Quick blots and nonradioactive detection systems

MISSING IMAGE

Material Information

Title:
Quick blots and nonradioactive detection systems improvements on methods for DNA hybridizations using mosquitoes
Physical Description:
vii, 88 leaves : ill., photos. ; 28 cm.
Language:
English
Creator:
Johnson, David William, 1959-
Publication Date:

Subjects

Subjects / Keywords:
Mosquitoes   ( lcsh )
DNA probes   ( lcsh )
Nucleic acid hybridization   ( lcsh )
Genre:
bibliography   ( marcgt )
theses   ( marcgt )
non-fiction   ( marcgt )

Notes

Thesis:
Thesis (Ph. D.)--University of Florida, 1990.
Bibliography:
Includes bibliographical references (leaves 85-87).
Statement of Responsibility:
by David William Johnson.
General Note:
Vita.

Record Information

Source Institution:
University of Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
aleph - 001718096
notis - AJD0509
oclc - 25682031
System ID:
AA00003748:00001

Full Text












QUICK BLOTS AND NONRADIOACTIVE DETECTION SYSTEMS:
IMPROVEMENTS ON METHODS FOR DNA HYBRIDIZATIONS
USING MOSQUITOES













By

DAVID WILLIAM JOHNSON


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


1990























ACKNOWLEDGEMENT


The author would like to acknowledge the one who makes

all things possible, "for from him and through him and to

him are all things. To him be the glory forever! Amen."

(Romans 11:36)













TABLE OF CONTENTS


ACKNOWLEDGEMENT... ................................ii

KEY TO ABBREVIATIONS AND SYMBOLS...........................V

ABSTRACT ...................................................vi

INTRODUCTION.. ............................................. 1

MATERIALS AND METHODS..................................... 7

General Molecular Methods................................7
Sources of Mosquitoes and Probes........................10
Squash Blots and Dot Blots..............................11
Isolation of the Culex-specific Probe, pCxl.............12
Isolation of Anopheles nuneztovari-specific Probes......13
DNA Sequencing..........................................14
Nonradioactive Detection Systems........................16
Overview of Nonradioactive Detection Systems.......... 16
Preparation and Use of Biotinylated Probes.............17
Preparation and Use of ECL Probes.....................18
Preparation and Use of Genius Probes..................19

MOSQUITO SPECIES-SPECIFIC DNA PROBES......................22

Isolation Methods and the Relevance of Genome
Organization.........................................22
Isolation of Probe pCxl.................................24
Isolation of Anopheles nuneztovari-specific
Probes................................................. 26
Mapping and Sequencing of Anopheles quadrimaculatus-
and Anopheles freeborni-specific Probes...............26

QUICK BLOTS..... ................... ........................37

Experiments Leading to the Quick Blot Protocol...........37
First Attempts at Making Quick Blots....................41
Steps in the Quick Blot Protocol........................47
Experiments to Optimize Use of Quick Blots with
Mosquito Species-specific Probes......................52


iii














SYNTHETIC OLIGONUCLEOTIDE PROBES...........................72

CONCLUSIONS AND SUMMARY...................................79

Discussion of the Efforts to Isolate a Culex-specific
Probe........................................................ 79
Significance of Oligonucleotide Probes and
Characterization of Other Mosquito Species-specific
Probes...................................................... 80
Significance of the Quick Blot Protocol and
Nonradioactive Detections.............................82

REFERENCES.. ........................... ....................85

BIOGRAPHICAL SKETCH.......................................88













KEY TO ABBREVIATIONS AND SYMBOLS


C degrees Centigrade

DNA deoxyribonucleic acid

EDTA ethylene-diamine-tetraacetic acid

kbp kilobase pair(s)

LF LA FRANCE (Dial Corp.)

M molar

mg milligrams)

min minutes)

ml milliliter(s)

mm millimeter

mM millimolar

9g microgram(s)

il microliter(s)

NFDM nonfat dry milk

ng nanogram(s)

nm nanometers

pg picograms

QB quick blot

RNA ribonucleic acid

s seconds)

SSC saline sodium citrate

SDS sodium dodecyl sulfate

v













Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

QUICK BLOTS AND NONRADIOACTIVE DETECTION SYSTEMS:
IMPROVEMENTS ON METHODS FOR DNA HYBRIDIZATIONS
USING MOSQUITOES

By

David William Johnson

December, 1990

Chairman: Dr. Jack A. Seawright
Major Department: Entomology and Nematology


A DNA (deoxyribonucleic acid) probe was isolated which

exhibited specificity for two mosquito species, Culex

niqripalpus Theobald and Culex salinarius Coquillett. The

nucleotide sequence of another probe specific for Anopheles

quadrimaculatus Say species A was determined in order to

identify sequences which conferred specificity to the probe

and to assist in the production of synthetic oligonucleotide

probes. Probes exhibiting specificity for Anopheles

nuneztovari Gabaldon were isolated in a primary screening,

and other mosquito species-specific probes were partially

characterized.












A new technique for preparing targets for hybridization

of nucleic acid probes, called the quick blot protocol, was

developed. It allowed rapid preparation of multiple (10 or

more) equivalent sample-containing filters, called quick

blots. Samples were applied uniformly in an orderly

arrangement on the filters. The quick blot protocol was used

to prepare targets for hybridization with mosquito species-

specific DNA probes. Using quick blots, detection of

radiolabeled probes was compared with detection of probes

prepared with three nonradioactive detection systems. A

method was developed for the differential detection of two

nonradioactive probes hybridized simultaneously to a quick

blot. Finally, the use of synthetic oligonucleotide probes

with quick blots was demonstrated.


vii













INTRODUCTION

The need for nonmorphological methods to identify

specimens occurs when specimens of related species cannot be

distinguished by morphology. These cryptic species probably

have arisen from recent speciation events and may therefore

provide valuable models for the study of evolutionary

processes.

In the case of mosquitoes, it is valuable to have

methods for readily identifying cryptic species which differ

in their abilities to serve as vectors for a parasite of

humans. An example is the Anopheles gambiae Giles species

complex, a group of at least six species which are

indistinguishable morphologically. These species differ in

their significance as vectors of malaria, and under certain

conditions can be distinguished by cytological (Coluzzi &

Sabatini, 1967) and isoenzyme (Hunt & Coetzee, 1986)

analyses. But perhaps the easiest way to distinguish three

members of this complex is with a DNA probe (Collins et al.,

1988). However, this single probe will not distinguish all

the known members of the complex.

There are two major areas of concern in the efforts to

make probe technologies useful. One is the isolation of

probes with the desired traits, and the other is the












development of methods that can best detect the hybridized

probe molecules.

The specificity of base pairing in the annealing, or

hybridization, of separated strands of nucleic acid has

allowed the development of DNA probe technologies. These

have proven invaluable for the detection of pathogens of

humans (Hyypia et al., 1989), viruses and viroids infecting

plants (McInnes & Symons, 1989a), and human genetic

disorders (Sutherland & Mulley, 1989). The specificity of

DNA probes has also been used to identify species of

mosquitoes (Cockburn et al., 1988; Cockburn, 1990). Methods

for using nucleic acid probes usually involve preparation of

a suitable target, in which the nucleic acid to be probed is

immobilized in a denatured form on a glass or membrane

filter support. Denatured probe is then given a chance to

anneal with the target nucleic acid in a hybridization step,

in conditions conducive to duplex formation. From this point

on, the focus will be on DNA probes, for even though RNA

probes could be of value in tissue- or age-specific

detection, they have not been as widely used as DNA probes

and are unstable.

The two main parameters that relate to the value of a

given DNA probe are specificity (selectivity) and

sensitivity. These parameters are determined in part by the










3

nucleotide sequence of the probe, but also depend greatly on

the conditions used to anneal the probe to the target, and

the characteristics of the detection system used to

visualize the hybridized (bound) probe.

There are several techniques used for preparing the

targets for nucleic acid probes. Nucleic acids may be

extracted from tissues, and applied to a filter to form a

slot blot (Wahl et al., 1987) or a dot blot (Costanzi &

Gillespie, 1987). Or, an organism or isolated tissue may be

used directly to form a squash blot (Cockburn, 1990; Keating

et al., 1989; Kirkpatrick et al., 1987; Tchen et al., 1985).

This is done by using enough force while squashing the

material against the filter that some DNA is freed from the

cells and becomes bound to the filter. The squash blot

method is useful in the preparation of two equivalent

filters containing the DNA of individual mosquitoes

(Cockburn, 1990).

This study focused on the isolation, characterization,

and use of mosquito species-specific DNA probes. The

specific objectives were: (1) isolation of new DNA probes

showing specificity for certain Culex and Anopheles species

(especially the vector of St. Louis encephalitis virus,

Culex nigripalpus), (2) characterization of the nucleotide

sequence(s) conferring specificity in one or more probes,












(3) development of a fast, reliable system for the

preparation of multiple targets for mosquito DNA probes

using individual mosquitoes, (4) assessment of the

usefulness of commercially available nonradioactive

detection systems when applied to systems for hybridization

of mosquito DNA probes (including a comparison to

radioactive detection methods), (5) assessment of the value

of synthetic oligonucleotides as mosquito species-specific

probes.

Central to this study were repetitive DNA probes shown

previously to exhibit specificity for the four known members

of the A. quadrimaculatus species complex (Cockburn, 1990).

These probes will be useful in assessing the potential of

the members of the complex to serve as vectors of malaria.

Probes Arp2, Brpl, and Crpl hybridized primarily to DNA from

A. quadrimaculatus species A, B, and C, respectively.

However, Arp2 hybridized slightly to species B DNA. This

probe was chosen as a model for the characterization of

mosquito species-specific probes, in part because of the

possibility of using its nucleotide sequence to prepare

oligonucleotide probes which might exhibit improved

specificity. Also, restriction analysis of probe Arp2

indicated that it was probably composed of multiple

identical (or very similar) repeat sequences (personal











communication, A. F. Cockburn, United States Department of

Agriculture (USDA)) which could be detected by nucleotide

sequencing of suitable subclones.

A new method, called the quick blot (QB) protocol, is

described for preparing hybridization targets using

mosquitoes. The QB protocol was used to produce ten

equivalent sets of nucleic acid targets on filters, called

quick blots (QBs), for use in nucleic acid hybridization

assays. It has been found useful in the analysis of

individual mosquitoes, with up to 96 individuals per filter.

The filters were used successfully as DNA hybridization

targets for mosquito species-specific DNA probes. The main

advantages that the QB protocol offers over previous methods

include: the uniformity of sample application, the orderly

arrangement of samples on the filters, the ability to

produce multiple identical sample-containing filters, and

the rapidity with which numerous samples can be processed.

Specific detection of DNA probes hybridized to QBs was

achieved with nonradioactive labeling and detection systems.

These results were compared to those obtained with

radiolabeled probes.

Nucleotide sequence data were obtained from plasmids

containing mosquito species-specific DNA and used to specify

the synthesis of oligonucleotides. These oligonucleotides










6

were tested for their usefulness as species-specific probes

to QBs, and advantages of these synthetic probes were

demonstrated. Thus, QBs may be used as targets for

hybridization of nucleic acid probes; nonradioactive

detection systems may be used to advantage with QBs in some

situations; and synthetic DNA probes can offer advantages

over conventional genomic clones.













MATERIALS AND METHODS

General Molecular Methods

Gels were 0.5-1.0% agarose (Sigma), buffered and run in

lX TBE (89mM Tris-borate, 89mM boric acid, 2mM EDTA) at less

than 5.5 volts per centimeter. Fragments were sized using a

Hind III digest of bacteriophage lambda or 1 kbp ladder

fragments (Bethesda Research Laboratories, Life

Technologies, Inc. (BRL)) as markers.

Plasmids were prepared by a modification of the

alkaline-lysis method of Birnboim & Doly (1979) and cesium

chloride purification, or by the boiling method (Holmes &

Quigley, 1981). Insect genomic DNA was prepared by the

method of Cockburn & Seawright (1988). Standard methods were

used for restriction analysis of plasmid and genomic DNA,

except that restriction enzymes were used in excess of the

manufacturer's (BRL) recommendations. Nucleic acids were

quantified by ultraviolet absorption at 260 nm.

Double-stranded DNA was radiolabeled by nick

translation (Nick Translation System, BRL) with 32P-dCTP,

and unincorporated label was removed by size exclusion

chromatography (using Bio-Gel P-60, BioRad).

Oligonucleotides were radiolabeled with 32P-ATP and T4

polynucleotide kinase. Unincorporated nucleotides were










8

removed by size exclusion chromatography (using Bio-Rad Bio-

Spin 30 columns).

Unless otherwise noted, filters were subjected to the

following treatments after application of the target DNA.

Prior to prehybridization, nitrocellulose filters were baked

for 20-45 min at 80*C under vacuum (vacuum-baked), and nylon

filters were subjected to treatment with 300 nm ultraviolet

(UV) light (1-2 min on the glass surface of a Chromato-Vue

Transilluminator, Ultraviolet Products, Model TM-36).

Filters were prehybridized in 1% NFDM (nonfat dry milk),

0.2% SDS at 550C for at least 30 min, and hybridized with

(denatured) probe in 30% formamide, 5X SSPE (20X SSPE is

3.6M NaCl, 0.2M NaH2PO4 pH 7.4, 20mM EDTA), 1% NFDM, 0.2%

SDS at 550C overnight.

Prehybridization of blots for oligonucleotide probes

was in buffer (6X SSPE, 0.3% SDS, 1.0% NFDM) for one hour at

650C. Hybridization with labeled oligonucleotide probe was

performed by adding the probe samples to the bags containing

the filters and prehybridization buffer, resealing, and

incubating for 24 hours at 37*C. Following hybridization,

the filters were washed four times for 15 min each wash in

4X SSPE at 65"C. All films used for autoradiography and

chemiluminescent detection (see below) were Kodak X-AR with

Kodak intensifying screens.











Excess probe annealing to highly repetitive DNA can

provide a higher sensitivity than a probe annealing to

moderately repetitive or single-copy sequences, if whole

genomic DNA serves as the target. In this study, excess

probe (0.5-1.0 jg per filter) was used in each hybridization

experiment to ensure that detection of bound probe was not

limited by probe concentration in the hybridization step.

Two distinct terms are used to describe spurious

detection: background and nonspecific detection. The term

background is used to refer to apparent signal development

in areas of the target filter (or its image on film) not

corresponding to locations where nucleic acid was applied.

The term nonspecific detection (or nonspecific signal) is

used to denote the appearance on the filter (or film) of

signal in areas where nucleic acid was applied but where no

probe was expected to be localized (based on the known

specificity of the probe).

The DH5-a and JM103 strains of Escherichia coli were

the hosts for all plasmids, and the DH5-a and HB101 strains

were the hosts for all transformations. Bacteria were grown

on Luria-Bertani culture medium with 30 gg/ml kanamycin or

50 lg/ml ampicillin. Bacteria were transformed by standard

methods (Hanahan, 1983) and screened for plasmids of

appropriate size, using agarose gel electrophoresis.










10
Oligonucleotide probes were synthesized at the ICBR DNA

Synthesis Facility, Gainesville, Florida.

Sources of Mosquitoes and Probes

Specimens of the following mosquito species used in

this study were supplied by the mosquito rearing facility at

the Medical and Veterinary Entomology Research Laboratory,

USDA, Gainesville, Florida: Aedes taeniorhynchus

(Wiedemann), Anopheles albimanus Wiedemann, A.

guadrimaculatus species A (ORLANDO strain), Culex

quinquefasciatus Say, and C. salinarius Coquillett.

Specimens of Anopheles crucians Wiedemann, Coquillettidea

perturbans (Walker), and Culex nigripalpus Theobald were

supplied by Mr. O. R. Willis (USDA), and were collected in

Alachua County, Florida. A. quadrimaculatus species B, C,

and D mosquitoes were supplied by P. E. Kaiser and S. E.

Mitchell (USDA).

Probes pA2, pBrpl-Sl, pCrpl-S1, pCrp-S2, and pCrp-S3

were supplied by A. F. Cockburn and were derived by

subcloning of phage Arp2, Brpl, and Crpl (Cockburn, 1990)

sal I fragments into plasmid pKl9. It was demonstrated

previously (Cockburn, 1990) that the probes Arp2, Brpl, and

Crpl probes exhibited sufficient specificity for A.

quadrimaculatus species A, B, and C, respectively, to allow

differentiation of specimens of all four members of the A.












quadrimaculatus species complex. The insert in pA2 was 2.8

kbp, much smaller than the 12 kbp sat I fragment in phage

Arp2. The sequence organization of this clone (see below)

suggests that a deletion occurred by recombination between

one or more internal repeats. Probe pKA2 was derived by

transferring the (sat I) insert of pA2 into pK19 using Hind

III and EcoR I. Probe pAfl-Sl was prepared by subcloning a

3.4 kbp sat I fragment from an Anopheles freeborni Aitken-

specific phage probe (A. F. Cockburn, USDA) into pKl9. The

derivation of other probes and subclones is detailed in the

appropriate sections below. All plasmid probes contained

vector pKl9 unless otherwise indicated.

Squash Blots and Dot Blots

Squash blots for hybridization of mosquito species-

specific DNA probes were prepared as described previously

(Cockburn, 1990). A damp blotting filter was covered with

mosquitoes arranged in a grid pattern. A second filter was

placed on top of the mosquitoes, and a metal rod was rolled

over the filters to thoroughly squash the mosquitoes in

between. The resulting sandwiches were laid on filter paper

soaked with denaturing solution (0.5M NaOH, 1.5M NaCl) for

about 5 min per side, then transferred to paper saturated

with neutralizing solution (1.5M NaC1, 1M Tris, pH 8.0) for

5 min per side. The two filters were separated, and












subjected to either the UV fixation (nylon filters) or

vacuum-baking nitrocellulosee filters) steps as described

above.

Dot blots were prepared using standard methods

(Costanzi & Gillespie, 1987). The dot blot is a way to

prepare hybridization targets using purified DNA. The DNA

can be diluted serially and applied to a blotting filter to

provide spots containing different amounts of bound DNA.

Application of sample solutions to the filter is simple when

using an apparatus called the dot blot manifold (Table 2).

Isolation of the Culex-specific probe. pCxl

Attempts were made to isolate a DNA probe specific for

C. niqripalpus by the method of Cockburn & Mitchell (1989).

Two variations of this approach were tried, using a phage

vector and a plasmid vector.

Recombinant phage was prepared by ligation of C.

nigripalpus DNA cut with EcoR I and xba I with LambdaGEM-4

EcoR I-xba I Arms (Promega). Ligated DNA was packaged

(Gigapack Gold, Stratagene) for screening. Library screening

was performed according to Cockburn (1990), using duplicate

plaque lifts hybridized separately to C. nigripalpus and C.

salinarius genomic DNA. Phage were grown on E. coli strain

P2392.












Plasmid subclones were obtained from recombinant

LambdaGEM-4 according to the directions supplied by the

manufacturer (Promega). Inserts in the LambdaGEM-4 vector

were contained within the pGEM-4 plasmid which is included

as part of the vector; plasmid subclones were easily derived

by cutting the purified recombinant LambdaGEM-4 DNA with spe

I, lighting, and transforming suitable host bacteria.

Plasmid libraries containing C. niqripalpus genomic DNA

in pK19 were prepared using double digests with Hind III and

xba I, EcoR I and Pst I, or EcoR I and Hind III. A plasmid

library was also prepared with C. salinarius DNA in pK19

using a Hind III and EcoR I double digest. Transformants from

the ligation mixtures were grown on kanamycin-containing

medium. Colony lifts were prepared according to the method

of Buluwela et al. (1989), and served as targets for

differential hybridization to C. nigripalpus, C. salinarius,

and C. quinquefasciatus genomic DNA.

Isolation of Anopheles nuneztovari-specific Probes

Isolation of Anopheles nuneztovari-specific probes was

accomplished according to the methods of Cockburn & Mitchell

(1989) and Cockburn (1990), using an A. nuneztovari library

in phage EMBL 3A supplied by A. F. Cockburn. Genomic DNAs

from A. nuneztovari and Anopheles oswaldoi (Peryassu),












supplied by L. P. Lounibos and J. Conn, were used for the

primary differential hybridization screening.

DNA Sequencing

Subcloning strategies were designed for the selection

of deletion subclones generated by restriction enzymes, and

to allow the use of the standard universal (forward) and

reverse primers.

Sequencing of pKA2 was aided by subcloning of Nsi I

fragments from the insert. The recipient vector (pK19) DNA

was cut with Pst I and phosphatased, and pKA2 DNA was cut

with Nsi I. These two digests were ligated, and

transformants were selected and used for sequencing. Using

this approach, each subclone was expected to contain a

single Nsi I fragment from the insert. The subclones were

called pKA2-N1, pKA2-N2, etc.

Nucleotide sequence data were also obtained from other

plasmid clones. These were the A. quadrimaculatus species B-

specific probe pBrpl-Sl, the A. freeborni-specific probe

pAfl-Sl, the Culex-specific probe pCxl, and three plasmid

subclones of the A. quadrimaculatus species C-specific probe

(pCrpl-Sl, pCrpl-S2, and pCrpl-S3, comprising the total

insert in the parental recombinant phage probe).

Sequencing of the unrearranged phage Arp2 insert was












accomplished by preparing Nsi I subclones in pKl9. These

were designated pArp2-Nl, pArp2-N2, etc.

Sequencing reactions were performed on boiling-method

preparations of 1-5 gg of plasmid DNA extracted from 2-ml

bacterial cultures grown up overnight. Primer annealing was

performed on alkali-denatured plasmid DNA. Sequenase version

2.0 (U.S. Biochemical Corp.) was used for sequencing by the

chain-terminating method (Sanger, 1977) with manufacturer-

supplied reaction solutions and procedures. Reaction

products were labeled with 35S dATP in buffers containing

Mg" ions. Sequencing reactions were run on 0.2-0.9 mm wedge

gels (4% acrylamide [19:1 linear to bis, LKB], 8M urea, 1X

TBE) at 55*C, 1750 volts on a Macrophor (LKB) or Sequigen

(BioRad) electrophoresis unit. Gels were rinsed for 10-20

min in 10% acetic acid before drying in a forced-air oven at

80*C. Gels run on the Macrophor were bonded to the running

plate, and others were transferred to filter paper prior to

drying and autoradiography.

Sequence analysis was done on the Multiple Sequence

Editor (Massachusetts Institute of Technology) and the

Genetics Computer Group Software Package (Devereux et al.,

1984) version 6.1, both running on a MicroVAX II computer.

Nucleotide sequence searches were performed using the

European Molecular Biology Laboratory (EMBL) version 22











(modified; February, 1990) and Genbank version 63 (March,

1990) databases.

Nonradioactive Detection Systems

Overview of Nonradioactive Detection Systems

Three different nonradioactive labeling and detection

methods were used in this study: the SA-AP (streptavidin-

alkaline phosphatase) method (GENE-TECT protocol, Clontech

Laboratories, with BRL reagents); the ECL (enhanced

chemiluminescence) method (ECL kit, Amersham Corporation);

and the Genius method (Genius Nonradioactive DNA Labeling

and Detection Kit, Boehringer Mannheim Biochemicals).

The nonradioactive labeling and detection kits were

used essentially as recommended by the suppliers, except

where otherwise noted. The SA-AP kit used biotinylation of

probe DNA via nick translation, and detection of hybridized

probe by binding of streptavidin-alkaline phosphatase,

followed by an enzyme-catalyzed color reaction. The ECL

probes were prepared by covalent binding of peroxidase to

the DNA, and detection of hybridized ECL probes was achieved

by a chemiluminescent reaction using X-ray film. The Genius

kit used random primed incorporation of the steriodal hapten

digoxigenin into probe DNA. Following hybridization, Genius

probes were detected by enzyme-linked immunoassay using an












antibody conjugate (a-digoxygenin-alkaline phosphatase

conjugate), and the same color reaction used with the

SA-AP method.

Preparation and Use of Biotinylated Probes

The preparation of biotinylated probes was achieved by

nick translation of double-stranded template DNA for the

incorporation of biotinylated nucleotides. The BRL Nick

Translation System (BRL) reagents were used, according to

the recommendations for the Biotin-21-dUTP Labeling System

(Clontech Laboratories). Unincorporated nucleotides were

removed by gel exclusion chromatography (using BIO-GEL P-60,

BioRad).

Unless otherwise noted, prehybridization and

hybridization conditions for use of biotinylated probes were

as described in the section on general molecular methods,

above.

Detection of hybridized biotinylated probes was

accomplished according to the directions in the GENE-TECT

protocol (GENE-TECT Detection System, Clontech

Laboratories). All detection steps were performed at room

temperature. Filters were first washed 30 min in 3% NFDM

(blocking step). Then they were incubated for 25 min with

SA-AP (streptavidin-alkaline phosphatase), in a solution

made by adding 2.5 gl SA-AP conjugate (BRL) per ml Buffer A












(0.2M NaCl, 0.05% Triton-X-100, 0.1M Tris, pH 7.5). The

filters were then washed 3 times with Buffer A, 10 min each

wash, then once for 10 min with Buffer C (0.1M NaCI, 50mM

MgC12, 0.1M Tris, pH 9.5). Then the filters were incubated

in the color solution (Buffer C with chromogenic substrates)

in reduced illumination until signals were developed

properly. The color reaction was terminated with ImM EDTA.

Preparation and Use of ECL Probes

The directions supplied by the manufacturer of the ECL

kit (ECL Version 2, Amersham) were followed in the

preparation and use of ECL probes, including the

prehybridization and hybridization steps, except that SSPE

was substituted for SSC in the wash solutions (see below).

Double-stranded DNA to be labeled was precipitated and

resuspended in deionized water at a concentration of 10

ng/ml. The DNA was boiled for 5 min, then immediately cooled

on ice for 5 min. An equivalent amount of DNA labeling

reagent and then glutaraldehyde solution were added to the

DNA and mixed thoroughly. The solution was consolidated by

spinning briefly (5 s) in a microcentrifuge, then incubated

for 10 min at 370C. The labeled probe was stored in 50%

glycerol at -20C until used.












The supplied hybridization buffer was used for both

prehybridization (at least 10 min at 40-42*C) and

hybridization (overnight at 40-42*C) after adding NaC1 to

0.5M.

Following hybridization of probes according to the ECL

protocol, filters were removed from the hybridization medium

and washed twice (20 min each wash) at 40-42*C with primary

wash buffer (6M urea, 14mM SDS, 0.5X SSPE). Then the filters

were washed twice (5 min each wash) at room temperature with

2X SSPE. Equal volumes of detection solutions 1 and 2 were

mixed, and the filters were incubated in this detection

buffer 1 min at room temperature. Filters were wrapped in

plastic wrap and exposed to x-ray film in the dark, with the

side of the filter which received the DNA during application

of target DNA facing the film. The film was developed after

a 1 min exposure, followed by longer exposures as needed.

Preparation and Use of Genius Probes

The directions supplied by the manufacturer of the

Genius kit (Genius Nonradioactive DNA Labeling and Detection

Kit, Boehringer Mannheim Biochemicals) were followed in the

preparation and use of Genius probes, except that labeled

probes were precipitated with NaCl rather than LiCl, and

SSPE was substituted for SSC in the hybridization steps.

Genius probes were prepared by the random primed












incorporation of digoxygenin-tagged nucleotides, and

detected by immunoassay.

In the preparation of a Genius probe, linearized,

purified, heat-denatured probe DNA was mixed with the

supplied hexanucleotide mixture, dNTP labeling mixture, and

Klenow enzyme according to the instructions provided with

the kit, and incubated for at least 60 min at 37*C. The

reaction was stopped by addition of 1mM EDTA. The

unincorporated tagged nucleotide was removed by ethanol

precipitation, the probe DNA was resuspended, and was stored

at -20C until used in a hybridization reaction.

The Genius prehybridization and hybridization buffer

was composed of 5X SSPE, 5% of the supplied blocking

reagent, 50% formamide, 0.1% sodium N-lauroylsarcosine, and

0.02% SDS. The temperature used for prehybridization and

hybridization, 420C, was that recommended for buffer with

50% formamide. Filters were hybridized overnight, then

washed twice for 5 min each wash at room temperature in 2X

SSPE, 0.1% SDS. Next the filters were washed twice for 15

min each wash at 680C in 0.1X SSPE, 0.1% SDS. Detection was

performed immediately following these washing steps.

All steps in the Genius detection protocol were

performed at room temperature. The Genius detection was

begun by washing filters for 1 min in Genius buffer 1 (150mM












NaCl, 100mM Tris, pH 7.5), then for 30 min in buffer 1 in

which had been dissolved 0.5% of the blocking agent. A brief

(1 min) rinse of the filters in buffer 1 was followed by

incubation for 30 min in a solution of antibody-conjugate,

prepared as a 1:5000 dilution of the supplied antibody-

conjugate in buffer 1. Unbound antibody-conjugate was

removed with 2 washes, each for 15 min, in buffer 1. Next

the filters were incubated for 2 min in buffer 3 (100mM

NaCl, 50mM MgC12, 100mM Tris, pH 9.5), and finally in the

color solution (buffer 3 plus chromogenic substrates) under

reduced illumination until signals were properly developed.

The color reaction was stopped with ImM EDTA.













MOSQUITO SPECIES-SPECIFIC DNA PROBES

Isolation Methods and the Relevance of Genome Organization

Mosquito species-specific DNA probes were isolated by

the method of Cockburn (1990). The method involves a search

for repetitive DNA clones from a library using differential

screening. The clones each contain a small piece of genomic

DNA. Two genomic DNA probes are used to screen clones for

the presence of a species-specific DNA insert. One

(homologous) probe is genomic DNA from the same species used

to prepare the library. The other (heterologous) probe is

genomic DNA from a different species. Only clones containing

a DNA sequence repeated many times in the genomic DNA probe

hybridize at detectable levels. To isolate a clone from the

C. nigripalpus libraries, DNA from the closely related

species C. salinarius or C. quinquefasciatus was used as the

heterologous probe. To isolate a clone from the A.

nuneztovari library, DNA from A. oswaldoi was used as the

heterologous probe.

The cloning strategy, including the choice of vector,

used in the preparation of DNA libraries to be screened for

probes determines the size (or range of sizes) of inserts

from the organism's DNA that end up in the clones. The

average size of the inserts in the library can affect the










23

outcome of the screening by differential hybridization, due

to peculiarities of genome organization.

The organization of the genomes of anopheline and

culicine mosquitoes is known to differ (Cockburn & Mitchell,

1989). Both anopheline and culicine genomes contain regions

of repetitive DNA, but there are longer stretches of

interveniong nonrepetitive DNA between the repeats in

anopheline genomes, as compared to culicine genomes.

Species-specific probes can be isolated for Anopheles

species rather easily by differential hybridization, using

phage vectors that typically contain 10-15-kbp inserts

(Cockburn & Mitchell, 1989). The separation of repetitive

DNA in the Anopheles genomes allows large inserts to retain

species specificity when the insert contains only a single

species-specific repeat. The different interspersion pattern

of culicine genomes, however, causes large inserts to be

more likely to show cross-hybridization to heterologous DNA

used in differential screening, due to the presence of

nonspecific repetitive DNA scattered throughout the genome.

One way to enhance the possibility of isolating a

species-specific repetitive DNA probe from Culex DNA is to

use a vector which favors small inserts. This decreases the

chance that a clone carrying species-specific repetitive DNA

also contains a portion of nonspecific repetitive DNA. That











was the rationale for using the LambdaGEM-4 and plasmid

vectors with double-digested genomic DNA in the attempts to

isolate a Culex-specific probe. The double-digested genomic

DNA used for preparation of libraries was mostly in the 100

base pair size range, and the LambdaGEM-4 vector excluded

inserts greater than 4.1 kbp. Cloning of small inserts thus

favored the isolation of a species-specific DNA probe from

Culex, using the differential hybridization method.

Isolation of Probe pCxl

In an attempt to isolate a C. nigripalpus-specific

probe by differential hybridization of genomic DNA from C.

nigripalpus and C. salinarius to recombinant LambdaGEM-4,

about 5000 recombinant phage containing C. nigripalpus DNA

were screened. From this primary screen, 10 plaques were

picked which gave some degree of differential signals. In no

case was the degree of hybridization to C. salinarius

genomic DNA negligible. However, two of the clones which

gave the best differential signals were chosen for further

characterization, because it was thought that they might

contain species-specific DNA along with nonspecific

sequences. The recombinant pGEM-4 plasmid was recovered from

the two clones (the plasmid is part of the phage vector

LambdaGEM-4), and the insert in both clones was found to be

about 1 kbp, but slightly different in size.










25

The DNA from the two recombinant pGEM-4 clones was cut

separately with 10 different restriction enzymes, each of

which cut the insert DNA into several fragments. These

digests were run on gels, and blotted to hybridization

filters to obtain equivalent targets that were hybridized

separately to C. nigripalpus and C. salinarius genomic DNAs.

The results of autoradiographic detection revealed that none

of the fragments hybridized differentially to the degree

necessary to distinguish the two species. Accordingly, work

with these clones was terminated.

Probe pCxl was isolated from a plasmid library of C.

niqripalpus Hind III/EcoR I fragments which was screened with

C. quinquefasciatus and C. nigripalpus genomic DNAs. The

insert in pCxl was about 10 kbp. Squash blots with

radiolabeled pCxl provided detection of C. nigripalpus and

C. salinarius, compared to negligible signals to C.

quinquefasciatus and all other mosquito species used in this

study.

About 5000 colonies containing C. nigripalpus insert

DNA, and about 1000 colonies with C. salinarius insert DNA,

were screened for species specific sequences by differential

hybridization to C. nigripalpus and C. salinarius genomic

DNAs. None were found to display specificity sufficient for

a species-specific probe.












Isolation of Anopheles nuneztovari-specific Probes

A partial sau3A I library of A. nuneztovari fragments

(about 15 kbp insert size) in phage EMBL 3A was obtained

from A. F. Cockburn.

In an initial screen for A. nuneztovari-specific

probes, nine plaques were isolated which gave good

differential signals in hybridization to A. nuneztovari and

A. oswaldoi genomic DNAs. These phage will be evaluated to

determine if they can distinguish these and other species of

the A. nuneztovari complex.

Mapping and Sequencing of Anopheles quadrimaculatus- and

Anopheles freeborni-specific Probes

Physical mapping was performed with the clone pAfl-Sl,

using single and double digests. This resulted in the

localization of unique EcoR I, Hind III, sst I, and Kpn I

sites located at about 250, 500, 600, and 1400 base pairs,

respectively, from the xba I site in the vector. This

analysis also revealed the presence of four Pst I sites, and

the absence of sites for Ace I, BamH I, sat I, and xba I, in

the insert. Many (more than 10) sau3A I sites were detected

in the insert, with several clustered within 200 base pairs

of the Pst I site in the vector. Deletion subclones were










27

constructed using the four unique restriction sites found in

the insert.

Analysis of the nucleotide sequence data obtained from

probes pBrpl-Sl (Figure 1), pAfl-S1 (Figure 3), and the Crp

plasmids (Figure 2) did not reveal any repeat structures

which might be important in conferring species specificity.

Of the three Crp plasmids, only pCrpl-S2 and pCrpl-S3 were

found to retain the specificity of the phage Crp probe, in

tests with quick blots (see below).

Comparisons of all the sequence data obtained in this

study to the data contained in the EMBL and Genbank

databases revealed no significant findings (no contiguous

regions of mosquito DNA longer than about 20 nucleotides

were similar to sequences stored in the database), with the

following exceptions. A small portion of sequence at one end

of the pAfl-Sl clone was found to show considerable homology

to several ribosomal sequences from plant and animal

sources, suggesting that the elimination of this small part

of the probe insert could result in increased specificity.

Comparisons of the sequence from pCrpl-S3 to cytochrome P-

450s from several sources may not be significant, as the

extent of similarity was not great; however, this finding

will be pursued further.









28

The fact that no repeat sequences are reported here for

the pBrpl-Sl, pCrpl-Sl, pCrpl-S2, pCrpl-S3, and pAfl-Sl

probes does not indicate that the sequences conferring

species specificity to the probes were not found. Such

sequences may be present in the data, but the small amount

of sequence data obtained from these clones is just a start

in the effort to characterize them at the molecular level.

The sequences important for species specificity in these

clones may not be small repeats (as is the case for the Arp2

probe), and the repetitive sequences providing specificity

may not become apparent even with the entire sequences in

hand, especially if only one repeat is contained in a given

clone. If this happens, subcloning and additional

specificity testing could narrow down the region conferring

specificity, and the species-specific subclones could be

used as tools to probe the genome directly.

Enough nucleotide sequence data were obtained from the

Nsi I subclones of pKA2 to allow recognition of conserved

internal repeats (Figures 4 and 11). This allowed the

specification of synthetic oligonucleotides. As the insert

in pKA2 was known to be rearranged with respect to that in

phage Arp2, sequence data were also obtained from subclones

prepared directly from phage Arp2 (Figures 5 and 11). The

latter data were thought to reflect more accurately the












actual sequence in the A. quadrimaculatus species A genome.

In the sequence data obtained from the phage Arp2 subclones,

it was found that in most every 200 base pair stretch of

contiguous sequence there were from one to five copies of a

given sequence motif, and two or three of the different

motifs, represented.

The differences between the sequence data obtained from

phage Arp2 and that from the pKA2 subclones suggest that the

sequence obtained from the phage Arp2 does not correspond to

the same regions of the mosquito genome as the sequence

obtained from the pKA2 subclones. However, the striking

conservation of consensus sequences in the data from both

sources (Figure 11) suggests that the pKA2 insert accurately

preserves at least some of the sequences found in the A.

quadrimaculatus species A genome. It also suggests a

mechanism that explains the shortening of the phage Arp2

insert in the subcloning step that generated pA2 (and thus

pKA2) from phage Arp2: the multiple conserved consensus

sequences in the Arp2 insert provided a suitable substrate

for an internal recombination event in the bacterial host

that resulted in a large deletion. This type of event would

leave the majority of sequences within the pA2 insert intact

with respect to the corresponding regions in the phage Arp2

insert.












Forward Primer.

1 GACGTCCAGC

51 GACGACGACG

101 GTACCGCATG

151 GGGTCTgcTT



Reverse Primer.

1 ATCTCAGCTG

51 ACGTCATGCA

101 TGGCAAAAGA

151 GCGCTcCCGT

201 CGTCTTTATT


181 Nucleotides.

TGCCGCTTCC TTCGTCTGcC GGCGTCGGAG TGACTTGTTG

TCGGGCCGTT GCgcTCcCGC CAGCCGACGC TCACGCTGGT

AAGTTCCGCC ACGCGTTGGG CGTGGACTTC GCCATggccA

GTTCGACTAA TAGgCCAACC T



275 Nucleotides.

ACTGCATAGT TTAGACGATT AACGTTGACT CGACCAAACA

AACCAGCAAC TTTTGGTTGc CGTCGAATTT CCACCTCACA

GTGGACAGTC CTCGTTGTGT CGCTACGGTC AGCTACAATG

TAGAAGCCGA CCGCCGCCCA CATTCGTTCT TCTTAAAGAT

AAAaGAACAC GCCGGTCCGT GGCGGTCAAA CCTAATGTGT


251 ACTGCCACTA TTTtCCTGGC CAGAA



Figure 1. Nucleotide Sequence from the A. quadrimaculatus Species
B-specific Probe, pBrpl-Sl. Lower case nucleotides indicate
uncertainty in the data at those positions.












pCrpl-Sl. Forward Primer. 264 Nucleotides.

1 AGCCAGCTGG ACGTCCAGTT GCCTAGTTCT CTTGCTTCTT GTCGTGTGAT

51 AGCCGNGCGA TTCGGTAATC GGCGCGTTGC CTACGGCANC GTGCTACCGT

101 GCCCGTTTGT CACCTAGGCA GCACATGCAG TCTTACAGTA GCACCAAaCG

151 GCTTACCAAA TGACGGGCTA GAGGCTATAC CTTGCGATAA CAGACTCTAA

201 CGATGATACG ATGGCGTTGC CAgGATgcAg GAAGCTCTtA aTGACAGTCA

251 CCAAGACACA CACG



pCrpl-Sl. Reverse Primer. 201 Nucleotides.

1 CTCAGCTGGT AAGCTGCTTA AAGATGnGGC GTAGCCGGGT GCCTGTCGGG

51 GTCTGCCTGT TGGGCGTCAT ACTGCATGTT GTTTCACGTT ACATCTTTTT

101 GTGTTGTGAT AAACTTCAAC AACCCTTGTC TTAgTTGGCn AcGGataTTt

151 CCATTAAGTG ACGTGAGTTt CATGTTGTTT tCCCGTATAT tGgAaTTGTa

201 A



pCrpl-S2. Forward Primer. 168 Nucleotides.

1 GGCGGCGGGT GTAAGCAAGA AGAATTTCTA GCAGAAATAA TTTtCTtGcT

51 GcCgGCCAGG CACCGCcCAG TTTGGATTAC ACATGACGGT GATAaAAAGG

101 ACCGGtCTGC CGGTCGCCGg TACAATgGcC ATCGCGTCTG ATACTTGGCG

151 CGTATAATCG nACTCGGA


Figure 2. Nucleotide Sequence from the A. quadrimaculatus Species
C-specific Probes pCrpl-S1, pCrpl-S2, and pCrpl-S3. Lower case
nucleotides indicate uncertainty in the data at those positions,
and N (or n) indicates the occurrence of a nucleotide of unknown
identity.















pCrplS-S2. Reverse Primer. 90 Nucleotides.

1 TATCGGTTGG ACACGAGCAG AGCAAGGTGC GTGGATCGAC GGgCGGCTGG

51 TGAGGCTGTG CCGAGCTGCG CGAAAAGCTT CGGTATCACg



pCrpl-S3. Reverse Primer. 124 Nucleotides.

1 GAGCGTACGG CTGAACGACA TTTTCTACTG AGATATGACC AAACTTGTTT

51 GAATCCTTTC TTTGCTTTGC GTAGCTTCTG AGCTACGCTC CCAAACAATT

101 GCTCACTGCT AATGAaAGAA AAaG


Figure 2--continued.













Forward Primer. 177 Nucleotides.

1 GATCCGGGGT AGTCCACTAT AACACAAACA AACAACCAAA GGTCAGGAAT

51 GAGTAAATGG AGGTGCGTTG GGCTAGCTTG CCAACCGAAA CATAAGGAAT

101 GAGTACATGG AGTTGAGTTT GGTTTCCAAT CTACTATAAG GAAGCAAAAA

151 ACTTTACCTT AAATGAATTC TGCGTCA



Reverse Primer. 282 Nucleotides.

1 GTGTTGGATT GCTAGGAGGC GCTTgCgACC CCCAAATaCC ACGTTCGTAA

51 TGGATCGgAT GTcCGTACnC TGCGGATCGA CAAGTGCACC GCgGCCTtGC

101 ACgCcCGGGG GnCCACCGAC nggGCTGAAT gTCGCCCCGG TCTATTGAGT

151 TCAACGGGTT TGTTCCCCTA GGCAGTTTAC GTACTCTTTG ACTCTCTATT

201 CAGAGTGCTT TnAACTTtCC TCACGGTACT TGTTCGCTAT CGGCTCATGG

251 TGGTATTAGC TTAGAaGGAG TTCTCcACTT AG



Reverse primer. 160 Nucleotides.

1 GCAAAAAACT TTACCTAAAT GAATTCTGCG TCATATCATG GGTGTTCTAG

51 TCAAGTGGCC AAGATAACCA AGAGGTGCAG CAAATTACAA ATGAGAAGTT

101 GAGTATGCCT TCTCATATgA TAACCCTCTA ACAAAGTCAA TGACGCAAAT

151 CAACATTGGA



Figure 3. Nucleotide Sequence from the Anopheles freeborni-
specific Probe pAfl-Sl. Lower case nucleotides indicate
uncertainty in the data at those positions, and N (or n)
indicates the occurrence of a nucleotide of unknown identity.












pKA2-N1. Forward Primer. 85 Nucleotides.

1 TGCATACACC AATAGATGCA ATNAGTTTNG AGTATGTTCT ATGATAGGTT

51 TGITAACAGA TGCCTAGATA TGGCATGTAT TCATA



pKA2-N1. Reverse Primer. 294 Nucleotides.

1 GCATATAGCT GGTGCTAGTT TTTANANAGT GGNAGAACAT GGGAAATCTG

51 TGAAGCAAAC CAAGTCACAG GACAGACTCC GAAACTGATG GCATCTATTG

101 GGCTACGCAT GGAAAACCCG CTTTTTGCAT ATAGCTGGTG CTAGTTTTGG

151 ATATATNNTT GGGAATACGN CTGTTTGCGT ATAGCTGGTG CTAGTTTGGA

201 ACTGTGACAC AATTCAATCT GTTAGCAATC ATAGGACATA CTCAACTATG

251 GCATGATCGG TGTACGATGA ACgCTATTGC TAGCTGGTGT CTAG

Figure 4. Nucleotide Sequence from NsiI Subclones of Plasmid
pKA2. Lower case nucleotides indicate uncertainty in the data at
those positions, and N (or n) indicates the occurrence of a
nucleotide of unknown identity. Internal repeats (conserved or
consensus sequences) used to specify the production of synthetic
oligonucleotides (Figure 11) are indicated as follows:
SEQUENCE 1; SEQUENCE 2; SEQUENCE 3; and SEQUENCE 4.
Note the overlaps of some of the repeats at their ends.













pKA2-N2. Data from Forward & Reverse Primers. 267

Nucleotides.

1 CGCTGTTTGC ATATAACTAG TGCTAGATTT GGATATATGG CACAAATGTC
-------------------------~~-"-"----~---------------

51 AAATCTGTTA GCAAATCAAT CATAGGACAT ACTTCAAACT CATGGCATCT


101 ATTGGTGTAC GCATGGTAAT CCGCTGTTTG CATATAGCTG GTGCTAGTTT


151 GAGATATATG GCACAAATGT GATCAATTGT CATATCTAGG CATCTGTTAG


201 CAAACCAATC ATAGGACATA CTCCAAACTC ATTGCATCTA TTGGTGTATG


251 CAGGTCGACT CTAGAGG




pKA2-N3. Data from Forward & Reverse Primers. 113

Nucleotides.

1 CGCTGTTTGC ATATAGCTGG TGCTAGTTTG AGATATATGG CAAAAATGTC
--------------------------------

51 AAATCTGTTA GCAAACCAAT CATAGGACAT ACTCCAAACT CATTGCATCT


101 ATTGGTGTAT GCA


Figure 4--continued.












pArp2-N1. Reverse Primer. 135 Nucleotides.

1 CAAGCTTGCN TNCCTGCATA CACCAATANA TGCAATGAGT TTGAGTATG

51 TCCTATGATT GGTTTGCTAA CAGATTTGAA ATTTGTGTCA CAGTTCCAAA

101 ACCAGCACCA GCCTATGCA AACAGCGTAT TCCCA




pArp2-N3. Reverse Primer. 262 Nucleotides.

1 TAGCTGGTGC TAGTTTTTTA TATATGGCAA ACATGTCAAA TCTGTTAACA

51 AACCAATCAC AGGACATACT CCAAACTCAT GGCATCTATT GGTCTACGcC

101 ATGAAAACCg CcGcTTTTTG CATATAGCTG GTGCTAGTTT TGGATATATG

151 CTTGGGAATN nNTGTTTGG TATANTGGTG CTAGTTTNNN AaCTGTGACA

201 CAAATTTCAA AtctGattaG CAaATCAATC ATAGGACATA CTCAaACTAT

251 GGCATGTATC GG



pArp2-N5. Reverse Primer. 94 Nucleotides.

1 CTATGATTGA TTTGCTAAAA GATTTGACAT TTGTGcCCAT ATATCCAAAA

51 CTAGCNCCGG CTATAACCAa ACAGCGTATT TCCATGCAGG TCGA

Figure 5. Nucleotide Sequence from Subclones of Phage Arp2. Lower
case nucleotides indicate uncertainty in the data at those
positions, and N (or n) indicates the occurrence of a nucleotide
of unknown identity. Internal repeats are identified (see Legend
for Figure 4).













QUICK BLOTS

Experiments Leading to the Quick Blot Protocol

In attempts to use nonradioactive detection systems

with mosquito species-specific probes, it was found that an

improved method for preparing targets from a series of

individual mosquitoes was needed. Table 1 provides a summary

of the experiments that led to the development of this

method.

Experiment 1 (Table 1) demonstrated the effectiveness

of SA-AP detection, using mosquito genomic DNA as both the

target and the probe, with dot blots. It revealed that 10 ng

of target DNA could be detected with homologous probe, even

when background was very high.

Experiments 2 and 3 (Table 1) suggested that the high

background seen in experiment 1 could be reduced by

substituting nitrocellulose filters for nylon without

sacrificing sensitivity. Using SA-AP detection with

nitrocellulose filters, a sample of 10 pg of target DNA was

detected on dot blots. Experiment 4 was performed in order

to determine if results differed when NFDM was substituted

for BSA (bovine serum albumin) in the SA-AP detection

protocol. Either ingredient could be used without effect on

the sensitivity of detection or the level of background.










38
Thus, NFDM was used in place of BSA in all subsequent SA-AP

detections.

In experiment 5 (Table 1) and in other experiments

(Tables 1 and 3), the recombinant plasmid pKA2 was used as a

probe. Using nick translation and autoradiography for

labeling and detection, respectively, it was found that

radiolabeled pKA2 provided specific detection of A.

quadrimaculatus species A, without showing significant

detection of A. quadrimaculatus species B, C, and D, A.

crucians, A. albimanus, A. aeqypti, A. taeniorhynchus, C.

quinquefasciatus, and C. perturbans.

Experiments 5 and 6 (Table 1) showed that an unmodified

SA-AP detection protocol could not be used for species

identification of mosquitoes using the squash blot protocol

(Cockburn, 1990) with species-specific probes, due to

nonspecific detection. The problem was thought to be caused

either by residual streptavidin-binding substance (perhaps

biotin) or alkaline phosphatase activity in the target areas

on the filters. Results of experiment 7 (Table 1) suggested

that the former was the cause, since no signals were formed

upon equivalent detection when both the SA-AP enzyme complex

and biotinylated probe were omitted. Thus, improvements to

the SA-AP detection system were needed, which would allow

specific detection of mosquitoes using species-specific












probes. It was thought that the streptavidin-binding

substance might be removed or neutralized by certain

treatments of the filters following sample application but

prior to the prehybridization step. These treatments are

hereafter referred to as post-application treatments or

post-application washes, as they were applied to blots after

the binding of sample (target) DNA to the filters.

Experiments 8 and 9 (Table 1) suggested that an

unmodified ECL detection protocol would not be useful for

mosquito identification using species-specific probes in

either the dot blot or squash blot systems, due to a

relatively high level of nonspecific detection. Experiment

10 showed that the ECL system was functioning in the

detection of non-mosquito control DNAs in the dot blot

system. Hence it was obvious that alterations would have to

be made before the ECL detection system could be used with

species-specific mosquito DNA probes. Experiment 11 (Table

1) was designed to find out whether the ECL detection

protocol would produce signals on nitrocellulose squash

blots of mosquitoes in the absence of hybridized probes.

Indeed it did, suggesting that residual peroxidase activity

in the target areas may have contributed to nonspecific

detection. It was thought that certain post-application wash












conditions might be found to inactivate this activity on

filters before prehybridization steps were performed.

In order to discover post-application treatments of the

filters which would eliminate the barriers to

species-specific nonradioactive detection of mosquito squash

blots using DNA probes, various washes of the filters were

tested. In experiments 12a and 12b (Table 1), squash blots

were washed separately for 45 min at room temperature in the

following solutions : 10% SDS, 8M urea, 0.5 M HCl, 10% meat

tenderizer in IX SSPE, 10% LA FRANCE (whitener/brightener

powder containing protease, The Dial Corporation), 8M urea

plus 10% SDS, or 8M urea followed by 10% SDS. In these

experiments, the washing step was followed by detection

steps, and the prehybridization and hybridization steps were

omitted.

When the ECL detection protocol was applied to these

unprobed squash blots (experiment 12a, Table 1), all the

washes were found to be useful in greatly reducing

background levels. However, various levels of nonspecific

detection were observed. The lowest signals occurred on nylon

filters which received the urea and the urea-then-SDS

treatments, and on nitrocellulose filters which received the

LA FRANCE or urea-then-SDS treatments (see notes on Table 1

for more experimental details).










41

Another set of squash blots treated as described above

was subjected to the SA-AP detection protocol (experiment

12b, Table 1). High background levels were observed on all

of the nylon filters, whereas all nitrocellulose filters

showed very low background. The nylon and nitrocellulose

filters which received the LA FRANCE treatments showed

negligible signals, apart from background, whereas all other

filters had a moderate level of nonspecific signals.

Experiments 12a and 12b (Table 1) revealed that

specific treatments of squash blots were effective for

reducing background and/or nonspecific detection. The

results suggested that nitrocellulose squash blots washed

with LA FRANCE could be used with DNA probes to provide

specific detection of mosquitoes with either the SA-AP or

the ECL systems.

First Attempts at Making Quick Blots

Although experiments 12a and 12b (Table 1) demonstrated

the potential usefulness of post-application treatments for

improving the specificity of nonradioactive detection with

squash blots, it was obvious that further improvements could

be made in signal-to-noise ratio, as well as in

standardization of sample application. It was thought that

an adaptation of the 96-well dot blot manifold might allow

the use of batch-processing techniques and ensure uniform












sample application. Further improvement in detection might

also be achieved with this apparatus by using a selective

barrier for excluding cuticle and large pieces of tissue

from binding to the filters. A dot blot manifold was used

essentially as in a standard dot blot protocol, but with the

important modification of placing a filter paper above the

blotting filter instead of below it.

Experiments 13a and 13b (Table 1) represent the first

attempts at implementing the QB protocol based on some of

the ideas described above. In experiment 13a, a thick filter

paper pad was used as a blocker. In experiment 13b, a thin

tissue was used. The filters were probed with radiolabeled

pKA2, and detection was by autoradiography. Detection of DNA

was superior when the thin tissue was used as the blocker.

The thicker paper apparently blocked the DNA from reaching

the blotting filter. After this experiment all other QBs

were produced by using the thin tissue.













Table 1. Experiments Performed to Develop the Quick Blot
Protocol.


EXPT FILTER/SAMPLE PREHYB/HYB PROBE DETECTION RESULTS


1 NY dot blot of
of AqA DNA


2 NC dot blot of
biotinylated
#147 DNA


3 NC dot blot of
#147 DNA
(unlabeled)

4 same as for
expt 2

5 NC squash blots
with Ac, AqA,
Cq, and Cs


6 same as for
expt 5

7 NC squash blots
with AqA, Cs,
and Cq


8 Hy-ECL dot blot
(with AqA, Cn,
Cq, and Cs)

9 NC squash blots
with AqA, Cs,
and At


std AqA
-BIOTIN


std


std


std


std


NONE


#147
-BIOTIN


NONE


pKA2
-BIOTIN


std NONE


NONE NONE


ECL pKA2



ECL pKA2
-ECL


SA-AP 10 ng det
unequivocal;
very high bg

SA-AP 100 pg det
unequivocal;
10 pg barely
distinguish-
able; very
low bg

SA-AP same as for
expt 2


SA-AP same as for
(BSA) expt 2

SA-AP nonspecific
det of all
samples; very
low bg

SA-AP same as for
expt 5


SA-AP
(without
SA-AP
reagent)


ECL



ECL


no det


nonspecific
det; very
low bg

nonspecific
det (signals
for all three
species);
very low bg













Table 1--continued.


EXPT FILTER/SAMPLE PREHYB/HYB PROBE DETECTION RESULTS


10 NY dot blot and ECL lambda
Hy-ECL dot blot -ECL
(both with lambda
DNA dilution series)



11 NC squash blot NONE NONE
with AqA, Cs,
and At


12a NC and NY
squash blots
with AqA, Cs,
and At
(VARIOUS POST-
APP WASHES:
SDS, urea,
HC1, mt, LF,
urea-SDS,
urea-then-SDS)


ECL NONE


ECL






ECL


ECL


10 pg det
unequivocal
with NC and NY
filters;
1 pg det
(barely) on NY

Nonspecific
det; low bg


Nonspecific
det with very
low bg, on all
filters,
but very faint
signals only
on NY filters
which received
the urea
and the
urea-then-SDS
treatments,
and lowest
signals among
the NC filters
which were
treated with
urea-then-SDS
or LF












Table 1--continued.


EXPT FILTER/SAMPLE PREHYB/HYB PROBE DETECTION RESULTS


12b same as for
expt 12a


std NONE


SA-AP All NY filters
showed high
bg, and all NC
filters showed
very low bg.
Nonspecific
signals seen
on all targets
on all filters
EXCEPT that
virtually no
signals seen
on both NC and
NY filters
which received
the LF washes


13a NY QB but
with filter
paper blocker;
AqA

13b NY QB (with
tissue paper
blocker); AqA


std




std


pKA2
-32P



pKA2
-32P


only 36 (out
of 94) spots
show a signal


all (of 94)
spots
show a signal


Notes for Table 1. EXPT = experiment (number). PREHYB/HYB = type
of prehybridization and hybridization conditions used. AqA = A.
quadrimaculatus species A (its DNA, when used in probe column);
Ac = A. crucians; Cq = C. quinquefasciatus; Cs = C. salinarius;
Cn = C. niqripalpus, At = A. taeniorhynchus. bg = background
level of signal development (i.e., signal intensity where target
DNA was not applied to the filter). #147 DNA = Hsp70 deletion
subclone from A. albimanus in pUC19, from Mark Benedict. pKA2
plasmid pKl9 with part of the mosquito DNA insert from phage Arp2
(Cockburn, 1990). lambda = phage lambda DNA.












Notes for Table 1--continued. Std = standard prehybridization (1%
NFDM, 0.2% SDS, 55C for at least one-half hour) and
hybridization (30% formamide, 5X SSPE, 1% NFDM, 0.2% SDS, plus
probe) conditions. SA-AP (BSA) = the GENE-TECT detection
protocol, Clontech Laboratories, Inc., with SSPE substituted for
SSC (saline sodium citrate). SA-AP = the GENE-TECT detection
protocol, but with NFDM substituted for BSA, and SSPE used
instead of SSC. NC = BA-85 nitrocellulose filter, Schleicher &
Schuell. QB = Quick Blot. NY = ZetaProbe nylon filter, Bio-Rad.
Hy-ECL = HyBond ECL filter nitrocellulosee; Amersham). NONE = no
treatment, or no probe. BIOTIN = biotinylated probe prepared by
nick translation. ECL = ECL hybridization buffer (for
prehybridization and hybridization steps), as supplied plus 0.5M
NaC1, or ECL probe prepared according to protocol provided by
manufacturer (Amersham). pg = picogram(s). ng = nanogram(s). det
= detection. no det = no signals or only very faint (barely
observable) signals. Dot blots = standard dot blot procedure
using dilution series of purified DNA applied to the filters,
with separate spots containing different amounts of the same DNA.
Squash blots prepared as described by Cockburn (1990). POST-APP =
post-application treatments, or washes of filters after target
DNA samples were applied (all for 45 min at room temperature):
SDS = 10% SDS; urea = 8M urea; HC1 = 0.5M HC1; mt = 10% meat
tenderizer (Tone's Meat Tenderizer, Tone Bros., Inc.); LF = 10%
LA FRANCE (whitener/brightener powder containing protease, Dial
Corporation); urea-SDS = 8M urea, 10% SDS; urea-then-SDS = first
wash with 8M urea, second wash with 10% SDS. Nitrocellulose
filters were subjected to standard vacuum-baking procedures
following application of samples, and nylon filters were
subjected to standard UV-fixation (ultraviolet light treatment)
following application of samples (except where otherwise noted).
However, results of equivalent experiments in which these
fixation steps were omitted suggested that non-fixed filters of
both types yield signals equal in intensity to fixed filters.











Steps in the Quick Blot Protocol

This section describes the steps in the QB protocol in

detail. A list of materials and apparatus used in the

preparation of QBs is given in Table 2, and a picture of the

apparatus is shown in Figure 6.

Mosquitoes (larvae, pupae, or adults) were placed

individually into the wells of a 96-well microtitration

plate. Denaturing buffer (Table 2) was then added. For

standard sized wells of 10 mm deep and 13 mm in diameter, a

maximum of 200 pl per well of denaturing buffer was used.

The DNA was then released from the tissues by grinding

with the steel pegs of the Replaclone for about three min in

the orientation that allowed all of the Replaclone pegs to

be inserted into wells of the plate. The progress of this

grinding step was checked visually at 30 s intervals by

inspecting the coloration of the sample buffer and noting

whether any large tissue fragments were attached to the

proximal part of the steel pegs. A given mosquito species or

life stage produced a characteristic (usually slightly

brownish or yellowish) coloration of the buffer when

grinding was sufficient. In about 5% of adult mosquito

samples, tissue fragments required being pushed back into

the buffer by using a pin or fine forceps.










48

The plate was incubated for 30 min at room temperature,

and then neutralization buffer (Table 2) was added and mixed

thoroughly in the sample wells using the Replaclone (or

micro-pipette). The volume of neutralization buffer added

per well was one-fourth of the volume of denaturing buffer

added previously. Use of a multi-channel pipette for all

transfers of solutions significantly decreased the time and

effort required to complete the protocol, but was not

required.

A blotting filter nitrocellulosee or nylon) was cut to

size and wet in water. The base of the dot blot manifold was

positioned for convenient access to the vacuum source, and

then the middle block of the manifold was set in position

over the base. Next, the wetted filter was placed over the

top of the middle block of the manifold so that it was more

or less centered over the sample application areas. The two

corners of the filter were trimmed where the metal pegs

arose from the manifold, so that the entire filter was flat.

A tissue was used to keep larger pieces of cuticle and

other debris off the blotting filter. The tissue was wetted,

then placed over the surface of the filter by starting from

one edge or corner. In this way, large bubbles did not

become trapped between the tissue and the filter.












The top portion of the manifold was clamped tightly

over the tissue, filter, and lower portions of the

apparatus. Vacuum was applied (usually with a trap and valve

mechanism so that a low level of suction was applied). Then

samples from the microtiter plate were applied to the dot

blot manifold wells, preserving the relative orientation of

sample locations between the microtiter plate wells and the

manifold wells. Once the samples had been aspirated through

the membrane, wash buffer (Table 2; about 350 pl per well)

was added to the wells to wash portions of the samples

remaining on the walls of the manifold wells onto the

filter. When all the buffer had been washed through the

filter, the vacuum was removed from the manifold, the

manifold was disassembled, and the filter removed.

By splitting the sample solutions into several

aliquots, a given set of samples was used to produce

multiple equivalent filters. Duplicate filters were prepared

in the dot blot manifold, samples being applied from the

same microtiter well plate, until the total sample volume

had been used. In this way, many (up to 10) equivalent

filters were produced with a single set of samples.

Nitrocellulose filters containing samples were

vacuum-baked. Then the filters were used as hybridization

targets with DNA probes. Nylon filters were either air-dried

or UV-fixed and then air-dried.












Table 2. Materials and Apparatus for the Quick Blot
Protocol.



Plastic Microtitration Plate, 96-well (flat-bottom wells;
many sources)

96-Place Microsample Filtration Manifold (Dot blot manifold;
Schleicher & Schuell)

Micro-Pipette (Multi-channel preferred; many sources)

Pipette Tips (many sources)

Replaclone (96-prong model; L.A.O. Enterprises)

Filters for Nucleic Acid Blotting nitrocellulosee, such as
BA-85 from Schleicher & Schuell; or nylon, such as
Zeta-Probe from Bio-Rad), cut to 12 x 8 cm size

Laboratory Tissues (such as Kimwipes from Kimberly-Clark, or

Stirling Light Duty Wipes from Stirling Converting
Company, Inc.)

Vacuum Source (sink aspirator or pump)

Buffers

Denaturing Buffer: 0.5M NaOH, 1.5M NaCl

Neutralization Buffer: 3N sodium acetate, 2N acetic acid

Wash Buffer: 2X SSPE


































Figure 6. Apparatus used to prepare quick blots. The 96
steel pegs of the Replaclone (left) fit into the wells of
the microtiter plate (lower right) when grinding the
mosquitoes. The dot blot manifold is shown with blotting
filter in place, overlaid with a tissue to prevent bits of
cuticle and cell debris from adhering to the blotting
filter. Before samples are applied to the blotting filter,
the top portion of the manifold is clamped into place, and
the vacuum source is attached. The optional multichannel
pipette speeds transfer of solutions.













Experiments to Optimize Use of Quick Blots

with Mosquito Species-specific Probes

Table 3 summarizes the results of experiments performed

to evaluate and refine the QB protocol for use in

identification of mosquito species by DNA hybridization

using species-specific probes. These experiments were

required for the optimization of results when using various

detection systems for species-specific DNA probes with

mosquito QBs.

Experiments 14 and 15 (Table 3) were performed to

evaluate the effectiveness of various post-application

treatments of QBs probed with either one or two probes. In

experiment 14, various post-application washes of the

filters were tested to maintain conditions that would reduce

the level of nonspecific detection. In experiment 14, the

probe was omitted from one set of filters which were treated

with the same washes, and it was found that washes that

contained a whitener/brightener with protease (LA FRANCE)

were effective at improving the specificity of detection

(filters C, D, G, and H in Figure 7). Even though specific

signal strengths were decreased somewhat by the use of LA

FRANCE, the overall effects were desirable due to a dramatic

reduction in nonspecific detection (compare filters E and F

with filters G and H in Figure 7).












In experiment 15 (Table 3), standard ECL

prehybridization was used, and ECL detection was performed

before SA-AP detection. The pCxl-ECL probe, when used alone

or in combination with a biotinylated probe, gave at least a

medium level of specific detection and a low level of

nonspecific detection with any of the post-application

treatments. When SA-AP detection of biotinylated pKA2 was

performed after ECL detection, very strong specific

detection was achieved. This occurred after post-application

washes, with both the urea-SDS-LF and the LF-then-urea-SDS

treatments (see notes to Tables 1 and 3 for more details on

post-application washes). These results suggested that some

aspect of the ECL prehybridization and/or detection was

enhancing the results of SA-AP detection, since SA-AP

detection of biotinylated pKA2 using standard

prehybridization resulted in nonspecific detection

(experiment 5, Table 1) and/or unacceptably high background

(experiment 15, Table 3).

Regarding experiments 14 and 15, there was considerable

variation in intensity between spots from different

mosquitoes. Since this was seen with spots which received

the same amount of homogenate (starting with a single

mosquito for each homogenate), the variation was probably

due to one or a combination of the following: a variable












amount of DNA was released from each mosquito which was

ground by this method, or a variable amount of target

repetitive DNA sequences in the genomes of individual

mosquitoes. Another result of these experiments which was

seen consistently in the QB results was the concentration of

signal in a small spot in the center of the circular area

where samples were applied. The latter effect was probably

due to tangential flow toward the center of the wells in the

dot blot apparatus during preparation of QBs. Also,

identical filters were given the post-application treatments

described, but using a wash temperature of 45*C. The results

were virtually identical to those obtained for similar

filters which received the post-application treatments at

room temperature.

Experiments 16a and 16b (Table 3) were performed to

confirm the utility of a combination of biotinylated and ECL

probes to QBs used in a single hybridization experiment,

when using stepwise LA FRANCE and urea-SDS post-application

treatments and ECL prehybridization. The two probes were

labeled reciprocally in the experiments, in hopes of

distinguishing effects from the detection system from

effects resulting only from properties of the particular

probes. Although some of the latter effects were manifested,

the results prove the utility of the conditions used for the











specific detection of these hybridized probes in a

sequential application of detection protocols.

In experiments 16c through 16f (Table 3), the same

post-application and prehybridization treatments were used

as in experiments 16a and 16b, but the filters were dot

blots instead of QBs, so that a rough quantitation of the

sensitivity of specific detection could be obtained.

Detection levels were in the range of 1-10 ng for ECL,

SA-AP, and autoradiographic detection.

Experiment 17 (Table 3) was performed to assess

quantitatively the levels of detection possible when ECL-

labeled and biotinylated probes were used in a single

hybridization step. A standard dot blot strip was used for

this experiment. It is not known why the sensitivity of

detection of the ECL-labeled probe was lower than that found

when only a single probe was used in the hybridization step

(experiment 10, Table 1). However, the results suggested

that detection in the 10 ng (or higher) range should be

sufficient for properly scoring results of various detection

systems using mosquito QBs. Also, this experiment showed

that when using a biotinylated probe in ECL prehybridization

and hybridization conditions, detection levels were lowered

considerably as compared to the levels obtained when

standard prehybridization and hybridization conditions











(i.e., those used with radiolabeled probes) were used

(experiments 2 through 4, Table 1).

Experiment 18 (Table 3) revealed the level of detection

attainable with radiolabeled probe hybridized to homologous

target DNA in a dot blot. Detection levels in the ng range

were achieved consistently in several experiments using

these conditions, and detection in the pg range has been

observed on occasion.

Figure 8 reveals the effects of using different filter

types and DNA binding conditions on the results of SA-AP

detection (experiment 19, Table 3). UV fixation of nylon

filters did not in itself affect the detection levels

(Figure 8 B and C) when QBs were subjected to SA-AP

detection. A degradation of specificity resulted when

alkaline binding was used in preparing a QB with a nylon

filter (Figure 8 A), as compared to that obtained when the

other conditions were used.

Experiments 20a and 20b (Table 3) were designed to

further test whether UV fixation of nylon QBs would improve

the detection of hybridized species-specific DNA.

Radiolabeled probe was detected by autoradiography, and the

QB which did not receive the UV fixation yielded signals

equivalent to those produced from the UV-fixed filter.











Three different nonradioactive detection systems were

used separately with QBs (experiment 21, Table 3; Figure 9).

Whereas reliable specific detection was obtained with the

ECL and SA-AP systems, the Genius system detection was quite

variable. Many of the experiments in Tables 1 and 3 were

performed with the Genius system, which was used as

suggested by the supplier, except for substituting SSPE for

SSC, and changing the formamide concentration in the

hybridization buffer to 50% for hybridization at 42*C.

Figure 9 B is typical of the results with the Genius system,

as a patchy distribution of high background often interfered

with interpretation.

Experiment 22 (Table 3), shown in Figure 10, confirmed

some of the results of experiments 15, 16, and 17. This

proves that probes with different specificities can be used

in a single hybridization step and detected differentially

with a sequential application of nonradioactive detection

methods.













NO PROBE pKA2-BIOTIN PROBE

AQ AA CN AT AQ AA CN AT

.... ...
..... .. .. .. S












A,E: no wash
B,F: urea-SDS
C,G: LF (LA FRANCE)
D,H: urea-SDS-LF

Figure 7. Effects of various post-application treatments of quick
blots on the specificity of SA-AP detection. Quick blots were
prepared using nitrocellulose filters, with each spot receiving
one-tenth of the solution in which a single mosquito was
macerated. Six (two rows of three) spots per filter contained DNA
from different individuals of a single mosquito species, as
follows: AQ = A. auadrimaculatus species A; AA = A. albimanus; CN
= C. nigripalpus; AT = A. taeniorhynchus. Certain filters
received treatments between target DNA application and
prehybridization. These treatments were called post-application
washes (or treatments), and were performed at room temperature
for 45 min. Filters A and E received no post-application wash.
Filters B and F received a post-application wash of urea-SDS (8M
urea, 10% SDS). Filters C and G received a post-application wash
of 10% LA FRANCE (Dial Corporation). Filters D and H received a
post-application wash of urea-SDS-LF (8M urea, 10% SDS, 10% LA
FRANCE). Filters were prehybridized and hybridized (with or
without biotinylated probe pKA2, as indicated) according to the
GENE-TECT protocol (Clontech Laboratories, using BRL reagents,
except that NFDM was substituted for BSA and SSPE was substituted
for SSC).












AQ AA CN AT


A

















A: NYLON: alkaline binding
B: NYLON: no UV
C: NYLON: UV-fixed
D: NITROCELLULOSE: baked


Figure 8. Effects of filter type and DNA-binding conditions on
SA-AP detection of probe pKA2 hybridized to quick blots. All four
filters were subjected to the urea-SDS-LF post-application
treatment before being subjected to prehybridization and
hybridization with biotinylated pKA2 probe (see legend to Figure
7 for details of post-application treatment, prehybridization and
hybridization conditions, and abbreviations). The method used for
fixing the DNA to the filters during sample application was
varied. Filter A was prepared according to the normal QB
protocol, except that the samples in the denaturing buffer were
applied to the blotting filter without being mixed with
neutralization buffer (Table 2). Nylon filters B and C were
prepared according to the normal QB protocol, except that no
vacuum-baking step was performed, and filter C was treated with
UV light after sample application. Nitrocellulose filter D was
prepared according to the unmodified QB protocol.












AQ AA CN AT



SA-AP





GENIUS



a *

ECL








Figure 9. Different nonradioactive systems used for detection of
probe pKA2 hybridized to quick blots. All three nitrocellulose
filters received the urea-SDS-LF post-application treatment
before being hybridized with pKA2 probe. See legend to Figure 7
for details on the post-application treatment and abbreviations).
Probe DNA was labeled according to the different methods
appropriate for detection by the SA-AP, Genius, and ECL
protocols. Prehybridization and hybridization conditions were as
follows: for the SA-AP and ECL filters, conditions were as for
the filters on which SA-AP and ECL detection was performed in the
experiments described in Table 3; for the Genius filter,
conditions were as suggested by the manufacturer (Boehringer
Mannheim Biochemicals), except for substituting SSPE for SSC, and
changing the formamide concentration in the hybridization buffer
to 50% for hybridization at 42*C.












AQ



e *g


pKA2-ECL


0 8 *


pCxl-BIOTIN


Figure 10. Sequential use of nonradioactive detection systems
following a single hybridization of two probes to a quick blot. A
quick blot was prepared in the same way as filters D and H of
Figure 7 (standard quick blot protocol, with urea-SDS-LF post-
application treatment; see Figure 7 legend for experimental
details, and for abbreviations). Two probes, biotinylated pCxl
and ECL-labeled pKA2, were hybridized to this filter, using the
ECL prehybridization and hybridization conditions (ECL
hybridization solution supplied in the kit plus 0.5M NaCl). The
bound pKA2 probe was detected first, using X-ray film according
to the ECL protocol, then the pCxl probe was detected using the
SA-AP detection protocol.













Table 3. Experiments Performed to Evaluate and Optimize the Quick
Blot Protocol.



EXPT FILTER/SAMPLE PREHYB/HYB PROBE DETECTION RESULTS


14 NC QB with AqA,
Aa, Cn, and At,
WITH VARIOUS
POST-APP
TREATMENTS:


none


urea-SDS


urea-SDS-LF


none


urea-SDS


std NONE


std NONE


std NONE


std NONE


std pKA2
-BIOTIN


std pKA2
-BIOTIN


SA-AP light to med
nonspecific
det at all
spots; no bg

SA-AP variable
(light to
strong)
nonspecific
det at all
spots; no bg

SA-AP no signals;
no bg

SA-AP no signals;
no bg

SA-AP very strong
specific det;
light to med
nonspecific
det; no bg

SA-AP very strong
specific det;
light to med
nonspecific
det; no bg













Table 3--continued.


EXPT FILTER/SAMPLE PREHYB/HYB PROBE DETECTION RESULTS


std pKA2
-BIOTIN


std


pKA2
-BIOTIN


SA-AP light to med
specific det;
no nonspecific
det; no bg

SA-AP light to med
specific det;
no nonspecific
det; no bg


14 (continued)
LF




urea-SDS-LF


15 NC QB; Aa, At,
AqA, Cq, Cs
WITH VARIOUS
POST-APP
TREATMENTS:


ECL pCxI-ECL


urea-SDS


urea-SDS-LF


ECL pCx1-ECL


ECL pCxl-ECL


ECL


ECL


ECL


med level of
specific det,
but light
nonspecific
det of all
other spots;
med bg

med level of
specific det,
but light
nonspecific
det of all
other spots;
med bg

med level of
specific det,
but light
nonspecific
det of all
other spots;
med bg












Table 3--continued.


EXPT FILTER/SAMPLE PREHYB/HYB PROBE DETECTION RESULTS


15 (continued)
LF-then-
urea-SDS


ECL pCxl-ECL


std


urea-SDS


std


pKA2
-BIOTIN










pKA2
-BIOTIN


ECL


ECL:
med level of
specific det,
but light
nonspecific
det of all
other spots;
med bg


SA-AP med
nonspecific
det on all
spots;
high uneven bg
(perhaps some
specific det
but high bg
makes
interpretation
difficult)

SA-AP med
nonspecific
det on all
spots;
high uneven bg
(perhaps some
specific det
but high bg
makes
interpretation
difficult)













Table 3--continued.


EXPT FILTER/SAMPLE PREHYB/HYB PROBE DETECTION


15 (continued)
urea-SDS-LF












LF-then-
urea-SDS






urea-SDS-LF


std pKA2
-BIOTIN


std


pKA2
-BIOTIN


ECL pKA2
-BIOTIN
and
pCxl-ECL


SA-AP med
nonspecific
det on all
spots;
high uneven bg
(perhaps some
specific det
but high bg
makes
interpretation
difficult)

SA-AP some
nonspecific
signals but
high bg
made


ECL
then
SA-AP


interpretation
difficult

ECL: good
specific det;
but also
very light
nonspecific
det; very low
bg
SA-AP: very
strong
specific det;
no bg
except
blotches due
to filter
overlap


RESULTS













Table 3--continued.


EXPT FILTER/SAMPLE PREHYB/HYB PROBE DETECTION


15 (continued)
LF-then-
urea-SDS


16a NC QB with
Aa, At, AqA,
Cq and Cs.
WITH POST-APP
TREATMENT:
LF-then-
urea-SDS


ECL pKA2
-BIOTIN
and
pCxl-ECL


ECL


pCxl-ECL
and
pKA2
-BIOTIN


ECL
then
SA-AP


ECL
then
SA-AP


ECL: good
specific det;
but also
very light
nonspecific
det; very low
bg
SA-AP: very
strong
specific det;
no bg, except
for blotches
due to filter
overlap

ECL: specific
(Cs) signals
somewhat
higher than
others but
nonspecific
signals med;
med bg
SA-AP:
specific
signals med,
and all other
spots show
very faint
signals;
low bg
(UNEQUIVOCAL
DET.)


RESULTS













Table 3--continued.


EXPT FILTER/SAMPLE PREHYB/HYB PROBE DETECTION RESULTS


16b NC QB with
Aa, At, AqA,
Cq and Cs.
WITH POST-APP
TREATMENT:
LF-then-
urea-SDS










16c NC dot blots
with L-HI and
pKA2
WITH POST-APP
TREATMENT:
LF-then-
urea-SDS


ECL pCxl
-BIOTIN
and
pKA2-ECL














ECL L-HI-ECL
and
pKl9
-BIOTIN


ECL
then
SA-AP















ECL
then
SA-AP


ECL: strong
specific (AqA)
SA-AP det;
nonspecific
signals and bg
undetectable
except at very
long exposures
SA-AP: signals
to Cs strong,
signals to Cq
weak; no other
signals (no
nonspecific
signals);
no bg

ECL: specific
(L-HI) det at
10 ng with 20
sec exp, to 1
ng with 10 min
exp
SA-AP:
specific
det at 10 ng
(and barely
seen at 1 ng);
no nonspecific
det; very low
bg













Table 3--continued.


EXPT FILTER/SAMPLE PREHYB/HYB PROBE DETECTION RESULTS


16d NC dot blots
with L-HI and
pKA2
WITH POST-APP
TREATMENT:
LF-then-
urea-SDS


16e NC dot blots
with L-HI and
pKA2
WITH POST-APP
TREATMENT:
LF-then-
urea-SDS

16f NC dot blots
with L-HI and
pKA2
WITH POST-APP
TREATMENT:
LF-then-
urea-SDS

17 NC dot blots
with L-HI and
pKA2
(NO POST-APP!!)


ECL


ECL


L-HI
-BIOTIN
and
pK19-ECL


ECL
then
SA-AP


L-HI
-32-P


ECL pK19
-32-P


ECL pK19-ECL
and
L-HI
-BIOTIN


ECL
then
SA-AP


ECL: specific
(pKl9) det at
10 ng with 20
sec exp, to 1
ng with 10 min
exp
SA-AP:
specific
det at 10 ng
no nonspecific
det; very low
bg

3 day RT exp:
specific det
faint but
unequivocal
at 1 ng


3 day RT exp:
specific det
faint but
unequivocal
at 1 ng



ECL: specific
det at 10 ng
(5 min exp),
at 1 ng at
longer
(40 min) exp
but with
increased bg
SA-AP:
specific
(but light)
det at 10 ng;
light bg













Table 3--continued.


EXPT FILTER/SAMPLE PREHYB/HYB PROBE DETECTION RESULTS


18 NC dot blots
with L-HI and
pKA2
(NO POST-APP!!)


std L-HI
-32-P


specific
det at 1 ng;
light bg


19 QB with AqA, std pKA2
Aa, Cn, and At. -BIOTIN
WITH POST-APP
TREATMENT:
urea-SDS-LF
WITH DIFFERENT
FILTERS AND/OR
BINDING CONDITIONS:


NY: alkaline
binding


NY: no UV
binding


NY: UV binding


20a NY QB; AqA


std pKA2
-32P


nonspecific
det variable:
light to
strong
det at all
spots; low bg

med specific
det;
no nonspecific
det; low bg

med specific
det;
no nonspecific
det; low bg

light to med
specific det;
no nonspecific
det; low bg

all spots
where sample
applied show
clear signal


SA-AP













Table 3--continued.


EXPT FILTER/SAMPLE PREHYB/HYB PROBE DETECTION RESULTS


20b NY QB; AqA
UV-fixed

21 NC QB with AqA,
Aa, Cn, and At.
WITH POST-APP
TREATMENT:
urea-SDS-LF
WITH DIFFERENT
NONRADIOACTIVE
DETECTIONS:


std


pKA2
-32P


std pKA2
-BIOTIN




Gen-2 pKA2
-GENIUS


ECL pKA2
-ECL


22 NC QB with AqA.
Aa, Cn, and At.
WITH POST-APP
TREATMENT:
urea-SDS-LF


ECL pKA2
-ECL
and
pCxl
-BIOTIN


same as for
expt 20a


SA-AP light to med
specific det;
faint to no
nonspecific
det; med bg

Genius light specific
det; faint to
no nonspecific
det; heavy bg
in areas that
tend to
obscure
signals


ECL


ECL
then
SA-AP


med specific
det;
no nonspecific
det; no bg

ECL: strong
specific det;
no nonspecific
det; low bg
SA-AP: strong
specific det;
no nonspecific
det; low bg












Table 3--continued.


EXPT FILTER/SAMPLE PREHYB/HYB PROBE DETECTION RESULTS


23 NC QB with AqA,
AqB, AqC, AqD,
Aa, and Cn.
WITH POST-APP
TREATMENT:
urea-SDS-LF


oligo Arp-1
through
Arp-4
oligo
probes
(32P)
(used
separately)


Arp-1 and
Arp-4 probes:
strong
specific det;
no nonspecific
det; no bg.
Arp-2 probe:
strong
specific
det; light
nonspecific
det; high bg
Arp-3 probe:
faint specific


det;
no nonspecific
det; no bg

Notes for Table 3. see notes for Table 1, and the following. AqB
= A. quadrimaculatus species B. AqC = A. quadrimaculatus species
C. AqD = A. quadrimaculatus species D. AR = autoradiography; L-HI
= phage lambda DNA restricted with Hind III. Aa = A. albimanus.
Gen-2 = GENIUS prehybridization/hybridization mix modified for
use at 42*C by including in the recommended mix 50% formamide,
and substituting SSPE for SSC. med = medium. Postapplication
treatments were performed as described in the notes on Table 1,
plus: urea-SDS-LF = 8M urea, 10% SDS, 10% LA FRANCE; LF-then-
urea-SDS = first wash with 10% LA FRANCE, then second wash with
8M urea, 10% SDS.













SYNTHETIC OLIGONUCLEOTIDE PROBES

Four oligonucleotides were synthesized based on

nucleotide sequence data obtained from Nsi I deletion

subclones derived from pKA2, in an attempt to (1) obtain

greater specificity in identification of A. quadrimaculatus

species A, as compared to that obtained by using pKA2 as a

probe, and (2) demonstrate that synthetic oligonucleotides

can provide valuable tools for identification of cryptic

mosquito species. Sequence data obtained from the Nsi I

subclones of pKA2 (which were used to specify the

oligonucleotide sequences) were compared to sequence

obtained from subclones of phage Arp2 (Figure 11), since the

latter was thought more likely to preserve the sequences

present in the mosquito genome.

Figure 11 shows the sequence of the synthetic

oligonucleotides compared to sequence data obtained from

subclones of phage Arp2 and plasmid pKA2. Here, differences

between an oligonucleotide sequence and the sequence from a

given phage subclone do not necessarily reveal the result of

molecular rearrangement in the pKA2 subclones. Rather, they

probably reflect small differences between the many repeat

elements found within the mosquito genome. The large












differences among the four sequence motifs detected in the

pKA2 subclones (and represented in the oligonucleotide

sequences) contrast with the similarities among the

sequences of a specific motif, whether from pKA2 or Arp2

subclones.

In the limited sequence data obtained from the pKA2 and

pArp2 subclones, the motifs 1 and 3, and the motifs 2 and 4,

were found to be adjacent or overlapping in at least six

instances per combination. Motifs 1 and 2 were also found

nonoverlapping, in at least four and three instances,

respectively (Figures 4 and 5).

The oligonucleotides were radiolabeled and used as

probes to quick blots prepared with A. quadrimaculatus

species A, B, C, and D, A. albimanus, and C. nigripalpus

(Table 3, experiment 23). The results of autoradiographic

detection of hybridized oligonucleotide probes is shown in

Figure 12. A long exposure of ten days (at -80*C with

intensifying screens) revealed that the specificity of

oligonucleotide probes Arp-1 and Arp-4 (and probably also

Arp-2) was greater than that of the phage Arp2 probe

(Cockburn, 1990). These results, when considered in light of

the sequence data obtained from the plasmid subclones,

suggested that the sequence elements present in A.

quadrimaculatus species A DNA which conferred species










74

specificity to the phage Arp2 probe are short, nonidentical

(but very similar) repeats, and that there exist three or

more distinct motifs which contribute to this specificity.

These sequence motifs are not tandem repeats, and are

present in some cases in inverted orientations with respect

to one another.

There are several possible advantages in using

oligonucleotides over cloned DNAs for the preparation of

hybridization probes. Usually a cloned insert will be a much

longer segment of DNA than the oligonucleotide, so there is

more chance for a degeneracy in specificity to be manifested

by some portion of the cloned DNA sequence. Thus, the

oligonucleotide may provide increased specificity if it

lacks nonspecific sequences found in the cloned DNA. Another

advantage of synthetic oligonucleotide probes is that since

their chemical structure is completely defined, new lots of

the probe may be produced at any facility set up for

synthesis of oligonucleotides. Incompletely characterized

DNA probes contained in plasmid vectors must be prepared

using suitable (bacterial) host strains and sufficient

amounts of recombinant plasmid. A third possible advantage

of oligonucleotides over recombinant plasmids for use as

probes is their purity. Probe DNAs propagated in recombinant

plasmids must be purified to remove bacterial nucleic acids,










75

proteins, and lipids. While these purification steps are

usually adequate for most applications, DNA modifying

enzymes (such as those used in the labeling of hybridization

probes) are often inhibited by trace contaminants. This is

not a problem with synthetic oligonucleotides, which are

typically free of contaminants.










Figure 11. Synthetic oligonucleotide sequences compared to
phage Arp2 and plasmid pKA2 subclone sequences. The
sequences of the four oligonucleotides used in this study
are each shown above sequence information obtained from
subclones of the insert from phage Arp2 and the subclones of
plasmid pKA2. The sequences of the oligonucleotides were
determined from sequence data obtained from the pKA2
subclones, and are shown with their 5' ends to the left.
Since there was some doubt about whether the pKA2 sequence
accurately represented sequence from the phage (Arp2)
insert, subclones from the phage (including those listed in
Figure 11 as subclones 1, 3, and 5) were sequenced and found
to be similar to the sequences of the oligonucleotides.
Since the insert in phage Arp2 was isolated from genomic DNA
of A. quadrimaculatus species A (Cockburn, 1990), this
figure reveals the close similarity of the sequences of the
oligonucleotides to the repeats in the mosquito genome.
oligo = oligonucleotide.














TTTGCATATAGCTGGTG-CTAG-TTT Oligonucleotide Arp-1
-.- pArp2-N3
.........G.......- G.- pArp2-N1
....... pArp2-N3
....GT......C..N.-....-... pArp2-N5
.. .G....-N .... ....... pArp2-N3
..................... pKA2-N1
-... pKA2-N1
.....G .......... pKA2-N1
GC.ATTGC.........T.... pKA2-N1
..........A..A...-.....A... pKA2-N2
pKA2-N2
... .......... .... ... pKA2-N3


GCAAACCAA-TCATAGGACATACTC Oligonucleotide Arp-2
....... .. .......... pArp2-N1
A...... .C........C...... pArp2-N3
.....T...-............... pArp2-N3
.....T........ pArp2-N5
A...... T.-.....A........ pKA2-N1
......... G... C .... G .... pKA2-N1
TGTT.G................... pKA2-N1
.....T.................T pKA2-N2
......... ........ pKA2-N2
S........ ....... ....... pKA2-N3


TTTGAGATATATGG-CACAAATGTGATCAATT Oligo. Arp-3
...TG.........G.........C.AATC.. pArp2-N5
...TTT.........-..A.C ....C.AATC.G pArp2-N3
...TG..AC.G..A-........T.C.AATC.G pArp2-N1
....G-...................--...A. pKA2-N2
pKA2-N2
.............. -................. pKA2-N2
.............-..A......-- ...A. pKA2-N3


CTCCAAACTCATTGCATCTATTGGTGTATGCAG Oligo. Arp-4
...... ........ ................ pArp2-N1
............G............C..C..CA pArp2-N3
...N.. .N.............. ....... pKA2-N1
..T..........G............... C...T pKA2-N2
.................... ......... pKA2-N2
... ....................... pKA2-N3














A B C D E F

Arp-1 4

Arp- 2

Arp-3

Arp-4 *



Figure 12. Results of using radiolabeled oligonucleotide
probes with quick blots for species-specific detection.
Quick blots were prepared, with each filter containing two
spots from each of six species. Each spot received one-tenth
of the solution in which a single insect was macerated. A,
B, C, D = A. quadrimaculatus species A, B, C, and D,
respectively. E = A. albimanus. F = C. nigripalpus. The
figure shows the results of autoradiographic detection (ten
days at -80*C with intensifying screens).












CONCLUSIONS AND SUMMARY

Discussion of the Efforts to Isolate a Culex-specific Probe

The difficulty encountered in isolating a C.

nigripalpus-specific DNA probe indicates that the vast

majority of species-specific repetitive DNA in the genome of

C. nigripalpus, if this exists, is closely linked with

nonspecific DNA sequences. One study (Cockburn & Mitchell,

1989) indicated that the level of repetitive DNA

interspersion in C. quinquefasciatus DNA was higher than

that found in anopheline DNA, although lower than that found

for Aedes aegypti (Linnaeus) DNA. Even if some repetitive

DNA is clustered within the C. nigripalpus genome, these

clustered repeats may not be species-specific. Indeed, the

results of the attempts to isolate a C. nigripalpus-specific

probe indicate a paucity or lack of species-specific

sequences in the genome.

The fact that the pCxl probe could be isolated from a

C. nigripalpus library by screening with C. quinquefasciatus

DNA, and the observation that the insert in pCxl is large,

indicate that the conclusions above regarding C. nigripalpus

versus C. salinarius do not apply when comparing the genomes

of C. nigripalpus and C. quinquefasciatus. These results

support the close phyletic relationship of C. nigripalpus











and C. salinarius, with C. quinquefasciatus a more distant

relative. They also show that the techniques used are

capable of isolating differentially repeated sequences when

they exist.

Significance of Synthetic Oligonucleotide Probes and

Characterization of Other Mosquito Species-specific Probes

The ease with which potential species-specific

synthetic oligonucleotide probes were specified from the

sequence data obtained from the pKA2 subclones, and the

success in using the synthetic oligonucleotides as species-

specific probes, indicate that this approach to obtaining

probes from clones thought to contain numerous repeats due

to a paucity of restriction sites is a valuable one. The

improved specificity of the synthetic oligonucleotide probes

showed these can be valuable tools for mosquito species

identification.

It may not be possible to identify repeat sequences in

clones containing only one (or a portion of one) repeat.

This could be one reason why repeats were not identified in

the sequence data obtained for pAfl-Sl, pBrpl-Sl, pCrpl-S2,

and pCrpl-S3. Nevertheless, in some cases testing of the

hybridization specificity of synthetic oligonucleotides

specified by sequence data from such clones may provide

species-specific probes as well as the localization of











repetitive species-specific sequences. For example, since

pCrpl-S2 and pCrpl-S3 retain the specificity of Crpl, it is

likely that a species-specific repeat spans the genomic

region corresponding to the junction of these clones. Thus,

oligonucleotides could be synthesized based on the sequence

data obtained for these two clones, and tested for

hybridization specificity. In this case, restriction

analysis could be used to define which of the ends composed

this junction.

The physical map of pAfl-Sl, and the sequence data

obtained from pAfl-Sl and the various A. quadrimaculatus-

specific probes, provide a foundation for further

characterization of the sequences which confer species

specificity in these clones. The data are also valuable for

providing a beginning of a more in-depth study of repetitive

DNA of mosquitoes, which might include transposons or other

interesting mobile genetic elements. There is a possibility

that the pCrpl-S2, pCrpl-S3, or other clones may contain

such mobile elements. The discovery of mobile genetic

elements in mosquitoes could provide valuable tools for

genetic engineering of these organisms.









82

Significance of the Quick Blot Protocol and Nonradioactive

Detections

There are several methods available for preparing

targets for nucleic acid hybridization experiments, and the

decision of which method to use in a particular situation

should be based on a number of considerations. These include

the specific goals of the experiment and the advantages

afforded by use of a particular method of preparing the

targetss. In the simplest of cases, where a single probe is

to be used with a single type of target, a slot blot, dot

blot, or squash blot may be appropriate. It may be more

advantageous to use a quick blot, however, for an experiment

requiring a single sample of tissue to be probed separately

with many probes, or for an experiment requiring many

samples to be probed.

Most of the features of quick blots are available in

one or more of the other types of blots, but none of the

others provides the unique combination of traits of quick

blots. Also, the ability to prepare multiple sets of

equivalent targets with a given set of samples, with little

additional effort, is a feature that is shared by the quick

blot, dot blot, and slot blot protocols, but not possible

with squash blots. The QB protocol can be used to prepare

sets of nucleic acid samples in a form suitable for various











types of nucleic acid analysis. The nucleic acids could

potentially be derived from any of a wide range of tissues

from various animals, including insects and other

arthropods, soft tissue samples from various non-arthropod

animals, and plants. It is well suited for analysis of

nucleic acids extracted from entire insects in the 1-20 mg

size range, or body parts or isolated tissues from larger

individuals. We have used the QB protocol to analyze DNA

from individual mosquitoes.

The availability of nonradioactive detection systems

has allowed nucleic acid hybridizations to be carried out in

laboratories not equipped for handling radioactive reagents.

Many agencies or groups not able or willing to comply with

regulations or safety requirements relating to radioisotopes

thus have the opportunity to use DNA probes in their basic

or diagnostic research.

Nonradioactive detection systems have been used in many

ways with various types of blots (McInnes & Symons, 1989b),

but their potential usefulness with quick blots is

especially great in those situations where nonradioactive

detection must be used with multiple probes to a given set

of samples. This is due to the ease of preparation of

multiple equivalent blots with the quick blot protocol.

These multiple blots can serve as targets for probes of











different specificities. This study has shown the

feasibility of using quick blots to screen any number of

mosquitoes with as many as ten different probes. The probes

may be species-specific, allowing the detection of different

mosquito species, or some may be pathogen-specific, allowing

the detection of particular mosquito-transmitted diseases

among the samples. Simple treatments of blots were described

which effectively reduce nonspecific background. The

procedure presented in this study for the nonradioactive

detection of two probes hybridized simultaneously would

allow a species-specific probe and a pathogen-specific probe

to be used in the same hybridization step.

Nucleic acid hybridization probes will be used in

increasing ways in basic and applied research, as they allow

rapid, accurate, and often extremely sensitive detection of

nucleotide sequences. In particular, it is expected that

these techniques will become more important in the

development of animal and plant breeding programs, and in

the diagnosis and treatment of many types of diseases. The

advances in DNA probe techniques described here are part of

a trend to moving DNA probes beyond the laboratory and into

the field. The advances may eventually allow field

epidemiologists and others to possess field kits which can

identify a putative vector, show what it is infected with,

and show what it has fed on, in a few simple steps.













REFERENCES


Birnboim, H.C., & Doly, J. 1979. A Rapid Alkaline Extraction
Procedure for Screening Recombinant Bacterial DNA.
Nucleic Acids Research 7:1513.

Buluwela, L., Forster, A., Boehm, T., & Rabbitts, T.H. 1989.
A Rapid Procedure for Colony Screening Using Nylon
Filters. Nucleic Acids Research 17:453.

Cockburn, A.F. 1990. A Simple and Rapid Technique for
Identification of Large numbers of Individual Mosquitoes
Using DNA Hybridization. Archives of Insect Biochemistry
and Physiology 14:191-199.

Cockburn, A.F., & Mitchell, S.E. 1989. Repetitive DNA
Interspersion Patterns in Diptera. Archives of Insect
Biochemistry and Physiology 10:105-113.

Cockburn, A.F., & Seawright, J.A. 1988. Techniques for
Mitochondrial DNA Analysis of Anopheline Mosquitoes.
Journal of the American Mosquito Association 2:261-265.

Cockburn, A.F., Tarrant, C.A., & Mitchell, S. 1988. Use of
DNA Probes to Distinguish Sibling Species of the
Anopheles quadrimaculatus Complex. Florida
Entomologist 71:299-302.

Collins, F.H., Mehaffey, P.C., Rasmussen, M.O.,
Brandling-Bennett, A. D., Odera, J. S., & Finnerty, V.
1988. Comparison of DNA-Probe and Isoenzyme Methods for
Differentiating Anopheles gambiae and Anopheles
arabiensis (Diptera: Culicidae). Journal of Medical
Entomology 25:116-120.

Coluzzi, M., & Sabatini, A. 1967. Cytogenetic Observations
on Species A and B of the Anopheles gambiae complex.
Parasitologia 10:179-183.












Costanzi, C., & Gillespie, D. 1987. Fast Blots:
Immobilization of DNA and RNA from Cells [chapter 62].
Berger, S.L., & Kimmel, A.R., Editors. Guide to
Molecular Cloning Techniques. San Diego, Academic Press.
pp 582-587.

Devereux, J., Haeberli, P., & Smithies, O. 1984. A
Comprehensive Set of Sequence Analysis Programs for the
VAX. Nucleic Acids Research 12:387-395.

Hanahan, D. 1983. Studies on Transformation of Escherichia
coli with Plasmids. Journal of Molecular Biology
166:557-580.

Holmes, D.S., & Quigley, M. 1981. A Rapid Boiling Method for
the Preparation of Bacterial Plasmids. Analytical
Biochemistry 114:193.

Hunt, R.H., & Coetzee, M. 1986. Chromosomal and
Electrophoretic Identification of a Sample of Anopheles
gambiae Group (Diptera: Culicidae) from the Grand
Comoros, Indian Ocean. Journal of Medical Entomology
23:655-660.

Hyypia, T., Huovinen, P., Holmberg, M., & Pettersson, U.
1989. Nucleic Acid Probes in the Diagnosis of Human
Microbial Pathogens [chapter 3]. Symons, R.H., Editor.
Nucleic Acid Probes. Boca Raton, CRC Press. pp 81-112.

Keating, S.T., Burand, J.P., & Elkington, J.S. 1989. DNA
Hybridization Assay for Detection of Gypsy Moth Nuclear
Polyhedrosis Virus in Infected Gypsy Moth (Lymantria
dispar L.) larvae. Applied and Environmental
Microbiology 55:2749-2754.

Kirkpatrick, B.C., Stenger, D.C., Morris, T.J., & Purcell,
A.H. 1987. Cloning and Detection of DNA from a
Nonculturable Plant Pathogenic Mycoplasma-Like Organism.
Science 238:197-200.

McInnes, J.L., & Symons, R.H. 1989a. Nucleic Acid Probes in
the Diagnosis of Plant Viruses and Viroids [chapter 4].
Symons, R.H., Editor. Nucleic Acid Probes. Boca Raton,
CRC Press. pp 113-138.












McInnes, J.L., & Symons, R.H. 1989b. Preparation and
Detection of Nonradioactive Nucleic Acid and
Oligonucleotide Probes [chapter 2]. Symons, R.H.,
Editor. Nucleic Acid Probes. Boca Raton, CRC Press. pp
33-80.

Sanger, F., Nicklen, S., & Coulson, A.R. 1977. DNA
Sequencing with Chain-terminating Inhibitors.
Proceedings of the National Academy of Sciences U.S.A.
74:5463-5467.

Sutherland, G.R., & Mulley, J.C. 1989. The Study and
Diagnosis of Human Genetic Disorders Using Nucleic Acid
Probes [chapter 6]. Symons, R.H., Editor. Nucleic Acid
Probes. Boca Raton, CRC Press. pp 159-203.

Tchen, P., Anxolabehere, D., Nouaud, D., & Periquet, G.
1985. Hybridization on Squashed Flies: a Method to
Detect Gene Sequences in Individual Drosophila.
Analytical Biochemistry 150:415-420.

Wahl, G.M., Meinkoth, J.L., & Kimmel, A.R. 1987. Northern
and Southern Blots [chapter 61]. Berger, S.L., & Kimmel,
A.R., Editors. Guide to Molecular Cloning Techniques.
San Diego, Academic Press. pp 572-581.













BIOGRAPHICAL SKETCH

I was born in Columbus, Ohio, on June 7, 1959. I moved

to Florida when I was 11 years old, and received the B.S. in

Microbiology & Cell Science from University of Florida in

December, 1981. I received the M.S. in Microbiology from The

Florida State University in August, 1984.













I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality, as
a dissertation for the degree of Doctor of Philosophy.






jck A. Seaw fight, Zair
Associate Professor of
Entomology and Nematology

I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality, as
a dissertation for the degree of Doctor of Philosophy.






Andrew F. Cockburn
Assistant Professor of
Entomology and Nematology

I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality, as
a dissertation for the degree of Doctor of Philosophy.






J. Howard Frank
Professor of
Entomology and Nematology













I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality, as
a dissertation for the degree of Doctor of Philosophy.





David G. Yojwg
Associate Scientist of
Entomology and Nematology

I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality, as
a dissertation for the degree of Doctor of Philosophy.






Ernest Hiebe
Professor of
Plant Pathology

This dissertation was submitted to the Graduate Faculty
of the College of Agriculture and to the Graduate School and
was accepted as partial fulfillment of the requirements for
the degree of Doctor of Philosophy.




December, 1990 e .

Dean, flege of Ariculture


Dean, Graduate School









































UNIVERSITY OF FLORIDA
II 1 82lll 8IIII 7II I l il II I111111111
3 1262 08553 8287