Molecular characterization of the gene, mRNAS, precursor proteins, and mature subunits involved in the synthesis of the ...

MISSING IMAGE

Material Information

Title:
Molecular characterization of the gene, mRNAS, precursor proteins, and mature subunits involved in the synthesis of the NADP-specific glutamate dehydrogenase isoenzymes in Chlorella sorokiniana
Physical Description:
xv, 177 leaves : ill. ; 29 cm.
Language:
English
Creator:
Miller, Philip
Publication Date:

Subjects

Genre:
bibliography   ( marcgt )
theses   ( marcgt )
non-fiction   ( marcgt )

Notes

Thesis:
Thesis (Ph. D.)--University of Florida, 1994.
Bibliography:
Includes bibliographical references (leaves 164-176).
Statement of Responsibility:
by Philip Miller.
General Note:
Typescript.
General Note:
Vita.

Record Information

Source Institution:
University of Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
aleph - 002296678
notis - ALP9917
oclc - 38253684
System ID:
AA00003632:00001

Full Text











MOLECULAR CHARACTERIZATION OF THE GENE, mRNAS, PRECURSOR
PROTEINS, AND MATURE SUBUNITS INVOLVED IN THE SYNTHESIS OF
THE NADP-SPECIFIC GLUTAMATE DEHYDROGENASE ISOENZYMES IN
CHLORELLA SOROKINIANA
















By


PHILIP W. MILLER


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY



UNIVERSITY OF FLORIDA


1994





























This work is dedicated to my parents, Walter and Elaine

Miller, who taught me by example that success is only

achieved by dedication and hard-work, and that true success

can be measured in many ways.













ACKNOWLEDGMENTS


The author wishes to express his sincere appreciation to

his mentor, Dr. Robert R. Schmidt, for his support and

guidance during the course of this research. Thanks are due

to Dr. Phillip M. Achey, Dr. Richard P. Boyce, Dr. Francis C.

Davis, and Dr. William B. Gurley for their guidance while

serving on the advisory committee. The author would like to

acknowledge the initial training provided by Dr. Kyu Don Kim

and the continued interest and suggestions provided by Dr.

Mark Cock throughout this research. The author would also

like to thank Mrs. Phyllis Schmidt for her continued guidance

in meeting all the requirements for this degree.

Special thanks go to Dr. Mark Tamplin, Rendi Murphree,

and Victor Garrido for providing the materials, expertise,

and training for the production of the monoclonal antibodies

crucial to this research. The author would like to thank Dr.

Roy Jensen and lab, and Dr. L. 0. Ingram for the use of their

equipment that was important to this study.

The author wishes to extend special thanks to my lab

mates Richard Hutson, Brenda Russell, Jan Baer, and Dr. Mary

U. Connell for their friendship and participation during the

course of this project. To Ms. Waltraud Dunn, I extend my

sincere thanks for her friendship, patience, stimulating


iii








conversations, and all the assistance she provided throughout

this study. To Julie Rogers, I offer my heartfelt thanks for

her unfailing support, confidence, and inspiration.

This research was supported in part by the USDA

Competitive Research Grants office (Grant 89-37262-4843).

The author was supported on a graduate research assistantship

funded by the Graduate School of the University of Florida.
















TABLE OF CONTENTS


ACKNOWLEDGMENTS .................................


......... iii


LIST OF FIGURES ...........................................vii

LIST OF TABLES .............................................. x

LIST OF ABBREVIATIONS ......................................xi

INTRODUCTION .............................................. ..1

LITERATURE REVIEW ........................................... 6


MATERIALS AND METHODS .............
Culture Conditions..............
Enzyme Assay....................
Isolation of RNA................
Genomic DNA Isolation...........


NADP-GDH Protein Purification........................
Purification of the a-NADP-GDH holoenzyme .........
Partial purification of NADP-GDH isoenzymes .......
Anti-NADP-GDH Antibody Production and Purification...
Monoclonal antibody production ....................
Polyclonal antibody production ....................
Western Blotting .....................................
Alkaline phosphatase conjugated antibody detection
1251-Protein A detection ..........................
Amino-Terminal Sequence Analysis of the NADP-GDH a-
Subunit and p-Subunit .............................
DNA Probe Synthesis ..................................
Northern Blot Analysis...............................
Southern Blot Analysis...............................
NADP-GDH cDNA Cloning and Characterization...........
kgtl0 library .....................................
XZAP II library ...................................
5' Race-PCR cloning ...............................
NADP-GDH cDNA characterization ....................
Primer Extension Analysis............................
Genomic Allele-Specific PCR..........................
Construction of NADP-GDH In vitro Transcription
Vectors ...........................................
Comparison of the NADP-GDH mRNAs, Antigens, and
Activities in 29 mM Induced C. sorokiniana Cells ..
Culture conditions ................................
RNase protection analysis .........................


....31
.... 32
.... 32
..... 33
.... 34
.... 34
.... 35

.... 37
.... 37
.... 38
....39
.... 41
....41
....41
....44
.... 46
....47
.... 48

....49

.... 50
.... 50
....51


........................
........................
o.......................








NADP-GDH antigen and activity analyses ................ 52
RT-PCR analysis .......................................52

RESULTS .................................................... 54
NADP-GDH cDNA Cloning and Characterization............... 54
Restriction mapping and sequencing of kgtl0 cDNA
clones .............................................54
Isolation, restriction-mapping, and sequencing of
the kZAPII NADP-GDH cDNA clones ..................... 58
Primer extension analysis .............................61
RACE-PCR cloning of two NADP-GDH 5' termini ........... 64
Analysis of the C. sorokiniana NADP-GDH cDNA
sequences .......................................... 70
Determination of the Exon/Intron Boundaries of the
NADP-GDH Gene ......................................... 75
Determination of the Number of NADP-GDH Genes in the
C. sorokiniana Genome ................................. 86
Southern blot analysis of the NADP-GDH gene ........... 86
Allele-specific PCR analysis of the NADP-GDH gene ..... 91
Purification of the NADP-GDH Isoenzymes.................. 94
Determination of the Stability of the NADP-GDH a-
Holoenzyme in the Presence of NADP+ ................... 98
Production of Anti-NADP-GDH Polyclonal and Monoclonal
Antibodies ...........................................100
Analysis of the a- and p-Subunit Similarity with Mouse
Anti-NADP-GDH MAbs ................................... 103
Determination of the Molecular Mass of the NADP-GDH
Subunits ............................................. 104
Comparison of the Induction Patterns of the NADP-GDH
Antigens, Activities, and mRNAs in 29 mM Ammonium
Medium ............................................... 114
RT-PCR Analysis of the NADP-GDH mRNAs.................... 133

DISCUSSION ................................................ 139

LIST OF REFERENCES ........................................ 164

BIOGRAPHICAL SKETCH ....................................... 177













LIST OF FIGURES


Figure page


1. Restriction maps of 17 cDNAs isolated from a
C.sorokinana cDNA library prepared from RNA isolated
from cells induced for 80 min in 29 mM ammonium
medium.................................................. 56

2. Northern blot analysis of poly(A)+ RNA isolated
from C. sorokiniana cells induced for 3 h in 1 mM
ammonium medium or continuously in 29 mM ammonium
medium................................................... 60

3. Restriction maps of eight cDNAs isolated from a C.
sorokiniana cDNA library ................................ 63

4. Primer extension analysis of NADP-GDH mRNA(s)....... 66

5. 5' RACE-PCR generated NADP-GDH 5'-terminus clones... 69

6. Nucleotide sequence of the consensus NADP-GDH
mRNAs derived from the cDNA and 5' RACE-PCR clone
sequences ............................................... 72

7. Secondary structure prediction of the C.
sorokiniana -42 nt NADP-GDH mRNA precursor
polypeptide.............................................. 77

8. Secondary structure prediction of the C.
sorokiniana +42 nt NADP-GDH mRNA precursor
polypeptide.............................................. 79

9. Nucleotide sequence of the C. sorokiniana NADP-GDH
gene..................................................... 81

10. Restriction maps and exon domains of four NADP-
GDH genomic clones spanning 21.9 kbp of the
C.sorokiniana genome .................................... 85

11. Transcriptional initiation site for the C.
sorokiniana NADP-GDH nuclear gene and the upstream
region in the genomic DNA .............................. 88


vii








12. Southern blot analysis of undigested genomic DNA
and restriction fragments............................... 90

13. Polyacrylamide gel electrophoresis of the PCR
products amplified from C. sorokiniana genomic DNA and
three NADP-GDH genomic clones........................... 93

14. Analytical SDS-PAGE of the NADP-GDH a-holoenzyme
purified by preparative nondenaturing gel............... 97

15. Stability of purified NADP-GDH a-holoenzyme at
40C in the presence of 0.1 mM NADP+ ......................****102

16. Mouse anti-NADP-GDH monoclonal antibody
immunoblot analysis of the NADP-GDH..................... 106

17. Estimation of the molecular weights of the C.
sorokiniana NADP-GDH a- and p-subunits.................. 108

18. Alignment of the C. sorokiniana NADP-GDH a- and
p-subunit deduced amino acid sequences.................. 112

19. Increase in culture turbidity of Chlorella cells
cultured for 240 min .................................... 116

20. Pattern of the total soluble protein in
synchronized daughter cells............................. 118

21. Patterns of accumulation of NADP-GDH antigens in
illuminated cells cultured in 29 mM ammonium medium..... 121

22. Patterns of accumulation of NADP-GDH antigens in
cells cultured in 29 mM ammonium medium for 240 min..... 123

23. Pattern of NADP-GDH activities in homogenates of
synchronous C. sorokiniana cells cultured in 29 mM
ammonium medium......................................... 125

24. Ribonuclease protection analysis of the NADP-GDH
mRNAs synthesized in synchronous C. sorokiniana cells
throughout a 240 min induction period in 29 mM
ammonium medium......................................... 128

25. Relative abundance patterns of NADP-GDH mRNA in
cells induced in 29 mM ammonium medium.................. 132

26. RT-PCR analysis of the NADP-GDH mRNAs synthesized
in synchronous C. sorokiniana cells throughout a 240
min induction period in 29 mM ammonium medium........... 136


viii







27. Relative abundances of the NADP-GDH mRNAs
synthesized in synchronous C. sorokiniana cells
throughout a 240 min induction period in 29 mM
ammonium medium......................................... 138

28. Model for the regulation of the processing of the
two NADP-GDH precursor proteins......................... 147

29. Helical wheel projections of the unique
C.sorokiniana NADP-GDH amino-terminal helical domains... 152

30. Diagramatic representation of the assembled
hexameric NADP-GDH...................................... 154

31. Model for the regulation of the C. sorokiniana
chloroplastic NADP-specific GDH isoenzymes.............. 163














LIST OF TABLES


Table page


1. Synthetic oligonucleotide sequences................. 45

2. Codon usage of the -42 nt NADP-GDH mRNA............. 74

3. Codon usage of the +42 nt NADP-GDH mRNA............. 74

4. Steps for the purification of the NADP-GDH a-
holoenzyme............................................... 95

5. Steps for the partial purification of NADP-GDH
isoenzymes............................................... 99

6. Ratios of NADP-GDH:NADP+ activities and a:p-
subunits................................................. 119














LIST OF ABBREVIATIONS


AP ................................

ATCase............................


BSA...............................

ca............................... .

CaM...............................

CPSase......... ....................


DHOase............................

DTT ...............................

Dsx...............................

EDTA..............................


EGTA..............................



ELISA ............................


GS..................... ...........

GOGAT..............................

HAT ...... ..................... ..


HCR ........ ......................

ICBR............................. .


Alkaline phosphatase

Aspartate trans-
carbamylase

Bovine serum albumin

Calculated average

Calmodulin

Carbomylphosphate
synthase

Dihydroorotase

Dithiothreitol

Double-sex

Ethylene diamine-
tetraacetic acid

Ethylene glycol-bis (3-
aminoethyl ether) N, N,
N', N',-tetraacetic acid

Enzyme-linked immuno-
absorption assay

Glutamine synthetase

Glutamate synthase

Hypoxanthine-aminopterin-
thymidine

Highly conserved region

Interdisciplinary Center
for Biotechnology
Research








LANT6.............................


mA ................................

MAb...............................

NAD-GDH...........................



NADP-GDH..........................




NBT.................. ... .......

NEB....................... ........

NMN .. ............ ...o ......... .

nt...... ....... ................

NT........................... .....

ODU.............................. .

OTCase............................


PK...... .. ..... ..... .............

PME............ ................. .

RACE-PCR...........................


RPA... ........ ...................


RT-PCR............................

Rubisco................ ...........


SNAP-25...........................


snRNA ................. ........


snRNP.............................


Neurotensin lysine-
asparagine rich

Milliamperes

Monoclonal antibody

Nicotinamide adenine
dinucleotide-specific
glutamate dehydrogenase

Nicotinamide adenine
dinucleotide phosphate-
specific glutamate
dehydrogenase

Nitroblue tetrazolium

New England Biolabs

Neuromedian N

Nucleotides

Nerotensin

Optical density unit(s)

Ornithine trans-
carbamylase

Pyruvate kinase

Pectin methylesterase

Rapid amplification of
cDNA ends-PCR

Ribonuclease protection
assay

Reverse transcriptase PCR

Ribulose bisphosphate
carboxylase/oxygenase

Synaptosomal associated
protein 25 kD

Small nuclear ribonucleic
acid

Small nuclear ribonuclear
proteins


xii








SPP ..............................


SPT................... ..... ......


Sxl................ ...............

TBS......................... ......

tra........ .............. .........

TTBS.............. ... ............


UTR. ...................... ..........

VR.........oo.... ... ........... .

X-phosphate........................


Stromal processing
peptidase

Serine:pyruvate amino-
transferase

Sex-lethal

Tris-buffered saline

Transformer

Tween Tris-buffered
saline

Untranslated region

Variable region

5-bromo-4-chloro-3-indole
phosphate


xiii














Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy


MOLECULAR CHARACTERIZATION OF THE GENE, mRNAS, PRECURSOR
PROTEINS, AND MATURE SUBUNITS INVOLVED IN THE SYNTHESIS OF
THE NADP-SPECIFIC GLUTAMATE DEHYDROGENASE ISOENZYMES IN
CHLORELLA SOROKINIANA

By

Philip W. Miller

December, 1994




Chairman: Dr. Robert R. Schmidt
Major Department: Microbiology and Cell Science


Chlorella sorokiniana possesses seven chloroplastic

NADP-glutamate dehydrogenases (NADP-GDHs) composed of varying

ratios of a- and P-subunits. Southern blot analysis and

allele-specific PCR demonstrated the C. sorokiniana genome

possesses a single NADP-GDH gene encoding both the a- and 3-

subunits. PCR analysis, cDNA cloning and sequencing, and

RNase protection analysis identified two NADP-GDH mRNAs that

are identical with the exception of a 42 nt insert located in

the 5' coding region of the longer mRNA. Deduced amino acid

sequence analysis revealed that the 42 nt insert encodes an

additional 14 amino acids. The absence or presence of the

insert does not affect the downstream reading frame. The +42

nt mRNA encodes a 53850 D precursor protein, whereas the -42


xiv








nt mRNA encodes a 52350 D precursor protein. The +42 nt and

-42 nt mRNAs are postulated to be derived via alternative

splicing of a pre-mRNA from the single 7.1 kbp NADP-GDH gene

that consists of 22 or 23 exons, respectively.

Western blot analysis of the a- and P-subunits showed

them to be antigenically similar and to be 53.5 and 52.3 kD

in size, respectively. Amino-terminal sequence analysis

revealed the a-subunit shares amino acid sequence identity

with the P-subunit; however, the a-subunit possesses a unique

11 amino acid a-helical domain that is lacking in the P-

subunit.

The induction patterns and relative abundances of the

NADP-GDH mRNAs, antigens, and activities were measured in

cells induced in 29 mM ammonium medium. The relative

abundance of the +42 nt mRNA correlated with the a-subunit

antigen, whereas the -42 nt mRNA correlated with the P-

subunit. The ratio of NADPH:NADP+-GDH activity was highest

when the P-subunit was prominent and lowest when the a-

subunit was prominent.

These results are consistent with a single nuclear gene

being transcribed into a pre-mRNA that is alternatively

processed to yield two mRNAs encoding two precursor proteins.

The precursor proteins are processed to either the a- or p-

subunit and assembled into isoenzymes with varying ammonium-

affinities.













INTRODUCTION

Inorganic nitrogen acquired by plants is ultimately

converted to ammonium before being assimilated in organic

nitrogen metabolism. One of the enzymes postulated to be

involved in the assimilatory process is GDH, a ubiquitous

enzyme found to be present in almost all organisms from

microbes to higher plants and animals (Srivastava and Singh,

1987). GDH catalyses the reversible conversion of x-

ketogluterate to glutamate via a reductive amination that

utilizes NADH or NADPH as a cofactor. The role of plant GDHs

in the assimilation of ammonium into amino acids has been

questioned since the discovery of the GS/GOGAT pathway that

is believed to be the favored pathway for ammonium

assimilation in higher plants (Miflin and Lea, 1976). The

primary objection to GDH playing a major role in nitrogen

metabolism is its low affinity for ammonium that would

require high intracellular ammonium concentrations to

function anabolically. Early evidence indicated that GDH is

a catabolic enzyme catalyzing the deamination of glutamate

with only a partial anabolic function in synthesizing

glutamate (Wallsgrove et al., 1987). However, more recent

studies reveal that Km values for ammonium and other

sustrates may be affected by various internal and external

factors and the previously reported in vitro Km values may







not reflect in vivo conditions. The physiological role of

large amounts of GDH present in various plant tissues and

organelles is still unclear, and possible conditions under

which GDH may play a significant role in carbon and nitrogen

metabolism have not been resolved.

The majority of plant GDHs characterized to date are

localized in the mitochondria; however, GDH species differing

in several properties (i.e. cofactor specificity) have been

characterized from chloroplasts (Srivastava and Singh, 1987).

Chlorella sorokiniana cells have been shown to possess a

constitutive, mitochondrial, tetrameric NAD-specific GDH

(Meredith et al., 1978), and seven ammonium-inducible,

chloroplast-localized, homo- and heterohexameric NADP-

specific GDH isoenzymes (Prunkard et al., 1986; Bascomb and

Schmidt, 1987). The seven chloroplastic NADP-GDH isoenzymes

were shown to have different electrophoretic mobilities

during native-PAGE, and presumably result from the formation

of homo- and heterohexamers composed of varying ratios of a-

and P-subunits (53.5 and 52.3 kD, respectively). Chlorella

cells cultured in 1 to 2 mM ammonium medium accumulate only

the a-homohexamer (Bascomb and Schmidt, 1987). The addition

of higher ammonium concentrations (3.4 to 29 mM) to nitrate-

cultured cells results in the accumulation of both a- and p-

subunits in NADP-GDH holoenzymes (Prunkard et al., 1986;

Bascomb and Schmidt, 1987; Bascomb et al., 1987). Prunkard

et al. (1986) demonstrated that the NADP-GDH subunit ratio

and isoenzyme pattern is influenced by both the carbon and








nitrogen source as well as the light conditions under which

cells are cultured.

The purified a- and p-homohexamers have strikingly

different ammonium Km values; however, the Km values for their

other substrates are very similar. The a-homohexamer is

allosterically regulated by NADPH and possesses an unusually

low Km for ammonium that ranges from 0.02 to 3.5 mM,

depending on the NADPH concentration (Bascomb and Schmidt,

1987). In contrast, the P-homohexamer is a non-allosteric

enzyme with an ammonium Km of approximately 75 mM. It is

postulated that the heterohexamers have varying degrees of

affinity for ammonium; however, no kinetic analyses have been

performed on purified heterohexamers. Pulse-chase

experiments, performed when homo- and heterohexamers of NADP-

GDH were accumulating during early induction in 29 mM

ammonium medium, revealed the a-subunit antigen was degraded

with a half-life of 50 min whereas the p-subunit antigen was

degraded more slowly with a half-life of 150 min (Bascomb et

al., 1986). After the removal of ammonium from the induced

cells, enhanced rates of degradation were observed for the a-

and p-subunit antigens, half-lifes of 5 and 13.5 min,

respectively.

Although the a- and p-subunits have distinct in vivo

turnover rates and the corresponding homohexamers have

remarkably different ammonium Km values, the a- and P-

subunits are derived from precursor proteins of nearly

identical size (ca 58,000 D) and were shown to have very








similar peptide maps (Prunkard et al., 1986; Bascomb and

Schmidt, 1987). Moreover, antibodies prepared against the 3-

homohexamer are capable of immunoprecipitating all of the

NADP-GDH isoenzymes (Yeung et al., 1981, Bascomb et al.,

1987), but do not crossreact with the mitochondrial NAD-GDH.

In addition, previous research in this laboratory provided

genomic cloning and southern blot evidence that indicated the

C. sorokiniana genome possesses a single NADP-GDH structural

gene (Cock et al., 1991).

Biochemical and immunochemical properties of the NADP-

GDH a- and p- subunits suggest that the two subunits share a

significant amount of protein sequence identity. Similar

kinetic, isoenzyme pattern, and immunological properties have

been shown for the mitochondrial GDH of grapevine (Loulakakis

and Roubelakis-Angelakis, 1991) and Arabidopsis (Cammaerts

and Jacobs, 1985). The understanding of the molecular

mechanisms regulating the C. sorokiniana NADP-GDH isoenzymes

is critical to further elucidate the metabolic significance

of GDH in carbon and nitrogen metabolism in Chlorella and

higher plants. Therefore, the purpose of this study is to

determine if the two NADP-GDH subunits arise from the (i)

differential processing of a precursor protein encoded by a

single nuclear gene and mRNA, (ii) specific processing of two

similar precursor proteins encoded by two mRNAs formed by

alternative splicing of a pre-mRNA derived from a single

nuclear gene, (iii) specific processing of two precursor





5


proteins encoded by two mRNAs transcribed from two closely

related nuclear genes.













LITERATURE REVIEW

Extensive research into the molecular and biochemical

mechanisms that control the physiology and potential fate of

a living cell has revealed a myriad of complexities in the

regulation of cellular processes. In prokaryotes, metabolic

processes have been shown to be temporally regulated at

transcription, translation, mRNA turnover and processing, and

post-translational modifications. The presence of organelles

in eukaryotes has provided another level of intricacy in

metabolic regulation by providing compartmentalization, that

provides for both temporal and spacial separation of cellular

events. The spatial separation of cellular processes

provides additional steps where regulation of transriptional,

post-transcriptional, translational, and post-translational

events can occur.

In response to the spatial and temporal separation of

metabolism, cells have evolved enzymes that share a similar

biological activity within an organism. These enzymes often

differ in their primary amino acid sequence (isoenzymes or

isoproteins), but may be capable of subunit exchange

(isozymes). Enzymatically similar isoforms may also exist as

a result of post-translational modifications

phosphorylationn, acetylation, methylation, etc.) to a single

protein. Theoretically, multiple isoenzymes have allowed








organisms to respond differentially in a refined way to a

broader range of developmental and environmental conditions.

Isoenzymes can arise via all the aforementioned cellular

processes and provide a useful tool to study the molecular

mechanisms involved in regulating biochemical processes.

The majority of isoenzymes characterized to date are

encoded by two or more genes within the genome of a organism.

Isoenzymes encoded by multiple genes are believed to have

arisen through gene duplication within an organism or via

gene exchange between organelles of eukaryotes (Gray and

Doolittle, 1982; Sun and Callis, 1993). The amount of

similarity conserved among isoenzymes derived from different

genes is influenced by how recent the duplication or exchange

has occurred (Pickersky et al., 1984), or may reflect a

strong selective pressure to maintain the primary amino acid

sequence (Moncreif et al., 1990).

Multiple isoenzymes of CaM, a 16 kD acidic Ca2+-binding,

signal transducing protein, have been identified in all

eukaryotes examined (Ling et al., 1991). Increased binding

of Ca2+ by CaM in response to increased intracellular Ca2+

levels triggers a conformational change in the protein.

Alteration of conformation in turn facilitates specific

interactions with Ca2+/CaM-dependent enzymes (O'Neil and

DeGrado, 1990). One notable feature of CaM isoenzymes is the

highly conserved primary structure; comparisons of amphibian,

avian, mammalian, and plant CaM isoproteins showed identities

of over 90 percent (Roberts et al., 1986). Analysis of CaM








amino acid sequences from a wide variety of organisms has

revealed that 47 of 148 amino acid residues are variant,

allowing a degree of latitude in the physiological

constraints that regulate the structure and function of each

CaM isoenzyme (Moncreif et al., 1990).

CaM multigene families have been characterized in rat

(Nojima, 1989), and human (Fischer et al., 1988). In both of

these species the CaM proteins encoded by different gene

families possess identical amino acid sequences; however,

their respective nucleotide sequences have diverged by

approximately 20 percent (Ling et al., 1991). More recently,

at least four CaM isoforms have been identified in

Arabidopsis thaliana that differ from one another by as much

as six amino acid substitutions (Gawienowski et al., 1993).

Arabiodopsis CaM isoenzymes are encoded by a multigene

family consisting of at least six different genes. Southern

blot analysis and genomic cloning determined the CaM proteins

were not allelic and that their coding regions had diverged

thirteen to twenty percent, and no significant identities

were retained in their mRNA 3'-untranslated regions. Most of

the amino acid changes between the CaM proteins appear to be

functionally conservative, and are clustered within the

fourth Ca2+-binding domain that is involved in high affinity

Ca2+ binding. It has yet to be determined if there exists

significant biochemical differences or tissue-specific

expression differences that would warrant these multiple CaM

proteins (Gawienowski et al., 1993). Multiple CaM isoforms,








each having a defined set of targets, may explain how a

common intracellular Ca2+ concentration signal can activate

different physiological responses.

In eukaryotes, multiple isoenzymes of CPSase and ATCase,

enzymes involved in the de novo pyrimidine biosynthetic

pathway have been identified (Jones, 1980; Ross, 1981).

Isoenzymes of these proteins have proven to be critical in

the biochemical regulation of eukaryotic pyrimidine and

arginine biosynthesis, both of which utilize

carbomylphosphate as an intermediate. Prokaryotes possess a

single CPSase and ATCase enzyme, both of which are

metabolically regulated by negative effectors to control flux

of carbomylphosphate between the two competing pathways

(Markoff and Radford, 1978).

Eukaryotes, other than plants, utilize two isoenzymes of

CPSase to commit separate pools of carbomylphosphate to the

pyrimidine and arginine pathways. An arginine-specific

CPSase is localized in the mitochondria with OTCase, the

enzyme that utlizes carbomylphosphate to synthesize

citrulline in the arginine pathway (Davis, 1986). A

pyrimidine-regulated CPSase activity exists on a

multifunctional protein that also exhibits ATCase activity

and is localized in the nucleus of yeast (Nagy et al., 1989),

or a cytosloic localized multifunctional protein that also

exhibits ATCase and DHOase activity observed in other

eukaryotes (Davidson et al., 1990). The different CPSase








activities have been shown to be encoded by separate genes in

these organisms.

The mechanisms of coordinately regulating the pyrimidine

and arginine pathways of plants are less understood.

Sequence analysis of partial cDNA clones from alfalfa has

provided evidence for the existence of arginine- and

pyrimidine-specific CPSases (Maley et al., 1992); however,

biochemical studies have only demonstrated a single

glutamine-dependent CPSase activity. Regardless of the

number of CPSases in plants, metabolic studies indicate that

the arginine and pyrimidine pathways share a common pool of

carbomylphosphate (Lovatt and Cheng, 1984). Localization of

CPSase, ATCase, and OTCase activities to the plant

chloroplast indicates that allocation of carbomylphosphate to

each pathway must be regulated (Shibata et al., 1986).

Williamson and Slocum (1994) utilized an ATCase

deficient mutant of Escherichia coli to clone by functional

complementation two different ATCases from pea plants.

Comparison of the deduced amino acid sequences of the clones

revealed an 85 percent identity and indicated they both

possessed a chloroplast targeting transit peptide. Southern

blot analysis revealed the two ATCase mRNAs are encoded by

two independent genes of the pea genome. Biochemical studies

are in progress to determine if these genes are

differentially regulated and if different ATCase subunits

which exist as homotrimers can also exist as heterotrimers

with unique kinetic properties.








Cell wall PME enzymes that de-esterify galactosyluronic

acid units of pectin, have been detected in all tissues of

higher plants analyzed. PME has been implicated in

functioning in a broad range of cellular processes including

fruit softening (Fischer and Bennett, 1991), plant response

to infection (Collomer and Keen, 1986), and cell growth

(Moustacos et al., 1991). Multiple isoenzymes of PME have

been detected in most plant species and tissues. It is

hypothesized that the multiple isoenzymes function in a

tissue-specific manner and have different modes of de-

esterification of pectins (Markovic and Kohn, 1984).

Harriman et al. (1991) and Recourt et al. (1992)

demonstrated that tomato and Phaseolus vulgaris genomes

possess multiple PME genes. The cDNAS isolated from tissue-

specific libraries indicated that there are multiple PMEs

with high sequence homologies encoded by separate genes. In

vivo expression of antisense RNA constructs, designed to

block specified PME isoforms, revealed regulation of PME

isoenzymes occurs by regulating transcription from different

genes in a developmental, tissue-specific manner (Gaffe et

al., 1994).

Multiple isoproteins do not exist in all cases where

multiple genes are detected. Multiple genes encoding (1-3,1-

4)-p-glucanendohydrolases have been identified in wheat

(Triticum aestivium). Isolation of P-glucanase cDNA clones

revealed two different cDNAs with 31 nucleotide

substitutions; however, the coding regions of the mRNAs were







identical and only a single P-glucanase protein was detected.

Further analysis revealed that the two mRNAs originated from

homeologous chromosomes in the wheat hexaploid genome (Lai et

al., 1993). Therefore, the potential exists to derive

multiple isoenzymes by combining genomes in polyploid

species. The level of conservation of similar proteins will

be determined by relatedness of the parental species, the

time lapse since the genomes were combined, and selective

pressures to maintain the primary structures of the proteins.

Multiple isoenzymes have been shown to be derived from a

single gene in an organism. Saccharomyces cerevisiae cells

possess both a cytosolic and secreted form of invertase.

Both isoenzymes of invertase are encoded by a single

structural gene, SUC2, which gives rise to two distinct mRNA

species (Perlman and Halvorson, 1981; Carlson and Botstein,

1982). The polypeptides encoded by the invertase mRNAs, when

translated in vitro, are 60 kD (p60) and 62 kD (p62). The

p60 mRNA is 1.8 kb and encodes the cytoplasmic invertase,

whereas the p62 mRNA is 1.9 kb and encodes the secreted

invertase (Carlson and Botstein, 1982). The p62 form has

been shown to be glycosylated in the Golgi to an 87 kD

protein, a process that targets the invertase for secretion.

The p62 protein is preferentially targeted to the Golgi

apparatus via a labile 19 amino acid amino-terminal signal

sequence that is cotranslationally cleaved upon import to the

Golgi (Perlman et al., 1982).








Amino acid analysis of the p60 and p62 proteins revealed

that, starting at amino acid residue 21, the secreted

invertase was identical to the cytoplasmic invertase.

Comparison of the 5' ends of the mRNA nucleotide sequences

and the SUC2 gene revealed the presence of two unique

promoters (Tassig and Carlson, 1983; Sarokin and Carlson,

1984, 1985). The promoter region for the secreted invertase

was located -140 bp upstream of the coding region, whereas

the intracellular invertase promoter was located -40 bp

upstream of its coding region. Deletion of the nucleotide

sequence from -650 to -418 bp removed the regulation of the

secreted form by glucose; however, deletion from -1900 to -80

bp had no influence on the cytoplasmic invertase (Sarokin and

Carlson, 1984).

Mammalian SPT is localized in two subcellular

organelles, the mitochondria and peroxisomes of the liver.

The peroxisomal SPTp and the mitochondrial SPTm isoenzymes

have very similar immunochemical (Oda et al., 1982),

catalytic and physical properties (Naguchi and Takada, 1978),

but their responses to hormones or other stimuli are quite

different. The SPTm is synthesized as a large precursor

which is specifically translocated into the mitochondria,

both in vivo and in vitro, and is processed into a mature

form similar in size to the mature SPTp. Two different SPT

mRNAs were detected by northern analysis using a SPTm probe.

The longer 1.9 kb mRNA was glucagon inducible and the smaller

1.7 kb mRNA was hormone insensitive indicating the larger







mRNA codes for the SPTm protein (45 kD) and the smaller mRNA

encodes the SPTp protein (43 kD) (Oda et al., 1993).

Cloning and sequence analysis of the two transcripts

provided evidence that the two mRNAs were identical except

for a longer 5' end possessed by the 1.9 kb SPTm mRNA. These

results were verified by S1 nuclease protection, and RNase

protection analysis. Utilizing SPTm and SPTp probes,

Southern blot analysis detected a single SPT gene.

Comparison of the cDNA and gene sequences revealed that the

two SPT mRNAs were generated by transcription from two unique

promoters located upstream of exon one. The SPTm mRNA

contains an amino terminal extension of 22 amino acids that

acts as a mitochondrial targeting signal, whereas the SPT

mRNA lacks the targeting signal due to initiation of

transcription from a different promoter downstream of the

mitochondrial start methionine codon in exon one. Transport

of SPTp to the peroxisome occurs if the SPT preprotein lacks

the mitochondrial targeting peptide (Oda et al., 1993).

There are many other examples of multliple isoproteins

generated from a single gene via the use of alternate

upstream promoters (Beltzer et al., 1988; Chatton et

al.,1988).

Alternative splicing of pre-mRNA transcribed from a

common promoter of single gene has emerged as a widespread

mechanism for regulating gene expression. In most cases,

alternative splicing gives rise to multiple protein isoforms

that share high identity, but vary in specific domains that








allow fine regulation of protein function (Smith et al.,

1989). Alternative splicing allows for protein isoform

switching without the need for permanent genetic change that

would be necessary with gene rearrangement. The number of

genes known to be alternatively spliced reported to date is so

vast; therefore, a limited number of representative cases

will be discussed.

Alternative splicing of transcripts has been shown to

regulate the localization of isoproteins. The immunoglogulin

heavy chain protein Igi is present as a membrane bound form

in early B lymphocytes. Upon maturation of the B-cell, after

antigen activiation, the membrane-bound IgR form decreases

and a concomitant increase in the IgR secreted pentamer form

is observed. The switch from membrane bound to secreted form

is acheived by the alternate use of 3' end exons that encode

the hydrophobic membrane-binding segment (Alt et al., 1980;

Rogers et al.,1980).

Gelosin, a protein which severs actin filaments, exists

as a plasma and cytosolic protein. Analysis of the two

isoenzymes indicated the proteins were identical except for

an additional 25 amino-terminal amino acids in the plasma

form. Analysis of the gelosin gene revealed the two

isoenzymes are expressed from the same gene via the use of

alternate promoters and subsequent alternative splicing of a

5' exon. The extra 25 amino acids of the mature plasma form

and an additional 27 amino acid signal peptide is encoded in

the extra exon. The 27 amino acid sequence targets the








plasma form to a secretion pathway and is cleaved from the

mature protein (Kwiatkowski et al., 1986).

Alternative pre-mRNA splicing can also function to

produce a functional and nonfunctional form of a protein that

acts as an on/off switch. The pathway of sexual

diffentiation in Drosophilia has revealed that an entire

sexual developmental cascade is regulated by alternative

splicing (Bingham et al., 1988). Briefly reviewed here, in

response to the X chromosome:autosome ratio this pathway is

regulated initially by the alternative splicing of three

primary genes:Sxl, tra, and dsx.

The Sxl gene, the first gene in the cascade, pre-mRNA is

alternatively spliced to yield male and female specific

transcripts. The splicing results in the inclusion of an

exon in male transcripts and in the truncation of the major

open reading frame after 48 codons. In females, the male

specific exon is spliced out and a complete 354 amino acid

RNA-binding protein is produced (Bell et al., 1988). The

functional female Sxl protein regulates the splicing out of a

248 bp intron in the tra gene mRNA which produces a female

function tra protein. The lack of the functional sxl protein

product in males leads to a default splicing pattern in the

male tra mRNA which produces a nonfunctional tra protein

(Boggs et al., 1987; Nagoshi et al., 1988). The functional

tra protein of females regulates the splicing of the dsx pre-

mRNA to a female-specific transcript that encodes a dsx

protein that represses male differentiation genes.








Alternative splicing of the dsx pre-mRNA produces functional

products in males and females; however, the male dsx mRNA

possesses a male specific exon that is spliced out of the

female mRNA. The male dsx protein represses the female

diferrentiation genes (Baker and Wolfner, 1988). Further

analysis revealed that the functional tra protein of females

acts by recruiting general splicing factors to a regulatory

element downstream of the female-specific 3' splice site of

the dsx mRNA (Tain and Maniatis, 1993).

Changes in the enzymatic activity of the enzyme PK can

be attributed to mRNA alternative splicing. The four

isoforms of PK, M1 and M2, L and R, each form homotetrameric

holoenzymes. The M1 and M2 isoenzymes differ by the presence

of an internal 45 amino acid segment that is encoded by a

pair of mutually exclusive exons (Noguchi et al., 1986).

This variable region is nearly identical to a similar region

found in the L and R isoforms. The M2, L, and R

homotetramers are all allosterically regulated and show

sigmoidal kinetics, whereas the M1 isoenzyme shows no

allosterism and has Michaelis-Menton kinetics (Imamura and

Tanaka, 1982). The M2, L, and R proteins reside in tissues

where allosteric regulation is critical to prevent futile

cycling, whereas the Ml form exists in muscle tissue in which

glycolysis is the dominant metabolic state. The

alternatively spliced exons of Ml and M2 encode a region that

is important in intrasubunit contacts; therefore, it is

postulated that interactions between subunits dictate the








regulatory properties of the individual isoenzymes (Noguchi

et al., 1986).

Alternative splicing also influences post-translational

modifications to isoproteins. The 25 kD synaptosomal

associated protein, SNAP-25, exists as two isoforms in

chicken. Cloning and characterization of the SNAP-25 cDNAs

and gene revealed that two exon fives exist in the gene.

Alternative splicing of the pre-mRNA mutually excluded one of

the two exons that resulted in two isoproteins that differed

in nine amino acid substitutions. The amino acid

substitutions result in the loss of a palmitoylation site,

thus influencing the ability of the isoforms to interact with

neuronal membranes (Bark, 1993).

The intracellular signaling by Ca2+ has been shown to be

finely regulated by alternative splicing in humans. The Ca2+

pump is a calmodulin-regulated P-type ATPase that is critical

in controlling intracellular Ca2+ concentrations. Analysis

of the pump gene structure indicated that alternative

splicing of the Ca2+ pump pre-mRNAs altered the calmodulin-

binding domain. Alteration of this domain either increases

or decreases pump affinity for calmodulin. The decreased

affinity for calmodulin causes an apparent lower affinity of

the pump for Ca2+, thus lowering the intracellular Ca2+

concentration (Enyedi et al., 1994).

Although alternative splicing appears to be a common

mechanism of altering gene function without permanently

changing gene structure, few examples of alternative mRNA








have been reported for plants. This absence of published

reports likely reflects a lack of detection of alternative

mRNA splicing rather than a lack of its existence. Rubisco

initiates the pathway of photosynthetic carbon reduction in

plants. This enzyme exhibits catalytic activity only after

activation by rubisco activase. Immunoblots utilizing anti-

activase antibodies detected two polypeptides in spinach (41

and 45 kD) and Arabidopsis (44 and 47 kD) indicating that the

two polypeptides were similar (Werneke, 1988). Genomic DNA

blots indicated that rubisco activase was encoded by a single

gene in spinach and Arabidopsis. Werneke et al. (1989)

demonstrated by amino- and carboxyl-terminal amino acid

analysis and cDNA cloning that the two activase isoenzymes

were derived by alternative splicing of activase pre-mRNA.

In spinach, two different 5' splice sites are utilized in

processing an intron in the 3' end of the primary transcript.

Use of the first 5' splice site introduced a termination

codon that results in formation of the 41 kD protein, whereas

selection of the downstream 5' splice junction omits the

temination codon and yields the 45 kD isoprotein. In

Arabidopsis, alternative splicing by a similar mechanism

results in the synthesis of the 44 kD and 47 kD polypeptides.

However, retention of the intron sequence does not introduce

a termination codon, but creates a frameshift that leads to

early termination of the protein. These results represent

the first case of alternative splicing reported for plants.







The P gene of Zea mays is postulated to

transcriptionally regulate flavonoid-derived pigment

biosynthesis in floral tissues. Two different P transcripts

have been detected, a 1.8 kb mRNA encoding a 43.7 kD protein

and a 0.945 kb mRNA encoding a 17.3 kD protein.

Characterization of the two P transcripts revealed they are

derived from a single gene and arise via alternative splicing

of the 3' end of a pre-mRNA (Grotewold et al., 1991). The

alternative splicing between exons two and three of the pre-

mRNA results in a frameshift that leads to early termination

of translation and yields the 17.3 kD polypeptide. The

truncated protein still possesses its DNA-binding domain;

therefore, it is hypothesized that the 17.3 kD protein may

act as a negative regulator and inhibits binding of the 43.7

kD functional transcriptional activator (Grotewold et al.,

1991).

Three cDNAs encoding RNA-binding proteins have been

isolated from Nicotiana (Nicotiana sylvestris) that encode

proteins with high affinities for polyuracil and polyguanine

motifs. Two of the cDNAs appear to be derived from a common

gene whose pre-mRNA undergoes alternative splicing in a

tissue specific manner. The alternative splicing occurs via

differential selection of two 5' splice junctions and results

in the formation of a functional and a truncated polypeptide.

The physiological significance of the isoproteins is unknown;

however, the functional polypeptide shows high homology with








the RNA-binding protein involved in the dsx alternative

splicing machinery of Drosophilia (Hirose et al., 1994).

Multiple isoenzymes can be derived by differential

proteolytic processing of a common precursor protein;

however, to date this mechanism has rarely been demonstrated.

NT and NMN, putative endocrine and neural signal prohormones,

are present in a 1:1 ratio within a common precursor

preprohormone polypeptide in mammals (Dobner et al., 1987).

Post-translational precursor processing has been shown to

occur in a tissue specific manner to yield both NT and NMN

prohormones in canines (Carraway and Mitra, 1990). Chicken

NT and LANT6 are derived via differential processing of a

common precursor prohormone (Carraway et al., 1993). Since

both NT and LANT6 have similar pharmacological activities and

bind similar receptors, it is postulated that the larger

slower degraded LANT6 may produce similar effects with a

different temporal pattern.

There are other translational and post-translational

mechanisms that could potentially yield multiple isoforms of

a protein. Such mechanisms include internal initiation of

translation (McBratney et al., 1993), protein splicing (Neff,

1993), protein methylation (Clark, 1993), protein acylation,

phosphorylation, and glycosylation (Blenis and Resh, 1993).

Although these mechanisms of regulation are undergoing

extensive research, the role and significance they play in

isoprotein formation is not well documented.








GDH is a ubiquitous enzyme detected in almost all

organisms from microbes to higher plants and animals

(Srivastava and Singh, 1987). This enzyme catalyzes the

reversible conversion of a-ketoglutarate to glutamate via a

reductive amination that utilizes NADH/NADPH as a cofactor.

A multitude of studies utilizing various techniques has

revealed that isoenzymes of GDH can be localized within the

mitochondria, chloroplast, and the cytoplasm depending on the

organism (Srivastava and Singh, 1987; LeJohn et al., 1994).

Multiple roles have been attributed to GDH including ammonia

assimilation (Yamaya and Oaks, 1987), maintaining the

glutamate/a-ketoglutarate ratio to regulate flux between

carbon and nitrogen metabolism (Munoz-Blanco and Cardenos,

1989), stress response (Miranda-Ham and Loyola-Vargus, 1988;

LeJohn et al., 1994), and function as a RNA-binding protein

(Preiss et al., 1993). Collectively, these findings

implicate GDH as playing a variety of cellular roles and

these various metabolic functions are regulated by the

differential use of GDH isoenzymes.

Chlorella sorokiniana has been shown to synthesize

multiple GDH isoenzymes: a constitutive, tetrameric,

mitochondrial NAD-GDH subunitt 45 kD), and seven ammonium-

inducible, hexameric, chloroplastic NADP-GDHs subunitt

53kD,P- and 55.5 kD,a-) (Prunkard et al., 1986; Bascomb and

Schmidt, 1987). The multiple chloroplastic isoenzymes have

different molecular weights and charges and presumably result

from the formation of homohexamers and heterohexamers due to








mixing of the a-subunits and P-subunits. The chloroplastic

isoenzyme pattern in C. sorkiniana has been shown to be

influenced by light conditions, carbon and nitrogen source,

and ammonium concentration (Isreal et al., 1977; Prunkard et

al., 1986; Bascomb and Schmidt, 1987).

Kinetic and physical characterization of the purified a-

homohexamer and P-homohexamer show them to have several

properties in common as well as striking differences (Bascomb

and Schmidt, 1987). The purified homohexamers have

remarkably different affinities for ammonia; however,

affinity values for the other substrates are quite similar.

The a-homohexamer is an allosteric enzyme with a low Km for

ammonia depending on the NADPH concentration, whereas the p-

homohexamer is nonallosteric and has a high Km for ammonia.

In addition, pulse-chase experiments demonstrated that the

two subunit types are synthesized and degraded at different

rates (Bascomb and Schmidt, 1987). Although the two subunit

types have distinct in vivo turnover rates, they appear to be

derived from precursor proteins of near identical size.

Antibodies derived against one subunit type are able to

immunprecipitate both a-subunits and 3-subunits (Yeung et

al., 1981), and peptide mapping of the subunits revealed that

the subunits have 36 of 40 peptides in common (Bascomb and

Schmidt, 1987). These results indicate that the two subunits

are very similar. Genomic cloning and Southern blot analysis

indicated a single NADP-GDH gene exists in the C. sorokiniana








genome that encodes both types of subunits (Cock et al.,

1991).

In summary, multiple isoenzymes have evolved as a

mechanism to allow an organism to respond to a broad range of

developmental and environmental conditions in a tissue-

specific manner. Isoenzymes and isoproteins can arise by a

variety of molecular and biochemical events including gene

duplication, alternative RNA splicing, transcriptional,

translational, and post-translational events. GDH, a

ubiquitous enzyme, exists as multiple isoenzymes with various

roles in most organisms studied. Considering the wealth of

information that exists on the metabolic roles and regulation

of GDH isoenzymes, further research into the biochemical

genetics of these isoenzymes may provide insight into

mechacanisms of molecular regulation in general.













MATERIALS AND METHODS


Culture Conditions


C. sorokiniana cells were cultured autotrophically as

previously described by Prunkard et al. (1986) in a modified

basal salts medium. The modified medium contained in mM

concentration: CaCl2, 0.34; K2S04, 6.0; KH2PO4, 18.4; MgCl2,

1.5; in [M concentration CoCl2, 0.189; CuC12, 0.352; EDTA,

72; FeCl3, 71.6; H3BO3, 38.8; MnCl2, 10.1; NH4VO4, 0.20;

(NH4)6MO7024, 4.19; NiC12, 0.19; SnC12, 0.19; ZnCl2, 0.734.
The medium was supplemented with 1 mM NH4Cl, 29 mM NH4C1, or

29 mM KNO3 as a nitrogen source depending on the experimental

conditions. The medium containing NH4Cl was adjusted to pH

7.4, and medium containing KNO3 was adjusted to pH 6.8 with

KOH after autoclaving. Cells were supplied with a 2%(v/v)

C02-air mixture and light intensity sufficient to allow cell

division into four progeny.


Enzyme Assay


The aminating and deaminiating activity of the NADP-GDH

was measured spectrophotometrically at 340 nm, by adding a 10

to 20 iL aliquot of enzyme preparation to 500 AL of assay

solution. The deaminating assay solution was composed of 44

mM Tris, 20.4 mM glutamate, and 1.02 mM NADP+ (Sigma), pH









8.8. The aminating assay solution was composed of 50 mM

Tris, 25 mM a-ketoglutarate, 0.357 mM NADPH (Sigma), and

0.356 M (NH4)2SO4, pH 7.4. One unit of enzyme activity was

the amount of NADP-GDH required to reduce or to oxidize 1.0

VM of NADP+ or NADPH per min at 38.50C.


Isolation of RNA


All labware used in total cellular RNA isolation was

sterilized by baking at 2200C for 8 h, and sterile

plasticware was utilized whenever possible. All solutions

were made with H20 treated with 0.1% diethylpyrocarbonate

(Sigma) overnight at 370C, and autoclaved according to

Sambrook et al. (1989).

On the day of the RNA isolation, a pellet of C.

sorokiniana cells stored at -700C was resuspended 1 to 10

(w/v) in RNA breakage buffer: 0.1M Tris (pH8.5), 0.4M LiCl,

10 mM EGTA, 5 mM EDTA, 100 units/mL sodium heparin (Sigma,

100 units/mg), and 1 mM aurintricarboxylic acid (Sigma). The

cell suspension was centrifuged at 7000g for 5 min at 40C and

the supernatant was discarded. The cell pellet was

resuspendeed 1 to 10 (w/v) in RNA breakage buffer and

ruptured by passage through a French pressure cell at 20,000

p.s.i.. The cell homogenate was collected in a disposable 50

mL conical tube containing 0.05 times volume 20% (w/v) SDS,

0.05 times volume 0.5 M EDTA (pH 8), 200 ug/mL proteinase K

(Sigma), and allowed to incubate at room temperature for 15

min. One-half volume of TE buffer (Tris 10mM:EDTA 1mM, pH








8.0) equilibrated phenol was added to the homogenate and

after a 3 min incubation a one-half volume of

chloroform:isoamylalcohol (24:1,v/v) was added and mixed for

10 min on a wrist action shaker (Burrel). The extracted

homogenate was transfer to a 30 mL siliconized (Sigmacote,

Sigma) corex tube and centrifuged at 10OOg for 10 min at 40C.

The upper aqueous phase was removed and repeatedly extracted

with an equal volume of chloroform:isoamylalcohol (24:1,

v/v), as described above, until the aqueous interface was

clear. After the final extraction, the aqueous phase was

combined with an equal volume of 2X LiCl-Urea buffer (4 M

LiCl, 4 M urea, 2 mM EDTA, 1 mM aurintricarboxylic acid) and

the RNA was precipitated on ice for 16 h at 40C. The RNA

precipitate was centrifuged at 4000g for 20 min at 40C and

the resulting pellet was rinsed once with IX LiCl-Urea buffer

and centrifuged again to pellet the RNA. The RNA pellet was

solublized in TE (pH 7.5) and an aliquot was quantified

spectrophotometrically at 260 nm. After quantitation, the

total RNA was precipitated with 0.3M sodium acetate (pH 5.2)

and 2.5 times volume of 100% ethanol and stored at -200C as a

precipitate. The mRNA fraction was isolated from total

cellular RNA using an oligo(dT) spin column kit (mRNA

SeparatorTM, Clontech) according to the supplier's

instructions.








Genomic DNA Isolation


Total cellular DNA was isolated from C. sorokiniana

cells using a modified procedure of Ausubel et al. (1989). A

6.5 g pellet of 29 mM KN03 cultured cells and a 6.0 g of 29

mM NH4Cl was harvested by centrifugation at 7000 rpm for 10

min at 40C. Each cell pellet was resuspended in 25 mL of DNA

extraction buffer (0.1 M Tris-HCl, pH 8; 0.1 M EDTA, pH 8;

0.25 M NaCl), mixed with 2.7 mL of 10% (w/v) sarkosyl, and

incubated for 2 h at 550C. The cell homogenate was combined

with 2.78 mL of 5M NaCl, 3.2 mL of 10% (w/v) CTAB, and

incubated at 650C for 20 min. An equal volume of

chloroform:isoamylalcohol (24:1, v/v) was added and extracted

by gentle shaking for 10 min followed by centifugation at

3000 rpm for 10 min at 40C. The supernatant was transferred

to a new tube and the nucleic acids were precipitated with

0.6 times volume of isopropol alcohol at -200C for 30 min.

The precipitate was pelleted by centrifugation at 4500 rpm

for 20 min at 40C. The pellet was resuspended in 9.5 ml of

TE (pH 8) and combined with 10 g of CsCl (BRL) and 0.5 mL of

10 mg/mL ethidium bromide. The CsCl:DNA mix was placed on

ice for 30 min and the contaminating RNA was removed by

centrifugation at 7500g for 10 min. The CsCl supernatant was

transferred to a 13 mL Quickseal tube (Beckman) and

centrifuged in a Vi65 Beckman rotor for 6 h at 55,000 rpm.

The high molecular weight DNA band was visualized with a

hand-held UV light, eluted from the tube, butanol extracted,

and dialysed 15 h against two changes of 1 L of TE (pH 8).








The dialyzed genomic DNA was quantified spectro-

photometrically at 260 nm and stored as an ethanol

precipitate until use.


NADP-GDH Protein Purification



Purification of the a-NADP-GDH holoenzyme


C. sorokiniana cells were cultured with continuous light

in 29 mM ammonium medium in a 30 L Plexiglas chamber as

previously described (Baker and Schmidt, 1963). Cells were

harvested at 4.0 0D640 by centrifugation at 30,000 rpm through

a Sharples centrifuge (Pennwalt) and washed two times in 10

mM Tris (pH 8.5 at 40C). Pelleted cells (130 g) were stored

at -200C in 250 mL centrifuge bottles until use.

Purification of NADP-GDH was accomplished using a modified

procedure of Yeung et al. (1981). Procedural modifications

involved the substitution of Sephadex G-200 gel (Pharmacia)

for G-150 gel in the gel-filtration column, and the addition

of NADP+ as a stabilizer to a final concentration of 0.1 mM

to the gel-filtration buffer and all subsequent storage

buffers. As a final modification, the NADP+ affinity resin

step was omitted and a preparative nondenaturing-PAGE step

was substituted (Miller et al., 1994a).

Sephadex G-200 column fractions possessing NADP-GDH

activity were pooled and concentrated via Diaflow (Amicon)

filtration. The soluble enzyme (68 mg) was protected from

oxidation by the addition of DTT to a final concentration of








10 mM, and dialyzed for 30 min against 28.8 mM Tris, 192 mM

glycine, 2 mM DTT (pH 8.4). The dialysate was clarified by

centrifugation at 20,000g for 10 min at 40C and was combined

with 3 mL of 40% (w/v) sucrose and 1 mL of 0.02% bromophenol

blue.

For preparative nondenaturing PAGE, a 3 cm tall 7%

acrylamide (w/v, 28 acrylamide: 0.735 bis-acrylamide, pH 8.8)

resolving gel, and a 2 cm tall 2% acrylamide (w/v, 1.6

acrylamide: 0.4 bis-acrylamide, pH 6.6) stacking gel were

cast in the 28 mm ID gel tube of the Model 491 Prep Cell

(Bio-Rad). All acrylamide stocks were pretreated with AG501-

X8 mixed bed resin (Bio-Rad) to remove any contaminating

acrylic acid residue to prevent in vitro N-acylation of

proteins during electrophoresis. The protein sample was

electrophoresed at 15 mA constant power for 20 min and then

for 3.5 h at a constant power of 30 mA. Six milliliter

fractions were collected and assayed for NADP-GDH deaminating

activity and GDH containing fractions were pooled. The

enzyme in the pooled fractions in 10 mM KPO4 (pH 6.2), 0.1 mM

NADP+ was concentrated by Diaflow filtration to 1 mg/mL as

determined by the method of Bradford (1976), using BSA as a

standard. The concentrated enzyme preparation was stored at

-200C. The purity of the preparation was determined by

silver-staining using the Silverstain Plus kit (Bio-Rad) to

visualize proteins resolved by 10% (w/v) Tris-Tricine SDS-

PAGE (Shagger and von Jagow, 1987).








Partial purification of NADP-GDH isoenzymes

To insure that both the a-subunit and 3-subunit were

represented, NADP-GDH isoenzymes were purified from a mixture

of cells cultured for 240 min in 1 mM ammonium medium (14 g),

90 min in 1 mM ammonium medium (6 g), and for 20, 40, 60, and

80 min in 29 mM ammonium medium (1 g/time point) according to

Bascomb and Schmidt (1987). GDH isoenzymes were partially

purified using a scaled down modified procedure of Yeung et

al. (1981). The DEAE sephacel ion exchange columns (pH

7.4,pH 6) were scaled down to a 40 mL bed volume and a 400 mL

linear KC1 gradient (0 to 0.4 M) was used to elute the

proteins in 3 mL fractions. The pH 6 DEAE ion-exchange

column fractions containing NADP-GDH were combined into two

pools; corresponding to the leading and trailing halves of

the NADP-GDH activity peak. The separate pooled fractions

were dialyzed against 10 mM KP04 (pH 6.2), 2 mM DTT for 16 h,

and affinity purified using Type 3 NADP+ affinity gel

(Pharmacia) as previuosly described (Bascomb and Schmidt,

1987). The NADP-GDH in the pooled fractions was concentrated

via Diaflow filtration to 2 mg/ml protein, as determined by

the method of Bradford (1976), and stored at 40C until

further use. After resolution of the proteins by 8% (w/v)

Tris-Tricine SDS-PAGE (Shagger and von Jagow, 1987), the

purity of the preparation was determined by silverstaining.








Anti-NADP-GDH Antibody Production and Purification


Monoclonal antibody production


Mouse anti-NADP-GDH MAbs were produced as described by

Tamplin et al. (1991). BALB/C mice were immunized by

intraperitoneal injection of 40 pg purified NADP-GDH a-

subunit in 0.25 mL PBS mixed 1:1 (v/v) with Freunds complete

adjuvant (Sigma). On day 24, the mice were injected

intraperitonealy with 25 ig of purified a-subunit in 0.25 mL

PBS mixed 1:1 (v/v) with Freunds incomplete adjuvant (Sigma).

The mice were injected on day 38 with 25 gg of purified a-

subunit in 0.5 mL PBS, and once again 2 days prior to cell

fusion. Tail bleeds were performed one week prior to cell

fusion and analysed by ELISA to select mice producing a high

anti-NADP-GDH titer. Splenocytes and myeloma SP2/0 were

fused by the protocol of Van Deusen and Whetstone (1981).

After selection with HAT medium, hybridoma supernatants were

screened by ELISA in 96 well EIA plates (Costar) against 1.25

pg NADP-GDH a-subunit in 50 gl 0.1 M Na2CO3 (pH 9.6) per

well. The ELISA procedure was performed as previously

described (Tamplin et al., 1991). ELISA positive clones were

selected and hybridoma supernatants were screened for

reactivity on Western blots. Selected high-titer hybridomas

were cloned by limiting dilution (Harlow and Lane, 1988), and

hybridoma supernatants were collected and frozen at -200C for

future use.








Polyclonal antibody production


Rabbit anti-NADP-GDH antibodies were produced

commercially by Hazelton Washington (Vienna, VA) in six New

Zealand white rabbits. Rabbits were given a primary

immunization of 0.3 mg of purified NADP-GDH a-holoenzyme per

animal; followed by mulitple 0.15 mg booster injections.

Preimmune sera, test bleeds, and production bleeds were

shipped on dry ice for future analyses. Anti-NADP-GDH IgG

titer was determined by measuring the ability of a series of

increasing amounts of antiserum or purified IgG to

immunoprecipitate 1 unit of NADP-GDH activity. After

incubating the immunoprecipitation mix for 35 min at 250C,

immunoprecipitates were removed by centifugation at 14,000

rpm for 2 min in an Eppendorf microfuge. The titer was

recorded as the percent of NADP-GDH activity remaining in the

supernatant relative to a preimmune serum control. Standard

reaction conditions utilized 10 RL of 25 mM imidazole (pH 6),

1 unit of NADP-GDH deaminating activity in 20 pL of 25 mM

imidazole (pH 6), anti-NADP-GDH antiserum or purified IgG in

a range from 0 to 25%, and rabbit preimmune serum was added

as a stabilizer to a final volume of 40 RL.

Anti-NADP-GDH IgG was purified from rabbit serum using a

MASSTM Protein A affinity membrane 50 mm disc device (Nygene

Corp.). Anti-NADP-GDH rabbit serum was diluted 1:4 (v/v) in

6 mL of PBS and passed through 0.45 im syringe filter

(Gelman). Filtered serum was bound to the Protein A disc at

40C and washed with PBS until the A280 of the eluate was








zero. Purified IgG was eluted with 10 mL of 0.1 M glycine

(pH 2.5) and 1 mL fractions were collected in microfuge

tubes, containing 0.1 mL of 1 M Tris (pH 8), and then gently

inverted to mix the contents. Fractions were analyzed

spectrophotometrically at 280 nm and fractions containing

greater than 1 mg/mL IgG were combined and frozen at -200C in

0.25 mL aliquots.

Western Blotting



Alkaline phosphatase conjugated antibody detection


For NADP-GDH antigen determinations, the proteins in

samples were resolved by 8% (w/v) Tris-Tricine SDS-PAGE using

a Mini-Protean II cell (Bio-Rad) or a 400 SE cell(Hoeffer).

The proteins were electroblotted to a 7 cm x 10 cm Immun-

LiteTM nylon membrane (Bio-Rad) at 20 V constant voltage for

16 to 20 h at 40C in a Mini-Transblot II cell (Bio-Rad).

Whatmann 3MM filter paper, scotch-brite pads, and Immun-LiteTM

membrane, utilized in the electrotransfer, were pre-

equilibrated for 10 min in 10 mM MES (pH 6), 0.01% (w/v) SDS

transfer buffer at room temperature. The immunodetection

procedure was performed at room temperature using the Immun-

LiteTM chemoluminescent detection kit (Bio-Rad). The nylon

membrane was incubated for 1 h in TBS blocking buffer (20 mM

Tris, 0.5 M NaCl, pH 7.5; 5% [w/v] nonfat dry milk). The

membrane was washed for 5 min with TTBS (TBS with 0.05% [v/v]

Tween 20) and incubated 2 to 16 h in primary antibody buffer








(TTBS, 1% [w/v] nonfat dry milk, rabbit anti-NADP-GDH IgG

[1.9 mg/mL IgG faction] diluted 1:200 or mouse anti-NADP-GDH

MAb hybridoma supernatant diluted 1:10). The nylon membrane

was washed for 15 min with three changes of 40 mL TTBS, and

incubated for 1 h in secondary antibody buffer(TTBS, 1% [w/v]

nonfat dry milk, 1:3,000 dilution of goat anti-rabbit IgG AP

conjugate [Bio-Rad] or 1:1,500 dilution of goat anti-mouse

IgG [whole molecule] AP conjugate [Sigma]). The immunoblot

was washed for 15 min with 3 changes of 40 mL TTBS, and 5 min

in 40 mL of TBS. The membrane was immersed for 5 min in

chemoluminescent substrate, sealed in a heat-sealable bag

(Seal-n-Save, Sears), and exposed to Kodak X-Omat AR film for

30 s to 5 min. After chemoluminescent detection, the

immonoblot was rinsed for 5 min in TBS, and incubated with a

color development substrate (10 mL 0.1 M Tris-HCl [pH 9.5],

0.1 M NaCl, 50 mM MgCl, 45 FiL NBT, 35 AL X-phosphate

[Boehringer Manniheim]). Color development was monitored

visually and stopped by the addition of 30 mL of TE (pH 8),

and molecular weight determinations were made relative to a

series of prestained protein markers (Midrange kit,

Diversified Biotech; Rainbow markers, Amersham).


125I-Protein A detection


The proteins in 12 pL aliquots of clarified cell

homogenates (20 mL cell culture concentrated in 3 mL of GDH

breakage buffer) were resolved by 8% (w/v) Tris-Tricine SDS-

PAGE in the 400 SE cell. The gel was electrophoresed at 10






mA constant current until the prestain 30 kD protein marker

(Rainbow markers, Amersham) reached the bottom of the gel.

The SDS gel, nitrocellulose (Bioblot-NC, Costar), and

Whatmann 3MM filter paper were equilibrated for 30 min in

24.8 mM Tris, 192 mM glycine, 20% (v/v) methanol, pH 8.4

transfer buffer (Towbin et al. 1979). The proteins were

transferred electrophoretically at 30 V constant voltage for

16 h at 40C in a Trans-Blot cell (Bio-Rad). Immunodetection

was performed using a modified procedure of Towbin and Gordon

(1984) and Johnson et al. (1984). After electroblotting, the

nitrocellulose was air-dried and blocked in 50 mL of 40 mM

Tris (pH 7.4), 150 mM NaCl, 5% (w/v) nonfat dry milk

(Carnation), and 0.01% (v/v) Antifoam A (Dow-Corning)

blocking buffer for 1 h. All incubations were performed at

room temperature in a heat-sealable bag on a Labquake shaker

(Lab Industries). The blocking solution was decanted and the

nitrocellulose was incubated in 30 mL of 40 mM Tris (pH 7.4),

150 mM NaCl, 5% (w/v) nonfat dry milk, 0.01% (v/v) Antifoam

A, 0.05% (v/v) Tween 20 (Batteiger et al., 1982), and rabbit

anti-NADP-GDH antibody (1.9 mg/mL, IgG fraction) diluted

1:300 for 3 h. The immunoblot washed for 1 h with three

changes of 200 mL of 40 mM Tris (pH 7.4), 150 mM NaCIl and

transferred to 25 mL of 40 mM Tris, (pH 7.4), 150 mM NaCI, 5%

(v/v) nonfat dry milk, 0.01% (v/v) Antifoam A, 0.05% (v/v)

Tween 20, and 0.25 iCi/lane of 125I-labelled Protein A (30

mCi/mg, Amersham) for 1 h in a new heat-sealable bag. The

nitrocellulose was washed for 1 h with three changes of 300








mL of 40 mM Tris (pH 7.4), 150 mM NaCl. The immunoblot was

allowed to air dry for 3 h on a stack of paper towels and

exposed to Fuji RX autoradiogrphy film at -700C.


Amino-Terminal Sequence Analysis of the NADP-GDH a-Subunit
and P-Subunit


An aliquot of a preparation of purified NADP-GDH a-

subunit (120 pmol) and a partially purified preparation of

NADP-GDH a-subunit (80 pmol) and p-subunit (50 pmol) were

resolved by 8% (w/v) Tris-Tricine SDS-PAGE and electroblotted

to a PVDF membrane (Immobilon-PSQ, Millipore) as described by

Plough et al. (1989). To prevent in vitro acylation of the

protein amino-terminal residues, all polyacrylamide solutions

used in PAGE were treated with AG501-X8 mixed bed resin to

remove contaminating acrylic acid. Protein sequence analysis

of the electroblotted proteins was provided by the ICBR

Protein Chemistry Core facility.


DNA Probe Synthesis


Specific cDNA restriction fragments were excised from

purified plasmids using the appropriate restriction

endonuclease (BRL). The plasmid restriction endonuclease

fragments were separated by electrophoresis in an alkaline

agarose gel (0.8% to 3% [w/v]) in TAE buffer (40 mM Tris-

acetate, 1 mM EDTA). The ethidium bromide stained fragment

of interest was cut out of the gel and mascerated in the

upper portion of a 0.45 Rm nylon membrane microfilterfuge







tube (Ranin). The mascerated agarose was frozen for 1 h at

-200C and then centrifuged at 3000 rpm in an Eppendorf

microfuge. The gel purified fragment in the supernatant was

precipitated with 0.3 M sodium acetate (pH 5.2) and 2.5 times

volume of 100% ethanol at -20oC.

Twenty-five nanograms of purified cDNA fragment were

diluted in 33 RL dH20 and denatured at 1000C and chilled

rapidly on ice. The denatured fragment was radiolabeled with
32P-dGTP (3000 Ci/mmol, Amersham) by the random primer method

of Feinberg and Vogelstein (1984). Unicorporated nucleotides

were removed from the 32P-labeled probe using a Sehadex G-50

(Pharmacia) spin column (Sambrook et al., 1989).


Northern Blot Analysis


Total or poly(A)+ RNA stored as an ethanol precipitate

was pelleted by centrifugation at 14000 rpm for 15 min in an

Eppendorf microfuge. The vacuum dried pellet was resuspended

in 20 VL of 75% (v/v) formamide (BRL), 8.28% (v/v)

formaldehyde, 3% (v/v) 10X MOPS (20 mM MOPS, 50 mM sodium

acetate, 10 mM EDTA, pH 7) and heated for 5 min at 800C then

chilled on ice. The denatured RNA sample was combined with 6

PL of formamide loading buffer (Sambrook et al., 1989) and 1

pL of 10 mg/mL ethidium bromide and resolved on a 2% (w/v)

formaldehyde-agarose gel (Ausubel et al., 1989). The RNA was

electrophoresed at 5 V/cm with constant circulation of the

electrophoresis buffer using magnetic stir bars in the buffer

reservoirs. After visualization with a UV transilluminator








(Fotodyne), the RNA was transferred by capillary blotting to

a Hybond-N nylon membrane (Amersham) with 20X SSPE (3.6 M

NaCI, 0.2 M KP04, pH 7.7; 20 mM EDTA). The nylon membrane

was rinsed once in 2X SSPE, air dried for 1 h, and UV

irradiated for 5 min on a transilluminator to covalently link

the RNA to the membrane.

The membrane was prehybridized for 2 h at 400C in 10 mL

of 50% (v/v) formamide, 25 mM KP04 (pH 7.7), 5X SSPE, 5X

Denhardt,s solution (0.1% [w/v] Ficoll, 0.1% [w/v]

polyvinylpyrrolidone, 0.1% [w/v] BSA), 0.1% (w/v) SDS, 100

Ag/mL sheared denatured salmon sperm DNA, 100 Rg/mL yeast

tRNA in a heat-sealable bag on a Labquake shaker. The

prehybrization solution was decanted and the membrane was

hybridized for 16 h at 420C on a Labquake shaker in 10 mL of

prehybridization buffer with 1 x 106 to 1 x 108 cpm of a heat

denatured 32P-labeled cDNA probe. The membrane was washed

three times in 0.1X SSPE, 0.1% (w/v) SDS for 20 min per wash

at 650C. The Northern blot was covered with laboratory

plastic wrap and exposed to Kodak X-Omat AR film with one

intensifying sceen at -700C.


Southern Blot Analysis


C. sorokiniana high molecular weight genomic DNA (6 pg)

was digested with a threefold excess of Pvu II, or Taq I

(BRL) for 4 h at the appropriate buffer and temperature

conditions. Three, 2 ig aliquots of Pvu II digested, Taq I

digested, and undigested genomic DNA were electrophoresed at








1.5 V/cm in a 0.8% (w/v) agarose gel in TAE buffer. Ethidium

bromide (0.5 Rg/mL) was added to the gel prior to

polymerization to allow visualization of the DNA during

electrophoresis. After electrophoresis, the gel was soaked

for 10 min in 0.1 N HC1, 35 min in 0.5 N NaOH, 1.5 M NaCI

denaturing solution, and 45 min in 0.5 M Tris, 3 M NaCl, pH 7

neutralizing solution. The DNA was transferred to a Hybond-N

nylon membrane by capillary action using 20X SSC (3 M NaCI,

0.3M sodium citrate) as described by Southern (1975). After

transfer, the membrane was rinsed in 2X SSC, air dried, and

the DNA was covalently linked to the membrane for 5 min on a

UV transilluminator. The nylon membrane was cut into three

strips each containing Pvu II digested, Taq I digested, and

uncut genomic DNA for analysis with different probes.

The nylon membranes were prehybridized in a HB-1D

hybridization oven (Techne) in 15 mL of 20% (v/v) formamide,

0.6 M NaCl, 0.6 M sodium citrate, 10 mM EDTA, 0.1% (w/v) SDS,

5X Denhardt's solution, 100 pg/mL denatured sheared salmon

sperm DNA for 2 h at 400C. The membranes were hybridized

independently for 16 h at 450C in 15 mL of 50% (v/v)

formamide, 10% (w/v) dextran sulfate (Sigma), 1X Denhardt's

solution, 4X SSC, 5 pg/mL denatured sheared salmon sperm DNA,

and 1 x 106 to 1 x 108 cpm denatured 32P-labeled CDNA probe.

The cDNA probes corresponded to the 5'-VR, HCR, or 3'-UTR of

the consensus C. sorokiniana NADP-GDH mRNAs. The membranes

were washed independently three times in 50 mL of 0.1X SSC,

0.1% (w/v) SDS for 30 min per wash at 650C. The nylon








membranes were covered with plastic wrap and exposed to Fuji

RX film with one intensifying screen at -70oC.


NADP-GDH cDNA Cloning and Characterization



qtl0O library


Small scale liquid lysates of previously isolated plaque

pure NADP-GDH kgtl0O clones were produced as described by

Sambrook et al. (1989). The kgtl0O clone DNA was isolated

using a rapid small scale liquid lysate k phage DNA isolation

procedure (Ausubel et al., 1989). The cDNA inserts were

excised from the purified phage DNA with Eco RI restriction

endonuclease, gel purified as described above, subcloned into

the multiple cloning site of pUC 18, and transformed by the

CaCl2 method (Ausubel et al., 1989) into Eschericia coli DH5a

for further characterization.


kZAP II library


Synchronous C. sorokiniana cells were cultured in a 3 L

chamber in 1 mM ammonium medium or 29 mM ammonium medium

according to conditions reported by Bascomb and Schmidt

(1987) to yield primarily the NADP-GDH a-holoenzyme or

predominately the p-holoenzyme, respectively. The level of

ammonia in the 1 mM ammonium medium induction was

periodically measured by the method of Hardwood and Kuhn

(1970). Cells were harvested by centrifugation at 8000g at

40C, and frozen at -700C for use in total RNA isolation. The








cells in 20 mL from each growth condition were concentrated

by filtration, resuspended in 3 mL of GDH breakage buffer,

and ruptured by passage through a French pressure cell at

20,000 p.s.i.. Aliquots of the various homogenates from

ammonium induced cells were resolved by 7.5% (w/v)

nondenaturing PAGE and the NADP-GDH isoenzyme pattern was

determined by use of a selective activity stain (Yeung et

al., 1981).

Total cellular RNA was isolated from 2 g cell pellets

from each growth condition as described above and the

poly(A)+ RNA fraction was purified by elution from an

oligo(dT) cellulose spin column (Clontech). The poly(A)+

selection was repeated two times on each RNA preparation to

insure complete removal of contaminating tRNAs, and rRNAs.

Both total RNA (20 pg) and poly(A)+ RNA (10 Rg) were analyzed

by 2% (w/v) formaldehyde-agarose gel electrophoresis, and

northern blot analysis, using a 242 bp HCR radiolabeled cDNA

probe, to verify the purity, intactness, and approximate

quantity of NADP-GDH mRNA represented in the a-induced and p-

induced RNA preparations. Poly(A)+ RNA (50 Rg) from each

preparation was combined and utilized for the commercial

production of a custom XUni-ZAP XR C. sorokiniana cDNA

library (Stratagene Cloning Systems, Palo Alto, CA).

The amplified XZAP library, containing 2 x 1010 pfu/mL,

was plated on twenty 150 mm petri plates at 50,000 pfu per

plate for a total of 1 x 106 pfu screened. The phage plaques

were absorbed to duplicate Hybond-N 132 mm circular membranes








and treated according to the plaque blotting protocol of

Amersham (1985). Membranes were prehybridized in a common

container in 200 mL of 2X PIPES (0.8 M NaCI, 20 mM PIPES, pH

6.5), 50% (w/v) formamide, 0.5% (w/v) SDS, 100 Rg/mL

denatured sheared salmon sperm DNA at 400C. Blocked

membranes were hybridized at 420C in ten heat-sealable bags

(four membranes/bag) in prehybridization buffer containing 1

x 106 cpm/membrane of a 32P-labeled NADP-GDH 242 bp HCR cDNA

probe on a lab rocker (Reliable Scientific). The membranes

were washed three times in 200 mL of 0.1X SSC, 0.1% (w/v) SDS

for 20 min per wash at 500C. Duplicate membranes were

wrapped in plastic wrap and exposed to Kodak X-Omat AR film

at -700C for 28 h. Putative NADP-GDH cDNA plagues, detected

on duplicate membranes, were cored from the plate and plaque

purified by secondary and tertiary screenings with the 242 bp

HCR probe. Putative NADP-GDH cDNA phage clones (167),

selected in the primary screening, were combined and screened

a second time with a 32P-labeled 130 bp Eco RI/Bgl II cDNA

fragment isolated from the 5' terminus of the most complete

5' end NADP-GDH cDNA clone (pGDc 42). Ten plaque pure NADP-

GDH clones were subcloned in pBluescript KS+ and transformed

into E. coli DH5a F' via an in vivo excision protocol

provided by Stratagene. All plasmid isolations were

performed as described by Kraft et al. (1988).







5' RACE-PCR cloning


The 5'-terminal NADP-GDH cDNA sequences were cloned

using a modified anchored PCR procedure for the rapid

amplification of cDNA ends (Frohman, 1990; Jain et al.,

1992). A mixture of poly(A)+ RNA, used in the synthesis of

the XZAP library, was utilized to clone the 5' end of the

NADP-GDH mRNA. One hundred nanograms of the mRNA mixture

were combined with 10 ng of a gene-specific primer (RRS 9;

Table 1), designed to hybridize to the HCR of NADP-GDH mRNAs,

heated for 5 min, and chilled on ice. First strand DNA

synthesis was performed using SuperscriptTM reverse

transcriptase (BRL) according to the supplier's protocol.

The terminated reverse transcription reaction was treated

with one unit of ribonuclease H for 20 min at 370C, 5 min at

950C, and extracted once with chloroform:isoamyl alcohol

(24:1, v/v). Excess primers and dNTPs were removed by

centrifugation at 2000 rpm through an Ultrafree-MC filterfuge

tube (30,000 MW cutoff, Millepore) and the retentate was

concentrated to 10 il on a Savant Speedvac. The first-strand

synthesis products were combined with 10 pL of tailing mix

(IX tailing buffer [Promega Corp.], 0.4 mM dATP, 10 units

terminal deoxytransferase) and incubated at 370C for 10 min.

The reaction mixture was heated to 950C for 5 min, diluted to

0.5 mL with TE (pH 8), and utilized as a cDNA pool. A

mixture of 5gL of the cDNA pool, 5 gL of VentTM polymerase 10X

buffer (NEB), 200 AM of each dNTP, 25 pmol of a gene specific



























Table 1. Synthetic oligonucleotide sequences


Oligomer
RRS5
RRS6
RRS7
RRS9
RRS11
RRS12
RRS13
RRS14
RRS15
RRS16
RRS17
RRS 18
RRS19
RRS24
RRS25


Nucleotide Sequence
GGGCTGCGCAGGCCGGGCGGCCACGATAGG
GGGTCGACATTCTAGACAGAATTCGTGGATCC(T)18
GGGTCGACATTCTAGACAGAA
CTCAAAGGCAAGGAACTTCATG
GGACGAGTACTGCACGC
GAGCAGATCTTCAAGAACAGC
TCTGCACGTAGCTGATGTGG
CCCAGCCAGGGCCCTCACC
CACAGTATCGCATTCCGGGC
GATCTCGGTCAGCAGCTG
CTTTCTGCTCGCCCTCTC
GCGGCGACATCGCGC
CGTGCGCCAGCTGCTGAC
CCTTGTTGTACTTGTGG
CCACAAGTACAACAAGG








primer (RRS 9), 5 pmol of the poly(dT) adaptor primer

(RRS6), 0.2 units PerfectmatchTM DNA polymerase enhancer

(Stratagene), and 1 unit of VentTM polymerase (NEB) in 50 RL

was amplified according to Jain et al. (1992). The PCR

products were purified away from the excess primers by

centrifugation at 2,000 rpm through an Ultrafree-MC unit.

The retentate was collected and subjected to two more rounds

of amplification using a new nested gene specific primer at

each step (RRS 11; RRS16, respectively) and an adaptor primer

(RRS 7). PCR amplifications were performed in a Model 480

thermocycler (Perkin-Elmer Cetus), and all custom

oligonucleotides were synthesized by the ICBR DNA synthesis

facility. The standard PCR reaction mixture consisted of 10

pIL of 10X VentTM polymerase buffer, 100 VM of each dNTP, 0.4

units of PerfectmatchTM, 50 pmol of each primer, 1 unit VentTM

DNA polymerase in a 100 pl reaction volume. The optimal PCR

cycling parameters were determined using OligoTM 4.0 primer

analysis software (National Biosciences Inc.). The 5' RACE-

PCR products were gel purified, subcloned into the Sma I site

of pUC 18, and transformed into E. coli DH5a for further

characterization.


NADP-GDH cDNA characterization


Purified NADP-GDH cDNA clone plasmids were digested for

1 to 2 h with specific restriction endonucleases using buffer

and temperature conditions deemed optimal by the supplier

(BRL). The resulting DNA fragments were resolved by








electrophoresis in a 1% (w/v) agarose minigel in TAE buffer.

DNA fragments less than 500 bp were resolved by 4% (w/v, 29

acrylamide:1 bis-acrylamide) PAGE in TBE buffer (0.13 M Tris,

45 mM Borate, 2.5 mM EDTA, pH 9) at 7 V/cm until the

bromophenol blue dye was 1.5 cm from the base of the gel.

Restriction fragment size was determined by comparison to

XDNA/Hind III and OX174/Hae III restriction fragment

standards (BRL).

NADP-GDH cDNA clones were sequenced by the dideoxy

method of Sanger et al. (1977) using modified T7 polymerse

(Tabor and Richardson, 1987) and the Sequenase 2.0 kit

protocol (United States Biochemical Corp.). The products of

the sequencing reactions were resolved on a 7 M urea, 5%

(w/v, 29 acrylamide:1 bis-acrylamide) sequencing gel. All

cDNA clones were partially sequenced from both ends.

Internal sequences were determined by subcloning select

restriction fragments into pUC 18 or by generation of a set

of nested deletions by timed digestion with exonuclease III

(Henikoff, 1984) using the Erase-a-base system (Promega

Corp.). Sequence data were analyzed using the Genetics

Computer Group programs (Devereux et al., 1984) on the ICBR

VAX computer.


Primer Extension Analysis


The 5' transcriptional start sites of the NADP-GDH mRNAs

were mapped by primer extension analysis as described by

Sambrook et al. (1989). A 20 Rg aliqout of a poly(A)+ RNA








mixture, isolated for use in the XZAP library synthesis, was

combined with 3.5 x 105 cpm of a 32P-labeled 30 nucleotide

oligomer (RRS 5) designed to hybridize to the 5' end of the

NADP-GDH mRNA. The primer:RNA mixture was denatured at 850C

for 10 min and allowed to anneal for 12 h at 300C. After

annealing, the RNA:primer complex was extended at 450C for 2

h with 5 units of SuperscriptTM reverse transcriptase, 0.5 mM

of each dNTP, according to the supplier's protocol. The

extension reaction products were treated with 5 ng of DNase

free RNase A (Sigma) for 30 min at 370C,

phenol:chloroform:isoamylalcohol (25:24:1, v/v) extracted,

and ethanol precipitated at 00C for 1 h. The pelleted

precipitate was resuspended in 6 iL of formamide loading

buffer and resolved on a 7 M urea, 5% (w/v) acrylamide

sequencing gel. The primer extension product was detected by

autoradiography on Kodak X-Omat AR film at -700C and the size

of the extension product was estimated by comparison to a

sequencing ladder.

Genomic Allele-Specific PCR


C. sorokiniana genomic DNA was analysed by allele-

specific PCR as described by Saiki et al. (1986). Genomic

DNA (1 Rg) and three NADP-GDH genomic clones in pUC 18 (0.1

ng; pGDg 8.4.4, 14.10.1, 15.2.2) were amplified using exon-

specific primer pairs that hybridized to exons one and three

(RRS17, RRS18), exons 10 and 11 (RRS12, RRS13), and exon 22

(RRS14, RRS15) of the NADP-GDH gene. The standard genomic








PCR reaction mixture was composed of IX VentTM polymerase

buffer, 200mM of each dNTP, 50 pmol of each primer, 0.4 units

PerfectmatchTM, and 1 unit VentTM polymerase. PCR cycles were

executed under cycling parameters deemed optimal for each

primer pair. The allele-specific PCR products were resolved

by 4% (w/v) PAGE and visualized by ethidium staining. The

size of the PCR products was estimated relative to a 123 bp

ladder (BRL).


Construction of NADP-GDH In vitro Transcription Vectors


PCR generated fragments corresponding to the 5'-VR of

the +42 nt and -42 nt mRNAs, HCR, and 3'-UTR were cloned

downstream of the SP6 promoter of the SP65 in vitro

transcription vector (Promega Corp.). Using the 5' RACE-PCR

+42 bp and -42 bp cDNA clones (5'-VR; RRS16, RRS17) or pGDc

23 (HCR7 RRS 12, RRS13: 3'-UTR; RRS14, RRS15) as templates,

the PCR fragments were amplified, gel purified, and cloned

into the SmaI site of pUC 18. Clones corresponding to each

of the mRNA regions were selected on the basis of their

orientation in pUC 18, excised by digestion with Sal I/Eco

RI, and directionally cloned in the antisense orientation

into the SP65 transcription vector. Constructs were verified

by sequence analysis and were purified by a large scale CsCl

plasmid isolation procedure (Ausubel et al., 1989). 32p_

labeled antisense RNA probes corresponding to the four

regions of the mRNA were transcribed using the RiboprobeTM in

vitro transcription system (Promega Corp.). Full length in








vitro transcription products were selected by gel

purification on a 7 M urea, 5% (w/v) acrylamide sequencing

gel according to Ausubel et al. (1989) and used as protecting

fragments for RPA.


Comparison of the NADP-GDH mRNAs, Antigens, and Activities in
29 mM Induced C. sorokiniana Cells



Culture conditions


C. sorokiniana cells were synchronized using three

alternating light:dark periods (9 h: 7 h) in 29 mM KNO3

medium. Cells were harvested by centrifugation, washed with

nitrogen-free medium, and resuspended in 4 L of pre-

equilibrated nitrogen-free medium in a 4 L Plexiglas chamber.

The cells were induced in 29 mM ammonium medium for 240 min

as described by Cock et al. (1991). Samples of 500 mL of

cell culture (2.87 x 106 cells/mL)were collected at TO, and

at 20 min intervals for the first 140 min, and a final sample

was harvested at 240 min. Samples for RNA isolation were

concentrated by centrifugation at 40C at 9,000 rpm and

stored at -700C. The cells in 20 mL of culture were

harvested by filtration, resuspended in 3 mL of GDH breakage

buffer, and stored at -200C for protein and GDH activity

analyses.








RNase protection analysis


Total cellular RNA was isolated from a 1 g pellet from

each time point as described above. The amount of poly(A)+

RNA in the various total RNA preparations was quantified

based on the formation of ribonuclease-resistant hybrids with

poly-3H-5,6-uridylate (2-10 Ci/mmol, New England Nuclear) as

described by Davis and Davis (1978) using purified p-globin

mRNA (BRL) as a standard.

The quanity and form of mRNA present at each time

interval was determined by RPA. A total of 210 ng of Poly

(A)+ RNA or 25 ng of control yeast tRNA was combined with 1 x

105 cpm of a 32P-labeled antisense RNA probe corresponding to

the +42 nt and -42 nt 5'-VR, HCR, or 3'-UTR of the NADP-GDH

mRNAs and hybridized for 16 h at 420C. RPAs were performed

using the GuardianTm RPA kit (Clontech) according to the

suppliers instructions. The ribonuclease resistant fragments

were resolved on a 7 M urea, 5% (w/v) sequencing gel and

sized by comparison to a sequencing ladder. The resistent

fragments were transferred from the gel to 3MM Whatmann

filter paper, dried at 800C, and exposed to a phosphorous

screen and then to Fuji RX film at -700C. The amount of

residual antisense RNA probe was quantitated on a

PhospholmagerTM (Molecular Dynamics) at the ICBR DNA Synthesis

Core facility.








NADP-GDH antigen and activity analyses


C. sorokiniana cell samples from the various time points

were disrupted by two passages through a French pressure cell

at 20,000 p.s.i.. Aliquots from each cell homogenate were

analyzed for both aminating and deaminating NADP-GDH

activity. Total soluble protein concentration in the cell

homogenates was determined by the method of Bradford (1976)

using BSA as a standard. The proteins in 12 pL aliquots from

each homogenate were resolved by 8% (w/v) Tris-Tricine SDS-

PAGE, transferred to nitrocellulose, and NADP-GDH antigen was

detected by 125I-Protein A Western blot analysis as described

above. The amount of NADP-GDH antigen present as the a-

subunit and p-subunit at each time interval was quantified on

a Visage 60 laser desitometer (Bio Image).


RT-PCR analysis


A modified RT-PCR (Kawaski, 1990) procedure was used to

identify and quantify the NADP-GDH mRNAs present in the total

RNA preparations from the various induction time-points. A

series of primer pairs were selected to yield ovelapping PCR

fragments spanning the entire length of the NADP-GDH mRNAs:

RRS17, RRS18; RRS17, RRS16; RRS19, RRS13; RRS12, RRS13;

RRS12, RRS24; RRS15, RRS25. An aliquot of total RNA from

each time-point containing 10 Rg of poly(A)+ RNA was combined

with 300 pmol of random hexameric oligonucleotides

(Pharmacia), incubated at 750C for 5 min, and chilled on ice.

The RNA:primer mixture in 6 IL was combined with 2 tL of 10X








VentTM polymerase buffer, 10 units RNASINTM (Promega Corp.), 1

mM of each dNTP, 1 mM DTT, 200 units SuperscriptTM reverse

transcriptase in a final volume of 20 iL, and incubated at

220C for 10 min, 420C for 70 min, 500C for 30 min, and 950C

for 5 min. After termination of the reaction, 120 pL of IX

VentTM polymerase buffer was added to each reaction tube. The

resulting mixture served as cDNA stocks for subsequent

amplifications. The standard RT-PCR amplification mixture

consisted of 8 RL 10X VentTM polymerase buffer, 200 RM of each

dNTP, 50 pmol of each primer, 0.2 units PerfectmatchTM, 20 pL

of a cDNA stock, and 4 units of VentTM (exo-) polymerase (NEB)

in 100 [tL final volume. The RT-PCR mixtures were cycled at

conditions determined to be optimal for each primer pair

using the OligoTM 4.0 primer analysis software. RT-PCR

products were resolved on 1% to 3% (w/v) agarose gels and

sized by comparison to a 123 bp ladder (BRL). The relative

intensities of the PCR fragments was quantified from

PolaroidTM Type 55 negatives of ethidium bromide stained gels

on a Visage 60 laser densitometer.













RESULTS


NADP-GDH cDNA Cloning and Characterization



Restriction mapping and sequencing of XqtlO cDNA clones


A kgtlO cDNA library was constructed from poly(A)+ RNA

isolated from C. sorokiniana cells induced in 29 mM ammonium

medium for 80 min. Cells induced under these conditions were

reported by Prunkard et al. (1986) and Bascomb et al. (1987)

to accumulate both the a- and P-subunits as NADP-GDH

holoenzymes between 40 and 120 min, and at 80 min the a- and

P-subunits each constituted approximately 50% of the total

NADP-GDH antigen. Approximately 2 x 106 pfu were screened

with a heterologous 1.2 kb Salmonella typhimurium gdhA gene

probe (Miller and Brenchley, 1984) and six putative NADP-GDH

cDNAs were isolated. The cDNAs ranged from 0.6 to 1.91 kb

and their restriction maps were identical in regions in which

they overlapped (Fig. IB; Cock et al., 1991). The cDNA

clones appeared to be truncated forms of the 1.91 kb pGDc 23

cDNA clone that lacked a complete 5' terminus. A lacZ-pGDc

23 translation fusion expressed in E. coli JM 109 accumulated

antigen which was recognized by antibodies raised to purified

C. sorokiniana NADP-GDH verifying the cDNA authenticity (Cock

et al., 1991).





























Figure 1. Restriction maps of 17 cDNAs isolated from a
C.sorokinana library prepared from RNA isolated from cells
induced for 80 min in 29 mM ammonium medium. A, The 2145 bp
consensus NADP-GDH map. Regions corresponding to the HCR and
3'-UTR are indicated. B, NADP-GDH cDNA clones isolated using
a heterologous 1.2 kb probe from the gdhA gene from S.
typhymurium. cDNA clones were sequenced in the regions
denoted by arrows. C, The cDNA clones were isolated using a
homologous 115 bp PstI fragment from the 5' end of the HCR of
pGDc 23.




























0 2 0a o s 1 1 2


254 b Consv gn
Pst I Pst I
s ConservTd PSegon frobt


Pv' II H1o II Pvu II

a Rn a tI |qi II Eqi. II
jst l| st I Pst I N( I Nor I -st I Uar I


.< to 1S 20


3'-Untranlt.ed
Roelol Probe
!r" I S..!


H.I II


!1r I N.r I


I


S I Teco I
I .iY consensus
3 GDH-cDNA


FN, P B.o E P N ? JNc N N






?Kc 3g F x


39 F I IF PN Hcq x
Eq N N NN'N No!


? aC 2a P


P q 3 ,, q P





st I ?st I
5 Probe

P ? e B*g f





? P1 Ig P
,qN c Bg P









P No Eag P


SP ? B, g P




N- P -. E N
Nq P0 Eq N


N Nf Pv e I








S N PvN N E N


N a. NN


N a Pv p






N N P7 f Ke 3












N ? N N K.eN S


I p P. B ? P, Ns P


Po 3q N P c Eq PN


pGDc 23


pGDc 2


pGDc 3


pGDc 6


pGDc 7


pGDc 10






pGDc 30


pGDc 31


pGDc 32


pGDc 33


pGDc 34


pGDc 35


pGDc 36


pGDc 38


pGDc 39


S.
1.2., 0


0.1.,


N.l~4



0.1, 4


pGDc 42


SpGc 44


. ..............


,l








In an attempt to select additional NADP-GDH cDNAs with

complete 5' termini, the kgtl0 library was rescreened with a

homologous 115 bp PstI restriction fragment probe (Fig. IC)

derived from the 5'-proximal end of pGDc 23. Approximately

one-half of the 115 bp probe sequence overlaps the 5-terminus

of the 354 bp NADP-GDH HCR (Fig. 1A) that is predicted to be

present in all NADP-GDH cDNAs. Eleven additional cDNA clones

were isolated, restriction-mapped, and their 3' and 5'

termini sequenced (Fig. 1C). The additional cDNA clones had

identical restriction maps and sequences in regions that

ovelapped with pGDC 23. NADP-GDH cDNA clones pGDC 31, 38,

and 42 were longer than pGDC 23 at their 5' termini; however,

none of the cDNAs possessed an ATG start methionine codon or

a 5'-untranslated region. The 5'-terminal EcoRI/PvuII

fragment (Fig. IC) of pGDC 42 was subcloned into pUC 18 and

both strands were sequenced. Sequence analysis of the pGDc

42 subclone revealed that pGDc 42 possesed an additional 256

bp of coding region sequence not found in pGDc 23.

Although the cDNA library was prepared using an oligo

(dT) primer, 10 of the 17 NADP-GDH cDNAs lacked a poly(A)+

tail and additional 3'-terminal sequences (Fig. 1). None of

the 17 cDNA clones were full-length at their 5' termini.

From the combined sequences of the cDNA clones, a 2145 bp

consensus NADP-GDH cDNA sequence and restriction map was

constructed (Fig.lA). Bascomb et al. (1986) and Cock et al.

(1991) showed the NADP-GDH mRNA to be 2.2 kb; therefore, the








consensus NADP-GDH clone was determined to be approximately

98% full-length.


Isolation, restriction-mapping, and sequencing of the kZAPII
NADP-GDH cDNA clones


Since all of the gtl0O library NADP-GDH cDNA clones

lacked complete 5' termini and many lacked complete 3'

termini, a second ammonium-induced unidirectional cDNA

library was constructed. Synchronous C. sorokiniana cells,

used for total RNA isolation, were cultured in 1 mM or 29 mM

ammonium medium according to conditions reported to yield

primarily the NADP-GDH a-holoenzyme or predominately the 3-

holoenzyme, respectively (Bascomb and Schmidt, 1987). The

NADP-GDH isoenzyme pattern from each culture condition was

verified by activity staining crude preparations resolved by

nondenaturing PAGE. Poly(A)+ RNA from each culture condition

was analyzed by northern analysis, using the 242 bp HCR and

the 378 bp 3'-UTR probes (Fig. 1A), to verify the approximate

level and intactness of NADP-GDH mRNA in each preparation

(Fig. 2). An equal quantity of poly(A)+ RNA from each

preparation was combined, to ensure representation of

multiple types of NADP-GDH mRNAs if they existed, and the RNA

mixture was utilized in the cDNA library construction. The

XZAPII unidirectional cloning system was utilized to ensure

the cloning of the complete 3' ends of the mRNAs.

Initial screening of 1 x 106 pfu with the homologous 242

bp HCR probe derived from pGDc 23 (Fig. 1A) yielded 167































Figure 2. Northern blot analysis of poly(A)+ RNA isolated
from C. sorokiniana cells induced for 3 h in 1 mM ammonium
medium (Lanes 1,3) or continuously in 29 mM ammonium medium
(Lanes 2,4). Formaldehyde-agarose gel resolved RNA
preparations immobilized on nylon were hybridized with the
242 bp HCR probe and 378 bp 3'-UTR probe. A single-sized 2.2
kb NADP-GDH mRNA was detected in both RNA preparations with
both probes.









HCR 3'-UTR
1 2"34
9.49-
7.46-
4.40-
2.37-
2.235-
1.35-


0.24-








putative NADP-GDH cDNA clones. Ten of the primary screening

plaques were selected at random and plaque purified by

secondary and tertiary screenings. Restriction-mapping and

sequencing of the ten NADP-GDH cDNAs revealed eight unique

overlapping clones ranging in size from 1.46 to 2.04 kb (Fig.

3). Two of the 10 clones proved to be identical to pBGDC 52

and 58 indicating a detection of redundant clones in the

amplified library. All eight of the unique NADP-GDH clones

possessed identical complete 3' termini; however, they all

lacked complete 5' termini (Fig. 3). The longest kZAP NADP-

GDH cDNA clone, pBGDc 53, was 103 bp shorter than the gtl0O

NADP-GDH consensus cDNA.

To detect any cDNA clones longer at the 5' terminus than

pBGDc 53, the 167 putative NADP-GDH plaques selected in the

primary screening were combined and rescreened. The second

screening utilized a homologous 130 bp EcoRI/BglII cDNA

fragment probe derived from the 5' terminus of pGDc 42 (Fig.

IC). No NADP-GDH clones longer than pBGDc 53 were isolated

from the secondary screening.


Primer extension analysis


Although all of the NADP-GDH cDNA clones isolated from

the kZAP library possessed complete 3' ends, none of the 25

cDNA clones isolated from either library possessed complete

5' ends. In order to determine the amount of sequence

remaining proximal to the 5' end of the consensus NADP-GDH

cDNA clone, primer extension analysis was performed on the











o0 0






(0 C: MO
Q a) (a


>iC 00 *



- 0 r.l
u 0 -v






m Q
e, 0 <
H 4)

'- O 0
14.4 .i Z)
SH Hn a








- H0 0 H
to ao



















S0) 0 ta
0 MOH -H
1-i l ) Q- >0


















O *) ( 0 o

04 -0 Q
ao a)











0 0 4-)
0 0 4
4-) 0 r-











0cm>
d0 a )
0a 3 h .
U) tvH 4 -)





U0) 1O 4

0 a)



m -H 0 U)
A1-4 c4 Qa
M 3 -4)UOi















62

n
0" N w
L Lo LO Lo a |L La



(t
621





A %n
S S S A.IA
PI n


o N
I25 ^ '& I '


0






M
0 H

m-
C -H
H --











M g--E-


iT


0

S.
S.
U'
0


- 1 -


j I


ty..
p.

U'
0>
S.








mixture of C. sorokiniana poly(A)+ RNA previously isolated

for the XZAP library construction. As determined by

comparison to a cDNA generated sequencing ladder, a single

primer extension product of 87 nt was detected (Fig. 4). The

87 nt product corresponds to 53 bp of sequence identified in

the 5' terminus of pGDc 42 (Fig. IC) and 34 bp of sequence

previously undetected. The additional 34 bp extension

predicted a mRNA of 2.179 kb that approximated the 2.2 kb

mRNA determined by northern blot analysis (Fig. 2). The

primer extension analysis was repeated with identical

results.


RACE-PCR cloning of two NADP-GDH 5' termini


To determine the 5'-terminal sequences of the NADP-GDH

mRNA(s), a modified anchored PCR procedure for the rapid

amplification of cDNA ends was performed (Jain et al., 1992).

To ensure any possible sequence differences that might reside

in the 5' region proximal to the HCR would not be missed, a

RNA mixture previously prepared by mixing equal quantities of

poly(A)+ RNA from cells synthesizing primarily the a- or 3-

holoenzyme was used for the RACE-PCR cloning.

Agarose gel elelctrophoresis of the products from the

second step of the RACE-PCR amplification revealed two DNA

fragments of approximately 390 and 450 bp in size.

Reamplification using a different nested gene-specific

primer, designed to hybridize closer to the 5'-termini of the

mRNAs, yielded two unique PCR products of approximately 330






























Figure 4. Primer extension analysis of NADP-GDH mRNA(s). A
poly(A)+ RNA mixture isolated from Chlorella cells,
synthesizing primarily the NADP-GDH a- or P-subunit, was
hybridized with a 32P-labelled 5' NADP-GDH-specific
oligonucleotide and extended with reverse transcriptase. A
single 87 nt primer extension product (PE) was detected after
resolution on a 5% sequenceing gel. The approximate size of
the extension product was determined by comparison to a NADP-
GDH cDNA clone sequencing ladder.


















AGCT PE


- -87 nt








and 370 bp in size as determined by agarose gel

electrophoresis (Fig. 5). Sequence analysis of the two

cloned final PCR products revealed the actual size of the

products, minus the anchor primer, to be 269 and 311 bp.

Comparison of the two RACE-PCR cDNA clone sequences showed

them to be identical except for the presence of an additional

42 bp in the 5' coding region of the longer PCR product. The

additional 42 bp sequence encodes 14 amino acids that were

not present in the 269 bp RACE-PCR clone (Fig. 5). The

absence of the 42 bp sequence in the 269 bp clone results in

the deletion of the 14 amino acids from the amino-terminus of

the polypeptide; however, the downstream reading frame

remained unchanged. Both RACE-PCR products possessed

identical putative 5'-UTRs, translation initiation sites, and

were identical for the first 12 codons (Fig. 5). Both the

+42 bp and -42 bp clones overlapped in frame with pGDC 42 at

their 3' ends. The 5' RACE products were 33 bp longer than

pGDC 42 at their 5'-termini which is in close agreement with

the 34 bp length predicted by primer extension analysis.

The NADP-GDH 5' RACE-PCR clones possessed identical 32

bp 5'-terminal pyrimidine rich (89%) sequences and

transcription initiation sequences indicative of eukaryotic

5'-UTRs and translational start sites, respectively (Kozak,

1984). Furthermore, additional 5'-terminal guanine residues

were detected (2 on the +42 bp and 1 on the -42 bp clone) in

both clones that could not be accounted for in the NADP-GDH

gene sequence. The presence of unique 5'-terminal guanine












0



-H 0 m
0 4-) -I

.O i0 0



4) 0

U C
0 P- ) H
00 "A





o -' H-H
0) P a (d
Pu d -W o




U 0 .I ri
MO 4 *o







O H ) 0

rC4 4-)
Sa)04
SV r 0
-4 ) OH




0 40 0 I
P z









0o0 () a
V Q U)-4430 a












a4 -HP
4-) 3 )o (
0 4 -4 U







U 0) r N
I r0 QO 0







Sa) 01 X

-1 0 Q H
P4 13 u 0)








S0 1 -H
H 0 U) 0









*-i 1) m


H P) 0 4 -)










44( CO U) W 4-) Q





69















< 00
S> >




> 1


-)J
; Ir




/ >






<< < <- 0
F- F-
2i








residues on 5' RACE-PCR products has proven to be a

definitive means of identifying 5' capping points and

transcription initation sites of eukaryotic mRNAs (Bahring et

al., 1994). The RACE-PCR procedure was repeated with

identical results. RT-PCR performed on the poly(A)+ RNA

mixture using two new gene-specific primers that flanked the

42 bp variable region also yielded two PCR products differing

in size by 42 bp.

Both 5' RACE-PCR products appear to be complete at their

5' termini and overlap in frame with the consensus NADP-GDH

cDNA identified earlier. These results are consistent with

the existence of two separate NADP-GDH mRNAs that share a

common transcriptional start site and are identical with the

exception of a 42 nt insert identified in the longer mRNA.

The +42 nt mRNA predicted size is 2185 nt, whereas the -42 nt

mRNA predicted size is 2143 assuming a mean poly(A) tail

length of 70 nt.


Analysis of the C. sorokiniana NADP-GDH cDNA sequences


Sequence analysis of the two consensus NADP-GDH cDNAs

(+42 bp and -42 bp) revealed both mRNAs possessed an

identical 32 nt 5'-UTR (Fig 6). The +42 bp cDNA possesses an

ORF from nt 33 to a TAA stop codon at nt 1611 that encodes a

precursor protein with a molecular mass of 57850 D. The -42

bp cDNA possesses an ORF from nt 33 to nt 1569 that encodes a

precursor protein of 56350 D. The 1500 D difference in

molecular mass observed in the two precursor proteins is due



























Figure 6. Nucleotide sequence of the consensus NADP-GDH
mRNAs derived from the cDNA and 5' RACE-PCR clone sequences.
Beginning at nucleotide 33, two ORFs were identified from two
mRNAs that differed by 42 nt in the 5'-VR (boxed). The +42
bp mRNA encodes a polypeptide of 57,850 D, whereas the -42 bp
mRNA encodes a 56,350 D polypeptide. The deduced amino acid
sequences of the C. sorokiniana precursor polypeptides (Cs)
are compared with those of E. coli (Ec) and N. crassa (Nc)
NADP-GDHs. Arrows denote the boundaries of the highly
conserved glutamate binding domain identified by Mattaj et
al. (1982). A consensus algal polyadenylation signal
(underlined) is located 17 bp upstream from the poly(A) tail
of the NADP-GDH mRNAs.










Cs CTCTTTCTGCTCGCCCTCTCCGTCCCGCCCATGCAGACC 40
M 0 T
GCCCTCGTCGCCAAGCCTATCGTGGCCGCCCCGCTGGCGGCACGCCCGCGCTGCCTCGCGCCGTGGCCGTGCGCGTGGGTCCGCTCCGCC 130
A L V A K P I V AIA P L A A R P R C L A P W P|C A W V R S A
AAGCGCGATGTCCGCGCCAAGGCCGTCTCGCTGGAGGAGCAGATCTCCGCGATGGACGCCACCACCGCCGACTTCACGGCGCTGCAGAAG 220
K A D V R A K A V S L E E Q I S A M D A T T G D F T A L Q K
GCGGTGAAGCAGATGGCCACCAAGGCGGGCACTGAGGGCCTGGTGCACGGCATCAAGAACCCCGAGCTGCGCCAGCTGCTGACCGAGATC 310
Cs A V K Q N A T K A G T E G L V H G I K N P E L R Q L L T E I
E M D Q T Y S L S F L N H V Q K
BE S
TTCATGAAGGACCCGGAGCAGCAGGAGTTCATGCAGGCGGTGCGCGAGGTGGCCGTCTCCCTGCAGCCCGTGTTCGAGAAGCGCCCCGAG 400
F M K D P E Q Q E F M Q A V R E V A V S L Q P V F E K R P E
R N P N Q T E F A Q.A V R E V M T T L W P F L E Q N P K Y R
N L P S E P E F E QGA Y K E L A Y T L E N S S L Q H .
CTGCTGCCCATCTTCAAGCAGATCGTTGAGCCTGAGCGCGTGATCACCTTCCGCGTGTCCTGGCTGGACGACGCCGGCAACCTGCAGGTC 490
L L P I F K Q I V E P E R V I T F R V S W L D D A G N L Q V
Q M S L L E R L . V .V R N Q I
Y R T A L T V A S I .. .. V .E N V.
AACCGCGGCTTCCGCGTGCAGTACTCGTCCGCCATCGGCCCCTACAAGGGCGGCCTGCGCTTCCACCCCTCCGTGAACCTGTCCATCATG 580
N R G F R V 0 Y S S A I G P Y K GG L R F H P S V N L S I M
A W F N L
Y F N L L L
AAGTTCCTTGCCTTTGAGCAGATCTTCAAGAACAGCCTGACCACCCTGCCCATGGGCGGCGGCAAGGGCGGCTCCGACTTCGACCCCAAG 670
K F L A F E Q I F K N S L T T L P M G G G K G G S D F D P K
S G T A .
G A G S A .
GGCAAGAGCGACGCGGAGGTGATGCGCTTCTGCCAGTCCTTCATGACCGAGCTGCAGCGCCACATCAGCTACGTGCAGGACGTGCCCGCC 760
G K S D A E V M R F C Q S F N T E L Q R H I S Y V 0 D V P A
E G A L Y L G A D T .
I R C A A H K G A D T .
GGCGACATCGGCGTGGGCGCGCGCGAGATTGGCTACCTTTTCGGCCAGTACAAGCGCATCACCAAGAACTACACCGGCGTGCTGACCGGC 850
G D I G V G A R E I G Y L F G Q Y K R I T K N Y T G V L T G
G V F N A K L S N T A C F .
G A R K A A N R F E .
AAGGGCCAGGAGTATGGCGGCTCCGAGATCCGCCCCGAGGCCACCGGCTACGGCGCCGTGCTGTTTGTGGAGAACGTGCTGAAGGACAAG 940
K G Q E Y G G S E I R P E A T G Y G A V L F V E N V L K D K
L S F L L Y T A R H
L S W L . L Y Y G H M E Y S
GGCGAGAGCCTCAAGGGCAAGCGCTGCCTGGTGTCTGGCGCGGGCAACGTGGCCCAGTACTGCGCGGAGCTGCTGCTGGAGAAGGGCGCC 1030
G E S L K G K R C L V S G A G N V A Q Y C A E L L L E K G A
MN G F E N V S S A I K A F.
.A G S YA V A L S A L K I L .
ATCGTGCTGTCGCTGTCCGACTCCCAGGGCTACGTGTACGAGCCCAACGGCTTCACGCGCGAGCAGCTGCAGGCGGTGCAGGACATGAAG 1120
1 V L S L S D S Q G Y V Y E P N G F T R E 0 L Q A V Q D M K
R .I T A S T V D E S K K A R L I E I .
T .V K .A L V A T G E S G I T V E D I N A V A
AAGAAGAACAACAGCGCCCGCATCTCCGAGTACAAGAGCGACACCGCCGTGTATGTGGGCGACCGCCGCAAGCCTTGGGAGCTGGACTGC 1210
K KN N S A R I S E Y K S D T A V Y V G D R R K P U E L D C
A S R D RD G V A D A K E FG L V Y L E G 0 0 S P -
I E Q L T S F 0 H GH LK I E G A R L H V G
CAGGTGGACATCGCCTTCCCCTGCGCCACCCAGAACGAGATCGATGAGCACGACGCCGAGCTGCTGATCAAGCACGGCTGCCAGTACGTG 1300
Q V D I A F P C A T 0 N E I D E H D A E LL I K H G C Q Y V
L L V D A H Q A N V K A .
K L V S K E E .G .L AA K F.
GTGGAGGGCGCCAACATGCCCTCCACCAACGAGGCCATCCACAAGTACAACAAGGCCGGCATCATCTACTGCCCCGGCAAGGCGGCCAAC 1390
V E G A N M P S T N E A I H K Y N K A G I I Y C P G K A A N
A T .I T E L F Q V L F A .
A S G C L E VFENNRKE K EAW A .
GCCGGCGGCGTGGCGGTCAGCGGCCTGGAGATGACCCAGAACCGCATGAGCCTGAACTGGACTCGCGAGGAGGTTCGCGACAAGCTGGAG 1480
A G G V A V S G L E M T Q N R M S L N W T R E E V R D K L E
T .. A .A A R G K A K .D A R H
C ...A S Q R A D E K
CGCATCATGAAGGACATCTACGACTCCGCCATGGGGCCGTCCCGCGAGTACAATGTTGACCTGGCTGCGGGCGCCAACATCGCGGGCTTC 1570
R I M K D I Y S A M G P S R E Y N V D L A A G A I A G F
H L H H A C V E H G G GE T N Y V .
D N A F F N G L N T A K T Y V E AAE GEL P S V S .
ACCAAGGTGGCTGATGCCGTCAAGGCCCAGGGCGCTGTTTAAGCTGCCCAGGCCCAAGCCACGGCTCACCGGCAATCCAACCCAACCAAC 1660
T K V A D A V K A Q G A V *
V .. M L V I *
V Q M H D D W S K N*
TCAACGGCCAGGACCTTTTCGGAAGCGGCGCCTTTTTCCCAGCCAGGGCCCTCACCTGCCCTTTCATAACCCTGCTATTGCCGCCGTGCC 1750
CCTGCAATTCCACCCCAAGAAGAACTAGCGGCACTTGACTGCATCAGGACGGCTATTTTTTTCGCGACGCGCGCTCACCCCGAGAGCCTC 1840
TCTCCCCCGAGCCCTAAGCGCTGACGTCCGCCCGACTTTGCCTCGCACATCGCTCGGTTTTGACCCCCTCCAGTCTACCCACCCTGTTGT 1930
GAAGCCTACCAGCTCAATTGCCTTTTAGTGTATGTGCGCCCCCTCCTGCCCCCGAATTTTCCTGCCATGAGACGTGCGGTTCCTAGCCTG 2020
GTGACCCCAAGTAGCAGTTAGTGTGCGTGCCTTGCCCTGCGCTGCCCGGGATGCGATACTGTGACCTGAGAGTGCTTGTGTAAACACGAC 2110
GAGTC (Poly A)70 2185








to the presence of the additional 14 amino acid residues in

the +42 bp cDNA (Fig. 6).

The sequence TGTAA located 17 nt upstream of the

polyadenylation site has been identified as a conserved

polyadenylation signal generally used in algal genomes (Fig.

6). The conserved TGTAA signal has been identified in the

same position in numerous Chlamydomonas, Chlorella, Volvox,

and Euglena cDNAs (Wolf et al., 1991).

The deduced amino acid sequences of the C. sorokiniana

NADP-GDHs are 50% and 50.3% identical with the NADP-specific

GDH of E. coli (McPherson and Wooton, 1983) and Neurospora

crassa (Kinnaird and Finchum, 1983), respectively (Fig. 6).

Comparison of the sequences of the highly conserved glutamate

binding domain (Mattaj et al., 1982) shows a strong identity

of 76.6% and 73.4%, respectively. Alignment of the C.

sorokiniana NADP-GDH polypeptide sequences with the bovine

mitochondrial NAD-dependent GDH (Julliard and Smith, 1979)

revealed a significantly lower 23% identity for the entire

protein and a 27.4% identity over the GDH conserved region.

Analysis of the codon preference of both NADP-GDH mRNAs

showed a strong bias for C and G at the first position, in

the case of arginine and leucine, and the third position of

the codon (Table 2, Table 3). Furthermore, an extreme

preference for G or C at the third codon position correlates

with the 63% GC content reported for the C. sorokiniana

genomic DNA (Cock et al., 1990).















Table 2.

TTT phe F
TTC phe F
TTA leu L
TTG leu L


leu L
leu L
leu L
leu L


Codon usaqe of


the -42 bo NADP-GDH mRNA.


TAT tyr Y
TAC tyr Y
TAA OCH Z
TAG AMB Z


CCT pro P
CCC pro P
CCA pro P
CCG pro P

ACT thr T
ACC thr T
ACA thr T
ACG thr T

GCT ala A
GCC ala A
GCA ala A
GCG ala A


his H
his H
gln Q
gln Q


AAT asn
AAC asn
AAA lys
AAG lys

GAT asp
GAC asp
GAA glu
GAG glu


TGT
TGC
TGA
TGG

CGT
CGC
CGA
CGG

AGT
AGC
AGA
AGG


arg R
arg R
arg R
arg R

ser S
ser S
arg R
arg R


GGT gly
GGC gly
GGA gly
GGG gly


Table 3. Codon usage of the +42 bp NADP-GDH mRNA.


TTT phe F
TTC phe F
TTA leu L
TTG leu L


leu L
leu L
leu L
leu L


CCT pro P
CCC pro P
CCA pro P
CCG pro P

ACT thr T
ACC thr T
ACA thr T
ACG thr T


4 GCT
8 GCC
- GCA
31 GCG


ala A
ala A
ala A
ala A


TAT tyr Y
TAC tyr Y
TAA OCH Z
TAG AMB Z


his H
his H
gln Q
gln Q


AAT asn
AAC asn
AAA lys
AAG lys

GAT asp
GAC asp
GAA glu
GAG glu


TGT cys C
TGC cys C
TGA OPA Z
TGG trp W

CGT arg R
CGC arg R
CGA arg R
CGG arg R


ser S
ser S
arg R
arg R








Both of the deduced NADP-GDH polypeptides possess amino-

terminal extensions that are rich in alanine, serine, and

threonine and contain few acidic residues. These amino acid

sequence motifs are indicative of chloroplast targeting

domains (Smeekens et al., 1990). The boundaries of the

transit peptide were delineated by amino terminal sequence

analysis as discussed later.

The secondary structures of the deduced polypeptide

sequences of the +42 nt and -42 nt GDH cDNAs were predicted

by the method of Garnier et al. (1978; Fig. 7, Fig. 8).

Alignment of the predicted secondary structures to homologous

regions of the Clostridium symbiosum NAD-GDH 1.96A resolution

crystal structure (Baker et al., 1992) indicates the

predicted structures are accurate representations.

Comparison of the chloroplast transit peptide regions of the

two predicted structures showed that the 14 amino acids

encoded by the additional 42 nt of the longer mRNA introduced

a random coil structure with multiple turns (Fig. 8) that

disrupts an a-helical domain observed in the -42 nt mRNA

transit peptide region (Fig. 7).


Determination of the Exon/Intron Boundaries
of the NADP-GDH Gene

A 9873 bp region of genomic DNA containing the NADP-GDH

gene previously sequenced by Cock et al. (1991) was compared

to the two consensus NADP-GDH cDNA sequences (Fig. 9). Both

the +42 bp and -42 bp NADP-GDH cDNAs span a 7178 bp region of













ch o
r-4 -
00


*D 0
r. 0
4- I I 04
0) i -)









04-)
0 Q) 0 CL

- H &- 02



-I ) 0) +



S*H 0
0 -) 0)C
0. (1) 10
4(N *Hd


r O) 0 -
Hm -H



C* 0 C -H
( 1- r-I0 -





0 0
O 0 4Q

) 4- 0
C -0 *r



4 0) 4 ,U

1- 0 c i


0 oo 0 G
0 C' 40 V




*d r. -r-4
0 Q.0to 0 )
4- 0- .C 0
) 0 -4



0 u -qH >-
- H i-H 0 -
. 01-4 <'u


1- >)>- H P
Fx) i- *d U-P

























0)
0)
0) -~ C
U)
n
d ~ I-












co 0
r- *H-

-. I 4-)

r-- 0 4-




I 0W
-
Q ,-C 0
Z 444-) OS

0M 0 -
00 O) )


+ 4 90




(0W~
to ) o --I









(4 0 o +
*1U 0
H 4 4) ()



0 0 0 I


o E0





C! U li 4O
UOlM C0







-d Cd Ua
0)0 +





0H 0 U






p Ei 0
34 .' 0






Co41
4- 40 *.C
>'0







WM- 0 *I

> ( (



oH cQ H -

)o iO C2





h0 o




















































































0)C
C
U) U C




























Figure 9. Nucleotide sequence of the C. sorokiniana NADP-GDH
gene containing 22 exons (+42 bp mRNA) or 23 exons (-42 bp
mRNA). The position of the exons are identified by their
corresponding deduced amino acid sequences. The 5'-VR amino
acid sequences are indicated separately in the 5' region of
the gene. The highly conserved glutamate binding region
(Mattaj et al., 1982) is distributed over six exons
encompassing 2.09 kb as indicated by the two arrows. The 5'-
VR 42 bp auxon is denoted by arrowheads. Underlined regions
indicate the 5'-UTR and 3'-UTR, respectively.






81



GATCAGCCGCCTGCAACGCAAGGGCAGCCACAGCCGCTCCCACCCGCCGCTGAACCGACACGTGCTTGGGCGCCTGCCGCCTGCCTGCCG 90
CATGCTTGTGCTGGTGAGGCTGGGCAGTGCTGCCATGCTGATTGAGGCTTGGTTCATCGGGTGGAAGCTTATGTGTGTGCTGGGCTTGCA 180
TGCCGGGCAATGCGCATGGTGGCAAGAGGGCGGCAGCACTTGCTGGACGTGCCGCGGTGCCTCCAGGTGGTTCAATCGCGGCAGCCAGAG 270
GGATTTCAGATGATCGCGCGTACAGGTTGAGCAGCAGTGTCAGCAAAGGTAGCAGTTTGCCAGAATGATCGGTTCAGCTGTTAATCAATG 360
CCAGCAAGAGAAGGGGTCAAGTGCAAACACGGGCATGCCACAGCACGGGCACCGGGGAGTGGAATGGCACCACCAAGTGTGTGCGAGCCA 450
GCATCGCCGCCTGGCTGTTTCAGCTACAACGGCAGGAGTCATCCAACTAACCATAGCTGATCAACACTGCAATCATCGGCGGCTGATGCA 540
AGCATCCTGCAAGACACATGCTGTGCGATGCTGCGCTGCTGCCTGCTGCGCACGCCGTTGAGTTGGCAGCAGCTCAGCCATGCACTGGAT 630
CAGGCTGGGCTGCCACTGCAATGTGGTGGATAGGATGCAAGTGGAGCGAATACCAAACCCTCTGGCTGCTTGCTGGGTTGCATGGCATCG 720
CACCATCAGCAGGAGCGCATGCGAAGGGACTGGCCCCATGCACGCCATGCCAAACCGGAGCGCACCGAGTGTCCACACTGTCACCAGGCC 810
CGCAAGCTTTGCAGAACCATGCTCATGGACGCATGTAGCGCTGACGTCCCTTGACGGCGCTCCTCTCGGGTGTGGGAAACGCAATGCAGC 900
ACAGGCAGCAGAGGCGGCGGCAGCAGAGCGGCGGCAGCAGCGGCGGGGGCCACCCTTCTTGCGGGGTCGCGCCCCAGCCAGCGGTGATGC 990
GCTGATCnnnCCAAACGAGTTCACATTCATTTGCAGCCTGGAGAAGCGAGGCTGGGGCCTTTGGGCTGGTGCAGCCCGCAATGGAATGCG 1080
GGACCGCCAGGCTAGCAGCAAAGGCGCCTCCCCTACTCCGCATCGATGTTCCATAGTGCATTGGACTGCATTTGGGTGGGGCGGCCGGCT 1170
GTTTCTTTCGTGTTGCAAAACGCGCCACGTCAGCAACCTGTCCCGTGGGTCCCCCGTGCCGATGAAATCGTGTGCACGCCGATCAGCTGA 1260
TTGCCCGGCTCGCGAAGTAGGCGCC CTCTTTCTGCTCGCCCTCTCTCCGTCCCGCC ATG CAG ACC GCC CTC GTC GTGAGCAG 1342
+42GDH M Q T A L V
-42 GDH M Q T A L V
CGCTTGGGTTGCCTTGCAGCGGTTGTTGCTGGATCGCGCCGCCGGCCGACCGGGGCTGGTTGCACGGCCCGCCGCGCCGCGCACACTGAC 1432
CGGCGGTCCTGTTTCTCCTCATTGCGACTGCAG GCC AAG CCT ATC GTG GCC GCC CCG CTG GCG GCA CGC CCG CGC 1507
A K P I V AAA P L A A R P R
A K P I V A
TGC CTC GCG CCG TGG CCG TGC GCG TGG GTAAGCGGCTCGGGTGGGGCCCGGGGATGGCACGCTGGGGTTAGGGTTGCGCGG 1588
C L A P W PAC A W
C A W
TGTGCGACGACAACGCCGCTCACGTCCAGCCTCAGCTGCTGGCGCCTCGCTGGCCCGCTGCCATTGCTCATGTGCAAGACAGGATGCTTG 1678
CTGGGTGATGGGCGGAGCACCAGGGCTGTTGGTGGTGGGCGGCGCGCACGCTGCCGCCGCCGCCAGCCGCCGCGCGCCTGCCTCTCGCAG 1768
TGGTGTGGCCCATCCTGCCTCCCTGCCAACAACCTCACCGCTCGCCCCGACCCGCAG GTC CGC TCC GCC AAG CGC GAT GTC 1849
V R S A K A D V
V R S A K A D V
CGC GCC AAG GCC GTC TCG GTGAGTGCTCTGCGTGCACCGCCAGCCCTGCAAGCACGCCCCCGCCGGCGCCAAACCTCCAACCGC 1933
R A K A V S
R A K A V S
CGCGGGGACCCCGCTGCCATGCATGCACCTGCCGGCACCTGCACCGCCTTCGTGCGCGCCGCTCCTGTGCAGCCCTCACCGTCACTGACC 2023
AATCCAAACACTTTTTCGCCACTGTTCTGCAG CTG GAG GAG CAG ATC TCC GCG ATG GAC GCC ACC ACC GGC GAC 2097
L E E 0 I S A M D A T T G D
TTC ACG GTGCGCCGCCACAGCCGTACTTATGCGCCCTGTTGGACTCGGGCAGCCACTGTACCGCCCCTTCATAGCGCCCGCCGTCCTG 2185
F T
CCTGACATGGGCTCAACGCAAGCCATGCCATGCCTTCAAACAGCATGCATTCATCCCTGTCCTGACTCATCAAGATCGCCCTGTGTCTTG 2275
ACCCTGCGCCGCCCCGCAACCGCCATCCCGCTTGTTTCCCGACCTGCCCTCTCCCCCCGCCCGCCCTCGTCCTCATGTGCCGCAG GCG 2363
A
CTG CAG AAG GCG GTG AAG CAG ATG GCC ACC AAG GCG GGC ACT GAG GGC CTG GTG CAC GGC ATC AAG AA 2431
L Q K A V K 0 M A T K A G T E G L V H G I K N
C CCC GAC GTG CGC CAG GCAAGTCTTTAGCCTGATTGGAATGGAATGTAAGCCTGCCTTGTGCGCATTCCTTGGGCATCAACAAT 2515
P D V R Q
CCTGAGCTGCGCCAGGTGAGGAATAACACACCGTTTTTGAGCACTTCTATCGTCCCCACCTGCTGGCGTTGCGGCTCGACCGGGCTGCTT 2605
AGAGCAGCCCCGATGAGAAGAAAGCCCACGTGCGCAGAGTGCCAAACGCTGTCTCCTTCCCCCGCCCTGTCATCCACCACAGCTGCTGAC 2695
CGAGATCTTCATGAAGGACCCCGTTCAGCAGGAGTTCATGCAGGCTCATCTACATGCATGCGTAACAATAACCTGCCTCTTTCCTCTTCC 2785
CACCACGCAG CTG CTG ACC GAG ATC TTC ATG AAG GAC CCG GAG CAG CAG GAG TTC ATG CAG GCG GTG CGC 2855
L L T E I F M K D P E Q Q E F M Q A V R
GAG GTG GCC GTC TCC CTG CAG CCC GTG TTC GAG AAG CGC CCC GAG CTG CTG CCC ATC TTC AAG CAG GC 2923
E V A V S L Q P V F E K R P E L L P I F K 0
AAGCGCGCCTGAGGGGGGCAGGGGTGGTGCAGGGCGGGTCAGAGGGCTGGTTATAACTAACTAGGGTGCGGTGGACACGGGCGTGCAGAA 3013
GCCTGGCTCATCCACCAGTGACAGCAGCATGCTGGGTTGGCGAGCAGCAAGACACCCATTCACCGCTCGGCGACTGGCCTGACTAGCTGC 3103
AAGTCTGCTCTGTGTTATTCGCCATCCGCAG ATC GTT GAGACCT GAG CGC GTG ATC ACC TTC CGC GTG TCC TGG 3176
I V E /P E R V I T F R V S W
CTG GAC GAC GCC GGC AAC CTG CAG GTACAGCAGGCAGGCTGGCGCCTTGGCTGGCTAGTGTTCCCTTGCAGAGAGAAGCAGC 3258
L D D A G N L Q
ACACCACGCACGCACACTCGTCCCTGCCCGCCGCCATATGGCATGCATGCGGCATCCCGTGCGCCGACAATTCCACTGTTGTGCACTCAG 3348
TTCAGCTTCATTCTCATGGCCCATTCATTCACTTCACTGTTTGCAG GTC AAC CGC GGC TTC CGC GTG CAG TAC TCG TCC 3427
V N R G F R V Q Y S S
GCC ATC GGC CCC TAC AAG GGC GGC CTG CGC TTC CAC CCC TCC G GTGCGTGCCTGCACTGGCTGTGCCTGCGCTGG 3502
A I G P Y K G G L R F H P S
CTGTGCCTGCGCTGGCCGTGCCTGCACCGGCTGTGCCTGGCTCAGCGGGTGGGGATGTGAGGCATGTCGGTGCACCAACCCGCCCGGCTT 3592
GCTCCGACGTCTACACCTGCAACACGGCTGCACAATGGACAGGGCAGGGCGGGGCAGGCACTTGCATCGGTGCCCGCCCCTCCAGCATGC 3682
ATGGGCGTGGCGAGCTGGGGGCGGGCCGGGCACCAACGGAGCAACTTGCAGTTCACCCTACTTTTCATGTGCCCCTGTCCAATGCCGCAG 3772
TG AAC CTG TCC ATC ATG AAG TTC CTT GTGAGTGCTGCCAAGCCTTGAAAGCGCTGTGCTAGCTGGTGAAATTGAGCAAGGA 3853
V N L S I M K F L
GCTGGGAAGAGTATAGCCGTGGGGGCAGGCCAGCCACTTTGCTGGCGCAAAGGTGGCCCTGCGATGCGCTGCGGCGACTGACACAGCGGC 3943
CCCTCCATCCCTTCACAACCATATGCAG GCC TTT GAG CAG ATC TTC AAG AAC AGC CTG ACC ACC CTG CCC ATG 4016
A F E Q I F K N S L T T L P M
GGC GGC GGC AAG GGC GGC TCC GAC TTC GAC CCC AAG G GTGCGCCTTCCTTGAGTTAGTCGGCGGCAAGCTGCACATT 4093
G G G K G G S D F D P K
AAATGCCTCCGTCGGTCGTGTTTCAAGGCCCGCCCTGGCCCATCATTGGCTGACGGTCCACTGCCTGCCACCCTGTGTCGCCACCTACCT 4183
GCATACCACCCACCCAACACTCCCGCCCCTCCTGCAACCCCTCCCTCCCCACTACCGCAG GC AAG AGC GAC GCG GAG GTG 4263
G K S D A E V
ATG CGC TTC TGC CAG TCC TTC ATG ACC GAG CTG CAG CGC CAC ATC AGC TAC GTG CAG GAC GTG CCC 4329
M R F C 0 S F M T E L 0 R H I S Y V Q D V P
GCC GGC GAC ATC GGC GTG G GTGAGCGAGCGAGCGAGCAGCGAGCGGGCGTGTTTTTGAAAATTGCAGGGAGGGTAGTCGGGTG 4412
A G D I G V
GGGCAAAGGAAACGCACACACTTGCATGCGTAGCCAGCAAGCTTTCGTTCTCCTCATTCGCCGCTCCATTAGCTCACTGCCTTTGCCCAC 4502
CTCTTGTTTACCAACAACACGCAG GC GCG CGCAGAG ATT GGC TAC CTT TTC GGC CAG TAC AAG CGC ATC ACC 4573
G A R E I G Y L F G 0 Y K R I T










AAG AAC TAC ACC GGC GTG CTG ACC GGC AAG GG GTGAGGCCCGCTTGCACTGACTGAGCTCGAGCCGGGAGCAACTGTAC 4652
K N Y T G V L T G K G
TTTGCATTCCTGCCGGTCTGTTTCGGGGCGGCTGATCGGCAAGGGGTAAGGACCAGTGCCCACAGGAGCTCTAACGCTTGCCTGCCACGT 4742
TTGGGTGAACTGGTGTTCTCCAGCAGCCAGAGTTTTCCATGTCCACCCGCCTGCAAGCTCCTGGCTGTTCATCGCTGTGCTCTGTGTCTC 4832

CCTGCCAACACAATCCATACCAACACAATCCTGCGCCCTGCAG C CAG GAG TAT GGC GGC TCC GAG ATC CGC CCC GAG 4909
Q E Y G G S E I R P E
GCC ACC GGC TAC GGC GCC GTG CTG TTT GTG GAG AAC GTG CTG AAG GAC AAG GGC GAG AGC CTC AAG GT 4977
A T G Y G A V L F V E N V L K D K G E S L K
GCAGCTATATGCCTTGGTTGTGCTGCCCTTGGCAGCAGTGAAGGCTGCGATGGTCTTTCACCTGAACTTTCAACGTACCAGCATGCGCAC 5067
ATGAGGTAGAGCACAGCCCAAACTGCTCAGAACGTCCGCCTGCCAAGTTCTTTCTTCCATCCACACCCCACACACCTGTGCAG GGC 5153
G
AAG CGC TGC CTG GTG TCT GGC GCG GGC AAC GTG GCC CAG TAC TGC GCG GAG CTG CTG CTG GAG AAG 5219
K R C L V S G A G N V A Q Y C A E L L L E K
GGC GCC ATC GTG CTG TCG CTG TCC GAC TCC CAG GGC TAC GTG TAC GAG GTGCGGTTGATACATCTGGGCCATTT 5293
G A I V L S L S D S Q G Y V Y E
CGGCTGTTGATTGTGCTCTGTGTTGTCTGTAGTGTCTGACTCCCTGGGCTCGTGCACGAGGTGCGGAAGGCTCAGGCAGCAGTTCGGAGC 5383
TCTGCCTGTCTGCTGCTCCTAGAGCTACCTAATGAAGCATAGCTCTGCTGTGCTGCCCCCTCGCGCCTGCTCACCCGTCAACCACCACCG 5473
CCCCTCCCCACCCCCTTTTCATTTTTCCCGCAG CCC AAC GGC TTC ACG CGC GAG CAG CTG CAG GCG GTG CAG GAC 5548
P N G F T R E 0 L Q A V 0 D
ATG AAG AAG AAG AAC AAC AGC GCC CGC ATC TCC GAG TAC AAG GACAGTGATGACCGGTCCAGGAAACAAGTTGCAC 5624
M K K K N N S A R I S E Y K
ATGTCGTCTAGAAGGTCCCTGCCGCCGACACAGCAGCCGCGCCTGGGCTGCCGCTGCTTCGATAGCACCACCCACCCCTGCCGCCCCATC 5714
TCCTGCCTGCACTGCACCTTCCCATTTTGCCCACTAGCCACTGCTCACTCGAGTTCTCAACTGTCACTTGCAATTTTCTCTCTGCTTGCA 5804
G AGC GAC ACC GCC GTG TAT GTG GGC GAC CGC CGC AAG CCT TGG GAG CTG GAC TGC CAG GTG GAC ATC 5871
S D T A V Y V G D R R K P W E L D C Q V D I
GCC TTC CCC TGC GCC ACC CAG GTGCGCAGCCAGACTGGCTTGCATGCAACGCATCAAATGTCTCAAGGTTTGCCTGCAAGTGC 5954
A F P C A T Q
TCTAAGCCCTGTCAGAACTTTTTACAAGCAGCATGGCAGTGGAGGTGGTGAGGGCGACGTCCTGCACCGTTTCCTCAATGCCGCCGTGCC 6044
CCGGCTCTCTTGCCCTGTATGCAG AAC GAG ATC GAT GAG CAC GAC GCC GAG CTG CTG ATC AAG CAC GGC TGC 6116
N E I D E H D A E L L I K H G C
CAG TAC GTG GTG GAG GGC GCC AAC ATG CCC TCC ACC AAC GAG GCC ATC CAC AAG TAC AAC AAG GTGGCG 6185
0 Y V V E G A N M P S T N E A I H K Y N K
CTGCCTATACGAAGAATGTATTCCACTTGATGTTCAATACAGGGCGGGTGTTCAGAAACTAGGCGTGCCGCGAGGCCGTCCACAAGTACA 6275
ACAAGTGGGCGGTGGCTGCGAAGTTAGTTCTTAATCAAGGGCTGGTATGCTGTGCTGCACCAACGAGGCCATCCACAAGTACAACAAGGT 6365
GGGCCTGTTTTGAGCTTGCTGACAAGCTAGCCTCCCGACAGCTCTCCGGGTTGCGAGTTCCCAGCTGCTGCCTTCCGCAGTCTTTGGGAC 6455
CACGTGCGCCACCCACCCACCCATGTTTCTCCCGCACACATACTGCTCAGTACACACTTGCAGCTCCATGCAACCCAGCCTCTTTGCTGC 6545
CCCACCCTTCCCTCTCCCTGCCTCCGCGTCGCGCAG GCC GGC ATC ATC TAC TGC CCC GGC AAG GCG GCC AAC GCC 6620
A G I I Y C P G K A A N A
GGC GGC GTG GCG GTC AGC GGC CTG GAG ATG ACC CAG AAC CGC ATG GTGAGCGTGGCATGATTTCCCTGCTTGTCA 6695
G G V A V S G L E M T Q N R M
GGGCTTGCAGTATAAGCTGAAGAAACGAAGTGGTCTGCAGTCAGCAGCCTGCAGATGACCCAGAGCCGCATGGTGAGGAGGGCAGGGGCT 6785
GTTAACTGGGAGCAGCCTCAGCGACGCCCAGTGCTGGTGCTTTGTTCCTCGTGCACCTCAGCTGCTGCAACTTTGTGAGCGCATCGCCCT 6875
GAACCGCCACAACTGCCTGCGCCTGCCCTGCCGCAG AGC CTG AAC TGG ACT CGC GAG GAG GTT CGC GAC AAG CTG 6950
S L N W T R E E V R D K L
GAG CGC ATC ATG AAG GTGAGGGCTGATTGTGCGGCTATCACAGTGCAACCACGCAAGCTGGAGCGCATCATGAAGGTGAGGGCTG 7035
E R I M K
ATTGTGCGGOCTATCACAGTGCAACCACGCTCGTCATGGGCCTTGCGCGCCTCGCCCGTCGCGACTCGGCTGAAGTCGCTGCGGAAGCCGC 7125
CTTCGAGGAGGAAAGCCTGCGCCTTCGTCACGGCTCGCACTGCTTCCTTTCCCTCCACAGGACATCTACGACTCGCCATGGGCGCCTTTT 7215
GCAGGACAACCCATTCCGTTCACAACACTCAGCAACCCTGCCCTCATTCTTCTTCATCCCCGCAG GAC ATC TAC GAC TCC GCC 7298
D I Y D S A
ATG GGG CCG TCC CGC GAG TAC AAT GTT GAC CTG GCT G GTGAGTGCCTGGCTGTGCAGACAGACACGACACTTGTAAA 7375
M G P S R E Y N V D L A
CTCAGTTTTTTCATTCTAGCCTGCCGCCGTTTCTGCCGGCCAGGATTGGCTTTGGATATCGCTCTGCCCTGAGTAGCTAGTAGCCAGTTG 7465
CCCGGCAGCTATTGCCCCCCTGCCTGCTGTAGCTGTCTGCTGCCTGCGGTGCTGGTGTGCATGGAGCACCCACCGCAAAGCTCAAACGCC 7555
TGCGGTTGGTGGGCGCATGCTGTGCTTGCGGTGCTGCCCATCCGCCCTTGCGTTGCCACCCTGCTCACCCTGCTCACCCTGCCCCGCCTG 7645
CCCCCTCCCCCCGTCCTCCCAATTCTACAG CG GGC GCC AAC ATC GCG G GTGAGTTGGATTGGGGGGAGTTGTGCACACTGCT 7727
A G A N I A
GAAACGTGCAACGAGCACTGCTGCCTGTGCACTGCTGGCGCTGTTTTGGCACGATATGCTGCATTGCTGGTTGCCCGTCCTCAACTGTTG 7817
CAAGAGAGTGGCAGCTTGAACCGCCAATGCAGCGAAATGGTCGCGCACCCGCCTATTTGTGGCTTACGTTGCATTCCTCTCTCCGCTGCC 7907
TGCAG GC TTC ACC AAG GTG GCT GAT GCC GTC AAG GCC CAG GGC GCT GTT TAA GCTGCCCAGGCCCAAGCCACG 7980
G F T K V A D A V K A Q G A V *
GCTCACCGGCAATCCAACCCAACCAACTCAACGGCCAGGACCTTTTCGGAAGCGGCGCCTTTTTCCCAGCCAGGGCCCTCACCTGCCCTT 8070
TCATAACCCTGCTATTGCCGCCGTGCCCCTGCAATTCCACCCCAAGAAGAACTAGCGGCACTTGACTGCATCAGGACGGCTATTTTTTTC 8160
GCGACGCGCGCTCACCCCGAGAGCCTCTCTCCCCCGAGCCCTAAGCGCTGACGTCCGCCCGACTTTGCCTCGCACATCGCTCGGTTTTGA 8250
CCCCCTCCAGTCTACCCACCCTGTTGTGAAGCCTACCAGCTCAATTGCCTTTTAGTGTATGTGCGCCCCCTCCTGCCCCCGAATTTTCCT 8340
GCCATGAGACGTGCGGTTCCTAGCCTGGTGACCCCAAGTAGCAGTTAGTGTGCGTGCCTTGCCCTGCGCTGCCCGGGATGCGATACTGTG 8430
ACCTGAGAGTGCTTGTGTAAACACGACGAGTC GATCACCCGGTGCTTGGTGCACAAGCAGGGCATTGGAGCAGGGCAGCGGATCTGGAC 8519
TCCAGACTGGAGACGGCGGCCGCCGCCAGGTCAGCAGCCGGAAAACGCACCCGGAAAACTAGATCCCGAGCGCCTGGGCCGCTGCGCGCC 8609
GCATTTACAGTTCCAGACCCAGTCAGATCACCCAGGGCATCCACCAGCCACTGCAAAGCGGTTGCACAGCGGCTCGGCTCGATGGCGCCG 8699
CAATGGCAGGCCCGCGCTACGAGCCCGCTGCCTGATCCTAGCTGCTGCCGTGGCTGTTTGCCGTGTGCCGCTGAAGGTGCCGACCGCACG 8789
CCCGGGCGAGTGCTGGGACACGTGACGCGCGAGCTCAAGGCCTCCGAGCTGCCGGGCAAGGTAAGCGGAGCGTGTAAAAGATGGCTGGTA 8879
CTGCTGTTGACCCGATCCGCCCTGCTCGCGCGGGCCAGCACCACCCCTGCGTGCCGCCAACCTCACCCGCGCCGTGCCGCTCTGCCCCTC 8969
CGATTTCTGCTGCAGGATATGGCCTGATCTTCTATGGAGACAGCATCACGGAGAGCCTGCGTGGCACAGACAAGTGCCGCGACGTCTGCC 9059
TGAAGAGTAAGACGCGGTCCTCCTGCAAAGGCATTCCTGAGGTGCGCGAGCACGAGGGCCGCCACTCCTGCCGAATGGTTGCTACACATT 9149
GCATCGGCAGGGGTGGATTGGTTCATGGGCAGCCACTTCTTTCAGCTTCATAACTTTGCAACCAGTTTCCATGATCGCCGTCGTGCCGCC 9239
GCCGCATCCGCCGCTCTCCTGCCCGCTTGCCGATACGCCTTTCTGGGCCCCCGCTTACCGCACTGTGACCGAAGGTCCTGCAAAAGTACT 9329
TTGGCGCCTACCGCCCGGGTGTGATGGGCATGTCCATGGATGAGTCGGCCCACCTGCTGTGGCGCCTGCAGAACGGCCAGATCCCCCGCG 9419
TCAACCAGGTGAGCGCGCACAGGCAGTGCAGCGCAGGCAGCACAGCGCACGACATAGTGCAGCAGCGGCAGACTGGACGGGCCAACTGTC 9509
TGCCTGCGGTCTGCACTGGTGGGGCCAACTGCGTCTTCTGCGCCATGCCTTCAGCCAGGAATAGCACATGCTCCTTCGCCCTGCCTGCAG 9599
CCCAAGACAGTTGTGCTGAACATCGGCACCAACGACCTCACCAACTGCCGTGGAGCGCGAAGAACGCCCAGAAGAAGCAGGCGGCCATCA 9689
ACAAAGAAATCCCGGGGATCGTGGGCCGGTGAGCTGGGCGGTGGGGCATTCGCATGAACATGCATATCCTGGCTGCCACAGCGTGCCGCA 9779
TGCTATGTTGGGTGGGTCCACGGCAGTTGGCCGCTCGGTGCCGCTGGTGCATGCTGTGTGGGAGGGGAAGCTGCCTCGGTGTGACCTGAA 9869
GGACTT 9873


Figure 9 continued







the C. sorokiniana genome and are divided into 22 exons and

23 exons, respectively (Fig. 10). The exons in this gene

exhibit a range from 9 bp (exon 3 of the -42 nt mRNA) to a

large exon of 550 bp at the 3' end of the gene. The 9, 16,

and 18 bp exons are smaller than the smallest exons

identified in higher-plant genes (Tischer et al., 1986).

The introns identified in the NADP-GDH gene range

between 42 and 402 bp with a mean length of 233 bp. The mean

intron length is similar to the mean intron length of 249 bp

calculated in a survey of higher-plant introns (Hawkins,
C A TC
1988). The consensus sequence AG/GTG GG was derived as
A C CG
the 5' intron donor site using the criteria suggested by

Cavener (1987). The 5' donor site closely matches the

general consensus, CAG/GTAAGT observed in higher-plants and

animals (Hawkins, 1988) with the exception of G at position

+3 of the C. sorokiniana intron. Three of the 21 conserved

5' intron splice junctions do not conform to the GT-AG rule

of Breathnach and Chambon (1981) due to a substitution of C
TTTTTTT T T
at position +2. A consensus sequence, C CcCtt C GCAG/,
CCCCCCC C C
was derived for the 3' intron splice junction of the NADP-GDH

gene. The strong preference for G at position -4 observed in

19 of 21 conserved intron splice junctions is typical of

plant introns (Brown, 1986). The 5' (GCC/GCC) and 3'

(CCG/TGC) splice site junctions of the 42 bp auxiliary exon

(termed auxon hereafter as per Werneke et al. [1989]) showed

no conservation in splice site branch points.











* 0 w
D ( d
c .. HH ,
r.-i o um





d ,d I
C >0 0 0d





m -H 4 m -,- *




i 0 0l ( 0 '0
-0 I4-) 0 ) H


a 4JC 4- 0 1
P )U- .
I CO 4 U) t UeC
*4 000 4-


Q) -dci. US-

. -0 4 -H H~ 0
Q>'0) Q) 0)'0H I.







Q (VM) ()4-


00 4-) >3 ('Dr
4ei ( Cna-






0 0r 0 U 0 M 0
0 0 M 4 0 P





(0 C r-0 O Q 0
0 (--L 0 .0 I )




O0) 0 0O
,Q -I *'-I r o r .





0) -- P' )0 M0 a)
p, U) r- r 0() a)
M14 0 4-)

a) CO'- A




--4 0 0 )O 4 uX 0









44 c -i 4-) .r-X
h M UO *PCQ*~!i







85





Z

4 -

' 2
? *f 8


E.


i-
E










x
I x






* E- -


-C
A
x


I
2 U
-( ~(-




2-
2-