Molecular characterization and detection of dasheen mosaic virus

MISSING IMAGE

Material Information

Title:
Molecular characterization and detection of dasheen mosaic virus
Physical Description:
138 leaves : ill. ; 29 cm.
Language:
English
Creator:
Li, Ruhui, 1959-
Publication Date:

Subjects

Genre:
bibliography   ( marcgt )
theses   ( marcgt )
non-fiction   ( marcgt )

Notes

Thesis:
Thesis (Ph. D.)--University of Florida, 1995.
Bibliography:
Includes bibliographical references (leaves 120-137).
Statement of Responsibility:
by Ruhui Li.
General Note:
Typescript.
General Note:
Vita.

Record Information

Source Institution:
University of Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
aleph - 002059770
notis - AKP7838
oclc - 33867124
System ID:
AA00004712:00001

Full Text












MOLECULAR CHARACTERIZATION AND DETECTION
OF DASHEEN MOSAIC VIRUS
















By

RUHUI LI


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


1995
















ACKNOWLEDGMENTS


I would like to express my deepest appreciation and gratitude to Dr. F. W. Zettler,

a great teacher in my career. My interest in plant virology was inspired when I attended his

plant virology class, and continued when I worked in his laboratory. Indeed, this work

could not have been done with his advice, support, encouragement and patience. I would

like to thank Dr. Ernest Hiebert, cochairman of my committee, who always shared with

me his expertise in many parts of my research, who was always patient when I learned to

do computer analysis. My great gratitude also goes to Dr. D. E. Purcifull, for his support

of my research, for his encouragement whether I succeed or failed, for his constructive

criticism and challenge to my writing, for his strict attitude to work, and for his sense of

humor too. I would like to extend my appreciation to Dr. C. L. Guy, who always opened

the door for me, and who shared his knowledge and time with me.

I wish to express my gratitude to Dr. G. N. Agrios for his care and encouragement

during these years. My special thanks go to Dr. C. L. Niblett and his wife Tiffany for their

encouragement and kindness during the initial stage of my study in the United States.

I want to thank Dr. Carlye Baker, who first taught me the molecular techniques,

and who was always there when I needed help, with a smile. I also want to thank Dr. Gail

Wisler, for always standing there, not just as a colleague, but also as a friend.











I would like to extend my appreciation to Kristin Beckham, Maureen Petersen,

Mark Elliott, Eugene Crawford, Ellen Dickstein and Lucious Mitchell for their excellent

technical assistance and friendship.

I give heartfelt thanks to my parents, Fengling Li and Guizhen He, for their love,

support, encouragement and understanding. They have not seen their eldest child, and only

daughter, for almost seven years. To them, I owe my deepest gratitude.

To my husband, Wei-Wei Rao, and our son, Ran Rao, go my love and gratitude,

they have endured many hardships along the way and both have sacrificed a lot, just to

share this dream with me.

I also gratefully acknowledge the financial assistance of the USDA/CSRS (CBAG

Grant No. 90-34135-5172), the American Floral Endowment, and the Manatee Fruit

Company.















TABLE OF CONTENTS


Page

ACKNOWLEDGMENTS................... ......... ii

LIST OF FIGURES ........... ................... vi

LIST OF TABLES ................ ... ......... .. viii

KEY TO ABBREVIATIONS ..... ... ........... ..... ix

ABSTRACT ................... .. ........... xi

CHAPTER 1 INTRODUCTION ...................... .1


CHAPTER 2


CHAPTER 3








CHAPTER 4


General Characteristics of Potyviridae ............... 1
Dasheen Mosaic Virus ....................... 12

CLONING, SEQUENCING OF 3'-TERMINAL REGION
AND COAT PROTEIN EXPRESSION OF DSMV-Chl

Introduction ............... ... ....... 20
Materials and Methods ......................21
Results .................. .......... 32
Discussion .............. ..... ....... 61

VARIABILITY OF COAT PROTEINS AMONG ISOLATES
OF DASHEEN MOSAIC VIRUS

Introduction .................. .......... 66
Materials and Methods ............. ...... 67
Results ...... ........ ....... ........ 70
Discussion .. ................ ......... 83

DETECTION OF DASHEEN MOSAIC VIRUS

Introduction .......................... 89
Materials and Methods .................... 90

iv













Results ... ................. .........99
Discussion . . . 110

CHAPTER 5 SUMMARY AND CONCLUSIONS ............. 113

REFERENCE LIST ................................. 120

BIOGRAPHICAL SKETCH .................... ........ 138












































v















LIST OF FIGURES


Figure page

2-1 Analysis of partially purified and purified DsMV-Chl preparations 34

2-2 Electron micrograph of a purifed DsMV-Chl preparation
negatively stained with 2% uranyl acetate . ..... 35

2-3 Agarose gel electrophoresis ofDsMV-Chl RNA isolated
from purifed virions .......................... 37

2-4 Map of the cDNA clones representing the DsMV-Chl genome 40

2-5 Sequencing strategy used for the cDNA clones representing
the 3'-terminal region of DsMV Chl . .... 41

2-6 Nucleotide sequence of the 3'-terminal region of DsMV-Chl ...... .42

2-7 Phylogenetic tree obtained from the alignment of putative amino acid
sequences of NIb proteins between DsMV and 14 other potyviruses
using the PAUP program ..... .......... ........ 50

2-8 Hydrophobicity plot of the NIb protein sequence of DsMV-Chl .. 51

2-9 Phylogenetic tree obtained from the alignment of coat proteins
between DsMV isolates and 8 potyviruses
using the PAUP program ................. ....... 54

2-10 Phylogenetic tree obtained from the alignment of coat proteins
between DsMV isolates and 14 other potyviruses
using the PAUP program ................... 55

2-11 Analysis of the DsMV pETh-3-CP expressed in E. coli ... 57

2-12 Western blotting analysis of the expressed CP and
native CP of DsMV ........................ .. .. 59

3-1 Western blotting analysis of the coat proteins ofdasheen mosaic
virus (DsMV) isolates from their original hosts . ... 72

vi












3-2 Western blotting analysis of the Chl isolate ofdasheen mosaic
virus (DsMV-Chl) and other potyviruses . .... 73

3-3 Western blotting analysis of the Chl isolate ofdasheen mosaic
virus (DsMV-Chl) transferred to several different hosts. ... 74

3-4 Western blotting analysis of four dasheen mosaic virus (DsMV)
isolates serially propagated in Philodendron selloum seedlings 75

3-5 Comparison of nucleotide sequences of the coat protein (CP)
gene of dasheen mosaic virus isolates . ... 77

3-6 Comparison of amino acid sequences of coat proteins
of dasheen mosaic virus isolates . ..... ...... 82

3-7 Comparison of nucleotide sequences of the 3'-NCRs
of dasheen mosaic virus isolates . . 84

4-1 Electron micrograph of cylindrical inclusions (CI) induced by
a caladium isolate of dasheen mosaic virus in a leaf cell
ofPhilodendron selloum .......................100

4-2 Agarose gel electrophoresis ofRT-PCR amplified products obtained
from total RNA extracted from aroid leaf tissues . ... 107

4-3 Agarose gel electrophoresis ofRT-PCR amplified products obtained
from total RNA extracted from leaf tissues of calla lily plants 108













LIST OF TABLES


Table ae

2-1 DsMV-Chl cDNA clones identified by immunoscreening
and preliminary sequencing ................... .... 38

2-2 DsMV-Ch1 cDNA clones identified by preliminary sequencing ..... 39

2-3 Percent nucleotide identity of NIb genes ofDsMV-Chl
and 14 other potyviruses ........................ 48

2-4 Percent similarity of the NIb protein, the coat protein
and the 3' noncodingregion (3'-NCR) ofDsMV-Chl
and 14 other potyviruses ....................... 49

2-5 Percent nucleotide identity of CP genes of two DsMV isolates
and 14 other potyviruses ..................... .... 52

2-6 Comparison of the DsMV-FL antiserum and the expressed
coat protein antiserum in I-ELISA . . ... 60

4-1 A.w absorbance value of I-ELISA and DAS-ELISA
forDsMVdetection .............. ..... .......... 101

4-2 Comparison of I-ELISA and Western blotting procedures
to detect DsMV in caladium leaves . . ... 102

4-3 Relative distribution of DsMV in three aroid hosts
as determined by I-ELISA .............. ....... 104

4-4 Effect of wounding on detection of DsMV in caladium corms 105

4-5 Comparison ofRT-PCR, I-ELISA and Western blotting
for detecting DsMV ..........................109
















KEY TO ABBREVIATIONS


AI
bp
BCMV
B1CMV
BYMV
CP
C-terminus
cDNA
CMV
CI
HiCi
DIECA
DSMO
DsMV-Ce
DsMV-Ch

DsMV-Ch2

DsMV-Ch3

DsMV-Xc
DsMV-Za
ELISA
HC/Pro
IPTG
kb
kDa
LB
P-ME
MW
3'-NCR
N-terminus
NIa
NIb
nm
nt
oligo dT


amorphous inclusion
base pair
bean common mosaic virus
blackeye cowpea mosaic virus
bean yellow mosaic virus
coat protein
carboxy-terminus
complementary DNA
cucumber mosaic virus
cylindrical inclusion
microCurie
diethyldithiocarbamate
dimethyl sulfoxide
taro isolate of dasheen mosaic virus
caladium isolate of dasheen mosaic virus from
cultivar 'Candidum'
caladium isolate of dasheen mosaic virus from
cultivar 'Carolyn Whorton'
caladium isolate of dasheen mosaic virus from
cultivar 'Frieda Hemple'
cocoyam isolate of dasheen mosaic virus
calla lily isolate of dasheen mosaic virus
enzyme-linked immunosorbent assay
helper component/protease
isopropyl-B-D-thiogalactopyranoside
kilobase
kilodalton
Luria broth
0-mercaptoethanol
molecular weight
3' non-coding region
amino-terminus
nuclear inclusion a
nuclear inclusion b
nanometer
nucleotide
oligonucleotide deoxythymidine












PCR
PepMoV
PMoV
PPV
PRSV-W
PRSV-P
PSbMV
PStV
PVY
RT-PCR
SbMV
SCMV
SDS-PAGE

TEV
TuMV
TVMV
WMV 2
X-Gal
ZYMV


polymerase chain reaction
pepper mottle virus
peanut mottle virus
plum pox virus
papaya ringspot virus type W
papaya ringspot virus type P
pea seed-borne mosaic virus
peanut stripe virus
potato virus Y
reverse transcription-polymerase chain reaction
soybean mosaic virus
sugarcane mosaic virus
sodium dodecyl sulfate polyacrylamide
gel electrophoresis
tobacco etch virus
turnip mosaic virus
tobacco vein mottling virus
watermelon mosaic virus 2
5-bromo-4-chloro-3-infolyl-B-D-galactopyranoside
zucchini yellow mosaic virus












Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the Requirements
for the Degree of Doctor of Philosophy

MOLECULAR CHARACTERIZATION AND DETECTION OF
DASHEEN MOSAIC VIRUS

by

Ruhui Li

August, 1995


Chairman: F. W. Zettler
Cochairman: E. Hiebert
Major Department: Plant Pathology

The sequence of the 3'-terminal 3158 nucleotides of a caladium (Caladium

hortulanum) isolate of dasheen mosaic virus (DsMV-Chl) was determined. The region

contains the nucleotide sequence which encodes the carboxyl terminus of the NIa

protease, the NIb RNA polymerase, and the coat protein (CP). The genomic organization

of this region is similar to those of other potyviruses. The overall nucleotide sequence

homology of the coding region compared with those of other sequenced potyviruses is

between 57-67%, and the amino acid sequence homology is between 68-82%.

Phylogenetic alignment of the genomic sequences indicated that DsMV is a distinct

member of the genus Potyvirus in the family Potyviridae.

The CP gene of DsMV-Ch was amplified by PCR, cloned into a pETh-3 vector,

and expressed in Escherichia coli. Antiserum against the expressed CP was obtained and

it was suitable for detecting DsMV in SDS-diffusion test, ELISA and Western blotting.











Variability among DsMV isolates from caladium, calla lily (Zantedeschia spp.),

cocoyam (Xanthosoma spp.), and taro (Colocasia esculenta) was noted in symptom

severity in inoculated Philodendron selloum seedlings. The CP molecular weight (MWs)

among isolates varied, ranging from 38-47 kDa in their original hosts based on western

blotting analysis. Because respective MWs of each DsMV isolate remained constant after

three passages in Philodendron selloum or other hosts, it was concluded that the observed

differences in the CP MWs were virus-mediated. Comparison of the CP sequence among

DsMV isolates revealed deletions and additions at the 3'-terminal regions, which may

contribute to the variability of the CP MWs among different DsMV isolates.

DsMV was not uniformly distributed within tissues of infected cocoyam and taro

leaves. In contrast, more uniform distribution of the virus was noted within infected

'Candidum', 'Carolyn Whorton', and 'Frieda Hemple' caladium leaves. Relatively high

growing temperatures resulted in a reduction in the distribution of DsMV within leaves of

infected cocoyam and taro plants. Under such conditions, many leaves without detectable

virus were produced by infected plants, which may be related to restriction of virus

movement in these plants.

Immunosorbent electron microscopy (ISEM), ELISA, Western blotting, and

reverse transcription-PCR (RT-PCR) were used to detect different DsMV isolates in

leaves and/or corms of caladium, calla lily, cocoyam and taro. Of them, RT-PCR was the

most sensitive. DsMV detection was also facilitated by corm wounding.














CHAPTER 1
INTRODUCTION


Dasheen mosaic virus (DsMV) is a species of the genus Potyvirus in the family Poyviridae,

and infects plants in the family Araceae, collectively referred to as aroids. This potyvirus

causes stunting and foliar mosaic, chlorotic feathering, and distortion symptoms in infected

plants, thereby reducing their market values and/or yields (Zettler & Hartman, 1987).


General Characteristics of Potyviridae


The Potyviridae is the largest of 47 plant virus groups and families currently

recognized by the International Committee for the Taxonomy of Viruses. Three genera,

Potyvirus, Rymovirus, and Bymovirus, are recognized (Murphy et al., 1995). There are two

whitefly transmitted viruses and two aphid transmitted viruses are unassigned. The family

contains at least 184 definitive and possible species (30% of all known plant viruses), many of

which cause significant losses in agronomic, pasture, horticultural and ornamental crops

(Shukla et al., 1994). A feature shared by all potyviruses is that they induce characteristic

cylindrical inclusion bodies in the cytoplasm of the infected cells (Edwardson, 1974). These

cylindrical inclusion (CI) bodies are formed by a virus-encoded protein (Dougherty & Hiebert,

1980). Except for species of the genus Bymovirus, which have bipartite particles about 500-











600 nm and 250-300 nm long, Pootvirus and Rymovirus virions are flexuous filaments of 650

to 900 nm in length (Murphy et al., 1995). The particles of monopartite potyviruses contain

one positive-sense, single-stranded genomic RNA molecule of 8.5-10 kb, which is

encapsidated by a single type of coat protein (Hollings & Brunt, 1981). The genomic RNA has

a protein (VPg) covalently attached to its 5' end (Hari, 1981; Siaw et al., 1985; Riechmann et

al., 1989; Murphy et al., 1990) and a poly(A) tract at its 3' end (Hari, 1979). Most potyviruses

(Potyvirus) are transmitted by aphids in a non-persistent manner, while Rymovirus, Bymovirus,

are transmitted by mites, and fungi, respectively. Some potyviruses, such as TEV, are known

to form nuclear inclusion bodies consisting of two nuclear proteins (NIa & NIb) aggregated in

equimolar amounts in nuclei of infected cells. A few potyviruses, such as PRSV-W, PeMoV,

potato virus A (PVA) and celery mosaic induce the formation of amorphous inclusions in the

cytoplasm and/or in the nucleoplasm of infected cells (Christie & Edwardson, 1977;

Edwardson & Christie, 1983).


Genome Organization


The complete nucleotide sequence of the following thirteen potyviruses has been

documented: TEV (Allison et al., 1986), TVMV (Domier et al., 1986), PPV (Maiss et al.,

1989; Lain et al., 1989), PepMoV (Vance et al., 1989), the necrotic and Hungarian strains of

PVY (Robaglia et al., 1989, Thole et al., 1993), PSbMV (Johansen et al., 1991), PRSV-P

(Yeh et al., 1992), the two strain of SbMV (Jayaram et al., 1992), TuMV (Nicolas et al.,

1992), Johnsongrass mosaic (Gough & Shukla, 1993), PVA (Puurand et al., 1994), PStV











(Gunasinghe et al., 1994) and ZYMV (Wisler et al., 1995). The sequence analysis of

potyviruses and in vitro translation studies of potyvirus genomic RNAs have revealed a single

open reading frame (ORF) encoding a large polyprotein ranging from 320 kDa to 358 kDa,

depending on the virus. This polyprotein is proteolytically processed into at least eight mature

viral proteins by three virus-encoded proteases (Hellmann et al., 1983; Dougherty &

Carrington, 1988). The different gene products into which the potyviral polyprotein is cleaved

are, proceeding from the N- to the C-terminus of the polyprotein: P1 protease, the helper

component/protease protein (HC-Pro), P3, a putative 6K peptide (6K1), the CI protein with

helicase activity, a second 6K peptide (6K2), the nuclear inclusion "a" protein (NIa), which

functions as VPg and protease, the nuclear inclusion "b" protein (NIb), the presumptive RNA

polymerase, and the capsid protein (CP). The length of potyviral 5' non-coding regions ranges

from 85 nucleotides (nt) for PRSV-W to 205 nt for TVMV. These regions are especially rich

in adenine residues with relatively few guanine residues. It has been shown that the TEV 5'

non-coding region can function as an enhancer of translation (Carrington et al., 1990).

Alignment of the non-coding regions of PPV, PVY, TEV, and TVMV revealed two highly

conserved regions, namely box "a" (ACAACAU) and box "b" (UCAAGCA) (Lain et al.,

1989; Turpen, 1989). These conserved sequences and their secondary structure may be

important for processes such as encapsidation, translation or replication (Lain et al., 1989;

Atreya et al., 1992; Riechmann et al., 1992).

The 3' non-coding regions of different potyviruses have been described as variable in

size, sequence, and predicted secondary structure (Lain et al., 1988; Turpen, 1989; Quemada











et al., 1990a, b). They contain AU-rich segments, and each sequence can be predicted to fold

into stable secondary structures (Turpen, 1989). Several short segments displaying sequence

homology among different potyviruses have been identified (Lain, 1989; Uyeda et al., 1992). In

contrast with the high sequence diversity found among the 3' non-coding regions of different

potyviruses, the 3' non-coding regions are more conserved among different strains of the same

potyvirus (Wetzel., 1991). The poly(A) tails have been determined to be very variable in length

(Allison et al., 1986; Lain et al., 1988). The most important functions of the 3' non-coding

region involve the interaction with virus replicase during the initiation of minus-strand RNA

synthesis and the prevention of exonucleolytic degradation (Bryan et al., 1992; Dolja &

Carrington, 1992). It has been shown that the 3' non-coding region of TVMV can have a

direct effect on the induction of disease symptoms (Rodriguez-Cerezo et al., 1991).


Replication


The subcellular site(s) of potyviral RNA synthesis has not been identified with

certainty, but is believed to be in the cytoplasm, as found with other positive stranded RNA

viruses (Verchot et al., 1991). A polymerase activity is associated with an enzyme complex

isolated from plants infected with PPV (Martin & Garcia, 1991). Several viral proteins,

including NIb, CI, VPg/NIa, and two small peptides (6K1 and 6K2), are believed to be

involved in the replication process of potyviruses. The large nuclear inclusion protein, NIb, is

the most conserved gene product of potyviruses and is believed to be the RNA-dependent

RNA polymerase (RdRp) based on the presence of conserved sequence motif (GDD)











characteristic of these enzymes (Domier et al., 1987; Lain et al., 1989; Robaglia et al., 1989;

Poch et al., 1989; Riechmann et al., 1992).

The CI protein of PPV has been shown to have nucleic acid-stimulated ATPase activity

and to be able to unwind RNA duplexes (Lain et al., 1990, 1991). The PPV CI was able to

unwind only dsRNA substrates with the 3' single-strand overhangs, indicating that the helicase

activity functions from the 3' to the 5' direction (Lain et al., 1990). The CI proteins of

potyviruses were found to contain a conserved nucleotide binding consensus sequence motif

(GXXGXGKS) at the C-terminal region and were implicated as membrane-binding

components of the replication complex (Domier et al., 1987).

In addition to the role of NIa in the proteolytic processing of the potyviral polyprotein,

for which only its carboxyl half is required, its N-terminal part has been shown to be the VPg.

The VPg ofTVMV (Siaw et al., 1985) and PPV (Riechmann et al., 1989) have been identified

as proteins of 24 kDa and 22 kDa, respectively. The TVMV VPg cistron has been mapped

showing that the VPg is the N-terminal portion of the NIa protein (Shahabuddin et al., 1988).

Likewise, the TEV VPg has been found to be either the 49 kDa NIa or its N-terminal 24 kDa

half (Murphy et al., 1990). The VPg is attached to the 5' end of the RNA by means of a

phosphate ester linkage to Y residues of the protein (Murphy et al., 1991). By analogy with

other viral systems, VPg is believed to serve as the primer for viral RNA synthesis

(Shahabuddin et al., 1988).

The NIa protease also may be involved in regulation of potyvirus replication. One level

of control has been proposed to be the regulation of the expression of gene products by











sequential proteolytic events (Dougherty et al., 1989a, b). Another proposed level of control is

that the subcellular localization of the NIa/NIb may play a regulatory role (Carrington et al.,

1991).


Proteolytic Processing of Polprotein


Three virus-encoded proteases, NIa (Carrington & Dougherty, 1987a; Hellmann et al.,

1988; Chang et al., 1988; Garcia et al., 1989a; Ghabrial et al., 1990), HC-Pro (Carrington et

al., 1989a), and P1 (Carrington et al., 1990; Verchot et al., 1991), process the large viral

precursor polyprotein co- and post-transcriptionally. The NIa is responsible for cleavages in the

C-terminal two-thirds of the polyprotein (Dougherty et al., 1988), whereas HC-Pro and P1

autocatalytically cleave at their respective C-termini (Carrington et al., 1989 a, b; Verchot et

al., 1991).

The small nuclear inclusion protein, NIa, is the major protease of potyviruses, and it is

capable of cleaving in a cis- and trans-manner at least six and possibly seven sites within the

polyprotein. It has a two-domain structure where the N-terminal domain is the genome-linked

VPg (Shahabuddin et al, 1988; Murphy et al., 1990), and the C-terminal half is the true

proteinase (Dougherty & Carrington, 1988). This proteolytic domain in TEV and TVMV was

like that reported for the poliovirus 3C and cowpea mosaic virus 24 kDa proteases (Domier et

al., 1987). The NIa protease is related to the trypsin-like family of cellular serine proteases,

except that a Cys is substituted for the active site nucleophile (Bazan and Fletterick, 1988;

Gorbalenya et al., 1989). Mutagenesis of selected TEV 27-kDa NIa ORF codons supports the











hypothesis that His-46, Asp-81, and Cys-151 make up the active-site triad (Dougherty et al.,

1989b). The consensus sequence GXCG has been found in all potyviruses examined to date

(Shukla et al., 1994). The NIa autocatalytically releases from the polyprotein by cleaving the

CI-NIa, and NIa-NIb junctions and catalyzes the production of CI, NIb, and CP by cleaving

the P3-CI, and NIb-CP junctions (Carrington & Dougherty, 1987a, b; Carrington et al., 1988;

Hellman et al., 1988; Garcia et al., 1989a, b, 1990). Additional cleavages, to release VPg and

the 6K1 and 6K2 products, also occur (Garcia et al., 1992; Restrepo-Hartwig & Carrington,

1992).

The NIa protease requires those conserved cleavage sites, defined as heptapeptide

sequences, that are efficiently recognized only by their own respective proteases (Carrington &

Dougherty, 1987a, 1988; Carrington et al., 1988; Dougherty et al., 1988, 1989a; Garcia et al.,

1989 a, b; Garcia & Lain, 1991; Parks & Dougherty, 1991). Cleavages are frequently at a

Q/(G, or S) site. A group-specific motif VXXQ/(A, S, G, or V), common to most potyviruses,

has been found (Shukla et al., 1994). The requirement for the conserved cleavage sites is

unique to the NIa proteases.

The helper component protease (HC-Pro) functions as an autocatalytic protease. The

HC-Pro 52 kDa protein of TEV is a multifunctional protein, and the proteolytically active

domain has been localized at its C-terminal half (Carrington et al., 1989a, b). The presence of

two essential residues, specifically Cys-679 and His-772, in this protease supports the

hypothesis that HC-Pro most closely resembles members of the cysteine-type family of

proteases (Oh & Carrington, 1989). Cleavage is at a specific G/G dipeptide and appears to be











the only cleavage event mediated by the HC-Pro protein (Carrington et al., 1989b; Oh &

Carrington, 1989). The HC-Pro ofpotyviruses accumulates to high levels and often complexes

into amorphous inclusion bodies (de Mejia et al., 1985b)

By expressing TEV polyprotein in transgenic plants, it was shown that a novel

proteolytic activity caused by neither HC nor NIa proteases is required for processing at the C-

terminal region of P1 protein (Carrington et al., 1990). Verchot et al. (1991) have

demonstrated that P1 is the protease responsible for cleaving the PI-HC junction at the Q/(S,

or G). Using the wheat germ in vitro translation system and a series of truncated or

mutagenized cDNAs from TEV, they showed that most of the HC protein and the first 157

amino acids of P1 were not required for proteolysis of the P1-HC junction and that the N-

terminal boundary of the protease domain lies somewhere between 157-188 and 304. The P1

protease is a serine-like protease based on the presence of the conserved active-site triad (His-

215, Asp-225 and Ser-256 for TEV) and the conserved motif (GXSG) found in all aphid-

transmitted potyviruses (Lain, 1990; Verchot, 1991). However, another factor besides P1

might be required since cleavage at this site does not occur in an in vitro rabbit reticulocyte

lysate system (Hiebert et al., 1984b; Carrington et al., 1989a). Alternatively, the absence of

cleavage in the reticulocyte lysate-based system could be due to the presence of a protease

inhibitor (Verchot et al., 1991).












Virus Movement


Natural plant-to-plant spread of the majority of potyviruses is accomplished by aphids, and

four viral proteins, PI, HC/Pro, CI and CP, have been suggested or demonstrated to be

involved in either cell-to-cell movement or plant-to-plant spread. Based on the sequence

similarity of the P1 protein of TVMV to that of 30 kDa movement protein of tobacco mosaic

virus, it has been suggested that the P1 protein may be involved in cell-to-cell movement

(Domier et al.,1987; Lain et al., 1989a; Robaglia et al., 1989). However, sequence identity may

be a poor indicator of function since it is known that cell-to-cell movement proteins of plant

viruses exhibit very little similarity, even among members of the same group (Lain et al., 1989a;

Hull, 1991). The P1 protein of other potyviruses (TEV, PPV, PVY), for example, differed

from that of TVMV. The P1 proteins of the potyviruses are the most variable products of the

genome (Wisler et al., 1995), which suggests that P1, particularly its N-terminal non-proteases

domain, may be involved in some specific virus-host interaction (Hull, 1991). By deletions and

modifications of the P1 coding sequence, Verchot and Carrington recently (1995)

demonstrated that P1 protein of TEV was not involved in the movement.

The HC protein is involved in aphid transmission and must be acquired by the insect in

conjunction with the virus (Pirone & Thornbury, 1983; Thornbury & Pirone, 1983; Hiebert et

al., 1984; Thorbury et al., 1985; Berger & Pirone, 1986). Although the HC protein is closely

related to the protein associated with the amorphous inclusions induced by certain potyviruses

(Hiebert et al., 1984; De Mejia et al., 1985 a, b; Baunoch et al., 1990), functional studies have











suggested that either the inclusion-bound form of this protein has been inactivated or,

alternatively, the HC activity is associated with a modified form of the inclusion protein

(Thombury & Pirone, 1983; Thornbury et al., 1985; Dougherty & Carrington, 1988). The size

of the biologically active HC form is believed to be a dimer, with MWs of 116 kDa for PVY

(Hellmann et al., 1983) and 106 kDa for TVMV (Thombury et al., 1985). The loss of

transmissibility associated with HC deficiency has been correlated with two mutations in the

HC coding sequence of potato virus C (Thombury et al., 1990; Atreya et al., 1992) and the

PAT isolate of ZYMV-PAT (Granier et al., 1993). The long-distance movement of TEV has

been associated with the central region of the HC-Pro by using site-directed mutagenesis of

infectious cDNA and complementary by HC-Pro supplied in trans by a transgenic host (Cronin

et al., 1995).

The CI protein has also been suggested to be involved in cell-to-cell movement on the

basis of electron microscope observations that CIs are associated with plasmodesmata and

virus particles (Lawson & Hearon, 1971; Murant et al., 1971; Langenberg, 1986; Lesemann,

1989; Baunoch et al., 1991).

The coat protein is the most extensively characterized potyviral gene product. The CP

nucleotide sequences of 103 strains of 35 distinct members of the Potyviridae have been

resolved (Shukla et al., 1994; Pappu et al., 1994; Puurand et al., 1994; Husted et al., 1994;

Colinet & Lepoivre, 1994). The interest in CP comes mainly from its usefulness in taxonomic

and evolution studies, in diagnosis, and in the study of CP-mediated resistance. Sequence

comparisons and particle assembly properties suggest the presence of three different regions in











the coat protein molecules of potyviruses: (i) a surface-exposed N-terminus varying in length

and sequence, (ii) a highly conserved core of 215-227 amino acids, and (iii) a surface-exposed

C-terminus of 18-20 amino acids (Shukla and Ward, 1989). Removal of the N- and C-termini

by trypsin digestion leaves a fully assembled virus particle composed of the coat protein core

region, which can not be distinguished by electron microscopy from untreated native infective

particles. Apparently the N- and C-termini are neither required for particle assembly nor for

infectivity during mechanical inoculation (Shukla et al., 1988; Jagadish et al., 1991).

The CP functions to protect the viral RNA, to facilitate its transmission by aphids (Gal-

On et al., 1990; Lecoq & Purcifull, 1992), and to facilitate movement of the virus within plants

(Dolja et al., 1994, 1995). Sequence analyses have shown that a change in the amino acid

triplet DAG, which is conserved in all aphid-transmissible potyviruses (Harrison & Robinson,

1988; Atreya et al., 1991), and other amino acids in the amino-terminus (N-terminus) of the CP

alters aphid transmissibility (Atreya et al., 1990, 1991, 1995; Harrison & Robinson, 1988; Gal-

On et al., 1990; Salomon & Raccah, 1990). A non-aphid transmissible isolate ofZYMV, which

has a defective CP but is capable of producing an active form of HC, has been described

(Antignus et al., 1989; Gal-On et al., 1992). By using mutational analysis, Atreya et al. (1995)

demonstrated that a basic residue (D or N) in the first position, the nonpolar residue A in the

second position, and the small nonpolar residue G in the third position are required for aphid

transmissibility.

The TEV CP has been recently shown to be necessary for cell-to-cell movement and

long-distance transport of the virus in plants (Dolja et al., 1994, 1995). The mutation at the











highly conserved S amino acid residue in the core domain and deletion at the variable C-

terminal region abolished or reduced virus movement within the plants.

In addition to their natural functions, the CP genes of some potyviruses, including

SbMV (Stark & Beachy, 1989), PPV (Reger et al., 1989; Scorza et al), PVY (Kaniewski et al.,

1990), PRSV-P (Ling et al., 1991; Fitch et al., 1992), TEV (Lindbo & Dougherty, 1992),

WMV-2 (Namba et al., 1992), ZYMV (Namba et al., 1992; Fang & Grumet, 1993), TVMV

(Zaccomer et al., 1993), and lettuce mosaic virus (Dianat et al., 1993) have been used

experimentally to obtain genetically engineered plants with CP-mediated resistance. Many of

these transgenic plants showed certain degrees of resistance to viral infection.


Dasheen Mosaic Virus


Dasheen mosaic virus (DsMV) is a species of the Potyviridae which causes serious

diseases of cultivated aroid plants worldwide (Zettler et al., 1978; Shimoyama et al., 1992a, b).

Viruses other than DsMV include konjak mosaic potyvirus ofAmorphophallus (Shimoyama et

al., 1992a, b); tobacco necrosis necrovirus of Dieffenbachia (Paludan & Begtrup, 1982);

cucumber mosaic cucumovirus of Arum (Lovisolo & Conti, 1969), Amorphophallus

(Shimoyama et al., 1990) and Colocasia (Kumuro & Asuyama, 1955); tomato spotted wilt

tospovirus of Zantedeschia (Tompkins & Severin, 1950); and bobone rhabdovirus of

Colocasia (James et al., 1973). DsMV and konjak mosaic virus are considered different on the

basis of biological and serological properties. However, none of these viruses infect as many

aroids nor is as wide spread as DsMV.











The Araceae, or aroid family, comprises about 107 genera and 2,500 species of

monocotyledonous herbs and vines. Most aroid plants occur in tropical Asia and the New

World tropics (Grayum, 1990). Many of them, such as Aglaonema, Arisaema, Caladum,

Dieffenbachia, Epipremnum, Monstera, Philodendron, Pinellia Spathiphyllun, and

Syngonium are important ornamentals, which account for nearly 25% of U.S. production of

foliage plants (U.S. Bureau of Census, 1974). Certain species of Anthurimn, Richardia and

Zantedeschia are valuable cut flower crops, and Cryptocoryne species are commercially grown

aquarium plants. Two genera ofaroids, Colocasia commonly referred as dasheen or taro, and

Xanthosoma, or cocoyam, are important tropical food crops. DsMV was first reported in 1970

in Florida by Zettler et al. (1970), and has since been found elsewhere, including Hawaii

(Buddenhagen et al, 1970; Hartman & Zettler, 1972; Kositratana et al, 1983), Puerto Rico

(Alconero & Zettler, 1971), Trinidad (Kenten & Woods, 1973), India (Hartman, 1974),

Venezuela (Debrot & Ordosgoitti, 1974), Japan (Tooyama, 1975), Egypt (Abo-Nil & Zettler,

1976), Netherlands (Hakkaart & Waterreus, 1976), the Solomon Islands (Gollifer et al. 1977),

Belgium (Samyn & Walvaert, 1977), Papua New Guinea (Shaw et al., 1979), Great Britain

(Hill & Wright, 1980), the Cameroons (Girard et al., 1980), Kiribati (Shanmuganathan, 1980),

French Polynesia (Jackson, 1982), Nigeria (Volin et al., 1981), Italy (Rana et al., 1983), South

Africa (Van der Meer, 1985), Costa Rica (Ramirez, 1985), Australia (Greber & Shaw, 1986),

P. R China (Zettler et al., 1987), Taiwan (Ko et al., 1988) and Cuba (Quintero, 1989).

Although DsMV has been reported to experimentally infect nonaroids such as Chenopodium

awaranticolor, C quinoa C. ambrosioides, Nicotiana benthamiana and Tetragonia expansa











(Gollifer & Brown, 1972; Rana et al., 1983; Kositratana, 1985; Shimoyama et al., 1992a), its

natural host range is restricted to aroid plants, and it has been reported to infect species of 20

genera: Aglaonema, Alocasia, Amorphophallus, Anthri*m, Arisaema Caladiwn, Colocasia,

Cryptocoryne, Cyrtosperma, Dieffenbacha, Monstera, Philodendron Pinellia, Richardia

Scindapsus, Spathiphyllun, Stenospermation, Syngonium, Xanthostna and Zantedeschia

(Zettler et al., 1987; Samyn & Welvaert, 1977; Chen, personal communication).

As noted for other Potyviridae, DsMV has flexuous, filamentous particles about 750

nm long (Zettler et al., 1978; Samyn & Welvaert, 1977; Hill & Wright, 1980; Girard et al.,

1980; Kositratana et al, 1983; Van der Meer, 1985; Greber & Shaw, 1986; Quintero, 1989). It

induces cylindrical inclusions in infected cells (Zettler et al., 1978; Girard et al, 1980;

Shanmuganathan,1980; Paludan & Begtrup, 1982; Greber & Shaw, 1986; Kositratana, 1985;

Ko et al., 1988, Liang et al., 1994), and like other members of this genus, DsMV is sap-

transmissible. DsMV also is transmitted in a non-persistent manner by aphids, namely Myzus

persicae, Aphis craccivora (Morales & Zettler, 1977; Van der Meer, 1985), and Aphis

gossypii (Gollifer et al, 1977), but apparently not by either Pentalonia nigronervosa (Morales

& Zettler, 1977) or Rhopalosiphumpadi (Gollifer et al., 1977).

The genome of DsMV is a single-stranded RNA of MW 3.2-3.42 x 106 (Kositratana,

1985; Shimoyama et al., 1992b). The four nonstructural proteins that have been identified thus

far were HC-Pro (51 kDa), CI (69 kDa), NIa (49 kDa), and NIb (56 kDa) proteins (Nagel &

Hiebert, unpublished). The DsMV CP protein is serologically related to those of araujia

mosaic, BICMV, TEV and ZYMV (Abo El-Nil et al., 1977; Hiebert & Charudattan, 1984;











Kositratana, 1985). The DsMV CI protein is serologically related to that of araujia mosaic

virus (Hiebert & Charudattan, 1984), and the DsMV in vitro synthesized protein is related to

the TVMV HC-Pro protein (Hiebert et al., 1984). The 3'-terminal region and the CP gene of

two Colocasia isolates of DsMV from Florida have been cloned and sequenced (Pappu et al.,

1993, 1994a, b). The predicted CP of isolate DsMV-LA contains 329 amino acids and has an

estimated MW of 36.2 kDa, and the CP of isolate DsMV-TEN contains 314 amino acids and

has a MW of 34.6 kDa. The CP sequence comparisons and phylogenetic reconstructions

indicated that the DsMV is a distinct potyvirus within the passionfruit woodiness virus

subgroup cluster.

Symptoms caused by DsMV in nature may differ considerably according to the aroid

host infected and the season in which the host is grown. In some aroids such as Colocasia,

Richardia Xanthosoma Zantedeschia and certain Dieffenbachia cultivars, DsMV causes leaf

mosaic, leaf mottle, chlorotic streaking along veins on leaves, and leaf distortion. The

inflorescence of Zantedeschia may show color break, with blisters and malformation (Zettler et

al., 1970; Alconero & Zettler, 1971; Hakkaart & Waterreus, 1976; Hill & Wright, 1980;

Paludan & Begtrup, 1982; Van der Meer, 1985; Greber & Shaw, 1986). In other aroids, such

as Aglaonema and Spathiphyllum, DsMV symptoms are usually much less evident. A

characteristic of many aroids is that DsMV symptoms are intermittently expressed, often

making detection difficult. In some instances, such as with Colocasia, Dieffenbachia,

Richardia, symptom expression is seasonal, most often appearing on foliage produced during

fall and/or spring months (Chase & Zettler, 1982; Greber & Shaw; 1986). Some aroid cultivars











more readily express DsMV symptoms than others. The caladium cultivars, 'Candidum' and

'White Christmas', for example, are much more likely to exhibit symptoms throughout the

growing season than the cultivars 'Frieda Hemple' and 'Carolyn Whorton' (Zettler & Hartman,

1986). The virus can cause yield loss of up to 60% in Caladimn, Dieffenbachik Philodendron

and Zantedeschia (Zettler & Hartman, 1987).


Diagnosis and detection of DsMV have been based on techniques of bioassay,

serology, and/or light and electron microscopy. Philodendron selloum seedlings are very

susceptible to infection of DsMV and have been used frequently in bioassays (Zettler et al.,

1970; Paludan & Begtrup, 1982); however, the seed viability of this and other aroids is short,

and the seed are not readily available commercially (Zettler & Hartman, 1987). Since DsMV is

not the only potyvirus which infects aroids (Shimoyama et al., 1992a; Chen, personal

communication), light and electron microscopy can not necessarily be used as reliable evidence

for ascertaining the existence of DsMV (Zettler & Hartman, 1987), nor are these methods

likely to be as sensitive as some others (Greber & Shaw, 1986). Serological methods, such as

immunodiffusion tests, have been used extensively in diagnosis and detection of DsMV, but

this method requires larger quantities of antiserum than techniques such as ELISA (Zettler &

Hartman, 1986). ELISA was also reported to be used for DsMV detection (Rana et al., 1986;

Hu et al., 1995), but either the antiserum used reacted with host proteins or no difference could

be detected among different isolates.

Dasheen mosaic virus has been successfully controlled by tissue culture methods in

some greenhouse grown aroids such as Anthwuium, Dieffenbachia, Philodendron,











Spathiphyllum, Syngonium and Zantedeschia, although the primary purpose of the tissue

culture method for these plants is rapid in vitro propagation (Zettler & Hartman, 1986, Gomez

et al., 1989). Despite these techniques, DsMV still causes problems in some low-cash field-

grown aroids such as Caladium, Colocasia and Xanthosoma, (Zettler et al. 1991).

Dasheen mosaic occurs throughout the world, due to the international distribution of

aroids as food plants and ornamentals and the perpetuation of the virus by propagating plants

vegetatively. Little is known about the evolutionary relationships among DsMV isolates

occurring in different geographic areas and among various hosts. There is evidence for the

occurrence of a severe strain of the virus in Frech Polynesia (Jackson, 1982). Symptomatic and

serological differences were noticed between an Egyptian isolate and a Florida isolate of

DsMV from taro (Abo El-Nil et al., 1976). Symptomatic and serological differences between a

Fiji isolate and a Florida isolate from taro were also noted (Abo El-Nil., 1977). Differences in

growth rate between P. sellout seedlings inoculated with several DsMV isolates were

reported, in which 79.5% and 4% weight reduction for taro and dieffenbachia isolates,

respectively, were reported (Wisler et al., 1978). The DsMV antiserum against a Chinese

evergreen isolate reacted with homologous isolate but not Florida and Fuji isolates in DAS-

ELISA (Kositratana, 198?). Shimoyama et al. (1992a) reported that the DsMV antiserum they

prepared did not react with several other potyvirses, including PVY-T, WMV-2, ZYMV,

BYMV, TuMV, BICMV, SbMV and konjak mosaic viruses. These studies indicated that

distinct DsMV isolates do exist, although the relationships between them remain obscure.











Other studies, in contrast, such as that by Zettler et al. (1987) indicate only slight differences

among DsMV isolates.

As an important group of ornamentals, domestic and international movement of aroids

occurs on a large scale. In addition to commercial bulk shipments of plant materials, there is

considerable movement of small quantities of clonal plant germplasm for purposes of

establishing botanical collections, breeding programs and medicinal plants. In order to avoid the

spread of some aroid diseases, including DsMV, international guidelines for the safe movement

of aroid germplasm have been recommended (Zettler et al., 1989). These guidelines

recommend growing plants in greenhouses and indexing them periodically for at least one crop

cycle before certifying them as being virus-free. Such conditions, if implemented, would impose

severe constraints in the international trade of these plants. Reliable, sensitive, practical, and

rapid means for detecting DsMV could help overcome such problems. A better knowledge of

the characteristics of DsMV, regarding both its general and molecular properties, would

provide the basis needed for improving the detection of DsMV and for understanding the

relationships among different DsMV isolates. The purposes of this study were to (i) purify the

virus for molecular studies of DsMV, (ii) obtain and evaluate antiserum to be used to diagnose

this virus. (iii) develop reliable and effective methods for detecting DsMV in propagating units

of Caadium, Colocasia and Xanthosoma.

An isolate from caladium was purified and its viral RNA used to establish a cDNA

library. The 3-terminal region of this isolate was sequenced and compared to those of other

potyviruses. The CP gene was expressed in Escherichia coli and used to obtain the antiserum









19

that was useful for serological tests. It was determined that the CP of DsMV isolates varied in

size and in nucleotide sequence. Serological procedures such as ELISA and Western blotting

were developed for detecting DsMV. Also reported was the use of RT-PCR for DsMV

detection.














CHAPTER 2
CLONING, SEQUENCING OF THE 3'-TERMINAL REGION
AND EXPRESSION OF THE COAT PROTEIN OF DSMV-Chl


Introduction


As a potyvirus, dasheen mosaic virus (DsMV) shares many properties with other

aphid-borne potyviruses, such as having flexuous, filamentous particles, inducing formation of

cylindrical inclusions (CI) in infected cells, having a positive-sense, single-stranded RNA

genome, being sap- and aphid-transmissible, having a relatively restricted host range, and being

serologically related to many other potyviruses (Zettler et al., 1978; Li et al., 1992). The RNA

of a Florida DsMV isolate from taro (Colocasia esculenta) has been translated in the rabbit

reticulocyte lysate in vitro system (Nagel & Hiebert, unpublished) to give five major

polypeptides, namely the HC-Pro, CI, NIa, NIb and CP proteins. The molecular weight of the

genomic RNA was estimated to be 3.2 x 106 for a California isolate from Chinese evergreen

(Kositratana, 1985), and 3.42 x 106 for a Japanese DsMV isolate from taro (Shimoyama et al.,

1992). The coat protein (CP) and the 3' non-coding region (3'-NCR) of two DsMV taro

isolates, LA and TEN, have been sequenced recently (Pappu et al., 1994b). However, the

characteristics of the DsMV genome organization and the sequences of other genes have not

been studied. Furthermore, understanding the molecular characteristics of DsMV will help to

define the virus and improve prospects fot its diagnosis and detection for the purposes of

establishing practical quarantine regulations and facilitating the production of virus-free plants











through micropropagation. The only source ofDsMV antiserum was that provided by Abo El-

Nil et al. (1977), but this supply is nearly exhausted. DsMV isolates also cross reacted with

PTY 1 monoclonal antibody, which is commercially available through Agdia Inc. (Elkhart, IN).

However, since this and other monoclonal antisera may not react with some potyviruses or

some potyviral isolates thereof (Jordan, 1992), there is an inherent risk of not detecting certain

viruses or viral isolates lacking the epitopes common to most other potyviruses. In this study,

the 3'-terminal region 3158 nucleotides of a DsMV caladium isolate was cloned, sequenced

and analyzed. The DsMV CP was expressed in Escherichia coli and used to produce

polyclonal antiserum for DsMV diagnosis and detection.


Materials and Methods


Virus Isolates


A 'Candidum' caladium plant infected with an isolate of DsMV was maintained in a

greenhouse and used to inoculate P. selloum seedling plants at the 7-8 leaf stage with an

artist's airbrush gun. Source tissue was triturated in a mortar and pestle with 0.05 M potassium

phosphate buffer (w/v, 1:20), pH 7.2, containing 600 mesh carborundum. The supernatant was

added to a glass bottle, which was connected with a portable carbon dioxide tank, and was

propelled onto the first two newly expanded leaves of P. selloum seedlings using carbon

dioxide at a pressure of 40 pounds per square inch (Gooding & Ross, 1970).











Virus Purification

The ultracentrifugation method used for DsMV purification was similar to that for

ZYMV described by Wisler (1992) with modifications. The leaf or root tissues of infected

caladium, calla lily, cocoyam, taro or Philodendron selloum seedlings were homogenized in a

cooled Waring blender for 1 min with 3 volumes of 0.3 M potassium phosphate buffer, pH 8.2,

to which 0.6% sodium diethyldithiocarbamate (DIECA) and 0.2% J-mercaptoethanol (J3-ME)

were added. The homogenate was emulsified with 1:1 (w/v) cold trichlorofluorethane (Freon)

for 30 sec. Following centrifugation at 2,500 g with a Sorvall high speed centrifuge (Du Pont

Co., Wilmington, DE) for 10 min, the aqueous phase was filtered through four layers of cheese

cloth. The suspension was centrifuged at 7,500 g for 10 min. Triton X-100 was added to the

aqueous phase to a final concentration of 1%. The mixture was stirred for 20 min at 40C. The

mixture was then centrifuged in a Beckman Ti 70 rotor (Beckman Instruments, Inc., Palo Alto,

CA) at 100,000 g (37k rpm) for 90 min. The pellet was resuspended in 20 mM HEPES, pH

8.2, containing 10 mM EDTA and 0.1% P-ME, with a tissue homogenizer. After stirring for

one hour at 4C, the suspension was partially clarified by centrifugation at 2,000 g for 10 min.

The supernatant was layered on the top of Beckman SW41 tubes containing a Cs2SO4 solution

(11.6 g salt plus 27 ml of 20 mM HEPES, pH 8.2), 5 ml per tube. The tubes were centrifuged

at 140,000 g (32k rpm) for 16-18 hr at 4oC. The two opalescent virus zones 24-26 mm from

the bottom of the tube were collected by droplet fractionation. The collected fractions

containing the virions were combined and diluted with 1 volume of 20 mM HEPES, pH 8.2,

and centrifuged at 10,000 g for 10 min. The virus was precipitated from the supernatant by











adding polyethylene glycol (PEG, MW 8,000) to a concentration of 6% (w/v), stirring at 4C

for 30 min, and then centrifuging at 10,000 g as before. The pellet was resuspended in 0.5 ml

of 20 mM HEPES, pH 8.2. Concentrations of the virus preparations were estimated by

spectrophotometry using an approximate extinction coefficient of A2w 2.6 (1 mg/ml, 1 cm light

path). Five pl of a 1:20 dilution of the virus preparation was mixed with an equal volume of

Laemmli dissociating solution (Laemmli, 1970), boiled for 2 min and analyzed by sodium

dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Gels were stained with

Coomassie Brilliant Blue R-250 (Gibco BRL, Gaithersburg MD), and destined in a solution

containing 1% acetic acid and 10% methanol for visualization. The virus preparations were

stored at -800C, and then used for RNA isolation.


Viral RNA Isolation


Viral RNA was isolated from purified virus preparations by two methods, sucrose

gradient centrilfgation and phenol/ chloroform extraction.

A purified virus preparation (5 mg) was dissociated by incubation in an equal volume

of RNA dissociating solution (0.2 M Tris-HCl, pH 9.0, containing 2 mM EDTA, and 2%

SDS) and 400 pg/ml ofprotease K for 10 min at room temperature. Linear-log sucrose density

gradients were made as described (Brakke and Van Pelt, 1970). The gradients were allowed to

diffuse overnight at 4C. A volume equal to that of the samples was removed from each

gradient before loading the samples. The gradients were centrifuged at 185,000 g (39k rpm)

for 5 hr at 150C with a Beckman SW41 rotor. Gradient zones containing RNA were collected











using an ISCO UV fractionator (ISCO, Inc., Lincoln, NE). The RNA was precipitated

overnight at -200C by adding 1/20 volume of 3 M sodium acetate (pH 5.2), and 3 volumes of

100% cold ethanol. After centrifugation at 10,000 g for 10 min, the pellet was rinsed with 70%

ethanol and vacuum-dried. The RNA was then resuspended in a small volume of sterile water

and stored at -800C.

The viral RNA was also extracted from incubated virus preparations by adding an

equal volume of phenol/chloroform (1:1) to the mixture, inverting gently and centrifuging at

12,000 g in an Eppendorf microcentrifuge for 5 min. The phenol fraction was removed by

adding an equal volume of chloroform, and centrifuging. The RNA was then precipitated with

3 volumes of 100/o ethanol in the presence of 0.3 M sodium acetate (pH 5.2) at -20C

overnight. After centrifugation, the RNA was resuspended in sterile water and stored at -800C.


Synthesis ofcDNAs


Two types of cDNAs were synthesized, one with oligo(dT)12.1g primers and the other

with random hexamers. Freshly prepared viral RNA was used for cloning, with 5 Pg RNA

being used as templates for the first strand synthesis. The first and second strand cDNAs were

synthesized using a TimeSaver" cDNA synthesis Kit (Pharmacia Biotech., Inc., Piscataway,

NJ) following the manufacturer's instructions. The first-stranded cDNA synthesis was labeled

with 1 l (10 pCi -32P-dCTP) (3000 Ci/mmol) (Du Pont NEN, Boston, MA) and used as a

tracer. After the double-stranded cDNA synthesis, the sample was extracted with phenol-











chloroform and purified by passing through a Sepharose CL-4B column. The next step

involved ligation ofEcoRINotI linkers to cDNAs.

In vitro packaging of the XDNA was performed using the Packagene Lambda DNA

Packaging System under the conditions recommended by the manufacturer (Promega Co.,

Madison, WI). The phage titer was determined by plating small aliquots of the packaging

extract on XL1-Blue cells.

Size analysis of cDNA was performed on a 0.9% gel. The gel was exposed to X-ray

film and compared to a 1-kb ladder molecular weight standard (Gibco BRL).


Immunoscreening ofDsMV-Chl Phage Clones


Immunoscreening for clones expressing CP or CI genes of the DsMV genome was

conducted essentially according to manufacturer's instructions as described in the PicoBlue"

Immunoscreening Kit and Predigested Lambda ZAP I/EcoRI/CIAP Cloning Kit (Stratagene,

La Jolla, CA). The titered bacteriophage library (500 pfu/plate) was used to inoculate 200 pl of

freshly prepared XL1-Blue ofE coli competent cells (OD6oo= 0.5), and incubated at 370C for

15 min. The mixture was added to 3 ml of NZY top agar (0.5% NaCl, 0.2% MgS4. 7H20,

0.5% yeast extract, 1% casein hydrolysate, and 0.8% agar) containing 500 pg/ml X-

galactoside and 10 mM isopropyl-B-D-thiogalactopyranoside (IPTG), which was poured onto

a NZY plate (80 mm x 80 mm) and incubated at 370C for 5-6 hr to allow for formation of

plaques (0.5 mm in diameter). The plates were chilled at 4C for 2 hr in order to prevent the

top agar from sticking to the nitrocellulose membranes. The plates were dried in a hood for 15











min, and sterile nitrocellulose membranes soaked in 10 mM IPTG were carefully layered upon

them. The plates were incubated at 420C for an additional 4-5 hr to allow expression of the

cloned gene(s). IPTG is a gratuitous inducer used to induce the expression of the B-

galactosidase fusion protein, and %ZAP II phage is a temperature-sensitive mutant (Pharmacia

Biotech.). The membranes were lifted, rinsed three times for 10 min each in TBST solution,

and processed as described in western blot analysis in chapter 4. DsMV-FL antiserum (1:1000)

and DsMV-FL CI antiserum (1:1000) were employed as primary antibodies. Positive plaques

were isolated with a sterile glass pipette and placed in 50 pl of SM buffer (100 mM NaCI, 50

mM Tris-HCl, pH 7.5, 10 mM MgCI2) containing 3 drops of chloroform. The tubes were

vortexed and incubated at room temperature for 2 hr to allow the phages to diffuse into the

solution. Forty pl aliquots of the phage clones were added to 200 pl of the XL1-Blue cells

(OD6o= 0.5), absorbed at 370C for 15 min, and amplified at 37TC in a shaker overnight in 5 ml

of2X YT with 0.2% maltose and 10 mM MgCI2. The cultures were centrifuged at 2,000 g for

10 min to remove the cell debris. Supernatants containing phages were stored at 40C with

addition of chloroform to a final concentration of 5%.


In Vivo Excision ofDsMV-Chl Plasmids from The XZAP II Vector


The plasmid clones were excised from the XZAP II vector according to the

manufacturer's instructions using a Predigested XZAP I/EcoRI/CIAP Cloning Kit

(Stratagene) with the following modification except that amplified phage clones (200 ul) were

used to start the excision. After excision, plasmids (pDCPn or pDCIn) were transformed into











SOLR of E coli cells, and plated on LB/AMP plates (0.5% NaCI, 1.0% tryptone, 0.5% yeast

extract, 1.5% agar, and 500 pg/ml). Single colonies were picked up, amplified and used for

clone analysis.


Analysis ofDsMV-Chl Clones:


Plasmids were purified according to a mini-prep procedure described by QIAGEN Inc.

(Chatsworth, CA). Up to 1.5 ml of cell culture was collected by centrifugation in a

microcentrifuge at 12,000 g for 1 min at 40C. The supernatant was discarded, and the pellet

was resuspended in 320 Wl of P1 buffer (50 mM Tris-HC1, pH 8.0, 10 mM EDTA, RNase A

100Ig/ml). After incubation at room temperature for 5 min, 320 pl ofP2 (200 mM NaOH, 1%

SDS) was added and the tube was mixed gently by inversion. After adding 320 pl ofP3 buffer

(3 M potassium acetate, pH 5.5), the tube was centrifuged at 12,000 g for 5 min. The aqueous

phase was transferred to a fresh tube and 1 volume of 100% isopropanol was added. The

mixture was then centrifuged at 12,000 g for 5 min. The pellet was resuspended in 25 pl of

sterile water, and then screened by EcoRI (Promega) digestion for clone with a single insert to

be used for sequence analysis.


DNA Sequencing ofDsMV-Chl Clones


The plasmid preparations were sequenced by the dideoxy chain termination procedure

using the Sequenase Version 2.0 DNA Sequencing Kit (United States Biochemical, Cleveland,

OH) with ca-35S-dATP. T7 and T3 primers complementary to the pBlueScript vector and











synthesized internal primers were used to complete the sequence determination for either two

clones or both strands of the same clone. Sequencing products were performed in a 6% (w/v)

polyacrylamide gel containing 7 M urea. Autoradiographs of air-dried sequencing gels were

made using XAR x-ray film (Eastman Kodak, Rochester, NY).


Pairwise Comparison and Phylogenetic Analysis


Sequence analysis and comparisons were made using the University of Wisconsin

Genetics Computer Group (GCG) Sequence Software package version 7.0 (Devereux et al.,

1984) available at the University of Florida ICBR Biological Computing Facility. The

sequences of the 3' non-coding region, CP, and NIb proteins of DsMV isolates were compared

to 14 other potyviruses. The sequences of 14 other potyviruses and DsMV-LA were obtained

by Farfetch from GeneBank, and the sequences were aligned using the Pileup method of

aligning multiple sequences in the GCG program.

Phylogenetic analyses were done by a cladistic parsimony method using the computer

program PAUP version 3.1.1 developed by D. L. Swoford (distributed by the Illinois Natural

History Survey, Champaign, Ill). Optimum trees were obtained with the heuristic method with

the tree-bisection-reconnected branch-swapping option or exhaustive method. One hundred

bootstrap replications were performed to establish confidence estimates on groups contained in

the most parsimonious tree.











Aphid Transmission


Three caladium isolates (Chl, Ch2 and Ch3) were tested for aphid transmission. The

aphids (Myzuspersicae), maintained on pepper (Capsicwn amnuum), were starved for two hr

and then placed on infected leaves for 30-40 sec. The aphids were then moved to P. sellomw

seedlings used as test plants. Each trial consisted of 6 test plants and each test plant received 10

aphids. After 15 min the aphids were killed. The plants were maintained in a greenhouse, and

two weeks later, were observed for symptom expression. Visual observations were confirmed

by I-ELISA test using DsMV-FL antiserum.


Subcloning and Expression of the DsMV Coat Protein and NIb protein


Based on the CP nucleotide sequence of DsMV-Chl, two primers, namely EH232 (5'-

AAGCTTGCAGGCTGATGATACAG-3') corresponding to the 5'-end of the CP gene and

EH234 (5'-GAATTCTTGAACACCGTGCAC-3') corresponding to the 3'-end of the non-

coding region, were synthesized at the University of Florida DNA Synthesis Core. A Hindm l

or EcoRI restriction site was included at the 5'-end of each primer for directional cloning of the

CP gene into an expression pETh-3 vector (McCarty et al., 1991) at HindIII and EcoRI on the

polylinker.

The intact CP gene (942 nt) was amplified by PCR as described in chapter 4. The DNA

fragment was purified from a 0.9% agarose gel by using Prep-A-Gene Master Kit (Bio-Rad )

according to manufacturer's instructions. The purified DNA was then cloned into a PCR

vector pGEM T vector (Promega) to generate pGEM-T-CP according to the manufacturer's











instructions. The plasmid pGEM-T-CP was digested by HindIt I and EcoRI (Promega) and

subcloned into HindIIIEcoRI double-digested pETh-3 to generate pETh-3-CP. The

nucleotide sequence of the vector/insert junction was confirmed by DNA sequencing using the

Sequenase Version 2.0 DNA Sequencing Kit (US Biochemical).

A single colony culture (5 ml) of E. coli BL21DE3pLysS, transformed with pETh-3-

CP, was grown overnight at 370C in LB containing 50 igg/ml ampicillin and 25 pg/ml

chloramphenicol. The overnight culture was diluted 1:100 into 5 ml or 250 ml (large scale) of

M9 medium (Sambrook et al., 1989) containing 50 pig/ml ampicillin, 25 Ig/ml

chloramphenicol, 0.4% glucose and 0.5% tryptone, and the culture was shaken at 370C until

early log phase (OD600 = 0.6). Then IPTG was added to a final concentration of 1 mM, and

growth was continued for an additional 4 hr at 370C. E. coli BL21DE3pLysS cells were

harvested by centrifugation at 5,000 g, the culture broth was discarded, and the cell pellet was

resuspended in one tenth of the original volume of TE buffer (10 mM Tris-HCI, pH 8.0, 1 mM

EDTA) and frozen overnight at -200C. The viscous cell suspension was thawed, sonicated for

30 sec and the lysate was then centrifuged at 10,000 g for 10 min. The pellet was resuspended

in a small volume of TE buffer. The preparations were then analyzed by SDS-PAGE. Both

noninduced pETh-3-CP and pETh-3 cultures were tested as controls.

The same approach used for the DsMV CP expression was applied to express the NIb

polymerase in E. coli. Three pairs of synthesized primers were used for PCR amplification of

either the intact or truncated NIb gene or a fragment containing the C-terminal region of the

NIa and the NIb gene: EH239 (5'-GAATTCATGCAAAGTGGGTGGGTGA-3')











corresponding to the 5'-end of the NIb gene and EH238 (5'-

AGATCTCTACTGCAACACAACCTC-3') corresponding to the 3'-end of the NIb gene,

primers EH256 (5'-AAGCTTGCAGCGAGATGATGA-3') corresponding to a sequence in

the NIb gene and EH238, primers EH267 (5'-GGGATTGGAATAGGCT-3') corresponding

to a sequence in the 5'-terminal region of the NIa gene and EH238.


Antigen Preparation and Antibody Production


After sonication, the fusion protein expressed by E. coli was partially purified by three

cycles of centrifugation at 10,000 g, washing each pellet with TE buffer, and separating the

proteins by preparative SDS-PAGE. Protein bands were visualized by incubating gels in 0.2 M

KCI for 10 min at 40C. The targeted protein band was excised, washed three times in cold

deionized water, and frozen at -200C. The cut pieces of the gel were then eluted using a Bio-

Rad Electoelutor at 10 mAmp/tube with constant current for 5 hr. The extracts containing the

protein were collected and dialyzed overnight against distilled water at room temperature.

Purity of the eluted protein was checked by analytical SDS-PAGE, after which the protein was

lyophilized.

Immunization was conducted as described by Purcifull and Batchelor (1977). A quarter

ml of purified protein (1 mg) at 4 mg/ml was emulsified with an equal volume of complete

Freund's adjuvant and injected into the thigh muscles of a New Zealand white rabbit (No.

1210). This was followed by two 1.0 mg injections of the CP protein emulsified with

incomplete Freund's adjuvant two or three weeks later. Blood was collected weekly for two











months, starting two weeks after the third injection. After a four week interval, a booster

injection was given, followed by subsequent bleeding.


Serological Evaluation ofAntiserum


The antiserum obtained was tested by SDS-immunodiffusion, I-ELISA and Western

blotting analysis. The SDS-immunodiffusion tests were conducted using crude extracts as

described by Purcifull and Batchelor (1977). The immunodiffusion medium consisted of 0.5%

Noble agar, 1% sodium azide and 0.5% SDS. About 12 ml of the thoroughly mixed agar

suspension was poured into a disposable plastic petri dish (90 mm x 15 mm). A set of wells

consisting of six peripheral antigen wells surrounding a central antiserum well with an interval

of 5 mm from the edges of one another were made with a gel cutter. Samples were prepared by

grinding plant tissues in 1% SDS solution (final concentration) with a mortar and pestle. After

addition of the antigens and antisera, the double radial diffusion plates were incubated at 250C.

Results were recorded after 24 hr and 48 hr. The DsMV-FL antiserum was used as a control.

Both I-ELISA and Western blotting using the DsMV-FL antiserum and the expressed DsMV

CP antiserum were conducted using procedures described in Chapter 4.


Results


Purification ofDsMV-Ch and Isolation of Viral RNA


The DsMV virions were only purified from the first two newly formed leaves after

inoculation of P. sellowu seedlings grown in relatively cool weather conditions during the











spring. The Aad/Aaso ratio of the final purified virus preparations obtained by 2 mM HEPES

buffer in 2 trials ranged from 1.11 to 1.20, with an average of 1.16. The estimated virus yields

were 4-8 mg/100g leaf tissue. SDS-PAGE analysis showed that the amount of virus obtained

by ultracentrifugation was slightly higher than that obtained by PEG precipitation (Fig. 2-1A).

The leaf tissues had higher concentrations of the virus than the root tissue (Fig. 2-1B).

Although many DsMV particles were seen in the leaf dip preparations, the virus could not be

purified from infected leaves of caladium, calla lily, cocoyam, and taro, presumably due to the

presence of viscous host components, probably polysaccharides.

Although cesium chloride was used in the purification of DsMV in previous research

(Abo El-Nil et al., 1977; Kositratana, 1985; Shimoyama et al., 1992), DsMV was degraded in

cesium chloride gradients made in 20 mM HEPES, pH 8.0, containing 10 mM EDTA and

0.1% P-ME. Electron microscopic examination of the virus preparations revealed numerous

fragments of virus particles. It was presumed, therefore, that degradation of virus particles

resulted from cesium chloride. In cesium sulfate gradients, however, two opalescent virus

bands were formed, and the bottom band contained more virions than the top band based on

the SDS-PAGE result (Fig. 2-1B). Furthermore, the virions from the bottom band collected

from the cesium sulfate gradients were less degraded than those noted in cesium chloride

gradients based on electron microscopy (Fig. 2-2).

Viral RNA was readily extracted in phenol/chloroform, and the procedure required a

minimum of time to process, thereby reducing the chance of degradation. The yield of viral

RNA extracted by phenol/chloroform was 14.5 pg, which was much higher than that by

















1 2 3


1 2 3


66K

45K N
35K U


i] -


"aCP


A


B


Fig. 2-1. Analysis of partially purified and purified DsMV-Chl preparations. A. The
partially purified preparations. Lane 1, protein standards: bovine serum albumin (66 kDa),
egg albumin (45 kDa), pepsin (35 kDa); lane 2, the purified preparation using the
ultracentrifugation method; lane 3, the purified preparation using PEG precipitation. B.
The purified preparations. Lane 1, the viral preparation collected from the top band of the
Cs2SO4 gradient; lane 2, the viral preparation collected from bottom band of the Cs2SO4
gradient; lane 3, the preparation from root tissues of P. selloum seedlings. The virus was
purified from inoculated P. selloum seedlings as procedures described in the text. Protein
samples were analyzed by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis
followed by Coomassie staining. The coat protein of the purified DsMV-Chl is indicated by
the arrow.


_


" :i;f;i':









35












_% .


















Fig. 2-2. Electron micrograph of a purified DsMV-Chl preparation negatively stained
with 2% uranyl acetate. The virus was purified from inoculated P. selloum seedlings by
ultracentafugation purification method described in text. Bar = 500 nm.











sucrose gradient (5.28 pg), and the resulting RNA was much more intact in agarose gel (Fig.

2-3).


Molecular Analysis ofcDNA Clones


After serological screening with DsMV-FL virion antiserum, 16 clones expressing the

CP (pDCP) were selected and screened by EcoRI and NotI digestions. Twelve pDCP clones

with a single insert were selected for direct sequence mapping (Table 2-1). The sizes of the

inserts in these clones ranged from 1.1-5.2 kb. The reaction of DsMV-FL CI antiserum was

nonspecific, and 22 white clones (pDCI) were randomly selected for EcoRI and NotI digestion

screening and sequence mapping. Among these clones, eight had correct inserts, which ranged

from 0.9 to 2.7 kb (Table 2-2). These cDNA clones with overlapping inserts covered all but the

1.2 kb central region and the upstream 5'-terminal region of the DsMV-Chl genome, based on

comparisons with the published sequence of SbMV (Jayaram et al., 1992) (Fig. 2-4). Twelve

clones with insert sizes ranging from 1.1 to 3.4 kb were selected for sequence analysis (Fig. 2-

5).


Sequences Representing the 3'-terminal region ofDsMV-Chl


The nucleotide sequence of 3158 bases (excluding the poly(A) tail) corresponding to

the 3'-terminal region of DsMV RNA was determined (Fig. 2-6). The nucleotide positions

were confirmed by analyzing either both strands of the same clones or individual strands of

different clones. Stretches of 20-40 adenosine residues were found at the ends of two clones















1 2


1OKb NO!


Fig. 2-3. Agarose gel electrophoresis ofDsMV-Chl RNA isolated from purified virions:
Lane 1, viral RNA isolated by phenol/chloroform extraction; lane 2, viral RNA isolated by
sucrose gradient. The viral RNA was loaded onto a 0.9% agarose gel. The separated RNA
was stained by ethidium bromide and visualized under UV light.















Table 2-1. DsMV-Chl cDNA clones identified
by immunoscreening' and preliminary sequencing2


Clone
designation

pDCP1

pDCP2

pDCP3

pDCP5

pDCP6

pDCP7

pDCP8

pDCP10

pDCP11

pDCP12

pDCP14

pDCP15

pDCP16


Approximate
size (kbp)

2.0

5.2

4.2

1.1

2.8

1.4

2.5

2.1

2.5

2.9

1.9

2.2

1.2


ScDNA library in XZAP II vectors was plaque screened by DsMV- FL
antiserum. White plaques expressing the CP were selected.
2 The selected clones were confirmed by EcoRI digestion, and the clones
with a single insert were selected. The positive clones were sequenced by
vector primers, T3 and T7, and results were mapped to relative positions
in the RNA genome compared to a published nucleotide sequence of
SbMV by a Gap program of the GCG program package.
3 Reactive with DsMV-FL antiserum.


Serological
reactivity3

CP

CP

CP

CP

CP

CP

CP

CP

CP

CP

CP

CP

CP
















Table 2-2. DsMV-Chl cDNA clones identified by preliminary sequencing'


Clone
designation

pDCI2


pDCI4

pDCI7

pDCI18

pDCI19

pDCI21

pDCI22


Approximate
size (kbp)

1.8


1.3

0.9

1.5

2.7

1.8

1.6


HC-Pro, CI

HC-Pro

NIb

HC-Pro, CI

P1, P2

P1, P2


cDNA library in XZAP H vectors was plaque screened by DsMV-FL
CI antiserum. White clones were selected. The selected clones were
confirmed by EcoRI digestion, and the clones with a single insert were
selected.
2 The positive clones were sequenced by vector primers, T3 and T7, and
the results were mapped to relative positions in the RNA genome
compared to a published SbMV nucleotide sequence by a Gap program
of the GCG program package.


Relative
position2

NIb, CP

























iii

a2


I-I
H


zC 0
) 3 a)









Z 04
0 En
0 C4
fi a






QH 0 0


0U
ma



0 ,Q
a 0
(0 4)

0 )3
Z0 (0






H 04 5
4 rE-4 0
004

040 -

H) -H (




1-1 4J O-




fo ^ (0 -


















>1 0 (dr4
> ()C 4 )
0 300

4 1H ) (0
u I4-I .U (

0 Iv 4 0 0
kH 0- II
[4- 1 qf
CL AU -U


Q 04




0 40 *H en 0
A t ,O -









,44 0 0I
4 4 H
oo -, a c




I I A I ^ 0
H a0
fe O Q *(U

|to *y -HO




H 0 0 0
0 U co (U1AO0)









II


( 0 ma
( a o <0 oE(
A (Q 0 .
I0- OO 0


J) ro a) a
I O II
(0 C ( II
O T II
(O (U
IHO C


I n 0 0
0~ a *
*0 E 0)
a ir* E
in ~- 4 d k





























Fig. 2-6. Nucleotide sequence of the 3'-terminal region of DsMV-Chl. The predicted amino
acid sequence of the open reading frame coding for the putative polyprotein is shown.
Underlined amino acids correspond to the NIa protease activity site (between residues 31 and
34), to the polymerase active motif (between 451 and 495), and aphid transmission motif
(amino acids 662-664). Amino acids underlined with dotted lines and slashes (/) correspond to
the putative polyprotein cleavage sites.















1 CAAAGAGAGAGGAGCGCGTATGCATGGTTGGCACGAATTTCCAAGATAAAAGCATGCGCG 60
KRE E R V C M V G T N FQ DK S MRA

61 CTACGATCTCGGAAGCATCTCTCATTCTACCAGAAGGGCAGGGAACATTCTGGAAACATT 120
TI S E A S LI L P E G Q G T F W K H W

121 GGATTTCAACTAAGGATGGGGAGTGTGGGATCCCATGGTGGCTGTGAGTGATGGATATA 180
I S T K D G E C G I P M V A V S D G Y I

181 TAGTTGGTTTCCATGGCCTTGGCTCAAACATATCTGAGAGGAACTATTTTGTCCCTTTCA 240
VG FH G L G S N IS E RN Y F V P F T

241 CTGACGACTTCGAGCAAACACATCTTAAAAGGCTCGATAGTCTTGAATGGACCCAGCATT 300
D D F E Q T H L K R L D S L E W T Q H W

301 GGCACTTTCAGCCTGACAAGATAGCTTGGGGTTCACTCAGACTAGTTAATGACCAACCTA 360
H FQ PD K I A W G S L R L V N DQ P T

361 CTGAAGATTTTAAGATTTCAAAGTTAATTTCAGACCTTTTCGAAAATCCTGTACAATTAC 420
E D F K I S K L I S D L F E N P V Q L Q/

421 AAGGGTCTCAAAGTGGGTGGGTGATTAATACTGCCGAAGGGAATCTAAAAGCTGTTGCCC 480
G SQ S G W V I N T A E G N L K A V A R

481 GGTGTGAAAGTGCACTCGTGACAAAACATACAGTGAAGGGACCGTGCAGATACTTCTCAG 540
CE S A L V T K H T V K G PC RY F SE

541 AGTACTTGAGTTCAAACCAGGAAGCTGAAAAGTTTTTCAGACCATTCATGGGAGCTTATC 600
YLS S N Q E A E K F F R P F M G A Y R

601 GCTCAAGTAGACTTAACAGGGAAGCTTTCAAGAAAGACTTCTTTAAGTATGCAAAGCCTG 660
SS R L N R E A F K K D F F K Y A K P V

661 TTGAGTTGAATAAAGTTGATTTCAATGCCTTCCAGATTGCAGTGGCAAGTGTGGAGACAA 720
E L N K V D F N A F Q I A V A S V E T M

721 TGATGATGGAAACAGGATTTAGCGAATGTGAGTATACACAGACGCTCAAACAATCATTG 780
M M E T G FS E CE Y IT D A Q T I I D

781 ACTCCCTCAATATGAAAGCAGCTGTGGGGGCTCAATATCGTGGGAAGAAGTCTGAGTACT 840
S L N M K A A V G A Q Y RG KK S EY F

841 TCCACGATATGGAGGTCTACGATATGGAACGACTCCTCTTCCAAAGTTGTGAAAGACTAT 900
H D M E V Y D M E R L L FQ SC E RL F

901 TCTATGGGAAGAAGGGAGTCTGGAATGGCTCATTAAAGGCAGAGTTGCGTCCAATTGAGA 960
YGK K G V W N G S L K A E L R P I E K

961 AAACGCAACTCAATAAAACAAGGACATTTACTGCCGCTCCTCTTGACACATTGTTAGGAG 1020
TQ LN KT RT F T A A P L DT L L G A

1021 CGAAGGCTTGTGTGGATGACTTTAACAACCAATTCTATAGTCTCAACCTAAAGTGTCCAT 1080
K A C V D D F N N Q F Y S L N L K C P W

Fig. 2-6-continued











44



1081 GGACAGTTGGTATGACCAAATTTTATAAAGGTTGGGATTCATTGATGAGAAAGCTTCCAG 1140
T V G M T K F Y K G W D S L M R K L P E

1141 AAGGATGGGTCTACTGCCACGCTGATGGGTCTCAGTTTGACTCATCATTAACACCACTCC 1200
G W V Y C H A D G S Q F D S S LT PLL

1201 TCATAAACGCGGTCGTGGACATCAGGAAGTTTTTCATGGAGGAGTGGTGGGTTGGTGAAG 1260
IN A V V D I R K F F M E E W W V G E E

1261 AAATGCTTGACAACTTGTATGCTGAAATTGTCTACACACCTATATTGACCCCAGATGGAA 1320
M L D N L Y A E I V Y T P I LT P D G T

1321 CAATTTTTAAGAAATTTAGGGGCAATAATAGTGGACAACCATCGACAGTCGTGGATAATA 1380
I F K K F R G N N S GQ PS T V V D N T

1381 CATTGATGGTTGTCATTTCAGTTTACTACGCATGTATCAAGCAAGGTTGGACGGATTATG 1440
L M V V I S V Y Y A C I KQ G W T DY D

1441 ATGTTAGTCAAAGAATAGTCTTCTTTGCAAATGGTGATGACATCATATTGGCTGTGCAGC 1500
V S Q R I V F F A N G D D I I L A V Q R

1501 GAGATGATGAACCCATCCTTAATACCTTTCAGGATTCTTTTCACGAATTGGGGCTCAACT 1560
D D E P I L N T F Q D S F H E L G L N Y

1561 ATGATTTCTCTGAGCGCACGATGAAGAGAGAGGAACTTTGGTTCATGTCCCATCAAGCTA 1620
D FS E R T M K RE E LW F M S H Q A M

1621 TGAAAGTAGGGATGTTTATATCCCTAAACTAGAGCGAGAGAGAATTGTATCAATTTTAG 1680
K V G D V Y I P K L E R E R I V S I LE

1681 AATGGGATAGAAGCAAAGAAATCATGCACAGAACAGAGGCAATTTGTGCAGCTATGATAG 1740
W D R S K E I M H R T E A I C A A M I E

1741 AAGCATGGGGTTACACTGACCTCTTGCAAGAAATAAGGAAATTCTATCTATGGCTGCTTG 1800
A W G Y T D L L Q E I R K F Y L W L L E

1801 AAAAAGATGAATTTAAGACACTAGCCTCTGAAGGGCGGGCACCATATATTGCTGAAACAG 1860
KD E F K T L A S E G R A P Y I A E T A

1861 CACTCAAGAAGCTATACACAGATGAAAACATAAAGGAGTGCGAGCTTCAGCGTTATCTGG 1920
L K K L Y T D E N I K E C E L Q R Y L D

1921 ATGCTTTCAATTTTGAAATGTTCTGCGAACATGATGAGGTTGTGTTGCAGGCTGATGATA 1980
A F N F E M F C E H D E V V L Q/A D D T

1981 CAGTTGATGCAAGGAAAAACAACAATACTACAAAAACAACTGAAACAAAAACACCTGCAA 2040
VD A R K N N N T T KT T ET KT PAT

2041 CGGGTGGTGGGAACAACCAAACAACAACACGCCACCTGTAGATAACACAACCAACAATA 2100
G G G N N T N N N T P P V D N T TNNN

2101 ATCCTCCACCGCCACCACCGGCGGTTACAAAGGTAACAGAGGTACCCGCCAATAAGCAAG 2160
PP P P P P A V T K V T E V P A N K Q V

Fig. 2-6-continued















2161 TGGTCCCAGCAGCAAGTGAGAAAGGTAAGGAAGTGTGTAAAGATGTTAACGCTGGCACTA 2220
V P A A S E K G K E V V K D V N A G T S

2221 GTGGCACATACTCCGTACCTCGGTTGAATAGAATCACAAACAAAATGAATTTACCTTTAG 2280
G T Y S V P R L N R I T N K M N L P L V

2281 TTAAAGGTAAATGCATTTTAAATTTGAATCATTTAATCGAGTACAAGCCAGAACAGCGTG 2340
K G K C I L N L N H L I E Y K P E Q R D

2341 ACATATTCAATACCAGAGCCACCCACACTCAATTTGAAGTCTGGTACAATGCTGTCAAGA 2400
I F N T R A T H T Q F E V W Y N A V K R

2401 GAGAATACGAGCTTGAGGATGAGCAGATGCACATAGTTATGAATGGTTTTATGGTTTGGT 2460
E Y E L E D E Q M H I V M N G F M V W C

2461 GCATCGATAATGGAACATCACCTGATATCAACGGGGCTTGGGTGATGATGGACGGAAACG 2520
I D N G T S P D I N G A W V M M D G N D

2521 ATCAAATTGAATACCCGTTGAAGCCAATTGTTGAAAATGCAAAACCAACCTTGCGTCAGA 2580
QI EY P L K P I V E N A K PT L RQ I

2581 TAATGCATCACTTTTCTGACGCAGCAGAGGCATACATTGAACTGAGAAACGCAGAGAAAC 2640
M H H FS D A A E A Y I E L R N A E K P

2641 CGTATATGCCTAGATACGGTCTTATTCGCAATTTACGTGATGCAAGTCTCGCCCGGTATG 2700
Y M P R Y G L I R N L R D A S L A R Y A

2701 CTTTTGACTTTTATGAGGTCAATTCTAAAACACCGGTGCGAGCAAGAGAAGCAGTTGCGC 2760
F D F Y E V N S KT P V R A R E A V A Q

2761 AAATGAAGGCGGCTGCACTCTCTAACGTTACCACTAGGTTGTTTGGTTTGGATGGTAACG 2820
M K A A A L S N V T T RL F G L D G N V

2821 TTTCAACTTCAAGCGAGAACACTGAAAGGCACACTGCAAAAGACGTCACACCAAACATGC 2880
ST S S E N T E RH T A K D V T P N M H

2881 ACACTTTACTTGGTGTTTCGTCTCCGCAGTAAAGGTCTGGTAAACAGGGCCGACAGTTAT 2940
T L L G V S S P Q *

2941 TGGCTCGCTGTTTGTAGTTTTATTTATATAAAGTATTGTTTGTATTCAAGTAGTGCTATT 3000

3001 TGGTTATAAACTACAGCGTGGTTTTCCACCGATGTGGAGTTGGCTTTGCACCCTATTATC 3060

3061 TACGTCCTTTATGTATTTGAAAACTACTGAACTACTGCACCTACGTCAGACCGCAAGGCG 3120

3121 ATGGGCGCGGTAGGCGAGACGCTTCGTGCACGGTGTTCA(n) 3159


Fig. 2-6-continued











(pDCP1 and pDCP7), suggesting this end represented the 3' end of the DsMV RNA.

Computer analysis of the sequence revealed a unique large open reading frame (ORF) in the

positive strand (virion sense). No other ORF of significant size was observed in either the plus

or minus strands. The ATG start codon of the single ORF was not identified. However, by

analogy with other potyviruses, it is presumably located near the 5'-terminus of the genome.

The ORF terminated at the first TAA stop codon, which is located at 246 residues upstream of

the 3' end. Nucleotide sequence heterogeneity among different cDNA clones was found to be

about 98-99%.

The putative amino acid sequence includes 140 C-terminal amino acids of the NIa

protease (about 40% of the protein), the NIb protein consisting of 516 amino acids, and the

coat protein consisting of 313 amino acids (Fig. 2-6). The cleavage sites between these three

proteins were identified by comparing them with those of other sequenced potyviruses

(Dougherty et al.; 1988; Shukla et al., 1994). The cleavage site between the NIa and the NIb

proteins was at the amino acid 140-141 position (Q/G), whereas the site between the NIb and

the CP proteins was at the amino acid 656-657 position (Q/A). The conserved cleavage

sequence VXXQ/A(G,S,E) has been found in both sites, which were VQLQ/G between the

NIa and the Nib proteins and VVLQ/A between the Nib and the CP proteins.


Analysis of the NIb Protein


The Nib protein of DsMV contained the consensus sequence motif

SGXXXTXXXNT-(30aa)-GDD. This polymerase motif was found in the DsMV NIb protein











beginning at amino acid residue 451 of the sequence. A second consensus motig YCHADGS,

was present in the NIb protein at amino acid positions 384 to 390. The similarity of the DsMV

NIb protein to those of other potyviruses ranged from 58% to 68% at the nucleotide level

(Table 2-3), and from 72% to 85% at the amino acid level (Table 2-4), respectively. A

phylogenetic tree was obtained from the alignment of putative NIb proteins ofDsMV-Ch and

14 other potyviruses (Fig. 2-7) on the premise that this protein is the most conserved one

among all the potyviruses (Shukla at al., 1994). Though DsMV was distinct from other

potyviruses, it was closely related to ZYMV in the BCMV subgroup. The potyviruses, SbMV

and WMV-2, were clustered together, confirming their close relationship (Shukla et al., 1994).

It is interesting to note that all potyviruses except those in the BCMV subgroup were clustered

together.

The putative amino acid sequence of the NIb protein of DsMV-Chl was used to

prepare a hydrophobicity plot according to the method ofKyte & Doolittle ( 1982) (Fig.2-8).

The N-terminal and C-terminal regions of this protein are hydrophilic, while in the central

region there is an even distribution of hydrophilic and hydrophobic regions. Each of these

regions consists of about 20 amino acids, suggesting the transmembrane property of the NIb

protein.


Analysis of the Coat Protein


The coat protein of DsMV-Chl also showed a relatively high degree of similarity with

those of other potyviruses (Table 2-5). The similarity ranged from 55% to 68% at the















Table 2-3. Percent nucleotide identity of NIb genes
ofDsMV-Chl and 14 other potyviruses
Percent similarity
Virus
2 3 4 5 6 7 8 9 10 11 12 13 14 15

1. DsMV-Chl 68 67 67 67 66 58 59 59 58 59 58 59 59 58

2. BCMV 60 72 73 70 60 59 58 58 59 59 59 59 61

3. SbMV 70 80 69 58 59 56 61 58 58 59 60 61

4. PStV 71 68 58 59 56 56 60 59 57 59 60

5. WMV-2 70 58 60 59 57 60 58 59 60 61

6. ZYMV 59 57 59 56 59 58 59 60 60

7. PVY-N 59 59 59 60 62 61 58 60

8. TEV 60 58 63 61 58 59 61

9. PSbMV 61 61 60 64 59 61

10. PRSV-P 59 60 60 59 62

11. TuMV 60 61 61 65

12. TVMV 60 60 62

13. SCMV 55 61

14. BYMV 61

15. PPV

i Name and abbreviations of the viruses used in table: BCMV, bean common
mosaic virus; BYMV, bean yellow mosaic virus; DsMV-Chl, dasheen mosaic virus
Chl isolate; PPV, plum pox virus; PSbMV, pea seed-borne mosaic virus; PRSV-P,
papaya ringspot virus type P; PSbMV, pea seed-borne mosaic virus; PStV, peanut
stripe virus; PVY-N, the N strain of potato virus Y; SbMV, soybean mosaic virus;
SCMV, sugarcane mosaic virus; TEV, tobacco etch virus; TuMV, turnip mosaic
virus; TVMV, tobacco vein mottling virus; WMV-2, watermelon mosaic virus 2;
ZYMV, zucchini yellow mosaic virus.
2 Percent similarity of Nib genes among the DsMV-Chl and other potyviruses was
obtained by Pileup in the GCG program package.















Table 2-4. Percent similarity of the NIb protein, the coat protein and
the 3' non-coding region (3'-NCR) ofDsMV-Chl and 14 other potyviruses


Percent similarity2
Virus1 NIb CP 3'-NCR

DsMV-Chl 92 79
BCMV 85 82 36
SbMV 84 82 39
PStV 83 77 38
WMV-2 84 80 35
ZYMV 83 80 34
PVY-N 73 79 35
TEV 75 74 39
PSbMV 74 72 34
PRSV-P 73 72 34
TuMV 75 73 36
TVMV 72 69 33
SCMV 74 68 35
BYMV 76 70 36
PPV 74 66 34

1 Name and abbreviations of the viruses used in table: BCMV, bean common mosaic
virus; BYMV, bean yellow mosaic virus; DsMV-Chl, dasheen mosaic virus Chl
isolate; PPV, plum pox virus; PSbMV, pea seed-borne mosaic virus; PRSV-P,
papaya ringspot virus type P; PSbMV, pea seed-borne mosaic virus; PStV, peanut
stripe virus; PVY-N, N strain of potato virus Y; SbMV, soybean mosaic virus;
SCMV, sugarcane mosaic virus; TEV, tobacco etch virus; TuMV, turnip mosaic
virus; TVMV, tobacco vein mottling virus; WMV-2, watermelon mosaic virus 2;
ZYMV, zucchini yellow mosaic virus.
2 Percent similarity of the NIb, the CP and the 3'-NCR between the DsMV-Chl
and other potyviruses was obtained by Gap in the GCG program package.

















SbMV


47
- BCMV
66


PStV
74


ZYMV


DsMV-Chl
148


PSbMV


TuMV


TVMV


PRSV-P


Fig. 2-7. Phylogenetic tree obtained from the
alignment of putative polymerases between DsMV-Chl
and 14 other potyviruses using the PAUP program.
The tree is the bootstrap 50% majority-rule
consensus tree. The number above a given branch
refers to branch length. Vertical distances are
arbitrary, and horizontal distances reflect number of
amino acid differences between branch nodes.






















co E




s 0






O)







4)
.- .. a








4-

S00 c0
4' CT


0CI
I-.








S2
0 s
0* .S

















1-s

I
o>

C 00
C
O4


C CN T- 0 .-











Table 2-5. Percent nucleotide identity of CP genes
of two DsMV isolates and 14 other potyviruses
Percent similarity2


Virus'


1. DsMV-Chl

2. DsMV-LA

3. BCMV

4. SbMV

5. PStV

6. WMV-2

7. ZYMV

8. PVY-N

9. TEV

10. PSbMV

11. PRSV-P

12. TuMV

13. TVMV

14. SCMV

15. BYMV

16. PPV


2 3 4

84 68 67

68 67

72


SName and abbreviations of the viruses used in table: BCMV, bean common mosaic
virus; BYMV, bean yellow mosaic virus; DsMV-Chl, dasheen mosaic virus Chl
isolate; DsMV-LA, dasheen mosaic virus LA isolate; PPV, plum pox virus; PRSV-P,
papaya ringspot virus type P; PSbMV, pea seed-borne mosaic virus; PStV, peanut
stripe virus; PVY-N, N strain of potato virus Y; SbMV, soybean mosaic virus;
SCMV, sugarcane mosaic virus; TEV, tobacco etch virus; TuMV, turnip mosaic
virus; TVMV, tobacco vein mottling virus; WMV-2, watermelon mosaic virus 2;
ZYMV, zucchini yellow mosaic virus.
2 Percent similarity of CP genes among the DsMV-Chl and other potyviruses was
obtained by Pileup in the GCG program package.











nucleotide level, and from 67% to 82% at the amino acid level (Table 2-4). Individual

comparisons showed that potyviruses such as BCMV and SbMV are the most closely related

to DsMV among those potyviruses for which the sequences are known. A comparison of the

coat protein ofDsMV-Chl with that ofDsMV-LA (Pappu et al., 1994a) revealed a similarity

of 84% at the nucleotide level and 92% at the amino acid level, indicating that many of the

nucleotide changes observed were silent. Diversity in the coat proteins of the DsMV-Chl and

other potyviruses occurred predominantly in sequence and length at the N-terminal regions

(Shukla et al., 1994). The conserved property of the CPs among different virus strains has been

used to classify the potyviruses and their strains (Shukla et al., 1988). Two sorts of

phylogenetic trees were obtained by alignment of the coat proteins of the Chl and LA isolates

of DsMV and either 8 (for exhaustive search) or 14 (for bootstrap search) other potyviruses.

The exhaustive search generated a tree showing that both DsMV isolates were closely related

to those in the BCMV subgroup (Fig. 2-9); however, in the bootstrap 50% majority-rule

consensus tree (Fig. 2-10), the two DsMV isolates were clustered together, and distinct from

other potyviruses.

At the N-terminal region of the DsMV-Chl CP, there was a DAR triplet at position

+5 to +7 in relation to the cleavage site. A single mutation from G to A at the 1986 nucleotide

changed the amino residue from a nonpolar glycine to a basic arginine. To confirm this was a

true point mutation, ten different clones covering the CP gene were sequenced, and all of them

had this point mutation.














159

128
PVY-N

100
183
PPV
83
142 248
TBV

161
TEV

65
9 DsMV-Chl
96
6DsMV-LA
120
89
89 BCMV
108
147
4 SbMV

160
160 SCMV





Fig. 2-9. Phylogenetic tree obtained from the
alignment of coat proteins between DsMV isolates
and 8 other potyviruses using the PAUP program.
The tree is the exhaustive consensus tree. The
number above a given branch refers to branch length.
Vertical distances are arbitrary, and horizontal
distances reflect number of amino acid differences
between branch nodes.













DsMV-Chl
- DsMV-LA




21

33

4



84


15SbMV
- SbMV


WMV-2


PStV


TEV


TuMV
69
69 PVY-N

88
PRSV-P
50 119 P
PPV
93
PSbMV
105
BYMV
99
99TVMV

122
122 SCMV



Fig. 2-10. Phylogenetic tree obtained from the
alignment of coat proteins between DsMV isolates
and 14 other potyviruses using the PAUP program.
The tree is the bootstrap 50% majority-rule
consensus tree. The number below a given branch
refers to branch length. Vertical distances
are arbitrary, and horizontal distances reflect
number of amino acid differences between branch
nodes.











The 3'-NCR of DsMV showed less than 40% homology with those of other

potyviruses, but higher than the 84% among Chi and LA isolates (Table 2-4). A search for

possible secondary structure revealed only short stretches of potentially unstable base pairing.

/
Aphid Transmission


All three caladium isolates, DsMV-Chl, -Ch2, and -Ch3 were determined to be

transmitted by aphids from their original hosts to P. selloum seedlings. Three out of six P.

selloum plants became infected after aphid inoculation with the Chl isolate, two out of six

plants with Ch2, and one out of six plants with Ch3, as indicated by symptom expression and

positive reactions in I-ELISA.


Expression of the CP and the NIb Genes in E. coli


To express DsMV CP as an intact protein, a 1.2 kb DNA fragment was obtained by

PCR using two viral specific primers, EH232 and EH234, and subcloned into a pETh-3

expression vector to yield pETh-3-CP. Large quantities of the insoluble DsMV CP were

expressed by the pETh-3-CP recombinant (Fig. 2-11). The expressed CP protein was about 39

kDa, which contained a 15-amino-acid residue as a fusion protein. Purification of the expressed

protein was facilitated by its insolubility. The protein was partially purified from cell lysates by

several cycles of centrifugation and washing the pellets. Further purification was accomplished

by preparative SDS-PAGE and electroelution.






























1 2 3


S5 7


53k






29kf~1


WW .


Ti

,...

,. :
-.-;ii.

';'`~''
:. ;s;:
:;:

""
:"


Fig. 2-11. Analysis of the DsMV pETh-3-CP expressed in E. coli: Lane 1, protein
standards: bovine serum albumin (68 kDa), glutamate dehydrogenase (53 kDa), carbonic
anhydrase (29 kDa); lanes 2-5, E. coli BL21DE3pLysS with pETh-3-CP, 0, 1, 3, and 5 hr
after inducing by IPTG, respectively; Lane 6-7, E. coli BL21DE3pLysS with pETh-3 vector, 0
and 5 hr after inducing by IPTG. Partially purified proteins were obtained by centrifuged cell
lysates of cultures. Protein samples were analyzed by 10% sodium dodecyl sulfate
polyacrylamide gel electrophoresis followed by Coomassie staining. The expressed coat protein
of 39 kDa is indicated by the arrow.


i











The expressed protein reacted with DsMV-FL polyclonal antiserum and with PTY 1

monoclonal antiserum. When comparing it to its homologous state in Western blotting, the

expressed DsMV-Chl CP was smaller in size than that of the native one (44 kDa) (Fig. 2-12).

The expected DNA fragments of both the intact and truncated NIb genes were

obtained by PCR using pDCPI2 as the template. The correct clones were confirmed by

restricted enzyme digestions and sequencing. However, induction of these clones was

unsuccessful in both BL21DE3pLYsS and BL21DE3pLYsE. The latter carries a CE6 plasmid

(data not shown). The growth of bacterial cells slowed following induction with IPTG, and no

expression was detected.


Application of DsMV Antiserum against Expressed Coat Protein


The expressed DsMV coat protein was a good immunogen and the antiserum prepared

to it compared favorably with DsMV-FL antiserum (Table 2-6). The antiserum obtained in the

second bleeding reacted with DsMV from infected plants in immunodiffusion tests (data not

shown). It also reacted in I-ELISA and Western blotting without any discernible background.

Both the antiserum to the expressed CP and the antiserum to the virion reacted with five

DsMV isolates, namely Chl, Ch2, Ch3, Ce, and Xc, as well as ZYMV, PRSV-P, PRSV-W

and WMV-2, but not with an isolate of tulip breaking virus from Lilium. Neither antiserum

reacted with squash mosaic comovirus or with the healthy controls.



















1 2 3 4


5 6


43K


w -0


Fig. 2-12. Western blotting analysis of the expressed CP and native CP of DsMV: lane 1,
expressed CP; lane 2, extract from DsMV-infected Caladium hortulanum 'Candidum'
(Chl); lane 3, extract from DsMV-infected Colocasia esculenta; lanes 4-5, extracts from
DsMV-infected Zantedeschia aethiopica (Za); lane 6, healthy Philodendron selloum.
Proteins were electrophoresed in a 10% sodium dodecyl sulfate polyacrylamide gel. After
electrophoresis, the proteins were blotted onto a nitrocellulose membrane and reacted with
DsMV-FL antiserum, and then detected with phosphatase-conjugated goat anti-rabbit
antibodies.


r*.~.... ~L














Table 2-6. Comparison of the DsMV-FL antiserum
and the expressed coat protein antiserum in I-ELISA'

DsMV-FL AS3 Expressed CP AS4
Antigen2 1:1000 1:10000

DsMV-Chl 0.467 0.519
DsMV-Ch2 0.542 0.384
DsMV-Ch3 0.576 0.975
DsMV-Cel 0.439 0.318
DsMV-X 0.345 0.285
Healthy caladium 0.000 0.002
TBV 0.000 0.001
Healthy lily 0.000 0.003
ZYMV 0.961 0.294
WMV-2 0.720 0.398
PRSV-W 0.431 0.135
SqMV 0.000 0.003
Healthy pumpkin 0.000 0.016

The antisera were compared using I-ELISA as described in
the text. The absorbancies (A405) represent the mean values
of at least four wells.
2 Name and abbreviations of the viruses used in test: DsMV,
several isolates of dasheen mosaic virus; PRSV-W, papaya
ringspot virus type W; PRSV-P, papaya ringspot virus type P;
TBV, tulip breaking virus infecting lily; WMV-2, watermelon
mosaic virus 2; ZYMV, zucchini yellow mosaic virus;
SqMV, squash mosaic comovirus.
3 Antiserum (rabbit No. 7?) against purified virions of DsMV
Florida taro isolate (Abo El-Nil et al., 1977).
4 Antiserum (rabbit No. 1210) against E. coli expressed coat protein
of DsMV-Chl from caladium isolate.












Discussion


Dasheen mosaic virus antiserum of high quality has only been successfully obtained

three times, using viral preparations purified from infected plants (Abo El-Ndi et al., 1977;

Kositratana, 1985; Shimoyama et al., 1992). Most other workers either failed to purify the

virus (Hakkaart & Waterreus, 1975; Samyn & Welvaert, 1977) or could not eliminate host

contaminants that interfered with serological tests (Rodoni & Moran, 1988). During the initial

experiments in this study, several different virus purification methods, including one described

by Abo El-Nil et al. (1977) were tried, also without much success. The isopycnic methods

using either phosphate or HEPES buffers were less efficient in preventing irreversible virus

aggregation during the extraction process and in reversing virus aggregation during PEG

precipitation. Precipitated virions thus were not resuspended and were lost during subsequent

low speed centrifugation. In this study, ultracentrifugation using phosphate buffer was used

successfully to purify DsMV in conjunction with cesium sulfate density gradient centrifugation.

Philodendron selloum was the only host from which the virus was purified. The virus

could only be purified from the first two symptomatic leaves of inoculated P. selloum

seedlings, however, because the virus titers in the subsequently formed leaves dropped

considerably. The yields of DsMV produced in this study were 4-8 mg/100 g of tissue. We

were unsuccessful in purifying DsMV from other hosts (caladium, calla lily, cocoyam and taro),

despite the high virus titers in these hosts based on the detection of numerous virus particles in

negatively stained leaf extracts. This lack of success can be attributed to the highly viscous











nature of leaf extracts of these hosts, which as in other reports (Hakkaart & Waterreus, 1975;

Samyn & Welvaert, 1977), interfered with purification. However, it has been reported that

DsMV, konjak mosaic and CMV were purified from Amorphophallus konjak (Shimoyama et

al., 1992). Also, DsMV and an unidentified isometric virus were purified from Pinellia (Chen,

personal communication).

The viral RNA isolated by the phenol/chloroform extraction yielded more intact DsMV

RNA than the sucrose gradient method, which is an important factor to consider when

establishing a cDNA library for a virus.

The sequence data of the 3'-terminal region of DsMV-Chl support that it is a distinct

member of the genus Potyvirus in the family Potyviridae since the similarities of the virus with

other potyviruses were 72 to 85% with the NIb proteins, 67-82% with the coat proteins, and

less than 40% with the 3'-NCRs, respectively (Table 2-4). Comparison of NIb proteins and

coat proteins of DsMV and 14 other potyviruses revealed a close relationship of DsMV with

those in the BCMV subgroup. The phylogenetic trees obtained by alignment of the coat

proteins using two exhaustive and bootstrap searches were not the same, however, indicating

that differences exist between different search programs. It is interesting to note that all

potyviruses except DsMV and those in the BCMV subgroup were clustered together in one

group, on the basis of the Nib proteins and the coat proteins (Fig. 2-7 & 2-10, respectively).

Two proteolytic cleavage sites at the C-terminal region of the DsMV-Chl were

identified. The protease responsible for the cleavage at these sites is the NIa protease.

Comparison of determined and predicted cleavage sites in the C-terminal halves of the potyviral











polyproteins revealed that the NIA protein cleaves at the Q/A, Q/G, Q/S, Q/T, Q/, or Q/E

dipeptide sequences (Dougherty & Carrington, 1988, Shukla et al., 1994). Further comparison

of the potyviral cleavage sites revealed a conserved sequence VXXQ/A (G, S, E) around the

NIa protease cleavage sites. Based on these rules, two putative cleavage sites were identified in

the sequenced region of DsMV. The sequence VXLQ/G was found around the cleavage site of

the NIa and the NIb proteins, and the sequence VXLQ/A was found around the cleavage site

of the NIb and the coat proteins. This conserved cleavage sequence has also been found in

SbMV (Jayaram et al., 1992), BCMV isolates (Khan et al., 1993), and PStV (Gunasinghe et

al., 1994), suggesting a close relationship among these viral proteases.

Comparison of NIb proteins of different potyviruses have revealed that this protein is

the most conserved of the individual potyviral proteins (Shulda et al., 1994). The DSMV-Chl

NIb protein is 83-85% similar to the analogous proteins of the members in the BCMV

subgroup, and 72-76% similar to the other potyviruses compared (Table 2-4). The NIb protein

of potyviruses contains the conserved motif SGXXXTXXXNT-18-37aa-GDD, which is

conserved in both animal and plant positive-stranded viral RNA-dependent RNA polymerase

(Kamer & Argos, 1984). This motif was present in the NIb protein of DsMV as

SGQPSTVVDNT-30aa-GDD in a position analogous to that of other sequenced potyviruses

when they were aligned according to the sequenced homology. A second consensus motif;

YCDADGS, which is also believed to be involved in the putative polymerase activity (Allison

et al., 1986; Domier et al., 1986) was present in the NIb protein of DsMV as YCHADGS.

When compared with other potyviruses, the motif YCHADGS is present in the NIb proteins in











the members of the BCMV subgroup, while the motif YCDADGS are present in all the other

potyviruses compared.

The CP sequences of potyviruses are highly conserved throughout most of the

sequence but diverge in sequence and length at the N-terminal region. The CP sequence of

DsMV-Chl is approximately 80% similar to those of the BCMV subgroup and ranged from 67

to 79% similar to those of other potyviruses compared. The DsMV isolates displayed higher

levels of homology in the CP sequences (92-96%). From phylogenetic analysis using PAUP, it

is clear that DsMV is a distinct virus, albeit relatively close to the potyviruses in the BCMV

subgroup.

According to the CP sequence, DsMV-Chl was not expected to be aphid-

transmissible, since it did not have the DAG sequence in the N-terminus portion of the CP as is

typical for aphid-transmissible potyviruses (Harrison & Robinson, 1988). Instead, it had the

DAR at the N-terminal region of the coat protein. However, when the aphid transmission tests

were conducted using DsMV-Chl from the infected caladium as virus source, this isolate

proved to be aphid transmissible. Furthermore, when the same isolate was cloned by RT-PCR

from the original host (caladium cultivar 'Candidum') and sequenced, the triplet DAG rather

than DAR was present. Kositratana reported (1985) that a California DsMV isolate from

Chinese evergreen plants was not aphid-transmissible from infected P. selloum plants to healthy

P. selloum seedlings, which might also resulted from the mutation at the DAG triplet. It is

probable that mutation at this triplet was frequent, due to the propagation of a variant in P.











selloum seedlings. This variant might have been present in the original DsMV infected

caladium plants, or it could have been the result of a single point mutation (GGG to AGG).

The antiserum against the E. coli expressed CP of DsMV-Chl reacted with DsMV

isolates and other potyviruses tested in a manner similar to that of the DsMV-FL antiserum

obtained by Abo El-Nil et al. (1977). The DsMV antisera not only reacted with its homologous

isolates, but also with most potyviruses tested, which indicated that the close relationship of

DsMV with these other potyviruses. The expression of the CP gene in vitro provided a suitable

alternative for obtaining immunogen for antiserum production to this virus, which thus far has

been difficult by conventional means.














CHAPTER 3
VARIABILITY OF COAT PROTEINS AMONG ISOLATES
OF DASHEEN MOSAIC VIRUS


Introduction


Many cultivated aroids have become ubiquitously infected with dasheen mosaic

virus throughout the world, since they are exclusively propagated by vegetative means and

thus can harbor the virus indefinitely (Zettler & Hartman, 1977). Although DsMV has been

reported from many countries, the relationships between isolates have not yet been studied

extensively. A severe DsMV isolate of taro has been reported in French Polynesia

(Jackson, 1982). Biological and serological differences between isolates were noticed in

infected taro from Egypt and Florida (Abo El-Nil et al., 1977), and between Florida and Fiji

isolates of taro (Abo EL-Nil et al., 1977). The serological difference between a California

isolate from Chinese evergreen and two isolates from taro, Florida isolate and Fiji isolate

(Kositratana, 1985). It has been reported that the estimated molecular weights of DsMV

coat protein varied among isolates from different hosts (Li et al., 1992; Pappu et al.,

1994b), and this variability could be associated with diversity on the N-terminal region of

the CPs (Pappu et al., 1994b).

The accumulating body of knowledge of coat protein sequences has been used by

various authors to differentiate potyviruses and their strains. Comparisons of the growing

number of potyviruses sequenced revealed that distinct potyviruses show only 38-71%

66











sequence homology in their coat proteins, whereas this homology is greater than 90% among

strains belonging to the same virus (Shulda & Ward, 1988, 1989). Furthermore, the 3' non-

coding regions (3'-NCRs) of different potyviruses also display a high degree of sequence

variation (similarity of 39-45% only), whereas sequences are highly conserved between virus

strains (similarities of 83% and more). Recently, the coat protein and the 3'-NCR sequences of

four DsMV isolates (Pappu et al., 1994a; Li et al., 1994; this study) are available to be

compared.


Materials and Methods


Antigens


Florida isolates of DsMV used in this study were DsMV-Ce from taro (Colocasia

esculenta), and DsMV-Chl, -Ch2, -Ch3 from three cultivars of caladium (Caladium

hortulanum), Candidum', 'Carolyn Whorton' and 'Frieda Hemple', respectively. The

calla lily (Zantedeschia aethiopica) isolate, DsMV-Za, was from California; and the

cocoyam (Xanthosoma caracu) isolate, DsMV-Xc, was from Puerto Rico. These isolates

were maintained in their original hosts throughout this investigation. The isolates were

also maintained in mechanically inoculated P. selloum seedlings throughout the study.

Symptoms of P. selloum usually appeared 2 weeks after inoculation, and the first

symptomatic leaf formed after inoculation was routinely tested.

Antigens of PRSV-W, PStV, PepMoV, PVY, TEV, WMV-2 and ZYMV were

provided by D. E. Purcifull (Department of Plant Pathology, University of Florida,











Gainesville). TVMV was from T. P. Pirone (Department of Plant Pathology, University of

Kentucky, Lexington). A Puerto Rican passionfruit potyvirus (Bird et al., 1991) was

provided by A. C. Monllor (Department of Crop Protection, University of Puerto Rico,

Rio Piedras). Also tested in this investigation were antigens of a gladiolus isolate of

BYMV (Nagel et al., 1983), bidens mottle collected from Bidenspilosa in the campus of

the University of Florida (Gainesville), and two strains of PMoV from peanut and

bambarra groundnut (Li et al., 1991).


Antisera


The purified DsMV-FL IgG ofAbo El-Nil et al. (1977) was routinely used in this

study. Antisera of BICMV, PRSV-W, PMoV, PStV, PVY, TEV, WMV-2 and ZYMV

were provided by D. E. Purcifull. Antisera to the Puerto Rican passionfruit potyvirus was

provided by A. C. Monllor. The PTY 1 potyvirus group cross reactive monoclonal

antiserum (PTY 1) was purchased from Agdia, Inc. (Elkhart, IN).


Propagations and Analysis of DsMV Isolates


Each DsMV isolate in its original host was maintained in a greenhouse. The leaf

samples were collected from infected plants and tested by Western blotting as described in

Chapter 4.

Six DsMV isolates, -Chl, -Ch2, -Ch3, -Cel, -Xc and -Za were used to inoculate

Philodendron selloum seedlings at the 7-8 leaf stage in the spring months of 1991. Each











isolate was then serially transferred at least twice to additional plants of P. selloum

seedlings. The first symptomatic leaves were collected from the infected plants of each

passage, and prepared for Western blotting.

Each isolate was also used to inoculate tissue culture-derived, virus-free plants of

taro, cocoyam, and the caladium cultivars 'Candidum', 'Carolyn Whorton', 'Frieda

Hemple' and 'Rosebud'. The leaf tissues of the infected plants were prepared for and

tested by Western blotting.


Cloning and Nucleotide Sequencing ofPCR-amplified CP Genes


The CP genes of the DsMV isolates Chla and Ch2 were obtained by RT-PCR as

described in Chapter 2. The DsMV-Chla was from caladium cultivar 'Candidum' which

was the same host from which DsMV-Chl was isolated, and -Ch2 was from caladium

cultivar 'Carolyn Whorton'. After electrophoresis, the desired amplified CP fragments

were isolated by using Prep-A-Gene Kit (Bio-Rad Laboratories, Hercules, CA), ligated

into pGEM-T vector (Promega Co., Madison, WI), and transformed into competent

Escherichia coli DH5a cells. The recombinant colonies were screened by the blue-white

color reaction. The plasmid preparations from the selected clones were then sequenced by

the termination method (Untited States Biochemical, Cleveland, OH) using T7, SP6 vector

primers and DsMV CP-specific internal primers. The nucleotide sequences were

determined for both strands.











Sequence and Comparison of the CP and the 3'-NCR


The nucleotide sequences of the coat protein genes and the 3' non-coding regions

of three caladium isolates, Chl, Chla, Ch2, and the two taro isolates, LA and TEN,

sequenced by Pappu et al. (1994b) were compiled, and analyzed. The Chla isolate was

cloned from the original host of the DsMV-Chl, caladium cultivar 'Candidum' by RT-

PCR. The level of the sequence relatedness was compared using Pileup available in the

GCG program package from the University of Wisconsin (Devereux et al., 1984).


Results


Symptoms in P. selloum


Each of six isolates tested induced systematic vein chlorosis in the first and/or

second leaves of P. selloum after mechanical inoculation. However, the isolates DsMV-

Ce, -Chl, and -Ch2 induced more severe symptoms in P. selloum than those of the Ch3,

Xc and Za isolates. The mild isolates induced chlorotic spots in the first symptomatic

leaves, whereas severe isolates induced pronounced stunting. Similar symptom differences

among DsMV isolates in P. selloum have been described by Abo El-Nil et al. (1977) and

Wisler et al. (1978).












The Coat Proteins of DsMV in Their Original Hosts


The estimated CP molecular weight (MW) of each of six DsMV isolates from their

original hosts varied (Fig. 3-1). In Western blots using DsMV antiserum, the respective

highest CP MW values for the isolates Chl, Ch2, Ch3, Ce, Xc, and Za were 44, 46, 38,

44, 47 and 43 kDa, whereas values for the other eleven potyviruses tested were much

lower, ranging from 31 kDa for TEV to 36 kDa for the Puerto Rican passionfruit virus

(Fig. 3-2). Similar results were noticed when polyclonal antisera of BICMV, PRSV-W,

PMoV, PStV, TEV, WMV-2, ZYMV, and the Puerto Rican passionfruit potyvirus, were

tested. In reciprocal tests with DsMV and two PMoV strains from peanut and bambarra

groundnut, homologous reactions were much stronger than heterologous ones. Likewise,

homologous reactions were stronger than heterologous reactions when two PMoV strains

were compared against the other potyviruses (i.e. PRSV-W, PStV, TEV, WMV-2, and

the Puerto Rican passionfruit potyvirus).


The Coat Proteins of DsMV Isolates in Other Hosts


The CP MWs corresponding to those noted in their respective original hosts were

detected for each of six DsMV isolates infecting P. selloum. Each isolate was manually

inoculated to plants ofP. selloum, caladium, cocoyam and taro (Fig. 3-3). Similarly, after

two or more serial passages through manually inoculated P. selloum seedlings, respective

CP MW values remained consistent for each of the DsMV isolates tested (Fig. 3-4).







































Fig. 3-1. Western blotting analysis of the coat proteins of dasheen mosaic virus (DsMV)
isolates from their original hosts: lane 1, healthy Colocasia esculenta; lane 2, BRL protein
standard; lane 3, Xanthosoma caracu (Xc); lane 4, Colocasia esculenta (Ce); lane 5,
Caladium hortulanum 'Carolyn Whorton' (Ch2); lane 6, C. hortulanum 'Frieda Hemple'
(Ch3); lane 7, C. hortulanum 'Candidum' (Chl); and lane 8, Zantedeschia aethiopica
(Za). Proteins were electrophoresed in a 10% sodium dodecyl sulfate polyacrylamide gel.
After electrophoresis, the proteins were blotted onto a nitrocellulose membrane and
reacted with DsMV-FL antiserum, and then detected with phosphatase-conjugated goat
anti-rabbit antibodies.







































Fig. 3-2. Western blotting analysis of the Chl isolate of dasheen mosaic virus (DsMV-
Chl) and other potyviruses: lane 1, healthy Philodendron selloum; lane 2, BRL protein
standard; lane 3, DsMV-Chl; lane 4, tobacco etch virus; lane 5, passionfruit potyvirus;
lane 6, watermelon mosaic virus 2; lane 7, papaya ringspot virus type W; lane 8, zucchini
yellow mosaic virus; lane 9, pepper mottle virus; lane 9, potato virus Y; lane 10, bean
yellow mosaic virus (gladiolus strain); lane 11, bidens mottle virus. Proteins were
electrophoresed in a 10% sodium dodecyl sulfate polyacrylamide gel. After
electrophoresis, the proteins were blotted onto a nitrocellulose membrane and reacted by
DsMV-FL antiserum, and then detected with phosphatase-conjugated goat anti-rabbit
antibodies.









74










J :


















Fig. 3-3. Western blotting analysis of the Chl isolate of dasheen mosaic virus (DsMV-
Chl) transferred to several different hosts: lane 1, BRL protein standard; lane 2, healthy
Philodendron selloum; lane 3, Xanthosoma caracu; lane 4, Colocasia esculenta; lane 5,
Caladium hortulanum 'Carolyn Whorton'; lane 6, C. hortulanum 'Candidum'; lane 7, C
hortulanum 'Candidum'; lane 8, C. hortulanum 'Frieda Hemple'; lane 9, healthy C.
hortulanum 'Candidum'. Proteins were electrophoresed in a 10% sodium dodecyl sulfate
polyacrylamide gel. After electrophoresis, the proteins were blotted onto a nitrocellulose
membrane and reacted with DsMV-FL antiserum, and then detected with phosphatase-
conjugated goat anti-rabbit antibodies.

























131


ui-

... i. .. ......









Fig. 3-4. Western blotting analysis of four dasheen mosaic virus (DsMV) isolates serially
propagated in Philodendron selloum seedlings: lane 1, BRL protein marker; lanes 2 and
14, healthy P. selloum; lanes 3-5, Cel isolate from Colocasia esculenta; lanes 6-8, Chl
isolate from Caladium hortulanum 'Candidum'; lanes 9-11, Xc isolate from Xanthosoma
caracu; and lanes 12-13, Ch2 isolate from C. hortulanum 'Carolyn Whorton'. The
proteins were electrophoresed in a 10% sodium dodecyl sulfate polyacrylamide gel. After
electrophoresis, the proteins were blotted onto a nitrocellulose membrane and detected
with DsMV-FL antiserum, and then detected with phosphatase-conjugated goat anti-rabbit
antibodies.


-Z .. ....
;:IR











Comparison of the Coat Protein Sequences


The alignment of the CP sequences of the caladium isolates, Chl, Chla, Ch2, and

the taro isolates, LA and TEN (Pappu et al., 1994b) showed (Fig. 3-5). The amino acid

sequences were deduced from the nucleotide sequences. Fig. 3-6 shows the multiple

alignment of the predicted amino acid sequences for these DsMV isolates. Sequence

homologies of CP genes among these DsMV isolates were 84% to 96% at the nucleotide

level, and 92% to 96% at the amino acid level. However, the CP of the LA isolate (330

amino acids) was 15-16 amino acids longer than those of the three other isolates studied:

314 amino acids for isolates Chl and Ch2, and 315 amino acids for the TEN isolate (Fig.

3-6). These differences can be attributed to a 12-base addition and a 57-60 base deletion

at the 5'-terminal region of the CP gene of the Chl, Ch2 and TEN isolates. The addition

occurred between positions + 49 and + 50 and corresponded to amino acid residues of 17

to 20 of the CPs of the Chl, Ch2 and TEN isolates. The deletion was from +94 (+97 for

the isolate TEN) to +154, corresponding to amino acid residues 32 (33 for isolate TEN)

to 51 of the LA isolate. The addition and deletion occurred within the unusual threonine

and asparagine rich portion of the N-terminal region.

Among isolates Chl, Chla, Ch2 and TEN, the N-terminal region of the coat

proteins appeared highly conserved, both in length (76-77 amino acids) and in sequence

(similarity 71% to 78%). While the N-terminal region of the LA isolate was larger in size

(92 amino acids), its sequence similarity was 71-73%. Furthermore, the CP core and the

C-terminal region of the Chl, Ch2, LA and TEN isolates were all fairly conserved both in




























Fig. 3-5. Comparison ofnucleotide sequences of the coat protein (CP) gene
of dasheen mosaic virus isolates Chl and Chla (from Caladium hortulanum
'Candidum'), Ch2 (from Caladium hortulanum 'Carolyn Whorton'), LA and
TEN (from Colocasia esculenta). Nucleotide coding for the N-terminal regions
of the CPs are underlined, and the stop codons are shown by asterisks.

















GCTGATGACA
GCAGATGACA
GCTGATGATA
GCTGATGATA
PCTGATGATA


CAGTTGATGC
CAGTTGATGC
CAGTTGATGC
CAGTTGATGC
CAGTTGATGC


AGGGAATCAG
AGGGAACCAG
AAGGAAAAAC
AGGGAAAAAC
AGGGAAGAAT


AACAATACCA
AATAATACTA
AACAATACTA
AACAACACTA
AGCAAAAACA


ATAAAACA..
ATAAAACAAC
CAAAAACAAC
CAAAAACAAC
CAAAAACAAC


N-terminus

49 88
.......... ACCCCTGCAG CTGGTGGTGG TAACAACACA AATACCAACA
CGAAACAAAG ACTCCTGCAG CAAGTGGTGG TAACAACACA AAT.......
TGAAACAAAA ACACCTGCAA CGGGTGGTGG GAACAACACA AAC.......
TGAAACAAAA ACACCTGCAA CGGGCGATGG GAACAACACA AAC.......
TGAAACAAAA ACTCCTGCAT CGGGTCGTGG CAACAACACC AAC


89 138
CCAATACTGG TAACAACACA AACACCAATA CCAGTACTGG TAACAATACA







139 188
AACACCAACA CCAACACTAA TACCAACACA ACCAATAATA ATCCTCCACC
AATACTCCAC CACCACCCGC AAACAACACA ACTAATAACA ATCCTCCACC
.. AACAACA CGCCACCTGT AGATAACACA ACCAACAATA ATCCTCCACC
... GACAACA CGCCACCTGT AGGTAACACA ACCAACAATA ATCCTCCACC
AACAGCACTA CACCACCTGC AAATAACAAC ACAAACAACA ATCCTCCACC




189 238
GCCACCACCG GCGGCACCAA AAGCTTCAGA GACGCCAGCA AACAAGCAGG
GCCACCACCG ACGGCACCAA AGGCGACAGA GACGCCAGCC AACACACAAG
GCCACCACCG GCGGTTACAA AGGCAACAGA GATACCCGCC AATAAGCAAG
ACCACCACCG GCGGTTCCAA AGGTAGCAGA GATACCCGCC AATAAGCAAG
ACCGCCACCA GGCGCGCCAA AAGCAACAGA GACGCCGGCT AACAAACAAG


239
TAGTCCCCAC AACAAGTGAT
TAGTCCCAAC GGCAAGTGGG
TGGTCCCAGC AGCAAGTGAG
TGGTCCCAGC AGCAAGTGAG
TCGTCCCCCA AACAAATGAG


AAAGGTAAGG
AAAGGTAAGG
AAAGGTAAGG
AAAGGTAAGG


AGATTGTTAA
AAGTTGTTAA
AAATTGTGAA
AAATTGTGAA


288
AGATGTCAAT
AGATGTCAAC
AGATGTTAAC
AGATGTTAAC


AAACGGAAGG AAGTGGTCAA AGATGTCAAC


Fig. 3-5--Continued


DsMV-LA
DsMV-TEN
DsMV-Chl
DsMV-Chla
DsMV-Ch2


















DsMV-LA
DsMV-TEN
DsMV-Chl
DsMV-Chla
DsMV-Ch2


289
GCTGGCACAA
GCTGGCACAA
GCTGGCACTA
GCTGGCACTA
GCTGGCACCA

339
TAAAATGAAC
CAAGATGAAT
CAAAATGAAT
CAAAACGAAT
CAAAATGAAC


389
ATTTAATCGA
ATTTAATCGA
ATTTAATCGA
ATTTAATCGA
ACTTGATCGA


439
ACCCACACAC
ACCCACACAC
ACCCACACTC
ACCCACACTC
ACCCACACAC


489
GCTCGAGGAT
GCTTGAGGAC
GCTTGAGGAT
GCTTGAGGAT
GCTCGAGGAT


539
GCATCGACAA
GCATCGATAA
GCATCGATAA
GAACATCACC
GCATCGACAA


CTCTGTACCT
TTCTGTACCT
CTCTGTACCT
CTCTGTACCT
CTCTGTACCT


TCAAAGGCAA
TTAAAGGTAA
TTAAAGGTAA
TTAAAGGTAA
TTAAAGGTAA


CGGTTAAACA
CGATTGAATA
CGGTTGAATA
CGGTTGAATA
CGATTAAACA


GTGCATTTTA
GTGCATTTTA
ATGCATTCTA
ATGCATTTTA
ATGCATTTTG


338
AAATCACAAA
AAATCACAAA
GAATCACAAA
AAATCACAAA
GAATCACACA

388
AATTTAAATC
AATTTAAACC
AATTTGAATC
AATTTGAATC
CATTTAAATC


GTGGAACATA
GTGGCACATA
GTGGCACACA
GTGGCACATA
GTGGCACGTA


TTGCCTTTAG
TTACCTTTAG
TTACCTTTAG
TTACCTTTAG
TTACCTTTAG



GCACAAACCT
GTACAAACCC
GTACAAGCCA
GTACAAGCCA
GTACAAACCA



AGTTTGAGGT
AATTCGAGGT
AATTTGAAGT
AATTTGAAGT
AATTTGAGGT



GAGCAGATGC
GAGCAGATGC
GAGCAGATGC
GAGCAGATGC
GAGCAGATGC



TGGAACATCA
TGGAACATCA
TGGAACATCA
TGATATCAAC
TGGAACTTCA


GAACAGCGTG
GAACAGCGCG
GAACAGCGTG
GAACAGCGAG



CTGGTACAAT
ATGGTACAAC
CTGGTACAAT
CTGGTACAAT
CTGGTACAAT



ATATTGTTAT
ACATTGTAAT
ACATAGTTAT
ACATAGTTAT
ACATTGTTAT



CCTGACATTA
CCCGATATCA
CCTGATATCA
GGGGCTTGGG
CCCGACATCA


ACATCTTCAA
ACATATTCAA
ACATATTCAA
ACATCTTCAA



GCTGTCAAGA
GCCGTTAAGA
GCTGTCAAGA
GCTGTCAAGA
GCTGTCAAGA



GAATGGTTTC
GAATGGTTTC
GAATGGTTTT
GAATGGTTTT
GAACGGTTTC



ACGGGGCTTG
ACGGGGCTTG
ACGGGGCTTG
TGATGATGGC
ACGGGGCTTG


TACCAGAGCC
TACCAGAGCC
TACCAGAGCC
TACCAGAGCC


488
GGGAATATGA
GGGAGTACGA
GAGAATACGA
GAGAATACGA
GGGAATATGA


538
ATGGTTTGGT
ATGGTTTGGT
ATGGTTTGGT
ATGGTTTGGT
ATGGTTTGGT


588
GGTGATGATG
GGTGATGATG
GGTGATGATG
ATCGATAGTG
GGTGATGATG


Fig. 3-5--Continued


438
GAGCAGCGTG ACATATTCAA CACCAGAGCC


















DsMV-LA
DsMV-TEN
DsMV-Chl
DsMV-Chla
DsMV-Ch2


ATCAAATTGA
ATCAGATTGA
ATCAAATTGA
ATCAAATTGA
ATCAAATTGA


589
GATGGAAATG
GACGGAAACG
GACGGAAACG
GATGGAAGTG
GACGGAAATG


639
AAAACCCACC
AAAACCCACC
AAAACCAACC
AAAACCAACT
AAGACCCACC


689
CTTATATTGA
CTTATATCGA
CATACATTGA
CATACATTGA
CGTACATTGA


739
CTTATTCGCA
CTCATTCGCA
CTTATTCGCA
CTCATCCGCA
CTAATTCGCA


789
CTATGAAGTT
CTATGAGGTC
TTATGAGGTC
CTATGAGGTC
CTATGAAGTC


839
AAATGAAGGC
AAATGAAGGC
AAATGAAGGC
GGATGAAGGC
AGATGAAGGC


ATACCCGTTA
ATACCCGTTA
ATACCCGTTG
ATACCCGTTA
ATACCCGTTA


TAATGCATCA
TAATGCATCA
TAATGCATCA
TTATGCATCA
TAATGCATCA



GCGGAAAAAC
GCGGAGAAAC
GCAGAGAAAC
GCGGAGAAAC
GCGGAAAAAC



TGCAAGTCTC
TGCAAGTCTT
TGCAAGTCTC
TGCAAGTCTT
TGCAAGTCTC



CACCGGTCCG
CACCGGTGCG
CACCGGTGCG
CACCGGTGCG
CGCCGGTACG



TCTAACGTTA
TCCAACGTTA
TCTAACGTTA
TCTAACGTTA
TCTAACGTTA


AAGCCGATTG
AAACCAATTG
AAGCCAATTG
AAACCAATTG
AAGCCGATCG



CTTTTCTGAC
CTTTTCTGAC
CTTTTCTGAC
CTTTTCTGAC
CTTTTCTGAC



CATACATGCC
CATACATGCC
CGTATATGCC
CGTACATGCC
CATACATGCC



GCCCGGTACG
GCCCGGTATG
GCCCGGTATG
GCCCGGTATG
GCCCGGTATG



AGCAAGGGAG
AGCGAGAGAA
AGCAAGAGAA
AGCAAGAGAA
AGCAAGAGAG



CCACTAGGTT
CCACTACCTT
CCACTAGGTT
CCACTAGGTT
CCACTAGGTT


638
TGGAGAATGC
TGGAAAATGC
TTGAAAATGC
TCGAAAATGC
TGGAAAATGC


688
GCAGCAGAGG
GCAGCAGAGG
GCAGCAGAGG
GCAGCAGAGG
GCAGCAGAGG


738
TAGGTATGGT
TAGGTATGGT
TAGATACGGT
TAGGTATGGT
TAGGATAGGT


788
CTTTCGACTT
CTTTCGACTT
CTTTTGACTT
CTTTTGACTT
CTTTCGACTT


838
GCAGTTGCGC
GCAGTCGCGC
GCAGTTGCGC
GCAGTTACGC
GCAGTAGCGC


888
GTTTGGTTTG
GTTTGGTTTG
GTTTGGTTTG
GTTTGGTTTG
GTTTGGTTTG


Fig. 3-5--Continued


TTGCGTCAGA
TTGCGTCAGA
TTGCGTCAGA
TTGCGTCAGA
TTGCGTCAGA



ACTGAGAAAT
ACCGAGGAAT
ACTGAGAAAC
ATTGAGGAAC
ACTGAGAAAT



ACTTACGTGA
ATCTACGTGA
ATTTACGTGA
ACTTACGTGA
ACTTACGTGA



AACTCTAAAA
AATTCTAAAA
AATTCTAAAA
AATTCTAAAA
AATTCTAAGA



CGCTGCACTT
CGCTGCGCTC
GGCTGCACTC
CGCTGCACTC
TGCTGCACTC



















889
GATGGTAACG
GATGGTAACG
GATGGTAACG
GATGGTAACG
GATGGTAACG


AGACGTCACA
GGATGTCACG
AGACGTCACA
AGACGTCACA
AGACGTCACA


TTTCGACTTC
TTTCAACTTC
TTTCAACTTC
TTTCAACTTC
TTTCAACTTC


CCCAACATGC
CCAAATATGC
CCAAACATGC
CCAAACATGC
CCAAACATGC


AAGCGAGAAC
AAGCGAGAAC
AAGCGAGAAC
AAGCGAGAAC
AAGCGAGAAC


ATACATTGCT
ACACCTTGCT
ACACTTTACT
ACACTTTACT
ACACTTTACT


ACTGAAAGGC
ACTGAAAGGC
ACTGAAAGGC
ACTGAAAGGC
ACTGGAAAGC


TGGTGTGGCA
CGGCGTAGCG
TGGTGTTTCG
TGGCGTTTCG
TGGCGTTTCG


938
ACACTGCAAA
ATACTGCAAA
ACACTGCAAA
ACACTGCAAA
ACACTGCAAA


TCTCCACAGTAA
CCTCCGCAGTAA
TCTCCGCAGTAA
TCTCCGCAGTAA
TCTCCGCAGTAA


Fig. 3-5--Continued


DsMV-LA
DsMV-TEN
DsMV-Chl
DsMV-Chla
DsMV-Ch2


990




















1
DsMV-LA ADDTVDAGNQ


DsMV-TEN
DsMV-Chl
DsMV-Chla
DsMV-Ch2


NNTNKT.... TRAAGGGNNT NTNTNTGNNT


------TETK
---T--TETK
------TETK
SKNT--TETK



TNNNPPPPPP
----------
----------
----------


----------
-------RKN
----------
--------KN


47
NTNTNTNTNT
--PP-PAN--
.-N-PPVD--
.D-----G--
-ST-PPAN-N


97
AGTSGTYSVP

---H---
----------
----------


147
THTQFEVWYN

----------





197
DGNDQIEYPL



--S--------
----------
-S-------



247
LIRNLRDASL

----------





297
DGNVSTSSEN


----------


KPIVENAKPT


----S---
-P-T------
-P-T-D----
-P-S-R----



AAPKASEIPA
TA--------
-VT--T----
----V---
G----T-T--



LPLVKGKCIL

----------


N.........



NKQWPTTSD
-T-----A-G
------AA-E
----------
------Q-NE



NLNHLIEYKP

----------


46
NTNTSTGNNT
..........






96
KGKEIVKDVN
---V ------
---V------

----------

-R--V-----


146
EQRDIFNTRA

----------


---------- H-------- ----------
---------- H --------- ----------


EQMHIVMNGF

----------


LRQIMHHFSD


MVWCIDNGTS



----------





AAEAYI ELRN


196
PDINGAWVMM

----------





246
AEKPYMPRYG


---------- ---------- ---------- --------I-
------- R-- ---------- ---------- -------- I-


ARYAFDFYEV


TERHTAKDVT





-GK-------


NSKTPVRARE


PNMHTLLGVS


AVAQMKAAAL



--TR------


296
SNVTTRLFGL


330
SPQ*

---*
__-*
--*


Fig. 3-6. Comparison of amino acid sequences of coat proteins of dasheen mosaic

virus isolates LA, TEN, Chl, Chla and Ch2. Identical amino acids are shown by

dashes and gaps are indicated by dots.


RLNKITNKMN


---R------
-R -
--------T-

---R--H---



AVKREYELED

----------











length (237 amino acids) and in sequence (98% at the amino acid level) (Fig. 3-6). The

overall sequence similarity of the coat proteins was quite high and comparable to identities

observed between strains of a single potyvirus species (Shukla & Ward, 1988; Ward et al.,

1992).

The 3'-NCR of the Chl, Ch2 and LA isolates were all similar in length (246, 243

and 247 nt, respectively). The sequence identity in this region ranged from 79-83% (Fig.

3-7).



Discussion


Western blotting analysis confirmed that the CP of DsMV is considerably larger

than those of most potyviruses (Abo El-Nil et al., 1978). The CP MWs of six DsMV

isolates were estimated to be 38-47 kDa, whereas ten other potyviruses used in

comparisons had estimated MWs of 31-36 kDa in Western blotting analyses. These

variations apparently reflect genomic differences between DsMV isolates since the specific

CP MW for each isolate is constant after serial passages through different hosts. Whereas

most potyviruses, including konjak mosaic (Shimoyama et al., 1992), have CP MWs of

about 32-36 kDa, those of DsMV isolates have values of 38-47 kDa. Abo El-Nil et al.

(1977) suggested that the high CP MW values of DsMV was associated with the N-

terminal portion of the coat protein. The availability of the CP sequences of several DsMV

isolates (Pappu et al., 1994a, b; this study) and of other potyviruses may help to confirm

this hypothesis. Indeed, the DsMV CPs of 314 to 330 amino acids noted in this study are


















AGGTCTGGTA
AGGTCTGGTA
AGGTCTGGTA
AGGTCTGGTA


51
TTTATATAAA
TTTACATAAA
TATATTTAAA
TATATTTAAA


101
ACAGCGTGGT
ACAGAGTGGT
ACAGTGTGTT
ACAGTGTGTT


AACAGGGCCG
AACAGG..CC
AACAGG..CC
AACAGA..GA


GTATTGTTTG
GTATTGTTTG
GTACTGTTTG
GTACTGTTTG



TTTCCACCGA
TTTCCACCGA
TTTCCACCGA
TTTCCACCGA


ACAGTTATTG
ACAGTTATTG
ACAGTTATTG
CCACTTATCG


TATTCAAGTA
TATTCAAGTA
TATTCAGGTA
TTTTCAAGTT



TGTGGAGTTG
TGTGGAGA.G
TGTGGAGAGG
TGTGGAGAGG


GCTCGCTGTT
GCTCGCTGTT
GCTCGCTGTC
TCTCGCTGTC



GTGCTATTTG
GTGCTATTTG
GTGTTATTTG
GTGGTATTTG



.GCTTTGCAC
TGCTATGCAT
TGCTATGCAC
TGCTATGCAC


50
TGTAGTTTTA
TGTAGTTTTA
TGTAGTCTTA
TGTAGTTTTA


100
GTTATAAACT
ATTATAAACT
ATTATAAACT
ATTACAAACT


150
CCTATTATCT
CCTACTATCT
CCTACTATCT
CCTACTATCT


AC.GTCCTTT
ACATTCCTTT
AC.GTCCTTT
AC.GTCCTTT


201
CCGCAAG...
CCGTAAG...
CCGTTGGTGC
CCGTTGGTGC


251
C
C


ATGTATTTGA
AAATGTTTGA
AAATATTTGG
AAATATTTGG



GCGATGGGCG
..CCATGGCG
GCCACTGGCG
GCCACTGGCG


AAACTACTGA ACTACTGCAC
AAACTACTGA ACCACTGCAC
AAACTGCTGA ACCACTGCAC


CTACGTCAGA
CTACATCAGA
CTACATCGGA


AAACTGCTGA ACCACTGCAC CTACATCGGA


CGGTAGGCGA
CTGTAGGCGA
CGGTAGGCGA
CGGTAGGCGA


GACGCTTCGT
GATGCTTCGT
GATGCTTCGT
GATGCTTCGT


250
GCACGGTGTT
GCACGGTGTT
GCACGGTGTT
GCACGGTGTT


Fig. 3-7. Comparison of nucleotide sequences of the 3'-NCRs of dasheen mosaic
virus isolates Chl and Chla, Ch2 and LA. Dots indicate the gaps for optimum
alignment.


1
DsMV-Chl
DsMV-Chla
DsMV-Ch2
DsMV-LA











relatively large for a potyvirus. However, the calculated CP MWs for four sequenced

isolates were from 34.6-36.9 kDa, which were close to those seen for other potyviruses.

Furthermore, the estimated MW of the CP expressed in E. coli was smaller (39 kDa, as

reported in chapter 2) than that (44 kDa) from infected plants, even though the expressed

CP had a fusion protein of 15 amino acids long. The similar differences between CP MW

(36 kDa) observed in SDS-PAGE and that calculated using sequence data (33 kDa) have

been reported for PRSV-P (Quemada et al., 1990a; Yeh et al., 1992).

There are several factors that could account for such apparent discrepancies in

MW. First, they might reflect the unusual amino acid composition of the DsMV CP

(Pappu et al., 1994a; Li et al., 1994; this study). The DsMV CP is different from those of

other potyviruses in that it is quite threonine and asparagine-rich at the N-terminal region.

These two amino acid residues account for 31.8-50% of the amino acid residues at the N-

terminal region of the CPs. In addition to a 6-proline sequence at the N-terminal region,

there are also many more (8-10) potential N-glycosylation sites which are clustered near

both the N- and the C-termini of the DsMV CP (Pappu et al., 1994a; this study) than in

the CPs of most potyviruses. These unusual sequences may affect behavior of DsMV CP

in SDS-PAGE, although theoretically no such influence should exist based on the

presumption that proteins are completely denatured under such conditions. Several short

proline stretches and/or a seven-proline stretch were also found at the N-terminal regions

of several sweet potato potyviruses (Colinet & Lepoivre, 1994). The CP MWs of these

viruses in SDS-PAGE, however, corresponded closely to those calculated from their











sequences of 316-355 amino acids, thereby indicating that proline stretches had no effect

on the MWs of the proteins in SDS-PAGE.

Another possibility is that some chemical components in aroids may have effects

on the migration rate of the DsMV CP in SDS-PAGE, causing such an abnormal behavior.

This possibility could be not tested, however, because the host range of DsMV is largely

restricted to aroids. Clearly, attempts to purify this virus from different aroids were

seriously impeded by their unusually viscous sap.

The variability of the CP MWs among different isolates, contrasts with the studies

of other potyvirus strains, such as ZYMV (Wisler, 1992) and PRSV (data not shown),

which appear to be much more uniform in size. Sequence analysis of the DsMV CPs

revealed a deletion and an addition at the N-terminal regions of the Chl, Ch2 and TEN

isolates, which, when compared to the LA isolate, consisted of a 16-amino-acid deletion.

The deletions or duplications at the N-terminal region of the DsMV CP among different

isolates may contribute to the variability of the coat protein sizes. The significance of these

deletions or duplications to the evolution of DsMV has been discussed by Pappu et al.

(1994). Similar sequence diversities at the N-terminal region of the CPs were also

reported for strains of TuMV (Sano et al., 1992), SCMV (Xiao et al., 1993), and BCMV

(Khan et al., 1993).

The availability of the sequences of the coat protein and the 3'-NCR of the DsMV

isolates, Chl, Ch2, LA and TEN, allowed an assessment to be made of their relationship

at the sequence level. As has been for reported for other potyviruses (Shukla et al., 1988),











the amino acid variation among the CPs of the four DsMV isolates occurs primarily at the

N-terminal region, while the sequence of the core and C-terminal regions are highly

conserved (Fig. 3-6). The CP sequences of these isolates showed similarities of 92% to

96%, which are, by convention, considered to be values delineated for strains of a given

virus (Shukla et al., 1988). Furthermore, the similarities of the 3'-NCR sequences of the

isolates Chl, Ch2 and LA were 79-83%, indicating that these isolates are very close to

each other.

We confirmed earlier studies (Abo El-Nil et al., 1977; Wisler et al., 1978) that

some isolates of DsMV can induce more severe stunting symptoms in P. selloum than

others, but CP MW is apparently not correlated with this properties. For example, the

respective isolates with the highest and lowest CP MW values, DsMV-Xc (47 kDa) and

DsMV-Ch3 (38 kDa) induced mild symptoms in P. selloum, whereas the four other

isolates (Chl, Ch2, Cel and Za) that induced more severe stunting symptoms had

intermediate CP MWs. However, relationships between the symptom differences in P.

selloum and CP sequence similarity of these isolates could not be established since CPs of

the Ch3, Xc and Za isolates have yet to be sequenced.

The coat protein variability of DsMV isolates does not appear to compromise the

ability to detect different DsMV isolates serologically. Abo El-Nil et al. (1977) noted

strong precipitin reactions between isolates with only barely perceptible reciprocal spur

formation in SDS-immunodiffusion tests. Likewise, each of the DsMV isolates could











readily be detected in ELISA and Western blot tests in this study, as could several taro

isolates of DsMV isolates from different geographical areas (Zettler et al., 1987).

Despite the CP MW differences between DsMV and other potyviruses (except two

PMoV strains) reciprocal reactions in Western blotting analyses reveal close serological

relationships. The unusual composition of its CP apparently had no significant effect on

the ability of DsMV antiserum to react against many other potyviruses. Furthermore, the

antisera from two different DsMV isolates cross-reacted with other potyviruses, thereby

providing additional evidence that the unusual amino acid residues stretches at the DsMV

CP does not contain epitopes essential for detecting it serologically.