). Auxinsareknowntomediatetheonsetofberrydevelopmentingrapevine[2,81].M oreover,indole-3-acetic acid(IAA)contentreachesitsmaximalleveljustafter anthesisandthendeclinestoverylowlevelsintheripe fruit[2,82].Two auxin-responsive genes (XM_002284085,XM_002279919)homologoustothe cotton Gbiaa-re ,whichisamemberofplant AUX/IAA genefamily[83]wereidentified.Itcanbehypothesized thatthesegrapevineauxin-responseproteinsactasactivatorsorrepressorsofgenesmediatingthevarious auxinresponses.Incotton,Gbiaa-reexhibitsconserved integrateddomainsofthe AUX_IAA,AUX/IAAfamily andtheexpressionof Gbiaa-re geneisinduciblebyIAA [83].Yangetal.[84]highlightedtheputativefunctionof thisgene,whichwasconsideredasatranscriptionfactor,duringcellwallregenera tionincottonprotoplasts. Surprisingly,thetwograpevine auxin-responsive genes areup-regulatedattheTH+10stagecomparedwiththe THstage,whereasIAAcontentisverylowattheendof berryripening[82]. One GA2-oxidase geneinvolvedinGAbiosynthesisis down-regulatedinberriesharvestedattheTH+10stage comparedwiththeberriesharvested10daysbefore (Table6).Intheliterature,itwashypothesizedthatthe GA2-oxidaseoxidizestheprecursorsofbioactiveGAs andplaysakeyroleindeterminingorregulatingthe amountsofactiveGAsinplants[85].Thecharacterizationofagrapevinegibberellicacid(GA)dwarfmutant, providedgeneticevidencethatGAsinhibittheflowering ingrapevine[86].However,itsfunctioninberryripeningremainstobetested.TransportersandtraffickingTwodistinctprimaryprotonpumps,theH+-transportingadenosinetriphosphatase(V-ATPase)andH+-translocatinginorganicpyrophosphatase(V-PPase)are localizedintheplantvacuolarmembrane.Theiractivity createsaprotonelectromotiveforceallowingthesecondaryactivetransportofi norganicions,sugarsand organicacids.Ingrape,Terrieretal.[87]andVenteret al.[88]alreadyidentifiedandcharacterizedtwoisoforms ofthe V-PPase genenamed VVPP1 and vpp2 respectively.Duringthegrapevineberryripening,theV-PPase activityapparentlyincreasesinparallelwiththetranscriptlevelsof vpp2 and VVPP1 [87,88].Theexpression patternof Vpp2 isalsomodulatedbyabioticstresses suchascold[88].Inthepresentstudy,thetranscript levelof vpp2 geneisdown-regulatedinChardonnaycultivarattheTH+10stageincomparisonwiththetheoreticalharveststage(TH)(Table6).Thisresultcouldbe inagreementwithapotentialreducedV-PPaseactivity 10-daysaftertheoreticalharvestdate(TH+10). Inourexperiments,asimila rexpressionpatternwas shownfortheaquaporin TIP1;2 (DQ834702)gene, encodingawaterchannelprotein.Thisconfirmsand extendsearlierdatashowingthattheexpressionof VvTIP1;2 isdown-regulatedduringCabernetSauvignon berryripening[56].AssuggestedbyTyermanetal.[89], aquaporinsmightalsoplayaroleintheregulationof berryhydraulicconductance,especiallybetweenvraison andharvestwhenadrasticreductionofberryhydraulic conductanceoccurs. Insummary,thepatternofallthegenesdifferentially expressedbetweentheTHandTH-7stagesand betweentheTH+10andTHstagescanbeconsidered asanindicatoroftheoptimalharvestdatefortheChardonnaycultivar.Takentogether,thesegenesconstitute asetofpotentialripeningindicatorsdistinguishingthe optimalharvestdatefromunder-maturationandovermaturationphases. Itisnoteworthythatamongthedifferentially expressedgenes,onlytwotranscriptionfactors(abZIP (XM_002285275)andaTCP(XM_002272192),Table5) werefound,andweredown-regulatedbetweentheTH andTH-7stages.Theothergenesencodedforenzymes orstructuralproteins.Thissuggeststhatnomajor reprogrammingoftranscripti onpatternsoccursatthe endoftheripening. Unfortunately,theseexp ressionprofilescannotbe comparedandvalidatedtotheotherlarge-scaleexpressionprofilingstudiesperformedtoanalyzetranscription changesduringberrydevelopmentandripening[6-8]. Indeed,theTH-7,THandTH+10stepsofberryripeninghaveneverbeenusedtogethertoinvestigatethelast stagesofgrapevineripening.Moreover,theintervals usedherebetweentwosamplingtimes(seventoten days)aremuchshorterthanthoseusedinpreviousstudies[6-8].Isthereanindicatorofripeningstatusspreadingduring Chardonnayberryripening?AttheTHstageincomparisonwiththeTH-7stage,the transcriptlevelofthegeneencodingaputativeS-adenosyl-L-methionine:salicylicac idcarboxylmethyltransferase(VvSAMT,XM_002262640)isdown-regulatedin DSBcorrespondingtothemostrepresentativedensityof agivenharvestdate(Table7).Thesamegeneisdown-Guillaumie etal BMCPlantBiology 2011, 11 :165 http://www.biomedcentral.com/1471-2229/11/165 Page16of27

PAGE 17

Table7 VvSAMT geneexpression(P<0.05, 1.75-fold)inChardonnaygrapevineberriesallalongtheinvestigatedripeningperiodsofthe2005and2006 growingseasons.PutativefunctionGrape Microarray Accession Number (Vv_#) Grape Nucleotide Accession Number (mRNA) GrapeGene Accession Number (GSVIVT#) Most Homologous Arabidopsis Sequence WBB average ratio (THvsTH-7) pvalue WBBaverage ratio (TH+10vsTH) pvalue DSB average ratio (THvsTH-7) pvalue DSBaverage ratio (TH+10vsTH) pvalue S-adenosyl-L-methionine: salicylicacidcarboxyl methyltransferase (VvSAMT) Vv_10000965XM_002262640GSVIVT00024874001At3g21950NSNS-0.8990.00325-0.9320.00223NSNSRatiovaluesarepresentedaslog2.DSB,densimetricallysortedberries;NS,nonsignificantvalues;TH-7,7-daysbeforetheoreticalharvest;TH,theoreticalharvest;TH+10,10-daysafterharvest;WBB,wholebunch berries.Guillaumie etal BMCPlantBiology 2011, 11 :165 http://www.biomedcentral.com/1471-2229/11/165 Page17of27

PAGE 18

regulatedonlyattheTH+10stageincomparisonwith thetheoreticalharveststage(TH)inWBB(Table7). Down-regulationof VvSAMT isthusdetectedearlierin DSBthaninWBB.Itcanbehypothesizedthatthisgene isanearlyindicatorforecastingbunchripening.A SAMTenzymeisresponsiblefortheformationof methylsalicylatewhichispartofsecondarymetabolites andespeciallyofvolatilemethylesters[90].Methylsalicylatebelongstoplantfragrantcompoundsandcontributestofloralscentandflavoringredientsfoundin fruits.Methylsalicylate, andasaconsequenceSAMT arealsothoughttoplayaroleininter-andintraplant communicationsduringtheplantdefenseagainstpathogeninfections.ThesefunctionsoftheSAMTmultigenic familywereassignedfollowingdetailedbiochemicaltesting[90,91].Ourdatacharacterizethefirstassociationof a SAMT genewiththelastphaseofberryripening.In Chardonnay,thespecificexpressionpatternobserved maybemorerelatedtoaslowingdownofflavorcompoundsynthesis/accumulationthananinvolvementof this VvSAMT geneinresponsetobioticstress.Although somebunchessufferedpathogenattacksinthevineyard attheTH+10,thesamplesusedformicroarrayanalysis wereselectedfreeofpathogens.ValidationofsomeChardonnayripeningindicatorswithin anothercultivarItisinterestingandimportanttodeterminewhetherthe geneswhichareconsistentlyaffectedduringthelate stagesofChardonnay(whitecultivar)ripeninginChampagnevineyard(France)arealsoaffectedforaredvarietygrownundercompletelydifferentconditions.Tothis end,theexpressionprofilesofthosegeneswerestudied inCabernetSauvignon(redcultivar)grownincontrol chambers.Incontrolledr ooms,CabernetSauvignon rootedcuttingsweresubjectedtotwokindsoftemperatureregimeseither30Cdaysand25Cnights(high temperatureregime)or20Cdaysand15Cnights(low temperatureregime).Threeparametersoftheprogressionofberrydevelopmentandripeningi.e.berry volume,percentageofcoloredberriesandtotalsoluble solids(BRIX)wereinvestigated. ThevolumeofCabernetSauvignonberriesfolloweda typicaldoublesigmoidalgrowthcurve,characteristicof thegrapeberrydevelopment[1],whateverthetemperatureregime(Figure5A).However,resultsobservedfor berryvolume,percentageofcoloredberriesandtotal solublesolidsindicatedaprecocityofvraisonand maturationwithhightemperatureregimeinsteadoflow temperatureone. Thevolumeofberriessubjectedtothehightemperatureregime(Figure5A)increasedduringthefirst6 weeksofdevelopmenttoapproximately450mm3,followedbyalagphaseintheberryexpansionuntil9 weekspost-flowering,afterwhichthevolumebeganto increaseagain.Thevolumeofthiskindofberries peakedatweek11(approximately750mm3)andthen decreasedtoafinalvalueof650mm3atharvest.The berriessubjectedto20Cd aysand15Cnightsbegan thevraisonlagphasemorethantwoweeksafterberriessubjectedto30Cdaysand25Cnightsandtheir berryvolumepeakedat16weekspost-floweringto Weeks p ost-flowerin g BRIX Volume (mm3) A C Percent of colored berries B Figure5 ProgressionofCabernetSauvignonberry developmentandripening .Changesofvariousparametersi.e.the berryvolume(A),percentageofcoloredberries(B)andtotalsoluble solids(BRIX)intheberryjuice(C)wereinvestigatedincontrolled rooms.CabernetSauvignonrootedcuttingsweresubjectedto either30Cdaysand25Cnightsor20Cdaysand15Cnights temperatureregimes.DataarereportedasmeansSE(errorbars). Guillaumie etal BMCPlantBiology 2011, 11 :165 http://www.biomedcentral.com/1471-2229/11/165 Page18of27

PAGE 19

approximately500mm3.Soanincreaseof10Cduring daysandnightsinfluencesnotonlytheprecocityofvraisonandmaturationbutalsoberrygrowth. Theonsetofripeninginredgrapesisindicatedbyan increaseinsoftness,sugarcontent,berrysize,andalso bythedevelopmentofskincolor.Inthecurrentexperiments,thecolorationofberriesexposedtohightemperatureregimebeganfourweeks(7weekspostflowering)beforetheberriessubjectedto20Cdaysand 15Cnights(11weekspost-flowering)(Figure5B).For hightemperatureberries,onlytwoweekswerenecessary toobtain95percentcoloredberriesinsteadoffour weeksforlowtemperatureCabernetSauvignonberries. Similarly,totalsolubleso lids(measuredasBRIX)of hightemperatureberriesbegantoincrease8weeks post-floweringandcontinuedtoincrease,reachinga valueof24BRIX17weekspost-flowering(Figure5C). Aspreviouslyevidencedfortheberryvolumeandpercentageofcoloredberries,thetotalsolublesolidsof berriesexposedtothelowtemperatureregimeonly begantoincreasefourweeksaftertheberriesgrown underthehightemperatureregimeandattainedamaximalvalueof22BRIX19weekspost-flowering(Figure 5C).Fromthedata,vraisonisconsideredtooccur between7and8weekspost-fl oweringforberriessubjectedto30Cdaysand25Cnights,andbetween10 and11weekspost-floweringforberriesexposedto20C daysand15Cnights. Takentogetherthecombinationoftheseobservations impliesthatahighertemperaturesubstantiallyhastened berrydevelopment,ripeningandconsequentlymaturation.Thisisingeneralagreementwithexistingknowledgeontheinfluenceoftemperatureongrapevineberry developmentespeciallyonripeningprocess[92]. GeneexpressionanalysiswasperformedonCabernet Sauvignonberriesharvestedfrom7to19weekspostfloweringi.e.fromvraisonof30Cdaysand25C nightsberriestoharvestofberriesexposedto20Cdays and15Cnights.Theexpress ionprofilesofninecandidategenesofChardonnaylateripeningwerequantified andanalyzed: VvCCD4a VvPAL2 VvGolS VvLEA1 VvDIR-like VvHKR miraculin-like gene (XM_002266394), VvValCS and VvSAMT .Amongthem, fourgenes, VvCCD4a VvPAL2 and VvDIR-like ,were up-regulatedthroughoutthelastphasesofChardonnay ripening(TH-7,TH,TH+10).Similarly VvGolS VvLEA1 and VvHKR weredown-regulatedthroughoutthesame lastphasesofChardonnayripening.The miraculin-like genewasdown-regulatedinTHversusTH-7berries and VvValCS wasamemberofthe53genesdifferentiallyregulatedinTH+10versusTHberries. Firstofallthegeneralaspectsofexpressionprofilesof sevenoftheninegenesinvestigatedaresimilarinall cultureconditionsinvestigated,vineyardorcontrolled environmentrooms,andwhatevergrapevinecultivars considered,Chardonnay(whitecultivar)orCabernet Sauvignon(redcultivar). ThroughoutthelateripeningphaseofCabernetSauvignonberries, VvCCD4a and VvDIR-like expression profilesevolveddifferentlydependingonthetemperatureregime(Figures6Aand6E).A20Cdaysand15C nightsregimeinducedanup-regulationof VvCCD4a and VvDIR-like fromvraisontoharvest(asevidenced aboveduringthelaststagesofChardonnayripening). Conversely,a30Cdaysand25Cnightsregimegeneratedanup-regulationof VvCCD4a and VvDIR-like from vraisonuntil13weekspost-flowering,equivalentto22 BRIX,andthenadown-regulationuntilharvest. Theexpressionprofilesof VvGolS,VvLEA1 and VvHKR duringripeningphaseissimilarbetween Chardonnayberriesharv estedfromavineyardand CabernetSauvignonberriessubjectedtoa20Cdays and15Cnightstemperatureregime(Table4andFigures6C,6Dand6F).Inbothexperiments,adownregulationof VvGolS VvLEA1 and Vv HKR expression profiles wasevidenced.Adown-regulationof VvGolS VvLEA1 and VvHKR wasalsoshowninCabernetSauvignonberriesexposedto30Cdaysand25Cnights from9to17weekspost-flowering(Figures6C,6D and6F). Amongtheninegenesinvestigated,the VvPAL2 differsfromtheothersbecauseitsexpressionprofile showednosimilarvariationthroughoutthelaststepsof ChardonnayandCabernetSauvignonripening(Table4 andFigure6B). VvPAL2 maynotbehavethesame betweenCabernetSauvignonandChardonnayberriesas itmaybeinfluencedbyanthocyaninproductioninthe CabernetSauvignonberri escomparedtotheChardonnayones. Similarly,the miraculin-like genecanbedistinguished fromtheothersbecausethroughoutripeningtheexpressionprofileofthisgeneiscompletelytheopposite betweenChardonnayandCabernetSauvignonberries (datanotshown).Thisgenebehavesdifferentlydependingonthecultivarandmayonlybeviewedasacultivar-specificindicatorofripeningas VvPAL2 InCabernetSauvignon, VvValCS wasonlyexpressed duringthelasttwoweeksoftheripeningphase(Figure 6G)andanup-regulationwasnoticedinalltemperature regimesinvestigated(asevidencedinChardonnay samples). Similarly,the VvSAMT genewasdown-regulated throughoutthematurationphaseofthegrapevineberry developmentfromvraisontoharvestdate,inalltemperatureregimesinvestigated,andparticularlyduring thelaststepsofripening(Figure6H). Toconclude,sevenripeningindicatorsi.e. VvCCD4a VvGolS VvLEA1 VvDIR-like VvHKR, VvValCS andGuillaumie etal BMCPlantBiology 2011, 11 :165 http://www.biomedcentral.com/1471-2229/11/165 Page19of27

PAGE 20

Weeks post-flowering VvPAL2 relative expression A Weeks post-flowering VvCCD4a relative expression Weeks post-flowering VvGolS relative expression C Weeks post-flowering VvLEA1 relative expression Weeks post-flowering VvDIR-like relative expression E Weeks post-flowering VvHKR relative expression G Weeks post-flowering VvValCS relative expression Weeks post-flowering B D F VvSAMT relative expression H Figure6 Transcriptabundancesofeightpotentialripeningindicatorsin Vitisvinifera cv.CabernetSauvignon .Theexpressionprofilesof VvCCD4a (A), VvPAL2 (B), VvGolS (C), VvLEA1 (D), VvDIR-like (E), VvHKR (F), VvValCS (G)and VvSAMT (H)wereinvestigatedfromvraisontoharvest. Berriesweresubjectedtoeither30Cdaysand25Cnightsor20Cdaysand15Cnightstemperatureregimes.ThemRNAlevelwasexpressed relativetothelowestlevelofexpressiondetectedinanysampleforeachgene,referencegenes Ubiquitin Actin and EF1a .RT-PCRdataare reportedasmeansSE(errorbars)ofn=3technicalreplicates. Guillaumie etal BMCPlantBiology 2011, 11 :165 http://www.biomedcentral.com/1471-2229/11/165 Page20of27

PAGE 21

VvSAMT evidencedfromtheexperimentsperformedon Chardonnayberriescouldalsobeconsideredaslate ripeningindicatorsofCabernetSauvignon,andwere thusvalidatedforamajorwhiteandamajorredgrapevinecultivar.Someofthemhavetheirexpressionprofilesinfluencedbytemperaturesuchas VvCCD4a, VvDIR-like andtoalesserextent VvLEA1 whilethe temperatureregimehasnoimpacton VvGolS VvHKR VvValCS and VvSAMT expressionprofilesevenifprecocityoffruitmaturatio nwasnoticedwithberries exposedtothehighertemperatureregime. ThetrendsofChardonnayandCabernetSauvignon aresimilardespitetheirdifferentgrowthconditionsand theirdifferentgeneticbackgroundanddespitethefact thatthetimingofthesamplingissomewhatdifferent betweenthesamplesets.Thisshowstherobustnessof thegeneexpressionpatterns.TheCabernetSauvignon seriesgrownatthehigher temperaturereachedamore maturefinalstageofdevelopmentthantheotherseries butthisdoesnotinvalidatethetrendsobservedforthe earlier,andcomparable,periodofdevelopment. Inthecontextofclimaticchangeswhichaltersgrapevinephysiology,berrygrowthripeningandcontent,the identificationofgeneslinkedtothelatestagesofgrapevineripeningisimportant.ConclusionsThelaststepsofgrapevineripeninginvolveacorrelative differentialexpressionofnumerousgenes.However, basedonthecomparisonofwholebunchesvsdensimetricallysortedberries,oftwovintages,andoftwocultivars(whiteandred)growneitherinvineyardor greenhouseconditions,onlyalimitedsetofthetested genes( VvCCD4a VvGolS VvLEA1 VvDIR-like VvHKR VvValCS or VvSAMT) showedaconsistentexpression pattern.Theymightbeuseddirectlyorindirectlyas potentialindicatorsofade quateripeningforoptimal winequality. Directuseofgeneexpressionprofilingisalreadyused commerciallytomonitorpearandappleripening,and thephysiologicalstatusofornamentalandforestspecies (http://www.nsure.eu).Indir ectassaysoftheproteins codedbythesegenesbyspecificantisera,orofthe metabolitessynthesizedbytheseproteins(CCD4,GolS, ValCS,SAMT)mayalsobeenvisaged.Eachofthese methodshaspotentialtechni callimitations.Forexample,theantiseramustbespecific,sensitive,andtheproteintargetedmustbeabundantenough.Metabolite assaysrelyontheassumptionthattheenzymesidentifiedabovearetheonlyoneslimitingtheirsynthesis. Therefore,furtherworkisneededtoinvestigatethese differentpossibilities.Inordertoreachamoreprecise ideaoftheripeningstatus,itmayalsobeusefultocombinearatioordifferenceofactivitiesofbothup-and down-regulatedgenes/protei ns/metabolitesratherthan torelyonlyonup-ordown-regulatedgenes.Moreover, thepreciseratioorsetofindicatorsdeterminedforoptimummaturitywillvarywiththematurityandthestyle ofwinethatthewinemakerwishestomake.MethodsPlantmaterial -SamplesfromvineyardExperimentalmaterialwasharvestedduringthe2005 and2006growingseasonsfrom Vitisvinifera L.cv. Chardonnaygrapevines,grownatthePlumecoqexperimentalstationoftheComitInterprofessionelduVin deChampagne(CIVC)inEpernay(France).Samples werecollectedatthreedifferenttimepointscorrespondingto7-daysbeforetheoreticalharvest(TH-7),theoreticalharvest(TH)and10-daysaftertheoreticalharvest (TH+10)asdefinedbytheviticulturistsofCIVC.For eachdate,threetypesofsampleswerecollectedseparatelyalongagrapevinerowlocatedinthemiddleof theplot.Twelvewholebuncheswerecollectedand pooledalongthisrow,ex ceptonthe3-4firstvine stocksonbothsidesoftherow,inordertominimize differencesbroughtaboutbyphytosanitarytreatments, sunexposureorbunchsize.Themostrepresentative berryclass,basedondensity(i.e.totalsolublesolids),of agivenharvestdatewasselectedforfurthercharacterization.Densitywasestimatedbyflotationofathousand berriesintoarangeofNaClsolutions,eachhavinga decreaseinsalinityof10g/LNaCl(from200to70g/L NaCl).Arepresentativesampleof100sortedberries wassqueezedformeasurementsoftotalsolublesolids( BRIX)andpotentialalcoholdegree(usingahand-held refractometer).Then,abouttwenty-fiveberriesbelongingtothemostrepresentativeberryclasswerepooled. Theywillbereferredtoasdensimetricallysortedberries (DSB).Thetwelvewholebunches(WBB)andthedensimetricallysortedberries(DSB)werefrozenimmediately inliquidnitrogenandstoredat-80Cuntilfurtheruse. Allremainingbunchesoftherowwerethencollected andusedformicrovinificationsandbiochemicalanalysis.-SamplesfromcontrolledenvironmentroomsGrapevineberriessamplesweretakenfrom Vitisvinifera L.cvCabernetSauvignonrootedcuttingsgrownincontrolledenvironmentroomswith16hdaysandtemperatureregimesofeither30Cdaysand25Cnightsor20C daysand15Cnights.Theroo tedcuttingswereencouragedtosetfruitbyremovingleavesfromemergingbuds asdescribedbyMullins[93],andonlyonebunchwas allowedtodeveloponeachvine.Theprogressionofberry developmentandripeningwasfollowedbymeasuring berryvolumeonarandomselectionof100berriesasoutlinedinBossetal.[24]andbyscoringthepercentageof coloredberriesatweeklyintervals.Arandomsampleof50Guillaumie etal BMCPlantBiology 2011, 11 :165 http://www.biomedcentral.com/1471-2229/11/165 Page21of27

PAGE 22

berrieswerecollectedfromeithertemperaturetreatment atfortnightlyintervalsstartingfromwhentheberriesfirst showedsignsofcolorchange,andcontinuingforafurther 10weeksforthe30Cdayand25Cnighttreatedberries andafurthereightweeksforthecoolertreatment.BRIX measurementsweremadeonthese50berriesusinga RFM710digitalrefractometer(BellinghamStanley,TunbridgeWells,Kent,UK)beforetheywerefrozeninliquid N2andstoredat-80Cpendingfurtheruse.DeterminationofphysiologicalparametersInordertoassesstheevolutionofChardonnayberry ripeningandtocorrelateitwithchangesintranscriptomicprofiles,berryweight,totalsolublesolids(BRIX), potentialalcoholcontent(%vol)wereevaluatedatthe threestagesusedforsampling.Totalsolublesolids( BRIX)weremeasuredingrapevinejuice,obtainedby pressingfreshberrieswithasmallhand-crankpress, usingahandheldrefractometer.Thepotentialalcohol contentwasestimatedfromtotalsolublesolids(BRIX).Microvinificationassaysanddeterminationofwine physicochemicalparametersMicrovinificationassayswereperformedfrom160kgof Chardonnaygrapesfollowingthetraditionalwine-makingmethodsofCIVC.Thedecantedmustandbase wineswereanalyzedforconventionalparameters accordingtotherecommendationsoftheInternational OrganizationofVineandWine(OIV)describedinthe Compendiumofinternationalmethodsofwineand mustanalysis[94].SensoryanalysisSensoryevaluationswereperformedtodetermine whetherthereweresignificantdifferencesbetweenbase winesmadewithbunchesharvestedduringthe2005 and2006growingseasonsattheTH-7,THandTH+10 stagesrespectively.Allevaluationswerecarriedoutat theCIVCinEpernay(Champagne,France)usingstandardwine-tastingprocedures.Atriangulartestwas designedtofigureouttheeffectsofharvestdateon basewineforeachvintagestudied.Allthetriangletests performedinthisstudywerecarriedoutinaccordance withtheISOstandardISO4120:2004;criteriaforsignificantdetectionoftheeffectsofharvestdatewerebased onbinomialdistributiontables.Theresultswereconsideredsignificantfor a 0.05.Thetastingpanelwas composedof13professionaltastersusedtoChampagne tastingpanels.Aminimumnumberof8correct responseswasneededtoconcludethataperceptibledifferenceexistsbetweenthetestedwines.Thebasewine usedforChampagnetastingisastillwine.Thesensory qualitiesofbasewineswereevaluatedaround8months aftertheharvestdate.RNAextractionTotalRNAfromChardonnayberrieswasisolatedas previouslydescribedbyReidetal.[95].Pediceland seedsofeachberrywereremovedbeforegrindingin liquidnitrogen.TotalRNAwassubjectedtoDNAdigestionwith5unitsofRNase-freeDNaseI(Promega)for1 hat37C.RNAcontentwasmeasuredat260mmwith aspectrophotometer(GeneQuant Pro,GEHealthcare, Pessacalouette,France)andvisualizedbyelectrophoresison1.5%agarosegels. TotalRNAextractionsfromCabernetSauvignoncultivarwereconductedontheberriesusingthemethodof Bossetal.[24],andfurtherpurifiedtoremovegenomic DNAasoutlinedinD Onofrioetal.[96].MicroarrayAnalysis -Probesynthesis,hybridizationanddataacquisitionThe Vitisvinifera microarrayslidesusedinthisstudy containasetof70-meroligonucleotides(Operon,USA; Array-ReadyOligoSet fortheGrapeGenome,Version1.0)representing14,562unigenes[11].Atotalof 16two-colormicroarrayswereusedtocompareTH-7 andTH+10timepointsfromallsamples(WBB2005, WBB2006,DSB2005,DSB2006)totheirrespective THtimepoint.Adye-swapwasdoneforeach comparison. TheAminoAllylMessageAmp IIaRNAAmplificationKit(Ambion,Huntingdon,UK)wasusedaccording tothemanufacturer srecommendationsforprobelabeling.Probeassemblywasperformedusing600picomol ofCy3-andCy5-labeledaRNA.ThepooledCy3-and Cy5-labeledaRNAswerethenconcentratedonMicroconYM-30columns(AmiconBioseparations,Millipore, Molsheim,France)andmixedwith90 Lofhybridizationsolutioncontaining1:1(v:v)formamide(5XSSC, 0.25%SDS,5XDenhardt ssolution,and1mg/mLdenaturedsalmonspermDNA.Priortohybridization,the DNAwasUV-crosslinkedonthemicroarraychipsina Stratalinkerbyexposureto100MJofUVlight.Followingcrosslinking,theslideswerechemicallyblockedby soakingthemgentlytwicewithup-anddown-movementfor1minin0.2%SDS.Airdriedslideswere hybridizedinanautomatichybridizationstationHS 4800(Tecan,Trappes,France)withawashingprerunin 1XSSC,0.1%SDS,for1min.Theprobesolutionwas boiledfor1minat100C,cooledonicefor2min,stabilizedat37Cfor5minandtheninjectedintothe hybridizationchamber.Slideswereincubatedat37C for16h,withmediumagitation,andthenwashed sequentiallyat30Cin1XSSC,0.1%SDSfor1min,this stepwasrepeatedthreetimes,in0.1XSSC,0.1%SDS for1min,threetimes,andfinallyin0.1XSSCfor30s. Slidesweredriedinthehybridizationstationfor3min, with2.7barsofnitrogengas.MicroarrayslideswereGuillaumie etal BMCPlantBiology 2011, 11 :165 http://www.biomedcentral.com/1471-2229/11/165 Page22of27

PAGE 23

scannedwithaGenepix4000Bfluorescencescanner (AxonInstruments,FosterCity,CA,USA)usingGenepix4.0imageacquisitionsoftwarewithphotomultiplier tubevoltageadjustedto400VforCy3(532nm)and 460VforCy5(635nm).-MicroarraydataprocessingandbioinformaticanalysisSpotflaggingwasdonefir stbyGenepix4.0(missing spots)andthenbyvisualinspectionoftheimagesto excludetheabnormalspots(saturationandheterogeneity).Integratedpixelintensityvaluesforeachspot werecalculatedbyusingGenepix4.0softwareand savedintab-delimitedform at.Medianintensityvalues werenormalizedwithbackgroundsubtractionbyagloballowessmethodfollowedbyaprint-tipmedian method.Differentiallyexpre ssedgeneswereidentified withtheR/BioconductorpackageLimma[97]using linearmodelsandbytakingintoaccounttechnical (dye-swaps)andbiological(years)replicatestoassess thefollowingcontrasts:WBBTHvsTH-7,WBBTH +10vsTH,DSBTHvsTH-7andDSBTH+10vsTH. Foreachhybridization,selectionofdifferentially expressedcloneswasperformedbyfilteringinorderto includegenesthatwereup-ordown-regulated1.75foldatleast(p-value<0.05). The70-mermicroarrayoligonucleotideswerebased onthetranscriptsoftheVvGI( Vitisvinifera Gene Index).Theoligonucleotideswerelinkedtothelatest versionoftheVvGI,version7.0,April17,2010(http:// compbio.dfci.harvard.edu/t gi/cgi-bin/tgi/gimain.pl? gudb=grape)andtothepredictedgenesofthe12X grapevinegenomicsequence(http://www.genoscope.cns. fr/externe/GenomeBrowser/Vitis/)usingaBLAST (blastn)program:allfulll engthhitswereselected.For eachdifferentiallyexpressedgene,themRNAnumber wassearchedusingaBLAST(blastn)programagainst allavailablemRNAsequencesinNCBIdatabase.The dataareavailableinArrayExpress(http://www.ebi.ac.uk/ arrayExpress)undertheaccessionE-MTAB-481.Real-TimePCRanalysisExpressionanalysisfromChardonnaycultivarwasperformedbyqPCRaccordingtoTerrieretal.[98].Atriplicatereversetranscriptionwasperformedon500ng oftotalRNAfromeachdevelopmentstage(RNAsamplesobtainedin2005and2006)usingtheSuperscriptII RTkit(Invitrogen,Fischerbioblock,Illkirch,France) accordingtothemanufacturer sinstructionsinafinal volumeof20 L.Specificannealingoftheoligonucleotideswascontrolledondissociationkineticsperformed attheendofeachPCRrun.ThePCRwasperformedin triplicateon1 LcDNAfromeachsample,usinga model7300SequenceDetectionSystem(AppliedBiosystems,Warrington,UK)andthePowerSYBR-Green PCRMasterkit(AppliedBiosystemsAppleraFrance, Courtaboeuf,France).PCRc onditionsusedconsitedof aninitialdenaturationstepat50Cfor2min,95Cfor 10minfollowedby40cyclesof95Cfor15sec,60C for1min.AllqPCRexperimentswereconductedintriplicateusingprimersdesig nedtoeachgeneofinterest. ThePCRprimercombinationsforeachgenewereas follows: VvCCD4a (XM_002268368):forward5 -CCACACAGCCTTCACTCTCA-3 ,reverse5 -AGGGCCTTT TTGAGAAGCAT-3 VvValCS (FJ696653/AY561843): forward5 -CGTGTATTGCCTTGTGGAAG-3 ,reverse 5 -TATGTGTCCCCTTGCCGTAT-3 .RelativefolddifferenceswerecalculatedbasedonthecomparativeCt methodusingthe EF1-a asaninternalstandard.To demonstratethattheefficienciesofthedifferentgene primerswereapproximatelyequal,theabsolutevalueof theslopeofloginputamountversus Ctwascalculated aspreviouslydescribed[98].Todeterminerelativefold differencesforeachsampleineachexperiment,theCt valueforallthegeneswasnormalizedtotheCtvalue for EF1a (controlgene)andwascalculatedrelativetoa calibratorusingtheformula2Ct[99]. GeneexpressionanalysisduringCabernetSauvignon berrydevelopmentwasperformedbyqPCRusing1 gof totalRNA.cDNAwassynthesisedusing1 gofRNA usingtheSuperScriptIIIfirst-strandcDNAsynthesiskit (Invitrogen,SanDiego,CA,USA)inafinalvolumeof20 L,andthiswasdilutedto200 LbeforeuseintheqPCR reactionmixes.qPCRwasconductedusingaRotor-Gene 2000(version4.2)real-timecycler(CorbettLifeScience, Sydney,Australia)andFastStartSYBRGreenMaster (RocheDiagnosticsGmbH,Mannheim,Germany).The reactionmixescontained70nMofeachprimer,2 Lof cDNA(1:10dilutionofthesynthesisreaction),and1 FastStartSYBRGreenMastermixinafinalvolumeof15 L.PCRconditionsusedconsistedofaninitialdenaturationstepat95Cfor15minfollowedby45cyclesof95C for20sec,58Cfor20secand72Cfor20sec.AllqPCR experimentswereconductedinthreetechnicalreplicates usingprimersdesignedtoeachgeneofinterest(Additionalfile3,TableS3).PrimerproductsfromtheqPCR reactionswereanalyzedbyelectrophoresisandmelt curvestoensurethattheyamplifiedaproductofonesize andweresequencedtoensurethattheymatchedthegene target.Quantificationwas obtainedbyplottingtheCt valuesfromtheberrycDNAsamplesagainstalinearcalibrationcurveobtainedfromtheCtvaluesofserially dilutedcDNAofthetargetgene.Theexpressionvalues werecalculatedusingthestandardcurvesforeachgene. Thesewerenormalizedtothemeanrelativeexpression valuesobtainedusingthreereferencegenes( Ubiquitin Actin and EF1a )intherespectivecDNAsamplesagain usingacalibrationcurvecalculatedfromCtvalues. Expressionlevelsarepresentedrelativetothelowestlevel ofexpressiondetectedinanysampleforeachgene.Guillaumie etal BMCPlantBiology 2011, 11 :165 http://www.biomedcentral.com/1471-2229/11/165 Page23of27

PAGE 24

AdditionalmaterialAdditionalfile1:SupplementaryTableS1 .TableS1.Differentially expressedgenes(P<0.05, 1.75-fold)ofunknownfunctionin Chardonnaygrapevineberriesbetweentheoreticalharvestdate(TH)and oneweekbefore(TH-7)ofthe2005and2006growingseasons.Ratio valuesarepresentedaslog2.DSB,densimetricallysortedberries;TH-7,7daysbeforetheoreticalharvest;TH,theoreticalharvest;WBB,whole bunchberries. Additionalfile2:SupplementaryTableS2 .TableS2.Differentially expressedgenes(P<0.05, 1.75-fold)ofunknownfunctionin Chardonnaygrapevineberriesbetween10-daysaftertheoreticalharvest (TH+10)andtheoreticalharvestdate(TH)ofthe2005and2006growing seasons.Ratiovaluesarepresentedaslog2.DSB,densimetricallysorted berries;TH,theoreticalharvest;TH+10,10-daysafterharvest;WBB,whole bunchberries. Additionalfile3:SupplementaryTableS3 .TableS3.qPCRprimer sequences.PrimersequencesusedforCabernetSauvignonqPCRanalysis andthemRNAaccessionnumberfromwhichthesequencedatawas obtainedforprimerdesign.ThemRNAnumberwassearchedusinga BLAST(blastn)programagainstavailablemRNAsequencesinNCBI database. Listofabbreviations bZIP:basicleucinezipper;BW:basewine;CCD:carotenoidcleavage dioxygenase;CIVC:ComitInterprofessionnelduVindeChampagne;DIRlike:dirigent-like;DMU:decantedmust;DSB:densimetricallysortedberries; EXP:expansin;FT/TFL:FLOWERINGLOCUST/TERMINALFLOWER;GA: gibberellicacid;GolS:galactinolsynthase;GRIP:graperipening-induced protein;GT:glycosyltransferase;HK:histidinekinase;HKR:histidinekinase receptor;HR:hypersensitiveresponse;IAA:indole-3-aceticacid;LEA:late embryogenesisabundantprotein;LRR:leucine-richrepeat;OIV:International OrganizationofVineandWine;PAL:phenylalanineammonia-lyase;PG: polygalacturonase;PL:pectatelyase;PR:pathogenesis-relatedprotein;RALF: rapidalkalinisationfactor;RFOs:raffinosefamilyoligosaccharides;SAMT:Sadenosyl-L-methionine:salicylicacidcarboxylmethyltransferase;SAR:systemic acquiredresistance;SE:standarderror;smHSP:smallmolecularweightheat shockprotein;TCP:TeosinteBranched1;CycloideaandPCF;TH:theoretical harvest;TH-7:7-daysbeforetheoreticalharvest;TH+10:10-daysafter theoreticalharvest;TIP:tonoplastintrinsicprotein;V-ATPase:VacuolarH +-transportingadenosinetriphosphatase;V-PPase:VacuolarH+-translocating inorganicpyrophosphatase;ValCS:(+)-valencenesynthase;Vv: Vitisvinifera ; VvGI: Vitisvinifera Geneindex;WBB:wholebunchberries;XTH:xyloglucan endotransglycosylase/hydrolase. AcknowledgementsandFunding ClaireGermain,DamienleSueur,AlexandraBonomelliandLaurentPanigai ofCIVCaregreatlythankedfortheirhelpinberrycollectionand microvinificationanalysis.VirginieGarciaandJohannPetit(Functional genomicplatformofBordeaux)arethankedfortechnicalsupportduring microarraydataprocessing.WethankCharlesRomieu(UMR1334 AmliorationGntiqueetAdaptationdesPlantesmditerranenneset Tropicales,Montpellier)forconstructivediscussions. ThisworkwasfundedbyADAR Dveloppementdenouveauxdescripteurs dematuritduraisinapplicablesauvignoble projectandmadepossibleby additionalfundingfromtheConseilRgionald Aquitaine(contact20061202002). Authordetails1Univ.Bordeaux,ISVV,EcophysiologieetGnomiqueFonctionnelledela Vigne,UMR1287,F-33140Villenaved Ornon,France.2INRA,ISVV, EcophysiologieetGnomiqueFonctionnelledelaVigne,UMR1287,F-33140 Villenaved Ornon,France.3INRA,UMR1083SciencePourl Oenologie,2Place Viala,34060Montpellier,Cedex01,France.4ComitInterprofessionelduVin deChampagne,5rueHenriMartin,51204Epernay,France.5Flinders UniversityofSouthAustralia,SchoolofBiologicalScience,GPOBox2100,SA 5001,Australia.6CSIROPlantIndustry,WaiteCampus,HartleyGrove,POBox 350,GlenOsmondSA5064,Australia. Authors contributions SG,RFandCCconductedtheresearchanddesignedtheexperimentson vineyardsamples.SGanalyzedthedataanddraftedthemanuscripttogether withSD.CKperformedthemicroarraystatisticalanalyses.NTandJDD contributedtoacquisitionofgeneexpressiondata.CDconductedthe growthroomexperiments,berrymeasurementsandsampling.PKBassisted inthegrowthroomexperimentsandgeneexpressionanalyses,substantially editedthemanuscriptandparticipatedindatainterpretationand organization.SDdesignedandsupervisedtheproject.SDandDM coordinatedtheADARprojectinwhichthisworkwasmanaged.Allauthors read,editedandapprovedthefinalmanuscript. Received:5July2011Accepted:18November2011 Published:18November2011 References1.CoombeBG,McCarthyMG: Dynamicsofgrapeberrygrowthand physiologyofripening. AustJGrapeWineResearch 2000, 6 :131-135. 2.CondeC,SilvaP,FontesN,DiasA,TavaresR,SousaM,AgasseA,DelrotS, GerosH: Biochemicalchangesthroughoutgrapeberrydevelopmentand fruitandwinequality. Food 2007, 1 :1-22. 3.JaillonO,AuryJM,NoelB,PolicritiA,ClepetC,CasagrandeA,ChoisneN, AubourgS,VituloN,JubinC,VezziA,LegeaiF,HugueneyP,DasilvaC, HornerD,MicaE,JublotD,PoulainJ,BruyreC,BillaultA,SegurensB, GouyvenouxM,UgarteE,CattonaroF,AnthouardV,VicoV,DelFabbroC, AlauxM,diGasperoG,DumasV, etal : Thegrapevinegenomesequence suggestsancestralhexaploidizationinmajorangiospermphyla. Nature 2007, 449 :463-467. 4.VelascoR,ZharkikhA,TroggioM,CartwrightDA,CestaroA,PrussD, PindoM,FitzgeraldLM,VezzulliS,ReidJ,MalacarneG,IlievD,CoppolaG, WardellB,MichelettiD,MacalmaT,FacciM,MitchellJT,PerazzolliM, EldredgeG,GattoP,OyzerskiR,MorettoM,GutinN,StefaniniM,ChenY, SegalaC,DavenportC,DemattL,MrazA, etal : Ahighqualitydraft consensussequenceofthegenomeofaheterozygousgrapevine variety. PLoSOne 2007, 2 :e1326. 5.CramerGR,ErglA,GrimpletJ,TillettRL,TattersallEA,BohlmanMC, VincentD,SondereggerJ,EvansJ,OsborneC,QuiliciD,SchlauchKA, SchooleyDA,CushmanJC: Waterandsalinitystressingrapevines:early andlatechangesintranscriptandmetaboliteprofiles. FunctIntegr Genomics 2007, 7 :111-134. 6.WatersDLE,HoltonTA,AblettEM,LeeLS,HenryRJ: Theripeningwine grapeberryskintranscriptome. PlantScience 2006, 171 :132-138. 7.DelucLG,GrimpletJ,WheatleyMD,TillettRL,QuiliciDR,OsborneC, SchooleyDA,SchlauchKA,CushmanJC,CramerGR: Transcriptomicand metaboliteanalysesofCabernetSauvignongrapeberrydevelopment. BMCGenomics 2007, 22 :429. 8.ZenoniS,FerrariniA,GiacomelliE,XumerleL,FasoliM,MalerbaG,BellinD, PezzottiM,DelledonneM: Characterizationoftranscriptionalcomplexity duringberrydevelopmentin Vitisvinifera usingRNA-Seq. PlantPhysiol 2010, 152 :1787-1795. 9.FigueiredoA,FortesAM,FerreiraS,SebastianaM,ChoiYH,SousaL,AcioliSantosB,PessoaF,VerpoorteR,PaisMS: Transcriptionalandmetabolic profilingofg rape(Vitisvinif eraL.)leavesunravelpossibleinnate resistanceagainstpathogenicfungi. JExpBot 2008, 59 :3371-3381. 10.RotterA,CampsC,LohseM,KappelC,PilatiS,HrenM,StittM,CoutosThvenotP,MoserC,UsadelB,DelrotS,GrudenK: Geneexpression profilinginsusceptibleinteractionofgrapevinewithitsfungal pathogen Eutypalata :extendingMapManontologyforgrapevine. BMC PlantBiol 2009, 5 :104. 11.CampsC,KappelC,LecomteP,LeonC,GomesE,Coutos-ThevenotP, DelrotS: Atranscriptomicstudyofgrapevine( Vitisvinifera cv.CabernetSauvignon)interactionwiththevascularascomycetefungus Eutypalata JExpBot 2010, 61 :1719-1737. 12. Gatto P,VrhovsekU,MuthJ,SegalaC,RomualdiC,FontanaP,PrueferD, StefaniniM,MoserC,MattiviF,VelascoR: Ripeningandgenotypecontrol stilbeneaccumulationinhealthygrapes. JAgricFoodChem 2008, 56 :11773-11785. 13.SchwartzSH,TanBC,GageDA,ZeevaartJA,McCartyDR: Specificoxidative cleavageofcarotenoidsbyVP14ofmaizes. Science 1997, 20 :1872-1874. 14.SchwartzSH,QinX,ZeevaartJA: Characterizationofanovelcarotenoid cleavagedioxygenasefromplants. JBiolChem 2001, 6 :25208-25211.Guillaumie etal BMCPlantBiology 2011, 11 :165 http://www.biomedcentral.com/1471-2229/11/165 Page24of27

PAGE 25

15.Mendes-PintoMM: Carotenoidbreakdownproductsthe-norisoprenoidsinwinearoma. ArchBiochemBiophys 2009, 483 :236-245. 16.RazunglesA,GnataZ,PinatelS,BaumesRL,BayonoveCL: Etude quantitativedecompossterpniques,norisoprnoquesetdeleurs prcurseursdansdiversesvaritsderaisin. SciencesdesAliments 1993, 13 :59-72. 17.BaumesRL,WirthJ,BureauS,GunataZ,RazunglesA: Biogenerationof C13-norisoprenoidcompounds:experimentssupportiveforanapocarotenoidpathwayingrapevines. AnalChimActa 2002, 458 :3-14. 18.MathieuS,TerrierN,ProcureurJ,BigeyF,GnataZ: Acarotenoidcleavage dioxygenasefrom Vitisvinifera L.:functionalcharacterizationand expressionduringgrapeberrydevelopmentinrelationtoC13norisoprenoidaccumulation. JExpBot 2005, 56 :2721-2731. 19.AhrazemO,TraperoA,GmezMD,Rubio-MoragaA,Gmez-GmezL: Genomicanalysisandgenestructureoftheplantcarotenoid dioxygenase4family:adeeperstudyin Crocussativus anditsallies. Genomics 2010, 96 :239-250. 20.HuangFC,MolnrP,SchwabW: Cloningandfunctionalcharacterization ofcarotenoidcleavagedioxygenase4genes. JExpBot 2009, 60 :3011-3022. 21.Ribreau-GayonP,DubourdieuD,DoncheB,LonvaudA: Handbookof Enology.Volume1.TheMicrobiologyofWineandVinifications. 2edition. Chichester:JohnWiley&Sons,Ltd;2006. 22.HrazdinaG,ParsonsGF,MattickLR: Physiologicalandbiochemicalevents duringdevelopmentandmaturationofgrapeberries. AmJEnolVitic 1984, 35 :220-227. 23.ChenJY,WenPF,KongWF,PanQH,WanSB,HuangWD: Changesand subcellularlocalizationsoftheenzymesinvolvedinphenylpropanoid metabolismduringgrapeberrydevelopment. JPlantPhysiol 2006, 163 :115-127. 24.BossPK,DaviesC,RobinsonSP: Analysisoftheexpressionofanthocyanin pathwaygenesindeveloping Vitisvinifera L.cvShirazgrapeberriesand theimplicationsforpathwayregulation. PlantPhysiol 1996, 111 :1059-1066. 25.OhS,ParkS,HanK-H: Transcriptionalregulationofsecondarygrowthin Arabidopsisthaliana. JExpBot 2003, 54 :2709-2722. 26.ScheibleW-R,MorcuendeR,CzechowskiT,FritzC,OsunaD,PalaciosRojasN,SchindelaschD,ThimmO,UdvardiMK,StittM: Genome-wide reprogrammingofprimaryandsecondarymetabolism,protein synthesis,cellulargrowthprocesses,andtheregulatoryinfrastructureof Arabidopsisinresponsetonitrogen. PlantPhysiol 2004, 136 :2483-2499. 27.SadoPE,TessierD,VasseurM,ElmorjaniK,GuillonF,SaulnierL: Integrating genesandphenotype:awheat-Arabidopsis-riceglycosyltransferase databaseforcandidategeneanalyses. FunctIntegrGenomics 2009, 9 :43-58. 28.DownieB,GurusingheS,DahalP,ThackerRR,SnyderJC,NonogakiH, YimK,FukanagaK,AlvaradoV,BradfordKJ: Expression of a GALACTINOL SYNTHASE geneintomatoseedsisup-regulatedbeforematuration desiccationandagainafterimbibitionwheneverradicleprotrusionis prevented. PlantPhysiol 2003, 131 :1347-1359. 29.TajiT,OhsumiC,IuchiS,SekiM,KasugaM,KobayashiM,YamaguchiShinozakiK,ShinozakiK: Importantrolesofdrought-andcold-inducible genesforgalactinolsynthaseinstresstolerancein Arabidopsisthaliana PlantJ 2002, 29 :417-426. 30.HaritatosE,AyreBG,TurgeonR: Identificationofphloeminvolvedin assimilateloadinginleavesbytheactivityofthegalactinolsynthase promoter. PlantPhysiol 2000, 123 :929-937. 31.WiseMJ,TunnacliffeA: POPPthequestion:whatdoLEAproteinsdo? TrendsPlantSci 2004, 9 :13-17. 32.vanLoonLC,RepM,PieterseCM: Significanceofinducibledefenserelatedproteinsininfectedplants. AnnuRevPhytopathol 2006, 44 :135-162. 33.SelsJ,MathysJ,DeConinckBM,CammueBP,DeBolleMF: Plant pathogenesis-related(PR)proteins:afocusonPRpeptides. PlantPhysiol Biochem 2008, 46 :941-950. 34.FerreiraRB,MonteiroSS,Piarra-PereiraMA,TeixeiraAR: Engineering grapevineforincreasedresistancetofungalpathogenswithout compromisingwinestability. TrendsBiotechnol 2004, 22 :168-173. 35.RobertN,FerranJ,BredaC,Coutos-ThvenotP,BoulayM,BuffardD, EsnaultR: Molecularcharacterizationoftheincompatibleinteractionof Vitisvinifera leaveswith Pseudomonassyringae pv. pisi expressionof genescodingforstilbenesynthaseandclass10PRprotein. EurJPlant Pathol 2001, 107 :249-261. 36.RalphSG,JancsikS,BohlmannJ: DirigentproteinsinconiferdefenseII: Extendedgenediscovery,phylogeny,andconstitutiveandstressinducedgeneexpressioninspruce( Picea spp.). Phytochemistry 2007, 68 :1975-1991. 37.DavinLB,WangHB,CrowellAL,BedgarDL,MartinDM,SarkanenS, LewisNG: Stereoselectivebimolecularphenoxyradicalcouplingbyan auxiliary(dirigent)proteinwithoutanactivecenter. Science 1997, 275 :362-366. 38.HejtkoJ,RyuH,KimGT,DobesovR,ChoiS,ChoiSM,SoucekP,HorkJ, PekrovB,PalmeK,BrzobohatyB,HwangI: Thehistidinekinases CYTOKININ-INDEPENDENT1andARABIDOPSISHISTIDINEKINASE2and3 regulatevasculartissuedevelopmentinArabidopsisshoots. PlantCell 2009, 21 :2008-2021. 39.WakabayashiK: Changesincellwallpolysaccharidesduringfruit ripening. JPlantRes 2000, 113 :231-237. 40. Ishimaru M,SmithDL,GrossKC,KobayashiS: Expressionofthreeexpansin genesduringdevelopmentandmaturationofKyohograpeberries. J PlantPhysiol 2007, 164 :1675-1682. 41.DottoMC,MartnezGA,CivelloPM: Expressionofexpansingenesin strawberryvarietieswithcontrastingfruitfirmness. PlantPhysiolBiochem 2006, 44 :301-307. 42.Deytieux-BelleauC,ValletA,DoncheB,GenyL: Pectinmethylesterase andpolygalacturonaseinthedevelopinggrapeskin. PlantPhysiol Biochem 2008, 46 :638-646. 43.SterlingJD,AtmodjoMA,InwoodSE,KumarKolliVS,QuigleyHF,HahnMG, MohnenD: FunctionalidentificationofanArabidopsispectin biosynthetichomogalacturonangalacturonosyltransferase. ProcNatlAcad SciUSA 2006, 103 :5236-5241. 44.NunanKJ,SimsIM,BacicA,RobinsonSP,FincherGB: Changesincellwall compositionduringripeningofgrapeberries. PlantPhysiol 1998, 118 :783-792. 45.RoseJK,BennettAB: Cooperativedisassemblyofthecellulose-xyloglucan networkofplantcellwalls:parallelsbetweencellexpansionandfruit ripening. TrendsPlantSci 1999, 4 :176-183. 46.YokoyamaR,NishitaniK: Acomprehensiveexpressionanalysisofall membersofagenefamilyencodingcell-wallenzymesallowedusto predictcis-regulatoryregionsinvolvedincell-wallconstructionin specificorgansofArabidopsis. PlantCellPhysiol 2001, 42 :1025-1033. 47.NunanKJ,DaviesC,RobinsonSP,FincherGB: Expressionpatternsofcell wall-modifyingenzymesduringgrapeberrydevelopment. Planta 2001, 214 :257-264. 48.GlissantD,DdaldchampF,DelrotS: Transcriptomicanalysisofgrape berrysofteningduringripening. JIntSciVigneVin 2008, 42 :1-13. 49.SaladiM,RoseJK,CosgroveDJ,CatalC: Characterizationofanew xyloglucanendotransglucosylase/hydrolase(XTH)fromripeningtomato fruitandimplicationsforthediversemodesofenzymicaction. PlantJ 2006, 47 :282-295. 50.LuW,WangY,JiangY,LiJ,LiuH,DuanX,SongL: Differentialexpression oflitchiXETgenesinrelationtofruitgrowth. PlantPhysiolBiochem 2006, 44 :707-713. 51.NishiyamaK,GuisM,RoseJK,KuboY,BennettKA,WangjinL,KatoK, UshijimaK,NakanoR,InabaA,BouzayenM,LatcheA,PechJC,BennettAB: Ethyleneregulationoffruitsofteningandcellwalldisassemblyin Charentaismelon. JExpBot 2007, 58 :1281-1290. 52.HiraiT,SatoM,ToyookaK,SunHJ,YanoM,EzuraH: Miraculin,atastemodifyingproteinissecretedintointercellularspacesinplantcells. J PlantPhysiol 2010, 167 :209-215. 53.ZhangCK,LangP,DaneF,EbelRC,SinghNK,LocyRD,DozierWA: Cold acclimationinducedgenesoftrifoliateorange( Poncirustrifoliata ). Plant Cell Rep 2005, 23 :764-769. 54. MondegoJM,DuarteMP,KiyotaE,MartnezL,deCamargoSR,De CaroliFP,AlvesBS,GuerreiroSM,OlivaML,Guerreiro-FilhoO,MenossiM: Molecularcharacterizationofamiraculin-likegenedifferentially expressedduringcoffeedevelopmentandcoffeeleafminerinfestation. Planta 2011, 233 :123-137. 55.GrimpletJ,DelucLG,TillettRL,WheatleyMD,SchlauchKA,CramerGR, CushmanJC: Tissue-specificmRNAexpressionprofilingingrapeberry tissues. BMCGenomics 2007, 21 :187.Guillaumie etal BMCPlantBiology 2011, 11 :165 http://www.biomedcentral.com/1471-2229/11/165 Page25of27

PAGE 26

56.FouquetR,LonC,OllatN,BarrieuF: Identificationofgrapevine aquaporinsandexpressionanalysisindevelopingberries. PlantCellRep 2008, 27 :1541-1550. 57.BourgisF,RojeS,NuccioML,FisherDB,TarczynskiMC,LiC,HerschbachC, RennenbergH,PimentaMJ,ShenTL,GageDA,HansonAD: Smethylmethionineplaysamajorroleinphloemsulfurtransportandis synthesizedbyanoveltypeofmethyltransferase. PlantCell 1999, 11 :1485-1498. 58.BuchnerP,StuiverCE,WestermanS,WirtzM,HellR,HawkesfordMJ,De KokLJ: Regulationofsulfateuptakeandexpressionofsulfate transportergenesin Brassicaoleracea asaffectedbyatmosphericH(2)S andpedosphericsulfatenutrition. PlantPhysiol 2004, 136 :3396-3408. 59.TatematsuK,NakabayashiK,KamiyaY,NambaraE: Transcriptionfactor AtTCP14regulatesembryonicgrowthpotentialduringseedgermination in Arabidopsisthaliana PlantJ 2008, 53 :42-52. 60.LundST,BohlmannJ: Themolecularbasisforwinegrapequality a volatilesubject. Science 2006, 311 :804-805. 61.BoidoE,LloretA,MedinaK,FariaL,CarrauF,VersiniG,DellacassaE: Aromacompositionof Vitisvinifera Cv.tannat:thetypicalredwinefrom Uruguay. JAgricFoodChem 2003, 51 :5408-5413. 62.DelucLG,QuiliciDR,DecenditA,GrimpletJ,WheatleyMD,SchlauchKA, MrillonJM,CushmanJC,CramerGR: Waterdeficitaltersdifferentially metabolicpathwaysaffectingimportantflavorandqualitytraitsin grapeberriesofCabernetSauvignonandChardonnay. BMCGenomics 2009, 10 :212. 63.LckerJ,BowenP,BohlmannJ: Vitisvinifera terpenoidcyclases:functional identificationoftwosesquiterpenesynthasecDNAsencoding (+)-valencenesynthaseand(-)-germacreneDsynthaseandexpression ofmono-andsesquiterpenesynthasesingrapevineflowersandberries. Phytochemistry 2004, 65 :2649-2659. 64.RobinsonSP,DaviesC: Molecularbiologyofgrapeberryripening. AustJ grapeWineResearch 2000, 6 :175-188. 65.AzizA,GauthierA,BzierA,PoinssotB,JoubertJM,PuginA,HeyraudA, BaillieulF: Elicitorandresistance-inducingactivitiesofbeta-1,4 cellodextrinsingrapevine,comparisonwithbeta-1,3glucansandalpha1,4oligogalacturonides. JExpBot 2007, 58 :1463-1472. 66.DeytieuxC,GenyL,LapaillerieD,ClaverolS,BonneuM,DoncheB: Proteomeanalysisofgrapeskinsduringripening. JExpBot 2007, 58 :1851-1862. 67.RoyChoudhuryS,RoyS,SenguptaDN: Characterizationofcultivar differencesinbeta-1,3glucanasegeneexpression,glucanaseactivity andfruitpulpsofteningratesduringfruitripeninginthreenaturally occurringbananacultivars. PlantCellRep 2009, 28 :1641-1653. 68.TattersallDB,vanHeeswijckR,HjPB: Identificationandcharacterization ofafruit-specific,thaumatin-likeproteinthataccumulatesatveryhigh levelsinconjunctionwiththeonsetofsugaraccumulationandberry softeningingrapes. PlantPhysiol 1997, 114 :759-769. 69. Davies C,RobinsonSP: Differentialscreeningindicatesadramaticchange inmRNAprofilesduringgrapeberryripening.Cloningand characterizationofcDNAsencodingputativecellwallandstress responseproteins. PlantPhysiol 2000, 122 :803-812. 70.DivartA,ClarkSE: LRR-containingreceptorsregulatingplant developmentanddefense. Development 2004, 131 :251-261. 71.diGasperoG,CiprianiG: Nucleotidebindingsite/leucine-richrepeats, Pto-likeandreceptor-likekinasesrelatedtodiseaseresistancein grapevine. MolGenetGenomics 2003, 269 :612-623. 72.TimperioAM,EgidiMG,ZollaL: Proteomicsappliedonplantabiotic stresses:roleofheatshockproteins(HSP). JProteomics 2008, 71 :391-411. 73.Neta-SharirI,IsaacsonT,LurieS,WeissD: Dualrolefortomatoheatshock protein21:protectingphotosystemIIfromoxidativestressand promotingcolorchangesduringfruitmaturation. PlantCell 2005, 17 :1829-1838. 74.Medina-EscobarN,CrdenasJ,Muoz-BlancoJ,CaballeroJL: Cloningand molecularcharacterizationofastrawberryfruitripening-relatedcDNA correspondingamRNAforalow-molecular-weightheat-shockprotein. PlantMolBiol 1998, 36 :33-42. 75.CarmonaMJ,CalonjeM,Martnez-ZapaterJM: The FT/TFL1 genefamilyin grapevine. PlantMolBiol 2007, 63 :637-650. 76.SreekantanL,ThomasMR: VvFT and VvMADS8 ,thegrapevine homologuesofthefloralintegrators FT and SOC1 ,haveunique expressionpatternsingrapevineandhastenfloweringin Arabidopsis FunctPlantBiol 2006, 33 :1129-1139. 77.GermainH,ChevalierE,CaronS,MattonDP: CharacterizationoffiveRALFlikegenesfrom Solanumchacoense providessupportfora developmentalroleinplants. Planta 2005, 220 :447-454. 78.Marn-RodrguezMC,OrchardJ,SeymourGB: Pectatelyases,cellwall degradationandfruitsoftening. JExpBot 2002, 53 :2115-2119. 79.ChourasiaA,SaneV,NathP: Differentialexpressionofpectatelyase duringethylene-inducedpostharvestsofteningofmango( Mangifera indica var.Dashehari). PhysiolPlant 2006, 128 :546-555. 80.Bentez-BurracoA,Blanco-PortalesR,Redondo-NevadoJ,BellidoML, MoyanoE,CaballeroJL,Muoz-BlancoJ: Cloningandcharacterizationof two ripening-related strawberry( Fragariaananassa cv.Chandler) pectatelyasegenes. JExpBot 2003, 54 :633-645. 81.DaviesC,BossPK,RobinsonSP: TreatmentofGrapeBerries,a NonclimactericFruitwithaSyntheticAuxin,RetardsRipeningandAlters theExpressionofDevelopmentallyRegulatedGenes. PlantPhysiol 1997, 115 :1155-1161. 82.BttcherC,KeyzersRA,BossPK,DaviesC: Sequestrationofauxinbythe indole-3-aceticacid-amidosynthetaseGH3-1ingrapeberry( Vitisvinifera L.)andtheproposedroleofauxinconjugationduringripening. JExp Bot 2010, 61 :3615-3625. 83.SongJ,ChaiY,PangY,ZuoK,FeiJ,LiuX,SunX,TangK: Isolationand characterizationofanIAA-responsivegenefrom Gossypiumbarbadense L. DNASeq 2004, 15 :71-76. 84.YangX,TuL,ZhuL,FuL,MinL,ZhangX: Expressionprofileanalysisof genesinvolvedincellwallregenerationduringprotoplastculturein cottonbysuppressionsubtractivehybridizationandmacroarray. JExp Bot 2008, 59 :3661-3674. 85.HeddenP,PhillipsAL: Gibberellinmetabolism:newinsightsrevealedby thegenes. TrendsPlantSci 2000, 5 :523-530. 86.BossPK,ThomasMR: Associationofdwarfismandfloralinductionwitha grape greenrevolution mutation. Nature 2002, 416 :847-850. 87.TerrierN,SauvageFX,AgeorgesA,RomieuC: Changesinacidityandin protontransportatthetonoplastofgrapeberriesduringdevelopment. Planta 2001, 213 :20-28. 88.VenterM,GroenewaldJH,BothaFC: Sequenceanalysisandtranscriptional profilingoftwovacuolarH+-pyrophosphataseisoformsin Vitisvinifera JPlantRes 2006, 119 :469-478. 89.TyermanSD,TilbrookJ,PardoC,KotulaL,SullivanW,SteudleE: Direct measurementsofhydraulicpropertiesindevelopingberriesof Vitis vinifera L.cv.ShirazandChardonnay. AustJGrapeWineRes 2004, 10 :170-181. 90.RossJR,NamKH,D AuriaJC,PicherskyE: S-Adenosyl-L-methionine:salicylic acidcarboxylmethyltransferase,anenzymeinvolvedinfloralscent productionandplantdefense,representsanewclassofplant methyltransferases. ArchBiochemBiophys 1999, 367 :9-16. 91.NegreF,KolosovaN,KnollJ,KishCM,DudarevaN: NovelS-adenosyl-Lmethionine:salicylicacidcarboxylmethyltransferase,anenzyme responsibleforbiosynthesisofmethylsalicylateandmethylbenzoate,is notinvolvedinfloralscentproductioninsnapdragonflowers. Arch BiochemBiophys 2002, 406 :261-270. 92. Chuine I,YiouP,ViovyN,SeguinB,DauxV,LeRoyLadurieE: Historical phenology:graperipeningasapastclimateindicator. Nature 2004, 432 :289-290. 93.MullinsMG: Testplantsforinvestigationsofthephysiologyoffruitingin Vitisvinifera L. Nature 1966, 209 :419-420. 94.OrganizationofVineandWine: Compendiumofinternationalmethodsof wineandmustanalysis.Paris 2006. 95.ReidKE,OlssonN,SchlosserJ,PengF,LundST: Anoptimizedgrapevine RNAisolationprocedureandstatisticaldeterminationofreference genesforreal-timeRT-PCRduringberrydevelopment. BMCPlantBiol 2006, 6 :27. 96.D OnofrioC,CoxA,DaviesC,BossPK: Inductionofsecondarymetabolism ingrapecellculturesbyjasmonates. FunctPlantBiol 2009, 36 :323-338. 97.SmythGK: LinearmodelsandempiricalBayesmethodsforassessing differentialexpressioninmicroarrayexperiments. StatisticalApplications inGeneticsandMolecularBiology 2004, 3,Article3. 98.TerrierN,GlissantD,GrimpletJ,BarrieuF,AbbalP,CoutureC,AgeorgesA, AtanassovaR,LonC,RenaudinJP,DdaldchampF,RomieuC,DelrotS, HamdiS: IsogenespecificoligoarraysrevealmultifacetedchangesinGuillaumie etal BMCPlantBiology 2011, 11 :165 http://www.biomedcentral.com/1471-2229/11/165 Page26of27

PAGE 27

geneexpressionduringgrapeberry( Vitisvinifera L.)development. Planta 2005, 222 :832-847. 99.LivakKJ,SchmittgenTD: Analysisofrelativegeneexpressiondatausing real-timequantitativePCRandthe2(-DeltaDeltaC(T))Method. Methods 2001, 25 :402-408.doi:10.1186/1471-2229-11-165 Citethisarticleas: Guillaumie etal .: Transcriptionalanalysisoflate ripeningstagesofgrapevineberry. BMCPlantBiology 2011 11 :165. Submit your next manuscript to BioMed Central and take full advantage of: Convenient online submission Thorough peer review No space constraints or color gure charges Immediate publication on acceptance Inclusion in PubMed, CAS, Scopus and Google Scholar Research which is freely available for redistribution Submit your manuscript at www.biomedcentral.com/submit Guillaumie etal BMCPlantBiology 2011, 11 :165 http://www.biomedcentral.com/1471-2229/11/165 Page27of27

PAGE 28

Table S1. Differentially expressed genes (P < 0.05, 1.75 fold) of unknown function in Chardonnay grapevine berries between theoretical harvest date (TH) and one week before (TH 7) of the 2005 and 2006 growing seasons. Grape Microarray Accession Number ( Vv_#) Grape Nucleotide Accession Number (mRNA) Grape Gene Accession Number (GSVIVT#) Most Homologous Arabidopsis Sequence WBB average ratio p value DSB average ratio p value Vv_10003148 XM_002280849 GSVIVT01019636001 At1g64640 1.087 0.00017 1.174 0.000 17 Vv_10004638 EE090683 GSVIVT01033335001 1.015 0.00063 0.998 0.00033 Vv_10005034 BQ794653 GSVIVT01032930001 1.09 0.00073 1.147 0.00031 Vv_10006335 XM_002281318 GSVIVT01016428001 At3g46230 0.906 0.00042 0.852 0.0009 Vv_10006849 XM_002274475 G SVIVT01034396001 At5g23350 0.847 0.00054 0.868 0.00074 Vv_10008539 XM_002285741 GSVIVT01009066001 At4g08950 1.133 0.00037 0.925 0.00092 Vv_10009130 XM_002283124 GSVIVT01033335001 2.311 2.00E 05 2.07 4.00E 05 Vv_10009159 XM_002283088 1.128 0 .00082 0.852 0.00088 Vv_10009224 XM_002273452 GSVIVT01022370001 At3g05270 1.201 0.00063 1.183 0.00014 Vv_10009951 CD799845 GSVIVT01009322001 1.206 0.00069 0.942 0.00273 Vv_10010811 CB340926 3.55 0.00554 7.965 0.00268 Vv_10011725 XM_002283788 GSVIVT01009614001 1.319 0.00011 0.984 0.00355 Vv_10011954 XM_002283772 GSVIVT01025834001 At4g24380 1.156 0.00022 0.889 0.00032 Vv_10012270 BQ794851 GSVIVT01038661001 0.801 0.00397 0.799 0.0023 Vv_10012395 XM_002271414 1.102 0.00015 1.237 0.00 014 Vv_10013006 CA810951 0.845 0.00062 0.873 0.0006 Vv_10013100 XM_002277387 GSVIVT01033335001 0.971 0.00145 0.983 0.00125

PAGE 29

Vv_10013215 BQ794654 GSVIVT01032930001 1.119 0.00153 1.176 0.00069 Vv_10013488 XM_002283088 1.244 0.00066 0.8 92 0.00122 Vv_10013891 XM_002279597 GSVIVT01017099001 At1g79910 0.995 0.00239 1.026 0.00156 Ratio values are presented as log2 DSB, densimetrically sorted berries; TH 7, 7 days before theoretical harvest; TH, theoretical harvest; WBB, whole bunch berr ies.

PAGE 30

Table S2. Differentially expressed genes (P < 0.05, 1.75 fold) of unknown function in Chardonnay grapevine berries between 10 days after theoretical harvest (TH+10) and theoretical harvest date (TH) of the 2005 and 2006 growing seasons. Grape Microarra y Accession Number (Vv_#) Grape Nucleotide Accession Number (mRNA) Grape Gene Accession Number (GSVIVT#) Most Homologous Arabidopsis Sequence WBB average ratio p value DSB average ratio p value Vv_10007815 CD719011 GSVIVT01021149001 At1g58170 1.016 0.0 0044 0.91 0.00084 Vv_10009030 XM_002268045 GSVIVT01021261001 At3g14870 0.811 0.00241 1.102 0.00022 Vv_10010268 XM_002285646 GSVIVT01025391001 1.685 0.00236 1.465 0.00075 Vv_10010851 CD008061 GSVIVT01035428001 1.012 0.01348 0.965 0.00946 Vv_100 11056 CA814196 1.018 0.00786 1.112 0.01018 Vv_10011367 CD710731 1.511 4.00E 04 1.152 0.00018 Vv_10011993 CB341842 GSVIVT01001657001 1.69 0.00032 1.888 0.00339 Vv_10013513 CD009042 GSVIVT01021388001 0.995 0.00169 1.127 0.00018 Vv_10013592 C F605569 GSVIVT01037841001 0.828 0.00371 0.992 0.00124 Vv_10000280 XM_002264134 1.092 0.00298 1.319 0.00127 Vv_10011345 XM_002263043 1.227 1.00E 04 1.465 0.00008 Vv_10000420 CA814462 GSVIVT01016697001 0.941 0.00415 1.086 0.01179 Vv_100 00680 XM_002268392 GSVIVT01005061001 At3g50440 1.595 6.00E 05 1.025 0.00048 Vv_10003589 CB920638 GSVIVT01031160001 0.839 0.00058 1.324 0.00015 Vv_10001062 XM_002265499 1.199 0.01166 0.856 0.01091

PAGE 31

Vv_10010515 CB979613 GSVIVT01010993001 0.946 0.0 0063 1.399 0.00011 Ratio values are presented as log2 DSB, densimetrically sorted berries; TH, theoretical harvest; TH+10, 10 days after harvest; WBB, whole bunch berries.

PAGE 32

Table S 3 qPCR primer sequences. Gene mRNA accession number Forward Primer Reverse Primer VvCCD4a XM_002268368 5 CGCACTGGCCGTATAATTT 3 5 CACAGGGCCTTTTTGAGAA 3 VvDIR like XM_002285641 5 CAATGGAGATGGCACTATTGAA 3 5 TCAAATGAAGTAAGAGCCACCTAA 3 VvG olS XM_002262669 5 AAGCTTGAAGGATCATGACG 3 5 TCCCAACAACAAACTGCTCA 3 VvHKR FJ822975 5 TTCCTTCATCGCTGAGTGGT 3 5 GCAGAATGGTCGAAAAGCTC 3 VvLEA 1 XM_002283966 5 AGCAATCTAAGGACGCTCCA 3 5 ACACGTGCAATCTCCTCCTC 3 VvPAL2 AB015871 5 TGCTGACTGGTGAAAAGGTG 3 5 AATGGAAAATAAAGAGTGTGGAAGG 3 VvSAMT XM_002262640 5 CTGCCCATCAGATGCTCATA 3 5 GCTTATTTAGTAAGACGTACATACG 3 VvValCS FJ696653/AY561843 5 TGGGAAAGTGATGAGGGATAA 3 5 TGCCCCTTGCCGTATTACAA 3 Actin XM_002282480 5 GCATCCCTCAGCACCTTCCA 3 5 AACCCCAC CTCAACACATCTCC 3 EF1 XM_002264364 5 CGGGCAAGAGATACCTCAAT 3 5 AGAGCCTCTCCCTCAAAAGG 3 Ubiquitin XM_002273532 5 GAGTATCAAAACAAAAGC 3 5 AGTAGATGACTGCATTGG 3 Primer sequences used for Cabernet Sauvignon qPCR analysis and the mRNA accession number from which the sequence data was obtained for primer design. The mRNA number was searched using a BLAST (blastn) program against available mRNA sequences in NCBI database.