Effect of DNA-dependent protein kinase on adeno-associated virus replication

MISSING IMAGE

Material Information

Title:
Effect of DNA-dependent protein kinase on adeno-associated virus replication
Physical Description:
Journal Article
Creator:
Choi, Young-Kook
Nash, Kevin
Byrne, Barry J.
Muzyczka, Nicholas
Song, Sihong
Publisher:
PLoS ONE
Publication Date:

Subjects

Genre:
serial   ( sobekcm )

Notes

Abstract:
Background: DNA-dependent protein kinase (DNA-PK) is a DNA repair enzyme and plays an important role in determining the molecular fate of the rAAV genome. However, the effect this cellular enzyme on rAAV DNA replication remains elusive. Methodology/Principal Findings: In the present study, we characterized the roles of DNA-PK on recombinant adenoassociated virus DNA replication. Inhibition of DNA-PK by a DNA-PK inhibitor or siRNA targeting DNA-PKcs significantly decreased replication of AAV in MO59K and 293 cells. Southern blot analysis showed that replicated rAAV DNA formed head-to-head or tail-to-tail junctions. The head-to-tail junction was low or undetectable suggesting AAV-ITR self-priming is the major mechanism for rAAV DNA replication. In an in vitro replication assay, anti-Ku80 antibody strongly inhibited rAAV replication, while anti-Ku70 antibody moderately decreased rAAV replication. Similarly, when Ku heterodimer (Ku70/80) was depleted, less replicated rAAV DNA were detected. Finally, we showed that AAV-ITRs directly interacted with Ku proteins. Conclusion/Significance: Collectively, our results showed that that DNA-PK enhances rAAV replication through the interaction of Ku proteins and AAV-ITRs.
Funding:
Publication of this article was funded in part by the University of Florida Open-Access publishing Fund. This work was supported by National Institutes of Health grants (P01-DK58327, PO1 HL59412, PO1 HL51811) to S.S., N.M. and B.B., and grants from Juvenile Diabetes Research Foundation (JDRF) and Alpha One Foundation to S.S. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Citation/Reference:
Choi Y-K, Nash K, Byrne BJ, Muzyczka N, Song S (2010) The Effect of DNA-Dependent Protein Kinase on Adeno-Associated Virus Replication. PLoS ONE 5(12): e15073. doi:10.1371/journal.pone.0015073

Record Information

Source Institution:
University of Florida Institutional Repository
Holding Location:
University of Florida
Rights Management:
All rights reserved by the source institution and holding location.
Resource Identifier:
sobekcm - AA00004977_00001
System ID:
AA00004977:00001


This item is only available as the following downloads:


Full Text

PAGE 1

TheEffectofDNA-DependentProteinKinaseonAdenoAssociatedVirusReplicationYoung-KookChoi1,KevinNash2¤,BarryJ.Byrne3,NicholasMuzyczka2,SihongSong1*1 DepartmentofPharmaceutics,UniversityofFlorida,Gainesville,Florida,UnitedStatesofAmerica, 2 DepartmentofMolecularGeneticsandMicrobiology,Universityof Florida,Gainesville,Florida,UnitedStatesofAmerica, 3 DepartmentofPediatrics,UniversityofFlorida,Gainesville,Florida,UnitedStatesofAmericaAbstractBackground:DNA-dependentproteinkinase(DNA-PK)isaDNArepairenzymeandplaysanimportantroleindetermining themolecularfateoftherAAVgenome.However,theeffectthiscellularenzymeonrAAVDNAreplicationremainselusive.Methodology/PrincipalFindings:Inthepresentstudy,wecharacterizedtherolesofDNA-PKonrecombinantadenoassociatedvirusDNAreplication.InhibitionofDNA-PKbyaDNA-PKinhibitororsiRNAtargetingDNA-PKcssignificantly decreasedreplicationofAAVinMO59Kand293cells.SouthernblotanalysisshowedthatreplicatedrAAVDNAformed head-to-headortail-to-tailjunctions.Thehead-to-tailjunctionwasloworundetectablesuggestingAAV-ITRself-primingis themajormechanismforrAAVDNAreplication.Inaninvitroreplicationassay,anti-Ku80antibodystronglyinhibitedrAAV replication,whileanti-Ku70antibodymoderatelydecreasedrAAVreplication.Similarly,whenKuheterodimer(Ku70/80)was depleted,lessreplicatedrAAVDNAweredetected.Finally,weshowedthatAAV-ITRsdirectlyinteractedwithKuproteins.Conclusion/Significance:Collectively,ourresultsshowedthatthatDNA-PKenhancesrAAVreplicationthroughthe interactionofKuproteinsandAAV-ITRs.Citation: ChoiY-K,NashK,ByrneBJ,MuzyczkaN,SongS(2010)TheEffectofDNA-DependentProteinKinaseonAdeno-AssociatedVirusReplication.PLoS ONE5(12):e15073.doi:10.1371/journal.pone.0015073 Editor: ImmoA.Hansen,NewMexicoStateUniversity,UnitedStatesofAmerica Received July26,2010; Accepted October19,2010; Published December20,2010 Copyright: 2010Choietal.Thisisanopen-accessarticledistributedunderthetermsoftheCreativeCommonsAttributionLicense,whichpermitsunrestricted use,distribution,andreproductioninanymedium,providedtheoriginalauthorandsourcearecredited. Funding: ThisworkwassupportedbyNationalInstitutesofHealthgrants(P01-DK58327,PO1HL59412,PO1HL51811)toS.S.,N.M.andB.B.,andgrantsfrom JuvenileDiabetesResearchFoundation(JDRF)andAlphaOneFoundationtoS.S.Thefundershadnoroleinstudydesign,datacollectionandanalysis,d ecisionto publish,orpreparationofthemanuscript. CompetingInterests: N.M.isaninventorofpatentsheldbytheUniversityofFloridarelatedtorecombinantAAVtechnology.Healsoownsequityinagene therapycompany(AGTC)thatiscommercializingAAVforgenetherapyapplicationsandservesontheirBoardofDirectors.Hereceivesnomonetary compensationfromAGTCoranyothercommercialentity.Thisdoesnotaltertheauthors’adherencetoallthePLoSONEpoliciesonsharingdataandmater ials. *E-mail:shsong@ufl.edu ¤Currentaddress:MolecularPharmacologyandPhysiology,ByrdAlzheimerInstitute,CollegeofMedicine,UniversityofSouthFlorida,Tampa,Flor ida,United StatesofAmericaIntroductionDNA-PKisanuclearserine/threonineproteinkinasethat consistsofa460kDacatalyticsubunit(DNA-PKcs)anda heterodimer(Ku70andKu80).DNA-PKplaysimportantroles inDNArepairandV(D)Jrecombinationthroughnonhomologous endjoining(NHEJ).WhenDNA-PKencountersDNAlesions suchasDNAdoublestrandbreak(DSB)damagebyionizing radiation,Ku70/80bindswithhighaffinitytoDNAends independentoftheirendsequenceorstructure[1,2,3].TheKu heterodimerrecruitsDNA-PKcstoformanactiveDNA-PK holoenzyme.LigaseIV/XRCC4interactswithDNA-PKonDNA ends,whichleadstoNHEJ[4,5].Severalproteinsincluding Mre11/Rad50/Nbs1andArtemisareinvolvedinthisprocess [6,7].ActivityofDNA-PKcsmayberegulatedbyautophosphorylationofDNA-PKcsatsevenputativephosphorylationsites includingThr2609andSer2056[8,9].Cellsoranimalslacking DNA-PKfunctionsaredeficientinaprotectiveresponseto ionizingradiationandvariousradiomimeticagents[10,11].DNAPKisapotentialtargetproteininmanycancertherapeuticssince inhibitorsofDNA-PKcanselectivelysensitizetumorcellsto ionizingradiation.Wortmannin,aninhibitorofPI3-kinase, inhibitsDNA-dependentproteinkinaseandsensitizescellsto ionizingradiation(IR)[12,13].Inaddition,wortmannindirectly bindstothekinasedomainofDNA-PKcsandinhibitsthefunction ofDNA-PKcsnoncompetitively[14].DNA-PKisasensor moleculethatdeterminesthecellularfatesbyregulatingcellular proteinsrelatedwithcellcycles,DNArepair,andapoptosis [9,15,16,17].Paradoxically,theKu70/80complexcanalsoinhibit nonhomologousendjoiningwhenitbindstothetelomere complex,shelterin[18]. Adeno-associatedvirus(AAV)isanonpathogenichuman parvovirusthatcontainsalinearsingle-strandedDNA(ssDNA) genome[19].TheAAVgenomeencodestwolargeopenreading frames, rep and cap ,thatareflankedby145nucleotideinverted terminalrepeats(ITRs).AAVhasaninterestingbiphasiclifecycle, eitherproductiveinfectioninthepresenceofahelpervirus,e.g., adenovirusorherpessimplexvirus(HSV),orlatentinfectioninthe absenceofahelpervirus.TheITRscomprisetheRepbinding elements(RBEandRBE’)andtheterminalresolutionsite( trs )and formaT-shapedhairpinstructurethatservesastheprimerfor minimaloriginofAAVDNAreplicationandforthesitespecific nickingoftheAAVITRatthe trs thatisrequiredforrepairing covalentlyclosedITRsduringAAVreplication[20,21,22,23].The PLoSONE|www.plosone.org1December2010|Volume5|Issue12|e15073

PAGE 2

largeRepproteins(Rep68orRep78)mediateviralDNA replicationand trs nicking[20,24,25,26,27]andregulateAAV geneexpression[28,29,30,31,32,33,34]andpackaging[35,36]. Rep68orRep78alsoplayimportantrolesforsite-specific integrationofwildtypeAAV2intohumanchromosome 19q13.3qter,namedtheAAVS1locus[37,38,39].AAVDNA replicationrequirestheITR,cellularpolymerases,andhelper virus-derivedfactors.Thep5promoterregionthatregulatesrep geneexpressionisalsoinvolvedinareducedRep-dependent replicationandsite-specificintegrationthatoccursintheabsence oftheITRandreliesontheRBEandcryptic trs inthep5 promoter[40]. InadditiontotheRepproteinsandITRs,AAVDNA replicationrequirescellularproteinsandhelpervirus-derived factorsdependingonthehelpervirusused.InthepresenceofAd, invitro replicationassayssuggestthatfourcellularcomplexesare essentialforAAVDNAreplication;thesearepolymerase d proliferatingcellnucelarantigen(PCNA),replicationfactorC (RFC),andminichromosomemaintenancecomplex(MCM) [25,41,42,43].TheAdandcellularsinglestrandedDNAbinding proteins(DBPandRPA)havealsobeenshowntostimulateAAV DNAreplication invitro [43,44][41].Rephasbeenshownto interactwithallofthesecellularandviralproteins[44,45]. IncontrasttoAdhelperinfections,relativelylittleisknown aboutcellularproteinsinvolvedinAAVreplicationduring coinfectionwithHerpessimplexvirus(HSV).Theherpeshelicase primasecomplexandsinglestrandedDNAbindingproteinare essentialforpromotingAAVDNAreplication invivo ataminimal level[44,46,47].However,expressionoftheHSVDBPand helicase/primaseprovideonly10%ofthenormalDNA replicationseenwithwildtypeherpescoinfection[47].This suggeststhatotherherpesgenesprovideessentialfunctionsand someofthesehaverecentlybeenidentified,(ICP0,ICP4,ICP22) [48].TheherpesDNApolymerase,whichappearstoprovide partialhelperfunctionundersomeconditions[46,48],hasalso beenshowntobecompletelydispensableforrAAVproduction [49],suggestingthatacellularpolymerasemaybenecessaryinthe presenceofHerpescoinfection. WehavepreviouslyreportedthatDNA-PKisinvolvedin determiningthemolecularfateoftherAAVgenomeinskeletal muscleandinliver[50,51].However,theeffectofDNA-PKon AAVreplicationremainselusive.Nashetal(44)haverecently shownthatKu70/80complex,whichformsacomplexwithDNAPK,aswellasDNA-PK,bothformacomplexwithRep78during productiveinfectionsinthepresenceofadenovirus.Theyalso showedthattheDNA-PK/Ku70/Ku80complexstimulatesAAV DNAreplication invitro ,althoughitdoesnotappeartobe essential.InthisreportweexaminetheeffectofDNA-PK/Ku70/ 80onAAVDNAreplicationinthepresenceofHSVandAd.In ordertotesttheeffectofDNA-PKonrAAVreplication,wehave employedboth invivo and invitro replicationassays.We demonstratedthatinhibitionofDNA-PKbywortmanninor siRNAresultedindecreaseofrAAVreplicationinMO59Kand 293cellsinthepresenceofHerpesvirusandin293cellsinthe presenceofAdhelperfunctions.Wealsoconfirmedthatdepletion ofKuproteinsleadtoareductionofAAVreplicationinan invitro assayusingAdinfectedextracts.Results DNA-PKinhibitor,wortmanninInhibitsrAAVreplicationInordertotesttheeffectofDNA-PKonrAAVreplication,we firstemployedwortmannin,aninhibitorofDNA-PK[14].DNAPKpositive( + / + )celllines,MO59Kand293cellswereinfected withrAAV2-UF5withorwithoutrecombinantherpeshelpervirus (containingtheAAV2 rep and cap genes)[52].Cellsweretreated withdifferentconcentrationsofwortmanninandtwodaysafter viralco-infection,episomalDNA(HirtDNA)wasisolated. ReplicatedformsofrAAV-UF5DNAincludingdouble-stranded monomer(about3.4kb),double-strandeddimer(about6.8kb) andhighmolecularweightconcatamers(over13kb)were analyzedbySouthernblotanalysisusing32Plabeledvector specific(CMV)probe.AsshowninFigure1,treatmentof wortmannindecreasedtherAAVgenomereplicationindosedependentmannerinbothcelllines.Nosignificantcytotoxicity wasobservedwhenwortmanninconcentrationwasbelow20mM inMO59Kcells,orbelow5mMin293cells.Wenoticedthatthe conversionofsingle-strandedAAVgenometodouble-stranded monomerorconcatamerswasmoreefficientin293cellsthanin MO59Kcells,probablyduetoE1geneexpressionin293cells [53,54,55].TargetingDNA-PKcsmRNAinhibitsrAAVreplicationTheresultsaboveindicatedthatDNA-PKmayplayarolein enhancingrAAVreplication.However,wortmannininhibitsnot onlyDNA-PK,butalsootherproteinkinases,suchasphosphatidylinositol3-kinase(PI-3).InordertopinpointtheroleofDNAPK,weemployedsyntheticsiRNAtotargetDNA-PKcsmRNA. SyntheticsiRNAat100pmolesignificantlydecreasedmRNA Figure1.rAAVreplicationinMO59Kcellsand293celltreated withwortmannin. HirtDNAwaspurifiedtwodaysafterviralinfection andsubjectedtoSouthernblotanalysis.Allsamplesweretriplicated andhybridizedwith32PlabeledCMVprobe.ReplicatedformsofrAAV includedouble-strandedmonomer(about3.4kb),ordimer(about 6.8kb),andconcatamersDNA(highmolecularweight).Noticethat treatmentofwortmanninreducedrAAVreplicationinadosedependentmannerinbothMO59Kcells(A)andin293cells(B). doi:10.1371/journal.pone.0015073.g001 DNA-PKandAAVReplication PLoSONE|www.plosone.org2December2010|Volume5|Issue12|e15073

PAGE 3

(Figure2A)andproteinlevels(Figure2B)in293cells,while controlsiRNAorLipofectamineTM2000reagentaloneshowedno effect.TheseresultsdemonstratedthatsiRNAwasefficientfor inhibitionofDNA-PKcs.AsshowninFigure3AandB,inhibition ofDNA-PKcsbysiRNAresultedinasignificantdecreaseofrAAV replicationascomparedwithcontrolsiRNAtreatment.The inhibitoryeffectofthesiRNAonrAAVreplicationwasdose dependent(Figure3C).SincetherAAVgenomeislinearand singlestrandedDNA,theviralinfectionmayaffectDNA-PK activity[56,57,58].Toavoidtheunwantedeffectfromviral transductionofrAAVandrHSV[59],weevaluatedrAAV replicationusingtransfecteddoublestrandedvectorandhelper plasmids.Twenty-fourhoursaftersiRNAtransfection,293cells wereco-transfectedwithpDG,whichsuppliesalloftheAdhelper genes,andpUF5.Twodaysafterthetransfection,HirtDNAwas isolatedanddigestedwith Dpn ItoremoveplasmidDNA.Results fromthisstudyagainshowedthatinhibitionofDNA-PK decreasedrAAVreplication(Figure3D).MolecularanalysisofreplicatedrAAVDNAWeandothershavepreviouslyshownthatinlatentinfections, rAAVDNAformsmainlyhead-to-tail(H-T)junctionsandpersists asanepisomeinliverandmusclecells.Cellularenzymes,suchas DNA-PKplayimportantrolesinthejunctionformationand persistenceofAAVDNA[50,51]andwouldbeexpectedto producecircularrAAVgenomeswithheadtotailjunctions. AlthoughAAVisknowntoreplicatebyahairpinpriming mechanism,arollingcirclemechanismhasbeenproposedduring theestablishmentoflatentinfections[60,61].Unliketheselfprimingmodel,whichgenerateshead-to-head(H-H)ortail-to-tail (T-T)junctions,therollingcirclemodelgenerateshead-to-tail(HT)junctions.InordertoevaluatethestructuresofreplicatedrAAV junctionandtheeffectofDNA-PKonjunctionformation, wedigestedHirtDNAwithuniquerestrictionenzymes, Xba I (1-cutter), Sac I(2-cutter),and Not I(2-cutter)asshowninFigure4A. Allofthepossiblefragmentsgeneratedfromthesedigestsarelisted inFigure4B.Southernblotanalysisusingtwodifferentprobes showedthatallpredictedfragments(H-H,T-T,freeends)were detected,exceptH-Tjunctions(Figure4C).Thelowor undetectablelevelsofheadtotailjunctionssuggestedAAV-ITR self-primingwasstilltheprimarymechanismforAAVDNA replication.InhibitionofDNA-PKdidnotaffectthetypeofAAV junctionformedduringAAVreplication.InvitroAAVreplicationInordertoconfirmtheobservationthatinhibitionofDNA-PK decreasedrAAVreplicationincells,weemployedapreviously developedinvitroreplicationassaytoexploretheroleofDNA-PK andKu70/80[25,43].Inthisassay,thereactioncontainspurified Rep68,dsAAVDNAtemplatewithcovalentlyclosedendsand nuclearextract(NE)fromadenovirus-infectedHeLacells.Since HeLacellsexpresshighlevelsofDNA-PK,wetestedtheeffectof selectiveinhibitionofeachsubunitoftheDNA-PKcomplexby addinganti-DNA-PKcs,anti-Ku70,oranti-Ku80antibodiesto theHeLaNEbeforestartingtheAAVreplicationreaction.As showninFigure5A,additionofanti-Ku80antibodysignificantly inhibitedrAAVreplication(70%, P 0.05 ),whileanti-Ku70 antibodyshowedamoderatedecreaseofrAAVreplication (33%, P=0.074 ).However,wedidnotobserveinhibitionof AAVreplicationusinganti-DNA-PKcsantibodies(Ab-23198–4127orAb-4cocktail).Inordertoruleoutanon-specificeffectofthe antibodiesonAAVreplication,weperformedtheassaywithHeLa nuclearextractsthathadbeendepletedforDNA-PKcsorKu heterodimer.SpecificdepletionofDNA-PKcsbyanti-DNA-PKcs Ab-4CocktailandKuproteinsbyanti-Ku70/80(Ku-Ab3)was observedbyWesternblotting(Figure5C).AsshowninFigure5D and5E,depletionofKu70/80decreasedAAVreplication ( P 0.05 byone-taileddistribution),whiledepletionofDNA-PKcsdidnot.Theresultsfromthese invitro replicationstudies confirmedthepreviousreportthatKu70/80interactswithAAV Repproteininvivo,andthattheycanenhanceinvitroAAVDNA replicationandpartiallysubstituteforMCMcomplex[45].AAV-ITRsinteractwithKuproteinsInordertotestforadirectinteractionbetweentheAAVITR andDNA-PK,webuiltanAAV-ITRbyannealingandligating threesyntheticoligonuceotides.ThisITRwasthenlinkedtoa magneticparticle(Figure6A),andasexpected,theITRinteracted withRep78(Figure6B,rightpanel).Inaddition,usingtheITR coatedmagneticparticles,wesuccessfullypulleddownand isolatedKu70andKu80proteins(Figure6B,leftpanel).To eliminatethepossibilitythatincompleteITRsorsinglestranded DNAinteractedwiththeKuproteins,wetreatedtheITRcoated beadswithexonucleaseIIItoremoveanypartiallyassembled ITRs.AsshowninFigure6C,exonucleaseIIItreatmentdidnot affecttheinteractionbetweentheAAV-ITRandKuproteins.The interactionwasalsofoundtobeafunctionoftheconcentrationof Kuproteins.Finally,whenfreecompetitorAAV-ITRwasadded tothereaction,lessKuproteinwaspulleddown(Figure6Dright) althoughthestreptavidin-coatedbeadsaloneweeklyinteractwith Ku70(Figure6Dleft).TheseresultsdemonstratedthatKu proteinscandirectlybindtohairpinedAAV-ITRs,eveninthe absenceofRepprotein. Figure2.TargetingDNA-PKcsbysiRNA. 293cellsaretransfected withsiRNA(100pmole)targetingDNA-PKcsmRNAandnon-specifically controlsiRNAusingLipofectamineTM2000.Twodaysaftertransfection, cellswereharvested.(A)RT-PCRforthedetectionofDNA-PKcsmRNA. AmplifiedcDNAfragmentswereseparatedona1%agarosegel.(B) WesternblotforthedetectionofDNA-PKcsproteinusingbeta-actin proteinasaninternalcontrol. doi:10.1371/journal.pone.0015073.g002 DNA-PKandAAVReplication PLoSONE|www.plosone.org3December2010|Volume5|Issue12|e15073

PAGE 4

DiscussionAAVreplicationhasbeenintensivelyinvestigatedandthe contributionsofAAVITRsequencesandRepproteinshavebeen reasonablywelldefined[20,21,22,23,25,62,63,64,65,66,67,68]. However,theeffectsofcellularproteinsonAAVreplicationare notcompletelyunderstood.Althoughtheminimumsetofproteins requiredtoreplicateAAVDNAefficiently invitro hasbeen identifiedforbothHerpesandAdinfectedcells [41,42,43,44,46,47,49,69,70,71],ithasrecentlybeenreported thatRepproteininteractswith188cellularproteins[45].Someof theseRep-interactingcellularfactorsplayimportantrolesin cellularDNAreplicationorrepairandarelikelytohavearolein AAVDNAreplicationaswell.Understandingthesemechanism(s) willenableustoenhancerAAVvectorproductionandtodevelop asafegenedeliverysystem.Inthepresentstudy,wefocusedonthe roleoftheDNA-PKcomplex(DNA-PKcsandKu70/80)inAAV DNAreplication. OurresultsshowedthatreductionofDNA-PKattheproteinor RNAlevelsdecreasedrAAVreplication,suggestingthatoneor morecomponentsoftheDNA-PKcomplexcanenhanceAAV replication. Invivo ,long-terminhibitionofDNA-PKcsby wortmanninandsiRNAreducedrAAVreplicationinboth MO59Kand293cells(Figs.1,2and3),indicatingthatDNAPKcsplaysanimportantroleinrAAVreplication.Furthermore, DNA-PKcssiRNAreducedAAVDNAreplicationwheneither HerpesvirusorAdhelperfunctionswereused(Fig.3).However, whencell-freeextractswereusedinan invitro replicationassay, depletionofDNA-PKcsdidnotaffectrAAVreplicationsuggesting thattheeffectofDNA-PKcsobserved invivo wasindirectly throughactingondownstreamfactors,suchasKuproteins. Indeed,ourresultsshowedthatKu70andKu80,hadacleareffect invitrowhentheyweredepletedbyeitherantibodyprecipitation orantibodyaddition(Fig.5).Finally,weshowedthatthe componentsoftheDNA-PKcomplex,particularlyKu70/80, couldbindtoahairpinnedAAVITR.Becausethemagnetically taggedsubstrateusedinthesebindingstudieshadaDNAendthat wasblockedwithamagneticbead,ourresultsshowedthedirect interactionbetweenKuproteinsandclose-endedAAT-ITR. Theseresultsareconsistentwithobservationsreportedpreviously usingaChIPassay[72].Ourresultsalsoareconsistentwiththe recentreportbyNashetal[45],whoshowedthatpurifiedKu70/ 80couldpartiallysubstitutefortheMCMhelicasecomplexinan AAVDNAreplicationassay.Thisgroupalsoshowedbyantibody Figure3.TargetingDNA-PKcsreducedrAAVreplication. 293cellsweretransfectedwithDNA-PKcsspecificsiRNA(DNA-PKcssiRNA)orcontrol siRNA.Twodaysaftertransfection,cellswereinfectedwithrAAV-UF5andrHSV,ortransfectedwithpUF5andpDG.rAAVreplicationwasevaluatedby SouthernblotanalysisasdescribedinFigure1.(A)EffectofDNA-PKcssiRNAonrAAVreplicationbySouthernblotaftervectorinfection. ConcentrationofDNA-PKcssiRNAandcontrolsiRNAwas100pmole.(B)DensitometryanalysisofdatafromFigureA.**, P 0.001 formonomer;*, P 0.05 fordimerandconcatamerswhencomparedwithcontrolsiRNAgroup.(C)DosedependenteffectofDNA-PKcssiRNAonrAAVDNA replication.(D)EffectofDNA-PKcssiRNAonrAAVaftervectorandhelperplasmidtransfection.Leftpanel,withoutDpnIdigestion;Rightpanelafte r. Note:DpnIdigestionremovestransfectedplasmidDNAandshowsall denovo replicatedrAAVforms(monomer,dimerandconcatamers). doi:10.1371/journal.pone.0015073.g003 DNA-PKandAAVReplication PLoSONE|www.plosone.org4December2010|Volume5|Issue12|e15073

PAGE 5

co-precipitationthatKu70/80formedacomplexwithRep78and 68 invivo thatwasindependentofthepresenceofDNA.Together, theseresultssuggestthattheenhancingeffectofDNA-PKcsthat weobserved invivo wasprobablythroughphosphorylationofKu proteins,andsuggestedthatKuproteinactivatedbyDNA-Pkcs stimulatedAAVreplication invitro intheabsenceofDNA-PKcs. DNA-PKisaDNArepairenzymeconsistingofalargecatalytic subunit(DNA-PKcs),whichhasser/thrkinase,andaheterodimericcomplexconsistingofKu70andKu80[73].TheKu heterodimerassociatestightlywithdoublestrandedDNAbreaks andrecruitsDNA-PKcs,XRCC4andLigaseIVtorepairthe DNAbreakbynon-homologousendjoining[74,75,76].Kualso bindstotelomeresviaahighaffinityinteractionwithTRF1,a componentofthetelomereshelterincomplexandhasarolein maintainingthestabilityoftelomeres[18].Incontrasttoitsrolein DNArepair,whenKubindstelomeres,itpreventstelomereend joining.Finally,Kuhasalsobeenshowntohavea3 9 to5 9 helicase activityandATPaseactivity[77]andtheseactivitiesappeartobe unrelatedtoitsbindingofDNAends. WeandothershaveshownthatDNA-PKplaysanimportant roleinprocessingrecombinantAAVgenomes[51,72,78, 79,80,81].InjectionofrAAVintoscidmice(DNA-PKcsnegative) showedapersistenceoflinearepisomalrAAVDNAcontaining freeendsinmousetissue,incontrasttonormalmice,inwhichall ofthefreeendshadbeenjoinedpredominantlyinaheadtotail fashion[78,79].Thisresultwasconsistentwiththeprimaryroleof theDNA-PKcomplexinNHEJ,andsuggestedthatthis mechanismpromotedrAAVDNAcirculization,akeystepin establishingstabletransduction.Curiously,Zentilinetal[72] showedthatinshorttermcellcultureexperiments(48hrs), transductionwasincreasedinKu80negativecelllinesinthe presenceofhydroxyurea,suggestingthatalternativemechanisms forformingtransducinggenomescanexistintheabsenceofDNA synthesis.Incontrast,theresultsreportedhereshowedthatAAV DNAsynthesisinthepresenceofhelpervirusfunctionsdidnot resultincircularintermediatesorheadtotailjunctions,regardless ofwhetherKu70/86wasactivatedbyDNA-PKcs(Fig5).This suggeststhattheprimaryroleofKu70/80instimulatingAAV DNAreplicationisunrelatedtoitsroleinpromotingNHEJor transduction.Ourresultsareconsistentwiththerecentreportthat AAVreplicationinthepresenceofAdcoinfectionstimulateda DNAdamageresponsethatwasprimarilyduetoDNA-PKcs[58]. GivenitsinhibitionoftelomereendjoininganditsDNA helicaseactivity,wecansuggesttwogeneralmechanismsbywhich Ku70/80mightstimulateAAVDNAsynthesis.First,the interactionwithRepandtheITRmaypreventNHEJofAAV DNAreplicativeintermediates.Thiswouldbeconsistentwiththe findingthattheproteincomplexcontainingtheAdE4orf6and E1b55KproteinstargetstheMre11/Rad50/Nbs1complex (MRN)fordegradation[82].IntheabsenceofthesetwoAd helperfunctionsforAAV(E1b55KandE4orf6),AdDNAforms concatemers,therebyinhibitingAdDNAreplication.TheMRN complexalsolocalizestoAAVreplicationcentersinthepresence ofAdcoinfectionandinhibitsAAVDNAreplicationinthe absenceoftheE4orf6/E1bcomplex[83].Therefore,thehelper functionprovidedbyE1bandE4orf6isbelievedinparttobethe inhibitionofMRNmediatedNHEJduringAAVDNAreplication. BybindingtoAAVITRs,Ku70/80mayalsopreventinteraction oftheITRwithMRN.Furthermore,bybindingtotheRep-ITR complex,Kuitselfmaybepreventedfromrecruitingtheother Figure4.StructureanalysisofreplicatedDNA. (A)MapoftherAAV-UF5vector;X(XbaI),S(SacI),andN(NotI),Twoboldlinesindicatethe positionofCMVandNeoRprobes.(B)AllpossiblegenomesizesgeneratedfromdifferentAAVjunctions.I.F.,internalfragment;H-H,head-to-head;TT,tail-to-tail;H-T,head-to-tail.(CandD)SouthernhybridizationprobedwithCMV(C),andNeoR(D)afterrestrictionenzymedigestionofHirtDNA. doi:10.1371/journal.pone.0015073.g004 DNA-PKandAAVReplication PLoSONE|www.plosone.org5December2010|Volume5|Issue12|e15073

PAGE 6

componentsoftheDNA-PKNHEJpathway.Thus,bindingofKu totheITRandRepwouldinhibitthetwomajorNHEJpathways inmammaliancells. Ku70/80mayalsoplayaroleinstranddisplacementsynthesis. WehaveshownpreviouslythatAAVDNAreplicationcanbe reconstituted invitro withpurifiedproteins,includingRep,pol d PCNAandRFC[41,42].Hereandelsewhere,wehavealsoshown thatreplicationcanbeatleastpartiallyreconstitutedby substitutingKuforMCM[45].Bothproteinshavesimilar3 9 DNAhelicaseactivitiesthatpreferareplicationforkasasubstrate [77,84];thus,bothcouldfunctioninAAVDNAreplicationas stranddisplacementhelicases.Neitherhasactivityonbluntended DNAmolecules[77,84]and,therefore,theinitialmeltingofAAV endsmaybethefunctionofRep,whichcanbindtoaRepbinding elementwithintheITRandunwindtheend[85].Onceanascent forkisestablished,eitherKuorMCMcanloadontothe3 9 strand andunwindtherestoftheITRtoformthehairpinprimer requiredforloadingDNApolymeraseandexecutingstrand displacementsynthesis. Insummary,wehavepresentedevidenceboth invivo and invitro thattheDNA-PKcomplexandinparticularKu70/80stimulates AAVDNAreplicationinthepresenceofbothAdandHerpes coinfection.Wehavealsosuggestedtwopossiblemechanismsthat mightaccountforthisactivityandguidefutureexperiments.MaterialsandMethods CellsandReagentsAhumangliomacellline(MO59K)wasobtainedfromATCC andwasculturedinDMEM/F-12medium(Cellgrow).Human embryonickidney293cells(Microbix)wereculturedinDulbecco’s MinimalEssentialMedium(DMEM).Allmediaweresupplementedwith10%fetalbovineserum(Cellgro),penicillin(100U/ ml)andstreptomycin(100mg/ml).Wortmannin(Sigma)was dissolvedinDMSOat10mMandstoredat 2 80 u C.rAAVtransductionTherAAV2-UF5vectorwasproducedattheUniversityof FloridaGeneTherapyCenterasdescribedpreviously[86].This vectorcontainsgreenfluorescentprotein(GFP)cDNAdrivenby cytomegalovirus(CMV)promoter.ThetiteroftherAAV-UF5 usedinthisstudywas2.5 6 1013physicalparticles/ml(1 6 1012infectiousunit/ml).TotestAAVreplicationfromviralDNA,cells wereinfectedwithrAAV2-UF5at1000particles/cellorcoinfectedwithoutrecombinantHSVhelpervectorwhichcontains AAV rep and cap genes[52].TotestAAVreplicationfromplasmid DNA,cellsweretransfected1.2mgofhelperplasmid(pDG),and 0.8mgofpTR-UF5byusingLipofectamine2000TM(Invitrogen). HirtDNAwaspurifiedtwodaysafterviralinfectionandwasused Figure5.InvitroAAVreplication. (A) Invitro AAVreplicationusingnuclearextract(NE)supplementedwithanti-DNA-PKcsAb-23198–4127(2,*), anti-DNA-PKcsAb-4cocktail(3,**),anti-Ku80(4),anti-Ku70(5),orwithallantibodies(6).(B)DensitometryanalysisofresultfromFigure5A.Supplement ofanti-ku80decreasedAAVreplicationby30%(DpnI-resistantAAVDNA, P 0.05 comparedtoshamcontrol).(C)Westernanalysisshowsthe depletionofDNA-PKcs,andKu70/80.(D)InvitroAAVreplicationusingDNA-PKcs( D -DNA-PKcs)orKu70/80( D -Ku80/70)depletedNE.Relativedensity ofeachtreatment(n=3)isplotted.*P 0.05. doi:10.1371/journal.pone.0015073.g005 DNA-PKandAAVReplication PLoSONE|www.plosone.org6December2010|Volume5|Issue12|e15073

PAGE 7

forSouthernblotanalysistodetectreplicatedformsofAAV genome.ThedensitometicquantificationofAAVgenomeswas performedwithKodakGelImageSoftware.siRNAtransfectionTwodoublestrandedRNAmoleculeswerepurchasedfrom Ambion(Austin,TX).ThesiRNAforDNA-PKcs(5 9 -GAUCGC ACCUUACUCUGUU-3 9 )targetsthesequencesof352base anddownstreamsequencesofhumanDNA-PKcsmRNA[87]. SilencerTMNegativeControl # 2siRNAfromAmbionwhichdoes notinducenonspecificeffectsongeneexpressionwasusedasa transfectioncontrol.293cellsatthenumberof2.5 6 105cells/well wereculturedin6-wellplatesandtransfectedwith100pmoleof siRNAusingLipofectamineTM2000(Invitrogen).Nextday, siRNAtransfectedcellswereinfectedortransfectedtotestAAV replicationasdescribedabove.RT-PCRTotalRNAwasextractedfromsiRNAtreatedcellsusing TrizolTMreagent(Invitrogen)andRT-PCRwasperformedwith AccessTMRT-PCRkit(Promega)using1mgtotalRNA.Primers werederivedfromthecodingregionofDNA-PKcDNA(upstream primer:5 9 -ACTGACACAGACTGCAGATGGAAG-3 9 downstreamprimer:5 9 -AGGGTGGAAAGAAAGAGAAGG TGG-3 9 ).Beta-actinwasusedasacontrol(upstreamprimer:5 9 TCACCATGGATGATGATATCGCCG-3 9 ,downstream primer:5 9 -ACATGATCTGGGTCATCTTCTCGC). SynthesisofthefirststrandcDNAwasperformedat48 u Cfor 45min.ThePCRwereperformedat96 u Cfor1min,56 u Cfor 1minand72 u Cfor2minfor35cycles.TheamplifiedPCR productswerefractionatedona1%agarosegel.WesternblotanalysisForwesternblotanalysis,cellpelletswerelysedinM-PERTMmammalianproteinextractionreagent(Pierce)supplementedwith proteaseinhibitors(leupeptin,pepstatin,aprotinin,antipain,1mg/ mleach)andPMSF(at1mM).Theproteinconcentrationwas determinedusingBCAkit(Pierce).Thirtymicrogramsoftotal cellularproteinswereseparatedon8%SDS-polyacrylamidegel andtransferredontoanitrocellulosemembrane(Amersham).The mouseanti-DNA-PKcs(DNA-PKcsAb-41–4127)ormouseantiKu80(KuAb-2610–705)ormouseanti-Ku70(KuAb-4506–541)(all antibodieswerepurchasedfromNeoMarkers)wasusedtodetect DNA-PKcs,orKu80orKu70respectively.HorseradishperoxiFigure6.AAT-ITRinteractswithKuproteins. (A)constructionofAAV-ITRonamagneticparticle.(B)ITRonmagneticbeadinteractswithRep78 andKuproteins.AAV-ITRwasboundtopurifiedproteinsorHeLanuclearextract(NE)atroomtemperatureor37 u Candthensubjectedtowestern blotanalysisusingantibodiestoDNA-PKcs,Ku80andKu70.Rep78areusedasapositivecontrol.(C)T-shapedclosedITRinteractwithKuproteinsin dose-dependentmanner.AAV-ITRsonthebeadweretreatedwithExonucleaseIIIandincubatedwithdifferentamountofHeLaNE(65mg/ml).TheITR bindingproteinsweresubjectedtowesternblotanalysisforDNA-PKcs,Ku80andKu70.(D)Competitionassay(rightpanel).WhenAAV-ITRonbead wasincubatedwithHeLanuclearextract,freeAAV-ITRwasadded(2.5fold)asacompetitor.Streptavidin-coatedmagneticbeadsandthebeadswith AAT-ITR(leftpanel)servedasacontrolandshowedadditionofAAV-ITRincreasedpulldownofKuproteins. doi:10.1371/journal.pone.0015073.g006 DNA-PKandAAVReplication PLoSONE|www.plosone.org7December2010|Volume5|Issue12|e15073

PAGE 8

dase-conjugatedgoatanti-mouseIgGwasthenusedandthesignal wasdetectedusingECL(Amersham).InvitroAAVreplicationassayInordertoinhibitDNA-PKsubunits,25mg(1ml)ofAdinfectedHeLacellnuclearextractwaspreincubatedwith1mlof specificantibodiesagainsteachsubunitsofDNA-PK(each 200mg/ml)for30minat37 u C.TheAAVDNAreplicationassay wasperformedasdescribedpreviously[25].Briefly,preincubated Ad-infectedHeLacellextractwithantibodieswasincubatedina reactionbuffercontaining30mMHEPES(pH7.5),7mM MgCl2,0.5mMDTT,100mMeachdNTP,25mCiof[a-32P] dATP,4mMATP,40mMcreatinephosphate,1mgofcreatine phosphokinase,0.1mgofNEsubstrateDNA,and1to80Uof Rep68baculovirusextractfor4hat37 u C.Afterincubation,the reactionmixturewastreatedwithProteinaseKandextractedwith phenol/chloroform.DNAwasprecipitatedinethanol.TheDNA wasdigestedwith Dpn ItoremovebacterialDNAandwas separatedby0.8%agarosegel.X-rayfilmwasexposedonadried gel.ImmunodepletionsInordertodepleteDNA-PKsubunits,25mgofAd-infected HeLacellextractwasmixedwith30mlofanti-DNA-PKcs(DNAPKcsAb-4cocktail),anti-Ku70/80(KuAb-3)orcontrolantibody (mouseIgG2aAb-1,Neomarkers)andincubatedat4 u Covernight. Eachreactionwasaddedwith50mlofProteinG-agarose (Calbiochem)andincubatedat4 u Covernight.DNA-PKsubunits interactedwiththeagarosebeadswerepelletedbycentrifugation. Supernatantswereharvestedcarefully.Thisprocedurewas repeatedthreetimes.Thesupernatantwasusedforinvitro AAVreplicationstudiesasdescribedaboveafterconfirmthe DNA-PKdepletionbyWesternblotanalysis.ConstructionofsyntheticAAV-ITRAT-shapedAAVITRwasbuiltbyannealingandligating threesyntheticoligos,ITR1(65-mer):5 9 -pGCTCGCTCACTGAGGCCGCCCGGGCAAAG CCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCA-3 9 ,ITR2(35-mer):5 9 -pGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAA-3 9 ITR3(19-mer):5 9 -pTTGGCCACTCCCTCTCTGCGCGCTC3 9 (Figure6A).ThisITRwasligatedwithbiotinatedoligonucleotides,whichcanbindtostreptavidincoatedmagneticparticles (RocheInc).AssayforinteractionbetweenDNA-PKandAAVITRDNAAAVITRonmagneticbeadwasincubatedwithpurifiedDNAPK(containingDNA-PKcs,Ku80andKu70),HeLanuclear extractorRep78atroomtemperatureor37 u C.Theincubation wasperformedinoneoftwobuffersovernightcontainingeither 25mMHEPES(pH7.5),5mMMgCL2,1mMDTTand1% BSAor20mMHEPES(pH7.6),1mMEDTA,10mMNH4SO4, 1mMDTT,0.2%Tween20and30mMKCL.Afterincubation, themagneticbeadswereheldbyamagnetandwashed3times withthebindingbuffer.AAV-ITRbindingproteinswereeluted out,dialyzedovernightfollowingtheinstructionofthekit,and subjectedtowesternblotanalysis.AuthorContributionsConceivedanddesignedtheexperiments:Y-KCKNNMSS.Performed theexperiments:Y-KCKNSS.Analyzedthedata:Y-KCKNNMSS. Contributedreagents/materials/analysistools:BBNMSS.Wrotethe paper:Y-KCKNBBNMSS.References1.BlierPR,GriffithAJ,CraftJ,HardinJA(1993)BindingofKuproteintoDNA. Measurementofaffinityforendsanddemonstrationofbindingtonicks.JBiol Chem268:7594–7601. 2.GriffithAJ,BlierPR,MimoriT,HardinJA(1992)Kupolypeptidessynthesized invitroassembleintocomplexeswhichrecognizeendsofdouble-strandedDNA. JBiolChem267:331–338. 3.WalkerJR,CorpinaRA,GoldbergJ(2001)StructureoftheKuheterodimer boundtoDNAanditsimplicationsfordouble-strandbreakrepair.Nature412: 607–614. 4.ChenL,TrujilloK,SungP,TomkinsonAE(2000)InteractionsoftheDNA ligaseIV-XRCC4complexwithDNAendsandtheDNA-dependentprotein kinase.JBiolChem275:26196–26205. 5.DrouetJ,DelteilC,LefrancoisJ,ConcannonP,SallesB,etal.(2005)DNAdependentproteinkinaseandXRCC4-DNAligaseIVmobilizationinthecellin responsetoDNAdoublestrandbreaks.JBiolChem280:7060–7069. 6.MaY,PannickeU,SchwarzK,LieberMR(2002)Hairpinopeningand overhangprocessingbyanArtemis/DNA-dependentproteinkinasecomplexin nonhomologousendjoiningandV(D)Jrecombination.Cell108:781–794. 7.MoshousD,CallebautI,deChassevalR,CorneoB,Cavazzana-CalvoM,etal. (2001)Artemis,anovelDNAdouble-strandbreakrepair/V(D)Jrecombination protein,ismutatedinhumanseverecombinedimmunedeficiency.Cell105: 177–186. 8.ChanDW,ChenBP,PrithivirajsinghS,KurimasaA,StoryMD,etal.(2002) AutophosphorylationoftheDNA-dependentproteinkinasecatalyticsubunitis requiredforrejoiningofDNAdouble-strandbreaks.GenesDev16:2333–2338. 9.ChenBP,ChanDW,KobayashiJ,BurmaS,AsaithambyA,etal.(2005)Cell cycledependenceofDNA-dependentproteinkinasephosphorylationin responsetoDNAdoublestrandbreaks.JBiolChem280:14709–14715. 10.ShinoharaET,GengL,TanJ,ChenH,ShirY,etal.(2005)DNA-dependent proteinkinaseisamoleculartargetforthedevelopmentofnoncytotoxic radiation-sensitizingdrugs.CancerRes65:4987–4992. 11.DaidoS,YamamotoA,FujiwaraK,SawayaR,KondoS,etal.(2005)Inhibition oftheDNA-dependentproteinkinasecatalyticsubunitradiosensitizesmalignant gliomacellsbyinducingautophagy.CancerRes65:4368–4375. 12.BoultonS,KyleS,YalcintepeL,DurkaczBW(1996)Wortmanninisapotent inhibitorofDNAdoublestrandbreakbutnotsinglestrandbreakrepairin Chinesehamsterovarycells.Carcinogenesis17:2285–2290. 13.PriceBD,YoumellMB(1996)Thephosphatidylinositol3-kinaseinhibitor wortmanninsensitizesmurinefibroblastsandhumantumorcellstoradiation andblocksinductionofp53followingDNAdamage.CancerRes56:246– 250. 14.IzzardRA,JacksonSP,SmithGC(1999)Competitiveandnoncompetitive inhibitionoftheDNA-dependentproteinkinase.CancerRes59:2581– 2586. 15.WooRA,JackMT,XuY,BurmaS,ChenDJ,etal.(2002)DNAdamageinducedapoptosisrequirestheDNA-dependentproteinkinase,andismediated bythelatentpopulationofp53.EmboJ21:3000–3008. 16.YamaguchiS,HasegawaM,AizawaS,TanakaK,YoshidaK,etal.(2005) DNA-dependentproteinkinaseenhancesDNAdamage-inducedapoptosisin associationwithFriendgp70.LeukRes29:307–316. 17.BhartiA,KraeftSK,GounderM,PandeyP,JinS,etal.(1998)Inactivationof DNA-dependentproteinkinasebyproteinkinaseCdelta:implicationsfor apoptosis.MolCellBiol18:6719–6728. 18.HsuHL,GilleyD,GalandeSA,HandeMP,AllenB,etal.(2000)Kuactsina uniquewayatthemammaliantelomeretopreventendjoining.GenesDev14: 2807–2812. 19.BernsKI(1996)Parvoviridae:TheVirusesandtheirreplication.In:FieldsB,ed. FieldsVirology.Philadelphia,PA:RavenPress.pp2173–2197. 20.ImDS,MuzyczkaN(1990)TheAAVoriginbindingproteinRep68isanATPdependentsite-specificendonucleasewithDNAhelicaseactivity.Cell61: 447–457. 21.BristerJR,MuzyczkaN(1999)Rep-mediatednickingoftheadeno-associated virusoriginrequirestwobiochemicalactivities,DNAhelicaseactivityand transesterification.JVirol73:9325–9336. 22.BristerJR,MuzyczkaN(2000)MechanismofRep-mediatedadeno-associated virusoriginnicking.JVirol74:7762–7771. 23.WeitzmanMD,KyostioSR,KotinRM,OwensRA(1994)Adeno-associated virus(AAV)RepproteinsmediatecomplexformationbetweenAAVDNAand itsintegrationsiteinhumanDNA.ProcNatlAcadSciUSA91:5808–5812. 24.HermonatPL,LabowMA,WrightR,BernsKI,MuzyczkaN(1984)Geneticsof adeno-associatedvirus:isolationandpreliminarycharacterizationofadenoassociatedvirustype2mutants.JVirol51:329–339. 25.NiTH,ZhouX,McCartyDM,ZolotukhinI,MuzyczkaN(1994)Invitro replicationofadeno-associatedvirusDNA.JVirol68:1128–1138.DNA-PKandAAVReplication PLoSONE|www.plosone.org8December2010|Volume5|Issue12|e15073

PAGE 9

26.WardP,UrcelayE,KotinR,SaferB,BernsKI(1994)Adeno-associatedvirus DNAreplicationinvitro:activationbyamaltosebindingprotein/Rep68fusion protein.JVirol68:6029–6037. 27.WardP,BernsKI(1996)Invitroreplicationofadeno-associatedvirusDNA: enhancementbyextractsfromadenovirus-infectedHeLacells.JVirol70: 4495–4501. 28.BeatonA,PalumboP,BernsKI(1989)Expressionfromtheadeno-associated virusp5andp19promotersisnegativelyregulatedintransbytherepprotein. JVirol63:4450–4454. 29.LabowMA,HermonatPL,BernsKI(1986)Positiveandnegativeautoregulation oftheadeno-associatedvirustype2genome.JVirol60:251–258. 30.PereiraDJ,McCartyDM,MuzyczkaN(1997)Theadeno-associatedvirus (AAV)RepproteinactsasbotharepressorandanactivatortoregulateAAV transcriptionduringaproductiveinfection.JVirol71:1079–1088. 31.PereiraDJ,MuzyczkaN(1997)Theadeno-associatedvirustype2p40promoter requiresaproximalSp1interactionandap19CArG-likeelementtofacilitate Reptransactivation.JVirol71:4300–4309. 32.PereiraDJ,MuzyczkaN(1997)ThecellulartranscriptionfactorSP1andan unknowncellularproteinarerequiredtomediateRepproteinactivationofthe adeno-associatedvirusp19promoter.JVirol71:1747–1756. 33.McCartyDM,ChristensenM,MuzyczkaN(1991)Sequencesrequiredfor coordinateinductionofadeno-associatedvirusp19andp40promotersbyRep protein.JVirol65:2936–2945. 34.WegerS,WistubaA,GrimmD,KleinschmidtJA(1997)Controlofadenoassociatedvirustype2capgeneexpression:relativeinfluenceofhelpervirus, terminalrepeats,andRepproteins.JVirol71:8437–8447. 35.DubielzigR,KingJA,WegerS,KernA,KleinschmidtJA(1999)Adenoassociatedvirustype2proteininteractions:formationofpre-encapsidation complexes.JVirol73:8989–8998. 36.KingJA,DubielzigR,GrimmD,KleinschmidtJA(2001)DNAhelicasemediatedpackagingofadeno-associatedvirustype2genomesintopreformed capsids.EMBOJ20:3282–3291. 37.KotinRM,SiniscalcoM,SamulskiRJ,ZhuXD,HunterL,etal.(1990)Sitespecificintegrationbyadeno-associatedvirus.ProcNatlAcadSciUSA87: 2211–2215. 38.SamulskiRJ,ZhuX,XiaoX,BrookJD,HousmanDE,etal.(1991)Targeted integrationofadeno-associatedvirus(AAV)intohumanchromosome19.EmboJ 10:3941–3950. 39.BalagueC,KallaM,ZhangWW(1997)Adeno-associatedvirusRep78protein andterminalrepeatsenhanceintegrationofDNAsequencesintothecellular genome.JVirol71:3299–3306. 40.PhilpottNJ,GomosJ,BernsKI,Falck-PedersenE(2002)Ap5integration efficiencyelementmediatesRep-d ependentintegrationintoAAVS1at chromosome19.ProcNatlAcadSciUSA99:12381–12385. 41.NashK,ChenW,McDonaldWF,ZhouX,MuzyczkaN(2007)Purificationof hostcellenzymesinvolvedinadeno-associatedvirusDNAreplication.JVirol 81:5777–5787. 42.NashK,ChenW,MuzyczkaN(2008)Completeinvitroreconstitutionof adeno-associatedvirusDNAreplicationrequirestheminichromosomemaintenancecomplexproteins.JVirol82:1458–1464. 43.NiTH,McDonaldWF,ZolotukhinI,MelendyT,WagaS,etal.(1998)Cellular proteinsrequiredforadeno-associatedvirusDNAreplicationintheabsenceof adenoviruscoinfection.JVirol72:2777–2787. 44.StrackerTH,CassellGD,WardP,LooYM,vanBreukelenB,etal.(2004)The Repproteinofadeno-associatedvirustype2interactswithsingle-stranded DNA-bindingproteinsthatenhanceviralreplication.JVirol78:441–453. 45.NashK,ChenW,SalganikM,MuzyczkaN(2009)Identificationofcellular proteinsthatinteractwiththeadeno-associatedvirusrepprotein.JVirol83: 454–469. 46.WeindlerFW,HeilbronnR(1991)Asubsetofherpessimplexvirusreplication genesprovideshelperfunctionsforproductiveadeno-associatedvirusreplication.JVirol65:2476–2483. 47.SlaninaH,WegerS,StowND,KuhrsA,HeilbronnR(2006)Roleoftheherpes simplexvirushelicase-primasecomplexduringadeno-associatedvirusDNA replication.JVirol80:5241–5250. 48.Alazard-DanyN,NicolasA,PloquinA,StrasserR,GrecoA,etal.(2009) Definitionofherpessimplexvirustype1helperactivitiesforadeno-associated virusearlyreplicationevents.PLoSPathog5:e1000340. 49.ToublancE,BenraissA,BonninD,BlouinV,BrumentN,etal.(2004) Identificationofareplication-defectiveherpessimplexvirusforrecombinant adeno-associatedvirustype2(rAAV2)particleassemblyusingstableproducer celllines.JGeneMed6:555–564. 50.SongS,MorganM,EllisT,PoirierA,ChesnutK,etal.(1998)Sustained secretionofhumanalpha-1-antitrypsinfrommurinemuscletransducedwith adeno-associatedvirusvectors.ProcNatlAcadSciUSA95:14384–14388. 51.SongS,LuY,ChoiYK,HanY,TangQ,etal.(2004)DNA-dependentPK inhibitsadeno-associatedvirusDNAintegration.ProcNatlAcadSciUSA101: 2112–2116. 52.ConwayJE,ZolotukhinS,MuzyczkaN,HaywardGS,ByrneBJ(1997) Recombinantadeno-associatedvirustype2replicationandpackagingisentirely supportedbyaherpessimplexvirustype1ampliconexpressingRepandCap. JVirol71:8780–8789. 53.ChangCT,ChenYL,LeeSH,LueCM,LinMT(1989)Theinhibitionof prostaglandinE1-inducedcornealneovascularizationbysteroideyedrops. TaiwanYiXueHuiZaZhi88:707–711. 54.ChangYN,HsuHT,HungMS,ChangCL,LiJG,etal.(1990)EffectsofPGE1 onplateletdeformability.ChinJPhysiol33:31–40. 55.LaughlinCA,JonesN,CarterBJ(1982)Effectofdeletionsinadenovirusearly region1genesuponreplicationofadeno-associatedvirus.JVirol41:868–876. 56.JurvansuuJ,FragkosM,IngemarsdotterC,BeardP(2007)Chk1instabilityis coupledtomitoticcelldeathofp53-deficientcellsinresponsetovirus-induced DNAdamagesignaling.JMolBiol372:397–406. 57.JurvansuuJ,RajK,StasiakA,BeardP(2005)ViraltransportofDNAdamage thatmimicsastalledreplicationfork.JVirol79:569–580. 58.SchwartzRA,CarsonCT,SchuberthC,WeitzmanMD(2009)AdenoassociatedvirusreplicationinducesaDNAdamageresponsecoordinatedby DNA-dependentproteinkinase.JVirol83:6269–6278. 59.ParkinsonJ,Lees-MillerSP,EverettRD(1999)Herpessimplexvirustype1 immediate-earlyproteinvmw110inducestheproteasome-dependentdegradationofthecatalyticsubunitofDNA-dependentproteinkinase.JVirol73: 650–657. 60.LaughlinCA,CardellichioCB,CoonHC(1986)LatentinfectionofKBcells withadeno-associatedvirustype2.JVirol60:515–524. 61.McLaughlinSK,CollisP,HermonatPL,MuzyczkaN(1988)Adeno-associated virusgeneraltransductionvectors:analysisofproviralstructures.JVirol62: 1963–1973. 62.DavisMD,WuJ,OwensRA(2000)Mutationalanalysisofadeno-associated virustype2Rep68proteinendonucleaseactivityonpartiallysingle-stranded substrates.JVirol74:2936–2942. 63.DavisMD,WonderlingRS,WalkerSL,OwensRA(1999)Analysisoftheeffects ofchargeclustermutationsinadeno-associatedvirusRep68proteininvitro. JVirol73:2084–2093. 64.WuJ,DavisMD,OwensRA(1999)Factorsaffectingtheterminalresolutionsite endonuclease,helicase,andATPaseactivitiesofadeno-associatedvirustype2 Repproteins.JVirol73:8235–8244. 65.WalkerSL,WonderlingRS,OwensRA(1997)MutationalanalysisoftheadenoassociatedvirusRep68protein:identificationofcriticalresiduesnecessaryfor site-specificendonucleaseactivity.JVirol71:2722–2730. 66.WalkerSL,WonderlingRS,OwensRA(1997)Mutationalanalysisoftheadenoassociatedvirustype2Rep68proteinhelicasemotifs.JVirol71:6996–7004.67.McCartyDM,PereiraDJ,ZolotukhinI,ZhouX,RyanJH,etal.(1994) IdentificationoflinearDNAsequencesthatspecificallybindtheadenoassociatedvirusRepprotein.JVirol68:4988–4997. 68.RyanJH,ZolotukhinS,MuzyczkaN(1996)Sequencerequirementsforbinding ofRep68totheadeno-associatedvirusterminalrepeats.JVirol70:1542–1553. 69.YalkinogluAO,HeilbronnR,BurkleA,SchlehoferJR,zurHausenH(1988) DNAamplificationofadeno-associatedvirusasaresponsetocellulargenotoxic stress.CancerRes48:3123–3129. 70.WardP,DeanFB,O’DonnellME,BernsKI(1998)Roleoftheadenovirus DNA-bindingproteinininvitroadeno-associatedvirusDNAreplication.JVirol 72:420–427. 71.WardP,FalkenbergM,EliasP,WeitzmanM,LindenRM(2001)Repdependentinitiationofadeno-associatedvirustype2DNAreplicationbya herpessimplexvirustype1replicationcomplexinareconstitutedsystem.JVirol 75:10250–10258. 72.ZentilinL,MarcelloA,GiaccaM(2001)InvolvementofcellulardoublestrandedDNAbreakbindingproteinsinprocessingoftherecombinantadenoassociatedvirusgenome.JVirol75:12279–12287. 73.GulloC,AuM,FengG,TeohG(2006)ThebiologyofKuanditspotential oncogenicroleincancer.BiochimBiophysActa1765:223–234. 74.SingletonBK,Torres-ArzayusMI,RottinghausST,TaccioliGE,JeggoPA (1999)TheCterminusofKu80activatestheDNA-dependentproteinkinase catalyticsubunit.MolCellBiol19:3267–3277. 75.DingQ,ReddyYV,WangW,WoodsT,DouglasP,etal.(2003)AutophosphorylationofthecatalyticsubunitoftheDNA-dependentproteinkinaseis requiredforefficientendprocessingduringDNAdouble-strandbreakrepair. MolCellBiol23:5836–5848. 76.BlockWD,YuY,MerkleD,GiffordJL,DingQ,etal.(2004)Autophosphorylation-dependentremodelingoftheDNA-dependentproteinkinase catalyticsubunitregulatesligationofDNAends.NucleicAcidsRes32: 4351–4357. 77.TutejaN,TutejaR,OchemA,TanejaP,HuangNW,etal.(1994)Human DNAhelicaseII:anovelDNAunwindingenzymeidentifiedastheKu autoantigen.EMBOJ13:4991–5001. 78.DuanD,YueY,EngelhardtJF(2003)ConsequencesofDNA-dependentprotein kinasecatalyticsubunitdeficiencyonrecombinantadeno-associatedvirus genomecircularizationandheterodimerizationinmuscletissue.JVirol77: 4751–4759. 79.SongS,LaipisPJ,BernsKI,FlotteTR(2001)EffectofDNA-dependentprotein kinaseonthemolecularfateoftherAAV2genomeinskeletalmuscle.ProcNatl AcadSciUSA98:4084–4088. 80.ChoiVW,McCartyDM,SamulskiRJ(2006)HostcellDNArepairpathwaysin adeno-associatedviralgenomeprocessing.JVirol80:10346–10356. 81.InagakiK,MaC,StormTA,KayMA,NakaiH(2007)TheroleofDNA-PKcs andartemisinopeningviralDNAhairpinterminiinvarioustissuesinmice. JVirol81:11304–11321.DNA-PKandAAVReplication PLoSONE|www.plosone.org9December2010|Volume5|Issue12|e15073

PAGE 10

82.StrackerTH,CarsonCT,WeitzmanMD(2002)Adenovirusoncoproteins inactivatetheMre11-Rad50-NBS1DNArepaircomplex.Nature418:348–352. 83.SchwartzRA,PalaciosJA,CassellGD,AdamS,GiaccaM,etal.(2007)The Mre11/Rad50/Nbs1complexlimitsadeno-associatedvirustransductionand replication.JVirol81:12936–12945. 84.KaplanDL,DaveyMJ,O’DonnellM(2003)Mcm4,6,7usesa‘‘pumpinring’’ mechanismtounwindDNAbystericexclusionandactivelytranslocatealonga duplex.JBiolChem278:49171–49182. 85.ZhouX,ZolotukhinI,ImDS,MuzyczkaN(1999)Biochemicalcharacterization ofadeno-associatedvirusrep68DNAhelicaseandATPaseactivities.JVirol73: 1580–1590. 86.ZolotukhinS,PotterM,HauswirthWW,GuyJ,MuzyczkaN(1996)A ‘‘humanized’’greenfluorescentproteincDNAadaptedforhigh-levelexpression inmammaliancells.JVirol70:4646–4654. 87.PengY,ZhangQ,NagasawaH,OkayasuR,LiberHL,etal.(2002)Silencing expressionofthecatalyticsubunitofDNA-dependentproteinkinasebysmall interferingRNAsensitizeshumancellsforradiation-inducedchromosome damage,cellkilling,andmutation.CancerRes62:6400–6404.DNA-PKandAAVReplication PLoSONE|www.plosone.org10December2010|Volume5|Issue12|e15073