Citation
Characterization of functional domains of a T-DNA promoter active in sunflower tumors

Material Information

Title:
Characterization of functional domains of a T-DNA promoter active in sunflower tumors
Added title page title:
Sunflower tumors
Added title page title:
T-DNA promoter
Creator:
Bruce, Wesley Bernard, 1959-
Publication Date:
Language:
English
Physical Description:
vi, 121 leaves : ill. ; 28 cm.

Subjects

Subjects / Keywords:
Boxes ( jstor )
DNA ( jstor )
Genes ( jstor )
Genetic mutation ( jstor )
Plasmids ( jstor )
Promoter regions ( jstor )
RNA ( jstor )
Sunflowers ( jstor )
TATA box ( jstor )
Tumors ( jstor )
Promoters (Genetics) ( lcsh )
Sunflowers -- Cytology ( lcsh )
Tumors, Plant ( lcsh )
Genre:
bibliography ( marcgt )
theses ( marcgt )
non-fiction ( marcgt )

Notes

Thesis:
Thesis (Ph. D.)--University of Florida, 1987.
Bibliography:
Includes bibliographical references (leaves 112-120).
General Note:
Typescript.
General Note:
Vita.
Statement of Responsibility:
by Wesley Bernard Bruce.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright [name of dissertation author]. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Resource Identifier:
000948890 ( ALEPH )
AER0997 ( NOTIS )
16899358 ( OCLC )

Downloads

This item has the following downloads:


Full Text












CHARACTERIZATION OF FUNCTIONAL DOMAINS OF A T-DNA
PROMOTER ACTIVE IN SUNFLOWER TUMORS











By



WESLEY BERNARD BRUCE


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN
PARTIAL FULFILLMENT OF THE REQUIREMENTS
FOR THE DEGREE OF DOCTOR OF PHILOSOPHY



UNIVERSITY OF FLORIDA


1987
































To the memory of my father, John W. Bruce














ACKNOWLEDGMENTS


I wish to thank Sabita Bandyopadyhay and Hampton McRae and their

many assistants for their technical expertise. I also wish to thank Eva

Czarnecka, Dulce Barros, and Ram Bandyopadhyay for guidance concerning

many of the procedures involved in this study. I owe a debt of gratitude to John

Ingersoll and Luis Mosquera for providing moral support as fellow graduate

students when I needed it and for their unending humor, making lab work

more enjoyable. A special mention goes to James Stanga for his brief and

valuable help in screening some of the deletion mutants used in Chapter 2. I

also owe a great debt of gratitude to my committee members, Robert Ferl,

Frances Davis, James Preston and Curt Hannah, for their invaluable support

and encouragement for this work and for providing solutions to my seemingly

unending questions. I also wish to express my deepest thanks to William Gurley

for support and guidance, for inspiring creative innovations, for his

acceptance for new ideas and for simply being a friend in times of need. Above

all, I would like to express my warmest thanks to my wife, Karen, for providing

me with the courage and determination to continue with this work and seeing

it to the end.














TABLE OF CONTENTS


PagA...

ACKNOW EDGEMENTS .......................................... .............................................. i

A B STR A C T ........................................ ............................................................... v

CHAPTERS

1. IN TR O D U CT IO N ................................................................................... 1

Promoter Structure of Animal and Viral Genes.................... 2
Plant Promoter Structure...................................... ............. 15

2. PROMOTER MUTATION ANALYSIS................................................ 30

Introduction........................................................................... 30
Materials and Methods.......................................................... 31
R esults.................................................... ................................. 43
Conclusion.............................................................................. 60

3. ENHANCER PROPERTIES OF T-DNA PROMOTERS........................... 66

Introduction........................................................................... 66
Materials and Methods.......................................................... 68
Results..................................................................................... 71
Conclusion............................................. ............................... 82

4. IN VITRO NUCLEAR FACTOR BINDING TO THE 780 ACTIVATOR
ELEM ENT ................................... ......................................... 89

In tro d u ctio n .................................................................................. 89
Materials and Methods................................................................ 90
R e su lts ............................................................................................ 9 3
Conclusion.............................................................................. 99

5. SU M M A R Y ......................................................................................... 106

R EFER E N C E S ...................................................................................................... 112

BIOGRAPHICAL SKETCH ............................................. ............................... 121















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy


CHARACTERIZATION OF FUNCTIONAL DOMAINS OF A T-DNA PROMOTER ACTIVE IN
SUNFLOWER TUMORS

by

Wesley Bernard Bruce

May, 1987

Chairman: William B. Gurley
Cochairman: Francis C. Davis, Jr.
Major Department: Microbiology and Cell Science


Three promoter domains required for transcriptional expression of the

780 gene of T-right (pTi15955) were identified by mutagenesis. These domains

are analogous to the TATA, upstream element, and enhancer typical of many

animal and viral genes. Precise quantification of transcriptional activity in

sunflower tumors of a series of 5' and internal deletions was achieved by using

a double gene vector containing a reference 780 gene as an internal standard.

Results of the 5' deletions delineated an activator element located -440 and -229

base pairs (bp) from the start of transcription. Removal of this element

resulted in a 100-fold drop in activity relative to wild type. Large scale internal

deletions (38 to 151 bp) occurring in various locations from positions -12 to -348

bp caused significant reductions in the major promoter transcriptional

activity. However, internal deletions starting at position -37 and extending to

-200 bp either had little effect, or increased activity. Removal of the TATA

motif drastically reduced activity to <0.1% of wild type. The activator was

shown to have enhancer-like properties by its position and its stimulation of









transcription in both polarities upstream of a -37 bp 5' deletion 780 gene even

when positioned 538 bp further upstream than its normal location. However,

the activator did not promote detectable levels of transcription when located 3'

to the gene. This element was also shown to specifically interact with nuclear

factors present in sunflower and soybean as determined by electrophoretic

mobility assays and DNase I protection analysis. The upstream sequences (ca.

-330 to -120 bp) of the octopine synthase (OCS) and agropine synthase genes of

T-DNA did not promote efficient transcription when inserted in either

polarity, upstream or downstream of the deleted 780 gene with one exception.

The OCS gene fragment stimulated transcription to 15% of 780 wild type

activity level while in the reverse polarity upstream of the deleted gene. In

conclusion, the 780 gene appears to have a complex promoter structure similar

to animal and viral genes in spite of its bacterial origin and constitutive

expression.

















CHAPTER 1

INTRODUCTION



Historically, procaryotic promoters provided the first evidence of

cis-acting DNA sequences controlling gene expression. Bacterial promoters

have been characterized as regions of DNA that bind RNA polymerase for

specific initiation of transcription (39). The sequences of a multitude of

procaryotic genes are known and generally show two highly conserved

regions 5' to the start of transcription that are involved in control (143). One

of these regions, labeled the "Pribnow box" or the "TATA box," has a sequence

consensus of 5'-TATAATG-3' located at position -10 basepairs (bp) from the start

of transcription. The other control region, known as the "recognition site," is

approximately located 35 bp upstream of the start site. Other sequences

upstream of the recognition site confer a negative or positive regulation in

some genes. Highly regulated transcription usually entails either repressor

proteins binding to operator DNA preventing RNA polymerase from binding,

or an activator protein stimulating transcription by binding to specific DNA

sequences farther upstream and presumably making contact with the RNA

polymerase (62).

Based on sequence comparisons, eucaryotic promoters show some

striking similarities to procaryotic promoters mainly of the "Pribnow box" and

the "recognition site." The conservation of sequence homology in the 5'

flanking region of genes suggests a preservation in the basic mechanisms of

transcriptional control between most organisms. Functional analyses of these









highly conserved regions, as well as other sequences possibly required for

eucaryotic gene expression, can be made by in vitro mutagenesis and using

both in vivo and in vitro transcription systems. Previous testing of promoter

mutations of animal and viral genes has established domains that govern

transcriptional regulation. These domains have roughly been categorized into

three major elements based on sequence, location and function (13, 35, 138).



Promoter Structure of Animal and Viral Genes



The TATA Box

Of the promoter domains of animal and viral genes that are similar to

functional domains in procaryotic promoters, an AT-rich region seems to be

the most highly conserved. This region contains the sequence known as the

TATA box and is usually found approximately 21 to 35 bp upstream from the

start of transcription. Most of the genes sequenced show homology in this

region with a consensus of 5'-TATA(A/T)A(A/T)-3' (13). The TATA box

functions simultaneously in positioning the start of transcription and

maintaining the rate of transcription (35, 154). Using deletion mutants of the

conalbumin and the adenovirus-2 (Ad2) major late genes, this motif was shown

to be required for accurate initiation of transcription (21, 160). Additionally,

the TATA region alone from the Ad2 major late gene (-12 to -32 bp) initiates

specific transcription starting about 25 bp downstream even when cloned in

the plasmid pBR322 (131). Removal of TATA sequences from the simian virus 40

(SV40) early region (97) as well as from the sea urchin histone H2A gene (54)

does not eliminate activity but produces heterogeneous sites of initiation.

However, a single base pair transversion (T to G) at the second T in the

conalbumin TATA box drastically reduces transcriptional activity in vitro










(159). A similar result occurs when point mutations are made in the TATA motif

of the mouse Pmajor globin gene introduced into HeLa cells which reduces

transcription to 25-50% relative to wild type levels (112). The same point

mutations in the globin gene also altered the initiation site. In another study,

Tokunaga et al. (154) demonstrated in vivo the requirement of the TATA box

for specific transcription in the Bombyx mori fibroin gene expressed in

monkey COS cells. An internal deletion (-58 to -20 bp) and point mutations in

the TATA motif drastically affected the transcriptional activity while altering

sites of initiation. Apparently, the TATA box only functions in positioning the

start of transcription for some genes. In other cases, the TATA is required for

normal transcriptional activity as well in the determination of the initiation

site.

Although the eucaryotic RNA polymerases have not been shown to bind

directly to specific regions within the promoter (90), other cellular factors are

able to complex with DNA in the TATA motif and at other 5' control sequences.

The binding of these cellular factors in turn may possibly provide the sites for

eucaryotic RNA polymerase II to interact with the promoter in a specific

fashion. The TATA boxes in the conalbumin promoter and in the Ad2 late

promoter form stable pre-initiation complexes with a HeLa cell factor in the

absence of RNA polymerase II (25). Parker and Topol (121) also demonstrated

binding of a chromatographically distinguishable component prepared from

isolated nuclei of cultured Drosophila Kc cells to the TATA-proximal regions of

the Drosophila histone H3, H4, and 5C genes. Footprint analysis on this

concentrated 70 kD "B factor" revealed the presence of sequence specific

DNA-binding activity to regions which included the TATA box, the start of

transcription and a portion of the leader sequence on these histone genes. The

TATA sequence from a Drosophila heat shock gene, hsp70, can be protected









from exonuclease III digestion between -21 to -41 bp relative to the cap site

with a factor present in Drosophila cell nuclei (171). The author of this latter

study believes that this factor involved with the Drosophila heat shock gene

may bind selectively to heat shock TATA boxes and not to analogous motifs of

other genes which are transcriptionally inactive during heat stress (171).

Based on this assumption, TATA-binding functions may exist as a family of

proteins each recognizing unique sequences surrounding the TATA motif.

Based on sequence analysis, a few animal gene promoters seem to

deviate from the requirement of having a TATA box. Instead of having this

motif, these promoters have GC-rich sequences similar to the GC box of the

SV40 upstream element (see below). These unique promoters direct

transcription of genes generally involved with purine and pyrimidine

metabolism such as hypoxanthine phosphoribosyl transferase (104), mouse

dihydrofolate reductase (dhr) (101, 132), and hamster

hydroxymethylglutaryl-coenzyme A reductase (124) and are generally

thought to be constitutive in their expression. Since these genes lack the

TATA motif, an alternate method of positioning the start of transcription may

exist possibly involving the GC sequences. The GC-rich sequences of the dhr

gene also interact with specific factors which may play a role in specifying

the site of transcriptional initiation together with maintaining the

constitutive level of expression (33, 40).



The Upstream Element

Based on promoter mutation studies and the presence of conserved

groups of sequences, a region of the 5' flanking sequences in animal and

viral genes between -40 to -110 bp from the start of transcripton is defined as

the "upstream element" (30, 103, 112). Five different consensus sequences,









including the CAAT box, have been found to be individually present within

this element (38). In addition, various promoters appear to have different

combinations of one or more of these subelements present within the

upstream element. Many genes require the upstream element for active

transcription since deletions or point mutations located within this region

often results in a decrease in transcriptional activity (36, 52, 59, 103, 112, 162).

However, point mutations located immediately upstream of the CAAT box in

mouse P-globin (112) and Herpes simplex virus thymidine kinase (HSV tk)

promoter (52) result in a dramatic increase in activity, sometimes as much as

3.5-fold. These particular up-mutations may act by optimizing the affinity of a

transcription factor for this element, or by possibly altering the conformation

of this factor when it is bound to the promoter (52).

The upstream element is not always required for wild type activity of

the promoter since some genes may be expressed at normal levels, or higher,

if the upstream element is removed leaving TATA intact. For example, deletion

of a region from -116 to -61 bp, that includes the CAAT sequences, from the sea

urchin H2A histone gene injected into Xenopus oocytes increase activity

nearly 2-fold (54). In another study where the 5' sequences of the fibroin gene

were removed to position -44 bp with only the TATA motif remaining, normal

rates of transcription in vivo (154) were still observed. Removal of TATA

sequences, however, resulted in a complete loss of transcriptional activity in

this gene. The upstream elements of the human p-globin gene can also be

deleted resulting in normal transcription levels when transferred into cells

that express the Ad 2 viral Ela gene products (53). The effects of

transcriptional activation of the p-globin gene by the Ela gene products seem

to be mediated through the TATA box, since the p-globin gene does not require

the upstream element for activity.










In genes requiring the upstream element for activity, spacing between

TATA and subcomponents of the upstream element is somewhat inflexible for

optimal promoter expression. For example, the promoter of HSV tk gene

contains three regions important for transcription (102). Two of these regions

constitute the upstream element and are designated ds-1 and ds-2. while the

third region designated ps includes the TATA box. When 6 bp are removed

between pa and ds-1, the level of transcription drops to 10-20% of wild type

activity. However, 9 to 30 bp can be inserted between p.S and ds-1 without

adversely affecting transcription. Increasing the distance between the

upstream element and TATA also reduces promoter activity level, since the

introduction of more than 30 bp results in less than 10% activity. The spacing

between ds-. and ds-2 is much less flexible in that only 10 bp can either be

inserted or removed between these two sequence motifs without resulting in a

decrease in activity. Stringent spatial requirements are also seen in the

organization of the upstream element of the rabbit P-globin promoter in

which only 10 bp insertion or deletions between two upstream element

consensus sequences (the 5'-GCCACACCC-3' positioned at -90 bp and the CAAT

box at approximately -75 bp) are tolerated without substantially affecting

promoter function (30). It can be argued from these results that these three

subelements of the HSV tk and the rabbit P-globin promoters bind factors and

allow the factors to interact with each other directly, since removal or

insertion of sequences between the binding sites would either crowd or

separate these factors from optimal contact and eliminate activity.

Cochran and Weissmann (19) examined the interchangeability of

upstream elements and TATA boxes between rabbit P-globin and HSV tk

promoters. Fused tk-p-globin promoters were analysed by quantitative S1

nuclease mapping. Activities of mosaic promoters which included the P-globin










TATA and the tk upstream element had relatively high activities. Promoters

that included the tk TATA sequence with the P-globin upstream element alone

or together with the tk upstream element, however, resulted in low expression

levels. Based on these results the P-globin TATA sequence seems to show no

particular preference for upstream elements for maintenance of normal

transcription levels. The tk TATA sequence may otherwise be of a specific

nature and require its own upstream element to achieve wild type levels of

activity.

Like the TATA box, the upstream elements of many genes also interact

with specific nuclear factors (35, 49, 58, 71, 112). The HSV tk, human P-globin

and mouse al-globin gene CAAT boxes interact specifically with a cellular

factor present in nuclear extracts of HeLa cells, and at least for the tk

promoter, the factor stimulates in vitro transcription (20, 34). A HeLa cell

factor protects from DNase I digestion a specific region from 16 bp upstream to

9 bp downstream of the HSV tk CAAT box and 17 bp upstream to 6 bp

downstream of the murine sarcoma virus LTR CAAT box (52). Another

previously purified transcription factor known to interact with a subelement

of the upstream element, the GC box, is the Spl factor obtained from cultured

human cells (34). This factor binds specifically to the hexanucleotide sequence

5'-GGGCGG-3' (GC box) which can be found in the upstream elements of several

genes including the SV40 early promoter (34), the HSV early gene 3 (70), the

HSV tk gene (71), the human metallothionein-IA gene (125), and the rat type II

collagen gene (80). The Spl factor has been shown to be required for specific

in vitro transcription of the SV40 early gene (34). The GC box of the chicken

5-crystallin also seems to bind specifically to an Spl-like factor in vivo (58).

Expression of the 5-crystallin promoter can be reduced when it is coinjected

into mouse lens epithelial cells with either the sequences of the SV40 21 bp










repeats, or with the part of the promoter of the HSV tk gene that includes the

upstream element. This reduction in promoter activity is presumed to be due to

competition for nuclear factors (58). Clearly, the upstream element and the

TATA box determine transcriptional levels by interaction with specific

nuclear factors.



The Enhancer Element

The third subdivision of eucaryotic promoter elements, designated

enhancers, (6, 160) are usually 100-200 bp in size and stimulate transcription

of heterologous promoters. These promoter elements function bidirectionally

and can operate over a considerable distance. This enhancer effect was

discovered by two groups, Banerji et al. (4) and Moreau et al. (108) and then

later seen by Fromm and Berg (46). As an example of enhancer activity, the

far upstream sequences of SV40 stimulate transcription of a linked p-globin

gene in vivo by more than two orders of magnitude in both polarities and over

distances of more than 3000 bp, even from a position downstream of the gene

(4). Transcriptional control elements with the same characteristics were later

found in other viruses and cellular genomes (29, 93, 94).

The SV40 enhancer is the best characterized of the many known

enhancers. This enhancer element contains two separate domains, "A" and "B,"

which are within a 72 bp repeat that is located in the promoter/regulatory

region of the early and late genes (176). The 72 bp repeat sequence contains

both a core consensus homology found in other viral and cellular enhancers

consisting of the sequence 5'-GTGG(A/T)(A/T) (A/T)G-3' (163) in addition to

stretches of alternating purines and pyrimidines (115). Maximal enhancer

activity is acheived when domain "A" is stereospecifically aligned with the 21

bp repeats of the SV40 upstream element suggesting that the different factors










present along one side of the DNA helix interact by direct contact (151). This

enhancer also acts in a constitutive rather than a tissue-specific or

developmentally controlled manner in a wide variety of animal tissues and

hosts (84, 85, 115).

The SV40 enhancer has been shown to activate a variety of heterologous

promoters (4, 46, 108, 156) and will also initiate transcription without the

apparent presence of any other promoter element (42). Insertion of the 72 bp

repeat in either orientation immediately upstream of a conalbumin promoter

(fused to the SV40 early gene coding region) promotes transcription starting

at the cap site (161). Interestingly, when a 275 bp fragment from pBR322 is

inserted between the SV40 enhancer and the -102 to +62 bp conalbumin

promoter, transcription is initiated at a 27-31% activity level within the pBR322

sequence 40 bp downstream of the enhancer. In this construction, the SV40

enhancer also initiated faithful transcription at the cap site of the conalbumin

promoter, but only at an 8% activity level. The pBR322 sequence upon

inspection does not show any TATA-like motif, suggesting that the SV40 72 bp

repeat can initiate RNA transcription from TATA-dependent as well as

-independent start sites.

The SV40 enhancer demonstrates preference for the most proximal

promoter when it is present on the same DNA molecule with more than one

gene. Preferential activation of proximal promoters is demonstrated by the

placement of two conalbumin promoters tandemly downstream of the SV40

enhancer (161). The enhancer activates transcription of the proximal

conalbumin promoter to 60-80% activity while the distal promoter is only

stimulated to 4-7% activity when compared to a single conalbumin promoter

downstream of the enhancer. Kadesch and Berg (72) also observed similar

results by inserting the 72 bp repeat of SV40 in various locations relative to










three distinct coding regions fused to truncated SV40 promoters. One of these

coding regions, the xanthine-guanosine phosphoribosyl transferase gene

(XGPRTase), was assayed for activity in CV-1 cells to determine positional

effects of the SV40 enhancer on this gene. With the enhancer element in the

5' position, the proximal fusion gene was transcribed efficiently, whereas the

activity of the distal gene, present further downstream, was reduced. Adhya

and Gottesman (1) also observed this effect and named it "promoter occlusion."

They suggested that the RNA polymerase II transcribing through the

downstream promoter may interfere with the promoter's activation.

Another phenomenon designated as "enhancer dampening" is observed

when the SV40 enhancer is positioned between two tandem genes which are in

the same polarity. The level of activity of the upstream gene (XGPRTase) drops

3-fold compared to the activity observed when the XGPRTase gene is present

with the enhancer sequence downstream alone (72). A possible explanation

for these effects of promoter regions preventing the enhancer from affecting

distal promoters is that these promoter regions might block a bidirectional

movement of RNA polymerase II or other transcriptional factors binding to

the enhancers (72). Another explanation is that the promoters of these two

genes compete for the same set of enhancer related factors.

Some enhancer elements can function in a tissue-specific manner, such

as those found in the mouse and human immunoglobulin heavy (38) and K

chain genes (7), the rat chymotrypsin (158), and insulin genes (158), the

human type I keratin (96) and albumin genes (119), and the long terminal

repeats of the Maloney murine sarcoma virus (85). A region of the insulin

promoter from -100 to -400 bp relative to the cap site promotes the expression

of the SV40 T-antigen only in the pancreatic islets of Langerhan P3 cells (158).

The enhancer of the mouse polyoma virus, a papovavirus like SV40, shows










distinct host-cell preference being approximately four times as active in

mouse cells than in primate cells, unlike the SV40 enhancer which promotes

transcription equally well in both hosts (28). The immunoglobulin enhancers

also direct transcriptional activity in lymphoid B cells early in differention,

but once established, the enhancer sequence becomes dispensible (79).

Enhancers as a class, therefore, seem to exert a continuum of specificity with

regard to function, from the constitutive action of the SV40 enhancer to the

highly specialized activation of transcription by enhancers associated with

genes under stringent developmental and environmental control.

Some promoter elements do not seem to fit neatly into the classes

discussed so far. Promoter elements possessing some enhancer-like qualities of

bidirectionallity and limited spacing flexibility exist in several inducible genes

such as the mouse metallothionein gene (MT-1) (74), heat shock genes (76),

and the p-interferon gene (47). These enhancer-like elements are found in the

region regarded as the upstream element as well as in various TATA-distal

positions. Searle et al. (135) were able to demonstrate that promoter strength

depended on the number of copies of the metal responsive element (MRE)

sequences present in the 5' flanking region of a heterologous gene. They

placed the MT-1 MRE sequence (5'-CCTTTGCGCCCG-3') in various locations and

polarities within the HSV tk promoter and examined the regulation of

induction by the addition of zinc. At least two MT-1 MRE's were required

regardless of position or orientation to obtain low induction, but this induction

was significantly increased when the elements were placed in the

TATA-proximal position. The level of inducibility could be increased by

incorporating more copies of this element into the tk promoter. In another

study, heat shock consensus elements (HSE) of the Drosophila hsp70 gene were

inserted in multiple copies into the promoter of a heme-inducible yeast gene









(CYCI, iso-1-cytochrome c [88]) increasing the level of heat inducibility

greater than 100-fold (162). The orientation of the HSE's in CYC1 promoter did

not affect the overall level of heat induction but adding more elements

increased the inducible activity. Although MRE's and HSE's have the ability to

activate heterologous promoters and function bidirectionally, they do not

efficiently promote transcription while 3' to the gene.

Enhancers often seem to utilize a repetition of sequence motifs to

activate transcription. Although enhancer elements of various viral and

cellular types do not show any obvious repeats (29, 85, 139), obscure sequence

redundancy may be present. A 74 bp region of the SV40 enhancer which

includes portion of one of the 72 bp repeated sequences as well as some

nonrepetitive upstream sequences can activate the SV40 early gene

transcription (42). However, within this 74 bp region there are several

shorter sequences which may provide the enhancer with necessary repetitive

domains to promote high gene expression levels. Deletions of one of these

shorter repeats does indeed eliminate activity. The SV40 enhancer can also

activate transcription even more efficiently when the 74 bp sequence is

repeated and in the presence of the upstream nonrepeated sequences (42, 176).

To demonstrate the affect of duplicating sequences on activity, a truncated

SV40 enhancer having reduced stimulatory effect was dimerized in vitro and

transfected into COS cells resulting in restoration of transcriptional activity

(28, 85). In another example, severely deleted enhancers fused to the

chloramphenical acetyltransferase (CAT) coding region were introduced into

COS cells and under selective pressure with chloramphenicol the deleted

enhancers were duplicated in vivo (61). This in vivo duplication of the

enhancer region in response to selective pressure suggests that the

redundancy of this element plays a role in normal enhancer function.










Just as the other eucaryotic promoter elements were shown to bind

specifically to transcriptional factors, enhancer sequences were likewise

demonstrated to interact with trans-acting factors. Since some enhancers

mediate tissue-specific and sometimes host-specific control, cell-specific

factors seem to be involved. Sch6ler and Gruss (134) demonstrated factor

interaction with enhancer DNA of an SV40/CAT fusion gene using a

competition assay. They reported a reduction in activity of this gene when

competed with normal SV40 enhancer sequences, but found no reduction in

activity when competed with DNA fragments containing the 21 bp repeats, the

TATA box or transcriptional termination signals of SV40. This indicates that

the enhancer specifically interacts with cellular factors which are required

for the activation of the SV40/CAT gene and that the presence of this factors)

is in limited amounts within the cell.

Other groups have reported transcription factors binding to cellular

enhancers such as those from the immunoglobulin heavy genes (IgH) and the

K chain genes (38, 137, 147). Mercola et al. (105) demonstrated by using

competition assays that factors from lymphoid B cells bound specifically to the

IgH enhancers, and that in vivo these enhancer sequences could compete with

the SV40 enhancer for trans-acting factors. Common or closely related factors

seem to interact with both of the IgH and SV40 enhancers since these

enhancers have homologous sequences. Extracts from lymphoid B cells protect

different regions of the mouse IgH enhancer DNA from in vitro DNase-I

digestion when compared to extracts from HeLa cells (3). The mouse IgH

enhancer can also efficiently activate the Ad2 major late promoter in vitro in

the presence of lymphoid B cell extracts. These results suggest that the

lymphoid cellular factors) binds to different regions of the IgH enhancer

than the HeLa cell factors.









Heat shock elements also interact with a specific transcription factor

which is activated when thermally induced (121, 155, 170). Based on

exonuclease protection analyses, a region from -91 to -52 bp of the Drosophila

hsp82 gene is protected from digestion when in the presence of extract from

heat-shocked Drosophila cells (169). The Drosophila heat shock transcription

factor (HSTF) binds to three domains upstream from the TATA on the hsp70

gene (170). Two of these binding sites occur within the region from -100 bp to

the cap site and coincide with HSE's. Both HSE's are required for in vitro and in

vivo transcriptional activation (162). This factor first occupies the

TATA-proximal HSE which in turns facilitates the cooperative binding of a

second HSTF to the TATA-distal HSE. The cooperative binding to the second site

has been suggested to serve as the molecular switch that activates the hsp70

gene (32). Shuey and Parker (141) demonstrated that a subset of protein-DNA

contacts between the HSTF and the first HSE changed upon the binding of a

second HSTF to the neighboring HSE. This change in the protein-DNA contacts

suggests that a conformational change in the protein-DNA complex occurs.

Part of this conformational change may involve bending of the DNA by

interaction with the second HSTF protein (142). This bending of the DNA, upon

binding of a regulatory protein, may be a general phenomena in the

interaction of dimer proteins to DNA, since the catabolite activating protein of

Escherichia coli also causes a bend or kink in the lac promoter DNA (172).

To summarize, three major subdivisions of promoter elements in animal

and viral genes have been discussed and their specific function examined. The

TATA element has an important role in governing the start of transcription

and is essential in most cases for normal activity. The second region of a

typical promoter, the upstream element, is also essential for activity in most

genes. This element must act in close proximity to the TATA box, and with some










examples the subelements within the upstream element can be oriented in

either direction. The enhancer comprises the third class of regulatory

components within eucaryotic promoters playing an active role in

establishing tissue-specificity, cell-cycle control or simply constitutive

expression. Enhancers have the ability to activate heterologous promoters in

either polarity, 5' or 3' to a gene, over large distances. A class of enhancer-like

elements exist in many inducible genes having a combination of

characteristics from the upstream element and enhancers. These elements,

unlike true enhancers, require specific TATA-proximal locations (at least for

one of the repetitive elements in a promoter) but can activate heterologous

promoters in either orientation. The sequence elements responsible for heat

shock and heavy metal activation fall into this intermediate class, and seem to

activate transcription best in multiple copies. Specific nuclear factors also

play an important role by interacting with all of these promoter elements and

controlling the transcriptional machinery in a very specific manner.



Plant Promoter Structure



Information regarding the functional domains of plant promoters is

scarce, and the basis of delineating these domains is mainly dependent on

sequence homologies to analogous domains of animal genes. Many plant genes

have been sequenced and show evidence of conservation of promoter domains

when compared to the animal promoters. Direct testing for the functional

importance of such domains has been done to a limited extent by in vitro

mutagenesis and introduction of mutated promoters into plants using a variety

of methods including: the transformation of plant protoplasts with naked DNA;

by natural infection routes either with plant virus such as the brome mosaic























n0 0








r- '
- -


I I
96


0


0
CCA
Cu C,
CA t-

. 0. o>

0 0
E -
a al BQ tn e


CIu
3 M S
!- 2 M sda.
3^


o
o
I-
C,


0
"5
.o





in
i-~o


U U


2 .,
S04
C2 Z











z z
Is *. S
4-ci 4 -


o
a,

0 o




In -
+N


Cu
- I

*S 2
I..-
cu


U U U


M el Wi


66
\OI


s i


(,


+


C
-

00


o


+ o



2o
O)'
r'"


- C
.-





0 ,
^S^

2^"r


oo


Z-o




I 1






























4)
U,
Cu
4)~

0 :
00
0a

0I:
0~


+





,Is


Ui


CM1









Cu
CIV






















C..


4)
0
+2
4) '
Oc?





















Cu
,
.-

!


CuU,
4).
Cu
d .


..
o















cz
















0 0
oo





r,



t
C a









w o

















S2,
S ^



ea
Sn






1^1,

I~Ei
5-^ >
Eg *
mr


4)
Q- =

1L. 0 l-
LOp
o 0-o











occ
sa a
C0 u



co)
4) -^ >i 4) -
Q. eg-


z 2
Cu -
3 Cu$
v

























co~
ZEt*
U, o



















ao a a
S0 '- .























5 y w
,aa,


























ca .Sc
amca
O Cu
O
-10 -g2



0< S .
cu
Cu

^^s E=


C-,C




0U0
U~,
^So^
a-s





4)Z


Q.C Q.#
C4)0,




.-
c --











<3 4) *0
U,4)


u4 O) 4)
.2o=







VI-







U, Cu -
U Qe 5
V l IU S
u-S ^
?
<- t- b
a c o &
Cl x: a
2C .
2 g^
^ ? .
<3f S *>C
"S Ot "
0 t eS3 l
^ i
L c0

?-, c =


s~cj


z


c0.. Cum
sL .
1"
S E R




E









virus (45), or with Agrobacterium tumefaciens T-DNA based vectors (65, 114).

Table 1 summarizes most of the studies involving plant promoter mutations and

the assessment of these gene activities in either callus tissue or regenerated

plants. With few apparent exceptions, the overall promoter structure of

higher plant genes seems to be similar to that of the typical animal promoter.

Therefore, the plant promoter will be discussed within the context of the three

major regulatory domains described above for animal genes.



The TATA Box

As with the animal and viral genes, the TATA box seems to be the most

conserved sequence motif present in plant promoters (10, 16, 77, 86, 89, 117).

By simple inspection, this element can be found approximately 30 bp from the

start of transcription and may therefore function in plants in a similar

manner to its function in animal genes. Mutations within the TATA element of

genes transcribed by plants have been made only in a few cases. An et al. (2)

demonstrated the function of TATA in maintaining transcriptional activity by

creating 3' deletions into the TATA element of the T-DNA nopaline synthase

(NOS) gene from A. tumefaciens. The NOS promoter was fused to the CAT

coding region, incorporated into the T-DNA, and then introduced into tobacco

calli using A. tumefaciens. Based on CAT activity assays, the level of expression

dropped nearly 10-fold when half of the TATA sequence was removed by a 3'

deletion. In another case, Morelli et al. (109) performed 5' deletions on the

ribulose bisphosphate-carboxylase gene (rbcS) of pea to position -35 bp,

keeping the TATA sequence intact, and still retained 18% of wild type activity.

When a further deletion was made removing the TATA box, transcriptional

activity was not detectable. Based on these limited results, this motif does seem










to be required for efficient expression. However, the other role of positioning

the start of transcription has not been directly demonstrated in plants.



The Upstream Element

The most common sequence motif of the upstream element in plants

appears to be the CAAT box which is usually positioned between -50 to -120 bp.

By examination of a variety of plant promoter sequences, none of the other

four consensus sequences present in the upstream element of animal genes

(112) are found in analogous positions in plant promoters. A limited number of

5' deletions in the promoter region of the cauliflower mosaic virus (CaMV) 35S

gene, as an example, reveal some information concerning the function of the

upstream element in plants (117). The TATA box by itself is not enough to

produce detectable amounts of transcripts when the 35S gene is deleted to

position -41 bp. Inclusion of 5' flanking sequences to -105 bp can, however,

maintain approximately 30% of the wild type transcriptional activity. The

sequence between -58 and -105 bp of 35S gene promoter that is necessary for

this low level expression includes a CAAT box and a 16 bp inverted repeat

which shows limited homology with the SV40 enhancer core consensus (51).

The CAAT sequences of the rbcS gene, however, are not necessary for activity

as demonstrated by an internal deletion of this region (109). By removing -56

to -107 bp, rbcS transcription actually increases to approximately 170% of

normal wild type levels. Another internal deletion made by Timko et al. (153)

from -92 to +1 bp of the rbcS gene resulted in no activity. Based on these

observations the sequences around the CAAT box are not required for efficient

light inducible expression, but the TATA box is essential for such expression.

Even though the promoter region of the rbcS gene which includes the CAAT

box was not needed, this gene seems to require other sequences 5'- to TATA for









activity to occur. This would then reflect the situation seen in some of the

inducible animal genes in which short sequence elements are required to be

located immediately upstream of the TATA box (121, 135). Direct demonstration

in plants of a requirement for the presence of an element immediately

proximal to TATA in the region analogous to the upstream element of animal

genes is still needed.

Analysis of the 5' deletion mutations in the promoter of the NOS gene

demonstrated the requirement of sequences upstream of the TATA box for full

transcriptional activity. In one study, Shaw et al. (140) demonstrated that 77 bp

of promoter which only includes CAAT box and TATA was required for wild

type activity when using Kalanchoe tumors and assaying for the production of

nopaline. However, when An et al. (2) used tobacco calli instead, to examine

deletion mutants of the NOS gene, 155 bp of promoter sequence upstream to the

cap site was needed to maintain normal levels of activity. An 8 bp inverted

repeat along with the second part of an 11 bp direct repeat reside within the

sequences between -101 and -155 bp of this promoter. The presence of repeats

in the upstream element region of the NOS promoter is similar to the presence

of repeats (different from those found in the NOS promoter) in the promoter of

the CaMV 35S gene, and suggests that the redundancy of these sequences may

be important for the expression of these two genes.

The opposing results of the two NOS studies may be a preliminary

indication of differential transcriptional activity requirements for different

portions of the same promoter which is dependent on the host plant species.

Another example of differential sequence requirements for expression as a

function of the plant system used can be seen with the octopine synthase gene

(OCS) as demonstrated by Koncz et al. (82). They made 5'-deletions to -292, -168

and -116 bp of the OCS promoter, introduced them into tobacco tissue and










measured OCS activity. The 5'- deletion to -292 bp did not affect expression,

whereas a deletion to either -168 or -116 bp resulted in no activity. This result

does not agree with results of Muria et al. (111) who demonstrated that the

expression levels of the OCS promoter containing only -116 bp (BamHI) fused to

the phaseolin coding region was very high in sunflower plants. Therefore, it

would appear that the requirement of sequences upstream of the CAAT box

differs depending on the host system.



Enhancer-like Elements

Enhancer-like elements are found in two light-inducible tissue-specific

genes of pea, the rbcS (43, 153) and the light harvesting chlorophyll a/b

binding protein (Cab) (145). In the case of the rbcS enhancer-like element, a

240-280 bp region (ca. -330 to -50 bp) imparts light-inducibility as well as

tissue-specificity on both the NOS promoter and the CaMV 35S promoter when

present 5' to the TATA box in either orientation. In another study, however, a

region from -973 to -92 bp of rbcS gene, which includes the enhancer-like

element failed to promote activity in a downstream location of NOS promoter

fused to the CAT coding region (153). The conclusion that the rbcS enhancer

does not function 3' to the gene may not be valid, since this latter construction

might have interfered with poly (A) addition due to the placement of the 881

bp rbcS region between the NOS/CAT gene and its poly (A) addition site. It is

possible that the rbcS enhancer-like region may function normally if it is

placed further downstream of the poly (A) addition site. When assayed in

regenerated tobacco plants, a 247 bp region (-347 to -100 bp) from the Cab gene

also confers light-induction and tissue-specificity on the constitutive NOS

promoter when placed upstream in either orientation. Duplicating this

enhancer-like element increases light induction 2-fold of the NOS promoter in









leaves when compared to a single element. This element is, however, unable to

activate any expression of the NOS/NptII gene while in the downstream

position regardless of orientation. Another interesting effect that this 247 bp

sequence imparts is its ability to silence, in either orientation, the constitutive

expression of the NOS promoter in root tissues. When the enhancer-like

sequence is removed, this promoter is equally active both in leaves and roots

in its normal constitutive manner. Two different properties are inherent

within this Cab enhancer-like element: one involving tissue-specificity, and

the other, its ability to increase activity by the introduction of multiple copies

of the sequence.



Inducible Plant Genes

Many examples of inducible genes exist in plants (43, 57, 69, 87). Some of

these genes contain repetitive elements with enhancer-like characteristics

similar to those found in animal genes. Regulation of thermal inducibility has

been conserved throughout diverse groups of eucaryotes. As mentioned

earlier, heat shock elements (HSE) are small repetitive sequences which

interact with specific factors (155) in animal heat shock genes, and are

responsible for heat inducibility of transcription. The sequences of the

promoters of several heat shock genes from soybean and maize are known (24,

113, 126) and contain 5'-flanking sequences that are similar to the Drosophila

hsp70 gene HSE's. Apparently conservation of other aspects of the thermal

induction system have also been maintained between animals and plants as

demonstrated by Spena et al. (150). In this study the hsp70 promoter of

Drosophila was fused to the NptII coding region and introduced into tobacco

tissue using A. tumefaciens. The fused gene was expressed after heat shock in

75% of the transformed calli. An example of interspecies conservation of the










heat shock response in plants was illustrated by Gurley et al. (55) in which

they introduced a small heat shock gene (Gmhspl7.5-E) of soybean into

sunflower tumors using a Ti-plasmid based vector system and showed a typical

thermal inducible response. Deletions of the 5'-flanking sequences in this

gene to -295 bp still retained 70% of its wild type (-1175 bp of promoter) heat

inducibility. However, deletions to -90 bp sharply reduced the heat-inducible

transcription to approximately 24% of normal levels. There are two regions

between -295 and -90 bp that may be responsible for the loss of activity: an

imperfect dyad/TATA centered at -250 bp which was found in several

Drosophila heat shock genes (149), and a 7 out of 10 bp homology with the HSE

consensus that is partially disrupted by the -90 bp deletion.

The alcohol dehydrogenase gene of maize, another inducible plant

gene, also seems to have a complex promoter structure based on in vivo DNase I

hypersensitivity. A region (-160 to -700 bp) in the promoter of the maize

alcohol dehydrogenase-1 (Adh-1) gene is accessible to DNase I digestion in a

constitutive manner whether or not the maize cells are placed under

anaerobic stress (122). However, another region from -35 to -150 bp is only

accessible to DNase I digestion when anaerobically induced. These DNase I

hypersensitivity sites may be due to preferential change in the chromatin

structure which is induced by anaerobic conditions to allow access of this

region to interaction with factors required for expression.

In another study, Ingersoll, Ferl and Gurley (unpublished results)

demonstrated that the mechanism of anaerobic induction of maize Adh-1 is

conserved in heterologous plant species. They introduced the Adh-1 gene

including approximately 1100 bp of 5' flanking sequences into sunflower

tumors incited by A. tumefaciens and observed expression specifically

inducible by anaerobic stress. They also demonstrated that this induction could










still occur, albeit at very low levels, with only -145 bp of 5'-flanking sequence.

It seems plausible that a region of the Adh-1 promoter upstream of position

-145 bp may be required for high levels of expression only, and that the

TATA-proximal sequences are required for the anaerobic induction.

Demonstration of any enhancer-like elements similar to the MRE's or HSE's

which can anaerobically induce Adh-1 gene awaits the results of further

studies.



T-DNA of A. tumefaciens

The T-DNA which resides on the tumor inducing plasmid (pTi) of A.

tumefaciens, is transferred and randomly integrated into the plant genome

upon wounding. Expression of phytohormone-producing T-DNA genes then

induces crown gall formation (for review see 114). The opine synthases are

also encoded on the T-DNA, and are involved in the production of opines

(usually condensation products of certain amino acids and sugars) which

supply the Agrobacterium with a carbon and nitrogen source (123). The

strains of A. tumefaciens and the tumors they can incite are categorized

according to the type opine (for example, octopine, nopaline, agropine, ect.)

produced in the tumor tissue (22).

In plant tumors incited by some octopine producing strains of A.

tumefaciens, the T-DNA is separated into two parts, T-left and T-right (Fig. 1-1).

T-left encodes phytohormone biosynthetic genes as well as the octopine

synthase (OCS) gene, while T-right only seems to encode opine synthases (37,

118). Three genes are responsible for phytohormone production: 1, 2, and 4.

Genes 1 and 2 are involved with auxin biosynthesis, while gene 4 is involved

with cytokinin biosynthesis (14, 157). All three are responsible for tumor

formation. Gene 2 which encodes a tryptophan-2-monooxygenase shows


















T-L

5 7 2 1 4 6 OCS


T-R

4' 3' 2' 1' 0'
-1ho -&bd- --h 46--


8 17a 2
18c 22 1 II
A F B I E C D


pTi15955


780 (4 1050
S----780 (4') 1050


Eco R1 C
Sph I b d


(3') 1450 (2')
-~ 4---& ............


HincII


Figure 1-1. T-DNA restriction enzyme map of pTil5955. The restriction
sites are based on the sequence of Barker et al. (5). Arrows denote the position
and polarities of the transcripts present in T-left (165) and T-right (128). The
EcoR 1-SphI fragment containing the 780 gene was used in this study.
Designations 1050 and 1450 correspond to transcripts 3' and 2' in T-right.


Bar HI
HindIII
Eco R1









significant sequence homology with the indoleacetamide hydrolase gene

(iaaM) of Pseudomonas savastanoi (173). Amino acid residues 239-263 of the

gene 1 protein show a high degree of homology to the adenine binding site

(amino acid residues 5-29) of the Pseudomonas fluorescens p-hydroxybenzoate

hydroxylase. The homology with genes from Pseudomonas, and the fact that

some of the T-DNA genes are also expressed in A. tumefaciens (114) suggest

that T-DNA genes may have an ancestrally bacterial origin.

The complete sequence of the T-DNA from an octopine-type pTi15955

strain is known (5), and indicates 26 open reading frames of longer than 100

amino acids in the T-left and T-right. Only 12 of these open reading frames

correspond to those genes known to be transcribed in plants (56, 110, 167).

Most of these plant-transcribed genes have characteristics of eucaryotic genes

transcribed by RNA polymerase II. These include the TATA sequences and

CAAT box motifs upstream from the start of transcription and poly (A) addition

signals beyond the stop codon. There is no evidence that any T-DNA genes

contain introns (110, 166, 167).

The genes present on the T-DNA are transcribed in plants in moderate to

low abundance representing less than 0.001% of the total poly (A) RNA of the

tumor cells (166). T-DNA genes are usually thought to be expressed in a

constitutive manner regardless of the plant tissue (11, 67, 120). However, gene

5, the left-most gene on T-left, may be expressed in a tissue-specific manner

(81) even though the results of the gene 5 studies are unclear. The opine

levels from the gene 5 promoter/OCS coding region fusion gene appears to be

expressed at the highest levels in callus tissues and in stems of transformed

tobacco plants and are barely detectable in fully developed leaves. The

expression of this fusion gene in matured leaves is fully restored when leaf

sections are incubated on a high auxin, low cytokinin medium. On the other









hand incubation of callus tissue on high cytokinin, low auxin medium results

in a decrease in activity of this gene. These results suggest that the product of

gene 5 is produced only in tissues having a high level of internal auxins

relative to the level of internal cytokinins (81). Alternatively, since transcript

levels were not directly assessed, these results may only reflect the

differential availability of opine precursors in the various tissues after

various hormone treatments.

Agrobacterium has a very broad host range with tumor formation

observed on at least 643 host plant species including 310 genera of

dicotyledenous plants, 4 families of monocots and 43 species of gymnosperms

(26, 64, 136). In order to incite tumors, the T-DNA genes must be expressed to

some degree and therefore the promoter sequences of these genes must

contain elements which are conserved throughout most of the plant kingdom.

A T-right gene from pTi15955 used in this dissertation was designated as

the 780 gene since the corresponding transcript is approximately 780 bases in

length (73, 168). Previous studies on the 780 gene include an approximate

determination of the start of transcription (168) which placed it approximately

30 bp upstream of the first methionine residue. The abundance of the 780 gene

transcripts in poly (A) RNA from the tobacco tumor line El, as analyzed on

northern blots, was much higher than that from poly (A) RNA from the

sunflower tumor line, PSCG-15955. This differential abundance is probably due

to the greater copy number of T-right present in the genome of El tumor

tissue. Karcher et al. (73) reported that this gene was trancribed about as

equally well in both tobacco (E9) and sunflower (S4-2) tumor tissue culture

lines at levels much higher than the other T-right genes. They observed

differences of the relative level of 780 transcripts in other tobacco and

sunflower calli. The 780 gene, therefore, seems to be expressed at fairly high









levels in at least two plant species. Due to the lack of definitive information to

the contrary, the 780 gene promoter is assumed to be constitutive in its

expression.

The function of the 780 gene as yet is still unknown. Transposon Tn5

insertions in four locations within and upstream from the 780 gene do not

affect the production of agropine and mannopine in callus tissue (128). The

oncogenic properties of the octopine Ti plasmids and the transfer and

integration of T-left and T-right are unaffected by mutations in any of the

T-right genes. The same T-right mutations also do not affect excretion of

mannopine or agropine since opines are detected in the media of the tumors

involved including a tumor line in which T-left is deleted (128).

Since little is known concerning constitutive plant promoters, a

characterization of the functional domains of the 780 gene promoter is of

particular importance. The compact nature of the T-DNA genes and the

availability of the 780 gene make it amenable to promoter studies in plants. In

order to identify DNA sequences involved in the transcriptional expression of

the 780 gene, 5' and internal deletions in the promoter were made, and then

introduced into sunflower seedlings using a Ti plasmid vector system

developed for this study. The level of transcription for each promoter mutation

was accurately determined using a homologous reference gene as an internal

standard which is similar in principle to that developed by McKnight and

Kingsbury in the analysis of linker scan mutations of HSV tk gene (103). From

this analysis, three functional domains within the 780 promoter were

identified. One of these promoter domains seemed to have some of the

characteristics of an enhancer and was designated as an activator element.

The activator was further analysed for enhancer-like characteristics by

testing fusions with the 780 gene TATA on a reference gene vector. A final






29


study was also made to detect interactions of transcriptional factors present in

crude nuclear extracts with the activator.

















CHAPTER 2

PROMOTER MUTATION ANALYSES





Introduction



A T-DNA gene was used as a model for identifying sequences required

for constitutive transcriptional control in higher plants. The effects of

modified 5'-flanking regions of the 780 gene on transcription was assessed in

vivo using the natural transformation scheme of A. tumefaciens. A Ti plasmid

based vector system was first developed in order to transfer this gene into the

genome of a host plant. This vector system involved the construction of a

double gene shuttle vector which contains two copies of the 780 gene. One of

these copies was a mutated test gene while the other acted as reference; both

integrated into the T-left DNA of a strain of A. tumefaciens 15955 which had its

endogenous 780 gene deleted. The start of transcription was then accurately

determined to the nucleotide. The test gene could also be distinguished from

the reference gene by S1 nuclease mapping using a single end-labeled DNA

probe.

The 5'-flanking region of the 780 gene was altered by a series of 5' and

internal deletions or substitutions. The effect of these mutations on

transcriptional activity in sunflower tumors was assessed by S1 nuclease

protection analysis directly utilizing the homologous reference gene as an

internal standard. Results from assays conducted at different times were









comparable, since both test and reference transcripts could be detected using a

single end-labeled DNA probe. In other plant promoter mutation studies

including those using the CaMV 35S gene (117), the rbcS gene (109), and the

chalcone synthase of A. majus (75), heterologous reference genes were used to

directly assess transcriptional activity (see Table 1-1). However, the present

study was the first to utilize a homologous gene for an internal standard

eliminating any possible discrepencies due to differences of test and reference

promoters.



Materials and Methods



Removal of the 780 Gene from pTil5955

The endogenous 780 gene of A. tumefaciens 15955 (strr) was removed

from T-right in order to facilitate the analysis of mutated 780 gene promoter

constructions introduced into T-left. The T-right deletion mutant of A.

tumefaciens was designated as Ag5260. The 4.7 kbp XhoI-HindIII fragment

(15,208 to 19,953 bp, [5]) containing the 780 gene (ORF 18), the 1050 (ORF 21),

and most of the 3' end of the 1450 gene (ORF 24) (5, 168) was replaced with a 1.5

kbp XhoI-HindIII fragment from the transposon Tn5 (127) which confers

kanamycin resistance (Fig. 2-1). The substitution of the T-right fragment was

achieved by the double homologous recombination procedure described by

Matzke and Chilton with some modifications (98).

This double homologous recombination event utilized a broad host range

vector containing T-DNA fragments and the Tn5 fragment, and was

constructed as follows. The BamHI-XhoI (13,774 to 15,208 bp, [5]) and

HindIII-EcoR1 (19,953 to 21,631 bp, [5]) fragments from T-right that flank the

4.7 kbp XhoI-HindIII region in T-right were ligated into the broad host range



















T-R

780 1050 1450 1650 1550
-4 --- ----- -0----- ----


I E I C I D
E C =


x


x



SKanr


I I
H H

/
__-


E' C' D


Figure 2-1. The removal of the 780 gene from the T-DNA of pTi15955.
An EcoR1 map of T-right from pTi15955 is shown at top with the arrows
denoting the positions and directions of the transcripts (73, 168). The natural
copy of the 780 gene was removed by replacing the 4.7 kbp XhoI-HindIII
fragment from the T-right DNA with a 1.5 kbp XhoI-HindIII kanamycin
resistant fragment (solid black) from the transposon Tn5 as described in
Materials and Methods. Kanr, kanamycin resistant gene; X, XhoI; H, HindlII.


T-L

.1111..........-


Eco R1









plasmid pRK290 (31). The 1.5 Sall-HindIII Tn5 fragment was then inserted

between the two fragments resulting in plasmid pKn306 (Fig. 2-2). Escherichia

coli LE392 harboring pKn306 was grown overnight at 370 C in Luria broth (LB)

containing tetracycline (tet) (12.5 tg/ml) and kanamycin (kan) (50 gpg/ml).

The overnight culture (1 ml) was pelleted in a 1.5 ml microfuge tube. The cells

were washed with fresh LB to remove antibiotics and finally resuspended in 1

ml of LB. A portion of this suspension (200 l1) was mixed with an equal volume

of similarly treated E. coli LE392 harboring pRK2013 that was grown

overnight at 280C in LB containing kanamycin (50 g.g/ml). The recipient, A.

tumefaciens 15955 (strr) was also grown overnight in LB containing

streptomycin (250 .gg/ml), washed with 1 ml of LB and 200 pl. of this overnight

growth was mixed with the two E. coli culture mixture. The plasmid pRK2013

encodes conjugal transfer functions which facilitate the transfer of pKn306 to

A. tumefaciens. The bacterial suspension was spotted on an LB plate and

incubated for 48 hours at 280C. The cells were resuspended in approximately 2
ml of sterile 10 mM MgSO4, and 200 l.1 of this suspension was mixed with 300 p.1

of an overnight growth of E. coli SK1590 harboring the plasmid pPH1JI genre )

(8). This mixture was spotted on another LB plate and incubated at 28C

overnight. The pPHIJI plasmid is incompatible with pKn306 and its presence

allowed selection for the loss of the plasmid pKn306 after recombination with

the Ti plasmid. After resuspension of the conjugated cells in 2 ml of sterile 10

mM MgSO4, they were plated on AB minimal media (18) containing

streptomycin (250 u.g/ml), kanamycin (20 utg/ml) and gentamicin (100 gpg/ml).

Individual colonies were picked after incubating 3 days on selection plates at

280C, screened with the 3-ketolactose test for the presence of A.tumefaciens (9)

and then rescreened for sensitivity to tetracycline at 5 gg/ml. A.tumefaciens

colonies that were strr, kanr, and tets should contain the kanr gene present on













eX pKn306
tet r, kan


X A.tumefaclens
strr


1. Triparental Conjugation


pTi15955


2. Homologous
Recombination


\ tet r


4. Selection for Double
Recombination
pPH1JI


str r kan r, genr, tetr
cointegration


3. Introduce plasmid pPHIJI
4 ---H (gen r


str r kan r gen r, tet s
double


recombination


Figure 2-2. Double homologous recombination event. (1.) A triparental
mating involving two E. coli hosts harboring the plasmids pKn306 and
pRK2013 separately and the A. tumefaciens strain 15955 results in a transfer of
the pKn306 into the A. tumefaciens. (2.) The homologous recombination
occurred between pTi15955 and pKn306. (3.) After selecting for streptomycin
(strr), kanamycin (kanr), and tetracycline (tetr) resistances, the plasmid
pPHIJI (genr)was then introduced into the A. tumefaciens containing pKn306.
(4.) Subsequent selection for streptomycin, kanamycin and gentamicin
resistances as well as tetracycline sensitivity (tets) distinguishes colonies that
resulted in the double recombination from those that the pKn306 just
cointegrated into the Ti plasmid.









the Ti plasmid with subsequent loss of the remainder of the pKn306 plasmid

(loss of tetr). Four tets colonies were picked and grown overnight in LB with

streptomycin ( 250 jig/ml) and kanamycin ( 20 jg/ml) for subsequent analysis.

The Ti plasmid from these four transconjugants was isolated

using a small scale DNA preparation described by Casse et al. (15). The

resultant DNA was separated on a 0.7% agarose gel which was then treated with

a 2% HCI solution for 15 minutes at room temperature. The gel was washed with

distillled H20, and the DNA was then denatured and transferred to a

nitrocellulose filter paper as described by Southern (148). Two different nick

translation probes were prepared (95): one from the EcoR1-HindIII fragment

containing the 780 gene, and the other from the plasmid (pKS-4, gift from D.

Sutton) that contains the Tn5 SalI-HindIII fragment conferring kanamycin

resistance. Both of these probes were hybridized as previously described (55)

to duplicate Southern blots to confirm the double homologous recombination

event.

The Ti plasmid resulting from this recombinational event lacks the left

border sequence of T-right, the genes corresponding to the 780 and 1050

transcripts, and most of the 3' terminus of the gene encoding the 1450

transcript. Plasmid pPHIJI, residing within Ag5260, seemed to interfere with

the introduction of shuttle vectors, and was therefore removed by a

carbinicillin-cycloserine enrichment procedure (107). This mutant, A.

tumefaciens Ag5260, was used as the recipient for shuttle vectors containing

various constructions of the 780 gene.


Construction of the Intermediate Shuttle Vector Containing the 780 Reference
Gene

The 780 gene was initially subcloned from plasmid p403 (56, 110) by

ligation of the isolated EcoR1-SphI fragment (16,202 to 17,601 bp, [5]) into









pUC-19 (116). The resultant plasmid, designated pUC-19:780, contained the

complete gene consisting of approximately 200 bp downstream of the poly (A)

addition signal, the protein coding region (138 amino acids), and 476 bp of

5'-flanking sequences.

For precise quantitation of the activity of the promoter mutants, a

reference gene was constructed and cloned into the shuttle vector, pW9, as

shown in Fig. 2-3. The plasmid pW9 contained a 4.2 kbp BamHI-SphI fragment

of T-left (pTi15955) from p233G (55) inserted into the E. coli plasmid, pACYC184

(16). The T-left fragment provided the site for homologous recombination of

the shuttle vector into the Ti plasmid of A. tumefaciens Ag5260. The reference

gene consisted of the 780 gene with 290 bp of 5'-flanking sequences and an 8

bp internal deletion in the untranslated leader sequence resulting from the

removal of a TaqI fragment. The -290 bp 5'-deletion mutant was used to

eliminate other upstream TaqI sites that would interfere with the construction

of the reference gene. The intermediate shuttle vector, designated as pW9-TD,

was completed by cloning the SalI-SphI fragment containing the reference

gene into pW9.



Promoter Deletion and Duplication Mutants.

A series of 5'- and 3'-deletions covering the 5'-flanking region were

obtained as outlined in Fig. 2-4. For 3'-deletions the EcoRl site was changed to

BamHI by linker addition (95). Plasmid pUC-19:780 DNA (5 gg) was linearized

either by EcoR1 (for 5'-deletions) or HincII (for 3'-deletions) and subsequently

digested with the exonuclease Bal 31 (Bethesda Research Laboratories) in a 50

tl reaction at 50 units/ml. The reactions were terminated by adding 1/10

volume of 0.2 M [ethylene-bis(oxyethylene-nitrile)] tetraacetic acid (EGTA,

Sigma). Following addition of Sail linkers (95) the 5'- and 3'-deletion fragments

























FpUC-19 S
780

Rco RI
lol 31
Sol I lnkr
oddllon
Sal I






S I I S
N T Laga


Sph I/Bo mHI 17a
SP Os 66 6a 4 |
[-- .. ?'.. ? -"^


Sp: pW9
(I.Okb)
Ocs


Lig 6a


Figure 2-3. Construction of the reference gene and pW9-TD. The
reference gene (solid black) was formed by removing an 8 bp TaqI fragment
(inverted triangle) in the 5' leader region of the 780 gene. The intermediate
shuttle vector, pW9-TD, was obtained by ligation of the reference gene into
pW9 which consisted of a SphI-BamHI fragment (BamHI fragment 17 [5]) from
T-left inserted into pACYC184 (16). B, BamH1; E, EcoR1, H, HindII; He, HinclI; S,

Sall; Sp, SphI; T, TaqI. apr, cmr, and tetr are ampicillin, chloramphenicol, and
tetracycline resistance, respectively. OCS is octopine synthase transcript. 4, 6a
and 6b are T-left transcripts of the T-DNA (165).























IS


Ic II Ie II1
1el 31 lam H1 Linker
S.I I LInk., 1 ddl, I"
SSl I Linekr
d 1. c 1
addition





A Ligas. DNA Ligo..


Figure 2-4. Construction of the double gene shuttle vector containing
the 5' and internal deletions of the 780 gene. 5' and 3' deletions were
constructed by Bal 31 digestion of the 5' flanking region and subsequent
recloning of the deletion mutants into pUC-19. The 5' deletion clones were then
ligated into pW9-TD, generating double gene shuttle vectors. Internal deletions
were made by lighting isolated SalI-HindIII 5' deletion fragments into the 3'
deletion clones as described in Materials and Methods. B, BamHl; E, EcoRl, H,
HindIII; He, HincII; S, Sail; Sp, SphI. apr and cmr are ampicillin and
chloramphenicol resistance, respectively. The black triangle denotes the Taql
deletion in the reference gene leader. OCS is octopine synthase transcript. 4, 6a
and 6b are T-left transcripts of the T-DNA (165).


I









were separated from pUC-19 sequences by digestion with HindIII and BamHI

respectively, and cloned into either the Sall-HindII or SalI-BamHI sites of

pUC-19. Deletion endpoints were determined by DNA sequencing (100, 130).

Internal deletion and duplication mutants were constructed after selection of

appropriate pairs of 5'- and 3'-deletion clones. The appropriate 5'-deletion

fragments (SalI-HindIII) were isolated and then inserted into the SalI-HindIII

site of the matching pUC-19:3'-deletion clones. The 5'- and internally deleted

780 genes were finally cloned between the BamHI-HindIII sites of pW9-TD to

form double gene shuttle vectors.



Triparental Conjugation and Tumor Formation

Double gene shuttle vectors carrying the various 780 gene promoter

alterations were transferred from E. coli LE392 into A. tumefaciens Ag5260 by

the triparental conjugation procedure of Fraley et al. (44) described as follows.

E. coli LE392 harboring a double gene shuttle vector (cmr) and another E. coli

LE392 harboring the transfer-helper plasmid, pRK2013 (kanr) encoding the

conjugal transfer functions, were separately grown overnight at 370C in LB,

with appropriate antibiotics. A. tumefaciens Ag5260 was also grown for two days

at 28C in LB with appropriate antibiotics. After washing 1 ml of each of these

cultures with fresh LB, 200 gl of each were mixed together and spotted on a LB

plate and incubated 2 days at 280C. The cells were then resuspended in 2 ml of

sterile 10 mM MgSO4 and plated on AB minimal media with streptomycin (250

tg/ml), kanamycin (20 gg/ml) and chloramphenicol (15 gig/ml) and incubated

at 280C for 3-5 days. Transconjugant colonies were tested by overnight growth

in 2 ml of LB with streptomycin (250 ig/ml), kanamycin (20 glg/ml) and

chloramphenicol (2.5 ig/ml). The strr, kanr, and cmr clones were analysed by

Southern blot analysis (148) after small scale DNA preparation (15).









Tumors were incited on one week old sunflower seedlings (Helianthus

an nuus cv. Large Grey) by injecting a drop of an overnight growth of

A. tumefacien transconjugant into the hypocotyls using a syringe fitted with

a 25 gauge needle (5/8 inch). The plants were then grown with an 18 hour

light cycle for 14 to 16 days at room temperature. Usually 200 to 300 tumors for

each promoter mutation were harvested, immediately frozen with liquid

nitrogen, and then stored at -700C.



Total RNA Extraction and Poly (A) RNA Isolation from Sunflower Tumors

Total RNA was extracted by the method of Jackson and Ingle (68) as a

modified by Czarnecka et al. (23, 55). Approximately 50 g of frozen tumors were

ground in a mortar and pestle in the presence of 200 ml of grinding buffer

containing 100 mM Tris-HCI (pH 8.8), 500 mM NaCI, 6% (wt/v) p-aminosalicylate

(Sigma), 2% (wt/v) triisopropylnapthalenesulfonate (Kodak), 6% (v/v)

n-butanol, 0.2% (wt/v) polyvinylpyrrolidone (Sigma), 0.3 mM

diethyldithiocarbamate (Sigma), and 0.13 mM dithiothreitol (DTT, Sigma). After

grinding the tumors to a slurry, the mixture was completely homogenized for

2-3 minutes using a Tekmar tissumizer, then extracted twice by shaking for 1

hour with an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1).

The nucleic acids were precipitated by adding 1/9 volume of 3 M sodium acetate

and 2 volumes of ice-cold 95% ethanol.

Following centrifugation of the precipitate, the collected pellet was

resuspended in 20 ml of 10 mM Tris-HC1 (pH 8.0), 1 mM EDTA and 1% sarkosyl

(Sigma) (TES) and extracted again with phenol/chloroform for 30 minutes

before centrifuging. An equal volume of a precipitating solution containing 4

M LiCI, 4 M urea and 2 mM EDTA was added to the separated aqueous phase to

cause the RNA to precipitate during an overnight incubation at 40C. The RNA









was collected by a 20 minute 6000 Xg centrifugation and washed with the

original volume of a 1/2 strength precipitating solution, then the RNA was

collected again by centrifugation. The pellet was resuspended in 5 ml of TES

and precipitated with sodium acetate and 95% ethanol. The total RNA was

finally resuspended in sterile 10 mM Tris-HCl (pH 8.0) and 1 mM EDTA to a

concentration of 15 mg/ml.

The poly (A) RNA fraction was isolated using oligo (dT) cellulose

chromatography (144). Approximately 5 .g of total RNA (0.5 mg/ml) in 10 mM

Tris-HCl (pH7.5), 1 mM EDTA (TE) with 0.1% sodium doedecylsulfate (SDS) was

heat denatured (10 minutes at -700C) and 1/10 volume 5 M NaCI was added, and

then the mixture was cooled to room temperature. This RNA solution was cycled

3 times at room temperature through a 1-2 ml oligo (dT) cellulose (Bethesda

Research Laboratories) column that was previously equilibrated with TE

containing 0.5 M NaCI. After washing the column with the equilibrating

buffer, the poly (A) fraction was eluted with TE at 680C. Generally, the first 2

ml of eluate were pooled and the poly (A) RNA precipitated with both 1/10

volume of 100 mM Mg acetate, 3 M Na acetate, and 2.2x volume of 95% ethanol.

The poly (A) RNA was then dissolved in sterile water. Concentrations of RNA

were calculated from the optical density at 260 nm (40 jig/ml = 1 O.D.).



Sl Nuclease Analysis

Transcript levels of both the 780 test gene and reference gene were

assayed by Sl nuclease hybrid protection (55). Analyses were performed with

approximately 15 u.g of poly (A) enriched RNA. The hybridization probe was

isolated from the 5'-deletion clone pA-74 and was 5'-end labeled at the HpaII site

located at +60 bp. This probe (SalI-HpaII fragment) contains the wild type

leader and 74 bp of 5'-flanking sequences of the test gene. Poly (A) RNA was









hybridized with an excess of the doubled stranded DNA probe (40,000-50,000

cpm) overnight at 380C. After S1 nuclease digestion (50 units/ml) at 230C for 30

minutes, the protected hybrids were fractionated on an 8% sequencing

polyacrylamide gel containing 7 M urea and exposed (with intensifier

screens) to XAR-5 (Kodak) film for 1 to 2 days at -700C.

Relative transcript levels (RTL) of each mutant were determined by

cutting portions of the gel corresponding to radioactive bands and using the

gel portions for Cerenkov counting. The RTL values were defined as the ratio

of cpm values of the test gene transcripts to cpm values of the reference gene

transcripts divided by the ratio of cpm values of the test gene transcripts to its

reference gene transcripts (30). All RTL values represent an average of 3 or

more independent hybridization experiments.



Primer Extension Analysis

Primer extension analysis was performed to confirm the S1 nuclease

analysis and to determine if the reference gene transcripts could be

distinguished from wild type gene transcripts. Poly (A) RNA (approximately 15

i.g) was added to 0.003 pmoles of a 5'-end labeled primer that was

complementary to the region from +33 to +49 bp of the 780 gene mRNA

transcript. A final volume of 10 tl of 10 mM Tris-HCl (pH 7.0) and 1.0 mM EDTA

was sealed in a 20 u1 capillary tube, and placed in a boiling water bath. After 3

minutes, the capillary tube was then quickly transferred to 500C for 6 hours to

allow the primer to anneal to the RNA. After annealing, the contents of the

capillary tubes were added to 10 4.l of a primer extension buffer (80 mM

Tris-HCl [pH 7.0], 150 mM KCI, 20 mM DTT, 6 mM MgCI2 and 1 mM each of dATP,

dGTP, dCTP, and dTTP) with 200 units of murine maloney virus reverse

transcriptase (Bethesda Research Laboratories) and incubated at 370C for 30









minutes. The reaction mixture was then phenol/choloroform extracted,

precipitated with ethanol and finally fractionated on 8% polyacrylamide gel

containing 7 M urea.



Results



Southern Blot Analysis of the T-right DNA of A. tumefaciens strain Ag5260

The substitution of the 4.7 kbp region of T-right of pTil 15955 for the 1.5

kbp Tn5 fragment conferring kanamycin resistance was examined by

Southern blot analysis. The Ti-plasmid bands from wild type A. tumefaciens

strain 15955 and an intermediate transconjugant containing the plasmid

pKn306 (introduced without selection) hybridized as expected to the 780 gene

probe. The Ti-plasmid of four clones after selection for recombination (lanes

2-5, Fig. 2-5) did not hybridize to the 780 gene probe but instead hybridized to

the kanamycin gene probe which has no homology to the wild type Ti-plasmid.

This clearly demonstrates that the endogenous 780 gene of pTi15955 has been

replaced with the kanamycin gene in strain Ag5260 (lane 2, Fig. 2-5).



Triparental Conjugations with Double Gene Shuttle Vectors

Double gene vectors containing the reference gene alone or the test

and reference gene together, were transferred into Ag5260 using the

triparental conjugation method. Between 5-50 colonies arose after 4-5 days on

AB minimal plates with streptomycin (250 .gg/ml), kanamycin (20 Ig/ml), and

chloramphenicol (15 g.g/ml). Of these potential transconjugants approximately

50% grew overnight in 2 ml LB in the presence of the same level of

streptomycin and kanamycin as was present in the AB minimal plates but with

reduced chloramphenicol (5-2.5 .g/ml). These clones were then used to

















NT PROBES:


C 1 2 3 4 5


C 1 2 3 4 5


"X


m O Ti


*

*


*1 W


Figure 2-5. Southern blot analysis of the double homologous
recombination event. Approximately 1-2 g.g of total DNA isolated from A.
tumefaciens clones was used for each lane. Nick translation probes used were
the isolated EcoR1-SphI fragment containing the 780 gene and the isolated
XhoI-HindIII fragment containing the kanamycin phosphotransferase gene
from Tn5. Lane C contains DNA from strain 15955. Lane 1 contains DNA from an
A. tumefaciens transconjugant clone harboring pKn306 plasmid. Lane 2-5
contain DNA from four separate transconjugants after selection for the double
recombination. Ti denotes the position of the Ti plasmid.


780


KAN









inoculate sunflower plants. The 780 gene used as a nick-translated probe,

hybridized to the Ti-plasmid bands of the various clones when analyzed by

Southern blotting (Fig. 2-6) as well as to the positive control, wild type strain

15955. These results along with the lack of hybridization of the recipient,

Ag5260, confirm the transfer and integration of the shuttle vector into the Ti

plasmid.



Discrimination of the 780 Test and Reference Gene Transcripts

Sl nuclease hybrid protection mapping was performed to accurately

determine the 5' start of transcription and to quantitate the transcripts from

the 780 test and reference gene. The deletion of the TaqI fragment in the

untranslated leader of the reference gene resulted in shorter transcripts that

could be distinguished from the longer test gene transcripts. However, the

basis of transcript discrimination obtained using S1 nuclease assay was due to

a local region of nonhomology between the wild type DNA probe and the

reference gene transcript which allowed the S1 nuclease to cleave the

resulting 8 bp loop in the labeled DNA (Fig. 2-7). As illustrated in Fig. 2-7,

protection of the labelled probe by the reference gene RNA resulted in a

smaller fragment than protection by the test gene RNA.

The autoradiographs of S1 nuclease mapping gels presented in Figs. 2-8

(and 2-10) show the length of protected hybrids obtained using the test gene

DNA probe with RNA derived from the wild type gene, the reference gene, and

with RNA from the test and reference genes present in the same vector. The

major start site of transcription for the wild type gene maps 60 bp upstream of

the HpalI site. When RNA from the tumors containing the reference gene was

hybridized to the test gene DNA probe, a cluster of bands ranging in size from

46 bp to 54 bp was observed. The position of this cluster of protected bands


















1 2 3 4 5 6 7



: f,





n -*We


8 9 10 11 12 13 14 15 16 17 18 19 20
g Oi-a -


W 4


W W 40e-


Figure 2-6. Southern blot analysis of selected double gene
transconjugants. Lane 1 contains approximately 200 ng of DNA from A.
tumefaciens strain 15955. Lane 2 contains approximately 1-2 jtg of total DNA
isolated from A. tumefaciens strain Ag5260. Lanes 3-20 contain approximately
1-2 jgg of total DNA isolated from various A. tumefaciens strain Ag5260 clones
containing double gene shuttle vectors recombined into the Ti plasmid. The
nick translated probe is the EcoR1-SphI fragment containing the 780 gene. Ti
denotes the position of the Ti plasmid. The lower bands are the chromosomal
DNA.


Ti -






47






DNA template 3 waw&As u *BB
Sa TT H2


780 ref. 780 *
melt DNA
hybridize to RNA

-------- --*---


S1 nuclease digestion




Gel
Electrophoresis

M 1



S Major
S= Reference





Figure 2-7. S1 nuclease hybrid protection strategy. The poly (A) RNA
from sunflower tumors containing both the test and reference gene was
hybridized to the 5' end-labeled DNA probe from the wild type 780 gene. Upon
forming a hybrid with the DNA template, the transcript from the reference
gene formed a single-stranded loop due to its deletion whereas the transcript
from the test gene protects the DNA probe in a normal fashion. After S1
nuclease digestion, two sizes of protected DNA resulted which were then
separated by electrophoresis on a denaturing gel. The hatched line represents
the DNA probe (-74 to +60 bp) with the asterisk denoting the site of the 5' label.
The inverted triangle represents the TaqI deletion in the 780 reference gene
leader sequence. Sa,. Sal; H2, HpaII; T, TaqI; M, marker lane; 1, lane containing
the protected end-labeled fragments.









M Ref WT G A+G


118-


72 -


-on
Si
LNIB r


IC
JGOWT
C
C
A
T
C
G
A-
A

-1C


Figure 2-8. Sl nuclease mapping of the 5' termini of poly (A) RNA
homologous to the 780 gene. A DNA sequence ladder was utilized for sizing S1
nuclease hybrid-protected fragments from wild type (3 g.g of RNA) and the
reference genes (15 utg of RNA). The M lane contains DX 174 DNA
HaeII-generated marker. The arrows denote 5' termini of test gene transcripts
and the 8 bp loop of the probe due to the TaqI deletion in the reference gene
transcripts. The sequence at the right of the ladder represents the coding
strand which is the complement of the actual DNA ladder sequence.


**









corresponded to the predicted position of the 8 bp loop in the probe:RNA

hybrid. When RNA from tumors containing both test and reference genes was

analysed (lanes WT and Ref., Fig. 2-10), two clusters of protected hybrids were

seen at the predicted positions, demonstrating the ability of this method to

assess the relative abundance of transcripts derived from these two promoters.

Primer extension analysis also confirmed that the 5' termini of the reference

gene is 8 bp shorter than the test gene (Fig. 2-9) and that the two types of

transcripts can be distinguished from each other.

A weakly protected band of 120 bp was also observed which suggested

the presence of another 5'-terminus 60 bp upstream from the major start site.

The level of transcripts originating from this minor start site relative to the

major start site appeared to be 10% of the major transcript level as determined

by the S1 nuclease mapping procedure. The true abundance of the minor

transcript, however, may be only 1-2% of the major transcript based on the

results of primer extension analysis (data not shown). With the DNA probe in

excess, the longer transcripts from the minor promoter seemed to be more

stable than the transcripts from the major promoter and reference gene while

using SI nuclease mapping conditions. When using primer extension analysis

the primer had no preference for any of these three transcripts and

hybridized with them equally well. This allowed a better estimation of the

minor transcripts relative to the major transcripts. Other bands were also seen

in the primer extension analysis which did not correspond to the S1 nuclease

hybrid protected bands. These minor bands were probably due to the primer

hybridizing to other RNA molecules since these bands could be seen in the

primer extension analysis when RNA from sunflower tumors not containing

the 780 gene was used (Fig. 2-9).














bp M12 3 4 5 6 78M
76* o

67* -




M aj

3 Ref



34.* 3


26*


-*-p


Figure 2-9. Primer extension analysis of RNA derived from 780 test and
reference genes. Each lane (except for Lane 1 and 6) contains approximately
15 jig poly (A) RNA isolated from sunflower tumors incited with various A.
tumefaciens clones and hybridized to a 5' 32P-end-labeled primer (17
nucleotides long from +33 to +49 bp of the 780 leader region). This hybrid was
elongated with reverse transcriptase as described in the Materials and
Methods. Lane 1 contains 15 jtg of yeast tRNA. Lanes 2-8 contain tumor RNA
incited by A.tumefaciens harboring the following 780 constructions: 2,
Ag5260; 3, reference gene alone; 4, wild type 780 gene and reference gene; 5,
A-290; 6, 5 gg of poly (A) RNA from tumors with the wild type 780 gene and
reference gene; 7, ID- 112/-74; 8, ID-76/-74. Maj, major transcript; Ref,
reference transcript; P, end-labeled primer. Lane M contains pBR322
HpaII-generated DNA marker.




















00S

00 &
o 0 .5






4- U0
Cco 0 Z
L e Cu
Soe- c

So moou





mC





< 7 l. C6
E 0 < o







C 0








.0
n 50 0a c
0-







^ -

0c u a
oo .e a <


cua c ...

4-.









0 o 0







C C'Cu
O .00 *

2 c, > a e
u. ~ oo 0







0 0 c 0 0
'--. 0 e L U











L -/ L-01al

LI-/9L-a0
LE-/9L-0I
.L-/9L -a0
SI -/LL-a I
LC-/LL -a I

86-/ES L -a I
86-/ZLL-01
LLI-/CSL -al
86-/6,Z-a I
LLI-/SZ-a I
06Z-/OZE-ai
06Z-/8fE-alI


13I+IM

0
a.

ze+V I
Lrz-V I
86-V I
OZ L-V
OLL-V
IZZ- V
06Z-V
LL9-V

89C-V
96C-V
LZtP-V
j3+iM i
A3a
IM I

.0


I

I


I
I
z


I

N -


mig

3



II;
3'





Ir-


< UJ
Stl
I- II
1 II



'II





IrJ L
~-,L U




Ii






I!
U~


0 .0
(Y. N %0


----------------









Effect of 5'-Deletions on the Major Promoter Activity

Analysis of in vivo transcriptional activity of 5'-deletion mutants

identified the 5'-boundary of the 780 gene promoter and indicated that a far

upstream activator element was required for efficient expression. Results of

the S1 nuclease mapping of the test and reference genes along with relative

transcript levels (RTL) derived for the major and minor promoters are

presented in Figs. 2-10A and 2-11. The activity plot of these results (Fig. 2-12)

demonstrates the effect of systematic 5'-deletions on promoter function for

both the major and minor start sites. This analysis indicated that the 5'-border

of the 780 gene may lie between -476 and -427 bp (ca. 5% activity drop) with a

distinct subcomponent of importance positioned near this border. The

presence of this far upstream regulatory sequence was revealed by the

dramatic reduction in RTL that occurred when the 31 bp region between -427

and -396 bp was deleted. Removal of these sequences reduced promoter activity

by approximately 45%. It was also apparent that other components of the

activator were located between position -396 and -229 bp. Deletion of this

region of the activator resulted in a loss of activity from approximately 50% at

-396 bp to 1% at -229 bp.

With the activator element deleted, the upstream element and TATA

motif of the 780 gene was not enough to promote detectable levels of

transcription. Removal of 5' sequences from -171 to +32 bp resulted in

activities of 0.5% or less. This 200-fold drop in activity demonstrated the

absolute requirement of the activator in obtaining wild type levels of

transcription.


















MINOR A I d
-120 -90
-44 -229 -60 -30 -1
MAJOR A -
St probe ',


WT -4
A-427 I
A-396 2
A-368 I
A-336 3-
A-311 i
A-290 -311
-2a
A-271 -
211
A-229 ---
A-171 m -
-171
A-97 -7
A-74
A+32
ID-348/-2901 I ,
-3U -2i@
I D-320/-290 i--- -
ID-153/-37 -I
ID-112/-37 I -I1
ID-76/-37 _-,
ID-252/-171 I -li
ID-249/-98 -2i -i .-
ID-153/-171 -1
ID-153/-98 -1- -
ID-112/-98 I -
ID-112/-74 --2 -74
I D-76/-74 I4
ID-112/-12 -112
I D-76/-12 -176


*32


-37
-a
-37









-12
-12


MAJ IMIN
100 100
92 68
55 39
52 35
35 30
30 33
21 20
6 7
1 3
0.5 2
0.5 1
0.5 2
0.5 1
52 36
65 60
106 0.1
143 0.1
90 64
28 30
17 32
36 33
70 123
42 96
47 24
38 49
0.5 0.1
0.1 43


Figure 2-11. Diagrammatic representation of 780 gene mutations and
RTLs. Deletion mutants shown here correspond to the deletions in Fig. 2-10.
Sail linkers are represented by short vertical lines ending at each deletion
site. The panel at the right shows the RTLs representing percentages of wild
type activity for both the major and minor promoters. RTLs of >10 varied by
10% or less between experiments. Mutants that showed RTLs of <10 varied no
more than 4% of wild type activity. Box A represents the activator element.
Box C and circle T indicate the positions of the CAAT and TATA sequences of the
major and minor promoters.





















100


80-


60


40


MAJOR

o----o MINOR


-450 -350 -250
5'-DELETIONS (bp)


-50


Figure 2-12. Effects of 5' deletions on transcriptional activity for both
major and minor promoters. RTLs were plotted from the data shown in Fig.
2-11. Endpoints for the 5' deletions are numbered from the start site of the
major transcript.










Effect of Internal Deletions on the Major Promoter

A total of 14 internal deletions and one 18 bp duplication mutant in the

5'-flanking region of the 780 gene were assayed for transcriptional activity

(Figs. 2-10B and 2-11). These mutants were grouped into 4 classes according to

the location of the mutation and their effect on the transcriptional activity of

the major promoter. The first class of deletions (ID-348/-290 and ID-320/-290)

were localized within the activator element delineated by the 5'-deletion series.

Both deletions in this class reduced activity to between 52 and 65% of wild type

levels which is similar in effect to the 5'-deletion at -396 bp. The results of

these two internal deletions together with the 5'-deletion series suggested that

the activator element is a single promoter element possibly having multiple

subcomponents that function in concert.

A second class of internal deletions either stimulated or caused minor

changes in transcriptional activity. Mutations in this class included ID-76/-37,

ID-112/-37, ID-153/-37 and ID-200/-37 (this last deletion is presented in Fig. 3-4

and 3-5). A common feature of this group was the absence of sequences

immediately upstream of the TATA box from -76 to -37. This particular deletion

resulted in 90% of wild type activity but removal of more sequences upstream

of -76 bp resulted in an increase of transcription from 106 to 140% of wild type.

These deletions allow the activator element to come as close as possible to TATA

removing parts, or all, of the upstream element sequences. The effects of

completely removing this region (ID-200/-37) resulted in an increase in

transcription relative to wild type indicating that sequences in the analogous

position of the upstream element of animal genes were not absolutely required

for normal levels of transcription.

Mutations located between position -229 bp (the putative 3'-boundary of

the activator) and approximately -74 bp have been grouped in a third class.










Generally these mutations decreased transcriptional activity to below 50% of

the wild type activity with the exception of ID-153/-98 which resulted in 70%

activity. Deletions ID-252/-171 and ID-249/-98 were especially drastic in their

effect, reducing activity to 17 and 28%, respectively. The severity of these two

mutations may have been due in part to removal of sequences within the 3'

end of the activator as well as part of the upstream element. Two small internal

deletions ID-76/-74 and ID-112/-98 caused reductions in transcriptional activity

to 38 and 42%, respectively, even though complete removal of this region

(ID-112/-37) resulted in an RTL of 143%.

Internal deletions that remove the TATA comprise the last class of

mutations and result in severe loss of promoter function. Deletions ID-76/-12

and ID-112/-12 showed less than 0.5% and 0.1% activity, respectively,

suggesting that TATA is essential for 780 promoter function. These levels

contrast strongly to the near wild type activities of the mutants ID-76/-37 and

ID-112/-37 which still contained the TATA motif. Activity levels resulting from

the removal of TATA were comparable to those obtained by removing the

entire activator element with the 5'-deletion to position -229 bp suggesting that

this motif was essential for normal activity.



Deletion Effects on the Minor Promoter

Analysis of the activity of the minor promoter suggested that it shares

the activator element with the major promoter along with other structural

similarities. The 5'-deletion activity plot in Fig. 2-12 showed that both the major

and minor promoters have nearly identical profiles. This finding suggested

that the activator element for the major promoter must also act in a similar

fashion on the minor promoter. Mutants ID-112/-98 and ID-153/-98 are similar

to those in the second class of the major promoter internal deletions in that










complete removal of sequences immediately upstream of the TATA (minor)

resulted in either increasing by 23% or causing little change on the level of

the minor transcripts. Mutant ID-153/-171 is similar to the third class of the

major promoter internal deletions since a similar alteration (18 bp

duplication) of sequences upstream of TATA also caused a decrease in activity

of the minor promoter. Removal of the TATA (minor) also drastically decreased

the minor transcripts to barely detectable amounts as shown by ID-112/-37 and

ID-153/-37. However, reduction of the activity level of the minor promoter was

not as drastic (reducing to 24%) with an internal deletion from -112 to -74 bp

suggesting that some sequences immediately downstream of -74 bp are

required for low level activity for this promoter.

The conservation in spacing between the TATA and the start of

transcription was demonstrated for the minor start site. In Fig. 2-13 (lane WT)

the start site for the minor transcript was mapped between -119 to -114 bp from

the HpaII site or approximately 60 bp upstream from the major start site. The

insertion of an 8 bp SalI linker between -17 and -15 bp relative to the minor

start of transcription (ID-76/-74) resulted in the shifting of this start site 3 to 5

bp upstream. This maintained a distance of 27 to 29 bp between the third

nucleotide of TATA (minor) and the start site of transcription. In a similar

mutation (ID-76/-37), 39 bp including the minor cap site were removed and an

8 bp Sall linker inserted. In this case the transcription start site did not appear

as discrete as the wild type start and was located 20 to 40 bp downstream of

TATA's (minor) new position. The level of activity for both of these mutations

also decreased to 49% for ID-76/-74 and 64% for ID-76/-37. These results suggest

that for the 780 gene minor promoter, the start of transcription is not

primarily determined by sequences around the cap site, but most probably by

















bpM m
probe -

122 --


110 .





90 *.


M


76.i


67 r


Figure 2-13. S1 nuclease mapping of the minor transcript.
Approximately 15 gpg of poly (A) RNA was hybridized to the S1 probe (Fig. 2-11).
ID-76/-74 contains a 6 bp insertion between the TATA (minor) and the minor
transcript cap site. ID-76/-37 contains a 31 bp deletion removing the minor cap
site, thereby moving the TATA (minor) to a new position resulting in protected
bands of about 80-90 bp in size. The 100 bp size bands represent a divergence of
test gene transcripts (readthrough) at the position corresponding to the Sall
linker in the test gene. Lane M consists of a pBR322 HpaII-generated marker.










TATA as in animal genes (83), and that the sequences from -76 to -37 bp are of

some importance to the minor promoter transcription.





Conclusion



The transcriptional activity of a series of 5' and internal deletion

mutants of the 780 gene from pTi15955 was assayed in order to determine the

internal structure of the promoter. Precise quantitation of transcription was

achieved by using a homologous reference gene acting as an internal

standard while present in the same vector as the mutant test gene. Since the

reference gene transcripts were shown to be distinguishable from the test

gene transcripts, an accurate determination of transcript levels was possible

for each mutation. Transcription factor saturation was avoided by using the

T-DNA vector system in which a relatively few copies are integrated in the

plant genome (106, 152, 175). The factor saturation problem usually

accompanies viral-based vectors and DNA transformation systems which result

in high template copy numbers (92) that can saturate out transcription

factors. Variations in promoter activity due to the integration of T-DNA at

random sites (43, 65, 73) was also avoided. Pooling 200-300 tumors for each

mutation assay averaged the possible chromosomal location effects on the

integrated T-DNA. With less than 10% variability of promoter activity between

experiments, the sensitivity of this transcription expression system allowed

the detection of discrete functional domains in the 5'-flanking region of the

780 gene.

Three functional domains were postulated based on the results of the 5'

and internal deletion studies. These domains have been designated as the









activator, the upstream region and the TATA and appear to be similar to

analogous elements in animal and viral promoters. Due to the limited number

of mutations evaluated, the 5' and 3' border of the activator element and the

boundaries of the upstream element are only approximate. The minor

promoter was also shown to have three functional domains similar to the

major promoter even though its own activity is much lower relative to the

activity of the major promoter.

The 780 gene activator element is the most distal domain with respect to

the start of transcription and is defined primarily by the effect of systematic

5'-deletions on the level of transcription (Fig. 2-12). The activator element was

required for full transcriptional activity for both the major and minor

promoters since its removal reduces the activity for both promoters 100

(major) to 30-fold (minor) less than wild type. The activator was also able to

function closer to TATA than that present in the wild type gene. For example,

the second class of internal deletions move the activator from 31 to 163 bp

closer to TATA and showed either very little reduction in activity, or as much

as a 40% increase over wild type transcription levels (Fig. 3-4).

A least characterized domain of the 780 promoter lies between the TATA

(-37 bp) and the postulated 3' border of the activator (-229 bp). In numerous

animal genes this region includes the domain designated as the upstream

element which is generally positioned from -110 to -40 bp (35, 112). In

general, this region is sensitive to slight disruptions in sequence composition

and spacing (30, 102, 112). The region between TATA and the activator element

of the 780 promoter seems to be analogous to the upstream element of animal

promoters since small scale disruptions drastically reduce transcriptional

activity demonstrating the limited spatial flexibility of this element (30, 102).

Larger deletions in the region, which included the CAAT box sequences










immediately upstream of TATA, were shown to stimulate transcription to as

much as 40% over wild type levels, implying that these sequences may also

impart a negative influence on the rate of transcription. With this in mind,

small disruptions of this sequence should therefore interfere with the

negative element's influence and allow the transcriptional rate to increase.

Such mutations (ID-76/-74 and ID-112/-98), however, resulted in sizeable

decreases in activity supporting the idea that the 780 upstream element

provides a positive rather than a negative influence.

The second class of mutations suggested that the activator was able to

substitute for the upstream element as long as the deletions positioned the

activator close to TATA and removed large portions of the intervening

sequences. Morelli et al. (109) observed a similar occurrence with the removal

of sequences, which included the CAAT box, in the rbcS gene from pea that

resulted in a nearly 2-fold increase in activity. The authors stated that this

region may act as a negative element since its removal increased activity. An

analogous event was demonstrated by the deletion of a similar region in the

promoter of the sea urchin H2A histone gene (54) also resulting in a nearly

2-fold increase in transcription. Deletions of the promoter regions which

include the CAAT box may not necessarily remove elements which have

negative influences on gene expression. Alternatively, these two studies may

suggest that other 5' elements far upstream, analogous to the 780 activator

element, can be repositioned closer to TATA and increase the transcriptional

activity possibly by optimizing interactions of factors involved with

transcription. Therefore, the rbcS, histone and 780 genes may require some

element to be located in the TATA-proximal position for efficient activity

similar to the MT-1 gene previously mentioned (135).









In most eucaryotic promoters, a TATA motif is often positioned from 21

to 35 bp upstream of the start of transcription. In animal genes TATA is an

essential component for activity of the promoter in some cases (30), but is only

required for precise positioning of the transcriptional start site in others (6,

83). A clear demonstration of its role in positioning the start transcription of

plant genes has not been reported. In this study the TATA element was

absolutely required for the transcriptional activity of the major promoter. Its

role in the positioning of the start of transcription was shown by the shift in

the transcription start site obtained by insertion of sequences between the

TATA (minor) and minor cap site, or by deletion of sequences between -76 and

-37 bp (Fig. 2-13). These results imply that the function of the TATA in animal

and plant promoters has been conserved throughout evolution.

In addition to TATA and CAAT motifs, no other sequences appear to be

present in the promoter of the 780 gene (Fig. 2-14) which show strong

homology with consensus sequences (112) commonly found in the promoters

of eucaryotic genes. There are, however, four direct repeats (one 11 bp and

three 7 bp in size) scattered throughout the 5'-flanking region. Three of these

four repeats (a, b, c) are clustered near the 5'-border of the activator element.

Deletion of these sequences, from position -427 to -396 bp, resulted in a sharp

decrease in activity of both the major and minor promoters (Fig. 2-12)

suggesting that some of these repeats may be critical to the activator function.

Repeat c (5'-TTGAAAA-3') is located at three positions in the 5'-flanking region,

whereas repeats a, b and d are present twice. Repeat c is also present once or

twice in the 5'-flanking region in seven of the thirteen known genes of the

octopine-type T-DNA (5). This same repeat is similar to the the sequence

5'-TTTCAAGGA-3' found in the 5'-flanking region of nopaline-type T-DNA genes

(78). A seven out of nine base pair homology to this latter sequence is present














Eco R1 -450
I *
AGAATTCGTGCCAATCCATTTTGTTTTGATTGTCTTTTGT AATGTT gCCGC
a
-400
0
TAATCACGGA1-GAAAAATCAACGCTTCACTCCTTTCGACTTTTTTAAAGCCGTTTCTAA
big C a
-350 -300
0 0
AATGAAATTCTAATCTTTGAAAAGGAAATTTATGCTATATGACTTTATCGCCGTGAATA
C
-250
ATTAAAGGAGATTCAGACGGAACTTTAGGCGCTCATTTCGCGACTGGCCCACGGATGATG
------------^---------------- bwaa
d b
-200
TAAAACACTACCTAACAAA TGAAAAAGACGCCAACCACCGATATAGCCGGTCCAAAGT
C
-150
CGCATCCACTGAAGTACTCATGATCTTTTGAAGGGTAAAATGTGCTTTAG CACCTAA
d CAAT
-100 minor cap site
TTCCCCTGTTGAGTAGGTAACGCCT AATATAI GGAAATTGCCT(CGAATTTCTCTTC
TATA CAAT
-50 ___
AAThCrGGCATTGTGAGCGGACTCCTATAAATATIAGAACCTCTGCCCTTGCACTCGC
TATA major cap
+50 site
CATCGAAACATCGAGCAATGAGTTATTATTGGATAGACTTAAGGCGCAAGCCCGCCGGAA
ref. gene deletion


Figure 2-14. Sequence of the 5'-flanking region of the 780 gene.
Nucletides are numbered from the major start of transcription. Solid circles
above the sequence denote the 5' termini of the major and minor promoter.
The large open box encloses the region of the activator element determined
by the deletion mutation analysis. The short boxes refer to TATA sequences
where designated. The CAAT motifs are circled for both the major and minor
promoters. The asterisk denotes the site of the 5' 32P end-label at position +60
bp of the hybridization probe which extends from position +60 to -74 bp.
Individual direct repeats are designated a, b, c, and d.









twice in the 5'-flanking region of the 780 gene promoter centered at positions

-294 and -148 bp. Although the significance of short repeated sequences in

T-DNA genes is not known, short repeats have been shown to be involved with

enhancer activity and to constitute sites of protein-DNA interaction in

enhancers and upstream elements of animal genes (20, 71).

In conclusion, the functional domains within the promoter of the 780

gene have been partially characterized based on this limited deletion study. Of

the three analyzed regions of the 780 promoter, the activator element seems to

be the most enhancer-like since this element can be moved much closer than

its wild type position relative to the cap site without disrupting the activity of

the gene. Because the 780 gene is noninducible, the activator element may

demonstrate some of the characteristics of a constitutive, or nonspecialized,

enhancer element in plant promoters. A direct test of bidirectional function of

the 780 activator in both the 5' and 3'-flanking regions of the gene is

presented in the next chapter.

















CHAPTER 3

ENHANCER PROPERTIES OF T-DNA PROMOTERS



Introduction



The existence of enhancers in T-DNA has not been reported in the

literature although the results of the mutation studies summarized in Table 1

demonstrate the requirement for transcription of sequences 5' to the upstream

element. As an example, sequences upstream to position -168 bp in the OCS

gene are essential since no octopine is detected in tobacco tumors containing

this gene with -168 bp deletion (82). Normal opine activity is restored when

the deletion is only to -292 bp suggesting the requirement of sequences

between -292 bp and -168 bp for OCS gene expression in tobacco. A second

T-DNA gene that may be associated with an enhancer-like element is gene 4

which encodes an enzyme in the cytokinin pathway, dimethylallyl

pyrophosphate transferase. Hooykaas et al. reported (Fallen Leaf Lake

Conference on "The Genus Agrobacterium and Crown Gall," Lake Tahoe,

Nevada, [September, 1986]) that a region, determined by internal deletions,

between ca. -180 to -150 bp in the promoter of gene 4 was essential for activity.

Previously, Lichtenstein et al. (91) demonstrated that a Tn5 insertion mutation

of gene 4 at the -121 bp site still resulted in normal expression as assessed by

the presence of normal tumor formation. Taken together, these results using

gene 4 mutations suggest that sequences upstream of the -121 bp site could be

repositioned nearly 5.5 kbp further upstream from the core promoter









(upstream element and TATA box) and the gene could still function normally.

Thus there is evidence of required sequence 5' to the upstream element in

tobacco tissue for both the OCS gene and gene 4. The location of promoter

elements this far upstream, and the possibility of considerable flexibility in

their spacing requirements suggests that these distal elements may have

enhancer-like properties.

Based on the internal deletions in Chapter 2, the activator element of

the 780 gene promoter was shown to exhibit some flexibity in spacing. The

possibility that this activator element may have enhancer-like qualities was

examined by functionally testing this element in both polarities upstream and

downstream of a 5' deleted 780 gene. The deletion clone (pA-37 clone) contained

only the TATA sequence and could not initiate any detectable transcription.

Therefore, any change in transcriptional activity must be directly due to the

presence of the activator element. The ability of the 780 gene activator

element to function at locations further upstream of its normal wild type

position was also examined. A HaeIII fragment of approximately 600 bp in size

from the replicative form of bacteriophage 4 X174 was used to separate the

activator element from the TATA box present in the -37 deletion clone.

The existence of enhancer-like properties in the upstream regions of

the OCS and agropine synthase genes (AGS) was also examined. The regions of

the OCS and AGS promoters used in this study were located between the CAAT

boxes and the T-DNA border sequences. These sequences were also placed 5' and

3' to the pA-37 5' deletion 780 gene and then introduced into sunflower using

the double gene shuttle vector system. The utilization of the double gene

vector system for these constructions provided accurate comparisons of the

ability of these three T-DNA elements to activate transcription from a severely

deleted 780 gene promoter.













Materials and Methods


Construction of 5' and 3' Bidirectional Orientations of the 780 Activator Region
Relative to the 780 Gene pA-37 Deletion Clone

The 780 activator region was introduced into 5' and 3' locations of the

pA-37 deletion clone of the 780 test gene. The activator element was inserted

into either the BamHI or HindIII sites of the double gene shuttle vector

containing the 780 deletion mutant (Fig. 3-1). Such constructions allowed the

activator element to be positioned in both polarities directly upstream from

the TATA box, or approximately 200 bp downstream of the poly (A) addition site

of the 780 gene. To acccomplish these constructions, the Sail site of the -112

and the -200 bp 780 gene 3' deletion clones (see Fig. 2-4) were converted to

BamHI sites by linker addition (95). After digestion with BamHI, the resultant

fragments were then ligated into the BamHI site of pW9-TD: A-37 and screened

to determine polarities by digesting the final plasmid with EcoRl and HindIII.

The activator element was also moved 538 bp further upstream than its

position in the wild type gene by inserting the SalI-linkered 603 bp HaeIII

fragment from 0X174 (1173 to 1779 bp [129]) into the Sall site situated between

the activator element and the -37 bp deletion of the 780 gene. The 603 bp

fragment was tested for its ability to affect transcriptional activity by being

placed alone in both polarities directly upstream of the 780 gene A-37 clone.

The polarities of the activator element upstream of the X 174 inserted

fragment were determined by a triple digestion of the resultant plasmid with




























,t 3' location


reference pW9-TD: A-37 A -37 test gene


5' location





Figure 3-1. Introduction of enhancer fragments into the double gene
shuttle vector. Enhancer fragments linkered with either BamHI or HindIII
were inserted in the 5' or 3' locations, respectively, of the 780 A-37 deletion
clone in both polarities as described in the Materials and Methods. The hatched
area is the SphI-BamHI fragment of pACYC184 (16). The solid black areas are
the 780 reference gene and A-37 deletion 780 gene. The stippled area is the
SphI-BamHI fragment from p233G (55). The black triangle denotes the TaqI
deletion in the reference gene leader and camr denotes the chloramphenicol
resistance gene.









EcoR1, PstI and AccI. The orientation of the DX174 HaeIII fragment alone was

determined by digesting the pW9/A-37:
To introduce the 780 activator element into the downstream location of

the A-37 deletion clone, the EcoR1-Sall fragment (-476 to -112 bp) from a -112

bp 3' deletion clone was modified by the addition of HindIII linkers (95).

Following linker addition this fragment was then inserted into the HindII site

of the pW9-TD:A-37 in both orientations. The polarity of this element was

determined by digestion of the final plasmid with EcoR1.


Construction the OCS and AGS Upstream Sequences Inserted in Both Polarities
5' and 3' to the A-37 deletion clone of 780

Sequences between the CAAT boxes and the respective 3' T-DNA borders

from the OCS and AGS genes have been placed in both polarities, 5' and 3' to the

A-37 780 gene deletion clone (Fig. 3-1). The BamHI-AccI fragment of the OCS

gene (13,775 to 13,991 bp [5]) and the BamHI-Sall fragment of a 3' deletion

mutant of the AGS gene (23,576 to 23,758 bp [5]) were modified by either BamHI

or HindIII linker addition (95). The OCS and AGS linkered fragments were then

ligated into the BamHI or HindIII site of pW9-TD:A-37 and screened by gel

analysis in order to obtain both polarities. The polarity of the OCS fragment

was determined by digestion of pW9-TD:A-37/OCS with HincII. The polarity of

the AGS fragment was determined by first isolating either a PstI-SalI

fragment, or an XbaI fragment for the 5' or 3' positions, respectively, from

pW9-TD:A-37/AGS, then digesting the isolated fragments with RsaI.

The double gene shuttle vectors with the 780 activator, OCS or AGS

sequences in the 5' and 3' positions relative to the A-37 deletion clone were

mobilized into A. tumefaciens Ag5260 and used to inoculate sunflowers

seedlings as previously described. The RNA from 14-16 day tumors was

extracted and analyzed by S1 nuclease hybrid protection mapping. RTL's were









determined from the cpm values of the radioactive bands that were cut out of

the polyacrylamide gel and subjected to Cerenkov counting. The RTL values

were calculated by the ratio of cpm values of the enhancer-element/test gene

and the 780 reference gene divided by the ratio of cpm value of the wild-type

780 gene to its 780 reference gene.



Results


Determination of Polarity of the Activator. OCS. AGS. and QX 174 Fragments
Relative to the A-37 Clone

The polarity of the activator element inserted in both the 5' and 3'

positions of a 5' deletion of the 780 gene was determined by restriction

endonuclease digestions. Fig. 3-2 summarizes the results of the digestions

involving the double gene shuttle vectors, pW9-TD: A-37, with the -476/-112,

-476/-200, -476/-112: 0X174 fragments, and the QX174 fragment alone. The

polarities were designated A for the normal wild type polarity and B for the

opposite polarity. After digestion with EcoR1 and HindIII, the predicted sizes

for fragments "a" and "c" from the plasmid pW9-TD:A-37 containing the

-476/-112 bp or -476/-200 bp sequences were 1357 and 1262 bp for the A

orientation, respectively. The B orientation, by prediction, should result in 963

bp size fragments (bands "b" and "d") for both elements. The fragment -476/-

112 in the 3' position should result in two bands, "e" (~ 2.0 kbp) for the A

polarity and "f" (. 1.8 kbp) for the B polarity, based sequence prediction. The

actual sizes of bands a-f' were similar to the predicted values (number 1, Fig.

3-2). Bands "1" and "k" representing both orientations of the OX174 fragment

alone were also determined from sequence data (129) to be approximately 3.0

and 2.4 kbp which corresponded to sizes determined from the gel (number 3,

Fig. 3-2). A triple digestion was needed to discern the polarity of the -476/-112



























Figure 3-2. Determination of polarities of the 780 activator element
and bX 174 DNA fragments. Minipreparations of double gene shuttle vectors
(with the 780 A-37 gene) plasmid DNA containing the -476/-112 bp or -476/-
200 bp fragments of the activator element or the DX 174 603 bp HaeIII
fragment in either orientation (lanes A and B for each fragment) were
digested with restriction enzymes and separated by gel electrophoresis. (1.)
The -476/-112 bp and -476/-200 bp fragment in the 5' position (780 5') and the
-476/-112 bp fragment in the 3' position (780 3'). (2.) The -476/-112 bp
fragment upstream of the OX174 fragment. (3.) The OX174 fragment in the 5'
position. A and B are the normal and opposite polarities, respectively. All sizes
are in basepairs determined directly from the gels. The >>> in the open box
denotes the polarities of the 780 activator element fragments while the
hatched box refers to the 'X174 fragment. The small black box represents the
region between -37 and +1 bp of the 780 promoter. The arrow is the 780
transcript. Lane Ma contains X HindIII-generated markers and OX174 HaeII-
generated markers while lane M only contains the X 174 HaeIII-generated
markers. Legend: Ac, AccI; E, EcoR1; H, HindII; P, Pstl.


















A B M


---b(9M)----


A
-----d (960)----
B -, ..ea


2. 780/0X174
M B A


*-- (-~2100)-



B (-4oo) -
44<< ---7


3. OX174
uft


6.5s3


1.35*


(14 ) (916)
P E Ac
A l
h (505)---- g (558)
P A
--0 < ~I I/I/1111/I/,


--I (3030)----
B FI-/ A--IzuZZZZZZZEZ
-k (2420)-
Ac Ac
A I--/.-'SSSSQSS a-


780 5'


S"
S1353

1* 07
672


Bp
* 1353
S1078
* 72


780 3'










fragment relative to the OX 174 fragment and the A-37 clone. For this

construction the OX 174 fragment was in the A orientation (determined by

bands "g" and "i"). The sizes of the -476/-112 fragment (bands "h" and "j") was

predicted to be 513 and 149 bp for both polarities which were similar to the

band sizes based on the electrophoretic gel (number 2, Fig. 3-2).

The polarities of the OCS and the AGS fragments relative to the A-37

clone in both the 5' and 3' positions were likewise determined by comparing

the size predicted with the actual sizes determined by the gel electrophoresis

(Fig. 3-3). After HincII digestion, the OCS fragment in the A orientation in the

5' and 3' locations should yield fragments with sizes of 610 and 732 bp,

respectively. The B orientation should yield fragments of 402 and 577 bp for

the 5' and 3' positions, respectively, based on sequence prediction. Portions of

the double gene shuttle vector plasmid containing the A-37 clone and the AGS

fragment were first isolated then digested with RsaI as described in Materials

and Methods. The polarity of the AGS fragment was determined by sequence

prediction of the bands "r-s" (band "r" was a doublet), produce fragments

having sizes of 190 and 652 bp for the 5' A orientation and 294 and 548 bp for

the 5' B orientation. The 3' location resulted in the bands "u-x" with predicted

sizes of 441 and 262 bp for the A orientation and 550 and 153 bp for the B

orientation.


Effects of the Activator Region in Different Polarities on A-37 Clone of the 780
Gene

The function of the 780 activator element in promoting transcription of

the A-37 clone while in the upstream position was assessed by Sl nuclease

mapping. An autoradiogram of the Sl nuclease mapping gel shows the results

of the transcriptional activity of the deletion clone with the activator element

present in both polarities (Fig. 3-4A). A summary of the constructions















'8 Cu a OC E -

e on a u

o a Cc o o







0 X
r- a -





0 I- 0U o

E au
C&4) 0-




0 I- 0
^E .D
a u 0 w, 00
^a rSo0 a




z zao


,=o 00 r





c0 0



0 N C c
SC C C -
OES E





C U o "
















to 0 m -C
O C a
o o '- '-
'*
0 >. OO -. CU
















-o N C
It


o v
C CNM


a N C
w O0


cot
OaM
]4











~0

c
< CO
*L~ ll

*.
sH ^ S
o-> X1

\ 1
s"-- S


a1
x


II') *it.' J~r

lv w


N 0 -
w IfD


Sn

0
L n






m m






(.


EAV
A tV
A


I

I
4













6 7 8 9 10


Mn- OO


.0 ---
m m


12 13 14 15 16 17 18 19 20




I -
. --i iii
-- -


Figure 3-4. Autoradiograph of Sl nuclease analysis of the 780 A-37
gene containing the various T-DNA fragments in different locations.
Approximately 15 |ig of poly (A) RNA was used for all lanes. The unmarked
lanes contain RNA from sunflower tumors with the reference and wild type
genes. (A.) Lane 1, -476/-112 5' A; lane 2, -476/-112 5' B; lane 3, -476/-200 5' B;
lane 4, 780 (-476/-112) A/OX; lane 5, 780 B/IX; lane 6, DX A; lane 7, OX B; lane 8,
780 3' A; lane 9, 780 3' B; lane 10, 780 A-37 gene; and lane 11, -476/-200 5' A. (B.)
Lane 12, OCS 5' A; lane 13, OCS 5' B; lane 14, AGS 5' A; lane 15, AGS 5' B; lane 16,
OCS 3' A; lane 17, OCS 3' B; lane 18, AGS 3' A; lane 19, AGS 3' B; and lane 20, 780
A-37 gene. "M" refers to the 780 major transcripts and "R" designates the
reference gene transcripts. The hybridiztion probe and conditions are the
same as in Fig. 2-10. Lanes 11 and 20 are from another autoradiogram.


=m


1 2 3 4 5









involving the 780 activator element and the relative transcript levels is shown

in Fig. 3-5. Using the construction -476/-112 5' A, in which the 780 promoter

between positions -112 bp and -37 bp was replaced by 25 bp of a portion of the

polylinker from pUC-19, activity was reduced slightly to 93% of wild type

levels. When the -476/-112 bp fragment was placed upstream in the opposite

polarity, the activity was reduced further to a RTL value of 90%. Removal of

163 bp of internal promoter sequences of the 780 gene between -200 to -37 bp

(-476/-200 5' A, Fig. 3-5) and replacing it with the 25 bp pUC-19 polylinker DNA

resulted in 127% of transcriptional activity. However, reversing the

orientation of the -476/-200 bp fragment (-476/-200 5' B) reduced

transcription by 35%. In summary, the activator region in both polarities

efficiently promoted transcriptional activity of the deleted 780 gene, which

contained only TATA box sequences, to approximately wild type levels.

The activator domain between -476 and -112 bp of the 780 promoter was

also able to activate the A-37 deletion clone when separated from the -37 bp site

by 603 bp of OX174 sequences. Moving the -476/-112 fragment to this new

position resulted in a 2-fold increase in transcription relative to the wild type

level. Reversing the polarity of the activator element in the same location

slightly reduced this elevated activity to 183% of normal levels. The OX174

fragment alone in either orientation was unable to stimulate significant

transcription resulting in activity levels similar to the A-37 deletion clone

alone. Evidently the activator element does not have stringent spatial

requirements for functioning in the 5' position since this element could

promote high levels of transcription from -650 bp to -37 bp upstream of TATA.

The activity level of the construction, -476/-112 5' A, differs

significantly from the activity of a similar construction, ID-112/-37 (Fig. 2-11)

containing an internal deletion of sequences between -112 to -37 bp




























Figure 3-5. Schematic of 780 activator element in various positions
relative to the 780 A-37 gene. The activator constructions correspond to the S1
nuclease analysis in Fig. 3-4A. The vertical-lined arrows represent either the
-476/-112 bp or -476/-200 bp fragments from the 780 promoter as designated.
The grey and black boxes denote the regions of the 780 promoter from -112 to
-38 bp and -37 to +1 bp, respectively. The stippled region represents the 780
gene from +1 bp to approximately 200 bp downstream of the poly (A) addition
site. The hatched box is the bX 174 HaeIII 603 bp fragment with 10 bp Sal
linkers added. The panel at the right shows the RTLs representing percentages
of 780 wild type gene activity (WT). Usually the RTLs varied to within + 10% of
the percentage value whereas the RTLs of 2.1 or less varied only 0.9
percentage points between experiments.






80





+1
-476 -112-37

WT 780 GENE


-476/-112 5' A
-476 -112

-476/-112 5' B
-112 -476

-476/-200 5' A IIIIIII
-476 -200

-476/-200 5' B
-200 -476 -37

780 A/oX ,IMM ,] Ix 74 i
-476 -112 (613 bp)

780 B/DX llll
-112 -476


(DX A


(X B

-r

780 3' A



780 3' B



A-37


I^ :X174




17 +926

m 780 GENE llll!lllllllllllllll


-47



-11

II I


'6 -112



12 -476


RTL

100


93


90


127


92


210



183


<2.0


<2.0




2.1



2.0



2.0


3


3












which was previously shown to be 140% of wild type levels. The ID-112/-37

mutation was constructed with a 6 bp Sall linker joining the two deletion

endpoints. Due to an additional 19 bp present between -112 bp and -37 bp

deletion sites in the -476/-112 5' A construction, this latter mutant was 1/3 less

active in transcription compared to the activity of the ID-112/-37 deletion

mutant. It is unclear why the additional 19 bp causes a reduction in activity

since the -476/-112 bp fragment was shown to function quite well when it was

positioned 613 bp further upstream.

The 780 activator was not, however, able to stimulate any detectable

level of transcription when placed downstream of the A-37 deletion clone.

Positioning the -476/-112 bp fragment approximately 200 bp downstream of

the poly (A) addition site resulted in no activity in either polarity. This result

is similar to the studies of the light-inducible enhancers from rbcS and Cab

genes which do not activate transcription of the NOS promoter while in the

downstream location (145, 153). Nevertheless the 780 promoter fragment from

-476 to -112 bp seemed to have some enhancer-like qualities, functioning

upstream regardless of position and orientation even though it could not

function downstream of the gene.

The start site of the 780 major promoter remained constant in all of the

constructions in which the test gene transcripts could be detected by the S1

nuclease mapping analysis (Fig. 3-4). The transcript levels from the minor

promoter were not examined since the DNA probe used for the S1 nuclease

mapping analysis diverges with the test gene transcripts at the -37 bp site

where Sail linkers were added. However, some low level transcripts starting

upstream of -37 bp in the activator constructions immediately uptream of A-37

bp clone seemed to occur but only represented approximately 1-2% of the









major promoter activity (data not shown). These upstream start sites were not

investigated further.


Evaluation of Enhancer-like Properties of Far Upstream Regions of the OCS and
AGS Promoter

The promoter region immediately upstream of the CAAT boxes of the OCS

and AGS genes were examined for their ability to promote activity of the A-37

bp deletion mutant of the 780 gene. The OCS promoter region from positions

-330 to -115 bp, and the AGS promoter region from positions -314 to -155 bp

(relative to their cap sites) were placed separately in both polarities upstream

and downstream of the 780 gene A-37 clone. The autoradiographs of S1 nuclease

mapping gels involving the OCS and AGS constructions are shown in Fig. 3-4B

with the calculated RTL values for each construction shown in Fig. 3-6. Placing

these heterologous promoter fragments either immediately upstream of the

A-37 clone, or approximately 200 bp downstream of the poly (A) addition site, in

both polarities produced levels of activity comparable to the A-37 deletion

alone with one exception. The OCS fragment in the B orientation resulted in

14% of activity relative to the 780 wild type gene activity level. The activity in

the B orientation was a 7-fold increase over the activity level (2%) of the OCS

fragment in the normal A orientation.




Conclusion



The activator region of the 780 gene was demonstrated to possess some

characteristics which are also shared by enhancer elements. It promotes

transcription when placed in different 5' positions relative to the 780 gene.

The activator region, in contrast to enhancer elements, was unable to function

in the downstream location. The transcriptional activity was elevated

































Figure 3-6. Schematic of the OCS and AGS fragment in various
positions relative to the 780 A-37 gene. The OCS and AGS constructions
correspond to the Sl nuclease analysis in Fig. 3-4B. The dark hatched arrows
represent the the OCS fragment (-330 to -115 bp relative to the original OCS
gene cap site) whereas the light hatched arrows represent AGS promoter
fragment (-314 to -133 bp relative to the original AGS gene cap site). "WT"
refers to the wild type 780 gene with its components as described in Fig. 3-5.
The panel at the right shows the RTLs representing percentages of 780 wild
type gene activity. The RTLs varied to within 0.8 percentage points between
experiments.















+1
-476 -112-37 e

WT l


OCS 5' A
-330 -115

OCS 5' B
-115 -330

AGS 5' A
-314 -133

AGS 5' B
-133 -314
-37
0


780 GENE


+92

-1


OCS 3' A


OCS


AGS


AGS 3' B


-33



-11


-31



-13


6


0 -115



5 -330


4 -133



3 -314


A-37


RTL


100


2.0



14


2.0


<2.0


2.0



<2.0



2.0


I









approximately 2-fold over wild type levels when this element was placed

further (613 bp) upstream by inserting a DX 174 fragment between the

activator element and the -37 bp site. This latter construction also

demonstrated that the 780 gene does not require an upstream element for wild

type levels of activity since the upstream element could be replaced by 4X174

sequences and still retain high activity. By sequence inspection, the -476/-112

bp and -476/-200 bp fragments in both polarities contain CAAT box-like

sequences that may replace the wild type CAAT boxes which were removed

during the constructions of the promoter mutations. Whether these CAAT

box-like sequences actually contribute to the transcriptional regulation is still

unresolved.

Aside from the activator element acting in a constitutive manner, this

element shares some properties of the rbcS light-inducible enhancer-like

element. Both of these elements are able to promote activity in either polarity

but apparently only in the 5' location. Also neither the 780 gene nor the rbcS

gene seem to require sequences around the CAAT box since deletion of these

TATA-proximal regions result in elevation of the transcriptional activities. It is

possible that plant enhancer-like elements may only work in the 5' location of

a gene since a demonstration of any such activities in the 3' position has not

been made.

The OCS and AGS sequences upstream of their CAAT boxes, in general, did

not efficiently activate transcription of the A-37 bp 780 deletion clone except

for one construction involving the reverse polarity of the OCS fragment. This

particular construction stimulated transcription 7-fold over background levels

but was still only 1/7 of the 780 gene wild type level. An explanation for the B

orientation of the OCS fragment promoting this increase in transcription

when compared to the A orientation could be due to the presence of regions of









homology of the OCS fragment in the B orientation with the 780 promoter

region. The 780 promoter does show such homologies including a 14 bp region

(also includes the distal a repeat) from -435 to -421 bp of the 780 promoter (see

Fig. 2-14) that is similar to a 14 bp sequence (with 2 bp mismatch) present in

the reversed OCS fragment positioned from -220 to -234 bp relative to the cap

site of the 780 A-37 deletion clone. Another 11 bp sequence present in the OCS

fragment in the B orientation is positioned -130 to -141 bp relative to the cap

site of the A-37 deletion clone which is homologous to a similar sequence in the

780 promoter positioned at -124 to -113 bp (allowing for 2 bp mismatch).

In addition, the 780 gene repeat c has nearly 80% homologies to a few

regions of the OCS sequence in both polarities. Two sites of homology can be

found in the OCS sequence in the B orientation at positions -267 and -180 bp

relative to the deleted 780 gene cap site whereas one site can be found in the A

orientation at position -194 bp relative to the A-37 cap site. Sequences of AGS

and DX 174 fragments or the T-DNA region upstream of all deletion

constructions do not show any obvious homologies. The reason for the OCS

fragment only working in one orientation is still unclear, since it contains the

sequence homologies to the the activator element which was able to work in

both polarities. Therefore further examination is still needed of whether these

sequences that are homologous to the OCS fragment in the B orientation are

important for transcriptional activity.

It is also possible the OCS and AGS genes may have enhancer-like

elements present in their promoters but these elements are only capable of

functioning in the presence of both an upstream element and TATA box. The

only previous demonstration of an enhancer-like element within the OCS

promoter was reported by A. J. Peacock et al., at the First International

Symposium on Plant Molecular Genetics in Savannah, Georgia, (October









28-November 2, 1985). They reported that a fragment from the OCS promoter,

located upstream of the CAAT box, was able to promote inducible activities

while positioned in either polarity at the -145 bp site of Adh-1 gene of maize.

In this case, the -145 bp promoter of Adh-1 may still include its own functional

upstream element which may possibly fulfill the requirement for an upstream

element by the putative OCS enhancer element for activation of transcription.

The 780 activator region seems to differ from the OCS or AGS fragments in this

respect by not having a strong requirement for an upstream element for

activator function.

Another possibility of why the OCS or AGS fragment did not efficiently

activate transcription of the 780 A-37 bp deletion clone was that these

promoter sequences may only effectively activate their own core promoter

(upstream element and TATA box) regions and not certain classes of

heterologous core promoters. An example of such specificity of interaction is

seen in the enhancers of the immunoglobulin genes. Both the K chain and the

heavy chain enhancers stimulated their own promoters 20-fold when

compared to their effect on SV40 (lacking its enhancer region) and

metallothionein (including nearly 2 kbp of promoter sequence) (48). The TATA

box of the HSV tk gene also preferentially functions with its own upstream

element (17). It is therefore possible that the OCS and AGS fragments may have

a preference for particular promoter sequences in their activation of

transcription.

In conclusion, the 780 enhancer-like element may be different to other

similar elements in other T-DNA genes, like the OCS and AGS genes. It is found

further upstream than elements required for activity in the other

characterized T-DNA genes, and it can function in both polarities without the

presence of the CAAT box. By analogy with animal enhancers, the 780






88


activator is likely to interact with specific transcription factors in the

regulation of transcription. The possibility of such an interaction was

examined using various plant nuclear extracts in the next chapter.

















CHAPTER 4

IN VITRO NUCLEAR FACTOR BINDING TO THE 780 ACTIVATOR ELEMENT





Introduction


Enhancers in animal genes mediate their control of transcription

through the specific binding of nuclear trans-acting factors. This interaction

is able to engage other promoter elements near the initiation site over a

considerable distance. The activator element of the 780 gene was previously

shown in chapter 3 to have enhancer-like characteristics. This element

residing nearly 200 bp from the TATA box and having a bidirectional activity,

is likely to bind nuclear factors and initiate transcription in a fashion similar

to the enhancers characterized in animal and viral genes.

Since the 780 gene was previously shown to be transcribed in tobacco as

well as sunflower tissues, these two plants species may contain similar

transcriptional factors interacting with the 780 promoter elements. Studies of

the immunoglobulin (137, 169), axl-globin (20), and the proto-oncogene c-fos

genes (50) in animals utilized an electrophoretic mobility shift assay to

demonstrate specific protein-DNA interaction. The electrophoretic mobility

shift assay is useful in identifying regions of the promoter where specific

binding occurs (20, 50, 169) as well as in the screening for the presence of

specific DNA binding factors from different tissues (137). In this study the

activator element was shown to bind specifically to factors from plant crude









nuclear extracts originating from two different plant species. This interaction

was first determined by electrophoretic mobility shift assay and then

examined more closely by in vitro DNase I digestion protection analysis. The

electrophoretic mobility shift assay detects specific factor binding to a labeled

DNA fragment which causes a retardation of mobility relative to the free DNA

fragment when separated on a low percent acrylamide gel. The assay is a

relatively simple, allowing one to characterize binding under a variety of

conditions as well as roughly map areas of a promoter where specific

interactions with nuclear factors occur.

The DNase I protection analysis permits a nucleotide level resolution, of

regions protected from digestion by factor binding. This technique can

identify short sequences recognized by certain nuclear factors and has been

utilized in the determination of the sequence of the Spl binding site (34). It

may be possible to obtain a more complete picture of the 780 gene promoter

function by correlating functional domains identified by deletion analysis

with those regions involved in specific factor binding.


Materials and Methods



Preparation of Crude Nuclear Extract from Plant Plumules

Preparation of crude nuclear extracts from sunflower and soybean

were performed from a procedure (169) as follows. Approximately 100 g of

plumules from either one-week old sunflower (H. annuus cv. Large Grey) or

etiolated soybean seedlings (Glycine max) were placed in 2X v/wt of ice cold
solution I (10 mM Hepes [pH 7.9], 0.3 M sucrose, 10 mM KC1, 1.5 mM MgC12, 0.1

mM EGTA, 0.5 mM DTT and 0.5 mM phenylmethylsulfonyl flouride (PMSF,

Sigma). Most of the extraction procedure was performed in the cold room at

4C. The plant mixture was homogenized for 1-2 minutes using a Tekmar









Tissuemizer at high speed, then filtered through mira cloth (Calbiochem)

reinforced with cheescloth. The nuclei from the filtrate was collected by

centrifugation at 2000 Xg for 10 minutes at 4C. The supernatent was discarded

and the pellet gently resuspended in 20 ml of solution I. The resuspended

nuclei were mixed with 13 strokes using a Dounce homogenizer (2 strokes are a

down and up movement) then collected again by centrifugation at 2000 Xg for

10 minutes at 4C. The supernatant was discarded and the loose nuclear pellet

was resuspended gently in 7 ml of solution II (10 mM Hepes [pH 7.9], 450 mM

NaCI, 1.5 mM MgC12, 0.1 mM EGTA, 0.5 mM DTT, 0.5 mM PMSF and 5% glycerol)

using a stirring rod every 5 minutes while on ice. This gentle stirring was

carried out for 30 minutes to allow nuclear factors to diffuse out of intact

nuclei. Nuclear material and any remaining debris were removed from this

mixture by centrifugation at 100,000 Xg for 1 hour at 4C. The supernate was

dispensed into aliquots, frozen in liquid N2, and stored at -700C. Protein

concentrations were determined by the method of Bradford (12).



Electrophoretic Mobility Shift Assay

Electrophoretic mobility shift assays using the activator region of the

780 gene were performed by a modified method of Singh et al. (147).

Approximately 0.5-1.0 ng of an end-labeled fragment (-476 to -200 bp of the 780

gene promoter unless otherwise specificied) was incubated with 2.5 tl of

soybean extract in a final volume of 26 u1 containing 16 mM Hepes [pH7.9], 60

mM NaCI, 0.1 mM EDTA, 0.5 mM DTT, 0.5 mM PMSF, and 20% glycerol. A typical

binding assay involving the sunflower nuclear extract was carried out at room

temperature in a final reaction volume of 20 pl consisting of 10 mM Tris-HCI

(pH 7.5), 1 mM DTT, 1 mM EDTA, 5% glycerol and 2.5 l.1 of the sunflower extract

present in solution II. The amount of poly (dl-dC) DNA, competitor DNA,









noncompetitor DNA, Triton-X-100 (Sigma), and MgC12 were varied as indicated

(see Results).

After 30 minutes, the binding reaction was fractionated on a 4%

polyacrylamide gel (30:1, acrylamide to bis-acrylamide) with recirculated

buffer consisting of 6.7 mM Tris-HCI (pH 7.5), 3.3 mM Na acetate, and 1 mM

EDTA. The gel was prerun for 30 minutes at 150 volts (11 volts/cm) at room

temperature before loading the samples which were then run at the same

voltage for 4 hours. After the run, the gel was fixed in 10% acetic acid, 10%

methanol solution for 20 minutes, washed with distilled water for 15 minutes,

then dried under vacuum on a 3MM Whatman filter using a heated slab gel

drier. The dried gel was exposed to XRP-5 X-ray film (Kodak) in the presence of

an intensifier screen at -70C for 2-5 days.



DNase I Protection Assay

DNase I protection assays were performed on the activator region of the

780 gene using the nuclear extract from soybean plumules. Approximately 1-2

ng of 3' end-labeled DNA fragment (-476 to -200 bp of the 780 gene promoter)

with 100 ng of QX174 HaeIII digested DNA as carrier were incubated with 0.5-3

t41 of solution II containing the crude nuclear extract. The DNA was added to a

final volume of 44 tl of 0.7 mM Hepes (pH 7.9), 30 mM NaCI, 0.1 mM MgCI2, 0.03

mM DTT, 0.03 mM PMSF and 3% glycerol, and incubated for 30 minutes at room

temperature. After binding, 5 p.1 of DNase I buffer was added to final

concentrations of 50 mM Na acetate (pH 6.5), 10 mM MgCl2, and 2 mM CaCl2

containing freshly diluted DNase I (Bethesda Research Laboratories) at a final

concentration of 25 ng/ml and incubated for 3 minutes at room temperature.

The optimum amount of DNase I was determined emperically for the best

distribution of digested DNA bands. The DNase I reaction was terminated by









adding 1/10 volume of 200 mM EDTA and 10 gtg of tRNA before extracting with

phenol:chloroform: isoamyl alcohol (25:24:1). The DNA fragments were

precipitated by the addition of 1/9 volume of 3M Na acetate (pH 5.2) and 2.2 X

volume of 95% ethanol. The resuspended pellets were analyzed on an 8%

polyacrylamide gel with 7 M urea, and exposed to XAR-5 X-ray film for 3-7 days

at -700C with an intensifier screen.



Results



Analysis of Nuclear Factors Complexed with 780 Activator Region

The electrophoretic mobility shift assay was used to assess the ability of

various fragments of the 780 activator region to form specific DNA-protein

complexes when incubated with crude nuclear extracts from sunflower or

soybean seedlings. Specific conditions of the binding reaction were varied to

obtain optimum interaction. Homologous and nonhomologous DNA was also

used for competition in the in vitro binding reaction with the end-labeled

probe to determine the specificity of the DNA-protein complex.

Four 3' end-labeled probes from different regions of the 780 activator

region were incubated with sunflower extracts and examined by the

electrophoretic mobility shift assay. Low intensity bands with reduced

mobilities were detected while using 3 of the 4 fragments which included the

-476/-347, -382/-248, and -310/-189 bp regions (Fig. 4-1). The -427/-290 bp

fragment apparently did not bind to the factors since no distinct band was

seen to shift. Factor interaction with the activator region seemed to be

localized to two regions: one from -476 to -427 bp and the other from -290 to

-189 bp. The apparent lack of binding of the -427/-290 bp fragment may reflect






94















11 2 3"4 5 6'7 8 9 1011 12








Is

Icc-


Bound






Free





Figure 4-1. Electrophoretic mobility shift assay of various 780
activator element fragments using sunflower extract. These activator
fragments were excised from either 5' or 3' 780 deletion clones and 3'
end-labeled at the Sall sites (*). Approximately 1 ng (3000 cpm) of these
labeled fragments was incubated with 2.5 Iil of crude sunflower extract as
described in Materials and Methods. Lanes 1, 4, 7, and 10 contain free DNA
fragment. Lanes 2, 5, 8, and 11 contain labeled fragment incubated with the
extract. Lanes 3, 6, 9 and 12 contain labeled DNA incubated with extract and 5
4g of poly (dI-dC) DNA. Bound refers to the specific protein-DNA complex and
free refers to the unbound labeled fragment.


_~~_~I~~C _




Full Text

PAGE 1

&+$5$&7(5,=$7,21 2) )81&7,21$/ '20$,16 2) $ 7'1$ 352027(5 $&7,9( ,1 681)/2:(5 780256 %\ :(6/(< %(51$5' %58&( $ ',66(57$7,21 35(6(17(' 72 7+( *5$'8$7( 6&+22/ 2) 7+( 81,9(56,7< 2) )/25,'$ ,1 3$57,$/ )8/),//0(17 2) 7+( 5(48,5(0(176 )25 7+( '(*5(( 2) '2&725 2) 3+,/2623+< 81,9(56,7< 2) )/25,'$

PAGE 2

7R WKH PHPRU\ RI P\ IDWKHU -RKQ : %UXFH

PAGE 3

$&.12:/('*0(176 ZLVK WR WKDQN 6DELWD %DQG\RSDG\KD\ DQG +DPSWRQ 0F5DH DQG WKHLU PDQ\ DVVLVWDQWV IRU WKHLU WHFKQLFDO H[SHUWLVH DOVR ZLVK WR WKDQN (YD &]DUQHFND 'XOFH %DUURV DQG 5DP %DQG\RSDGK\D\ IRU JXLGDQFH FRQFHUQLQJ PDQ\ RI WKH SURFHGXUHV LQYROYHG LQ WKLV VWXG\ RZH D GHEW RI JUDWLWXGH WR -RKQ ,QJHUVROO DQG /XLV 0RVTXHUD IRU SURYLGLQJ PRUDO VXSSRUW DV IHOORZ JUDGXDWH VWXGHQWV ZKHQ QHHGHG LW DQG IRU WKHLU XQHQGLQJ KXPRU PDNLQJ ODE ZRUN PRUH HQMR\DEOH $ VSHFLDO PHQWLRQ JRHV WR -DPHV 6WDQJD IRU KLV EULHI DQG YDOXDEOH KHOS LQ VFUHHQLQJ VRPH RI WKH GHOHWLRQ PXWDQWV XVHG LQ &KDSWHU DOVR RZH D JUHDW GHEW RI JUDWLWXGH WR P\ FRPPLWWHH PHPEHUV 5REHUW )HUO )UDQFHV 'DYLV -DPHV 3UHVWRQ DQG &XUW +DQQDK IRU WKHLU LQYDOXDEOH VXSSRUW DQG HQFRXUDJHPHQW IRU WKLV ZRUN DQG IRU SURYLGLQJ VROXWLRQV WR P\ VHHPLQJO\ XQHQGLQJ TXHVWLRQV DOVR ZLVK WR H[SUHVV P\ GHHSHVW WKDQNV WR :LOOLDP *XUOH\ IRU VXSSRUW DQG JXLGDQFH IRU LQVSLULQJ FUHDWLYH LQQRYDWLRQV IRU KLV DFFHSWDQFH IRU QHZ LGHDV DQG IRU VLPSO\ EHLQJ D IULHQG LQ WLPHV RI QHHG $ERYH DOO ZRXOG OLNH WR H[SUHVV P\ ZDUPHVW WKDQNV WR P\ ZLIH .DUHQ IRU SURYLGLQJ PH ZLWK WKH FRXUDJH DQG GHWHUPLQDWLRQ WR FRQWLQXH ZLWK WKLV ZRUN DQG VHHLQJ LW WR WKH HQG LLL

PAGE 4

7$%/( 2) &217(176 3DJH $&.12:/('*(0(176 LLL $%675$&7 Y &+$37(56 ,1752'8&7,21 3URPRWHU 6WUXFWXUH RI $QLPDO DQG 9LUDO *HQHV 3ODQW 3URPRWHU 6WUXFWXUH 352027(5 087$7,21 $1$/<6,6 ,QWURGXFWLRQ 0DWHULDOV DQG 0HWKRGV 5HVXOWV &RQFOXVLRQ (1+$1&(5 3523(57,(6 2) 7'1$ 352027(56 ,QWURGXFWLRQ 0DWHULDOV DQG 0HWKRGV 5HVXOWV &RQFOXVLRQ ,1 9,752 18&/($5 )$&725 %,1',1* 72 7+( $&7,9$725 (/(0(17 ,QWURGXFWLRQ 0DWHULDOV DQG 0HWKRGV 5HVXOWV &RQFOXVLRQ 6800$5< 5()(5(1&(6 %,2*5$3+,&$/ 6.(7&+

PAGE 5

$EVWUDFW RI 'LVVHUWDWLRQ 3UHVHQWHG WR WKH *UDGXDWH 6FKRRO RI WKH 8QLYHUVLW\ RI )ORULGD LQ 3DUWLDO )XOILOOPHQW RI WKH 5HTXLUHPHQWV IRU WKH 'HJUHH RI 'RFWRU RI 3KLORVRSK\ &+$5$&7(5,=$7,21 2) )81&7,21$/ '20$,16 2) $ 7'1$ 352027(5 $&7,9( ,1 681)/2:(5 780256 E\ :HVOH\ %HUQDUG %UXFH 0D\ &KDLUPDQ :LOOLDP % *XUOH\ &RFKDLUPDQ )UDQFLV & 'DYLV -U 0DMRU 'HSDUWPHQW 0LFURELRORJ\ DQG &HOO 6FLHQFH 7KUHH SURPRWHU GRPDLQV UHTXLUHG IRU WUDQVFULSWLRQDO H[SUHVVLRQ RI WKH JHQH RI 7ULJKW S7L f ZHUH LGHQWLILHG E\ PXWDJHQHVLV 7KHVH GRPDLQV DUH DQDORJRXV WR WKH 7$7$ XSVWUHDP HOHPHQW DQG HQKDQFHU W\SLFDO RI PDQ\ DQLPDO DQG YLUDO JHQHV 3UHFLVH TXDQWLILFDWLRQ RI WUDQVFULSWLRQDO DFWLYLW\ LQ VXQIORZHU WXPRUV RI D VHULHV RI n DQG LQWHUQDO GHOHWLRQV ZDV DFKLHYHG E\ XVLQJ D GRXEOH JHQH YHFWRU FRQWDLQLQJ D UHIHUHQFH JHQH DV DQ LQWHUQDO VWDQGDUG 5HVXOWV RI WKH f GHOHWLRQV GHOLQHDWHG DQ DFWLYDWRU HOHPHQW ORFDWHG DQG EDVH SDLUV ESf IURP WKH VWDUW RI WUDQVFULSWLRQ 5HPRYDO RI WKLV HOHPHQW UHVXOWHG LQ D IROG GURS LQ DFWLYLW\ UHODWLYH WR ZLOG W\SH /DUJH VFDOH LQWHUQDO GHOHWLRQV WR ESf RFFXULQJ LQ YDULRXV ORFDWLRQV IURP SRVLWLRQV WR ES FDXVHG VLJQLILFDQW UHGXFWLRQV LQ WKH PDMRU SURPRWHU WUDQVFULSWLRQDO DFWLYLW\ +RZHYHU LQWHUQDO GHOHWLRQV VWDUWLQJ DW SRVLWLRQ DQG H[WHQGLQJ WR ES HLWKHU KDG OLWWOH HIIHFW RU LQFUHDVHG DFWLYLW\ 5HPRYDO RI WKH 7$7$ PRWLI GUDVWLFDOO\ UHGXFHG DFWLYLW\ WR b RI ZLOG W\SH 7KH DFWLYDWRU ZDV VKRZQ WR KDYH HQKDQFHUOLNH SURSHUWLHV E\ LWV SRVLWLRQ DQG LWV VWLPXODWLRQ RI Y

PAGE 6

WUDQVFULSWLRQ LQ ERWK SRODULWLHV XSVWUHDP RI D ES n GHOHWLRQ JHQH HYHQ ZKHQ SRVLWLRQHG ES IXUWKHU XSVWUHDP WKDQ LWV QRUPDO ORFDWLRQ +RZHYHU WKH DFWLYDWRU GLG QRW SURPRWH GHWHFWDEOH OHYHOV RI WUDQVFULSWLRQ ZKHQ ORFDWHG f WR WKH JHQH 7KLV HOHPHQW ZDV DOVR VKRZQ WR VSHFLILFDOO\ LQWHUDFW ZLWK QXFOHDU IDFWRUV SUHVHQW LQ VXQIORZHU DQG VR\EHDQ DV GHWHUPLQHG E\ HOHFWURSKRUHWLF PRELOLW\ DVVD\V DQG '1DVH SURWHFWLRQ DQDO\VLV 7KH XSVWUHDP VHTXHQFHV FD WR ESf RI WKH RFWRSLQH V\QWKDVH 2&6f DQG DJURSLQH V\QWKDVH JHQHV RI 7'1$ GLG QRW SURPRWH HIILFLHQW WUDQVFULSWLRQ ZKHQ LQVHUWHG LQ HLWKHU SRODULW\ XSVWUHDP RU GRZQVWUHDP RI WKH GHOHWHG JHQH ZLWK RQH H[FHSWLRQ 7KH 2&6 JHQH IUDJPHQW VWLPXODWHG WUDQVFULSWLRQ WR b RI ZLOG W\SH DFWLYLW\ OHYHO ZKLOH LQ WKH UHYHUVH SRODULW\ XSVWUHDP RI WKH GHOHWHG JHQH ,Q FRQFOXVLRQ WKH JHQH DSSHDUV WR KDYH D FRPSOH[ SURPRWHU VWUXFWXUH VLPLODU WR DQLPDO DQG YLUDO JHQHV LQ VSLWH RI LWV EDFWHULDO RULJLQ DQG FRQVWLWXWLYH H[SUHVVLRQ YL

PAGE 7

&+$37(5 ,1752'8&7,21 +LVWRULFDOO\ SURFDU\RWLF SURPRWHUV SURYLGHG WKH ILUVW HYLGHQFH RI FLnMDFWLQJ '1$ VHTXHQFHV FRQWUROOLQJ JHQH H[SUHVVLRQ %DFWHULDO SURPRWHUV KDYH EHHQ FKDUDFWHUL]HG DV UHJLRQV RI '1$ WKDW ELQG 51$ SRO\PHUDVH IRU VSHFLILF LQLWLDWLRQ RI WUDQVFULSWLRQ f 7KH VHTXHQFHV RI D PXOWLWXGH RI SURFDU\RWLF JHQHV DUH NQRZQ DQG JHQHUDOO\ VKRZ WZR KLJKO\ FRQVHUYHG UHJLRQV n WR WKH VWDUW RI WUDQVFULSWLRQ WKDW DUH LQYROYHG LQ FRQWURO f 2QH RI WKHVH UHJLRQV ODEHOHG WKH 3ULEQRZ ER[ RU WKH 7$7$ ER[ KDV D VHTXHQFH FRQVHQVXV RI 7$7$$7*n ORFDWHG DW SRVLWLRQ EDVHSDLUV ESf IURP WKH VWDUW RI WUDQVFULSWLRQ 7KH RWKHU FRQWURO UHJLRQ NQRZQ DV WKH UHFRJQLWLRQ VLWH LV DSSUR[LPDWHO\ ORFDWHG ES XSVWUHDP RI WKH VWDUW VLWH 2WKHU VHTXHQFHV XSVWUHDP RI WKH UHFRJQLWLRQ VLWH FRQIHU D QHJDWLYH RU SRVLWLYH UHJXODWLRQ LQ VRPH JHQHV +LJKO\ UHJXODWHG WUDQVFULSWLRQ XVXDOO\ HQWDLOV HLWKHU UHSUHVVRU SURWHLQV ELQGLQJ WR RSHUDWRU '1$ SUHYHQWLQJ 51$ SRO\PHUDVH IURP ELQGLQJ RU DQ DFWLYDWRU SURWHLQ VWLPXODWLQJ WUDQVFULSWLRQ E\ ELQGLQJ WR VSHFLILF '1$ VHTXHQFHV IDUWKHU XSVWUHDP DQG SUHVXPDEO\ PDNLQJ FRQWDFW ZLWK WKH 51$ SRO\PHUDVH f %DVHG RQ VHTXHQFH FRPSDULVRQV HXFDU\RWLF SURPRWHUV VKRZ VRPH VWULNLQJ VLPLODULWLHV WR SURFDU\RWLF SURPRWHUV PDLQO\ RI WKH 3ULEQRZ ER[ DQG WKH UHFRJQLWLRQ VLWH 7KH FRQVHUYDWLRQ RI VHTXHQFH KRPRORJ\ LQ WKH f IODQNLQJ UHJLRQ RI JHQHV VXJJHVWV D SUHVHUYDWLRQ LQ WKH EDVLF PHFKDQLVPV RI WUDQVFULSWLRQDO FRQWURO EHWZHHQ PRVW RUJDQLVPV )XQFWLRQDO DQDO\VHV RI WKHVH

PAGE 8

KLJKO\ FRQVHUYHG UHJLRQV DV ZHOO DV RWKHU VHTXHQFHV SRVVLEO\ UHTXLUHG IRU HXFDU\RWLF JHQH H[SUHVVLRQ FDQ EH PDGH E\ LQ YLWUR PXWDJHQHVLV DQG XVLQJ ERWK LQ YLYR DQG LQ YLWUR WUDQVFULSWLRQ V\VWHPV 3UHYLRXV WHVWLQJ RI SURPRWHU PXWDWLRQV RI DQLPDO DQG YLUDO JHQHV KDV HVWDEOLVKHG GRPDLQV WKDW JRYHUQ WUDQVFULSWLRQDO UHJXODWLRQ 7KHVH GRPDLQV KDYH URXJKO\ EHHQ FDWDJRUL]HG LQWR WKUHH PDMRU HOHPHQWV EDVHG RQ VHTXHQFH ORFDWLRQ DQG IXQFWLRQ f 3URPRWHU 6WUXFWXUH RI $QLPDO DQG 9LUDO *HQHV 7KH 7$7$ %R[ 2I WKH SURPRWHU GRPDLQV RI DQLPDO DQG YLUDO JHQHV WKDW DUH VLPLODU WR IXQFWLRQDO GRPDLQV LQ SURFDU\RWLF SURPRWHUV DQ $7ULFK UHJLRQ VHHPV WR EH WKH PRVW KLJKO\ FRQVHUYHG 7KLV UHJLRQ FRQWDLQV WKH VHTXHQFH NQRZQ DV WKH 7$7$ ER[ DQG LV XVXDOO\ IRXQG DSSUR[LPDWHO\ WR ES XSVWUHDP IURP WKH VWDUW RI WUDQVFULSWLRQ 0RVW RI WKH JHQHV VHTXHQFHG VKRZ KRPRORJ\ LQ WKLV UHJLRQ ZLWK D FRQVHQVXV RI n7$7$$nSf$$Mfn f 7KH 7$7$ ER[ IXQFWLRQV VLPXOWDQHRXVO\ LQ SRVLWLRQLQJ WKH VWDUW RI WUDQVFULSWLRQ DQG PDLQWDLQLQJ WKH UDWH RI WUDQVFULSWLRQ f 8VLQJ GHOHWLRQ PXWDQWV RI WKH FRQDOEXPLQ DQG WKH DGHQRYLUXV $Gf PDMRU ODWH JHQHV WKLV PRWLI ZDV VKRZQ WR EH UHTXLUHG IRU DFFXUDWH LQLWLDWLRQ RI WUDQVFULSWLRQ f $GGLWLRQDOO\ WKH 7$7$ UHJLRQ DORQH IURP WKH $G PDMRU ODWH JHQH WR ESf LQLWLDWHV VSHFLILF WUDQVFULSWLRQ VWDUWLQJ DERXW ES GRZQVWUHDP HYHQ ZKHQ FORQHG LQ WKH SODVPLG S%5 f 5HPRYDO RI 7$7$ VHTXHQFHV IURP WKH VLPLDQ YLUXV 69f HDUO\ UHJLRQ f DV ZHOO DV IURP WKH VHD XUFKLQ KLVWRQH +$ JHQH f GRHV QRW HOLPLQDWH DFWLYLW\ EXW SURGXFHV KHWHURJHQHRXV VLWHV RI LQLWLDWLRQ +RZHYHU D VLQJOH EDVH SDLU WUDQVYHUVLRQ 7 WR *f DW WKH VHFRQG 7 LQ WKH FRQDOEXPLQ 7$7$ ER[ GUDVWLFDOO\ UHGXFHV WUDQVFULSWLRQDO DFWLYLW\ LQ YLWUR

PAGE 9

f $ VLPLODU UHVXOW RFFXUV ZKHQ SRLQW PXWDWLRQV DUH PDGH LQ WKH 7$7$ PRWLI RI WKH PRXVH 3PDMRU JORELQ JHQH LQWURGXFHG LQWR +H/D FHOOV ZKLFK UHGXFHV WUDQVFULSWLRQ WR b UHODWLYH WR ZLOG W\SH OHYHOV f 7KH VDPH SRLQW PXWDWLRQV LQ WKH JORELQ JHQH DOVR DOWHUHG WKH LQLWLDWLRQ VLWH ,Q DQRWKHU VWXG\ 7RNXQDJD HW DO f GHPRQVWUDWHG LQ YLYR WKH UHTXLUHPHQW RI WKH 7$7$ ER[ IRU VSHFLILF WUDQVFULSWLRQ LQ WKH %RPE\[ PRUL ILEURLQ JHQH H[SUHVVHG LQ PRQNH\ &26 FHOOV $Q LQWHUQDO GHOHWLRQ WR ESf DQG SRLQW PXWDWLRQV LQ WKH 7$7$ PRWLI GUDVWLFDOO\ DIIHFWHG WKH WUDQVFULSWLRQDO DFWLYLW\ ZKLOH DOWHULQJ VLWHV RI LQLWLDWLRQ $SSDUHQWO\ WKH 7$7$ ER[ RQO\ IXQFWLRQV LQ SRVLWLRQLQJ WKH VWDUW RI WUDQVFULSWLRQ IRU VRPH JHQHV ,Q RWKHU FDVHV WKH 7$7$ LV UHTXLUHG IRU QRUPDO WUDQVFULSWLRQDO DFWLYLW\ DV ZHOO LQ WKH GHWHUPLQDWLRQ RI WKH LQLWLDWLRQ VLWH $OWKRXJK WKH HXFDU\RWLF 51$ SRO\PHUDVHV KDYH QRW EHHQ VKRZQ WR ELQG GLUHFWO\ WR VSHFLILF UHJLRQV ZLWKLQ WKH SURPRWHU f RWKHU FHOOXODU IDFWRUV DUH DEOH WR FRPSOH[ ZLWK '1$ LQ WKH 7$7$ PRWLI DQG DW RWKHU n FRQWURO VHTXHQFHV 7KH ELQGLQJ RI WKHVH FHOOXODU IDFWRUV LQ WXUQ PD\ SRVVLEO\ SURYLGH WKH VLWHV IRU HXFDU\RWLF 51$ SRO\PHUDVH ,, WR LQWHUDFW ZLWK WKH SURPRWHU LQ D VSHFLILF IDVKLRQ 7KH 7$7$ ER[HV LQ WKH FRQDOEXPLQ SURPRWHU DQG LQ WKH $G ODWH SURPRWHU IRUP VWDEOH SUHLQLWLDWLRQ FRPSOH[HV ZLWK D +H/D FHOO IDFWRU LQ WKH DEVHQFH RI 51$ SRO\PHUDVH ,, f 3DUNHU DQG 7RSRO f DOVR GHPRQVWUDWHG ELQGLQJ RI D FKURPDWRJUDSKLFDOO\ GLVWLQJXLVKDEOH FRPSRQHQW SUHSDUHG IURP LVRODWHG QXFOHL RI FXOWXUHG 'URVRSKLOD .F FHOOV WR WKH 7$7$SUR[LPDO UHJLRQV RI WKH 'URVRSKLOD KLVWRQH + + DQG & JHQHV )RRWSULQW DQDO\VLV RQ WKLV FRQFHQWUDWHG N' f% IDFWRU UHYHDOHG WKH SUHVHQFH RI VHTXHQFH VSHFLILF '1$ELQGLQJ DFWLYLW\ WR UHJLRQV ZKLFK LQFOXGHG WKH 7$7$ ER[ WKH VWDUW RI WUDQVFULSWLRQ DQG D SRUWLRQ RI WKH OHDGHU VHTXHQFH RQ WKHVH KLVWRQH JHQHV 7KH 7$7$ VHTXHQFH IURP D 'URVRSKLOD KHDW VKRFN JHQH KVS FDQ EH SURWHFWHG

PAGE 10

IURP H[RQXFOHDVH ,,, GLJHVWLRQ EHWZHHQ WR ES UHODWLYH WR WKH FDS VLWH ZLWK D IDFWRU SUHVHQW LQ 'URVRSKLOD FHOO QXFOHL f 7KH DXWKRU RI WKLV ODWWHU VWXG\ EHOLHYHV WKDW WKLV IDFWRU LQYROYHG ZLWK WKH 'URVRSKLOD KHDW VKRFN JHQH PD\ ELQG VHOHFWLYHO\ WR KHDW VKRFN 7$7$ ER[HV DQG QRW WR DQDORJRXV PRWLIV RI RWKHU JHQHV ZKLFK DUH WUDQVFULSWLRQDOO\ LQDFWLYH GXULQJ KHDW VWUHVV f %DVHG RQ WKLV DVVXPSWLRQ 7$7$ELQGLQJ IXQFWLRQV PD\ H[LVW DV D IDPLO\ RI SURWHLQV HDFK UHFRJQL]LQJ XQLTXH VHTXHQFHV VXUURXQGLQJ WKH 7$7$ PRWLI %DVHG RQ VHTXHQFH DQDO\VLV D IHZ DQLPDO JHQH SURPRWHUV VHHP WR GHYLDWH IURP WKH UHTXLUHPHQW RI KDYLQJ D 7$7$ ER[ ,QVWHDG RI KDYLQJ WKLV PRWLI WKHVH SURPRWHUV KDYH *&ULFK VHTXHQFHV VLPLODU WR WKH *& ER[ RI WKH 69 XSVWUHDP HOHPHQW VHH EHORZf 7KHVH XQLTXH SURPRWHUV GLUHFW WUDQVFULSWLRQ RI JHQHV JHQHUDOO\ LQYROYHG ZLWK SXULQH DQG S\ULPLGLQH PHWDEROLVP VXFK DV K\SR[DQWKLQH SKRVSKRULERV\O WUDQVIHUDVH f PRXVH GLK\GURIRODWH UHGXFWDVH GKUf f DQG KDPVWHU K\GUR[\PHWK\OJOXWDU\OFRHQ]\PH $ UHGXFWDVH f DQG DUH JHQHUDOO\ WKRXJKW WR EH FRQVWLWXWLYH LQ WKHLU H[SUHVVLRQ 6LQFH WKHVH JHQHV ODFN WKH 7$7$ PRWLI DQ DOWHUQDWH PHWKRG RI SRVLWLRQLQJ WKH VWDUW RI WUDQVFULSWLRQ PD\ H[LVW SRVVLEO\ LQYROYLQJ WKH *& VHTXHQFHV 7KH *&ULFK VHTXHQFHV RI WKH GKU JHQH DOVR LQWHUDFW ZLWK VSHFLILF IDFWRUV ZKLFK PD\ SOD\ D UROH LQ VSHFLI\LQJ WKH VLWH RI WUDQVFULSWLRQDO LQLWLDWLRQ WRJHWKHU ZLWK PDLQWDLQLQJ WKH FRQVWLWXWLYH OHYHO RI H[SUHVVLRQ f 7KH 8SVWUHDP (OHPHQW %DVHG RQ SURPRWHU PXWDWLRQ VWXGLHV DQG WKH SUHVHQFH RI FRQVHUYHG JURXSV RI VHTXHQFHV D UHJLRQ RI WKH n IODQNLQJ VHTXHQFHV LQ DQLPDO DQG YLUDO JHQHV EHWZHHQ WR ES IURP WKH VWDUW RI WUDQVFULSWRQ LV GHILQHG DV WKH XSVWUHDP HOHPHQW f )LYH GLIIHUHQW FRQVHQVXV VHTXHQFHV

PAGE 11

LQFOXGLQJ WKH &$$7 ER[ KDYH EHHQ IRXQG WR EH LQGLYLGXDOO\ SUHVHQW ZLWKLQ WKLV HOHPHQW f ,Q DGGLWLRQ YDULRXV SURPRWHUV DSSHDU WR KDYH GLIIHUHQW FRPELQDWLRQV RI RQH RU PRUH RI WKHVH VXEHOHPHQWV SUHVHQW ZLWKLQ WKH XSVWUHDP HOHPHQW 0DQ\ JHQHV UHTXLUH WKH XSVWUHDP HOHPHQW IRU DFWLYH WUDQVFULSWLRQ VLQFH GHOHWLRQV RU SRLQW PXWDWLRQV ORFDWHG ZLWKLQ WKLV UHJLRQ RIWHQ UHVXOWV LQ D GHFUHDVH LQ WUDQVFULSWLRQDO DFWLYLW\ f +RZHYHU SRLQW PXWDWLRQV ORFDWHG LPPHGLDWHO\ XSVWUHDP RI WKH &$$7 ER[ LQ PRXVH 3JORELQ f DQG +HUSHV VLPSOH[ YLUXV WK\PLGLQH NLQDVH +69 WNf SURPRWHU f UHVXOW LQ D GUDPDWLF LQFUHDVH LQ DFWLYLW\ VRPHWLPHV DV PXFK DV IROG 7KHVH SDUWLFXODU XSPXWDWLRQV PD\ DFW E\ RSWLPL]LQJ WKH DIILQLW\ RI D WUDQVFULSWLRQ IDFWRU IRU WKLV HOHPHQW RU E\ SRVVLEO\ DOWHULQJ WKH FRQIRUPDWLRQ RI WKLV IDFWRU ZKHQ LW LV ERXQG WR WKH SURPRWHU f 7KH XSVWUHDP HOHPHQW LV QRW DOZD\V UHTXLUHG IRU ZLOG W\SH DFWLYLW\ RI WKH SURPRWHU VLQFH VRPH JHQHV PD\ EH H[SUHVVHG DW QRUPDO OHYHOV RU KLJKHU LI WKH XSVWUHDP HOHPHQW LV UHPRYHG OHDYLQJ 7$7$ LQWDFW )RU H[DPSOH GHOHWLRQ RI D UHJLRQ IURP WR ES WKDW LQFOXGHV WKH &$$7 VHTXHQFHV IURP WKH VHD XUFKLQ +$ KLVWRQH JHQH LQMHFWHG LQWR ;HQRSXV RRF\WHV LQFUHDVH DFWLYLW\ QHDUO\ IROG f ,Q DQRWKHU VWXG\ ZKHUH WKH n VHTXHQFHV RI WKH ILEURLQ JHQH ZHUH UHPRYHG WR SRVLWLRQ ES ZLWK RQO\ WKH 7$7$ PRWLI UHPDLQLQJ QRUPDO UDWHV RI WUDQVFULSWLRQ LQ YLYR f ZHUH VWLOO REVHUYHG 5HPRYDO RI 7$7$ VHTXHQFHV KRZHYHU UHVXOWHG LQ D FRPSOHWH ORVV RI WUDQVFULSWLRQDO DFWLYLW\ LQ WKLV JHQH 7KH XSVWUHDP HOHPHQWV RI WKH KXPDQ SJORELQ JHQH FDQ DOVR EH GHOHWHG UHVXOWLQJ LQ QRUPDO WUDQVFULSWLRQ OHYHOV ZKHQ WUDQVIHUUHG LQWR FHOOV WKDW H[SUHVV WKH $G YLUDO (OD JHQH SURGXFWV f 7KH HIIHFWV RI WUDQVFULSWLRQDO DFWLYDWLRQ RI WKH 3JORELQ JHQH E\ WKH (OD JHQH SURGXFWV VHHP WR EH PHGLDWHG WKURXJK WKH 7$7$ ER[ VLQFH WKH 3JORELQ JHQH GRHV QRW UHTXLUH WKH XSVWUHDP HOHPHQW IRU DFWLYLW\

PAGE 12

,Q JHQHV UHTXLULQJ WKH XSVWUHDP HOHPHQW IRU DFWLYLW\ VSDFLQJ EHWZHHQ 7$7$ DQG VXEFRPSRQHQWV RI WKH XSVWUHDP HOHPHQW LV VRPHZKDW LQIOH[LEOH IRU RSWLPDO SURPRWHU H[SUHVVLRQ )RU H[DPSOH WKH SURPRWHU RI +69 WN JHQH FRQWDLQV WKUHH UHJLRQV LPSRUWDQW IRU WUDQVFULSWLRQ f 7ZR RI WKHVH UHJLRQV FRQVWLWXWH WKH XSVWUHDP HOHPHQW DQG DUH GHVLJQDWHG GV DQG GV ZKLOH WKH WKLUG UHJLRQ GHVLJQDWHG MOV LQFOXGHV WKH 7$7$ ER[ :KHQ ES DUH UHPRYHG EHWZHHQ MOV DQG GV WKH OHYHO RI WUDQVFULSWLRQ GURSV WR b RI ZLOG W\SH DFWLYLW\ +RZHYHU WR ES FDQ EH LQVHUWHG EHWZHHQ SL DQG GV ZLWKRXW DGYHUVHO\ DIIHFWLQJ WUDQVFULSWLRQ ,QFUHDVLQJ WKH GLVWDQFH EHWZHHQ WKH XSVWUHDP HOHPHQW DQG 7$7$ DOVR UHGXFHV SURPRWHU DFWLYLW\ OHYHO VLQFH WKH LQWURGXFWLRQ RI PRUH WKDQ ES UHVXOWV LQ OHVV WKDQ b DFWLYLW\ 7KH VSDFLQJ EHWZHHQ GV DQG GV LV PXFK OHVV IOH[LEOH LQ WKDW RQO\ ES FDQ HLWKHU EH LQVHUWHG RU UHPRYHG EHWZHHQ WKHVH WZR VHTXHQFH PRWLIV ZLWKRXW UHVXOWLQJ LQ D GHFUHDVH LQ DFWLYLW\ 6WULQJHQW VSDWLDO UHTXLUHPHQWV DUH DOVR VHHQ LQ WKH RUJDQL]DWLRQ RI WKH XSVWUHDP HOHPHQW RI WKH UDEELW LJORELQ SURPRWHU LQ ZKLFK RQO\ ES LQVHUWLRQ RU GHOHWLRQV EHWZHHQ WZR XSVWUHDP HOHPHQW FRQVHQVXV VHTXHQFHV WKH n*&&$&$&&&n SRVLWLRQHG DW ES DQG WKH &$$7 ER[ DW DSSUR[LPDWHO\ ESf DUH WROHUDWHG ZLWKRXW VXEVWDQWLDOO\ DIIHFWLQJ SURPRWHU IXQFWLRQ f ,W FDQ EH DUJXHG IURP WKHVH UHVXOWV WKDW WKHVH WKUHH VXEHOHPHQWV RI WKH +69 WN DQG WKH UDEELW f§JORELQ SURPRWHUV ELQG IDFWRUV DQG DOORZ WKH IDFWRUV WR LQWHUDFW ZLWK HDFK RWKHU GLUHFWO\ VLQFH UHPRYDO RU LQVHUWLRQ RI VHTXHQFHV EHWZHHQ WKH ELQGLQJ VLWHV ZRXOG HLWKHU FURZG RU VHSDUDWH WKHVH IDFWRUV IURP RSWLPDO FRQWDFW DQG HOLPLQDWH DFWLYLW\ &RFKUDQ DQG :HLVVPDQQ f H[DPLQHG WKH LQWHUFKDQJHDELOLW\ RI XSVWUHDP HOHPHQWV DQG 7$7$ ER[HV EHWZHHQ UDEELW JORELQ DQG +69 WN SURPRWHUV )XVHG WNf§3 f§JOREL Q SURPRWHUV ZHUH DQDO\VHG E\ TXDQWLWDWLYH 6, QXFOHDVH PDSSLQJ $FWLYLWLHV RI PRVDLF SURPRWHUV ZKLFK LQFOXGHG WKH 3JORELQ

PAGE 13

7$7$ DQG WKH WN XSVWUHDP HOHPHQW KDG UHODWLYHO\ KLJK DFWLYLWLHV 3URPRWHUV WKDW LQFOXGHG WKH WN 7$7$ VHTXHQFH ZLWK WKH JORELQ XSVWUHDP HOHPHQW DORQH RU WRJHWKHU ZLWK WKH WN XSVWUHDP HOHPHQW KRZHYHU UHVXOWHG LQ ORZ H[SUHVVLRQ OHYHOV %DVHG RQ WKHVH UHVXOWV WKH JORELQ 7$7$ VHTXHQFH VHHPV WR VKRZ QR SDUWLFXODU SUHIHUHQFH IRU XSVWUHDP HOHPHQWV IRU PDLQWHQDQFH RI QRUPDO WUDQVFULSWLRQ OHYHOV 7KH WN 7$7$ VHTXHQFH PD\ RWKHUZLVH EH RI D VSHFLILF QDWXUH DQG UHTXLUH LWV RZQ XSVWUHDP HOHPHQW WR DFKLHYH ZLOG W\SH OHYHOV RI DFWLYLW\ /LNH WKH 7$7$ ER[ WKH XSVWUHDP HOHPHQWV RI PDQ\ JHQHV DOVR LQWHUDFW ZLWK VSHFLILF QXFOHDU IDFWRUV f 7KH +69 WN KXPDQ JORELQ DQG PRXVH DAJORELQ JHQH &$$7 ER[HV LQWHUDFW VSHFLILFDOO\ ZLWK D FHOOXODU IDFWRU SUHVHQW LQ QXFOHDU H[WUDFWV RI +H/D FHOOV DQG DW OHDVW IRU WKH WN SURPRWHU WKH IDFWRU VWLPXODWHV LQ YLWUR WUDQVFULSWLRQ f $ +H/D FHOO IDFWRU SURWHFWV IURP '1DVH GLJHVWLRQ D VSHFLILF UHJLRQ IURP ES XSVWUHDP WR ES GRZQVWUHDP RI WKH +69 WN &$$7 ER[ DQG ES XSVWUHDP WR ES GRZQVWUHDP RI WKH PXULQH VDUFRPD YLUXV /75 &$$7 ER[ f $QRWKHU SUHYLRXVO\ SXULILHG WUDQVFULSWLRQ IDFWRU NQRZQ WR LQWHUDFW ZLWK D VXEHOHPHQW RI WKH XSVWUHDP HOHPHQW WKH *& ER[ LV WKH 6SO IDFWRU REWDLQHG IURP FXOWXUHG KXPDQ FHOOV f 7KLV IDFWRU ELQGV VSHFLILFDOO\ WR WKH KH[DQXFOHRWLGH VHTXHQFH ***&**n *& ER[f ZKLFK FDQ EH IRXQG LQ WKH XSVWUHDP HOHPHQWV RI VHYHUDO JHQHV LQFOXGLQJ WKH 69 HDUO\ SURPRWHU f WKH +69 HDUO\ JHQH f WKH +69 WN JHQH f WKH KXPDQ PHWDOORWKLRQHLQ,A JHQH f DQG WKH UDW W\SH ,, FROODJHQ JHQH f 7KH 6SO IDFWRU KDV EHHQ VKRZQ WR EH UHTXLUHG IRU VSHFLILF LQ YLWUR WUDQVFULSWLRQ RI WKH 69 HDUO\ JHQH f 7KH *& ER[ RI WKH FKLFNHQ FU\VWD,OLQ DOVR VHHPV WR ELQG VSHFLILFDOO\ WR DQ 6SOOLNH IDFWRU LQ YLYR f ([SUHVVLRQ RI WKH f§FU\VWDO LQ SURPRWHU FDQ EH UHGXFHG ZKHQ LW LV FRLQMHFWHG LQWR PRXVH OHQV HSLWKHOLDO FHOOV ZLWK HLWKHU WKH VHTXHQFHV RI WKH 69 ES

PAGE 14

UHSHDWV RU ZLWK WKH SDUW RI WKH SURPRWHU RI WKH +69 WN JHQH WKDW LQFOXGHV WKH XSVWUHDP HOHPHQW 7KLV UHGXFWLRQ LQ SURPRWHU DFWLYLW\ LV SUHVXPHG WR EH GXH WR FRPSHWLWLRQ IRU QXFOHDU IDFWRUV f &OHDUO\ WKH XSVWUHDP HOHPHQW DQG WKH 7$7$ ER[ GHWHUPLQH WUDQVFULSWLRQDO OHYHOV E\ LQWHUDFWLRQ ZLWK VSHFLILF QXFOHDU IDFWRUV 7KH (QKDQFHU (OHPHQW 7KH WKLUG VXEGLYLVLRQ RI HXFDU\RWLF SURPRWHU HOHPHQWV GHVLJQDWHG HQKDQFHUV f DUH XVXDOO\ ES LQ VL]H DQG VWLPXODWH WUDQVFULSWLRQ RI KHWHURORJRXV SURPRWHUV 7KHVH SURPRWHU HOHPHQWV IXQFWLRQ ELGLUHFWLRQDOO\ DQG FDQ RSHUDWH RYHU D FRQVLGHUDEOH GLVWDQFH 7KLV HQKDQFHU HIIHFW ZDV GLVFRYHUHG E\ WZR JURXSV %DQHUML HW DO f DQG 0RUHDX HW DO f DQG WKHQ ODWHU VHHQ E\ )URPP DQG %HUJ f $V DQ H[DPSOH RI HQKDQFHU DFWLYLW\ WKH IDU XSVWUHDP VHTXHQFHV RI 69 VWLPXODWH WUDQVFULSWLRQ RI D OLQNHG JORELQ JHQH LQ YLYR E\ PRUH WKDQ WZR RUGHUV RI PDJQLWXGH LQ ERWK SRODULWLHV DQG RYHU GLVWDQFHV RI PRUH WKDQ ES HYHQ IURP D SRVLWLRQ GRZQVWUHDP RI WKH JHQH f 7UDQVFULSWLRQDO FRQWURO HOHPHQWV ZLWK WKH VDPH FKDUDFWHULVWLFV ZHUH ODWHU IRXQG LQ RWKHU YLUXVHV DQG FHOOXODU JHQRPHV f 7KH 69 HQKDQFHU LV WKH EHVW FKDUDFWHUL]HG RI WKH PDQ\ NQRZQ HQKDQFHUV 7KLV HQKDQFHU HOHPHQW FRQWDLQV WZR VHSDUDWH GRPDLQV $ DQG % ZKLFK DUH ZLWKLQ D ES UHSHDW WKDW LV ORFDWHG LQ WKH SURPRWHUUHJXODWRU\ UHJLRQ RI WKH HDUO\ DQG ODWH JHQHV f 7KH ES UHSHDW VHTXHQFH FRQWDLQV ERWK D FRUH FRQVHQVXV KRPRORJ\ IRXQG LQ RWKHU YLUDO DQG FHOOXODU HQKDQFHUV FRQVLVWLQJ RI WKH VHTXHQFH n*7**$nSf$nSf $Sf*n f LQ DGGLWLRQ WR VWUHWFKHV RI DOWHUQDWLQJ SXULQHV DQG S\ULPLGLQHV f 0D[LPDO HQKDQFHU DFWLYLW\ LV DFKHLYHG ZKHQ GRPDLQ $ LV VWHUHRVSHFLILFDOO\ DOLJQHG ZLWK WKH ES UHSHDWV RI WKH 69 XSVWUHDP HOHPHQW VXJJHVWLQJ WKDW WKH GLIIHUHQW IDFWRUV

PAGE 15

SUHVHQW DORQJ RQH VLGH RI WKH '1$ KHOL[ LQWHUDFW E\ GLUHFW FRQWDFW f 7KLV HQKDQFHU DOVR DFWV LQ D FRQVWLWXWLYH UDWKHU WKDQ D WLVVXHVSHFLILF RU GHYHORSPHQWDOO\ FRQWUROOHG PDQQHU LQ D ZLGH YDULHW\ RI DQLPDO WLVVXHV DQG KRVWV f 7KH 69 HQKDQFHU KDV EHHQ VKRZQ WR DFWLYDWH D YDULHW\ RI KHWHURORJRXV SURPRWHUV f DQG ZLOO DOVR LQLWLDWH WUDQVFULSWLRQ ZLWKRXW WKH DSSDUHQW SUHVHQFH RI DQ\ RWKHU SURPRWHU HOHPHQW f ,QVHUWLRQ RI WKH ES UHSHDW LQ HLWKHU RULHQWDWLRQ LPPHGLDWHO\ XSVWUHDP RI D FRQDOEXPLQ SURPRWHU IXVHG WR WKH 69 HDUO\ JHQH FRGLQJ UHJLRQf SURPRWHV WUDQVFULSWLRQ VWDUWLQJ DW WKH FDS VLWH f ,QWHUHVWLQJO\ ZKHQ D ES IUDJPHQW IURP S%5 LV LQVHUWHG EHWZHHQ WKH 69 HQKDQFHU DQG WKH WR ES FRQDOEXPLQ SURPRWHU WUDQVFULSWLRQ LV LQWLDWHG DW D b DFWLYLW\ OHYHO ZLWKLQ WKH S%5 VHTXHQFH ES GRZQVWUHDP RI WKH HQKDQFHU ,Q WKLV FRQVWUXFWLRQ WKH 69 HQKDQFHU DOVR LQLWLDWHG IDLWKIXO WUDQVFULSWLRQ DW WKH FDS VLWH RI WKH FRQDOEXPLQ SURPRWHU EXW RQO\ DW DQ b DFWLYLW\ OHYHO 7KH S%5 VHTXHQFH XSRQ LQVSHFWLRQ GRHV QRW VKRZ DQ\ 7$7$OLNH PRWLI VXJJHVWLQJ WKDW WKH 69 ES UHSHDW FDQ LQLWLDWH 51$ WUDQVFULSWLRQ IURP 7$7$GHSHQGHQW DV ZHOO DV LQGHSHQGHQW VWDUW VLWHV 7KH 69 HQKDQFHU GHPRQVWUDWHV SUHIHUHQFH IRU WKH PRVW SUR[LPDO SURPRWHU ZKHQ LW LV SUHVHQW RQ WKH VDPH '1$ PROHFXOH ZLWK PRUH WKDQ RQH JHQH 3UHIHUHQWLDO DFWLYDWLRQ RI SUR[LPDO SURPRWHUV LV GHPRQVWUDWHG E\ WKH SODFHPHQW RI WZR FRQDOEXPLQ SURPRWHUV WDQGHPO\ GRZQVWUHDP RI WKH 69 HQKDQFHU f 7KH HQKDQFHU DFWLYDWHV WUDQVFULSWLRQ RI WKH SUR[LPDO FRQDOEXPLQ SURPRWHU WR b DFWLYLW\ ZKLOH WKH GLVWDO SURPRWHU LV RQO\ VWLPXODWHG WR b DFWLYLW\ ZKHQ FRPSDUHG WR D VLQJOH FRQDOEXPLQ SURPRWHU GRZQVWUHDP RI WKH HQKDQFHU .DGHVFK DQG %HUJ f DOVR REVHUYHG VLPLODU UHVXOWV E\ LQVHUWLQJ WKH ES UHSHDW RI 69 LQ YDULRXV ORFDWLRQV UHODWLYH WR

PAGE 16

WKUHH GLVWLQFW FRGLQJ UHJLRQV IXVHG WR WUXQFDWHG 69 SURPRWHUV 2QH RI WKHVH FRGLQJ UHJLRQV WKH [DQWKLQHJXDQRVLQH SKRVSKRULERV\O WUDQVIHUDVH JHQH ;*357DVHf ZDV DVVD\HG IRU DFWLYLW\ LQ &9 FHOOV WR GHWHUPLQH SRVLWLRQDO HIIHFWV RI WKH 69 HQKDQFHU RQ WKLV JHQH :LWK WKH HQKDQFHU HOHPHQW LQ WKH n SRVLWLRQ WKH SUR[LPDO IXVLRQ JHQH ZDV WUDQVFULEHG HIILFLHQWO\ ZKHUHDV WKH DFWLYLW\ RI WKH GLVWDO JHQH SUHVHQW IXUWKHU GRZQVWUHDP ZDV UHGXFHG $GK\D DQG *RWWHVPDQ f DOVR REVHUYHG WKLV HIIHFW DQG QDPHG LW SURPRWHU RFFOXVLRQ 7KH\ VXJJHVWHG WKDW WKH 51$ SRO\PHUDVH ,, WUDQVFULELQJ WKURXJK WKH GRZQVWUHDP SURPRWHU PD\ LQWHUIHUH ZLWK WKH SURPRWHUnV DFWLYDWLRQ $QRWKHU SKHQRPHQRQ GHVLJQDWHG DV HQKDQFHU GDPSHQLQJ LV REVHUYHG ZKHQ WKH 69 HQKDQFHU LV SRVLWLRQHG EHWZHHQ WZR WDQGHP JHQHV ZKLFK DUH LQ WKH VDPH SRODULW\ 7KH OHYHO RI DFWLYLW\ RI WKH XSVWUHDP JHQH ;*357DVHf GURSV IROG FRPSDUHG WR WKH DFWLYLW\ REVHUYHG ZKHQ WKH ;*357DVH JHQH LV SUHVHQW ZLWK WKH HQKDQFHU VHTXHQFH GRZQVWUHDP DORQH f $ SRVVLEOH H[SODQDWLRQ IRU WKHVH HIIHFWV RI SURPRWHU UHJLRQV SUHYHQWLQJ WKH HQKDQFHU IURP DIIHFWLQJ GLVWDO SURPRWHUV LV WKDW WKHVH SURPRWHU UHJLRQV PLJKW EORFN D ELGLUHFWLRQDO PRYHPHQW RI 51$ SRO\PHUDVH ,, RU RWKHU WUDQVFULSWLRQDO IDFWRUV ELQGLQJ WR WKH HQKDQFHUV f $QRWKHU H[SODQDWLRQ LV WKDW WKH SURPRWHUV RI WKHVH WZR JHQHV FRPSHWH IRU WKH VDPH VHW RI HQKDQFHU UHODWHG IDFWRUV 6RPH HQKDQFHU HOHPHQWV FDQ IXQFWLRQ LQ D WLVVXHVSHFLILF PDQQHU VXFK DV WKRVH IRXQG LQ WKH PRXVH DQG KXPDQ LPPXQRJOREXOLQ KHDY\ f DQG FKDLQ JHQHV f WKH UDW FK\PRWU\SVLQ f DQG LQVXOLQ JHQHV f WKH KXPDQ W\SH NHUDWLQ f DQG DOEXPLQ JHQHV f DQG WKH ORQJ WHUPLQDO UHSHDWV RI WKH 0DORQH\ PXULQH VDUFRPD YLUXV f $ UHJLRQ RI WKH LQVXOLQ SURPRWHU IURP WR ES UHODWLYH WR WKH FDS VLWH SURPRWHV WKH H[SUHVVLRQ RI WKH 69 7DQWLJHQ RQO\ LQ WKH SDQFUHDWLF LVOHWV RI /DQJHUKDQ S FHOOV f 7KH HQKDQFHU RI WKH PRXVH SRO\RPD YLUXV D SDSRYDYLUXV OLNH 69 VKRZV

PAGE 17

GLVWLQFW KRVWFHOO SUHIHUHQFH EHLQJ DSSUR[LPDWHO\ IRXU WLPHV DV DFWLYH LQ PRXVH FHOOV WKDQ LQ SULPDWH FHOOV XQOLNH WKH 69 HQKDQFHU ZKLFK SURPRWHV WUDQVFULSWLRQ HTXDOO\ ZHOO LQ ERWK KRVWV f 7KH LPPXQRJOREXOLQ HQKDQFHUV DOVR GLUHFW WUDQVFULSWLRQDO DFWLYLW\ LQ O\PSKRLG % FHOOV HDUO\ LQ GLIIHUHQWLRQ EXW RQFH HVWDEOLVKHG WKH HQKDQFHU VHTXHQFH EHFRPHV GLVSHQVLEOH f (QKDQFHUV DV D FODVV WKHUHIRUH VHHP WR H[HUW D FRQWLQXXP RI VSHFLILFLW\ ZLWK UHJDUG WR IXQFWLRQ IURP WKH FRQVWLWXWLYH DFWLRQ RI WKH 69 HQKDQFHU WR WKH KLJKO\ VSHFLDOL]HG DFWLYDWLRQ RI WUDQVFULSWLRQ E\ HQKDQFHUV DVVRFLDWHG ZLWK JHQHV XQGHU VWULQJHQW GHYHORSPHQWDO DQG HQYLURPHQWDO FRQWURO 6RPH SURPRWHU HOHPHQWV GR QRW VHHP WR ILW QHDWO\ LQWR WKH FODVVHV GLVFXVVHG VR IDU 3URPRWHU HOHPHQWV SRVVHVVLQJ VRPH HQKDQFHUOLNH TXDOLWLHV RI ELGLUHFWLRQDOOLW\ DQG OLPLWHG VSDFLQJ IOH[LEOLW\ H[LVW LQ VHYHUDO LQGXFLEOH JHQHV VXFK DV WKH PRXVH PHWDOORWKLRQHLQ JHQH 07f f KHDW VKRFN JHQHV f DQG WKH LQWHUIHURQ JHQH f 7KHVH HQKDQFHUOLNH HOHPHQWV DUH IRXQG LQ WKH UHJLRQ UHJDUGHG DV WKH XSVWUHDP HOHPHQW DV ZHOO DV LQ YDULRXV 7$7$GLVWDO SRVLWLRQV 6HDUOH HW DO f ZHUH DEOH WR GHPRQVWUDWH WKDW SURPRWHU VWUHQJWK GHSHQGHG RQ WKH QXPEHU RI FRSLHV RI WKH PHWDO UHVSRQVLYH HOHPHQW 05(f VHTXHQFHV SUHVHQW LQ WKH n IODQNLQJ UHJLRQ RI D KHWHURORJRXV JHQH 7KH\ SODFHG WKH 07 05( VHTXHQFH n&&777*&*&&&*nf LQ YDULRXV ORFDWLRQV DQG SRODULWLHV ZLWKLQ WKH +69 WN SURPRWHU DQG H[DPLQHG WKH UHJXODWLRQ RI LQGXFWLRQ E\ WKH DGGLWLRQ RI ]LQF $W OHDVW WZR 07 05(nV ZHUH UHTXLUHG UHJDUGOHVV RI SRVLWLRQ RU RULHQWDWLRQ WR REWDLQ ORZ LQGXFWLRQ EXW WKLV LQGXFWLRQ ZDV VLJQLILFDQWO\ LQFUHDVHG ZKHQ WKH HOHPHQWV ZHUH SODFHG LQ WKH 7$7$SUR[LPDO SRVLWLRQ 7KH OHYHO RI LQGXFLELOLW\ FRXOG EH LQFUHDVHG E\ LQFRUSRUDWLQJ PRUH FRSLHV RI WKLV HOHPHQW LQWR WKH WN SURPRWHU ,Q DQRWKHU VWXG\ KHDW VKRFN FRQVHQVXV HOHPHQWV +6(f RI WKH 'URVRSKLOD KVS JHQH ZHUH LQVHUWHG LQ PXOWLSOH FRSLHV LQWR WKH SURPRWHU RI D KHPHLQGXFLEOH \HDVW JHQH

PAGE 18

&<& LVROF\WRFKURPH F >@f LQFUHDVLQJ WKH OHYHO RI KHDW LQGXFLELOLW\ JUHDWHU WKDQ IROG f 7KH RULHQWDWLRQ RI WKH +6(nV LQ &<& SURPRWHU GLG QRW DIIHFW WKH RYHUDOO OHYHO RI KHDW LQGXFWLRQ EXW DGGLQJ PRUH HOHPHQWV LQFUHDVHG WKH LQGXFLEOH DFWLYLW\ $OWKRXJK 05(nV DQG +6(nV KDYH WKH DELOLW\ WR DFWLYDWH KHWHURORJRXV SURPRWHUV DQG IXQFWLRQ ELGLUHFWLRQDOO\ WKH\ GR QRW HIILFLHQWO\ SURPRWH WUDQVFULSWLRQ ZKLOH n WR WKH JHQH (QKDQFHUV RIWHQ VHHP WR XWLOL]H D UHSHWLWLRQ RI VHTXHQFH PRWLIV WR DFWLYDWH WUDQVFULSWLRQ $OWKRXJK HQKDQFHU HOHPHQWV RI YDULRXV YLUDO DQG FHOOXODU W\SHV GR QRW VKRZ DQ\ REYLRXV UHSHDWV f REVFXUH VHTXHQFH UHGXQGDQF\ PD\ EH SUHVHQW $ ES UHJLRQ RI WKH 69 HQKDQFHU ZKLFK LQFOXGHV SRUWLRQ RI RQH RI WKH ES UHSHDWHG VHTXHQFHV DV ZHOO DV VRPH QRQUHSHWLWLYH XSVWUHDP VHTXHQFHV FDQ DFWLYDWH WKH 69 HDUO\ JHQH WUDQVFULSWLRQ f +RZHYHU ZLWKLQ WKLV ES UHJLRQ WKHUH DUH VHYHUDO VKRUWHU VHTXHQFHV ZKLFK PD\ SURYLGH WKH HQKDQFHU ZLWK QHFHVVDU\ UHSHWLWLYH GRPDLQV WR SURPRWH KLJK JHQH H[SUHVVLRQ OHYHOV 'HOHWLRQV RI RQH RI WKHVH VKRUWHU UHSHDWV GRHV LQGHHG HOLPLQDWH DFWLYLW\ 7KH 69 HQKDQFHU FDQ DOVR DFWLYDWH WUDQVFULSWLRQ HYHQ PRUH HIILFLHQWO\ ZKHQ WKH ES VHTXHQFH LV UHSHDWHG DQG LQ WKH SUHVHQFH RI WKH XSVWUHDP QRQUHSHDWHG VHTXHQFHV f 7R GHPRQVWUDWH WKH DIIHFW RI GXSOLFDWLQJ VHTXHQFHV RQ DFWLYLW\ D WUXQFDWHG 69 HQKDQFHU KDYLQJ UHGXFHG VWLPXODWRU\ HIIHFW ZDV GLPHUL]HG LQ YLWUR DQG WUDQVIHFWHG LQWR &26 FHOOV UHVXOWLQJ LQ UHVWRUDWLRQ RI WUDQVFULSWLRQDO DFWLYLW\ f ,Q DQRWKHU H[DPSOH VHYHUHO\ GHOHWHG HQKDQFHUV IXVHG WR WKH FKORUDPSKHQLFDO DFHW\OWUDQVIHUDVH &$7f FRGLQJ UHJLRQ ZHUH LQWURGXFHG LQWR &26 FHOOV DQG XQGHU VHOHFWLYH SUHVVXUH ZLWK FKORUDPSKHQLFRO WKH GHOHWHG HQKDQFHUV ZHUH GXSOLFDWHG LQ YLYR f 7KLV LQ YLYR GXSOLFDWLRQ RI WKH HQKDQFHU UHJLRQ LQ UHVSRQVH WR VHOHFWLYH SUHVVXUH VXJJHVWV WKDW WKH UHGXQGDQF\ RI WKLV HOHPHQW SOD\V D UROH LQ QRUPDO HQKDQFHU IXQFWLRQ

PAGE 19

-XVW DV WKH RWKHU HXFDU\RWLF SURPRWHU HOHPHQWV ZHUH VKRZQ WR ELQG VSHFLILFDOO\ WR WUDQVFULSWLRQDO IDFWRUV HQKDQFHU VHTXHQFHV ZHUH OLNHZLVH GHPRQVWUDWHG WR LQWHUDFW ZLWK WUDQVDFWLQJ IDFWRUV 6LQFH VRPH HQKDQFHUV PHGLDWH WLVVXHVSHFLILF DQG VRPHWLPHV KRVWVSHFLILF FRQWURO FHOOVSHFLILF IDFWRUV VHHP WR EH LQYROYHG 6FKOHU DQG *UXVV f GHPRQVWUDWHG IDFWRU LQWHUDFWLRQ ZLWK HQKDQFHU '1$ RI DQ 69&$7 IXVLRQ JHQH XVLQJ D FRPSHWLWLRQ DVVD\ 7KH\ UHSRUWHG D UHGXFWLRQ LQ DFWLYLW\ RI WKLV JHQH ZKHQ FRPSHWHG ZLWK QRUPDO 69 HQKDQFHU VHTXHQFHV EXW IRXQG QR UHGXFWLRQ LQ DFWLYLW\ ZKHQ FRPSHWHG ZLWK '1$ IUDJPHQWV FRQWDLQLQJ WKH ES UHSHDWV WKH 7$7$ ER[ RU WUDQVFULSWLRQDO WHUPLQDWLRQ VLJQDOV RI 69 7KLV LQGLFDWHV WKDW WKH HQKDQFHU VSHFLILFDOO\ LQWHUDFWV ZLWK FHOOXODU IDFWRUV ZKLFK DUH UHTXLUHG IRU WKH DFWLYDWLRQ RI WKH 69&$7 JHQH DQG WKDW WKH SUHVHQFH RI WKLV IDFWRUVf LV LQ OLPLWHG DPRXQWV ZLWKLQ WKH FHOO 2WKHU JURXSV KDYH UHSRUWHG WUDQVFULSWLRQ IDFWRUV ELQGLQJ WR FHOOXODU HQKDQFHUV VXFK DV WKRVH IURP WKH LPPXQRJOREXOLQ KHDY\ JHQHV ,J+f DQG WKH FKDLQ JHQHV f 0HUFOD HW DO f GHPRQVWUDWHG E\ XVLQJ FRPSHWLWLRQ DVVD\V WKDW IDFWRUV IURP O\PSKRLG % FHOOV ERXQG VSHFLILFDOO\ WR WKH ,J+ HQKDQFHUV DQG WKDW LQ YLYR WKHVH HQKDQFHU VHTXHQFHV FRXOG FRPSHWH ZLWK WKH 69 HQKDQFHU IRU IUD mDFWLQJ IDFWRUV &RPPRQ RU FORVHO\ UHODWHG IDFWRUV VHHP WR LQWHUDFW ZLWK ERWK RI WKH ,J+ DQG 69 HQKDQFHUV VLQFH WKHVH HQKDQFHUV KDYH KRPRORJRXV VHTXHQFHV ([WUDFWV IURP O\PSKRLG % FHOOV SURWHFW GLIIHUHQW UHJLRQV RI WKH PRXVH ,J+ HQKDQFHU '1$ IURP LQ YLWUR '1DVH, GLJHVWLRQ ZKHQ FRPSDUHG WR H[WUDFWV IURP +H/D FHOOV f 7KH PRXVH ,J+ HQKDQFHU FDQ DOVR HIILFLHQWO\ DFWLYDWH WKH $G PDMRU ODWH SURPRWHU LQ YLWUR LQ WKH SUHVHQFH RI O\PSKRLG % FHOO H[WUDFWV 7KHVH UHVXOWV VXJJHVW WKDW WKH O\PSKRLG FHOOXODU IDFWRUVf ELQGV WR GLIIHUHQW UHJLRQV RI WKH ,J+ HQKDQFHU WKDQ WKH +H/D FHOO IDFWRUV

PAGE 20

+HDW VKRFN HOHPHQWV DOVR LQWHUDFW ZLWK D VSHFLILF WUDQVFULSWLRQ IDFWRU ZKLFK LV DFWLYDWHG ZKHQ WKHUPDOO\ LQGXFHG f %DVHG RQ H[RQXFOHDVH SURWHFWLRQ DQDO\VHV D UHJLRQ IURP WR ES RI WKH 'URVRSKLOD KVS JHQH LV SURWHFWHG IURP GLJHVWLRQ ZKHQ LQ WKH SUHVHQFH RI H[WUDFW IURP KHDWVKRFNHG 'URVRSKLOD FHOOV f 7KH 'URVRSKLOD KHDW VKRFN WUDQVFULSWLRQ IDFWRU +67)f ELQGV WR WKUHH GRPDLQV XSVWUHDP IURP WKH 7$7$ RQ WKH KVS JHQH f 7ZR RI WKHVH ELQGLQJ VLWHV RFFXU ZLWKLQ WKH UHJLRQ IURP ES WR WKH FDS VLWH DQG FRLQFLGH ZLWK +6(nV %RWK +6(nV DUH UHTXLUHG IRU LQ YLWUR DQG LQ YLYR WUDQVFULSWLRQDO DFWLYDWLRQ f 7KLV IDFWRU ILUVW RFFXSLHV WKH 7$7$SUR[LPDO +6( ZKLFK LQ WXUQV IDFLOLWDWHV WKH FRRSHUDWLYH ELQGLQJ RI D VHFRQG +67) WR WKH 7$7$GLVWDO +6( 7KH FRRSHUDWLYH ELQGLQJ WR WKH VHFRQG VLWH KDV EHHQ VXJJHVWHG WR VHUYH DV WKH PROHFXODU VZLWFK WKDW DFWLYDWHV WKH KVS JHQH f 6KXH\ DQG 3DUNHU f GHPRQVWUDWHG WKDW D VXEVHW RI SURWHLQ'1$ FRQWDFWV EHWZHHQ WKH +67) DQG WKH ILUVW +6( FKDQJHG XSRQ WKH ELQGLQJ RI D VHFRQG +67) WR WKH QHLJKERULQJ +6( 7KLV FKDQJH LQ WKH SURWHLQ'1$ FRQWDFWV VXJJHVWV WKDW D FRQIRUPDWLRQDO FKDQJH LQ WKH SURWHLQ'1$ FRPSOH[ RFFXUV 3DUW RI WKLV FRQIRUPDWLRQDO FKDQJH PD\ LQYROYH EHQGLQJ RI WKH '1$ E\ LQWHUDFWLRQ ZLWK WKH VHFRQG +67) SURWHLQ f 7KLV EHQGLQJ RI WKH '1$ XSRQ ELQGLQJ RI D UHJXODWRU\ SURWHLQ PD\ EH D JHQHUDO SKHQRPHQD LQ WKH LQWHUDFWLRQ RI GLPHU SURWHLQV WR '1$ VLQFH WKH FDWDEROLWH DFWLYDWLQJ SURWHLQ RI (VFKHULFKLD FROL DOVR FDXVHV D EHQG RU NLQN LQ WKH ODF SURPRWHU '1$ f 7R VXPPDUL]H WKUHH PDMRU VXEGLYLVLRQV RI SURPRWHU HOHPHQWV LQ DQLPDO DQG YLUDO JHQHV KDYH EHHQ GLVFXVVHG DQG WKHLU VSHFLILF IXQFWLRQ H[DPLQHG 7KH 7$7$ HOHPHQW KDV DQ LPSRUWDQW UROH LQ JRYHUQLQJ WKH VWDUW RI WUDQVFULSWLRQ DQG LV HVVHQWLDO LQ PRVW FDVHV IRU QRUPDO DFWLYLW\ 7KH VHFRQG UHJLRQ RI D W\SLFDO SURPRWHU WKH XSVWUHDP HOHPHQW LV DOVR HVVHQWLDO IRU DFWLYLW\ LQ PRVW JHQHV 7KLV HOHPHQW PXVW DFW LQ FORVH SUR[LPLW\ WR WKH 7$7$ ER[ DQG ZLWK VRPH

PAGE 21

H[DPSOHV WKH VXEHOHPHQWV ZLWKLQ WKH XSVWUHDP HOHPHQW FDQ EH RULHQWHG LQ HLWKHU GLUHFWLRQ 7KH HQKDQFHU FRPSULVHV WKH WKLUG FODVV RI UHJXODWRU\ FRPSRQHQWV ZLWKLQ HXFDU\RWLF SURPRWHUV SOD\LQJ DQ DFWLYH UROH LQ HVWDEOLVKLQJ WLVVXHVSHFLILFLW\ FHOOF\FOH FRQWURO RU VLPSO\ FRQVWLWXWLYH H[SUHVVLRQ (QKDQFHUV KDYH WKH DELOLW\ WR DFWLYDWH KHWHURORJRXV SURPRWHUV LQ HLWKHU SRODULW\ n RU n WR D JHQH RYHU ODUJH GLVWDQFHV $ FODVV RI HQKDQFHUOLNH HOHPHQWV H[LVW LQ PDQ\ LQGXFLEOH JHQHV KDYLQJ D FRPELQDWLRQ RI FKDUDFWHULVWLFV IURP WKH XSVWUHDP HOHPHQW DQG HQKDQFHUV 7KHVH HOHPHQWV XQOLNH WUXH HQKDQFHUV UHTXLUH VSHFLILF 7$7$SUR[LPDO ORFDWLRQV DW OHDVW IRU RQH RI WKH UHSHWLWLYH HOHPHQWV LQ D SURPRWHUf EXW FDQ DFWLYDWH KHWHURORJRXV SURPRWHUV LQ HLWKHU RULHQWDWLRQ 7KH VHTXHQFH HOHPHQWV UHVSRQVLEOH IRU KHDW VKRFN DQG KHDY\ PHWDO DFWLYDWLRQ IDOO LQWR WKLV LQWHUPHGLDWH FODVV DQG VHHP WR DFWLYDWH WUDQVFULSWLRQ EHVW LQ PXOWLSOH FRSLHV 6SHFLILF QXFOHDU IDFWRUV DOVR SOD\ DQ LPSRUWDQW UROH E\ LQWHUDFWLQJ ZLWK DOO RI WKHVH SURPRWHU HOHPHQWV DQG FRQWUROOLQJ WKH WUDQVFULSWLRQDO PDFKLQHU\ LQ D YHU\ VSHFLILF PDQQHU 3ODQW 3URPRWHU 6WUXFWXUH ,QIRUPDWLRQ UHJDUGLQJ WKH IXQFWLRQDO GRPDLQV RI SODQW SURPRWHUV LV VFDUFH DQG WKH EDVLV RI GHOLQHDWLQJ WKHVH GRPDLQV LV PDLQO\ GHSHQGHQW RQ VHTXHQFH KRPRORJLHV WR DQDORJRXV GRPDLQV RI DQLPDO JHQHV 0DQ\ SODQW JHQHV KDYH EHHQ VHTXHQFHG DQG VKRZ HYLGHQFH RI FRQVHUYDWLRQ RI SURPRWHU GRPDLQV ZKHQ FRPSDUHG WR WKH DQLPDO SURPRWHUV 'LUHFW WHVWLQJ IRU WKH IXQFWLRQDO LPSRUWDQFH RI VXFK GRPDLQV KDV EHHQ GRQH WR D OLPLWHG H[WHQW E\ LQ YLWUR PXWDJHQHVLV DQG LQWURGXFWLRQ RI PXWDWHG SURPRWHUV LQWR SODQWV XVLQJ D YDULHW\ RI PHWKRGV LQFOXGLQJ WKH WUDQVIRUPDWLRQ RI SODQW SURWRSODVWV ZLWK QDNHG '1$ E\ QDWXUDO LQIHFWLRQ URXWHV HLWKHU ZLWK SODQW YLUXV VXFK DV WKH EURPH PRVDLF

PAGE 22

7$%/( *(1( 7'1$ 2&6 126 7'1$ 7U 7'1$ 7U 7'1$ 126 7'1$ 126 &D09 6 3HD UEH6 6800$5< 2) 352027(5 087$7,216 ,1 3/$17 *(1(6 7<3(D 352027(5 087$7,21r 3/$17 6<67(0 t $66$<& 5(68/76r 5()(5(1&( & nGHOHWLRQV WR 1LF WXPRUV RSLQH DVVDY f & nGHOHWLRQ 1c& WXPRUV RSLQH DVVD\ & 7Q LQVHUWLRQV WR 1c& WXPRUV URRW\ SKHQRW\SH WR f & 7Q LQVHUWLRQ IURP S8&.f 1LF DQG 5DO WXPRUV VKRRW\ SKHQRW\SH f & nGHOHWLRQV WR .D/ WXPRUV 126 DVVD\ WR WR ORZ f & n DQG nGHOHWLRQV WR 1LF WXPRUV &$7 DQG 1SWOO DVVD\V WR WR b WR WR b WR f & nGHOHWLRQV WR 1LF WXPRUV t UHJHQ SODQWV 1RUWKHUQ EORW DQDO\VLV 5HI JHQH 126 Sf1SWO, b b rf n DQG LQWHUQDO GHO WR 3HW FDOOL 6, QXFOHDVH DQG 1RUWKHUQ EORW DQDO\VLV 5HI JHQH 126 Sf1SW,, b WR b b f

PAGE 23

7$%/( FRQnWf *(1( 7<3(D 352027(5 087$7,21r 3/$17 6<67(0 t $66$<& 5(68/76A 5()(5(1&( 3HD UEF6 n DQG LQWHUQDO GHO WR 1LF FDOOL &$7 DVVD\ b WR b f 3HD &DE nGHOHWLRQV DQG 1LJ UHJHQ SODQWV 1SWOO WR IROG GHFUHDVH f 6R\EHDQ KHDW VKRFN nGHOHWLRQV WR +HO SULPDU\ WXPRUV 6, QXFOHDVH DQDO\VLV WR b f 6QDSGUDJRQ FKDOFRQH V\QWKDVH n DQG LQWHUQDO GHO WR 1LF FDOOL DQG UHJHQ SODQWV 51$ GRW EORW DQG 1SW DVVD\ 5HI JHQH 0Q6 Sf1SW,, b b !b f D& UHIHUV WR FRQVWLWXWLYH H[SUHVVLRQ DQG UHIHUV WR LQGXFLEOH H[SUHVVLRQ A'HOHWLRQV DUH LQ EDVHSDLUV IURP WKH VWDUW RI WUDQVFULSWLRQ F1LF LV 1LFRWLDQD WREDFXP .DO LV .DODQFKRH VS 3HW LV 3HWXQLD K\EULGD DQG +HO LV +HOLDQWKXV DWLXXV 1SWOO DQG &$7 DVVD\ UHIHUV WR FKLPHULF SURPRWHUJHQH IXVLRQV HLWKHU WR WKH 1SWOO RU &$7 FRGLQJ VHTXHQFHV DQG DVVD\HG IRU HQ]\PH DFWLYLW\ 5HI JHQH UHIHUV WR WKH UHIHUHQFH JHQH XVHG DV DQ LQWHUQDO VWDQGDUG 126 Sf1SWO, UHIHUV WR WKH QRSDOLQH V\QWKDVH SURPRWHU DQG 0Q6 Sf1SW8 UHIHUV WR WKH PDQQRSLQH V\QWKDVH SURPRWHU IXVHG WR WKH 1SWOO FRGLQJ UHJLRQ 3HUFHQWDJH YDOXHV DUH OHYHOV RI WUDQVFULSWLRQ UHODWLYH WR ZLOGW\SH UHIHUV WR b UHIHUV WR PXWDQW RU b

PAGE 24

YLUXV f RU ZLWK $JUREDFWHULXP WXPHIDFLHQV 7'1$ EDVHG YHFWRUV f 7DEOH VXPPDUL]HV PRVW RI WKH VWXGLHV LQYROYLQJ SODQW SURPRWHU PXWDWLRQV DQG WKH DVVHVVPHQW RI WKHVH JHQH DFWLYLWLHV LQ HLWKHU FDOOXV WLVVXH RU UHJHQHUDWHG SODQWV :LWK IHZ DSSDUHQW H[FHSWLRQV WKH RYHUDOO SURPRWHU VWUXFWXUH RI KLJKHU SODQW JHQHV VHHPV WR EH VLPLODU WR WKDW RI WKH W\SLFDO DQLPDO SURPRWHU 7KHUHIRUH WKH SODQW SURPRWHU ZLOO EH GLVFXVVHG ZLWKLQ WKH FRQWH[W RI WKH WKUHH PDMRU UHJXODWRU\ GRPDLQV GHVFULEHG DERYH IRU DQLPDO JHQHV 7KH 7$7$ %R[ $V ZLWK WKH DQLPDO DQG YLUDO JHQHV WKH 7$7$ ER[ VHHPV WR EH WKH PRVW FRQVHUYHG VHTXHQFH PRWLI SUHVHQW LQ SODQW SURPRWHUV f %\ VLPSOH LQVSHFWLRQ WKLV HOHPHQW FDQ EH IRXQG DSSUR[LPDWHO\ ES IURP WKH VWDUW RI WUDQVFULSWLRQ DQG PD\ WKHUHIRUH IXQFWLRQ LQ SODQWV LQ D VLPLODU PDQQHU WR LWV IXQFWLRQ LQ DQLPDO JHQHV 0XWDWLRQV ZLWKLQ WKH 7$7$ HOHPHQW RI JHQHV WUDQVFULEHG E\ SODQWV KDYH EHHQ PDGH RQO\ LQ D IHZ FDVHV $Q HW DO f GHPRQVWUDWHG WKH IXQFWLRQ RI 7$7$ LQ PDLQWDLQLQJ WUDQVFULSWLRQDO DFWLYLW\ E\ FUHDWLQJ n GHOHWLRQV LQWR WKH 7$7$ HOHPHQW RI WKH 7'1$ QRSDOLQH V\QWKDVH 126f JHQH IURP $ WXPHIDFLHQV 7KH 126 SURPRWHU ZDV IXVHG WR WKH &$7 FRGLQJ UHJLRQ LQFRUSRUDWHG LQWR WKH 7'1$ DQG WKHQ LQWURGXFHG LQWR WREDFFR FDOOL XVLQJ $ WXPHIDFLHQV %DVHG RQ &$7 DFWLYLW\ DVVD\V WKH OHYHO RI H[SUHVVLRQ GURSSHG QHDUO\ IROG ZKHQ KDOI RI WKH 7$7$ VHTXHQFH ZDV UHPRYHG E\ D n GHOHWLRQ ,Q DQRWKHU FDVH 0RUHOOL HW DO f SHUIRUPHG n GHOHWLRQV RQ WKH ULEXORVH ELVSKRVSKDWHFDUER[\ODVH JHQH UEF6f RI SHD WR SRVLWLRQ ES NHHSLQJ WKH 7$7$ VHTXHQFH LQWDFW DQG VWLOO UHWDLQHG b RI ZLOG W\SH DFWLYLW\ :KHQ D IXUWKHU GHOHWLRQ ZDV PDGH UHPRYLQJ WKH 7$7$ ER[ WUDQVFULSWLRQDO DFWLYLW\ ZDV QRW GHWHFWDEOH %DVHG RQ WKHVH OLPLWHG UHVXOWV WKLV PRWLI GRHV VHHP

PAGE 25

WR EH UHTXLUHG IRU HIILFLHQW H[SUHVVLRQ +RZHYHU WKH RWKHU UROH RI SRVLWLRQLQJ WKH VWDUW RI WUDQVFULSWLRQ KDV QRW EHHQ GLUHFWO\ GHPRQVWUDWHG LQ SODQWV 7KH 8SVWUHDP (OHPHQW 7KH PRVW FRPPRQ VHTXHQFH PRWLI RI WKH XSVWUHDP HOHPHQW LQ SODQWV DSSHDUV WR EH WKH &$$7 ER[ ZKLFK LV XVXDOO\ SRVLWLRQHG EHWZHHQ WR ES %\ H[DPLQDWLRQ RI D YDULHW\ RI SODQW SURPRWHU VHTXHQFHV QRQH RI WKH RWKHU IRXU FRQVHQVXV VHTXHQFHV SUHVHQW LQ WKH XSVWUHDP HOHPHQW RI DQLPDO JHQHV f DUH IRXQG LQ DQDORJRXV SRVLWLRQV LQ SODQW SURPRWHUV $ OLPLWHG QXPEHU RI n GHOHWLRQV LQ WKH SURPRWHU UHJLRQ RI WKH FDXOLIORZHU PRVDLF YLUXV &D09f 6 JHQH DV DQ H[DPSOH UHYHDO VRPH LQIRUPDWLRQ FRQFHUQLQJ WKH IXQFWLRQ RI WKH XSVWUHDP HOHPHQW LQ SODQWV f 7KH 7$7$ ER[ E\ LWVHOI LV QRW HQRXJK WR SURGXFH GHWHFWDEOH DPRXQWV RI WUDQVFULSWV ZKHQ WKH 6 JHQH LV GHOHWHG WR SRVLWLRQ ES ,QFOXVLRQ RI n IODQNLQJ VHTXHQFHV WR ES FDQ KRZHYHU PDLQWDLQ DSSUR[LPDWHO\ b RI WKH ZLOG W\SH WUDQVFULSWLRQDO DFWLYLW\ 7KH VHTXHQFH EHWZHHQ DQG ES RI 6 JHQH SURPRWHU WKDW LV QHFHVVDU\ IRU WKLV ORZ OHYHO H[SUHVVLRQ LQFOXGHV D &$$7 ER[ DQG D ES LQYHUWHG UHSHDW ZKLFK VKRZV OLPLWHG KRPRORJ\ ZLWK WKH 69 HQKDQFHU FRUH FRQVHQVXV f 7KH &$$7 VHTXHQFHV RI WKH UEF6 JHQH KRZHYHU DUH QRW QHFHVVDU\ IRU DFWLYLW\ DV GHPRQVWUDWHG E\ DQ LQWHUQDO GHOHWLRQ RI WKLV UHJLRQ f %\ UHPRYLQJ WR ES UEF6 WUDQVFULSWLRQ DFWXDOO\ LQFUHDVHV WR DSSUR[LPDWHO\ b RI QRUPDO ZLOG W\SH OHYHOV $QRWKHU LQWHUQDO GHOHWLRQ PDGH E\ 7LPNR HW DO f IURP WR ES RI WKH UEF6 JHQH UHVXOWHG LQ QR DFWLYLW\ %DVHG RQ WKHVH REVHUYDWLRQV WKH VHTXHQFHV DURXQG WKH &$$7 ER[ DUH QRW UHTXLUHG IRU HIILFLHQW OLJKW LQGXFLEOH H[SUHVVRQ EXW WKH 7$7$ ER[ LV HVVHQWLDO IRU VXFK H[SUHVVLRQ (YHQ WKRXJK WKH SURPRWHU UHJLRQ RI WKH UEF6 JHQH ZKLFK LQFOXGHV WKH &$$7 ER[ ZDV QRW QHHGHG WKLV JHQH VHHPV WR UHTXLUH RWKHU VHTXHQFHV n WR 7$7$ IRU

PAGE 26

DFWLYLW\ WR RFFXU 7KLV ZRXOG WKHQ UHIOHFW WKH VLWXDWLRQ VHHQ LQ VRPH RI WKH LQGXFLEOH DQLPDO JHQHV LQ ZKLFK VKRUW VHTXHQFH HOHPHQWV DUH UHTXLUHG WR EH ORFDWHG LPPHGLDWHO\ XSVWUHDP RI WKH 7$7$ ER[ f 'LUHFW GHPRQVWUDWLRQ LQ SODQWV RI D UHTXLUHPHQW IRU WKH SUHVHQFH RI DQ HOHPHQW LPPHGLDWHO\ SUR[LPDO WR 7$7$ LQ WKH UHJLRQ DQDORJRXV WR WKH XSVWUHDP HOHPHQW RI DQLPDO JHQHV LV VWLOO QHHGHG $QDO\VLV RI WKH n GHOHWLRQ PXWDWLRQV LQ WKH SURPRWHU RI WKH 126 JHQH GHPRQVWUDWHG WKH UHTXLUHPHQW RI VHTXHQFHV XSVWUHDP RI WKH 7$7$ ER[ IRU IXOO WUDQVFULSWLRQDO DFWLYLW\ ,Q RQH VWXG\ 6KDZ HW DO f GHPRQVWUDWHG WKDW ES RI SURPRWHU ZKLFK RQO\ LQFOXGHV &$$7 ER[ DQG 7$7$ ZDV UHTXLUHG IRU ZLOG W\SH DFWLYLW\ ZKHQ XVLQJ .DODQFKH WXPRUV DQG DVVD\LQJ IRU WKH SURGXFWLRQ RI QRSDOLQH +RZHYHU ZKHQ $Q HW DO f XVHG WREDFFR FDOOL LQVWHDG WR H[DPLQH GHOHWLRQ PXWDQWV RI WKH 126 JHQH ES RI SURPRWHU VHTXHQFH XSVWUHDP WR WKH FDS VLWH ZDV QHHGHG WR PDLQWDLQ QRUPDO OHYHOV RI DFWLYLW\ $Q ES LQYHUWHG UHSHDW DORQJ ZLWK WKH VHFRQG SDUW RI DQ ES GLUHFW UHSHDW UHVLGH ZLWKLQ WKH VHTXHQFHV EHWZHHQ DQG ES RI WKLV SURPRWHU 7KH SUHVHQFH RI UHSHDWV LQ WKH XSVWUHDP HOHPHQW UHJLRQ RI WKH 126 SURPRWHU LV VLPLODU WR WKH SUHVHQFH RI UHSHDWV GLIIHUHQW IURP WKRVH IRXQG LQ WKH 126 SURPRWHUf LQ WKH SURPRWHU RI WKH &D09 6 JHQH DQG VXJJHVWV WKDW WKH UHGXQGDQF\ RI WKHVH VHTXHQFHV PD\ EH LPSRUWDQW IRU WKH H[SUHVVLRQ RI WKHVH WZR JHQHV 7KH RSSRVLQJ UHVXOWV RI WKH WZR 126 VWXGLHV PD\ EH D SUHOLPLQDU\ LQGLFDWLRQ RI GLIIHUHQWLDO WUDQVFULSWLRQDO DFWLYLW\ UHTXLUHPHQWV IRU GLIIHUHQW SRUWLRQV RI WKH VDPH SURPRWHU ZKLFK LV GHSHQGHQW RQ WKH KRVW SODQW VSHFLHV $QRWKHU H[DPSOH RI GLIIHUHQWLDO VHTXHQFH UHTXLUHPHQWV IRU H[SUHVVLRQ DV D IXQFWLRQ RI WKH SODQW V\VWHP XVHG FDQ EH VHHQ ZLWK WKH RFWRSLQH V\QWKDVH JHQH 2&6f DV GHPRQVWUDWHG E\ .RQF] HW DO f 7KH\ PDGH nGHOHWLRQV WR DQG ES RI WKH 2&6 SURPRWHU LQWURGXFHG WKHP LQWR WREDFFR WLVVXH DQG

PAGE 27

PHDVXUHG 2&6 DFWLYLW\ 7KH n GHOHWLRQ WR ES GLG QRW DIIHFW H[SUHVVLRQ ZKHUHDV D GHOHWLRQ WR HLWKHU RU ES UHVXOWHG LQ QR DFWLYLW\ 7KLV UHVXOW GRHV QRW DJUHH ZLWK UHVXOWV RI 0XULD HW DO ,OOf ZKR GHPRQVWUDWHG WKDW WKH H[SUHVVLRQ OHYHOV RI WKH 2&6 SURPRWHU FRQWDLQLQJ RQO\ ES %DP<:f IXVHG WR WKH SKDVHROLQ FRGLQJ UHJLRQ ZDV YHU\ KLJK LQ VXQIORZHU SODQWV 7KHUHIRUH LW ZRXOG DSSHDU WKDW WKH UHTXLUHPHQW RI VHTXHQFHV XSVWUHDP RI WKH &$$7 ER[ GLIIHUV GHSHQGLQJ RQ WKH KRVW V\VWHP (QKDQFHUOLNH (OHPHQWV (QKDQFHUOLNH HOHPHQWV DUH IRXQG LQ WZR OLJKWLQGXFLEOH WLVVXHVSHFLILF JHQHV RI SHD WKH UEF6 f DQG WKH OLJKW KDUYHVWLQJ FKORURSK\OO DE ELQGLQJ SURWHLQ &DEf f ,Q WKH FDVH RI WKH UEF6 HQKDQFHUOLNH HOHPHQW D ES UHJLRQ FD WR ESf LPSDUWV OLJKWLQGXFLELOLW\ DV ZHOO DV WLVVXHVSHFLILFLW\ RQ ERWK WKH 126 SURPRWHU DQG WKH &D09 6 SURPRWHU ZKHQ SUHVHQW n WR WKH 7$7$ ER[ LQ HLWKHU RULHQWDWLRQ ,Q DQRWKHU VWXG\ KRZHYHU D UHJLRQ IURP WR ES RI UEF6 JHQH ZKLFK LQFOXGHV WKH HQKDQFHUOLNH HOHPHQW IDLOHG WR SURPRWH DFWLYLW\ LQ D GRZQVWUHDP ORFDWLRQ RI 126 SURPRWHU IXVHG WR WKH &$7 FRGLQJ UHJLRQ f 7KH FRQFOXVLRQ WKDW WKH UEF6 HQKDQFHU GRHV QRW IXQFWLRQ n WR WKH JHQH PD\ QRW EH YDOLG VLQFH WKLV ODWWHU FRQVWUXFWLRQ PLJKW KDYH LQWHUIHUHG ZLWK SRO\ $f DGGLWLRQ GXH WR WKH SODFHPHQW RI WKH ES UEF6 UHJLRQ EHWZHHQ WKH 126&$7 JHQH DQG LWV SRO\ $f DGGLWLRQ VLWH ,W LV SRVVLEOH WKDW WKH UEF6 HQKDQFHUOLNH UHJLRQ PD\ IXQFWLRQ QRUPDOO\ LI LW LV SODFHG IXUWKHU GRZQVWUHDP RI WKH SRO\ $f DGGLWLRQ VLWH :KHQ DVVD\HG LQ UHJHQHUDWHG WREDFFR SODQWV D ES UHJLRQ WR ESf IURP WKH &DE JHQH DOVR FRQIHUV OLJKWLQGXFWLRQ DQG WLVVXHVSHFLILFLW\ RQ WKH FRQVWLWXWLYH 126 SURPRWHU ZKHQ SODFHG XSVWUHDP LQ HLWKHU RULHQWDWLRQ 'XSOLFDWLQJ WKLV HQKDQFHUOLNH HOHPHQW LQFUHDVHV OLJKW LQGXFWLRQ IROG RI WKH 126 SURPRWHU LQ

PAGE 28

OHDYHV ZKHQ FRPSDUHG WR D VLQJOH HOHPHQW 7KLV HOHPHQW LV KRZHYHU XQDEOH WR DFWLYDWH DQ\ H[SUHVVLRQ RI WKH 1261SWOO JHQH ZKLOH LQ WKH GRZQVWUHDP SRVLWLRQ UHJDUGOHVV RI RULHQWDWLRQ $QRWKHU LQWHUHVWLQJ HIIHFW WKDW WKLV ES VHTXHQFH LPSDUWV LV LWV DELOLW\ WR VLOHQFH LQ HLWKHU RULHQWDWLRQ WKH FRQVWLWXWLYH H[SUHVVLRQ RI WKH 126 SURPRWHU LQ URRW WLVVXHV :KHQ WKH HQKDQFHUOLNH VHTXHQFH LV UHPRYHG WKLV SURPRWHU LV HTXDOO\ DFWLYH ERWK LQ OHDYHV DQG URRWV LQ LWV QRUPDO FRQVWLWXWLYH PDQQHU 7ZR GLIIHUHQW SURSHUWLHV DUH LQKHUHQW ZLWKLQ WKLV &DE HQKDQFHUOLNH HOHPHQW RQH LQYROYLQJ WLVVXHVSHFLILFLW\ DQG WKH RWKHU LWV DELOLW\ WR LQFUHDVH DFWLYLW\ E\ WKH LQWURGXFWLRQ RI PXOWLSOH FRSLHV RI WKH VHTXHQFH ,QGXFLEOH 3ODQW *HQHV 0DQ\ H[DPSOHV RI LQGXFLEOH JHQHV H[LVW LQ SODQWV f 6RPH RI WKHVH JHQHV FRQWDLQ UHSHWLWLYH HOHPHQWV ZLWK HQKDQFHUOLNH FKDUDFWHULVWLFV VLPLODU WR WKRVH IRXQG LQ DQLPDO JHQHV 5HJXODWLRQ RI WKHUPDO LQGXFLELOLW\ KDV EHHQ FRQVHUYHG WKURXJKRXW GLYHUVH JURXSV RI HXFDU\RWHV $V PHQWLRQHG HDUOLHU KHDW VKRFN HOHPHQWV +6(f DUH VPDOO UHSHWLWLYH VHTXHQFHV ZKLFK LQWHUDFW ZLWK VSHFLILF IDFWRUV f LQ DQLPDO KHDW VKRFN JHQHV DQG DUH UHVSRQVLEOH IRU KHDW LQGXFLELOLW\ RI WUDQVFULSWLRQ 7KH VHTXHQFHV RI WKH SURPRWHUV RI VHYHUDO KHDW VKRFN JHQHV IURP VR\EHDQ DQG PDL]H DUH NQRZQ f DQG FRQWDLQ nIODQNLQJ VHTXHQFHV WKDW DUH VLPLODU WR WKH 'URVRSKLOD KVS JHQH +6(nV $SSDUHQWO\ FRQVHUYDWLRQ RI RWKHU DVSHFWV RI WKH WKHUPDO LQGXFWLRQ V\VWHP KDYH DOVR EHHQ PDLQWDLQHG EHWZHHQ DQLPDOV DQG SODQWV DV GHPRQVWUDWHG E\ 6SHQD HW DO f ,Q WKLV VWXG\ WKH KVS SURPRWHU RI 'URVRSKLOD ZDV IXVHG WR WKH 1SWOO FRGLQJ UHJLRQ DQG LQWURGXFHG LQWR WREDFFR WLVVXH XVLQJ $ WXPHIDFLHQV 7KH IXVHG JHQH ZDV H[SUHVVHG DIWHU KHDW VKRFN LQ b RI WKH WUDQVIRUPHG FDOOL $Q H[DPSOH RI LQWHUVSHFLHV FRQVHUYDWLRQ RI WKH

PAGE 29

KHDW VKRFN UHVSRQVH LQ SODQWV ZDV LOOXVWUDWHG E\ *XUOH\ HW DO f LQ ZKLFK WKH\ LQWURGXFHG D VPDOO KHDW VKRFN JHQH ^* PKVS (f RI VR\EHDQ LQWR VXQIORZHU WXPRUV XVLQJ D 7LSODVPLG EDVHG YHFWRU V\VWHP DQG VKRZHG D W\SLFDO WKHUPDO LQGXFLEOH UHVSRQVH 'HOHWLRQV RI WKH nIODQNLQJ VHTXHQFHV LQ WKLV JHQH WR ES VWLOO UHWDLQHG b RI LWV ZLOG W\SH ES RI SURPRWHUf KHDW LQGXFLELOLW\ +RZHYHU GHOHWLRQV WR ES VKDUSO\ UHGXFHG WKH KHDWLQGXFLEOH WUDQVFULSWLRQ WR DSSUR[LPDWHO\ b RI QRUPDO OHYHOV 7KHUH DUH WZR UHJLRQV EHWZHHQ DQG ES WKDW PD\ EH UHVSRQVLEOH IRU WKH ORVV RI DFWLYLW\ DQ LPSHUIHFW G\DG7$7$ FHQWHUHG DW ES ZKLFK ZDV IRXQG LQ VHYHUDO 'URVRSKLOD KHDW VKRFN JHQHV f DQG D RXW RI ES KRPRORJ\ ZLWK WKH +6( FRQVHQVXV WKDW LV SDUWLDOO\ GLVUXSWHG E\ WKH ES GHOHWLRQ 7KH DOFRKRO GHK\GURJHQDVH JHQH RI PDL]H DQRWKHU LQGXFLEOH SODQW JHQH DOVR VHHPV WR KDYH D FRPSOH[ SURPRWHU VWUXFWXUH EDVHG RQ LQ YLYR '1DVH K\SHUVHQVLWLYLW\ $ UHJLRQ WR ESf LQ WKH SURPRWHU RI WKH PDL]H DOFRKRO GHK\GURJHQDVH $GKf JHQH LV DFFHVVLEOH WR '1DVH GLJHVWLRQ LQ D FRQVWLWXWLYH PDQQHU ZKHWKHU RU QRW WKH PDL]H FHOOV DUH SODFHG XQGHU DQDHURELF VWUHVV f +RZHYHU DQRWKHU UHJLRQ IURP WR ES LV RQO\ DFFHVVDEOH WR '1DVH GLJHVWLRQ ZKHQ DQDHURELFDOO\ LQGXFHG 7KHVH '1DVH K\SHUVHQVLWLYLW\ VLWHV PD\ EH GXH WR SUHIHUHQWLDO FKDQJH LQ WKH FKURPDWLQ VWUXFWXUH ZKLFK LV LQGXFHG E\ DQDHURELF FRQGLWLRQV WR DOORZ DFFHVV RI WKLV UHJLRQ WR LQWHUDFWLRQ ZLWK IDFWRUV UHTXLUHG IRU H[SUHVVLRQ ,Q DQRWKHU VWXG\ ,QJHUVROO )HUO DQG *XUOH\ XQSXEOLVKHG UHVXOWVf GHPRQVWUDWHG WKDW WKH PHFKDQLVP RI DQDHURELF LQGXFWLRQ RI PDL]H $GK LV FRQVHUYHG LQ KHWHURORJRXV SODQW VSHFLHV 7KH\ LQWURGXFHG WKH $GK JHQH LQFOXGLQJ DSSUR[LPDWHO\ ES RI n IODQNLQJ VHTXHQFHV LQWR VXQIORZHU WXPRUV LQFLWHG E\ $ WXPHIDFLHQV DQG REVHUYHG H[SUHVVLRQ VSHFLILFDOO\ LQGXFLEOH E\ DQDHURELF VWUHVV 7KH\ DOVR GHPRQVWUDWHG WKDW WKLV LQGXFWLRQ FRXOG

PAGE 30

VWLOO RFFXU DOEHLW DW YHU\ ORZ OHYHOV ZLWK RQO\ ES RI nIODQNLQJ VHTXHQFH ,W VHHPV SODXVLEOH WKDW D UHJLRQ RI WKH $GK SURPRWHU XSVWUHDP RI SRVLWLRQ ES PD\ EH UHTXLUHG IRU KLJK OHYHOV RI H[SUHVVLRQ RQO\ DQG WKDW WKH 7$7$SUR[LPDO VHTXHQFHV DUH UHTXLUHG IRU WKH DQDHURELF LQGXFWLRQ 'HPRQVWUDWLRQ RI DQ\ HQKDQFHUOLNH HOHPHQWV VLPLODU WR WKH 05(nV RU +6(nV ZKLFK FDQ DQDHURELFDOO\ LQGXFH $GK JHQH DZDLWV WKH UHVXOWV RI IXUWKHU VWXGLHV 7'1$ RI $ WXPHIDFLHQV 7KH 7'1$ ZKLFK UHVLGHV RQ WKH WXPRU LQGXFLQJ SODVPLG S7Lf RI $ WXPHIDFLHQV LV WUDQVIHUUHG DQG UDQGRPO\ LQWHJUDWHG LQWR WKH SODQW JHQRPH XSRQ ZRXQGLQJ ([SUHVVLRQ RI SK\WRKRUPRQHSURGXFLQJ 7'1$ JHQHV WKHQ LQGXFHV FURZQ JDOO IRUPDWLRQ IRU UHYLHZ VHH f 7KH RSLQH V\QWKDVHV DUH DOVR HQFRGHG RQ WKH 7'1$ DQG DUH LQYROYHG LQ WKH SURGXFWLRQ RI RSLQHV XVXDOO\ FRQGHQVDWLRQ SURGXFWV RI FHUWDLQ DPLQR DFLGV DQG VXJDUVf ZKLFK VXSSO\ WKH $JUREDFWHULXP ZLWK D FDUERQ DQG QLWURJHQ VRXUFH f 7KH VWUDLQV RI $ WXPHIDFLHQV DQG WKH WXPRUV WKH\ FDQ LQFLWH DUH FDWHJRUL]HG DFFRUGLQJ WR WKH W\SH RSLQH IRU H[DPSOH RFWRSLQH QRSDOLQH DJURSLQH HFWf SURGXFHG LQ WKH WXPRU WLVVXH f ,Q SODQW WXPRUV LQFLWHG E\ VRPH RFWRSLQH SURGXFLQJ VWUDLQV RI $ WXPHIDFLHQV WKH 7'1$ LV VHSDUDWHG LQWR WZR SDUWV 7OHIW DQG 7ULJKW )LJ f 7OHIW HQFRGHV SK\WRKRUPRQH ELRV\QWKHWLF JHQHV DV ZHOO DV WKH RFWRSLQH V\QWKDVH 2&6f JHQH ZKLOH 7ULJKW RQO\ VHHPV WR HQFRGH RSLQH V\QWKDVHV f 7KUHH JHQHV DUH UHVSRQVLEOH IRU SK\WRKRUPRQH SURGXFWLRQ DQG *HQHV DQG DUH LQYROYHG ZLWK DX[LQ ELRV\QWKHVLV ZKLOH JHQH LV LQYROYHG ZLWK F\WRNLQLQ ELRV\QWKHVLV f $OO WKUHH DUH UHVSRQVLEOH IRU WXPRU IRUPDWLRQ *HQH ZKLFK HQFRGHV D WU\SWRSKDQPRQRR[\JHQDVH VKRZV

PAGE 31

7/ 75 2&6 n n n 7 2f %DP +, +LQG+, (FR 5OL D W F f $ ) % (& S7LO U nf (FR 5 6SK nf B nf f§ f§ ‘ f§ +LQGL )LJXUH 7'1$ UHVWULFWLRQ HQ]\PH PDS RI S7LO 7KH UHVWULFWLRQ VLWHV DUH EDVHG RQ WKH VHTXHQFH RI %DUNHU HW DO f $UURZV GHQRWH WKH SRVLWLRQ DQG SRODULWLHV RI WKH WUDQVFULSWV SUHVHQW LQ 7OHIW f DQG 7ULJKW f 7KH (FR5O6SKO IUDJPHQW FRQWDLQLQJ WKH JHQH ZDV XVHG LQ WKLV VWXG\ 'HVLJQDWLRQV DQG FRUUHVSRQG WR WUDQVFULSWV n DQG n LQ 7ULJKW

PAGE 32

VLJQLILFDQW VHTXHQFH KRPRORJ\ ZLWK WKH LQGROHDFHWDPLGH K\GURODVH JHQH LDD0f RI 3VHXGRPRQDV VDYDVWDQRL f $PLQR DFLG UHVLGXHV f§ RI WKH JHQH SURWHLQ VKRZ D KLJK GHJUHH RI KRPRORJ\ WR WKH DGHQLQH ELQGLQJ VLWH DPLQR DFLG UHVLGXHV f RI WKH 3VHXGRPRQDV IORUHVFHQV SK\GUR[\EHQ]RDWH K\GUR[\ODVH 7KH KRPRORJ\ ZLWK JHQHV IURP 3VHXGRPRQDV DQG WKH IDFW WKDW VRPH RI WKH 7'1$ JHQHV DUH DOVR H[SUHVVHG LQ $ WXPHIDFLHQV f VXJJHVW WKDW 7'1$ JHQHV PD\ KDYH DQ DQFHVWUDOO\ EDFWHULDO RULJLQ 7KH FRPSOHWH VHTXHQFH RI WKH 7'1$ IURP DQ RFWRSLQHW\SH S7L VWUDLQ LV NQRZQ f DQG LQGLFDWHV RSHQ UHDGLQJ IUDPHV RI ORQJHU WKDQ DPLQR DFLGV LQ WKH 7OHIW DQG 7ULJKW 2QO\ RI WKHVH RSHQ UHDGLQJ IUDPHV FRUUHVSRQG WR WKRVH JHQHV NQRZQ WR EH WUDQVFULEHG LQ SODQWV f 0RVW RI WKHVH SODQWWUDQVFULEHG JHQHV KDYH FKDUDFWHULVWLFV RI HXFDU\RWLF JHQHV WUDQVFULEHG E\ 51$ SRO\PHUDVH ,, 7KHVH LQFOXGH WKH 7$7$ VHTXHQFHV DQG &$$7 ER[ PRWLIV XSVWUHDP IURP WKH VWDUW RI WUDQVFULSWLRQ DQG SRO\ $f DGGLWLRQ VLJQDOV EH\RQG WKH VWRS FRGRQ 7KHUH LV QR HYLGHQFH WKDW DQ\ 7'1$ JHQHV FRQWDLQ LQWURQV f 7KH JHQHV SUHVHQW RQ WKH 7'1$ DUH WUDQVFULEHG LQ SODQWV LQ PRGHUDWH WR ORZ DEXQGDQFH UHSUHVHQWLQJ OHVV WKDQ b RI WKH WRWDO SRO\ $f 51$ RI WKH WXPRU FHOOV f 7'1$ JHQHV DUH XVXDOO\ WKRXJKW WR EH H[SUHVVHG LQ D FRQVWLWXWLYH PDQQHU UHJDUGOHVV RI WKH SODQW WLVVXH f +RZHYHU JHQH WKH OHIWPRVW JHQH RQ 7OHIW PD\ EH H[SUHVVHG LQ D WLVVXHVSHFLILF PDQQHU f HYHQ WKRXJK WKH UHVXOWV RI WKH JHQH VWXGLHV DUH XQFOHDU 7KH RSLQH OHYHOV IURP WKH JHQH SURPRWHU2&6 FRGLQJ UHJLRQ IXVLRQ JHQH DSSHDUV WR EH H[SUHVVHG DW WKH KLJKHVW OHYHOV LQ FDOOXV WLVVXHV DQG LQ VWHPV RI WUDQVIRUPHG WREDFFR SODQWV DQG DUH EDUHO\ GHWHFWDEOH LQ IXOO\ GHYHORSHG OHDYHV 7KH H[SUHVVLRQ RI WKLV IXVLRQ JHQH LQ PDWXUHG OHDYHV LV IXOO\ UHVWRUHG ZKHQ OHDI VHFWLRQV DUH LQFXEDWHG RQ D KLJK DX[LQ ORZ F\WRNLQLQ PHGLXP 2Q WKH RWKHU

PAGE 33

KDQG LQFXEDWLRQ RI FDOOXV WLVVXH RQ KLJK F\WRNLQLQ ORZ DX[LQ PHGLXP UHVXOWV LQ D GHFUHDVH LQ DFWLYLW\ RI WKLV JHQH 7KHVH UHVXOWV VXJJHVW WKDW WKH SURGXFW RI JHQH LV SURGXFHG RQO\ LQ WLVVXHV KDYLQJ D KLJK OHYHO RI LQWHUQDO DX[LQV UHODWLYH WR WKH OHYHO RI LQWHUQDO F\WRNLQLQV f $OWHUQDWLYHO\ VLQFH WUDQVFULSW OHYHOV ZHUH QRW GLUHFWO\ DVVHVVHG WKHVH UHVXOWV PD\ RQO\ UHIOHFW WKH GLIIHUHQWLDO DYDLODELOLW\ RI RSLQH SUHFXUVRUV LQ WKH YDULRXV WLVVXHV DIWHU YDULRXV KRUPRQH WUHDWPHQWV $JUREDFWHULXP KDV D YHU\ EURDG KRVW UDQJH ZLWK WXPRU IRUPDWLRQ REVHUYHG RQ DW OHDVW KRVW SODQW VSHFLHV LQFOXGLQJ JHQHUD RI GLFRW\OHGHQRXV SODQWV IDPLOLHV RI PRQRFRWV DQG VSHFLHV RI J\PQRVSHUPV f ,Q RUGHU WR LQFLWH WXPRUV WKH 7'1$ JHQHV PXVW EH H[SUHVVHG WR VRPH GHJUHH DQG WKHUHIRUH WKH SURPRWHU VHTXHQFHV RI WKHVH JHQHV PXVW FRQWDLQ HOHPHQWV ZKLFK DUH FRQVHUYHG WKURXJKRXW PRVW RI WKH SODQW NLQJGRP $ 7ULJKW JHQH IURP S7L XVHG LQ WKLV GLVVHUWDWLRQ ZDV GHVLJQDWHG DV WKH JHQH VLQFH WKH FRUUHVSRQGLQJ WUDQVFULSW LV DSSUR[LPDWHO\ EDVHV LQ OHQJWK f 3UHYLRXV VWXGLHV RQ WKH JHQH LQFOXGH DQ DSSUR[LPDWH GHWHUPLQDWLRQ RI WKH VWDUW RI WUDQVFULSWLRQ f ZKLFK SODFHG LW DSSUR[LPDWHO\ ES XSVWUHDP RI WKH ILUVW PHWKLRQLQH UHVLGXH 7KH DEXQGDQFH RI WKH JHQH WUDQVFULSWV LQ SRO\ $f 51$ IURP WKH WREDFFR WXPRU OLQH (O DV DQDO\]HG RQ QRUWKHUQ EORWV ZDV PXFK KLJKHU WKDQ WKDW IURP SRO\ $f 51$ IURP WKH VXQIORZHU WXPRU OLQH 36&* 7KLV GLIIHUHQWLDO DEXQGDQFH LV SUREDEO\ GXH WR WKH JUHDWHU FRS\ QXPEHU RI 7ULJKW SUHVHQW LQ WKH JHQRPH RI (O WXPRU WLVVXH .DUFKHU HW DO f UHSRUWHG WKDW WKLV JHQH ZDV WUDQFULEHG DERXW DV HTXDOO\ ZHOO LQ ERWK WREDFFR (f DQG VXQIORZHU 6f WXPRU WLVVXH FXOWXUH OLQHV DW OHYHOV PXFK KLJKHU WKDQ WKH RWKHU 7ULJKW JHQHV 7KH\ REVHUYHG GLIIHUHQFHV RI WKH UHODWLYH OHYHO RI WUDQVFULSWV LQ RWKHU WREDFFR DQG VXQIORZHU FDOOL 7KH JHQH WKHUHIRUH VHHPV WR EH H[SUHVVHG DW IDLUO\ KLJK

PAGE 34

OHYHOV LQ DW OHDVW WZR SODQW VSHFLHV 'XH WR WKH ODFN RI GHILQLWLYH LQIRUPDWLRQ WR WKH FRQWUDU\ WKH JHQH SURPRWHU LV DVVXPHG WR EH FRQVWLWXWLYH LQ LWV H[SUHVVLRQ 7KH IXQFWLRQ RI WKH JHQH DV \HW LV VWLOO XQNQRZQ 7UDQVSRVRQ 7Q LQVHUWLRQV LQ IRXU ORFDWLRQV ZLWKLQ DQG XSVWUHDP IURP WKH JHQH GR QRW DIIHFW WKH SURGXFWLRQ RI DJURSLQH DQG PDQQRSLQH LQ FDOOXV WLVVXH f 7KH RQFRJHQLF SURSHUWLHV RI WKH RFWRSLQH 7L SODVPLGV DQG WKH WUDQVIHU DQG LQWHJUDWLRQ RI 7OHIW DQG 7ULJKW DUH XQDIIHFWHG E\ PXWDWLRQV LQ DQ\ RI WKH 7ULJKW JHQHV 7KH VDPH 7ULJKW PXWDWLRQV DOVR GR QRW DIIHFW H[FUHWLRQ RI PDQQRSLQH RU DJURSLQH VLQFH RSLQHV DUH GHWHFWHG LQ WKH PHGLD RI WKH WXPRUV LQYROYHG LQFOXGLQJ D WXPRU OLQH LQ ZKLFK 7OHIW LV GHOHWHG f 6LQFH OLWWOH LV NQRZQ FRQFHUQLQJ FRQVWLWXWLYH SODQW SURPRWHUV D FKDUDFWHUL]DWLRQ RI WKH IXQFWLRQDO GRPDLQV RI WKH JHQH SURPRWHU LV RI SDUWLFXODU LPSRUWDQFH 7KH FRPSDFW QDWXUH RI WKH 7'1$ JHQHV DQG WKH DYDLODELOLW\ RI WKH JHQH PDNH LW DPHQDEOH WR SURPRWHU VWXGLHV LQ SODQWV ,Q RUGHU WR LGHQWLI\ '1$ VHTXHQFHV LQYROYHG LQ WKH WUDQVFULSWLRQDO H[SUHVVLRQ RI WKH JHQH n DQG LQWHUQDO GHOHWLRQV LQ WKH SURPRWHU ZHUH PDGH DQG WKHQ LQWURGXFHG LQWR VXQIORZHU VHHGOLQJV XVLQJ D 7L SODVPLG YHFWRU V\VWHP GHYHORSHG IRU WKLV VWXG\ 7KH OHYHO RI WUDQVFULSWLRQ IRU HDFK SURPRWHU PXWDWLRQ ZDV DFFXUDWHO\ GHWHUPLQHG XVLQJ D KRPRORJRXV UHIHUHQFH JHQH DV DQ LQWHUQDO VWDQGDUG ZKLFK LV VLPLODU LQ SULQFLSOH WR WKDW GHYHORSHG E\ 0F.QLJKW DQG .LQJVEXU\ LQ WKH DQDO\VLV RI OLQNHU VFDQ PXWDWLRQV RI +69 WN JHQH f )URP WKLV DQDO\VLV WKUHH IXQFWLRQDO GRPDLQV ZLWKLQ WKH SURPRWHU ZHUH LGHQWLILHG 2QH RI WKHVH SURPRWHU GRPDLQV VHHPHG WR KDYH VRPH RI WKH FKDUDFWHULVWLFV RI DQ HQKDQFHU DQG ZDV GHVLJQDWHG DV DQ DFWLYDWRU HOHPHQW 7KH DFWLYDWRU ZDV IXUWKHU DQDO\VHG IRU HQKDQFHUOLNH FKDUDFWHULVWLFV E\ WHVWLQJ IXVLRQV ZLWK WKH JHQH 7$7$ RQ D UHIHUHQFH JHQH YHFWRU $ ILQDO

PAGE 35

VWXG\ ZDV DOVR PDGH WR GHWHFW LQWHUDFWLRQV RI WUDQVFULSWLRQDO IDFWRUV SUHVHQW LQ FUXGH QXFOHDU H[WUDFWV ZLWK WKH DFWLYDWRU

PAGE 36

&+$37(5 352027(5 087$7,21 $1$/<6(6 ,QWURGXFWLRQ $ 7'1$ JHQH ZDV XVHG DV D PRGHO IRU LGHQWLI\LQJ VHTXHQFHV UHTXLUHG IRU FRQVWLWXWLYH WUDQVFULSWLRQDO FRQWURO LQ KLJKHU SODQWV 7KH HIIHFWV RI PRGLILHG nIODQNLQJ UHJLRQV RI WKH JHQH RQ WUDQVFULSWLRQ ZDV DVVHVVHG LQ YLYR XVLQJ WKH QDWXUDO WUDQVIRUPDWLRQ VFKHPH RI $ WXPHIDFLHQV $ 7L SODVPLG EDVHG YHFWRU V\VWHP ZDV ILUVW GHYHORSHG LQ RUGHU WR WUDQVIHU WKLV JHQH LQWR WKH JHQRPH RI D KRVW SODQW 7KLV YHFWRU V\VWHP LQYROYHG WKH FRQVWUXFWLRQ RI D GRXEOH JHQH VKXWWOH YHFWRU ZKLFK FRQWDLQV WZR FRSLHV RI WKH JHQH 2QH RI WKHVH FRSLHV ZDV D PXWDWHG WHVW JHQH ZKLOH WKH RWKHU DFWHG DV UHIHUHQFH ERWK LQWHJUDWHG LQWR WKH 7OHIW '1$ RI D VWUDLQ RI $ WXPHIDFLHQV ZKLFK KDG LWV HQGRJHQRXV JHQH GHOHWHG 7KH VWDUW RI WUDQVFULSWLRQ ZDV WKHQ DFFXUDWHO\ GHWHUPLQHG WR WKH QXFOHRWLGH 7KH WHVW JHQH FRXOG DOVR EH GLVWLQJXLVKHG IURP WKH UHIHUHQFH JHQH E\ 6, QXFOHDVH PDSSLQJ XVLQJ D VLQJOH HQGODEHOHG '1$ SUREH 7KH nIODQNLQJ UHJLRQ RI WKH JHQH ZDV DOWHUHG E\ D VHULHV RI n DQG LQWHUQDO GHOHWLRQV RU VXEVWLWXWLRQV 7KH HIIHFW RI WKHVH PXWDWLRQV RQ WUDQVFULSWLRQDO DFWLYLW\ LQ VXQIORZHU WXPRUV ZDV DVVHVVHG E\ 6, QXFOHDVH SURWHFWLRQ DQDO\VLV GLUHFWO\ XWLOL]LQJ WKH KRPRORJRXV UHIHUHQFH JHQH DV DQ LQWHUQDO VWDQGDUG 5HVXOWV IURP DVVD\V FRQGXFWHG DW GLIIHUHQW WLPHV ZHUH

PAGE 37

FRPSDUDEOH VLQFH ERWK WHVW DQG UHIHUHQFH WUDQVFULSWV FRXOG EH GHWHFWHG XVLQJ D VLQJOH HQGODEHOHG '1$ SUREH ,Q RWKHU SODQW SURPRWHU PXWDWLRQ VWXGLHV LQFOXGLQJ WKRVH XVLQJ WKH &D09 6 JHQH f WKH UEF6 JHQH f DQG WKH FKDOFRQH V\QWKDVH RI $ PDMXV f KHWHURORJRXV UHIHUHQFH JHQHV ZHUH XVHG WR GLUHFWO\ DVVHVV WUDQVFULSWLRQDO DFWLYLW\ VHH 7DEOH f +RZHYHU WKH SUHVHQW VWXG\ ZDV WKH ILUVW WR XWLOL]H D KRPRORJRXV JHQH IRU DQ LQWHUQDO VWDQGDUG HOLPLQDWLQJ DQ\ SRVVLEOH GLVFUHSHQFLHV GXH WR GLIIHUHQFHV RI WHVW DQG UHIHUHQFH SURPRWHUV 0DWHULDOV DQG 0HWKRGV 5HPRYDO RI WKH *HQH IURP S7L 7KH HQGRJHQRXV JHQH RI $ WXPHIDFLHQV VWUUf ZDV UHPRYHG IURP 7ULJKW LQ RUGHU WR IDFLOLWDWH WKH DQDO\VLV RI PXWDWHG JHQH SURPRWHU FRQVWUXFWLRQV LQWURGXFHG LQWR 7OHIW 7KH 7ULJKW GHOHWLRQ PXWDQW RI $ WXPHIDFLHQV ZDV GHVLJQDWHG DV $J 7KH NES ;KRO+ LQGOOO IUDJPHQW WR ES >@f FRQWDLQLQJ WKH JHQH 25) f WKH 25) f DQG PRVW RI WKH n HQG RI WKH JHQH 25) f f ZDV UHSODFHG ZLWK D NES ;KRO+LQGO8 IUDJPHQW IURP WKH WUDQVSRVRQ 7Q f ZKLFK FRQIHUV NDQDP\FLQ UHVLVWDQFH )LJ f 7KH VXEVWLWXWLRQ RI WKH 7ULJKW IUDJPHQW ZDV DFKLHYHG E\ WKH GRXEOH KRPRORJRXV UHFRPELQDWLRQ SURFHGXUH GHVFULEHG E\ 0DW]NH DQG &KLOWRQ ZLWK VRPH PRGLILFDWLRQV f 7KLV GRXEOH KRPRORJRXV UHFRPELQDWLRQ HYHQW XWLOL]HG D EURDG KRVW UDQJH YHFWRU FRQWDLQLQJ 7'1$ IUDJPHQWV DQG WKH 7Q IUDJPHQW DQG ZDV FRQVWUXFWHG DV IROORZV 7KH % D P +,;K R WR ES >@f DQG + LQGOOO(FR5 WR ES >@f IUDJPHQWV IURP 7ULJKW WKDW IODQN WKH NES ;KRO+ LQGOOO UHJLRQ LQ 7ULJKW ZHUH OLJDWHG LQWR WKH EURDG KRVW UDQJH

PAGE 38

7/ 75 m+, (FR 2&6 f§f ff§ ff§ f f f )LJXUH 7KH UHPRYDO RI WKH JHQH IURP WKH 7'1$ RI S7L $Q (FR5O PDS RI 7ULJKW IURP S7LO LV VKRZQ DW WRS ZLWK WKH DUURZV GHQRWLQJ WKH SRVLWLRQV DQG GLUHFWLRQV RI WKH WUDQVFULSWV f 7KH QDWXUDO FRS\ RI WKH JHQH ZDV UHPRYHG E\ UHSODFLQJ WKH NES ;KR?+LQt??? IUDJPHQW IURP WKH 7ULJKW '1$ ZLWK D NES ;KRO+ LQGOOO NDQDP\FLQ UHVLVWDQW IUDJPHQW VROLG EODFNf IURP WKH WUDQVSRVRQ 7Q DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV .DQU NDQDP\FLQ UHVLVWDQW JHQH ; ;KR?? + mGLOO

PAGE 39

SODVPLG S5. f 7KH 6DOO+LQGOOO 7Q IUDJPHQW ZDV WKHQ LQVHUWHG EHWZHHQ WKH WZR IUDJPHQWV UHVXOWLQJ LQ SODVPLG S.Q )LJ f (VFKHULFKLD FROL /( KDUERULQJ S.Q ZDV JURZQ RYHUQLJKW DW r & LQ /XULD EURWK /%f FRQWDLQLQJ WHWUDF\FOLQH WHWf SJPOf DQG NDQDP\FLQ NDQf SJPOf 7KH RYHUQLJKW FXOWXUH POf ZDV SHOOHWHG LQ D PO PLFURIXJH WXEH 7KH FHOOV ZHUH ZDVKHG ZLWK IUHVK /% WR UHPRYH DQWLELRWLFV DQG ILQDOO\ UHVXVSHQGHG LQ PO RI /% $ SRUWLRQ RI WKLV VXVSHQVLRQ SLf ZDV PL[HG ZLWK DQ HTXDO YROXPH RI VLPLODULO\ WUHDWHG ( FROL /( KDUERULQJ S5.O WKDW ZDV JURZQ RYHUQLJKW DW r& LQ /% FRQWDLQLQJ NDQDP\FLQ SJPOf 7KH UHFLSLHQW $ WXPHIDFLHQV VWUUf ZDV DOVR JURZQ RYHUQLJKW LQ /% FRQWDLQLQJ VWUHSWRP\FLQ SJPOf ZDVKHG ZLWK PO RI /% DQG SL RI WKLV RYHUQLJKW JURZWK ZDV PL[HG ZLWK WKH WZR ( FROL FXOWXUH PL[WXUH 7KH SODVPLG S5. HQFRGHV FRQMXJDO WUDQVIHU IXQFWLRQV ZKLFK IDFLOLWDWH WKH WUDQIHU RI S.Q WR $ WXPHIDFLHQV 7KH EDFWHULDO VXVSHQVLRQ ZDV VSRWWHG RQ DQ /% SODWH DQG LQFXEDWHG IRU KRXUV DW r& 7KH FHOOV ZHUH UHVXVSHQGHG LQ DSSUR[LPDWHO\ PO RI VWHULOH P0 0J62S DQG SL RI WKLV VXVSHQVLRQ ZDV PL[HG ZLWK SL RI DQ RYHUQLJKW JURZWK RI ( FROL 6. KDUERULQJ WKH SODVPLG S3+,-, JHQUf f 7KLV PL[WXUH ZDV VSRWWHG RQ DQRWKHU /% SODWH DQG LQFXEDWHG DW r& RYHUQLJKW 7KH S3+,-, SODVPLG LV LQFRPSDWLEOH ZLWK S.Q DQG LWV SUHVHQFH DOORZHG VHOHFWLRQ IRU WKH ORVV RI WKH SODVPLG S.Q DIWHU UHFRPELQDWLRQ ZLWK WKH 7L SODVPLG $IWHU UHVXVSHQVLRQ RI WKH FRQMXJDWHG FHOOV LQ PO RI VWHULOH P0 0J62S WKH\ ZHUH SODWHG RQ $% PLQLPDO PHGLD f FRQWDLQLQJ VWUHSWRP\FLQ SJPOf NDQDP\FLQ SJPOf DQG JHQWDPLFLQ SJPOf ,QGLYLGXDO FRORQLHV ZHUH SLFNHG DIWHU LQFXEDWLQJ GD\V RQ VHOHFWLRQ SODWHV DW r& VFUHHQHG ZLWK WKH NHWRODFWRVH WHVW IRU WKH SUHVHQFH RI $ WXPHIDFLHQV f DQG WKHQ UHVFUHHQHG IRU VHQVLWLYLW\ WR WHWUDF\FOLQH DW SJPO $ WXPHIDFLHQV FRORQLHV WKDW ZHUH VWUU NDQU DQG WHWV VKRXOG FRQWDLQ WKH NDQU JHQH SUHVHQW RQ

PAGE 40

( FROO A S 5 NDQU M .U? / FJO7A A S.Q A WHWU NDQU M S7LAf $WXPHIDFOHQV VWUU 7ULSDUHQWDO &RQMXJDWLRQ S7L 6HOHFWLRQ IRU 'RXEOH 5HFRPELQDWLRQ S3+8, AS7L.Q62M7fAnA A$WXPHIDFLHQVA ,QWURGXFH SODVPLG S3+8, S3+8, f JHQ U f AS7LNDQAA $WXPHIDFOHQV S3+8, VWU 7 NDQ U JHQU WHWU FRLQWHJUDWLRQ VWU NDQ I JHQ U WHW V GRXEOH UHFRPELQDWLRQ )LJXUH 'RXEOH KRPRORJRXV UHFRPELQDWLRQ HYHQW f $ WULSDUHQWDO PDWLQJ LQYROYLQJ WZR ( FROL KRVWV KDUERULQJ WKH SODVPLGV S.Q DQG S5. VHSDUDWHO\ DQG WKH $ WXPHIDFLHQV VWUDLQ UHVXOWV LQ D WUDQVIHU RI WKH S.Q LQWR WKH $ WXPHIDFLHQV f 7KH KRPRORJRXV UHFRPELQDWLRQ RFFXUUHG EHWZHHQ S7L DQG S.Q f $IWHU VHOHFWLQJ IRU VWUHSWRP\FLQ VWUUf NDQDP\FLQ NDQUf DQG WHWUDF\FOLQH WHWUf UHVLVWDQFHV WKH SODVPLG S3+,-, JHQUfZDV WKHQ LQWURGXFHG LQWR WKH $ WXPHIDFLHQV FRQWDLQLQJ S.Q f 6XEVHTXHQW VHOHFWLRQ IRU VWUHSWRP\FLQ NDQDP\FLQ DQG JHQWDPLFLQ UHVLVWDQFHV DV ZHOO DV WHWUDF\FOLQH VHQVLWLYLW\ WHWVf GLVWLQJXLVKHV FRORQLHV WKDW UHVXOWHG LQ WKH GRXEOH UHFRPELQDWLRQ IURP WKRVH WKDW WKH S.Q MXVW FRLQWHJUDWHG LQWR WKH 7L SODVPLG

PAGE 41

WKH 7L SODVPLG ZLWK VXEVHTXHQW ORVV RI WKH UHPDLQGHU RI WKH S.Q SODVPLG ORVV RI WHWUf )RXU WHWV FRORQLHV ZHUH SLFNHG DQG JURZQ RYHUQLJKW LQ /% ZLWK VWUHSWRP\FLQ SJPOf DQG NDQDP\FLQ SJPOf IRU VXEVHTXHQW DQDO\VLV 7KH 7L SODVPLG IURP WKHVH IRXU WUDQVFRQMXJDQWV ZDV LVRODWHG XVLQJ D VPDOO VFDOH '1$ SUHSDUDWLRQ GHVFULEHG E\ &DVVH HW DO f 7KH UHVXOWDQW '1$ ZDV VHSDUDWHG RQ D b DJDURVH JHO ZKLFK ZDV WKHQ WUHDWHG ZLWK D b +& VROXWLRQ IRU PLQXWHV DW URRP WHPSHUDWXUH 7KH JHO ZDV ZDVKHG ZLWK GLVWLOOOHG +2 DQG WKH '1$ ZDV WKHQ GHQDWXUHG DQG WUDQVIHUUHG WR D QLWURFHOOXORVH ILOWHU SDSHU DV GHVFULEHG E\ 6RXWKHUQ f 7ZR GLIIHUHQW QLFN WUDQVODWLRQ SUREHV ZHUH SUHSDUHG f RQH IURP WKH (FR5 +LmGLOO IUDJPHQW FRQWDLQLQJ WKH JHQH DQG WKH RWKHU IURP WKH SODVPLG S.6 JLIW IURP 6XWWRQf WKDW FRQWDLQV WKH 7Q 6DOO+LmGLOO IUDJPHQW FRQIHUULQJ NDQDP\FLQ UHVLVWDQFH %RWK RI WKHVH SUREHV ZHUH K\EULGL]HG DV SUHYLRXVO\ GHVFULEHG f WR GXSOLFDWH 6RXWKHUQ EORWV WR FRQILUP WKH GRXEOH KRPRORJRXV UHFRPELQDWLRQ HYHQW 7KH 7L SODVPLG UHVXOWLQJ IURP WKLV UHFRPELQDWLRQDO HYHQW ODFNV WKH OHIW ERUGHU VHTXHQFH RI 7ULJKW WKH JHQHV FRUUHVSRQGLQJ WR WKH DQG WUDQVFULSWV DQG PRVW RI WKH n WHUPLQXV RI WKH JHQH HQFRGLQJ WKH WUDQVFULSW 3ODVPLG S3+,-, UHVLGLQJ ZLWKLQ $J VHHPHG WR LQWHUIHUH ZLWK WKH LQWURGXFWLRQ RI VKXWWOH YHFWRUV DQG ZDV WKHUHIRUH UHPRYHG E\ D FDUELQLFLOOLQF\FORVHULQH HQULFKPHQW SURFHGXUH f 7KLV PXWDQW $ WXPHIDFLHQV $J ZDV XVHG DV WKH UHFLSLHQW IRU VKXWWOH YHFWRUV FRQWDLQLQJ YDULRXV FRQVWUXFWLRQV RI WKH JHQH &RQVWUXFWLRQ RI WKH ,QWHUPHGLDWH 6KXWWOH 9HFWRU &RQWDLQLQJ WKH 4 5HIHUHQFH *HQH 7KH JHQH ZDV LQLWLDOO\ VXEFORQHG IURP SODVPLG S f E\ OLJDWLRQ RI WKH LVRODWHG (FR5?6SK? IUDJPHQW WR ES >@f LQWR

PAGE 42

S8& f 7KH UHVXOWDQW SODVPLG GHVLJQDWHG S8& FRQWDLQHG WKH FRPSOHWH JHQH FRQVLVWLQJ RI DSSUR[LPDWHO\ ES GRZQVWUHDP RI WKH SRO\ $f DGGLWLRQ VLJQDO WKH SURWHLQ FRGLQJ UHJLRQ DPLQR DFLGVf DQG ES RI nIODQNLQJ VHTXHQFHV )RU SUHFLVH TXDQWLWDWLRQ RI WKH DFWLYLW\ RI WKH SURPRWHU PXWDQWV D UHIHUHQFH JHQH ZDV FRQVWUXFWHG DQG FORQHG LQWR WKH VKXWWOH YHFWRU S: DV VKRZQ LQ )LJ 7KH SODVPLG S: FRQWDLQHG D NES %DP+O6SKO IUDJPHQW RI 7OHIW S7L f IURP S* f LQVHUWHG LQWR WKH ( FROL SODVPLG S$&<&O f 7KH 7OHIW IUDJPHQW SURYLGHG WKH VLWH IRU KRPRORJRXV UHFRPELQDWLRQ RI WKH VKXWWOH YHFWRU LQWR WKH 7L SODVPLG RI $ WXPHIDFLHQV $J 7KH UHIHUHQFH JHQH FRQVLVWHG RI WKH JHQH ZLWK ES RI nIODQNLQJ VHTXHQFHV DQG DQ ES LQWHUQDO GHOHWLRQ LQ WKH XQWUDQVODWHG OHDGHU VHTXHQFH UHVXOWLQJ IURP WKH UHPRYDO RI D 7DT, IUDJPHQW 7KH ES nGHOHWLRQ PXWDQW ZDV XVHG WR HOLPLQDWH RWKHU XSVWUHDP 7DT VLWHV WKDW ZRXOG LQWHUIHUH ZLWK WKH FRQVWUXFWLRQ RI WKH UHIHUHQFH JHQH 7KH LQWHUPHGLDWH VKXWWOH YHFWRU GHVLJQDWHG DV S:7' ZDV FRPSOHWHG E\ FORQLQJ WKH 6DOO6SKO IUDJPHQW FRQWDLQLQJ WKH UHIHUHQFH JHQH LQWR S: 3URPRWHU 'HOHWLRQ DQG 'XSOLFDWLRQ 0XWDQWV $ VHULHV RI n DQG nGHOHWLRQV FRYHULQJ WKH nIODQNLQJ UHJLRQ ZHUH REWDLQHG DV RXWOLQHG LQ )LJ )RU fGHOHWLRQV WKH (FR5 VLWH ZDV FKDQJHG WR %DP +, E\ OLQNHU DGGLWLRQ f 3ODVPLG S8& '1$ SJf ZDV OLQHDUL]HG HLWKHU E\ (FR5 IRU nGHOHWLRQVf RU +LQGL IRU nGHOHWLRQVf DQG VXEVHTXHQWO\ GLJHVWHG ZLWK WKH H[RQXFOHDVH %DO %HWKHVGD 5HVHDUFK /DERUDWRULHVf LQ D SL UHDFWLRQ DW XQLWVPO 7KH UHDFWLRQV ZHUH WHUPLQDWHG E\ DGGLQJ YROXPH RI 0 >HWK\OHQHELVR[\HWK\OHQHQLWULOHf@ WHWUDDFHWLF DFLG (*7$ 6LJPDf )ROORZLQJ DGGLWLRQ RI 6DO OLQNHUV f WKH n DQG nGHOHWLRQ IUDJPHQWV

PAGE 43

)LJXUH &RQVWUXFWLRQ RI WKH UHIHUHQFH JHQH DQG S:7' 7KH UHIHUHQFH JHQH VROLG EODFNf ZDV IRUPHG E\ UHPRYLQJ DQ ES 7DT, IUDJPHQW LQYHUWHG WULDQJOHf LQ WKH n OHDGHU UHJLRQ RI WKH JHQH 7KH LQWHUPHGLDWH VKXWWOH YHFWRU S:7' ZDV REWDLQHG E\ OLJDWLRQ RI WKH UHIHUHQFH JHQH LQWR S: ZKLFK FRQVLVWHG RI D 6SKO%DP+, IUDJPHQW ^%DP +, IUDJPHQW >@f IURP 7OHIW LQVHUWHG LQWR S$&<& f % %DUQ+O ( (FR5? + nmGLOO +H +LQGL 6 6DLO 6S 6SKO 7 7DTO DSU FPU DQG WHWU DUH DPSLFLOOLQ FKORUDPSKHQLFRO DQG WHWUDF\FOLQH UHVLVWDQFH UHVSHFWLYHO\ 2&6 LV RFWRSLQH V\QWKDVH WUDQVFULSW D DQG E DUH 7OHIW WUDQVFULSWV RI WKH 7'1$ f

PAGE 44

AU nL L \f§L + )LJXUH &RQVWUXFWLRQ RI WKH GRXEOH JHQH VKXWWOH YHFWRU FRQWDLQLQJ WKH n DQG LQWHUQDO GHOHWLRQV RI WKH JHQH f DQG n GHOHWLRQV ZHUH FRQVWUXFWHG E\ %DO GLJHVWLRQ RI WKH f IODQNLQJ UHJLRQ DQG VXEVHTXHQW UHFORQLQJ RI WKH GHOHWLRQ PXWDQWV LQWR S8& 7KH n GHOHWLRQ FORQHV ZHUH WKHQ OLJDWHG LQWR S:7' JHQHUDWLQJ GRXEOH JHQH VKXWWOH YHFWRUV ,QWHUQDO GHOHWLRQV ZHUH PDGH E\ OLJDWLQJ LVRODWHG 6DOO+LQGOOO n GHOHWLRQ IUDJPHQWV LQWR WKH n GHOHWLRQ FORQHV DV GHFULEHG LQ 0DWHULDOV DQG 0HWKRGV % %DP +, ( (FR 5O + +LQGOOO +H +LQFO9 6 6DO, 6S 6SKO DSU DQG FPU DUH DPSLFLOOLQ DQG FKORUDPSKHQLFRO UHVLVWDQFH UHVSHFWLYHO\ 7KH EODFN WULDQJOH GHQRWHV WKH 7DT, GHOHWLRQ LQ WKH UHIHUHQFH JHQH OHDGHU 2&6 LV RFWRSLQH V\QWKDVH WUDQVFULSW D DQG E DUH 7OHIW WUDQVFULSWV RI WKH 7'1$ f

PAGE 45

ZHUH VHSDUDWHG IURP S8& VHTXHQFHV E\ GLJHVWLRQ ZLWK +LQ£O: DQG 6DP+, UHVSHFWLYHO\ DQG FORQHG LQWR HLWKHU WKH 6DO?+RU D,DP+, VLWHV RI S8& 'HOHWLRQ HQGSRLQWV ZHUH GHWHUPLQHG E\ '1$ VHTXHQFLQJ f ,QWHUQDO GHOHWLRQ DQG GXSOLFDWLRQ PXWDQWV ZHUH FRQVWUXFWHG DIWHU VHOHFWLRQ RI DSSURSULDWH SDLUV RI n DQG nGHOHWLRQ FORQHV 7KH DSSURSULDWH nGHOHWLRQ IUDJPHQWV 6D,]nUWG,,,f ZHUH LVRODWHG DQG WKHQ LQVHUWHG LQWR WKH 6D,7]AGO+ VLWH RI WKH PDWFKLQJ S8&nGHOHWLRQ FORQHV 7KH n DQG LQWHUQDOO\ GHOHWHG JHQHV ZHUH ILQDOO\ FORQHG EHWZHHQ WKH %DP?L?+cQ£??? VLWHV RI S:7' WR IRUP GRXEOH JHQH VKXWWOH YHFWRUV 7ULSDUHQWDO &RQMXJDWLRQ DQG 7XPRU )RUPDWLRQ 'RXEOH JHQH VKXWWOH YHFWRUV FDUU\LQJ WKH YDULRXV JHQH SURPRWHU DOWHUDWLRQV ZHUH WUDQVIHUUHG IURP ( FROL /( LQWR $ WXPHIDFLHQV $J E\ WKH WULSDUHQWDO FRQMXJDWLRQ SURFHGXUH RI )UDOH\ HW DO f GHVFULEHG DV IROORZV ( FROL /( KDUERULQJ D GRXEOH JHQH VKXWWOH YHFWRU FPUf DQG DQRWKHU ( FROL /( KDUERULQJ WKH WUDQVIHUKHOSHU SODVPLG S5. NDQUf HQFRGLQJ WKH FRQMXJDO WUDQVIHU IXQFWLRQV ZHUH VHSDUDWHO\ JURZQ RYHUQLJKW DW r& LQ /% ZLWK DSSURSLDWH DQWLELRWLFV $ WXPHIDFLHQV $J ZDV DOVR JURZQ IRU WZR GD\V DW r& LQ /% ZLWK DSSURSULDWH DQWLELRWLFV $IWHU ZDVKLQJ PO RI HDFK RI WKHVH FXOWXUHV ZLWK IUHVK /% SL RI HDFK ZHUH PL[HG WRJHWKHU DQG VSRWWHG RQ D /% SODWH DQG LQFXEDWHG GD\V DW r& 7KH FHOOV ZHUH WKHQ UHVXVSHQGHG LQ PO RI VWHULOH P0 0J6 DQG SODWHG RQ $% PLQLPDO PHGLD ZLWK VWUHSWRP\FLQ SJPOf NDQDP\FLQ SJPOf DQG FKORUDPSKHQLFRO SJPOf DQG LQFXEDWHG DW r& IRU GD\V 7UDQVFRQMXJDQW FRORQLHV ZHUH WHVWHG E\ RYHUQLJKW JURZWK LQ PO RI /% ZLWK VWUHSWRP\FLQ SJPOf NDQDP\FLQ SJPOf DQG FKORUDPSKHQLFRO SJPOf 7KH VWUU NDQU DQG FPU FORQHV ZHUH DQDO\VHG E\ 6RXWKHUQ EORW DQDO\VLV f DIWHU VPDOO VFDOH '1$ SUHSDUDWLRQ f

PAGE 46

7XPRUV ZHUH LQFLWHG RQ RQH ZHHN ROG VXQIORZHU VHHGOLQJV +HOLDQWKXV DQQXXV FY /DUJH *UH\f E\ LQMHFWLQJ D GURS RI DQ RYHUQLJKW JURZWK RI $ WXPHIDFLHQ WUDQVFRQMXJDQW LQWR WKH K\SRFRW\OV XVLQJ D V\ULQJH ILWWHG ZLWK D JDXJH QHHGOH LQFKf 7KH SODQWV ZHUH WKHQ JURZQ ZLWK DQ KRXU OLJKW F\FOH IRU WR GD\V DW URRP WHPSHUDWXUH 8VXDOO\ WR WXPRUV IRU HDFK SURPRWHU PXWDWLRQ ZHUH KDUYHVWHG LPPHGLDWHO\ IUR]HQ ZLWK OLTXLG QLWURJHQ DQG WKHQ VWRUHG DW r& 7RWDO 51$ ([WUDFWLRQ DQG 3RO\ $f 51$ ,VRODWLRQ IURP 6XQIORZHU 7XPRUV 7RWDO 51$ ZDV H[WUDFWHG E\ WKH PHWKRG RI -DFNVRQ DQG ,QJOH f DV D PRGLILHG E\ &]DUQHFND HW DO f $SSUR[LPDWHO\ J RI IUR]HQ WXPRUV ZHUH JURXQG LQ D PRUWDU DQG SHVWOH LQ WKH SUHVHQFH RI PO RI JULQGLQJ EXIIHU FRQWDLQLQJ P0 7ULV+&O S+ f P0 1D&O b ZWYf SDPLQRVDOLF\ODWH 6LJPDf b ZWYf WULLVRSURS\OQDSWKDOHQHVXOIRQDWH .RGDNf b YYf QEXWDQRO b ZWYf SRO\YLQ\OS\UUROLGRQH 6LJPDf P0 GLHWK\OGLWKLRFDUEDPDWH 6LJPDf DQG P0 GLWKLRWKUHLWRO '77 6LJPDf $IWHU JULQGLQJ WKH WXPRUV WR D VOXUU\ WKH PL[WXUH ZDV FRPSOHWHO\ KRPRJHQL]HG IRU PLQXWHV XVLQJ D 7HNPDU WLVVXPL]HU WKHQ H[WUDFWHG WZLFH E\ VKDNLQJ IRU KRXU ZLWK DQ HTXDO YROXPH RI SKHQROFKORURIRUPLVRDP\O DOFRKRO f 7KH QXFOHLF DFLGV ZHUH SUHFLSLWDWHG E\ DGGLQJ YROXPH RI 0 VRGLXP DFHWDWH DQG YROXPHV RI LFHFROG b HWKDQRO )ROORZLQJ FHQWULIXJDWLRQ RI WKH SUHFLSLWDWH WKH FROOHFWHG SHOOHW ZDV UHVXVSHQGHG LQ PO RI P0 7ULV+&O S+ f P0 ('7$ DQG b VDUNRV\O 6LJPDf 7(6f DQG H[WUDFWHG DJDLQ ZLWK SKHQROFKORURIRUP IRU PLQXWHV EHIRUH FHQWULIXJLQJ $Q HTXDO YROXPH RI D SUHFLSLWDWLQJ VROXWLRQ FRQWDLQLQJ 0 /L&O 0 XUHD DQG P0 ('7$ ZDV DGGHG WR WKH VHSDUDWHG DTXHRXV SKDVH WR FDXVH WKH 51$ WR SUHFLSLWDWH GXULQJ DQ RYHUQLJKW LQFXEDWLRQ DW r& 7KH 51$

PAGE 47

ZDV FROOHFWHG E\ D PLQXWH ;J FHQWULIXJDWLRQ DQG ZDVKHG ZLWK WKH RULJLQDO YROXPH RI D VWUHQJWK SUHFLSLWDWLQJ VROXWLRQ WKHQ WKH 51$ ZDV FROOHFWHG DJDLQ E\ FHQWULIXJDWLRQ 7KH SHOOHW ZDV UHVXVSHQGHG LQ PO RI 7(6 DQG SUHFLSLWDWHG ZLWK VRGLXP DFHWDWH DQG b HWKDQRO 7KH WRWDO 51$ ZDV ILQDOO\ UHVXVSHQGHG LQ VWHULOH P0 7ULV+&O S+ f DQG P0 ('7$ WR D FRQFHQWUDWLRQ RI PJPO 7KH SRO\ $f 51$ IUDFWLRQ ZDV LVRODWHG XVLQJ ROLJR G7f FHOOXORVH FKURPDWRJUDSK\ f $SSUR[LPDWHO\ SJ RI WRWDO 51$ PJPOf LQ P0 7ULV+&O S+f P0 ('7$ 7(f ZLWK b VRGLXP GRHGHF\OVXOIDWH 6'6f ZDV KHDW GHQDWXUHG PLQXWHV DW r&f DQG YROXPH 0 1D&O ZDV DGGHG DQG WKHQ WKH PL[WXUH ZDV FRROHG WR URRP WHPSHUDWXUH 7KLV 51$ VROXWLRQ ZDV F\FOHG WLPHV DW URRP WHPSHUDWXUH WKURXJK D PO ROLJR G7f FHOOXORVH %HWKHVGD 5HVHDUFK /DERUDWRULHVf FROXPQ WKDW ZDV SUHYLRXVO\ HTXLOLEUDWHG ZLWK 7( FRQWDLQLQJ 0 1D&O $IWHU ZDVKLQJ WKH FROXPQ ZLWK WKH HTXLOLEUDWLQJ EXIIHU WKH SRO\ $f IUDFWLRQ ZDV HOXWHG ZLWK 7( DW r& *HQHUDOO\ WKH ILUVW PO RI HOXDWH ZHUH SRROHG DQG WKH SRO\ $f 51$ SUHFLSLWDWHG ZLWK ERWK YROXPH RI P0 0J DFHWDWH 0 1D DFHWDWH DQG [ YROXPH RI b HWKDQRO 7KH SRO\ $f 51$ ZDV WKHQ GLVVROYHG LQ VWHULOH ZDWHU &RQFHQWUDWLRQV RI 51$ ZHUH FDOFXODWHG IURP WKH RSWLFDO GHQVLW\ DW QP SJPO 2'f 6, 1XFOHDVH $QDO\VLV 7UDQVFULSW OHYHOV RI ERWK WKH WHVW JHQH DQG UHIHUHQFH JHQH ZHUH DVVD\HG E\ 6, QXFOHDVH K\EULG SURWHFWLRQ f $QDO\VHV ZHUH SHUIRUPHG ZLWK DSSUR[LPDWHO\ SJ RI SRO\ $f HQULFKHG 51$ 7KH K\EULGL]DWLRQ SUREH ZDV LVRODWHG IURP WKH nGHOHWLRQ FORQH S$ DQG ZDV nHQG ODEHOHG DW WKH +SD,, VLWH ORFDWHG DW ES 7KLV SUREH 6DO?+S D ,, IUDJPHQWf FRQWDLQV WKH ZLOG W\SH OHDGHU DQG ES RI nIODQNLQJ VHTXHQFHV RI WKH WHVW JHQH 3RO\ $f 51$ ZDV

PAGE 48

K\EULGL]HG ZLWK DQ H[FHVV RI WKH GRXEOHG VWUDQGHG '1$ SUREH FSPf RYHUQLJKW DW r& $IWHU 6, QXFOHDVH GLJHVWLRQ XQLWVPOf DW r& IRU PLQXWHV WKH SURWHFWHG K\EULGV ZHUH IUDFWLRQDWHG RQ DQ b VHTXHQFLQJ SRO\DFU\ODPLGH JHO FRQWDLQLQJ 0 XUHD DQG H[SRVHG ZLWK LQWHQVLILHU VFUHHQVf WR ;$5 .RGDNf ILOP IRU WR GD\V DW r& 5HODWLYH WUDQVFULSW OHYHOV 57/f RI HDFK PXWDQW ZHUH GHWHUPLQHG E\ FXWWLQJ SRUWLRQV RI WKH JHO FRUUHVSRQGLQJ WR UDGLRDFWLYH EDQGV DQG XVLQJ WKH JHO SRUWLRQV IRU &HUHQNRY FRXQWLQJ 7KH 57/ YDOXHV ZHUH GHILQHG DV WKH UDWLR RI FSP YDOXHV RI WKH WHVW JHQH WUDQVFULSWV WR FSP YDOXHV RI WKH UHIHUHQFH JHQH WUDQVFULSWV GLYLGHG E\ WKH UDWLR RI FSP YDOXHV RI WKH WHVW JHQH WUDQVFULSWV WR LWV UHIHUHQFH JHQH WUDQVFULSWV f $OO 57/ YDOXHV UHSUHVHQW DQ DYHUDJH RI RU PRUH LQGHSHQGHQW K\EULGL]DWLRQ H[SHULPHQWV 3ULPHU ([WHQVLRQ $QDO\VLV 3ULPHU H[WHQVLRQ DQDO\VLV ZDV SHUIRUPHG WR FRQILUP WKH 6, QXFOHDVH DQDO\VLV DQG WR GHWHUPLQH LI WKH UHIHUHQFH JHQH WUDQVFULSWV FRXOG EH GLVWLQJXLVKHG IURP ZLOG W\SH JHQH WUDQVFULSWV 3RO\ $f 51$ DSSUR[LPDWHO\ MR Jf ZDV DGGHG WR SPROHV RI D nHQG ODEHOHG SULPHU WKDW ZDV FRPSOHPHQWDU\ WR WKH UHJLRQ IURP WR ES RI WKH JHQH P51$ WUDQVFULSW $ ILQDO YROXPH RI SL RI P0 7ULV+&O S+ f DQG P0 ('7$ ZDV VHDOHG LQ D SL FDSLOODU\ WXEH DQG SODFHG LQ D ERLOLQJ ZDWHU EDWK $IWHU PLQXWHV WKH FDSLOODU\ WXEH ZDV WKHQ TXLFNO\ WUDQVIHUUHG WR r& IRU KRXUV WR DOORZ WKH SULPHU WR DQQHDO WR WKH 51$ $IWHU DQQHDOLQJ WKH FRQWHQWV RI WKH FDSLOODU\ WXEHV ZHUH DGGHG WR SL RI D SULPHU H[WHQVLRQ EXIIHU P0 7ULV+&O >S+ @ P0 .& P0 '77 P0 0J&O DQG P0 HDFK RI G$73 G*73 G&73 DQG G773f ZLWK XQLWV RI PXULQH PDORQH\ YLUXV UHYHUVH WUDQVFULSWDVH %HWKHVGD 5HVHDUFK /DERUDWRULHVf DQG LQFXEDWHG DW r& IRU

PAGE 49

PLQXWHV 7KH UHDFWLRQ PL[WXUH ZDV WKHQ SKHQROFKRORURIRUP H[WUDFWHG SUHFLSLWDWHG ZLWK HWKDQRO DQG ILQDOO\ IUDFWLRQDWHG RQ b SRO\DFU\ODPLGH JHO FRQWDLQLQJ 0 XUHD 5HVXOWV 6RXWKHUQ %ORW $QDO\VLV RI WKH 7ULJKW 31$ RI $ WXPHIDFLHQV VWUDLQ $V 7KH VXEVWLWXWLRQ RI WKH NES UHJLRQ RI 7ULJKW RI S7L IRU WKH NES 7Q IUDJPHQW FRQIHUULQJ NDQDP\FLQ UHVLVWDQFH ZDV H[DPLQHG E\ 6RXWKHUQ EORW DQDO\VLV 7KH 7LSODVPLG EDQGV IURP ZLOG W\SH $ WXPHIDFLHQV VWUDLQ DQG DQ LQWHUPHGLDWH WUDQVFRQMXJDQW FRQWDLQLQJ WKH SODVPLG S.Q LQWURGXFHG ZLWKRXW VHOHFWLRQf K\EULGL]HG DV H[SHFWHG WR WKH JHQH SUREH 7KH 7LSODVPLG RI IRXU FORQHV DIWHU VHOHFWLRQ IRU UHFRPELQDWLRQ ODQHV )LJ f GLG QRW K\EULGL]H WR WKH JHQH SUREH EXW LQVWHDG K\EULGL]HG WR WKH NDQDP\FLQ JHQH SUREH ZKLFK KDV QR KRPRORJ\ WR WKH ZLOG W\SH 7LSODVPLG 7KLV FOHDUO\ GHPRQVWUDWHV WKDW WKH HQGRJHQRXV JHQH RI S7L KDV EHHQ UHSODFHG ZLWK WKH NDQDP\FLQ JHQH LQ VWUDLQ $J ODQH )LJ f 7ULSDUHQWDO &RQMXJDWLRQV ZLWK 'RXEOH *HQH 6KXWWOH 9HFWRUV 'RXEOH JHQH YHFWRUV FRQWDLQLQJ WKH UHIHUHQFH JHQH DORQH RU WKH WHVW DQG UHIHUHQFH JHQH WRJHWKHU ZHUH WUDQVIHUUHG LQWR $J XVLQJ WKH WULSDUHQWDO FRQMXJDWLRQ PHWKRG %HWZHHQ FRORQLHV DURVH DIWHU GD\V RQ $% PLQLPDO SODWHV ZLWK VWUHSWRP\FLQ SJPOf NDQDP\FLQ SJPOf DQG FKORUDPSKHQLFRO SJPOf 2I WKHVH SRWHQWLDO WUDQVFRQMXJDQWV DSSUR[LPDWHO\ b JUHZ RYHUQLJKW LQ PO /% LQ WKH SUHVHQFH RI WKH VDPH OHYHO RI VWUHSWRP\FLQ DQG NDQDP\FLQ DV ZDV SUHVHQW LQ WKH $% PLQLPDO SODWHV EXW ZLWK UHGXFHG FKORUDPSKHQLFRO SJPOf 7KHVH FORQHV ZHUH WKHQ XVHG WR

PAGE 50

17 352%(6 .$1 &O & 7L )LJXUH 6RXWKHUQ EORW DQDO\VLV RI WKH GRXEOH KRPRORJRXV UHFRPELQDWLRQ HYHQW $SSUR[LPDWHO\ SJ RI WRWDO '1$ LVRODWHG IURP $ WXPHIDFLHQV FORQHV ZDV XVHG IRU HDFK ODQH 1LFN WUDQVODWLRQ SUREHV XVHG ZHUH WKH LVRODWHG (FR5O6SKO IUDJPHQW FRQWDLQLQJ WKH JHQH DQG WKH LVRODWHG ; KRO+ L QGOOO IUDJPHQW FRQWDLQLQJ WKH NDQDP\FLQ SKRVSKRWUDQVIHUDVH JHQH IURP 7Q /DQH & FRQWDLQV '1$ IURP VWUDLQ /DQH FRQWDLQV '1$ IURP DQ $ WXPHIDFLHQV WUDQVFRQMXJDQW FORQH KDUERULQJ S.Q SODVPLG /DQH FRQWDLQ '1$ IURP IRXU VHSDUDWH WUDQVFRQMXJDQWV DIWHU VHOHFWLRQ IRU WKH GRXEOH UHFRPELQDWLRQ 7L GHQRWHV WKH SRVLWLRQ RI WKH 7L SODVPLG

PAGE 51

LQRFXODWH VXQIORZHU SODQWV 7KH JHQH XVHG DV D QLFNWUDQVODWHG SUREH K\EULGL]HG WR WKH 7LSODVPLG EDQGV RI WKH YDULRXV FORQHV ZKHQ DQDO\]HG E\ 6RXWKHUQ EORWWLQJ )LJ f DV ZHOO DV WR WKH SRVLWLYH FRQWURO ZLOG W\SH VWUDLQ 7KHVH UHVXOWV DORQJ ZLWK WKH ODFN RI K\EULGL]DWLRQ RI WKH UHFLSLHQW $J FRQILUP WKH WUDQVIHU DQG LQWHJUDWLRQ RI WKH VKXWWOH YHFWRU LQWR WKH 7L SODVPLG 'LVFULPLQDWLRQ RI WKH 7HVW DQG 5HIHUHQFH *HQH 7UDQVFULSWV 6, QXFOHDVH K\EULG SURWHFWLRQ PDSSLQJ ZDV SHUIRUPHG WR DFFXUDWHO\ GHWHUPLQH WKH n VWDUW RI WUDQVFULSWLRQ DQG WR TXDQWLWDWH WKH WUDQVFULSWV IURP WKH WHVW DQG UHIHUHQFH JHQH 7KH GHOHWLRQ RI WKH 7DT IUDJPHQW LQ WKH XQWUDQVODWHG OHDGHU RI WKH UHIHUHQFH JHQH UHVXOWHG LQ VKRUWHU WUDQVFULSWV WKDW FRXOG EH GLVWLQJXLVKHG IURP WKH ORQJHU WHVW JHQH WUDQVFULSWV +RZHYHU WKH EDVLV RI WUDQVFULSW GLVFULPLQDWLRQ REWDLQHG XVLQJ 6, QXFOHDVH DVVD\ ZDV GXH WR D ORFDO UHJLRQ RI QRQKRPRORJ\ EHWZHHQ WKH ZLOG W\SH '1$ SUREH DQG WKH UHIHUHQFH JHQH WUDQVFULSW ZKLFK DOORZHG WKH 6, QXFOHDVH WR FOHDYH WKH UHVXOWLQJ ES ORRS LQ WKH ODEHOHG '1$ )LJ f $V LOOXVWUDWHG LQ )LJ SURWHFWLRQ RI WKH ODEHOOHG SUREH E\ WKH UHIHUHQFH JHQH 51$ UHVXOWHG LQ D VPDOOHU IUDJPHQW WKDQ SURWHFWLRQ E\ WKH WHVW JHQH 51$ 7KH DXWRUDGLRJUDSKV RI 6, QXFOHDVH PDSSLQJ JHOV SUHVHQWHG LQ )LJV DQG f VKRZ WKH OHQJWK RI SURWHFWHG K\EULGV REWDLQHG XVLQJ WKH WHVW JHQH '1$ SUREH ZLWK 51$ GHULYHG IURP WKH ZLOG W\SH JHQH WKH UHIHUHQFH JHQH DQG ZLWK 51$ IURP WKH WHVW DQG UHIHUHQFH JHQHV SUHVHQW LQ WKH VDPH YHFWRU 7KH PDMRU VWDUW VLWH RI WUDQVFULSWLRQ IRU WKH ZLOG W\SH JHQH PDSV ES XSVWUHDP RI WKH +SDOO VLWH :KHQ 51$ IURP WKH WXPRUV FRQWDLQLQJ WKH UHIHUHQFH JHQH ZDV K\EULGL]HG WR WKH WHVW JHQH '1$ SUREH D FOXVWHU RI EDQGV UDQJLQJ LQ VL]H IURP ES WR ES ZDV REVHUYHG 7KH SRVLWLRQ RI WKLV FOXVWHU RI SURWHFWHG EDQGV

PAGE 52

n S f§ 7L Dr )LJXUH 6RXWKHUQ EORW DQDO\VLV RI VHOHFWHG GRXEOH JHQH WUDQVFRQMXJDQWV /DQH FRQWDLQV DSSUR[LPDWHO\ QJ RI '1$ IURP $ WXPHIDFLHQV VWUDLQ /DQH FRQWDLQV DSSUR[LPDWHO\ SJ RI WRWDO '1$ LVRODWHG IURP $ WXPHIDFLHQV VWUDLQ $J /DQHV FRQWDLQ DSSUR[LPDWHO\ SJ RI WRWDO '1$ LVRODWHG IURP YDULRXV $ WXPHIDFLHQV VWUDLQ $J FORQHV FRQWDLQLQJ GRXEOH JHQH VKXWWOH YHFWRUV UHFRPELQHG LQWR WKH 7L SODVPLG 7KH QLFN WUDQVODWHG SUREH LV WKH (FR5?6SKO IUDJPHQW FRQWDLQLQJ WKH JHQH 7L GHQRWHV WKH SRVLWLRQ RI WKH 7L SODVPLG 7KH ORZHU EDQGV DUH WKH FKURPRVRPDO '1$

PAGE 53

)LJXUH 6, QXFOHDVH K\EULG SURWHFWLRQ VWUDWHJ\ 7KH SRO\ $f 51$ IURP VXQIORZHU WXPRUV FRQWDLQLQJ ERWK WKH WHVW DQG UHIHUHQFH JHQH ZDV K\EULGL]HG WR WKH n HQGODEHOHG '1$ SUREH IURP WKH ZLOG W\SH JHQH 8SRQ IRUPLQJ D K\EULG ZLWK WKH '1$ WHPSODWH WKH WUDQVFULSW IURP WKH UHIHUHQFH JHQH IRUPHG D VLQJOHVWUDQGHG ORRS GXH WR LWV GHOHWLRQ ZKHUHDV WKH WUDQVFULSW IURP WKH WHVW JHQH SURWHFWV WKH '1$ SUREH LQ D QRUPDO IDVKLRQ $IWHU 6, QXFOHDVH GLJHVWLRQ WZR VL]HV RI SURWHFWHG '1$ UHVXOWHG ZKLFK ZHUH WKHQ VHSDUDWHG E\ HOHFWURSKRUHVLV RQ D GHQDWXULQJ JHO 7KH KDWFKHG OLQH UHSUHVHQWV WKH '1$ SUREH WR ESf ZLWK WKH DVWHULVN GHQRWLQJ WKH VLWH RI WKH n ODEHO 7KH LQYHUWHG WULDQJOH UHSUHVHQWV WKH 7DT GHOHWLRQ LQ WKH UHIHUHQFH JHQH OHDGHU VHTXHQFH 6D6DOO + +SD??? 7 7DT 0 PDUNHU ODQH ODQH FRQWDLQLQJ WKH SURWHFWHG HQGODEHOHG IUDJPHQWV

PAGE 54

)LJXUH 6, QXFOHDVH PDSSLQJ RI WKH n WHUPLQL RI SRO\ $f 51$ KRPRORJRXV WR WKH JHQH $ '1$ VHTXHQFH ODGGHU ZDV XWLOL]HG IRU VL]LQJ 6, QXFOHDVH K\EULGSURWHFWHG IUDJPHQWV IURP ZLOG W\SH SJ RI 51$f DQG WKH UHIHUHQFH JHQHV SJ RI 51$f 7KH 0 ODQH FRQWDLQV G!; '1$ +DH,OOJHQHUDWHG PDUNHU 7KH DUURZV GHQRWH n WHUPLQL RI WHVW JHQH WUDQVFULSWV DQG WKH ES ORRS RI WKH SUREH GXH WR WKH 7DT, GHOHWLRQ LQ WKH UHIHUHQFH JHQH WUDQVFULSWV 7KH VHTXHQFH DW WKH ULJKW RI WKH ODGGHU UHSUHVHQWV WKH FRGLQJ VWUDQG ZKLFK LV WKH FRPSOHPHQW RI WKH DFWXDO '1$ ODGGHU VHTXHQFH

PAGE 55

FRUUHVSRQGHG WR WKH SUHGLFWHG SRVLWLRQ RI WKH ES ORRS LQ WKH SUREH51$ K\EULG :KHQ 51$ IURP WXPRUV FRQWDLQLQJ ERWK WHVW DQG UHIHUHQFH JHQHV ZDV DQDO\VHG ODQHV :7 DQG 5HI )LJ f WZR FOXVWHUV RI SURWHFWHG K\EULGV ZHUH VHHQ DW WKH SUHGLFWHG SRVLWLRQV GHPRQVWUDWLQJ WKH DELOLW\ RI WKLV PHWKRG WR DVVHVV WKH UHODWLYH DEXQGDQFH RI WUDQVFULSWV GHULYHG IURP WKHVH WZR SURPRWHUV 3ULPHU H[WHQVLRQ DQDO\VLV DOVR FRQILUPHG WKDW WKH n WHUPLQL RI WKH UHIHUHQFH JHQH LV ES VKRUWHU WKDQ WKH WHVW JHQH )LJ f DQG WKDW WKH WZR W\SHV RI WUDQVFULSWV FDQ EH GLVWLQJXLVKHG IURP HDFK RWKHU $ ZHDNO\ SURWHFWHG EDQG RI ES ZDV DOVR REVHUYHG ZKLFK VXJJHVWHG WKH SUHVHQFH RI DQRWKHU nWHUPLQXV ES XSVWUHDP IURP WKH PDMRU VWDUW VLWH 7KH OHYHO RI WUDQVFULSWV RULJLQDWLQJ IURP WKLV PLQRU VWDUW VLWH UHODWLYH WR WKH PDMRU VWDUW VLWH DSSHDUHG WR EH b RI WKH PDMRU WUDQVFULSW OHYHO DV GHWHUPLQHG E\ WKH 6, QXFOHDVH PDSSLQJ SURFHGXUH 7KH WUXH DEXQGDQFH RI WKH PLQRU WUDQVFULSW KRZHYHU PD\ EH RQO\ b RI WKH PDMRU WUDQVFULSW EDVHG RQ WKH UHVXOWV RI SULPHU H[WHQVLRQ DQDO\VLV GDWD QRW VKRZQf :LWK WKH '1$ SUREH LQ H[FHVV WKH ORQJHU WUDQVFULSWV IURP WKH PLQRU SURPRWHU VHHPHG WR EH PRUH VWDEOH WKDQ WKH WUDQVFULSWV IURP WKH PDMRU SURPRWHU DQG UHIHUHQFH JHQH ZKLOH XVLQJ 6, QXFOHDVH PDSSLQJ FRQGLWLRQV :KHQ XVLQJ SULPHU H[WHQVLRQ DQDO\VLV WKH SULPHU KDG QR SUHIHUHQFH IRU DQ\ RI WKHVH WKUHH WUDQVFULSWV DQG K\EULGL]HG ZLWK WKHP HTXDOO\ ZHOO 7KLV DOORZHG D EHWWHU HVWLPDWLRQ RI WKH PLQRU WUDQVFULSWV UHODWLYH WR WKH PDMRU WUDQVFULSWV 2WKHU EDQGV ZHUH DOVR VHHQ LQ WKH SULPHU H[WHQVLRQ DQDO\VLV ZKLFK GLG QRW FRUUHVSRQG WR WKH 6, QXFOHDVH K\EULG SURWHFWHG EDQGV 7KHVH PLQRU EDQGV ZHUH SUREDEO\ GXH WR WKH SULPHU K\EULGL]LQJ WR RWKHU 51$ PROHFXOHV VLQFH WKHVH EDQGV FRXOG EH VHHQ LQ WKH SULPHU H[WHQVLRQ DQDO\VLV ZKHQ 51$ IURP VXQIORZHU WXPRUV QRW FRQWDLQLQJ WKH JHQH ZDV XVHG )LJ f

PAGE 56

E3 00 r m} Pr r f§ B )LJXUH 3ULPHU H[WHQVLRQ DQDO\VLV RI 51$ GHULYHG IURP WHVW DQG UHIHUHQFH JHQHV (DFK ODQH H[FHSW IRU /DQH DQG f FRQWDLQV DSSUR[LPDWHO\ SJ SRO\ $f 51$ LVRODWHG IURP VXQIORZHU WXPRUV LQFLWHG ZLWK YDULRXV $ WXPHIDFLHQV FORQHV DQG K\EULGL]HG WR D f A A 3HQGODEHOHG SULPHU QXFOHRWLGHV ORQJ IURP WR ES RI WKH OHDGHU UHJLRQf 7KLV K\EULG ZDV HORQJDWHG ZLWK UHYHUVH WUDQVFULSWDVH DV GHVFULEHG LQ WKH 0DWHULDOV DQG 0HWKRGV /DQH FRQWDLQV SJ RI \HDVW W51$ /DQHV FRQWDLQ WXPRU 51$ LQFLWHG E\ $ WXPHIDFLHQV KDUERULQJ WKH IROORZLQJ FRQVWUXFWLRQV $J UHIHUHQFH JHQH DORQH ZLOG W\SH JHQH DQG UHIHUHQFH JHQH $ SJ RI SRO\ $f 51$ IURP WXPRUV ZLWK WKH ZLOG W\SH JHQH DQG UHIHUHQFH JHQH ,'f§ f§ ,' 0DM PDMRU WUDQVFULSW 5HI UHIHUHQFH WUDQVFULSW 3 HQGODEHOHG SULPHU /DQH 0 FRQWDLQV S%5 SDOOJHQHUDWHG '1$ PDUNHU

PAGE 57

)LJXUH $XWRUDGLRJUDSK RI 6, QXFOHDVH DQDO\VLV RI JHQH PXWDQWV $SSUR[LPDWHO\ SJ RI SRO\ $f 51$ ZDV XVHG IRU DOO ODQHV /DQHV :7 5() DQG :75() UHSUHVHQW 51$ IURP VXQIORZHU WXPRUV FRQWDLQLQJ RQO\ WKH ZLOG W\SH JHQH WKH UHIHUHQFH JHQH RU ERWK UHVSHFWLYHO\ $f 6, QXFOHDVH DQDO\VLV RI n GHOHWLRQ PXWDQWV %f 6, QXFOHDVH DQDO\VLV RI LQWHUQDO GHOHWLRQ PXWDQWV %DQGV ZLWK VL]HV EHWZHHQ DQG ES DULVH IURP UHDGWKURXJK WUDQVFULSWLRQ GXH WR WKH GLYHUJHQFH RI WKH SUREH ZLWK WHVW 51$ DW WKH SRVLWLRQ FRUUHVSRQGLQJ WR WKH 6DO OLQNHU LQ WKH WHVW JHQH 7KH VLQJOH EDQG LQ ODQH ,' LV GXH WR WKH n WHUPLQL DSSUR[LPDWHO\ ES GRZQVWUHDP RI WKH PLQRU SURPRWHU 7$7$ ER[ LQ LWV QHZ SRVLWLRQ /DQH 0 FRQWDLQV S%5 SDOOJHQHUDWHG '1$ PDUNHU

PAGE 58

! 2 r RR 2 YL R 9nR R ,G P UR 2 K:7 5() f :75() $ $ $ $ $ $ $ $ $ $ $ $fr‘ _ :75() ,' ,' ,' ,' c c ,' ,' ,' ,' ,' 'f§f§ _ ,' ,' ,'f§f§ _ f§ f§

PAGE 59

(IIHFW RI n'HOHWLRQV RQ WKH 0DMRU 3URPRWHU $FWLYLW\ $QDO\VLV RI LQ YLYR WUDQVFULSWLRQDO DFWLYLW\ RI nGHOHWLRQ PXWDQWV LGHQWLILHG WKH nERXQGDU\ RI WKH JHQH SURPRWHU DQG LQGLFDWHG WKDW D IDU XSVWUHDP DFWLYDWRU HOHPHQW ZDV UHTXLUHG IRU HIILFLHQW H[SUHVVLRQ 5HVXOWV RI WKH 6, QXFOHDVH PDSSLQJ RI WKH WHVW DQG UHIHUHQFH JHQHV DORQJ ZLWK UHODWLYH WUDQVFULSW OHYHOV 57/f GHULYHG IRU WKH PDMRU DQG PLQRU SURPRWHUV DUH SUHVHQWHG LQ )LJV $ DQG 7KH DFWLYLW\ SORW RI WKHVH UHVXOWV )LJ f GHPRQVWUDWHV WKH HIIHFW RI V\VWHPDWLF fGHOHWLRQV RQ SURPRWHU IXQFWLRQ IRU ERWK WKH PDMRU DQG PLQRU VWDUW VLWHV 7KLV DQDO\VLV LQGLFDWHG WKDW WKH nERUGHU RI WKH JHQH PD\ OLH EHWZHHQ DQG ES FD b DFWLYLW\ GURSf ZLWK D GLVWLQFW VXEFRPSRQHQW RI LPSRUWDQFH SRVLWLRQHG QHDU WKLV ERUGHU 7KH SUHVHQFH RI WKLV IDU XSVWUHDP UHJXODWRU\ VHTXHQFH ZDV UHYHDOHG E\ WKH GUDPDWLF UHGXFWLRQ LQ 57/ WKDW RFFXUUHG ZKHQ WKH ES UHJLRQ EHWZHHQ DQG ES ZDV GHOHWHG 5HPRYDO RI WKHVH VHTXHQFHV UHGXFHG SURPRWHU DFWLYLW\ E\ DSSUR[LPDWHO\ b ,W ZDV DOVR DSSDUHQW WKDW RWKHU FRPSRQHQWV RI WKH DFWLYDWRU ZHUH ORFDWHG EHWZHHQ SRVLWLRQ DQG ES 'HOHWLRQ RI WKLV UHJLRQ RI WKH DFWLYDWRU UHVXOWHG LQ D ORVV RI DFWLYLW\ IURP DSSUR[LPDWHO\ b DW ES WR b DW ES :LWK WKH DFWLYDWRU HOHPHQW GHOHWHG WKH XSVWUHDP HOHPHQW DQG 7$7$ PRWLI RI WKH JHQH ZDV QRW HQRXJK WR SURPRWH GHWHFWDEOH OHYHOV RI WUDQVFULSWLRQ 5HPRYDO RI n VHTXHQFHV IURP WR ES UHVXOWHG LQ DFWLYLWLHV RI b RU OHVV 7KLV IROG GURS LQ DFWLYLW\ GHPRQVWUDWHG WKH DEVROXWH UHTXLUHPHQW RI WKH DFWLYDWRU LQ REWDLQLQJ ZLOG W\SH OHYHOV RI WUDQVFULSWLRQ

PAGE 60

0,125 0$-25 :7 $ $ $ $ $f§ $ $ $ $ $ $ $ ,' ,'A ,' ,' ,' ,' 'A ,' ,' ,' ,'+$ ,' ,' 'A 6, SUREH L ‹p f§L ,f§ K f§, ,7 + + f§ f§ +, K 0$0,1 )LJXUH 'LDJUDPPDWLF UHSUHVHQWDWLRQ RI JHQH PXWDWLRQV DQG 57/V 'HOHWLRQ PXWDQWV VKRZQ KHUH FRUUHVSRQG WR WKH GHOHWLRQV LQ )LJ 6DLO OLQNHUV DUH UHSUHVHQWHG E\ VKRUW YHUWLFDO OLQHV HQGLQJ DW HDFK GHOHWLRQ VLWH 7KH SDQHO DW WKH ULJKW VKRZV WKH 57/V UHSUHVHQWLQJ SHUFHQWDJHV RI ZLOG W\SH DFWLYLW\ IRU ERWK WKH PDMRU DQG PLQRU SURPRWHUV 57/V RI YDULHG E\ b RU OHVV EHWZHHQ H[SHULPHQWV 0XWDQWV WKDW VKRZHG 57/V RI YDULHG QR PRUH WKDQ s b RI ZLOG W\SH DFWLYLW\ %R[ $ UHSUHVHQWV WKH DFWLYDWRU HOHPHQW %R[ & DQG FLUFOH 7 LQGLFDWH WKH SRVLWLRQV RI WKH &$$7 DQG 7$7$ VHTXHQFHV RI WKH PDMRU DQG PLQRU SURPRWHUV

PAGE 61

)LJXUH (IIHFWV RI n GHOHWLRQV RQ WUDQVFULSWLRQDO DFWLYLW\ IRU ERWK PDMRU DQG PLQRU SURPRWHUV 57/V ZHUH SORWWHG IURP WKH GDWD VKRZQ LQ )LJ (QGSRLQWV IRU WKH n GHOHWLRQV DUH QXPEHUHG IURP WKH VWDUW VLWH RI WKH PDMRU WUDQVFULSW

PAGE 62

(IIHFW RI ,QWHUQDO 'HOHWLRQV RQ WKH 0DMRU 3URPRWHU $ WRWDO RI LQWHUQDO GHOHWLRQV DQG RQH ES GXSOLFDWLRQ PXWDQW LQ WKH nIODQNLQJ UHJLRQ RI WKH JHQH ZHUH DVVD\HG IRU WUDQVFULSWLRQDO DFWLYLW\ )LJV % DQG f 7KHVH PXWDQWV ZHUH JURXSHG LQWR FODVVHV DFFRUGLQJ WR WKH ORFDWLRQ RI WKH PXWDWLRQ DQG WKHLU HIIHFW RQ WKH WUDQVFULSWLRQDO DFWLYLW\ RI WKH PDMRU SURPRWHU 7KH ILUVW FODVV RI GHOHWLRQV ,' DQG ,'f ZHUH ORFDOL]HG ZLWKLQ WKH DFWLYDWRU HOHPHQW GHOLQHDWHG E\ WKH GHOHWLRQ VHULHV %RWK GHOHWLRQV LQ WKLV FODVV UHGXFHG DFWLYLW\ WR EHWZHHQ DQG b RI ZLOG W\SH OHYHOV ZKLFK LV VLPLODU LQ HIIHFW WR WKH nGHOHWLRQ DW ES 7KH UHVXOWV RI WKHVH WZR LQWHUQDO GHOHWLRQV WRJHWKHU ZLWK WKH nGHOHWLRQ VHULHV VXJJHVWHG WKDW WKH DFWLYDWRU HOHPHQW LV D VLQJOH SURPRWHU HOHPHQW SRVVLEO\ KDYLQJ PXOWLSOH VXEFRPSRQHQWV WKDW IXQFWLRQ LQ FRQFHUW $ VHFRQG FODVV RI LQWHUQDO GHOHWLRQV HLWKHU VWLPXODWHG RU FDXVHG PLQRU FKDQJHV LQ WUDQVFULSWLRQDO DFWLYLW\ 0XWDWLRQV LQ WKLV FODVV LQFOXGHG ,' ,'f§f§ ,' DQG ,' WKLV ODVW GHOHWLRQ LV SUHVHQWHG LQ )LJ DQG f $ FRPPRQ IHDWXUH RI WKLV JURXS ZDV WKH DEVHQFH RI VHTXHQFHV LPPHGLDWHO\ XSVWUHDP RI WKH 7$7$ ER[ IURP WR 7KLV SDUWLFXODU GHOHWLRQ UHVXOWHG LQ b RI ZLOG W\SH DFWLYLW\ EXW UHPRYDO RI PRUH VHTXHQFHV XSVWUHDP RI ES UHVXOWHG LQ DQ LQFUHDVH RI WUDQVFULSWLRQ IURP WR b RI ZLOG W\SH 7KHVH GHOHWLRQV DOORZ WKH DFWLYDWRU HOHPHQW WR FRPH DV FORVH DV SRVVLEOH WR 7$7$ UHPRYLQJ SDUWV RU DOO RI WKH XSVWUHDP HOHPHQW VHTXHQFHV 7KH HIIHFWV RI FRPSOHWHO\ UHPRYLQJ WKLV UHJLRQ ,'f UHVXOWHG LQ DQ LQFUHDVH LQ WUDQVFULSWLRQ UHODWLYH WR ZLOG W\SH LQGLFDWLQJ WKDW VHTXHQFHV LQ WKH DQDORJRXV SRVLWLRQ RI WKH XSVWUHDP HOHPHQW RI DQLPDO JHQHV ZHUH QRW DEVROXWHO\ UHTXLUHG IRU QRUPDO OHYHOV RI WUDQVFULSWLRQ 0XWDWLRQV ORFDWHG EHWZHHQ SRVLWLRQ ES WKH SXWDWLYH nERXQGDU\ RI WKH DFWLYDWRUf DQG DSSUR[LPDWHO\ ES KDYH EHHQ JURXSHG LQ D WKLUG FODVV

PAGE 63

*HQHUDOO\ WKHVH PXWDWLRQV GHFUHDVHG WUDQVFULSWLRQDO DFWLYLW\ WR EHORZ b RI WKH ZLOG W\SH DFWLYLW\ ZLWK WKH H[FHSWLRQ RI ,'f§f§ ZKLFK UHVXOWHG LQ b DFWLYLW\ 'HOHWLRQV ,'f§f§ DQG ,' ZHUH HVSHFLDOO\ GUDVWLF LQ WKHLU HIIHFW UHGXFLQJ DFWLYLW\ WR DQG b UHVSHFWLYHO\ 7KH VHYHULW\ RI WKHVH WZR PXWDWLRQV PD\ KDYH EHHQ GXH LQ SDUW WR UHPRYDO RI VHTXHQFHV ZLWKLQ WKH n HQG RI WKH DFWLYDWRU DV ZHOO DV SDUW RI WKH XSVWUHDP HOHPHQW 7ZR VPDOO LQWHUQDO GHOHWLRQV ,' DQG ,'f§f§ FDXVHG UHGXFWLRQV LQ WUDQVFULSWLRQDO DFWLYLW\ WR DQG b UHVSHFWLYHO\ HYHQ WKRXJK FRPSOHWH UHPRYDO RI WKLV UHJLRQ ,'f§f§f UHVXOWHG LQ DQ 57/ RI b ,QWHUQDO GHOHWLRQV WKDW UHPRYH WKH 7$7$ FRPSULVH WKH ODVW FODVV RI PXWDWLRQV DQG UHVXOW LQ VHYHUH ORVV RI SURPRWHU IXQFWLRQ 'HOHWLRQV ,'f§f§ DQG ,'f§f§ VKRZHG OHVV WKDQ b DQG b DFWLYLW\ UHVSHFWLYHO\ VXJJHVWLQJ WKDW 7$7$ LV HVVHQWLDO IRU SURPRWHU IXQFWLRQ 7KHVH OHYHOV FRQVWUDVW VWURQJO\ WR WKH QHDU ZLOG W\SH DFWLYLWLHV RI WKH PXWDQWV ,' DQG ,'f§ f§ ZKLFK VWLOO FRQWDLQHG WKH 7$7$ PRWLI $FWLYLW\ OHYHOV UHVXOWLQJ IURP WKH UHPRYDO RI 7$7$ ZHUH FRPSDUDEOH WR WKRVH REWDLQHG E\ UHPRYLQJ WKH HQWLUH DFWLYDWRU HOHPHQW ZLWK WKH nGHOHWLRQ WR SRVLWLRQ ES VXJJHVWLQJ WKDW WKLV PRWLI ZDV HVVHQWLDO IRU QRUPDO DFWLYLW\ 'HOHWLRQ (IIHFWV RQ WKH 0LQRU 3URPRWHU $QDO\VLV RI WKH DFWLYLW\ RI WKH PLQRU SURPRWHU VXJJHVWHG WKDW LW VKDUHV WKH DFWLYDWRU HOHPHQW ZLWK WKH PDMRU SURPRWHU DORQJ ZLWK RWKHU VWUXFWXUDO VLPLODULWLHV 7KH nGHOHWLRQ DFWLYLW\ SORW LQ )LJ VKRZHG WKDW ERWK WKH PDMRU DQG PLQRU SURPRWHUV KDYH QHDUO\ LGHQWLFDO SURILOHV 7KLV ILQGLQJ VXJJHVWHG WKDW WKH DFWLYDWRU HOHPHQW IRU WKH PDMRU SURPRWHU PXVW DOVR DFW LQ D VLPLODU IDVKLRQ RQ WKH PLQRU SURPRWHU 0XWDQWV ,' DQG ,'f§f§ DUH VLPLODU WR WKRVH LQ WKH VHFRQG FODVV RI WKH PDMRU SURPRWHU LQWHUQDO GHOHWLRQV LQ WKDW

PAGE 64

FRPSOHWH UHPRYDO RI VHTXHQFHV LPPHGLDWHO\ XSVWUHDP RI WKH 7$7$ PLQRUf UHVXOWHG LQ HLWKHU LQFUHDVLQJ E\ b RU FDXVLQJ OLWWOH FKDQJH RQ WKH OHYHO RI WKH PLQRU WUDQVFULSWV 0XWDQW ,'f§ f§ LV VLPLODU WR WKH WKLUG FODVV RI WKH PDMRU SURPRWHU LQWHUQDO GHOHWLRQV VLQFH D VLPLODU DOWHUDWLRQ ES GXSOLFDWLRQf RI VHTXHQFHV XSVWUHDP RI 7$7$ DOVR FDXVHG D GHFUHDVH LQ DFWLYLW\ RI WKH PLQRU SURPRWHU 5HPRYDO RI WKH 7$7$ PLQRUf DOVR GUDVWLFDOO\ GHFUHDVHG WKH PLQRU WUDQVFULSWV WR EDUHO\ GHWHFWDEOH DPRXQWV DV VKRZQ E\ ,'f§ f§ DQG ,'f§ f§ +RZHYHU UHGXFWLRQ RI WKH DFWLYLW\ OHYHO RI WKH PLQRU SURPRWHU ZDV QRW DV GUDVWLF UHGXFLQJ WR bf ZLWK DQ LQWHUQDO GHOHWLRQ IURP WR ES VXJJHVWLQJ WKDW VRPH VHTXHQFHV LPPHGLDWHO\ GRZQVWUHDP RI ES DUH UHTXLUHG IRU ORZ OHYHO DFWLYLW\ IRU WKLV SURPRWHU 7KH FRQVHUYDWLRQ LQ VSDFLQJ EHWZHHQ WKH 7$7$ DQG WKH VWDUW RI WUDQVFULSWLRQ ZDV GHPRQVWUDWHG IRU WKH PLQRU VWDUW VLWH ,Q )LJ ODQH :7f WKH VWDUW VLWH IRU WKH PLQRU WUDQVFULSW ZDV PDSSHG EHWZHHQ WR ES IURP WKH +SDOO VLWH RU DSSUR[LPDWHO\ ES XSVWUHDP IURP WKH PDMRU VWDUW VLWH 7KH LQVHUWLRQ RI DQ ES 6DO OLQNHU EHWZHHQ DQG ES UHODWLYH WR WKH PLQRU VWDUW RI WUDQVFULSWLRQ ,'f UHVXOWHG LQ WKH VKLIWLQJ RI WKLV VWDUW VLWH WR ES XSVWUHDP 7KLV PDLQWDLQHG D GLVWDQFH RI WR ES EHWZHHQ WKH WKLUG QXFOHRWLGH RI 7$7$ PLQRUf DQG WKH VWDUW VLWH RI WUDQVFULSWLRQ ,Q D VLPLODU PXWDWLRQ ,'f ES LQFOXGLQJ WKH PLQRU FDS VLWH ZHUH UHPRYHG DQG DQ ES 6DO OLQNHU LQVHUWHG ,Q WKLV FDVH WKH WUDQVFULSWLRQ VWDUW VLWH GLG QRW DSSHDU DV GLVFUHWH DV WKH ZLOG W\SH VWDUW DQG ZDV ORFDWHG WR ES GRZQVWUHDP RI 7$7$nV PLQRUf QHZ SRVLWLRQ 7KH OHYHO RI DFWLYLW\ IRU ERWK RI WKHVH PXWDWLRQV DOVR GHFUHDVHG WR b IRU ,' DQG b IRU ,' 7KHVH UHVXOWV VXJJHVW WKDW IRU WKH JHQH PLQRU SURPRWHU WKH VWDUW RI WUDQVFULSWLRQ LV QRW SULPDULO\ GHWHUPLQHG E\ VHTXHQFHV DURXQG WKH FDS VLWH EXW PRVW SUREDEO\ E\

PAGE 65

( R . &2 6 2 ES 0 e )LJXUH 6, QXFOHDVH PDSSLQJ RI WKH PLQRU WUDQVFULSW $SSUR[LPDWHO\ SJ RI SRO\ $f 51$ ZDV K\EULGL]HG WR WKH 6L SUREH )LJ f ,' FRQWDLQV D ES LQVHUWLRQ EHWZHHQ WKH 7$7$ PLQRUf DQG WKH PLQRU WUDQVFULSW FDS VLWH ,' FRQWDLQV D ES GHOHWLRQ UHPRYLQJ WKH PLQRU FDS VLWH WKHUHE\ PRYLQJ WKH 7$7$ PLQRUf WR D QHZ SRVLWLRQ UHVXOWLQJ LQ SURWHFWHG EDQGV RI DERXW ES LQ VL]H 7KH ES VL]H EDQGV UHSUHVHQW D GLYHUJHQFH RI WHVW JHQH WUDQVFULSWV UHDGWKURXJKf DW WKH SRVLWLRQ FRUUHVSRQGLQJ WR WKH 6DO OLQNHU LQ WKH WHVW JHQH /DQH 0 FRQVLVWV RI D S%5 SDOOJHQHUDWHG PDUNHU

PAGE 66

7$7$ DV LQ DQLPDO JHQHV f DQG WKDW WKH VHTXHQFHV IURP WR ES DUH RI VRPH LPSRUWDQFH WR WKH PLQRU SURPRWHU WUDQVFULSWLRQ &RQFOXVLRQ 7KH WUDQVFULSWLRQDO DFWLYLW\ RI D VHULHV RI n DQG LQWHUQDO GHOHWLRQ PXWDQWV RI WKH JHQH IURP S7L ZDV DVVD\HG LQ RUGHU WR GHWHUPLQH WKH LQWHUQDO VWUXFWXUH RI WKH SURPRWHU 3UHFLVH TXDQWLWDWLRQ RI WUDQVFULSWLRQ ZDV DFKLHYHG E\ XVLQJ D KRPRORJRXV UHIHUHQFH JHQH DFWLQJ DV DQ LQWHUQDO VWDQGDUG ZKLOH SUHVHQW LQ WKH VDPH YHFWRU DV WKH PXWDQW WHVW JHQH 6LQFH WKH UHIHUHQFH JHQH WUDQVFULSWV ZHUH VKRZQ WR EH GLVWLQJXLVKDEOH IURP WKH WHVW JHQH WUDQVFULSWV DQ DFFXUDWH GHWHUPLQDWLRQ RI WUDQVFULSW OHYHOV ZDV SRVVLEOH IRU HDFK PXWDWLRQ 7UDQVFULSWLRQ IDFWRU VDWXUDWLRQ ZDV DYRLGHG E\ XVLQJ WKH 7'1$ YHFWRU V\VWHP LQ ZKLFK D UHODWLYHO\ IHZ FRSLHV DUH LQWHJUDWHG LQ WKH SODQW JHQRPH f 7KH IDFWRU VDWXUDWLRQ SUREOHP XVXDOO\ DFFRPSDQLHV YLUDOEDVHG YHFWRUV DQG '1$ WUDQVIRUPDWLRQ V\VWHPV ZKLFK UHVXOW LQ KLJK WHPSODWH FRS\ QXPEHUV f WKDW FDQ VDWXUDWH RXW WUDQVFULSWLRQ IDFWRUV 9DULDWLRQV LQ SURPRWHU DFWLYLW\ GXH WR WKH LQWHJUDWLRQ RI 7'1$ DW UDQGRP VLWHV f ZDV DOVR DYRLGHG 3RROLQJ WXPRUV IRU HDFK PXWDWLRQ DVVD\ DYHUDJHG WKH SRVVLEOH FKURPRVRPDO ORFDWLRQ HIIHFWV RQ WKH LQWHJUDWHG 7'1$ :LWK OHVV WKDQ b YDULDELOLW\ RI SURPRWHU DFWLYLW\ EHWZHHQ H[SHULPHQWV WKH VHQVLWLYLW\ RI WKLV WUDQVFULSWLRQ H[SUHVVLRQ V\VWHP DOORZHG WKH GHWHFWLRQ RI GLVFUHWH IXQFWLRQDO GRPDLQV LQ WKH nIODQNLQJ UHJLRQ RI WKH JHQH 7KUHH IXQFWLRQDO GRPDLQV ZHUH SRVWXODWHG EDVHG RQ WKH UHVXOWV RI WKH n DQG LQWHUQDO GHOHWLRQ VWXGLHV 7KHVH GRPDLQV KDYH EHHQ GHVLJQDWHG DV WKH

PAGE 67

DFWLYDWRU WKH XSVWUHDP UHJLRQ DQG WKH 7$7$ DQG DSSHDU WR EH VLPLODU WR DQDORJRXV HOHPHQWV LQ DQLPDO DQG YLUDO SURPRWHUV 'XH WR WKH OLPLWHG QXPEHU RI PXWDWLRQV HYDOXDWHG WKH n DQG n ERUGHU RI WKH DFWLYDWRU HOHPHQW DQG WKH ERXQGDULHV RI WKH XSVWUHDP HOHPHQW DUH RQO\ DSSUR[LPDWH 7KH PLQRU SURPRWHU ZDV DOVR VKRZQ WR KDYH WKUHH IXQFWLRQDO GRPDLQV VLPLODU WR WKH PDMRU SURPRWHU HYHQ WKRXJK LWV RZQ DFWLYLW\ LV PXFK ORZHU UHODWLYH WR WKH DFWLYLW\ RI WKH PDMRU SURPRWHU 7KH JHQH DFWLYDWRU HOHPHQW LV WKH PRVW GLVWDO GRPDLQ ZLWK UHVSHFW WR WKH VWDUW RI WUDQVFULSWLRQ DQG LV GHILQHG SULPDULO\ E\ WKH HIIHFW RI V\VWHPDWLF fGHOHWLRQV RQ WKH OHYHO RI WUDQVFULSWLRQ )LJ f 7KH DFWLYDWRU HOHPHQW ZDV UHTXLUHG IRU IXOO WUDQVFULSWLRQDO DFWLYLW\ IRU ERWK WKH PDMRU DQG PLQRU SURPRWHUV VLQFH LWV UHPRYDO UHGXFHV WKH DFWLYLW\ IRU ERWK SURPRWHUV PDMRUf WR IROG PLQRUf OHVV WKDQ ZLOG W\SH 7KH DFWLYDWRU ZDV DOVR DEOH WR IXQFWLRQ FORVHU WR 7$7$ WKDQ WKDW SUHVHQW LQ WKH ZLOG W\SH JHQH )RU H[DPSOH WKH VHFRQG FODVV RI LQWHUQDO GHOHWLRQV PRYH WKH DFWLYDWRU IURP WR ES FORVHU WR 7$7$ DQG VKRZHG HLWKHU YHU\ OLWWOH UHGXFWLRQ LQ DFWLYLW\ RU DV PXFK DV D b LQFUHDVH RYHU ZLOG W\SH WUDQVFULSWLRQ OHYHOV )LJ Af $ OHDVW FKDUDFWHUL]HG GRPDLQ RI WKH SURPRWHU OLHV EHWZHHQ WKH 7$7$ ESf DQG WKH SRVWXODWHG n ERUGHU RI WKH DFWLYDWRU ESf ,Q QXPHURXV DQLPDO JHQHV WKLV UHJLRQ LQFOXGHV WKH GRPDLQ GHVLJQDWHG DV WKH XSVWUHDP HOHPHQW ZKLFK LV JHQHUDOO\ SRVLWLRQHG IURP WR ES f ,Q JHQHUDO WKLV UHJLRQ LV VHQVLWLYH WR VOLJKW GLVUXSWLRQV LQ VHTXHQFH FRPSRVLWLRQ DQG VSDFLQJ f 7KH UHJLRQ EHWZHHQ 7$7$ DQG WKH DFWLYDWRU HOHPHQW RI WKH SURPRWHU VHHPV WR EH DQDORJRXV WR WKH XSVWUHDP HOHPHQW RI DQLPDO SURPRWHUV VLQFH VPDOO VFDOH GLVUXSWLRQV GUDVWLFDOO\ UHGXFH WUDQVFULSWLRQDO DFWLYLW\ GHPRQVWUDWLQJ WKH OLPLWHG VSDWLDO IOH[DEL LW\ RI WKLV HOHPHQW f /DUJHU GHOHWLRQV LQ WKH UHJLRQ ZKLFK LQFOXGHG WKH &$$7 ER[ VHTXHQFHV

PAGE 68

LPPHGLDWHO\ XSVWUHDP RI 7$7$ ZHUH VKRZQ WR VWLPXODWH WUDQVFULSWLRQ WR DV PXFK DV b RYHU ZLOG W\SH OHYHOV LPSO\LQJ WKDW WKHVH VHTXHQFHV PD\ DOVR LPSDUW D QHJDWLYH LQIOXHQFH RQ WKH UDWH RI WUDQVFULSWLRQ :LWK WKLV LQ PLQG VPDOO GLVUXSWLRQV RI WKLV VHTXHQFH VKRXOG WKHUHIRUH LQWHUIHUH ZLWK WKH QHJDWLYH HOHPHQWnV LQIOXHQFH DQG DOORZ WKH WUDQVFULSWLRQDO UDWH WR LQFUHDVH 6XFK PXWDWLRQV ,' DQG ,'f§f§f KRZHYHU UHVXOWHG LQ VL]HDEOH GHFUHDVHV LQ DFWLYLW\ VXSSRUWLQJ WKH LGHD WKDW WKH XSVWUHDP HOHPHQW SURYLGHV D SRVLWLYH UDWKHU WKDQ D QHJDWLYH LQIOXHQFH 7KH VHFRQG FODVV RI PXWDWLRQV VXJJHVWHG WKDW WKH DFWLYDWRU ZDV DEOH WR VXEVWLWXWH IRU WKH XSVWUHDP HOHPHQW DV ORQJ DV WKH GHOHWLRQV SRVLWLRQHG WKH DFWLYDWRU FORVH WR 7$7$ DQG UHPRYHG ODUJH SRUWLRQV RI WKH LQWHUYHQLQJ VHTXHQFHV 0RUHOOL HW DO f REVHUYHG D VLPLODU RFFXUUHQFH ZLWK WKH UHPRYDO RI VHTXHQFHV ZKLFK LQFOXGHG WKH &$$7 ER[ LQ WKH UEF6 JHQH IURP SHD WKDW UHVXOWHG LQ D QHDUO\ IROG LQFUHDVH LQ DFWLYLW\ 7KH DXWKRUV VWDWHG WKDW WKLV UHJLRQ PD\ DFW DV D QHJDWLYH HOHPHQW VLQFH LWV UHPRYDO LQFUHDVHG DFWLYLW\ $Q DQDORJRXV HYHQW ZDV GHPRQVWUDWHG E\ WKH GHOHWLRQ RI D VLPLODU UHJLRQ LQ WKH SURPRWHU RI WKH VHD XUFKLQ +$ KLVWRQH JHQH f DOVR UHVXOWLQJ LQ D QHDUO\ IROG LQFUHDVH LQ WUDQVFULSWLRQ 'HOHWLRQV RI WKH SURPRWHU UHJLRQV ZKLFK LQFOXGH WKH &$$7 ER[ PD\ QRW QHFHVVDULO\ UHPRYH HOHPHQWV ZKLFK KDYH QHJDWLYH LQIOXHQFHV RQ JHQH H[SUHVVLRQ $OWHUQDWLYHO\ WKHVH WZR VWXGLHV PD\ VXJJHVW WKDW RWKHU f HOHPHQWV IDU XSVWUHDP DQDORJRXV WR WKH DFWLYDWRU HOHPHQW FDQ EH UHSRVLWLRQHG FORVHU WR 7$7$ DQG LQFUHDVH WKH WUDQVFULSWLRQDO DFWLYLW\ SRVVLEO\ E\ RSWLPL]LQJ LQWHUDFWLRQV RI IDFWRUV LQYROYHG ZLWK WUDQVFULSWLRQ 7KHUHIRUH WKH UEF6 KLVWRQH DQG JHQHV PD\ UHTXLUH VRPH HOHPHQW WR EH ORFDWHG LQ WKH 7$7$SUR[LPDO SRVLWLRQ IRU HIILFLHQW DFWLYLW\ VLPLODU WR WKH 07 JHQH SUHYLRXVO\ PHQWLRQHG f

PAGE 69

,Q PRVW HXFDU\RWLF SURPRWHUV D 7$7$ PRWLI LV RIWHQ SRVLWLRQHG IURP WR ES XSVWUHDP RI WKH VWDUW RI WUDQVFULSWLRQ ,Q DQLPDO JHQHV 7$7$ LV DQ HVVHQWLDO FRPSRQHQW IRU DFWLYLW\ RI WKH SURPRWHU LQ VRPH FDVHV f EXW LV RQO\ UHTXLUHG IRU SUHFLVH SRVLWLRQLQJ RI WKH WUDQVFULSWLRQDO VWDUW VLWH LQ RWKHUV f $ FOHDU GHPRQVWUDWLRQ RI LWV UROH LQ SRVLWLRQLQJ WKH VWDUW WUDQVFULSWLRQ RI SODQW JHQHV KDV QRW EHHQ UHSRUWHG ,Q WKLV VWXG\ WKH 7$7$ HOHPHQW ZDV DEVROXWHO\ UHTXLUHG IRU WKH WUDQVFULSWLRQDO DFWLYLW\ RI WKH PDMRU SURPRWHU ,WV UROH LQ WKH SRVLWLRQLQJ RI WKH VWDUW RI WUDQVFULSWLRQ ZDV VKRZQ E\ WKH VKLIW LQ WKH WUDQVFULSWLRQ VWDUW VLWH REWDLQHG E\ LQVHUWLRQ RI VHTXHQFHV EHWZHHQ WKH 7$7$ PLQRUf DQG PLQRU FDS VLWH RU E\ GHOHWLRQ RI VHTXHQFHV EHWZHHQ DQG ES )LJ f 7KHVH UHVXOWV LPSO\ WKDW WKH IXQFWLRQ RI WKH 7$7$ LQ DQLPDO DQG SODQW SURPRWHUV KDV EHHQ FRQVHUYHG WKURXJKRXW HYROXWLRQ ,Q DGGLWLRQ WR 7$7$ DQG &$$7 PRWLIV QR RWKHU VHTXHQFHV DSSHDU WR EH SUHVHQW LQ WKH SURPRWHU RI WKH JHQH )LJ f ZKLFK VKRZ VWURQJ KRPRORJ\ ZLWK FRQVHQVXV VHTXHQFHV f FRPPRQO\ IRXQG LQ WKH SURPRWHUV RI HXFDU\RWLF JHQHV 7KHUH DUH KRZHYHU IRXU GLUHFW UHSHDWV RQH ES DQG WKUHH ES LQ VL]Hf VFDWWHUHG WKURXJKRXW WKH nIODQNLQJ UHJLRQ 7KUHH RI WKHVH IRXU UHSHDWV D E Ff DUH FOXVWHUHG QHDU WKH nERUGHU RI WKH DFWLYDWRU HOHPHQW 'HOHWLRQ RI WKHVH VHTXHQFHV IURP SRVLWLRQ WR ES UHVXOWHG LQ D VKDUS GHFUHDVH LQ DFWLYLW\ RI ERWK WKH PDMRU DQG PLQRU SURPRWHUV )LJ f VXJJHVWLQJ WKDW VRPH RI WKHVH UHSHDWV PD\ EH FULWLFDO WR WKH DFWLYDWRU IXQFWLRQ 5HSHDW F 77*$$$$ff LV ORFDWHG DW WKUHH SRVLWLRQV LQ WKH nIODQNLQJ UHJLRQ ZKHUHDV UHSHDWV D E DQG G DUH SUHVHQW WZLFH 5HSHDW F LV DOVR SUHVHQW RQFH RU WZLFH LQ WKH nIODQNLQJ UHJLRQ LQ VHYHQ RI WKH WKLUWHHQ NQRZQ JHQHV RI WKH RFWRSLQHW\SH 7'1$ f 7KLV VDPH UHSHDW LV VLPLODU WR WKH WKH VHTXHQFH n777&$$**$n IRXQG LQ WKH fIODQNLQJ UHJLRQ RI QRSDOLQHW\SH 7'1$ JHQHV f $ VHYHQ RXW RI QLQH EDVH SDLU KRPRORJ\ WR WKLV ODWWHU VHTXHQFH LV SUHVHQW

PAGE 70

(FR 5 $*$$77&*7*&&$$7&&$7777*7777*$77*7&77*7IW$$*, , ,JJ-;tJIWt&&*& D f 7$$7&$&**$IO & &$& &8 &$8 $$$*&& 8 $$ \! & D $$7*$$$77&7$$7&777*$$$$7**$$$777$7*&7$7$7*$&777$7&*&&*7*$$7$ & $77 $$$**$*$77 &$*$&**$$&777 $**&*&7 &$777&*&*$&7 **&&&$&**$7 *$7 ‘‘ f§DDDVDDDDVDD 7 $$$$&$&7$&&7 $$&$$$7 77 $$$$$*$&*&&$$&&$&&*$7 $7 $*&&**7 &&$$$*7 f &*&$7 &&$&7 $$*7 $&7 &$7 *$7 &7777 *$$***7 $$$$$7 *7*&777 $**a&& $&&7$$A G &$$7 PLQRU FDS VLWH WWFFFFWJWWJDJWDJJWDDFJFFWADDWDWDW,JJDDDWWJFFWAFJDDWWWFWFA7WF 7$7$ &$$7  DDWFfWWWJJFDWWJWJDJFJJDFWFF@WDWDDDWDWWDJDDFFWFWJFFFWWJFDFWFJF 7$7$ PDMRU FDS VLWH &$7&*AA7&*$*&$$7*$*77$77$77**$7$*$&77$$**&*&$$*&&&*&&**$$ UHI JHQH GHOHWLRQ )LJXUH 6HTXHQFH RI WKH nIODQNLQJ UHJLRQ RI WKH JHQH 1XFOHWLGHV DUH QXPEHUHG IURP WKH PDMRU VWDUW RI WUDQVFULSWLRQ 6ROLG FLUFOHV DERYH WKH VHTXHQFH GHQRWH WKH n WHUPLQL RI WKH PDMRU DQG PLQRU SURPRWHU 7KH ODUJH RSHQ ER[ HQFORVHV WKH UHJLRQ RI WKH DFWLYDWRU HOHPHQW GHWHUPLQHG E\ WKH GHOHWLRQ PXWDWLRQ DQDO\VLV 7KH VKRUW ER[HV UHIHU WR 7$7$ VHTXHQFHV ZKHUH GHVLJQDWHG 7KH &$$7 PRWLIV DUH FLUFOHG IRU ERWK WKH PDMRU DQG PLQRU SURPRWHUV 7KH DVWHULVN GHQRWHV WKH VLWH RI WKH n AS HQGODEHO DW SRVLWLRQ ES RI WKH K\EULGL]DWLRQ SUREH ZKLFK H[WHQGV IURP SRVLWLRQ WR ES ,QGLYLGXDO GLUHFW UHSHDWV DUH GHVLJQDWHG DEF DQG G

PAGE 71

WZLFH LQ WKH nIODQNLQJ UHJLRQ RI WKH JHQH SURPRWHU FHQWHUHG DW SRVLWLRQV DQG ES $OWKRXJK WKH VLJQLILFDQFH RI VKRUW UHSHDWHG VHTXHQFHV LQ 7'1$ JHQHV LV QRW NQRZQ VKRUW UHSHDWV KDYH EHHQ VKRZQ WR EH LQYROYHG ZLWK HQKDQFHU DFWLYLW\ DQG WR FRQVWLWXWH VLWHV RI SURWHLQ'1$ LQWHUDFWLRQ LQ HQKDQFHUV DQG XSVWUHDP HOHPHQWV RI DQLPDO JHQHV f ,Q FRQFOXVLRQ WKH IXQFWLRQDO GRPDLQV ZLWKLQ WKH SURPRWHU RI WKH JHQH KDYH EHHQ SDUWLDOO\ FKDUDFWHUL]HG EDVHG RQ WKLV OLPLWHG GHOHWLRQ VWXG\ 2I WKH WKUHH DQDO\]HG UHJLRQV RI WKH SURPRWHU WKH DFWLYDWRU HOHPHQW VHHPV WR EH WKH PRVW HQKDQFHUOLNH VLQFH WKLV HOHPHQW FDQ EH PRYHG PXFK FORVHU WKDQ LWV ZLOG W\SH SRVLWLRQ UHODWLYH WR WKH FDS VLWH ZLWKRXW GLVUXSWLQJ WKH DFWLYLW\ RI WKH JHQH %HFDXVH WKH JHQH LV QRQLQGXFLEOH WKH DFWLYDWRU HOHPHQW PD\ GHPRQVWUDWH VRPH RI WKH FKDUDFWHULVWLFV RI D FRQVWLWXWLYH RU QRQVSHFLDOL]HG HQKDQFHU HOHPHQW LQ SODQW SURPRWHUV $ GLUHFW WHVW RI ELGLUHFWLRQDO IXQFWLRQ RI WKH DFWLYDWRU LQ ERWK WKH n DQG nIODQNLQJ UHJLRQV RI WKH JHQH LV SUHVHQWHG LQ WKH QH[W FKDSWHU

PAGE 72

&+$37(5 (1+$1&(5 3523(57,(6 2) 7'1$ 352027(56 ,QWURGXFWLRQ 7KH H[LVWHQFH RI HQKDQFHUV LQ 7'1$ KDV QRW EHHQ UHSRUWHG LQ WKH OLWHUDWXUH DOWKRXJK WKH UHVXOWV RI WKH PXWDWLRQ VWXGLHV VXPPDUL]HG LQ 7DEOH GHPRQVWUDWH WKH UHTXLUHPHQW IRU WUDQVFULSWLRQ RI VHTXHQFHV n WR WKH XSVWUHDP HOHPHQW $V DQ H[DPSOH VHTXHQFHV XSVWUHDP WR SRVLWLRQ ES LQ WKH 2&6 JHQH DUH HVVHQWLDO VLQFH QR RFWRSLQH LV GHWHFWHG LQ WREDFFR WXPRUV FRQWDLQLQJ WKLV JHQH ZLWK ES GHOHWLRQ f 1RUPDO RSLQH DFWLYLW\ LV UHVWRUHG ZKHQ WKH GHOHWLRQ LV RQO\ WR ES VXJJHVWLQJ WKH UHTXLUHPHQW RI VHTXHQFHV EHWZHHQ ES DQG ES IRU 2&6 JHQH H[SUHVVLRQ LQ WREDFFR $ VHFRQG 7'1$ JHQH WKDW PD\ EH DVVRFLDWHG ZLWK DQ HQKDQFHUOLNH HOHPHQW LV JHQH ZKLFK HQFRGHV DQ HQ]\PH LQ WKH F\WRNLQLQ SDWKZD\ GLPHWK\ODOO\O S\URSKRVSKDWH WUDQVIHUDVH +RR\NDDV HW DO UHSRUWHG )DOOHQ /HDI /DNH &RQIHUHQFH RQ 7KH *HQXV $JUREDFWHULXP DQG &URZQ *DOO /DNH 7DKRH 1HYDGD >6HSWHPEHU @f WKDW D UHJLRQ GHWHUPLQHG E\ LQWHUQDO GHOHWLRQV EHWZHHQ FD WR ES LQ WKH SURPRWHU RI JHQH ZDV HVVHQWLDO IRU DFWLYLW\ 3UHYLRXVO\ /LFKWHQVWHLQ HW DO f GHPRQVWUDWHG WKDW D 7Q LQVHUWLRQ PXWDWLRQ RI JHQH DW WKH ES VLWH VWLOO UHVXOWHG LQ QRUPDO H[SUHVVLRQ DV DVVHVVHG E\ WKH SUHVHQFH RI QRUPDO WXPRU IRUPDWLRQ 7DNHQ WRJHWKHU WKHVH UHVXOWV XVLQJ JHQH PXWDWLRQV VXJJHVW WKDW VHTXHQFHV XSVWUHDP RI WKH ES VLWH FRXOG EH UHSRVLWLRQHG QHDUO\ NES IXUWKHU XSVWUHDP IURP WKH FRUH SURPRWHU

PAGE 73

XSVWUHDP HOHPHQW DQG 7$7$ ER[f DQG WKH JHQH FRXOG VWLOO IXQFWLRQ QRUPDOO\ 7KXV WKHUH LV HYLGHQFH RI UHTXLUHG VHTXHQFH n WR WKH XSVWUHDP HOHPHQW LQ WREDFFR WLVVXH IRU ERWK WKH 2&6 JHQH DQG JHQH 7KH ORFDWLRQ RI SURPRWHU HOHPHQWV WKLV IDU XSVWUHDP DQG WKH SRVVLELOLW\ RI FRQVLGHUDEOH IOH[LELOLW\ LQ WKHLU VSDFLQJ UHTXLUHPHQWV VXJJHVWV WKDW WKHVH GLVWDO HOHPHQWV PD\ KDYH HQKDQFHUOLNH SURSHUWLHV %DVHG RQ WKH LQWHUQDO GHOHWLRQV LQ &KDSWHU WKH DFWLYDWRU HOHPHQW RI WKH JHQH SURPRWHU ZDV VKRZQ WR H[KLELW VRPH IOH[LELW\ LQ VSDFLQJ 7KH SRVVLELOLW\ WKDW WKLV DFWLYDWRU HOHPHQW PD\ KDYH HQKDQFHUOLNH TXDOLWLHV ZDV H[DPLQHG E\ IXQFWLRQDOO\ WHVWLQJ WKLV HOHPHQW LQ ERWK SRODULWLHV XSVWUHDP DQG GRZQVWUHDP RI D n GHOHWHG JHQH 7KH GHOHWLRQ FORQH S$ FORQHf FRQWDLQHG RQO\ WKH 7$7$ VHTXHQFH DQG FRXOG QRW LQLWLDWH DQ\ GHWHFWDEOH WUDQVFULSWLRQ 7KHUHIRUH DQ\ FKDQJH LQ WUDQVFULSWLRQDO DFWLYLW\ PXVW EH GLUHFWO\ GXH WR WKH SUHVHQFH RI WKH DFWLYDWRU HOHPHQW 7KH DELOLW\ RI WKH JHQH DFWLYDWRU HOHPHQW WR IXQFWLRQ DW ORFDWLRQV IXUWKHU XSVWUHDP RI LWV QRUPDO ZLOG W\SH SRVLWLRQ ZDV DOVR H[DPLQHG $ +DH,,, IUDJPHQW RI DSSUR[LPDWHO\ ES LQ VL]H IURP WKH UHSOLFDWLYH IRUP RI EDFWHULRSKDJH ; ZDV XVHG WR VHSDUDWH WKH DFWLYDWRU HOHPHQW IURP WKH 7$7$ ER[ SUHVHQW LQ WKH GHOHWLRQ FORQH 7KH H[LVWHQFH RI HQKDQFHUOLNH SURSHUWLHV LQ WKH XSVWUHDP UHJLRQV RI WKH 2&6 DQG DJURSLQH V\QWKDVH JHQHV $*6f ZDV DOVR H[DPLQHG 7KH UHJLRQV RI WKH 2&6 DQG $*6 SURPRWHUV XVHG LQ WKLV VWXG\ ZHUH ORFDWHG EHWZHHQ WKH &$$7 ER[HV DQG WKH 7'1$ ERUGHU VHTXHQFHV 7KHVH VHTXHQFHV ZHUH DOVR SODFHG n DQG n WR WKH S$ n GHOHWLRQ JHQH DQG WKHQ LQWURGXFHG LQWR VXQIORZHU XVLQJ WKH GRXEOH JHQH VKXWWOH YHFWRU V\VWHP 7KH XWLOL]DWLRQ RI WKH GRXEOH JHQH YHFWRU V\VWHP IRU WKHVH FRQVWUXFWLRQV SURYLGHG DFFXUDWH FRPSDULVRQV RI WKH DELOLW\ RI WKHVH WKUHH 7'1$ HOHPHQWV WR DFWLYDWH WUDQVFULSWLRQ IURP D VHYHUO\ GHOHWHG JHQH SURPRWHU

PAGE 74

0DWHULDOV DQG 0HWKRGV &RQVWUXFWLRQ RI n DQG n %LGLUHFWLRQDO 2ULHQWDWLRQV RI WKH $FWLYDWRU 5HJLRQ 5HODWLYH WR WKH *HQH S$ 'HOHWLRQ &ORQH 7KH DFWLYDWRU UHJLRQ ZDV LQWURGXFHG LQWR n DQG n ORFDWLRQV RI WKH S$ GHOHWLRQ FORQH RI WKH WHVW JHQH 7KH DFWLYDWRU HOHPHQW ZDV LQVHUWHG LQWR HLWKHU WKH %DP +, RU +LQ GLOO VLWHV RI WKH GRXEOH JHQH VKXWWOH YHFWRU FRQWDLQLQJ WKH GHOHWLRQ PXWDQW )LJ f 6XFK FRQVWUXFWLRQV DOORZHG WKH DFWLYDWRU HOHPHQW WR EH SRVLWLRQHG LQ ERWK SRODULWLHV GLUHFWO\ XSVWUHDP IURP WKH 7$7$ ER[ RU DSSUR[LPDWHO\ ES GRZQVWUHDP RI WKH SRO\ $f DGGLWLRQ VLWH RI WKH JHQH 7R DFFFRPSOLVK WKHVH FRQVWUXFWLRQV WKH 6DO VLWH RI WKH DQG WKH ES JHQH n GHOHWLRQ FORQHV VHH )LJ f ZHUH FRQYHUWHG WR 6DP+, VLWHV E\ OLQNHU DGGLWLRQ f $IWHU GLJHVWLRQ ZLWK %DP +, WKH UHVXOWDQW IUDJPHQWV ZHUH WKHQ OLJDWHG LQWR WKH %DP +, VLWH RI S:7' $ DQG VFUHHQHG WR GHWHUPLQH SRODULWLHV E\ GLJHVWLQJ WKH ILQDO SODVPLG ZLWK eFR5O DQG LQGLOO 7KH DFWLYDWRU HOHPHQW ZDV DOVR PRYHG ES IXUWKHU XSVWUHDP WKDQ LWV SRVLWLRQ LQ WKH ZLOG W\SH JHQH E\ LQVHUWLQJ WKH 6D,OLQNHUHG ES +DH ,,, IUDJPHQW IURP ; WR ES >@f LQWR WKH 6DO VLWH VLWXDWHG EHWZHHQ WKH DFWLYDWRU HOHPHQW DQG WKH ES GHOHWLRQ RI WKH JHQH 7KH ES IUDJPHQW ZDV WHVWHG IRU LWV DELOLW\ WR DIIHFW WUDQVFULSWLRQDO DFWLYLW\ E\ EHLQJ SODFHG DORQH LQ ERWK SRODULWLHV GLUHFWO\ XSVWUHDP RI WKH JHQH $ FORQH 7KH SRODULWLHV RI WKH DFWLYDWRU HOHPHQW XSVWUHDP RI WKH ; LQVHUWHG IUDJPHQW ZHUH GHWHUPLQHG E\ D WULSOH GLJHVWLRQ RI WKH UHVXOWDQW SODVPLG ZLWK

PAGE 75

&DPU UHIHUHQFH )LJXUH ,QWURGXFWLRQ RI HQKDQFHU IUDJPHQWV LQWR WKH GRXEOH JHQH VKXWWOH YHFWRU (QKDQFHU IUDJPHQWV OLQNHUHG ZLWK HLWKHU %DP+O RU mGLOO ZHUH LQVHUWHG LQ WKH n RU f ORFDWLRQV UHVSHFWLYHO\ RI WKH $ GHOHWLRQ FORQH LQ ERWK SRODULWLHV DV GHVFULEHG LQ WKH 0DWHULDOV DQG 0HWKRGV 7KH KDWFKHG DUHD LV WKH 6SKO%DP+O IUDJPHQW RI S$&<&O f 7KH VROLG EODFN DUHDV DUH WKH UHIHUHQFH JHQH DQG $ GHOHWLRQ JHQH 7KH VWLSSOHG DUHD LV WKH 6SKO% DP+O IUDJPHQW IURP S* f 7KH EODFN WULDQJOH GHQRWHV WKH 7DT GHOHWLRQ LQ WKH UHIHUHQFH JHQH OHDGHU DQG FDPU GHQRWHV WKH FKORUDPSKHQLFRO UHVLVWDQFH JHQH

PAGE 76

eFR5O 3V, DQG $F FO 7KH RULHQWDWLRQ RI WKH -"; +DH ,,, IUDJPHQW DORQH ZDV GHWHUPLQHG E\ GLJHVWLQJ WKH S:$2; FRQVWUXFWLRQ ZLWK $FFO 7R LQWURGXFH WKH DFWLYDWRU HOHPHQW LQWR WKH GRZQVWUHDP ORFDWLRQ RI WKH $ GHOHWLRQ FORQH WKH (FR5O6DOO IUDJPHQW WR ESf IURP D ES n GHOHWLRQ FORQH ZDV PRGLILHG E\ WKH DGGLWLRQ RI mGLOO OLQNHUV f )ROORZLQJ OLQNHU DGGLWLRQ WKLV IUDJPHQW ZDV WKHQ LQVHUWHG LQWR WKH nmGLOO VLWH RI WKH S:7'$ LQ ERWK RULHQWDWLRQV 7KH SRODULW\ RI WKLV HOHPHQW ZDV GHWHUPLQHG E\ GLJHVWLRQ RI WKH ILQDO SODVPLG ZLWK (FR5O &RQVWUXFWLRQ WKH 3&6 DQG $*6 8SVWUHDP 6HTXHQFHV ,QVHUWHG LQ %RWK 3RODULWLHV n DQG n WR WKH $ GHOHWLRQ FORQH RI 6HTXHQFHV EHWZHHQ WKH &$$7 ER[HV DQG WKH UHVSHFWLYH f 7'1$ ERUGHUV IURP WKH 2&6 DQG $*6 JHQHV KDYH EHHQ SODFHG LQ ERWK SRODULWLHV n DQG n WR WKH $ JHQH GHOHWLRQ FORQH )LJ f 7KH %DP:O$FFO IUDJPHQW RI WKH 2&6 JHQH WR ES >@f DQG WKH %DP:O6DOO IUDJPHQW RI D n GHOHWLRQ PXWDQW RI WKH $*6 JHQH WR ES >@f ZHUH PRGLILHG E\ HLWKHU %DP:? RU nmGLOO OLQNHU DGGLWLRQ f 7KH 2&6 DQG $*6 OLQNHUHG IUDJPHQWV ZHUH WKHQ OLJDWHG LQWR WKH %DP
PAGE 77

GHWHUPLQHG IURP WKH FSP YDOXHV RI WKH UDGLRDFWLYH EDQGV WKDW ZHUH FXW RXW RI WKH SRO\DFU\ODPLGH JHO DQG VXEMHFWHG WR &HUHQNRY FRXQWLQJ 7KH 57/ YDOXHV ZHUH FDOFXODWHG E\ WKH UDWLR RI FSP YDOXHV RI WKH HQKDQFHUHOHPHQWWHVW JHQH DQG WKH UHIHUHQFH JHQH GLYLGHG E\ WKH UDWLR RI FSP YDOXH RI WKH ZLOGW\SH JHQH WR LWV UHIHUHQFH JHQH 5HVXOWV 'HWHUPLQDWLRQ RI 3RODULW\ RI WKH $FWLYDWRU 3&6 $*6 DQG ; )UDJPHQWV 5HODWLYH WR WKH $ &ORQH 7KH SRODULW\ RI WKH DFWLYDWRU HOHPHQW LQVHUWHG LQ ERWK WKH n DQG n SRVLWLRQV RI D n GHOHWLRQ RI WKH JHQH ZDV GHWHUPLQHG E\ UHVWULFWLRQ HQGRQXFOHDVH GLJHVWLRQV )LJ VXPPDUL]HV WKH UHVXOWV RI WKH GLJHVWLRQV LQYROYLQJ WKH GRXEOH JHQH VKXWWOH YHFWRUV S:7' $ ZLWK WKH f§f§ f§ ; IUDJPHQWV DQG WKH ; IUDJPHQW DORQH 7KH SRODULWLHV ZHUH GHVLJQDWHG $ IRU WKH QRUPDO ZLOG W\SH SRODULW\ DQG % IRU WKH RSSRVLWH SRODULW\ $IWHU GLJHVWLRQ ZLWK (FR5 DQG mGLOO WKH SUHGLFWHG VL]HV IRU IUDJPHQWV D DQG F IURP WKH SODVPLG S:7'$ FRQWDLQLQJ WKH f§f§ ES RU ES VHTXHQFHV ZHUH DQG ES IRU WKH $ RULHQWDWLRQ UHVSHFWLYHO\ 7KH % RULHQWDWLRQ E\ SUHGLFWLRQ VKRXOG UHVXOW LQ ES VL]H IUDJPHQWV EDQGV E DQG Gf IRU ERWK HOHPHQWV 7KH IUDJPHQW LQ WKH n SRVLWLRQ VKRXOG UHVXOW LQ WZR EDQGV H a NESf IRU WKH $ SRODULW\ DQG I B NESf IRU WKH % SRODULW\ EDVHG VHTXHQFH SUHGLFWLRQ 7KH DFWXDO VL]HV RI EDQGV DIn ZHUH VLPLODU WR WKH SUHGLFWHG YDOXHV QXPEHU )LJ f %DQGV DQG N UHSUHVHQWLQJ ERWK RULHQWDWLRQV RI WKH ; IUDJPHQW DORQH ZHUH DOVR GHWHUPLQHG IURP VHTXHQFH GDWD f WR EH DSSUR[LPDWHO\ DQG NES ZKLFK FRUUHVSRQGHG WR VL]HV GHWHUPLQHG IURP WKH JHO QXPEHU )LJ f $ WULSOH GLJHVWLRQ ZDV QHHGHG WR GLVFHUQ WKH SRODULW\ RI WKH f§

PAGE 78

)LJXUH 'HWHUPLQDWRQ RI SRODULWLHV RI WKH DFWLYDWRU HOHPHQW DQG ; '1$ IUDJPHQWV 0LQLSUHSDUDWLRQV RI GRXEOH JHQH VKXWWOH YHFWRUV ZLWK WKH $ JHQHf SODVPLG '1$ FRQWDLQLQJ WKH ES RU ES IUDJPHQWV RI WKH DFWLYDWRU HOHPHQW RU WKH ; ES +DH ,,, IUDJPHQW LQ HLWKHU RULHQWDWLRQ ODQHV $ DQG % IRU HDFK IUDJPHQWf ZHUH GLJHVWHG ZLWK UHVWULFWLRQ HQ]\PHV DQG VHSDUDWHG E\ JHO HOHFWURSKRUHVLV f 7KH ES DQG ES IUDJPHQW LQ WKH n SRVLWLRQ ff DQG WKH f§f§ ES IUDJPHQW LQ WKH n SRVLWLRQ nf f 7KH ES IUDJPHQW XSVWUHDP RI WKH ; IUDJPHQW f 7KH ; IUDJPHQW LQ WKH n SRVLWLRQ $ DQG % DUH WKH QRUPDO DQG RSSRVLWH SRODULWLHV UHVSHFWLYHO\ $OO VL]HV DUH LQ EDVHSDLUV GHWHUPLQHG GLUHFWO\ IURP WKH JHOV 7KH !!! LQ WKH RSHQ ER[ GHQRWHV WKH SRODULWLHV RI WKH DFWLYDWRU HOHPHQW IUDJPHQWV ZKLOH WKH KDWFKHG ER[ UHIHUV WR WKH ; IUDJPHQW 7KH VPDOO EODFN ER[ UHSUHVHQWV WKH UHJLRQ EHWZHHQ DQG ES RI WKH SURPRWHU 7KH DUURZ LV WKH WUDQVFULSW /DQH 0D FRQWDLQV ; mGLOOJHQHUDWHG PDUNHUV DQG ; +DH ,OOn JHQHUDWHG PDUNHUV ZKLOH ODQH 0 RQO\ FRQWDLQV WKH ; +DH ,OOJHQHUDWHG PDUNHUV /HJHQG $F $FF, ( (FR5O + LGOOO 3 3VW,

PAGE 79

n n $ % 0 %S f f f $ % HaLRRf !}!` f§I Hf§rf W rA f§, '; 0R % $ Lf§ L f __f ,r /}!!!8\ Q f J f f§ $F L0QPU7770

PAGE 80

IUDJPHQW UHODWLYH WR WKH ; IUDJPHQW DQG WKH $ FORQH )RU WKLV FRQVWUXFWLRQ WKH ; IUDJPHQW ZDV LQ WKH $ RULHQWDWLRQ GHWHUPLQHG E\ EDQGV J DQG Lf 7KH VL]HV RI WKH IUDJPHQW EDQGV K DQG Mf ZDV SUHGLFWHG WR EH DQG ES IRU ERWK SRODULWLHV ZKLFK ZHUH VLPLODU WR WKH EDQG VL]HV EDVHG RQ WKH HOHFWURSKRUHWLF JHO QXPEHU )LJ f 7KH SRODULWLHV RI WKH 2&6 DQG WKH $*6 IUDJPHQWV UHODWLYH WR WKH $ FORQH LQ ERWK WKH n DQG n SRVLWLRQV ZHUH OLNHZLVH GHWHUPLQHG E\ FRPSDULQJ WKH VL]H SUHGLFWHG ZLWK WKH DFWXDO VL]HV GHWHUPLQHG E\ WKH JHO HOHFWURSKRUHVLV )LJ f $IWHU +LQF8 GLJHVWLRQ WKH 2&6 IUDJPHQW LQ WKH $ RULHQWDWLRQ LQ WKH n DQG n ORFDWLRQV VKRXOG \LHOG IUDJPHQWV ZLWK VL]HV RI DQG ES UHVSHFWLYHO\ 7KH % RULHQWDWLRQ VKRXOG \LHOG IUDJPHQWV RI DQG ES IRU WKH n DQG n SRVLWLRQV UHVSHFWLYHO\ EDVHG RQ VHTXHQFH SUHGLFWLRQ 3RUWLRQV RI WKH GRXEOH JHQH VKXWWOH YHFWRU SODVPLG FRQWDLQLQJ WKH $ FORQH DQG WKH $*6 IUDJPHQW ZHUH ILUVW LVRODWHG WKHQ GLJHVWHG ZLWK 5VD, DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV 7KH SRODULW\ RI WKH $*6 IUDJPHQW ZDV GHWHUPLQHG E\ VHTXHQFH SUHGLFWLRQ RI WKH EDQGV UV EDQG U ZDV D GRXEOHWf SURGXFH IUDJPHQWV KDYLQJ VL]HV RI DQG ES IRU WKH n $ RULHQWDWLRQ DQG DQG ES IRU WKH n % RULHQWDWLRQ 7KH n ORFDWLRQ UHVXOWHG LQ WKH EDQGV X[ ZLWK SUHGLFWHG VL]HV RI DQG ES IRU WKH $ RULHQWDWLRQ DQG DQG ES IRU WKH % RULHQWDWLRQ (IIHFWV RI WKH $FWLYDWRU 5HJLRQ LQ 'LIIHUHQW 3RODULWLHV RQ $ &ORQH RI WKH *HQH 7KH IXQFWLRQ RI WKH DFWLYDWRU HOHPHQW LQ SURPRWLQJ WUDQVFULSWLRQ RI WKH $ FORQH ZKLOH LQ WKH XSVWUHDP SRVLWLRQ ZDV DVVHVVHG E\ 6, QXFOHDVH PDSSLQJ $Q DXWRUDGLRJUDP RI WKH 6, QXFOHDVH PDSSLQJ JHO VKRZV WKH UHVXOWV RI WKH WUDQVFULSWLRQDO DFWLYLW\ RI WKH GHOHWLRQ FORQH ZLWK WKH DFWLYDWRU HOHPHQW SUHVHQW LQ ERWK SRODULWLHV )LJ $f $ VXPPDU\ RI WKH FRQVWUXFWLRQV

PAGE 81

)LJXUH 'HWHUPLQDWLRQ RI SRODULWLHV RI WKH 2&6 DQG $*6 '1$ IUDJPHQWV 0LQLSUHSDUDWLRQV RI GRXEOH JHQH VKXWWOH YHFWRUV ZLWK WKH $ JHQHf SODVPLG '1$ FRQWDLQLQJ WKH 2&6 DQG $*6 IUDJPHQWV LQ HLWKHU RULHQWDWLRQ ZHUH GLJHVWHG ZLWK UHVWULFWLRQ HQ]\PHV DQG VHSDUDWHG E\ JHO HOHFWURSKRUHVLV f 7KH 2&6 IUDJPHQW LQ HLWKHU SRODULW\ ODQHV $ DQG %f LQ WKH n DQG n SRVLWLRQV f 7KH $*6 IUDJPHQW LQ HLWKHU SRODULW\ ODQHV $ DQG %f LQ WKH n DQG n SRVLWLRQV 7KH !!! LQ WKH ER[ GHQRWH WKH SRODULWLHV RI WKH 2&6 IUDJPHQW ZKLOH WKH VKRUW WKLFN DUURZV GHQRWH WKH SRODULWLHV RI WKH $*6 IUDJPHQW 7KH VWLSSOHG DUHD LV WKH JHQH ZLWK WKH ORQJ WKLQ DUURZ UHSUHVHQWLQJ WKH WUDQVFULSW 7KH EODFN ER[ GHQRWHV WKH UHJLRQ RI WKH SURPRWHU EHWZHHQ DQG ES $OO VL]HV DUH LQ EDVHSDLUV DQG GHWHUPLQHG GLUHFWO\ IURP WKH JHOV /DQH 0 FRQWDLQV ; QHOOOJHQHUDWHG PDUNHUV ZKLOH ODQH : FRQWDLQV WKH GRXEOH JHQH VKXWWOH YHFWRU ZLWK WKH $ JHQHf GLJHVWHG ZLWK +LQGL /HJHQG +H +LQGLn 5 I"VDO

PAGE 82

2&6 n 2&6 n +H $, P f aa !}!!‘n n a Qf +H mm‘ Y! f $UW ‘ +H +H % W ‘D m@ $*6 n $*6 n UA f f§ff§ 5 B % =, 3J_ V ff§ ff§ff§ Y f f§ 5 Z U 5 f U 7, 7 < -=

PAGE 83

$ % )LJXUH $XWRUDGLRJUDSK RI 6, QXFOHDVH DQDO\VLV RI WKH $ JHQH FRQWDLQLQJ WKH YDULRXV 7'1$ IUDJPHQWV LQ GLIIHUHQW ORFDWLRQV $SSUR[LPDWHO\ SJ RI SRO\ $f 51$ ZDV XVHG IRU DOO ODQHV 7KH XQPDUNHG ODQHV FRQWDLQ 51$ IURP VXQIORZHU WXPRUV ZLWK WKH UHIHUHQFH DQG ZLOG W\SH JHQHV $f /DQH n $ ODQH f§f§ f % ODQH n % ODQH f $2; ODQH %2; ODQH 2; $ ODQH 2; % ODQH n $ ODQH n % ODQH $ JHQH DQG ODQH n $ %f /DQH 2&6 f $ ODQH 2&6 n % ODQH $*6 f $ ODQH $*6 f % ODQH 2&6 n $ ODQH 2&6 n % ODQH $*6 n $ ODQH $*6 f % DQG ODQH $ JHQH 0 UHIHUV WR WKH PDMRU WUDQVFULSWV DQG 5 GHVLJQDWHV WKH UHIHUHQFH JHQH WUDQVFULSWV 7KH K\EULGL]WLRQ SUREH DQG FRQGLWLRQV DUH WKH VDPH DV LQ )LJ /DQHV DQG DUH IURP DQRWKHU DXWRUDGLRJUDP

PAGE 84

LQYROYLQJ WKH DFWLYDWRU HOHPHQW DQG WKH UHODWLYH WUDQVFULSW OHYHOV LV VKRZQ LQ )LJ 8VLQJ WKH FRQVWUXFWLRQ n $ LQ ZKLFK WKH SURPRWHU EHWZHHQ SRVLWLRQV ES DQG ES ZDV UHSODFHG E\ ES RI D SRUWLRQ RI WKH SRO\OLQNHU IURP S8& DFWLYLW\ ZDV UHGXFHG VOLJKWO\ WR b RI ZLOG W\SH OHYHOV :KHQ WKH f§ ES IUDJPHQW ZDV SODFHG XSVWUHDP LQ WKH RSSRVLWH SRODULW\ WKH DFWLYLW\ ZDV UHGXFHG IXUWKHU WR D 57/ YDOXH RI b 5HPRYDO RI ES RI LQWHUQDO SURPRWHU VHTXHQFHV RI WKH JHQH EHWZHHQ WR ES n $ )LJ f DQG UHSODFLQJ LW ZLWK WKH ES S8& SRO\OLQNHU '1$ UHVXOWHG LQ b RI WUDQVFULSWLRQDO DFWLYLW\ +RZHYHU UHYHUVLQJ WKH RULHQWDWLRQ RI WKH ES IUDJPHQW n %f UHGXFHG WUDQVFULSWLRQ E\ b ,Q VXPPDU\ WKH DFWLYDWRU UHJLRQ LQ ERWK SRODULWLHV HIILFLHQWO\ SURPRWHG WUDQVFULSWLRQDO DFWLYLW\ RI WKH GHOHWHG JHQH ZKLFK FRQWDLQHG RQO\ 7$7$ ER[ VHTXHQFHV WR DSSUR[LPDWHO\ ZLOG W\SH OHYHOV 7KH DFWLYDWRU GRPDLQ EHWZHHQ f§ DQG ES RI WKH SURPRWHU ZDV DOVR DEOH WR DFWLYDWH WKH $ GHOHWLRQ FORQH ZKHQ VHSDUDWHG IURP WKH ES VLWH E\ ES RI !; VHTXHQFHV 0RYLQJ WKH IUDJPHQW WR WKLV QHZ SRVLWLRQ UHVXOWHG LQ D IROG LQFUHDVH LQ WUDQVFULSWLRQ UHODWLYH WR WKH ZLOG W\SH OHYHO 5HYHUVLQJ WKH SRODULW\ RI WKH DFWLYDWRU HOHPHQW LQ WKH VDPH ORFDWLRQ VOLJKWO\ UHGXFHG WKLV HOHYDWHG DFWLYLW\ WR b RI QRUPDO OHYHOV 7KH ; IUDJPHQW DORQH LQ HLWKHU RULHQWDWLRQ ZDV XQDEOH WR VWLPXODWH VLJQLILFDQW WUDQVFULSWLRQ UHVXOWLQJ LQ DFWLYLW\ OHYHOV VLPLODU WR WKH $ GHOHWLRQ FORQH DORQH (YLGHQWO\ WKH DFWLYDWRU HOHPHQW GRHV QRW KDYH VWULQJHQW VSDWLDO UHTXLUHPHQWV IRU IXQFWLRQLQJ LQ WKH n SRVLWLRQ VLQFH WKLV HOHPHQW FRXOG SURPRWH KLJK OHYHOV RI WUDQVFULSWLRQ IURP ES WR ES XSVWUHDP RI 7$7$ 7KH DFWLYLW\ OHYHO RI WKH FRQVWUXFWLRQ f§ n $ GLIIHUV VLJQLILFDQWO\ IURP WKH DFWLYLW\ RI D VLPLODU FRQVWUXFWLRQ )LJ f FRQWDLQLQJ DQ LQWHUQDO GHOHWLRQ RI VHTXHQFHV EHWZHHQ WR ES

PAGE 85

)LJXUH 6FKHPDWLF RI DFWLYDWRU HOHPHQW LQ YDULRXV SRVLWLRQV UHODWLYH WR WKH $ JHQH 7KH DFWLYDWRU FRQVWUXFWLRQV FRUUHVSRQG WR WKH 6, QXFOHDVH DQDO\VLV LQ )LJ $ 7KH YHUWLFDOOLQHG DUURZV UHSUHVHQW HLWKHU WKH f§f§ ES RU ES IUDJPHQWV IURP WKH SURPRWHU DV GHVLJQDWHG 7KH JUH\ DQG EODFN ER[HV GHQRWH WKH UHJLRQV RI WKH SURPRWHU IURP WR ES DQG WR ES UHVSHFWLYHO\ 7KH VWLSSOHG UHJLRQ UHSUHVHQWV WKH JHQH IURP ES WR DSSUR[LPDWHO\ ES GRZQVWUHDP RI WKH SRO\ $f DGGLWLRQ VLWH 7KH KDWFKHG ER[ LV WKH ; +DH ,,, ES IUDJPHQW ZLWK ES 6DLO OLQNHUV DGGHG 7KH SDQHO DW WKH ULJKW VKRZV WKH 57/V UHSUHVHQWLQJ SHUFHQWDJHV RI ZLOG W\SH JHQH DFWLYLW\ :7f 8VXDOO\ WKH 57/V YDULHG WR ZLWKLQ s b RI WKH SHUFHQWDJH YDOXH ZKHUHDV WKH 57/V RI RU OHVV YDULHG RQO\ s SHUFHQWDJH SRLQWV EHWZHHQ H[SHULPHQWV

PAGE 86

f f f 57/ :7 ,, ‘ ‘QU *(1( n $ WW 4 LQLQQQLL0 f§f§ n % ,( r $ KHPP n n % LLLLLLLLXLLLLD L f $2; ,, ,, ESf %2; ,OLOOOOOOOOOOOOOOOOOOOOOOOOO66AV66;n k;, 2; $ 2; % :$Ar1\0 f f§ f f $ *(1( aMP OOOOOOOOO+OOOOOO_>,*! n % OOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO $ ‘ f§ ’

PAGE 87

ZKLFK ZDV SUHYLRXVO\ VKRZQ WR EH b RI ZLOG W\SH OHYHOV 7KH ,' PXWDWLRQ ZDV FRQVWUXFWHG ZLWK D ES 6DLO OLQNHU MRLQLQJ WKH WZR GHOHWLRQ HQGSRLQWV 'XH WR DQ DGGLWLRQDO ES SUHVHQW EHWZHHQ ES DQG ES GHOHWLRQ VLWHV LQ WKH f§ n $ FRQVWUXFWLRQ WKLV ODWWHU PXWDQW ZDV OHVV DFWLYH LQ WUDQVFULSWLRQ FRPSDUHG WR WKH DFWLYLW\ RI WKH ,' GHOHWLRQ PXWDQW ,W LV XQFOHDU ZK\ WKH DGGLWLRQDO ES FDXVHV D UHGXFWLRQ LQ DFWLYLW\ VLQFH WKH f§ ES IUDJPHQW ZDV VKRZQ WR IXQFWLRQ TXLWH ZHOO ZKHQ LW ZDV SRVLWLRQHG ES IXUWKHU XSVWUHDP 7KH DFWLYDWRU ZDV QRW KRZHYHU DEOH WR VWLPXODWH DQ\ GHWHFWDEOH OHYHO RI WUDQVFULSWLRQ ZKHQ SODFHG GRZQVWUHDP RI WKH $ GHOHWLRQ FORQH 3RVLWLRQLQJ WKH f§ ES IUDJPHQW DSSUR[LPDWHO\ ES GRZQVWUHDP RI WKH SRO\ $f DGGLWLRQ VLWH UHVXOWHG LQ QR DFWLYLW\ LQ HLWKHU SRODULW\ 7KLV UHVXOW LV VLPLODU WR WKH VWXGLHV RI WKH OLJKWLQGXFLEOH HQKDQFHUV IURP UEF6 DQG &DE JHQHV ZKLFK GR QRW DFWLYDWH WUDQVFULSWLRQ RI WKH 126 SURPRWHU ZKLOH LQ WKH GRZQVWUHDP ORFDWLRQ f 1HYHUWKHOHVV WKH SURPRWHU IUDJPHQW IURP WR ES VHHPHG WR KDYH VRPH HQKDQFHUOLNH TXDOLWLHV IXQFWLRQLQJ XSVWUHDP UHJDUGOHVV RI SRVLWLRQ DQG RULHQWDWLRQ HYHQ WKRXJK LW FRXOG QRW IXQFWLRQ GRZQVWUHDP RI WKH JHQH 7KH VWDUW VLWH RI WKH PDMRU SURPRWHU UHPDLQHG FRQVWDQW LQ DOO RI WKH FRQVWUXFWLRQV LQ ZKLFK WKH WHVW JHQH WUDQVFULSWV FRXOG EH GHWHFWHG E\ WKH 6, QXFOHDVH PDSSLQJ DQDO\VLV )LJ f 7KH WUDQVFULSW OHYHOV IURP WKH PLQRU SURPRWHU ZHUH QRW H[DPLQHG VLQFH WKH '1$ SUREH XVHG IRU WKH 6, QXFOHDVH PDSSLQJ DQDO\VLV GLYHUJHV ZLWK WKH WHVW JHQH WUDQVFULSWV DW WKH ES VLWH ZKHUH 6DLO OLQNHUV ZHUH DGGHG +RZHYHU VRPH ORZ OHYHO WUDQVFULSWV VWDUWLQJ XSVWUHDP RI ES LQ WKH DFWLYDWRU FRQVWUXFWLRQV LPPHGLDWHO\ XSWUHDP RI $ ES FORQH VHHPHG WR RFFXU EXW RQO\ UHSUHVHQWHG DSSUR[LPDWHO\ b RI WKH

PAGE 88

PDMRU SURPRWHU DFWLYLW\ GDWD QRW VKRZQf 7KHVH XSVWUHDP VWDUW VLWHV ZHUH QRW LQYHVWLJDWHG IXUWKHU (YDOXDWLRQ RI (QKDQFHUOLNH 3URSHUWLHV RI )DU 8SVWUHDP )HJLIOQtB4/MKH 4&6 DQG $*6 3URPRWHU 7KH SURPRWHU UHJLRQ LPPHGLDWHO\ XSVWUHDP RI WKH &$$7 ER[HV RI WKH 2&6 DQG $*6 JHQHV ZHUH H[DPLQHG IRU WKHLU DELOLW\ WR SURPRWH DFWLYLW\ RI WKH $ ES GHOHWLRQ PXWDQW RI WKH JHQH 7KH 2&6 SURPRWHU UHJLRQ IURP SRVLWLRQV WR ES DQG WKH $*6 SURPRWHU UHJLRQ IURP SRVLWLRQV WR ES UHODWLYH WR WKHLU FDS VLWHVf ZHUH SODFHG VHSDUDWHO\ LQ ERWK SRODULWLHV XSVWUHDP DQG GRZQVWUHDP RI WKH JHQH $ FORQH 7KH DXWRUDGLRJUDSKV RI 6, QXFOHDVH PDSSLQJ JHOV LQYROYLQJ WKH 2&6 DQG $*6 FRQVWUXFWLRQV DUH VKRZQ LQ )LJ % ZLWK WKH FDOFXODWHG 57/ YDOXHV IRU HDFK FRQVWUXFWLRQ VKRZQ LQ )LJ 3ODFLQJ WKHVH KHWHURORJRXV SURPRWHU IUDJPHQWV HLWKHU LPPHGLDWHO\ XSVWUHDP RI WKH $ FORQH RU DSSUR[LPDWHO\ ES GRZQVWUHDP RI WKH SRO\ $f DGGLWLRQ VLWH LQ ERWK SRODULWLHV SURGXFHG OHYHOV RI DFWLYLW\ FRPSDUDEOH WR WKH $ GHOHWLRQ DORQH ZLWK RQH H[FHSWLRQ 7KH 2&6 IUDJPHQW LQ WKH % RULHQWDWLRQ UHVXOWHG LQ b RI DFWLYLW\ UHODWLYH WR WKH ZLOG W\SH JHQH DFWLYLW\ OHYHO 7KH DFWLYLW\ LQ WKH % RULHQWDWLRQ ZDV D IROG LQFUHDVH RYHU WKH DFWLYLW\ OHYHO bf RI WKH 2&6 IUDJPHQW LQ WKH QRUPDO $ RULHQWDWLRQ &RQFOXVLRQ 7KH DFWLYDWRU UHJLRQ RI WKH JHQH ZDV GHPRQVWUDWHG WR SRVVHVV VRPH FKDUDFWHULVWLFV ZKLFK DUH DOVR VKDUHG E\ HQKDQFHU HOHPHQWV ,W SURPRWHV WUDQVFULSWLRQ ZKHQ SODFHG LQ GLIIHUHQW n SRVLWLRQV UHODWLYH WR WKH JHQH 7KH DFWLYDWRU UHJLRQ LQ FRQWUDVW WR HQKDQFHU HOHPHQWV ZDV XQDEOH WR IXQFWLRQ LQ WKH GRZQVWUHDP ORFDWLRQ 7KH WUDQVFULSWLRQDO DFWLYLW\ ZDV HOHYDWHG

PAGE 89

)LJXUH 6FKHPDWLF RI WKH 2&6 DQG $*6 IUDJPHQW LQ YDULRXV SRVLWLRQV UHODWLYH WR WKH $ JHQH 7KH 2&6 DQG $*6 FRQVWUXFWLRQV FRUUHVSRQG WR WKH 6, QXFOHDVH DQDO\VLV LQ )LJ % 7KH GDUN KDWFKHG DUURZV UHSUHVHQW WKH WKH 2&6 IUDJPHQW WR ES UHODWLYH WR WKH RULJLQDO 2&6 JHQH FDS VLWHf ZKHUHDV WKH OLJKW KDWFKHG DUURZV UHSUHVHQW $*6 SURPRWHU IUDJPHQW WR ES UHODWLYH WR WKH RULJLQDO $*6 JHQH FDS VLWHf :7 UHIHUV WR WKH ZLOG W\SH JHQH ZLWK LWV FRPSRQHQWV DV GHVFULEHG LQ )LJ 7KH SDQHO DW WKH ULJKW VKRZV WKH 57/V UHSUHVHQWLQJ SHUFHQWDJHV RI ZLOG W\SH JHQH DFWLYLW\ 7KH 57/V YDULHG WR ZLWKLQ s SHUFHQWDJH SRLQWV EHWZHHQ H[SHULPHQWV

PAGE 90

f f f ZW QL L PL ,,, ‘ *(1( 2&6 n $ :Z/ : 2&6 f % $*6 f $ $*6 n % &0 W f 2&6 n $ ‘ PPP! 2&6 f % IO $*6 f $ ‘ $*6 r % ‘ A====O $ 57/

PAGE 91

DSSUR[LPDWHO\ IROG RYHU ZLOG W\SH OHYHOV ZKHQ WKLV HOHPHQW ZDV SODFHG IXUWKHU ESf XSVWUHDP E\ LQVHUWLQJ D ; IUDJPHQW EHWZHHQ WKH DFWLYDWRU HOHPHQW DQG WKH ES VLWH 7KLV ODWWHU FRQVWUXFWLRQ DOVR GHPRQVWUDWHG WKDW WKH JHQH GRHV QRW UHTXLUH DQ XSVWUHDP HOHPHQW IRU ZLOG W\SH OHYHOV RI DFWLYLW\ VLQFH WKH XSVWUHDP HOHPHQW FRXOG EH UHSODFHG E\ ; VHTXHQFHV DQG VWLOO UHWDLQ KLJK DFWLYLW\ %\ VHTXHQFH LQVSHFWLRQ WKH ES DQG ES IUDJPHQWV LQ ERWK SRODULWLHV FRQWDLQ &$$7 ER[OLNH VHTXHQFHV WKDW PD\ UHSODFH WKH ZLOG W\SH &$$7 ER[HV ZKLFK ZHUH UHPRYHG GXULQJ WKH FRQVWUXFWLRQV RI WKH SURPRWHU PXWDWLRQV :KHWKHU WKHVH &$$7 ER[OLNH VHTXHQFHV DFWXDOO\ FRQWULEXWH WR WKH WUDQVFULSWLRQDO UHJXODWLRQ LV VWLOO XQUHVROYHG $VLGH IURP WKH DFWLYDWRU HOHPHQW DFWLQJ LQ D FRQVWLWXWLYH PDQQHU WKLV HOHPHQW VKDUHV VRPH SURSHUWLHV RI WKH UEF6 OLJKWLQGXFLEOH HQKDQFHUOLNH HOHPHQW %RWK RI WKHVH HOHPHQWV DUH DEOH WR SURPRWH DFWLYLW\ LQ HLWKHU SRODULW\ EXW DSSDUHQWO\ RQO\ LQ WKH n ORFDWLRQ $OVR QHLWKHU WKH JHQH QRU WKH UEF6 JHQH VHHP WR UHTXLUH VHTXHQFHV DURXQG WKH &$$7 ER[ VLQFH GHOHWLRQ RI WKHVH 7$7$SUR[LPDO UHJLRQV UHVXOW LQ HOHYDWLRQ RI WKH WUDQVFULSWLRQDO DFWLYLWLHV ,W LV SRVVLEOH WKDW SODQW HQKDQFHUOLNH HOHPHQWV PD\ RQO\ ZRUN LQ WKH n ORFDWLRQ RI D JHQH VLQFH D GHPRQVWUDWLRQ RI DQ\ VXFK DFWLYLWLHV LQ WKH n SRVLWLRQ KDV QRW EHHQ PDGH 7KH 2&6 DQG $*6 VHTXHQFHV XSVWUHDP RI WKHLU &$$7 ER[HV LQ JHQHUDO GLG QRW HIILFLHQWO\ DFWLYDWH WUDQVFULSWLRQ RI WKH $ ES GHOHWLRQ FORQH H[FHSW IRU RQH FRQVWUXFWLRQ LQYROYLQJ WKH UHYHUVH SRODULW\ RI WKH 2&6 IUDJPHQW 7KLV SDUWLFXODU FRQVWUXFWLRQ VWLPXODWHG WUDQVFULSWLRQ IROG RYHU EDFNJURXQG OHYHOV EXW ZDV VWLOO RQO\ RI WKH JHQH ZLOG W\SH OHYHO $Q H[SODQDWLRQ IRU WKH % RULHQWDWLRQ RI WKH 2&6 IUDJPHQW SURPRWLQJ WKLV LQFUHDVH LQ WUDQVFULSWLRQ ZKHQ FRPSDUHG WR WKH $ RULHQWDWLRQ FRXOG EH GXH WR WKH SUHVHQFH RI UHJLRQV RI

PAGE 92

KRPRORJ\ RI WKH 2&6 IUDJPHQW LQ WKH % RULHQWDWLRQ ZLWK WKH SURPRWHU UHJLRQ 7KH SURPRWHU GRHV VKRZ VXFK KRPRORJLHV LQFOXGLQJ D ES UHJLRQ DOVR LQFOXGHV WKH GLVWDO D UHSHDWf IURP WR ES RI WKH SURPRWHU VHH )LJ f WKDW LV VLPLODU WR D ES VHTXHQFH ZLWK ES PLVPDWFKf SUHVHQW LQ WKH UHYHUVHG 2&6 IUDJPHQW SRVLWLRQHG IURP WR ES UHODWLYH WR WKH FDS VLWH RI WKH $ GHOHWLRQ FORQH $QRWKHU ES VHTXHQFH SUHVHQW LQ WKH 2&6 IUDJPHQW LQ WKH % RULHQWDWLRQ LV SRVLWLRQHG WR ES UHODWLYH WR WKH FDS VLWH RI WKH $ GHOHWLRQ FORQH ZKLFK LV KRPRORJRXV WR D VLPLODU VHTXHQFH LQ WKH SURPRWHU SRVLWLRQHG DW WR ES DOORZLQJ IRU ES PLVPDWFKf ,Q DGGLWLRQ WKH JHQH UHSHDW F KDV QHDUO\ b KRPRORJLHV WR D IHZ UHJLRQV RI WKH 2&6 VHTXHQFH LQ ERWK SRODULWLHV 7ZR VLWHV RI KRPRORJ\ FDQ EH IRXQG LQ WKH 2&6 VHTXHQFH LQ WKH % RULHQWDWLRQ DW SRVLWLRQV DQG ES UHODWLYH WR WKH GHOHWHG JHQH FDS VLWH ZKHUHDV RQH VLWH FDQ EH IRXQG LQ WKH $ RULHQWDWLRQ DW SRVLWLRQ ES UHODWLYH WR WKH $ FDS VLWH 6HTXHQFHV RI $*6 DQG 2 ; IUDJPHQWV RU WKH 7'1$ UHJLRQ XSVWUHDP RI DOO GHOHWLRQ FRQVWUXFWLRQV GR QRW VKRZ DQ\ REYLRXV KRPRORJLHV 7KH UHDVRQ IRU WKH 2&6 IUDJPHQW RQO\ ZRUNLQJ LQ RQH RULHQWDWLRQ LV VWLOO XQFOHDU VLQFH LW FRQWDLQV WKH VHTXHQFH KRPRORJLHV WR WKH WKH DFWLYDWRU HOHPHQW ZKLFK ZDV DEOH WR ZRUN LQ ERWK SRODULWLHV 7KHUHIRUH IXUWKHU H[DPLQDWLRQ LV VWLOO QHHGHG RI ZKHWKHU WKHVH VHTXHQFHV WKDW DUH KRPRORJRXV WR WKH 2&6 IUDJPHQW LQ WKH % RULHQWDWLRQ DUH LPSRUWDQW IRU WUDQVFULSWLRQDO DFWLYLW\ ,W LV DOVR SRVVLEOH WKH 2&6 DQG $*6 JHQHV PD\ KDYH HQKDQFHUOLNH HOHPHQWV SUHVHQW LQ WKHLU SURPRWHUV EXW WKHVH HOHPHQWV DUH RQO\ FDSDEOH RI IXQFWLRQLQJ LQ WKH SUHVHQFH RI ERWK DQ XSVWUHDP HOHPHQW DQG 7$7$ ER[ 7KH RQO\ SUHYLRXV GHPRQVWUDWLRQ RI DQ HQKDQFHUOLNH HOHPHQW ZLWKLQ WKH 2&6 SURPRWHU ZDV UHSRUWHG E\ $ 3HDFRFN HW DO DW WKH )LUVW ,QWHUQDWLRQDO 6\PSRVLXP RQ 3ODQW 0ROHFXODU *HQHWLFV LQ 6DYDQQDK *HRUJLD 2FWREHU

PAGE 93

1RYHPEHU f 7KH\ UHSRUWHG WKDW D IUDJPHQW IURP WKH 2&6 SURPRWHU ORFDWHG XSVWUHDP RI WKH &$$7 ER[ ZDV DEOH WR SURPRWH LQGXFLEOH DFWLYLWLHV ZKLOH SRVLWLRQHG LQ HLWKHU SRODULW\ DW WKH ES VLWH RI $GK JHQH RI PDL]H ,Q WKLV FDVH WKH ES SURPRWHU RI $GK PD\ VWLOO LQFOXGH LWV RZQ IXQFWLRQDO XSVWUHDP HOHPHQW ZKLFK PD\ SRVVLEO\ IXOILOO WKH UHTXLUHPHQW IRU DQ XSVWUHDP HOHPHQW E\ WKH SXWDWLYH 2&6 HQKDQFHU HOHPHQW IRU DFWLYDWLRQ RI WUDQVFULSWLRQ 7KH DFWLYDWRU UHJLRQ VHHPV WR GLIIHU IURP WKH 2&6 RU $*6 IUDJPHQWV LQ WKLV UHVSHFW E\ QRW KDYLQJ D VWURQJ UHTXLUHPHQW IRU DQ XSVWUHDP HOHPHQW IRU DFWLYDWRU IXQFWLRQ $QRWKHU SRVVLELOLW\ RI ZK\ WKH 2&6 RU $*6 IUDJPHQW GLG QRW HIILFLHQWO\ DFWLYDWH WUDQVFULSWLRQ RI WKH $ ES GHOHWLRQ FORQH ZDV WKDW WKHVH SURPRWHU VHTXHQFHV PD\ RQO\ HIIHFWLYHO\ DFWLYDWH WKHLU RZQ FRUH SURPRWHU XSVWUHDP HOHPHQW DQG 7$7$ ER[f UHJLRQV DQG QRW FHUWDLQ FODVVHV RI KHWHURORJRXV FRUH SURPRWHUV $Q H[DPSOH RI VXFK VSHFLILFLW\ RI LQWHUDFWLRQ LV VHHQ LQ WKH HQKDQFHUV RI WKH LPPXQRJOREXOLQ JHQHV %RWK WKH FKDLQ DQG WKH KHDY\ FKDLQ HQKDQFHUV VWLPXODWHG WKHLU RZQ SURPRWHUV IROG ZKHQ FRPSDUHG WR WKHLU HIIHFW RQ 69 ODFNLQJ LWV HQKDQFHU UHJLRQf DQG PHWDOORWKLRQHLQ LQFOXGLQJ QHDUO\ NES RI SURPRWHU VHTXHQFHf f 7KH 7$7$ ER[ RI WKH +69 WN JHQH DOVR SUHIHUHQWLDOO\ IXQFWLRQV ZLWK LWV RZQ XSVWUHDP HOHPHQW f ,W LV WKHUHIRUH SRVVLEOH WKDW WKH 2&6 DQG $*6 IUDJPHQWV PD\ KDYH D SUHIHUHQFH IRU SDUWLFXODU SURPRWHU VHTXHQFHV LQ WKHLU DFWLYDWLRQ RI WUDQVFULSWLRQ ,Q FRQFOXVLRQ WKH HQKDQFHUOLNH HOHPHQW PD\ EH GLIIHUHQW WR RWKHU VLPLODU HOHPHQWV LQ RWKHU 7'1$ JHQHV OLNH WKH 2&6 DQG $*6 JHQHV ,W LV IRXQG IXUWKHU XSVWUHDP WKDQ HOHPHQWV UHTXLUHG IRU DFWLYLW\ LQ WKH RWKHU FKDUDFWHUL]HG 7'1$ JHQHV DQG LW FDQ IXQFWLRQ LQ ERWK SRODULWLHV ZLWKRXW WKH SUHVHQFH RI WKH &$$7 ER[ %\ DQDORJ\ ZLWK DQLPDO HQKDQFHUV WKH

PAGE 94

DFWLYDWRU LV OLNHO\ WR LQWHUDFW ZLWK VSHFLILF WUDQVFULSWLRQ IDFWRUV LQ WKH UHJXODWLRQ RI WUDQVFULSWLRQ 7KH SRVVLELOLW\ RI VXFK DQ LQWHUDFWLRQ ZDV H[DPLQHG XVLQJ YDULRXV SODQW QXFOHDU H[WUDFWV LQ WKH QH[W FKDSWHU

PAGE 95

&+$37(5 ,1 9,752 18&/($5 )$&725 %,1',1* 72 7+( $&7,9$725 (/(0(17 ,QWURGXFWLRQ (QKDQFHUV LQ DQLPDO JHQHV PHGLDWH WKHLU FRQWURO RI WUDQVFULSWLRQ WKURXJK WKH VSHFLILF ELQGLQJ RI QXFOHDU UUDLVDFWLQJ IDFWRUV 7KLV LQWHUDFWLRQ LV DEOH WR HQJDJH RWKHU SURPRWHU HOHPHQWV QHDU WKH LQLWLDWLRQ VLWH RYHU D FRQVLGHUDEOH GLVWDQFH 7KH DFWLYDWRU HOHPHQW RI WKH JHQH ZDV SUHYLRXVO\ VKRZQ LQ FKDSWHU WR KDYH HQKDQFHUOLNH FKDUDFWHULVWLFV 7KLV HOHPHQW UHVLGLQJ QHDUO\ ES IURP WKH 7$7$ ER[ DQG KDYLQJ D ELGLUHFWLRQDO DFWLYLW\ LV OLNHO\ WR ELQG QXFOHDU IDFWRUV DQG LQLWLDWH WUDQVFULSWLRQ LQ D IDVKLRQ VLPLODU WR WKH HQKDQFHUV FKDUDFWHUL]HG LQ DQLPDO DQG YLUDO JHQHV 6LQFH WKH JHQH ZDV SUHYLRXVO\ VKRZQ WR EH WUDQVFULEHG LQ WREDFFR DV ZHOO DV VXQIORZHU WLVVXHV WKHVH WZR SODQWV VSHFLHV PD\ FRQWDLQ VLPLODU WUDQVFULSWLRQDO IDFWRUV LQWHUDFWLQJ ZLWK WKH SURPRWHU HOHPHQWV 6WXGLHV RI WKH LPPXQRJOREXOLQ f F[MJORELQ f DQG WKH SURWRRQFRJHQH FIRV JHQHV f LQ DQLPDOV XWLOL]HG DQ HOHFWURSKRUHWLF PRELOLW\ VKLIW DVVD\ WR GHPRQVWUDWH VSHFLILF SURWHLQ'1$ LQWHUDFWLRQ 7KH HOHFWURSKRUHWLF PRELOLW\ VKLIW DVVD\ LV XVHIXO LQ LGHQWLI\LQJ UHJLRQV RI WKH SURPRWHU ZKHUH VSHFLILF ELQGLQJ RFFXUV f DV ZHOO DV LQ WKH VFUHHQLQJ IRU WKH SUHVHQFH RI VSHFLILF '1$ ELQGLQJ IDFWRUV IURP GLIIHUHQW WLVVXHV f ,Q WKLV VWXG\ WKH DFWLYDWRU HOHPHQW ZDV VKRZQ WR ELQG VSHFLILFDOO\ WR IDFWRUV IURP SODQW FUXGH

PAGE 96

QXFOHDU H[WUDFWV RULJLQDWLQJ IURP WZR GLIIHUHQW SODQW VSHFLHV 7KLV LQWHUDFWLRQ ZDV ILUVW GHWHUPLQHG E\ HOHFWURSKRUHWLF PRELOLW\ VKLIW DVVD\ DQG WKHQ H[DPLQHG PRUH FORVHO\ E\ LQ YLWUR '1DVH GLJHVWLRQ SURWHFWLRQ DQDO\VLV 7KH HOHFWURSKRUHWLF PRELOLW\ VKLIW DVVD\ GHWHFWV VSHFLILF IDFWRU ELQGLQJ WR D ODEHOHG '1$ IUDJPHQW ZKLFK FDXVHV D UHWDUGDWLRQ RI PRELOLW\ UHODWLYH WR WKH IUHH '1$ IUDJPHQW ZKHQ VHSDUDWHG RQ D ORZ SHUFHQW DFU\ODPLGH JHO 7KH DVVD\ LV D UHODWLYHO\ VLPSOH DOORZLQJ RQH WR FKDUDFWHUL]H ELQGLQJ XQGHU D YDULHW\ RI FRQGLWLRQV DV ZHOO DV URXJKO\ PDS DUHDV RI D SURPRWHU ZKHUH VSHFLILF LQWHUDFWLRQV ZLWK QXFOHDU IDFWRUV RFFXU 7KH '1DVH SURWHFWLRQ DQDO\VLV SHUPLWV D QXFOHRWLGH OHYHO UHVROXWLRQ RI UHJLRQV SURWHFWHG IURP GLJHVWLRQ E\ IDFWRU ELQGLQJ 7KLV WHFKQLTXH FDQ LQGHQWLI\ VKRUW VHTXHQFHV UHFRJQL]HG E\ FHUWDLQ QXFOHDU IDFWRUV DQG KDV EHHQ XWLOL]HG LQ WKH GHWHUPLQDWLRQ RI WKH VHTXHQFH RI WKH 6SO ELQGLQJ VLWH f ,W PD\ EH SRVVLEOH WR REWDLQ D PRUH FRPSOHWH SLFWXUH RI WKH JHQH SURPRWHU IXQFWLRQ E\ FRUUHODWLQJ IXQFWLRQDO GRPDLQV LGHQWLILHG E\ GHOHWLRQ DQDO\VLV ZLWK WKRVH UHJLRQV LQYROYHG LQ VSHFLILF IDFWRU ELQGLQJ 0DWHULDOV DQG 0HWKRGV 3UHSDUDWLRQ RI &UXGH 1XFOHDU ([WUDFW IURP 3ODQW 3OXPXOHV 3UHSDUDWLRQ RI FUXGH QXFOHDU H[WUDFWV IURP VXQIORZHU DQG VR\EHDQ ZHUH SHUIRUPHG IURP D SURFHGXUH f DV IROORZV $SSUR[LPDWHO\ J RI SOXPXOHV IURP HLWKHU RQHZHHN ROG VXQIORZHU + DQQXXV FY /DUJH *UH\f RU HWLRODWHG VR\EHDQ VHHGOLQJV *O\FLQH PD[f ZHUH SODFHG LQ ; YZW RI LFH FROG VROXWLRQ P0 +HSHV >S+ @ 0 VXFURVH P0 .& P0 0J&A P0 (*7$ P0 '77 DQG P0 SKHQ\OPHWK\OVXOIRQ\O IORXULGH 306) 6LJPDf 0RVW RI WKH H[WUDFWLRQ SURFHGXUH ZDV SHUIRUPHG LQ WKH FROG URRP DW r& 7KH SODQW PL[WXUH ZDV KRPRJHQL]HG IRU PLQXWHV XVLQJ D 7HNPDU

PAGE 97

7LVVXHPL]HU DW KLJK VSHHG WKHQ ILOWHUHG WKURXJK PLUD FORWK &DOELRFKHPf UHLQIRUFHG ZLWK FKHHVFORWK 7KH QXFOHL IURP WKH ILOWUDWH ZDV FROOHFWHG E\ FHQWULIXJDWLRQ DW ;J IRU PLQXWHV DW r& 7KH VXSHUQDWHQW ZDV GLVFDUGHG DQG WKH SHOOHW JHQWO\ UHVXVSHQGHG LQ PO RI VROXWLRQ 7KH UHVXVSHQGHG QXFOHL ZHUH PL[HG ZLWK VWURNHV XVLQJ D 'RXQFH KRPRJHQL]HU VWURNHV DUH D GRZQ DQG XS PRYHPHQWf WKHQ FROOHFWHG DJDLQ E\ FHQWULIXJDWLRQ DW ;J IRU PLQXWHV DW r& 7KH VXSHUQDWDQW ZDV GLVFDUGHG DQG WKH ORRVH QXFOHDU SHOOHW ZDV UHVXVSHQGHG JHQWO\ LQ PO RI VROXWLRQ ,, P0 +HSHV >S+ @ P0 1D&O P0 0J&O P0 (*7$ P0 '77 P0 306) DQG b JO\FHUROf XVLQJ D VWLUULQJ URG HYHU\ PLQXWHV ZKLOH RQ LFH 7KLV JHQWOH VWLUULQJ ZDV FDUULHG RXW IRU PLQXWHV WR DOORZ QXFOHDU IDFWRUV WR GLIIXVH RXW RI LQWDFW QXFOHL 1XFOHDU PDWHULDO DQG DQ\ UHPDLQLQJ GHEULV ZHUH UHPRYHG IURP WKLV PL[WXUH E\ FHQWULIXJDWLRQ DW ;J IRU KRXU DW r& 7KH VXSHUQDWH ZDV GLVSHQVHG LQWR DOLTXRWV IUR]HQ LQ OLTXLG 1 DQG VWRUHG DW r& 3URWHLQ FRQFHQWUDWLRQV ZHUH GHWHUPLQHG E\ WKH PHWKRG RI %UDGIRUG f (OHFWURSKRUHWLF 0RELOLW\ 6KLIW $VVD\ (OHFWURSKRUHWLF PRELOLW\ VKLIW DVVD\V XVLQJ WKH DFWLYDWRU UHJLRQ RI WKH JHQH ZHUH SHUIRUPHG E\ D PRGLILHG PHWKRG RI 6LQJK HW DO f $SSUR[LPDWHO\ QJ RI DQ HQGODEHOHG IUDJPHQW WR ES RI WKH JHQH SURPRWHU XQOHVV RWKHUZLVH VSHFLILFLHGf ZDV LQFXEDWHG ZLWK SL RI VR\EHDQ H[WUDFW LQ D ILQDO YROXPH RI SL FRQWDLQLQJ P0 +HSHV >S+@ P0 1D&O P0 ('7$ P0 '77 P0 306) DQG b JO\FHURO $ W\SLFDO ELQGLQJ DVVD\ LQYROYLQJ WKH VXQIORZHU QXFOHDU H[WUDFW ZDV FDUULHG RXW DW URRP WHPSHUDWXUH LQ D ILQDO UHDFWLRQ YROXPH RI SL FRQVLVLWLQJ RI P0 7ULV+&O S+ f P0 '77 P0 ('7$ b JO\FHURO DQG SL RI WKH VXQIORZHU H[WUDFW SUHVHQW LQ VROXWLRQ ,, 7KH DPRXQW RI SRO\ GL G&f '1$ FRPSHWLWRU '1$

PAGE 98

QRQFRPSHWLWRU '1$ 7ULWRQ; 6LJPDf DQG 0J&O ZHUH YDULHG DV LQGLFDWHG VHH 5HVXOWVf $IWHU PLQXWHV WKH ELQGLQJ UHDFWLRQ ZDV IUDFWLRQDWHG RQ D b SRO\DFU\ODPLGH JHO DFU\ODPLGH WR ELVDFU\ODPLGHf ZLWK UHFLUFXODWHG EXIIHU FRQVLVWLQJ RI P0 7ULV+&O S+ f P0 1D DFHWDWH DQG P0 ('7$ 7KH JHO ZDV SUHUXQ IRU PLQXWHV DW YROWV YROWVFPf DW URRP WHPSHUDWXUH EHIRUH ORDGLQJ WKH VDPSOHV ZKLFK ZHUH WKHQ UXQ DW WKH VDPH YROWDJH IRU KRXUV $IWHU WKH UXQ WKH JHO ZDV IL[HG LQ b DFHWLF DFLG b PHWKDQRO VROXWLRQ IRU PLQXWHV ZDVKHG ZLWK GLVWLOOHG ZDWHU IRU PLQXWHV WKHQ GULHG XQGHU YDFXXP RQ D 00 :KDWPDQ ILOWHU XVLQJ D KHDWHG VODE JHO GULHU 7KH GULHG JHO ZDV H[SRVHG WR ;53 ;UD\ ILOP .RGDNf LQ WKH SUHVHQFH RI DQ LQWHQVLILHU VFUHHQ DW r& IRU GD\V '1DVH 3URWHFWLRQ $VVD\ '1DVH SURWHFWLRQ DVVD\V ZHUH SHUIRUPHG RQ WKH DFWLYDWRU UHJLRQ RI WKH JHQH XVLQJ WKH QXFOHDU H[WUDFW IURP VR\EHDQ SOXPXOHV $SSUR[LPDWHO\ QJ RI n HQGODEHOHG '1$ IUDJPHQW WR ES RI WKH JHQH SURPRWHUf ZLWK QJ RI '; +DH,,, GLJHVWHG '1$ DV FDUULHU ZHUH LQFXEDWHG ZLWK _LO RI VROXWLRQ ,, FRQWDLQLQJ WKH FUXGH QXFOHDU H[WUDFW 7KH '1$ ZDV DGGHG WR D ILQDO YROXPH RI SL RI P0 +HSHV S+ f P0 1D&O P0 0J&O P0 '77 P0 306) DQG b JO\FHURO DQG LQFXEDWHG IRU PLQXWHV DW URRP WHPSHUDWXUH $IWHU ELQGLQJ SL RI '1DVH EXIIHU ZDV DGGHG WR ILQDO FRQFHQWUDWLRQV RI P0 1D DFHWDWH S+ f P0 0J&O DQG P0 &D&O FRQWDLQLQJ IUHVKO\ GLOXWHG '1DVH %HWKHVGD 5HVHDUFK /DERUDWRULHVf DW D ILQDO FRQFHQWUDWLRQ RI QJPO DQG LQFXEDWHG IRU PLQXWHV DW URRP WHPSHUDWXUH 7KH RSWLPXP DPRXQW RI '1DVH ZDV GHWHUPLQHG HPSHULFDOO\ IRU WKH EHVW GLVWULEXWLRQ RI GLJHVWHG '1$ EDQGV 7KH '1DVH UHDFWLRQ ZDV WHUPLQDWHG E\

PAGE 99

DGGLQJ YROXPH RI P0 ('7$ DQG SLJ RI W51$ EHIRUH H[WUDFWLQJ ZLWK SKHQRKFKORURIRUP LVRDP\O DOFRKRO f 7KH '1$ IUDJPHQWV ZHUH SUHFLSLWDWHG E\ WKH DGGLWLRQ RI YROXPH RI 0 1D DFHWDWH S+ f DQG ; YROXPH RI b HWKDQRO 7KH UHVXVSHQGHG SHOOHWV ZHUH DQDO\]HG RQ DQ b SRO\DFU\ODPLGH JHO ZLWK 0 XUHD DQG H[SRVHG WR ;$5 ;UD\ ILOP IRU GD\V DW r& ZLWK DQ LQWHQVLILHU VFUHHQ 5HVXOWV $QDO\VLV RI 1XFOHDU )DFWRUV &RPSOH[HG ZLWK $FWLYDWRU 5HJLRQ 7KH HOHFWURSKRUHWLF PRELOLW\ VKLIW DVVD\ ZDV XVHG WR DVVHVV WKH DELOLW\ RI YDULRXV IUDJPHQWV RI WKH DFWLYDWRU UHJLRQ WR IRUP VSHFLILF '1$SURWHLQ FRPSOH[HV ZKHQ LQFXEDWHG ZLWK FUXGH QXFOHDU H[WUDFWV IURP VXQIORZHU RU VR\EHDQ VHHGOLQJV 6SHFLILF FRQGLWLRQV RI WKH ELQGLQJ UHDFWLRQ ZHUH YDULHG WR REWDLQ RSWLPXP LQWHUDFWLRQ +RPRORJRXV DQG QRQKRPRORJRXV '1$ ZDV DOVR XVHG IRU FRPSHWLWLRQ LQ WKH LQ YLWUR ELQGLQJ UHDFWLRQ ZLWK WKH HQGODEHOHG SUREH WR GHWHUPLQH WKH VSHFLILFLW\ RI WKH '1$SURWHLQ FRPSOH[ )RXU n HQGODEHOHG SUREHV IURP GLIIHUHQW UHJLRQV RI WKH DFWLYDWRU UHJLRQ ZHUH LQFXEDWHG ZLWK VXQIORZHU H[WUDFWV DQG H[DPLQHG E\ WKH HOHFWURSKRUHWLF PRELOLW\ VKLIW DVVD\ /RZ LQWHQVLW\ EDQGV ZLWK UHGXFHG PRELOLWLHV ZHUH GHWHFWHG ZKLOH XVLQJ RI WKH IUDJPHQWV ZKLFK LQFOXGHG WKH f§ DQG ES UHJLRQV )LJ f 7KH ES IUDJPHQW DSSDUHQWO\ GLG QRW ELQG WR WKH IDFWRUV VLQFH QR GLVWLQFW EDQG ZDV VHHQ WR VKLIW )DFWRU LQWHUDFWLRQ ZLWK WKH DFWLYDWRU UHJLRQ VHHPHG WR EH ORFDOL]HG WR WZR UHJLRQV RQH IURP WR ES DQG WKH RWKHU IURP WR ES 7KH DSSDUHQW ODFN RI ELQGLQJ RI WKH ES IUDJPHQW PD\ UHIOHFW

PAGE 100

U %RXQG M )LJXUH (OHFWURSKRUHWLF PRELOLW\ VKLIW DVVD\ RI YDULRXV DFWLYDWRU HOHPHQW IUDJPHQWV XVLQJ VXQIORZHU H[WUDFW 7KHVH DFWLYDWRU IUDJPHQWV ZHUH H[FLVHG IURP HLWKHU n RU n GHOHWLRQ FORQHV DQG f HQGODEHOHG DW WKH 6DO VLWHV rf $SSUR[LPDWHO\ QJ FSPf RI WKHVH ODEHOHG IUDJPHQWV ZDV LQFXEDWHG ZLWK SL RI FUXGH VXQIORZHU H[WUDFW DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV /DQHV DQG FRQWDLQ IUHH '1$ IUDJPHQW /DQHV DQG FRQWDLQ ODEHOHG IUDJPHQW LQFXEDWHG ZLWK WKH H[WUDFW /DQHV DQG FRQWDLQ ODEHOHG '1$ LQFXEDWHG ZLWK H[WUDFW DQG SJ RI SRO\ GOG&f '1$ %RXQG UHIHUV WR WKH VSHFLILF SURWHLQ'1$ FRPSOH[ DQG IUHH UHIHUV WR WKH XQERXQG ODEHOHG IUDJPHQW

PAGE 101

D WUXH DEVHQFH RI IDFWRU ELQGLQJ RU PD\ VLPSO\ EH GXH WR D ODFN RI RSWLPL]DWLRQ RI LQ YLWUR ELQGLQJ SDUDPHWHUV $GGLWLRQDO HOHFWURSKRUHWLF VKLIW DVVD\V ZHUH FRQGXFWHG XVLQJ WKH ES IUDJPHQW LQ RUGHU WR DFKHLYH DQ RSWLPL]DWLRQ RI LQ YLWUR ELQGLQJ )LJ f 0XOWLSOH SURWHLQ'1$ FRPSOH[HV ZHUH HYLGHQW E\ WKH GHFUHDVH LQ PRELOLW\ RI WKH HQGODEHOHG IUDJPHQW LQ WKH SUHVHQFH RI VXQIORZHU H[WUDFW $ PXOWLSOH EDQGLQJ SDWWHUQ ZDV DOVR VHHQ XVLQJ FDXOLIORZHU FUXGH QXFOHDU H[WUDFW SUHSDUHG LQ D VLPLODU PDQQHU DV WKH VXQIORZHU DQG VR\EHDQ H[WUDFWVf ERXQG WR WKH DFWLYDWRU UHJLRQ GDWD QRW VKRZQf $GGLWLRQ RU UHPRYDO RI WKH ELQGLQJ VDOW VROXWLRQ RU WKH SUHVHQFH RI 7ULWRQ; LQ WKH ELQGLQJ UHDFWLRQ GLG QRW VHHP WR DIIHFW WKH SDWWHUQ RI VKLIWHG FRPSOH[HV WR DQ\ VLJQLILFDQW OHYHO ODQHV )LJ f 7KH LQWHQVLWLHV RI WKH EDQGV KRZHYHU ZHUH KLJKO\ GHSHQGHQW RQ WKH DPRXQW RI H[WUDFW DQG SRO\ GOG&f RU WKH SUHVHQFH RI D GLYDOHQW FDWLRQ LQ WKH ELQGLQJ UHDFWLRQ 7KH DGGLWLRQ RI PRUH H[WUDFW DQG SRO\ GOG&f '1$ VLJQLILFDQWO\ GHFUHDVHG WKH FRPSOH[HVn PRELOLW\ $OVR DGGLQJ P0 0J&O WR WKH ELQGLQJ UHDFWLRQ FDXVHG IRXU GLVWLQFW EDQGV WR IRUP ZLWK WKH WKUHH VORZHVW EDQGV GHVLJQDWHG DV D E DQG F ODQH )LJ f $JDLQ DGGLQJ PRUH H[WUDFW DQG SRO\ GOG&f '1$ ZLWK 0J&O ODQH f VOLJKWO\ GHFUHDVHG WKH PRELOLW\ RI EDQGV D E DQG F ZKLOH LQFUHDVLQJ WKHLU OHYHO RI LQWHQVLW\ 7KH 0J&O ZDV WKHUHIRUH DGGHG WR VXEVHTXHQW ELQGLQJ UHDFWLRQV WR HQKDQFH SURWHLQ'1$ FRPSOH[ IRUPDWLRQV &RPSHWLWLRQ RI VSHFLILF ELQGLQJ IDFWRUV IURP VXQIORZHU IRU WKH DFWLYDWRU HOHPHQW RI WKH JHQH ZDV DFKLHYHG E\ DGGLQJ YDULRXV DPRXQWV RI XQODEHOHG ES IUDJPHQW IURP WKH SURPRWHU $ ES +SD,, IUDJPHQW IURP S8& ZDV DGGHG WR WKH ELQGLQJ UHDFWLRQ DOUHDG\ FRQWDLQLQJ WKH ODEHOHG ES IUDJPHQWf DV QRQKRPRORJRXV '1$ WR FRPSDUH WKH VSHFLILFLW\ RI WKH SURWHLQ'1$ FRPSOH[LQJ )LJ f %DQGV E DQG F ZHUH YLUWXDOO\

PAGE 102

)LJXUH (OHFWURSKRUHWLF PRELOLW\ VKLIW DVVD\ RI WKH ES JHQH IUDJPHQW 7KH ES IUDJPHQW ZDV LVRODWHG IURP D n GHOHWLRQ FORQH DQG n HQGODEHOHG DW WKH (FR5O VLWH ESf $SSUR[LPDWHO\ QJ FSPf RI WKLV IUDJPHQW ZDV LQFXEDWHG ZLWK SL RI VXQIORZHU H[WUDFW DQG SJ RI SRO\ GOG&f '1$ XQOHVV RWKHUZLVH LQGLFDWHG 7KH ELQGLQJ UHDFWLRQ VDOWV LQ DOO ODQHV H[FHSW ODQH f ZDV P0 1D&O P0 7ULV+&O S+ f P0 '77 P0 ('7$ DQG b JO\FHURO /DQH XQERXQG '1$ ODQH SL H[WUDFW RQO\ ODQH SL H[WUDFW RQO\ ZLWK QR VDOWV ODQH DGGLQJ b 7ULWRQ; ODQH QRWKLQJ DGGHG /DQHV DQG FRQWDLQ SL H[WUDFW SJ RI SRO\ GOG&f '1$ ZLWKRXW DQG ZLWK WKH DGGLWLRQ RI P0 0J&O b 7ULWRQ; UHVSHFWLYHO\ /DQHV DQG FRQWDLQ DGGHG P0 0J&O ZLWKRXW DQG ZLWK b 7ULWRQ; UHVSHFWLYHO\ /DQHV FRQWDLQ DGGHG P0 0J&O LQ HDFK ZLWK XQODEHOHG ES IUDJPHQW RI WKH DFWLYDWRU DQG S8& '1$ LQGLFDWHG DV IROORZV QJ RI ES IUDJPHQW QJ RI ES IUDJPHQW QJ RI ES +SD,, IUDJPHQW IURP S8& '1$ QJ RI ES +SD,, IUDJPHQW IURP S8& '1$ D Ef F DQG G UHIHU WR WKH SURWHLQ'1$ FRPSOH[HV DQG IUHH UHIHUV WR WKH ORZHU XQERXQG EDQG LQ DOO ODQHV 7KH XSSHU EDQG LQ ODQH LV D FRQWDPLQDWLRQ RI HQGODEHOHG IUDJPHQW SUHVHQW LQ WKH ORDGLQJ G\H b VXFURVH b EURPSKHQRO EOXHf XVHG IRU WKDW ODQH DORQH

PAGE 103

HOLPLQDWHG E\ DGGLQJ IROG H[FHVV RI FROG JHQH ES IUDJPHQW WR WKH ELQGLQJ UHDFWLRQ ODQHV DQG )LJ f +RZHYHU EDQGV E DQG F ZHUH QRW DIIHFWHG DV PXFK ZKHQ WKH VDPH DPRXQW RI S8& '1$ ZDV DGGHG ODQH )LJ f GHPRQVWUDWLQJ WKDW WKLV UHJLRQ RI WKH DFWLYDWRU HOHPHQW LQWHUDFWHG VSHFLILFDOO\ WR IDFWRUV SUHVHQW LQ WKH VXQIORZHU H[WUDFW %DQG D VHHPHG WR EH D QRQVSHFLILF FRPSOH[ VLQFH LW GLVVDSSHDUHG ZKHQ QJ RI S8& '1$ ZDV DGGHG '1$ELQGLQJ IDFWRUV SUHVHQW LQ DQRWKHU SODQW VSHFLHV VR\EHDQ ZHUH WHVWHG IRU LQWHUDFWLRQ ZLWK WKH DFWLYDWRU HOHPHQW )LJ f $ FUXGH QXFOHDU H[WUDFW IURP VR\EHDQ VHHGOLQJV ZDV LQFXEDWHG ZLWK WKH ES IUDJPHQW ZKLFK FRQWDLQV PRVW RI WKH JHQH DFWLYDWRU HOHPHQW $IWHU VHSDUDWLRQ RQ D DFU\ODPLGH JHO D VLQJOH '1$SURWHLQ FRPSOH[ ZDV VHHQ )LJ ODQH f 7KH LQWHQVLW\ RI WKLV FRPSOH[ ZDV RQO\ VOLJKWO\ UHGXFHG XSRQ DGGLQJ DV PXFK DV IROG H[FHVV RI QRQVSHFLILF '1$ >SRO\ GO G&f '1$@ LQ WKH ELQGLQJ UHDFWLRQ ODQH f +RZHYHU WKLV SURWHLQ'1$ FRPSOH[ ZDV VLJQLILFDQWO\ UHGXFHG ZKHQ RQO\ IROG H[FHVV RI WKH FROG f§• ES IUDJPHQW '1$ ZDV DGGHG ZLWK WKH ODEHOHG IUDJPHQW '1$ IURP S8& ZDV QRW DEOH WR FRPSHWH ZLWK WKH DFWLYDWRU HOHPHQW IRU VSHFLILF ELQGLQJ RI WKHVH QXFOHDU IDFWRUV GDWD QRW VKRZQf 7KHVH UHVXOWV LQGLFDWH WKDW VR\EHDQ DOVR FRQWDLQV IDFWRUV ZKLFK VSHFLILFDOO\ LQWHUDFW ZLWK WKH VDPH SRUWLRQ RI WKH JHQH DFWLYDWRU HOHPHQW WKDW ZDV VKRZQ SUHYLRXVO\ WR LQWHUDFW ZLWK VXQIORZHU QXFOHDU IDFWRUV '1DVH 3URWHFWLRQ $QDO\VLV RI 6R\EHDQ )DFWRU ,QWHUDFWLRQ ZLWK WKH $FWLYDWRU (OHPHQW $ '1DVH SURWHFWLRQ DQDO\VLV ZDV DWWHPSWHG WR GHOLQHDWH PRUH DFFXUDWHO\ UHJLRQV LQYROYHG ZLWK IDFWRUELQGLQJ WR WKH DFWLYDWRU HOHPHQW $ f HQGODEHOHG IUDJPHQW IURP WR ES IURP WKH SURPRWHU ZDV XVHG LQ WKH ELQGLQJ UHDFWLRQ ZLWK FUXGH QXFOHDU H[WUDFWV IURP VR\EHDQ 7KH SURWHLQ'1$ FRPSOH[

PAGE 104

&203 '1$ QJf 32/< GOrG&fSJf 25,*,1 f %281' f +PP! )5(( f )LJXUH (OHFWURSKRUHWLF PRELOLW\ VKLIW DVVD\ RI D • ES IUDJPHQW IURP WKH DFWLYDWRU UHJLRQ XVLQJ VR\EHDQ H[WUDFW 8QIUDFWLRQDWHG QXFOHDU H[WUDFW SJf IURP VR\EHDQ QXFOHL ZDV LQFXEDWHG ZLWK WR QJ RI n HQGODEHOHG '1$ 7KH '1$ XVHG IRU ELQGLQJ ZDV D ES IUDJPHQW WR ESf DQG FRQWDLQHG SDUW RI WKH DFWLYDWRU HOHPHQW RI WKH SURPRWHU +RPRORJRXV FRPSHWLWRU '1$ DQG SRO\ GO G&f '1$ ZDV DGGHG LQ YDU\LQJ DPRXQWV LQ WKH ELQGLQJ UHDFWLRQ DV LQGLFDWHG IRU HDFK ODQH 2ULJLQ UHIHUV WR WKH ZHOOV RI WKH DFU\ODPLGH JHO ERXQG LV WKH SURWHLQ'1$ FRPSOH[ DQG IUHH LV WKH XQERXQG ODEHOHG IUDJPHQW

PAGE 105

ZDV VXEVHTXHQWO\ GLJHVWHG ZLWK OLPLWHG DPRXQWV RI '1DVH DQG WKH ODEHOHG '1$ DQDO\]HG E\ IUDFWLRQDWLRQ RQ D '1$ VHTXHQFLQJ JHO 3URWHFWHG UHJLRQV YHU\ UHGXFHG EDQG LQWHQVLWLHVf RI WKH ODEHOHG '1$ IUDJPHQW ZHUH VHHQ ODQHV DQG )LJ f ZKHQ FRPSDUHG WR '1DVH JHQHUDWHG EDQGV IURP ODEHOHG '1$ WKDW ZDV QRW LQFXEDWHG ZLWK H[WUDFW ODQH )LJ f $GGLWLRQ RI QRQVSHFLILF S8& '1$ LQ WKH ELQGLQJ UHDFWLRQ SULRU WR '1DVH GLJHVWLRQ GLG QRW VLJQLILFDQWO\ FKDQJH WKH EDQGLQJ SDWWHUQ ODQHV DQG )LJ f 7KH SURWHFWHG UHJLRQ RU IRRWSULQW ZDV WKH UHVXOW RI D VSHFLILF LQWHUDFWLRQ RI IDFWRUV LQ WKH H[WUDFW ZLWK WKH '1$ VLQFH SURWHFWLRQ ZDV UHGXFHG E\ WKH DGGLWLRQ RI D IROG H[FHVV RI XQODEHOHG ES IUDJPHQW ODQH )LJ f 7KH SURWHFWHG UHJLRQ HQFRPSDVVHG PRVW RI WKH ES IUDJPHQW ZKLFK GRHV QRW FRLQFLGH ZLWK WKH UHVXOWV RI WKH HOHFWURSKRUHWLF PRELOLW\ VKLIW DVVD\ LQYROYLQJ WKH ES IUDJPHQW SUHVHQWHG LQ )LJ 7KLV GLVFUHSDQF\ PD\ EH GXH WR WKH IDFW WKDW WKH HOHFWURSKRUHWLF PRELOLW\ VKLIW DVVD\ LQYROYHG VXQIORZHU H[WUDFW ZKHUHDV WKLV '1$VH IRRWSULQW ZDV JHQHUDWHG XVLQJ VR\EHDQ H[WUDFW ,QFXEDWLRQ ZLWK WKH VR\EHDQ H[WUDFW DOVR UHVXOWHG LQ VHYHUDO '1DVH K\SHUVHQVLWLYH VLWHV )LJ f§ DUURZVf 7KH LQWHQVLWLHV RI D IHZ RI WKHVH EDQGV ZHUH UHGXFHG XSRQ DGGLWLRQ RI VSHFLILF FRPSHWLWRU '1$ VXJJHVWLQJ WKDW DW OHDVW D SRUWLRQ RI WKHVH VLWHV DUH WKH UHVXOW RI VSHFLILF LQWHUDFWLRQ ZLWK QXFOHDU IDFWRUV &RQFOXVLRQ 7KH DFWLYDWRU UHJLRQ RI WKH JHQH ZDV VKRZQ WR VSHFLILFDOO\ LQWHUDFW LQ YLWUR ZLWK FUXGH QXFOHDU H[WUDFWV IURP WZR SODQW VSHFLHV 7KLV LQWHUDFWLRQ ZDV URXJKO\ PDSSHG E\ WKH HOHFWURSKRUHWLF PRELOLW\ VKLIW DVVD\ DQG

PAGE 106

)LJXUH '1DVH IRRWSULQW DQDO\VLV RQ WKH ES DFWLYDWRU HOHPHQW 7KH ES IUDJPHQW IURP WKH SURPRWHU ZDV n HQGODEHOHG DW WKH eFR5O VLWH DV LQ )LJ 7KLV IUDJPHQW ZDV LQFXEDWHG ZLWK LJ RI FUXGH VR\EHDQ H[WUDFW DQG QJ ; DHOOOGLJHVWHG '1$ DQG GLJHVWHG ZLWK '1DVH DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV XQOHVV RWKHUZLVH LQGLFDWHG 9DU\LQJ DPRXQWV RI KRPRORJRXV DQG QRQKRPRORJRXV '1$ ZDV DGGHG WR WKH LQFXEDWLRQ SULRU WR WKH '1DVH GLJHVWLRQ DOVR DV LQGLFDWHG /DQH QR H[WUDFW ODQHV DQG DGGLQJ DQG QJ RI WKH ES +SD ,, IUDJPHQW IURP S8& '1$ UHVSHFWLYHO\ ODQHV DQG QRWKLQJ DGGHG ODQHV DQG DGGLQJ DQG QJ RI XQODEHOHG ES IUDJPHQW UHVSHFWLYHO\ 3 UHIHUV WR SURWHFWHG UHJLRQV RSHQ ER[HVf ZKHUHDV ( UHIHUV WR WKH K\SHUVHQVLWLYH EDQGV DUURZVf D E F DQG G LQGLFDWH WKH ORFDWLRQV RI WKH VKRUW UHSHDWV IRXQG LQ WKH SURPRWHU 7KH RSHQ VWDU GHQRWHV WKH n HQGODEHO DW ES VLWH 6L]H PDUNHUV ZHUH GHWHUPLQHG E\ D S%5 +SD,, GLJHVWLRQ QRW VKRZQf 1XPEHUV DW WKH ULJKW LQGLFDWH ORFDWLRQV RI WKH '1DVH ,JHQHUDWHG EDQGV UHODWLYH WR WKH VWDUW RI WUDQVFULSWLRQ RI WKH JHQH

PAGE 107

A r

PAGE 108

H[DPLQHG LQ PRUH GHWDLO E\ WKH '1DVH SURWHFWLRQ DQDO\VLV 7KH VSHFLILFLW\ RI WKH SURWHLQ'1$ FRPSOH[HV ZDV GHPRQVWUDWHG E\ WKH SUHVHQFH RI EDQGV ZLWK UHGXFHG PRELOLWLHV WKDW FRXOG EH UHGXFHG E\ WKH DGGLWLRQ RI KRPRORJRXV '1$ EXW QRW ZLWK QRQVSHFLILF '1$ )DFWRUV IURP ERWK VXQIORZHU DQG VR\EHDQ ZHUH DEOH WR VSHFLILFDOO\ ELQG WR WKLV '1$ HOHPHQW VXJJHVWLQJ D FRQVHUYDWLRQ RI IDFWRUV SUHVHQW LQ WKHVH WZR VSHFLHV RI SODQWV $OWKRXJK GXH WR D OLPLWHG QXPEHU RI REVHUYDWLRQV WKH JHQH KDV RQO\ EHHQ VKRZQ WR EH WUDQVFULEHG LQ VXQIORZHU DQG WREDFFR WLVVXHV f WKLV JHQH SUREDEO\ IXQFWLRQV LQ RWKHU SODQWV DV ZHOO VLQFH WKH RWKHU 7'1$ JHQHV FDQ EH H[SUHVVHG LQ D ZLGH YDULHW\ RI KRVWV 7KH HOHFWURSKRUHWLF PRELOLW\ VKLIW DVVD\ XVLQJ WKH VXQIORZHU H[WUDFW UHVXOWHG LQ D FRPSOLFDWHG SDWWHUQ RI PXOWLSOH EDQGV )LJ f 7KH SUHVHQFH RI VXFK PXOWLSOH EDQGV PD\ LQGLFDWH PXOWLSOH IDFWRU ELQGLQJ VLWHV LQ ZKLFK VRPH RI WKH LQWHUDFWLRQV DUH VSHFLILF ZKLOH RWKHUV DUH QRQVSHFLILF 2WKHUV KDYH UHSRUWHG VLPLODU SDWWHUQV RI SURWHLQ'1$ FRPSOH[HV LQ DQLPDO V\VWHPV f )DFWRU ELQGLQJ WR WKH LPPXQRJOREXOLQ .FKDLQ HQKDQFHU VHTXHQFHV UHVXOWV LQ D KHWHURJHQHLW\ RI ELQGLQJ SDWWHUQV GHSHQGLQJ RQ WKH WLVVXHOLQH XVHG IRU PDNLQJ WKH QXFOHDU H[WUDFWV f $ UHJLRQ RI WKH PRXVH FIRV JHQH SURPRWHU DOVR UHVXOWV LQ PXOWLSOH EDQGLQJ SDWWHUQV ZKHQ FRPSOH[HG ZLWK QXFOHDU IDFWRUV ,Q VRPH FDVHV WKH DGGLWLRQDO FRPSOH[HV FRXOG QRW EH HOLPLQDWHG ZLWK D ODUJH H[FHVV RI KRPRORJRXV RU QRQKRPRORJRXV '1$ f VXJJHVWLQJ WKDW FHUWDLQ W\SHV RI FRPSOH[HV PD\ KDYH GLVFUHWH JHO PRELOLWLHV EXW DUH WKH UHVXOW RI VRPH LUUHYHUVLEOH LQWHUDFWLRQV 7KHUH DUH PDQ\ SRVVLELOLWLHV WKDW PLJKW FDXVH D PXOWLSOH EDQGLQJ SDWWHUQ VXFK DV WKH H[LVWHQFH RI GLIIHUHQW '1$ELQGLQJ SURWHLQV LQ WKH VDPH H[WUDFW RU WKH ELQGLQJ IDFWRU PD\ EH SUHVHQW LQ PXOWLPHULF IRUPV ELQGLQJ WR PRUH WKDQ RQH VLWH

PAGE 109

1RQVSHFLILF ELQGLQJ RI KLVWRQHV RU VLPLODU SURWHLQV DOO DORQJ WKH OHQJWK RI WKH '1$ IUDJPHQW PD\ DOVR FDXVH VXFK SDWWHUQV ,Q FRQWUDVW WR WKH FRPSOH[ EDQGLQJ SDWWHUQ VHHQ XVLQJ VXQIORZHU H[WUDFWV ELQGLQJ RI WKH VR\EHDQ QXFOHDU H[WUDFW WR D SRUWLRQ RI WKH DFWLYDWRU HOHPHQW WR ESf UHVXOWHG LQ D VLQJOH IDFWRU'1$ FRPSOH[ 7KLV FRPSOH[ ZDV VSHFLILF LQ QDWXUH VLQFH LW FRXOG EH FRPSHWHG DJDLQVW ZLWK KRPRORJRXV '1$ EXW QRW ZLWK QRQKRPRORJRXV '1$ ,W LV SRVVLEOH WKH VXQIORZHU H[WUDFW PD\ KDYH FRQWDLQHG VHYHUDO GLIIHUHQW IDFWRUV UHVXOWLQJ LQ PXOWLSOH EDQGV ZKHUHDV WKH VR\EHDQ H[WUDFW FRQWDLQHG D VLQJOH IDFWRU SURGXFLQJ D VLQJOH EDQG ZKHQ ERXQG +RZHYHU WKH SUHVHQFH RI D VLQJOH SURWHLQ'1$ FRPSOH[ ZKLOH XVLQJ WKH HOHFWURSKRUHWLF PRELOLW\ VKLIW DVVD\ PD\ VWLOO EH D UHVXOW RI PXOWHUPHULF ELQGLQJ VLWHV E\ D SDUWLFXODU IDFWRU DV LQ WKH FDVH RI WKH LPPXQRJOREXOLQ KHDY\ FKDLQ HQKDQFHU '1$ f $ IUDJPHQW FRQWDLQLQJ VHTXHQFHV RI WKLV HQKDQFHU FRXOG IRUP D VLQJOH EDQG ZKHQ LQFXEDWHG ZLWK QXFOHDU H[WUDFWV IURP +H/D DQG KXPDQ % O\PSKRPD (: WLVVXHOLQH DOWKRXJK DVVD\V LQYROYLQJ SURWHFWLRQ IURP '1DVH RU PHWK\ODWLRQ GHPRQVWUDWHG WKDW WKH KHDY\ FKDLQ HQKDQFHU LQWHUDFWHG ZLWK D IDFWRUVf DW PXOWLSOH VLWHV 0XOWLSOH ELQGLQJ DOVR VHHPV WR EH WKH FDVH ZKHQ WKH '1DVH SURWHFWLRQ DQDO\VLV ZDV GRQH ZLWK WKH DFWLYDWRU HOHPHQW LQFXEDWHG ZLWK H[WUDFW IURP VR\EHDQ 7KH '1DVH SURWHFWLRQ DQDO\VLV GHOLQHDWHG VR\EHDQ IDFWRU ELQGLQJ VLWHV ZLWKLQ WKH DFWLYDWRU UHJLRQ UDQJLQJ LQ VL]H IURP D IHZ QXFOHRWLGHV WR DSSUR[LPDWHO\ ES )DFWRU ELQGLQJ WR PRVW RI WKHVH UHJLRQV ZDV VSHFLILF VLQFH RQO\ KRPRORJRXV '1$ ES IUDJPHQW RI WKH SURPRWHUf VXFFHVVIXOO\ FRPSHWHG IRU WKH ELQGLQJ VLWHV 7KH SUHVHQFH RI FORVHO\ VSDFHG PXOWLSOH ELQGLQJ VLWHV ZHUH VHHQ LQ WKH DFWLYDWRU HOHPHQW ZKLFK FDQ DOVR EH IRXQG LQ WKH '1DVH SURWHFWLRQ DQDO\VLV RI WKH 69 SURPRWHU DQG WKH LPPXQRJOREXOLQ KHDY\ FKDLQ HQKDQFHU f ,Q WKH 69 SURPRWHU

PAGE 110

DSSUR[LPDWHO\ RU FORVHO\ VSDFHG VLWHV RI '1DVH SURWHFWLRQ H[LVW RYHU D UHJLRQ RI ES ZKLFK LQFOXGHV WKH 7$7$ ER[ WKH ES UHSHDWV DQG WKH ES HQKDQFHU UHSHDW f ,Q DGGLWLRQ ILYH VLWHV UDQJLQJ LQ VL]HV IURP WR ES LQ WKH LPPXQRJOREXOLQ KHDY\ FKDLQ HQKDQFHU UHJLRQ DUH HYLGHQW ZKHQ SURWHFWHG E\ IDFWRUV SUHVHQW LQ +H/D RU %-$% QXFOHDU H[WUDFWV IURP '1DVH GLJHVWLRQ f 7KHVH UHVXOWV IURP PDPPDOLDQ VWXGLHV VHHPV WR EH VLPLODU WR WKH ELQGLQJ SDWWHUQ RI WKH DFWLYDWRU HOHPHQW WR IDFWRUV IURP VR\EHDQ H[WUDFWV 6RPH '1DVH JHQHUDWHG EDQGV ZHUH JUHDWO\ HQKDQFHG ZKHQ IDFWRUV SUHVHQW LQ WKH VR\EHDQ H[WUDFW ZHUH ERXQG WR WKH DFWLYDWRU HOHPHQW 7KH LQWHQVLWLHV RI PRVW RI WKHVH '1DVH K\SHUVHQVLWLYH VLWHV ZHUH UHGXFHG ZKHQ XQODEHOHG KRPRORJRXV '1$ ZDV DGGHG WR WKH ELQGLQJ UHDFWLRQ ZKHUHDV WKH VDPH VLWHV GLG QRW FKDQJH XSRQ DGGLQJ QRQKRPRORJRXV '1$ (QKDQFHPHQW RI '1DVH JHQHUDWHG EDQGV GXH WR LQFUHDVHG VHQVLWLYLW\ WR '1DVH DUH DOVR VHHQ LQ WKH IRRWSULQW DQDO\VLV RI WKH 69 SURPRWHU f 6RPH RI WKHVH EDQGV DUH DOVR UHGXFHG XSRQ DGGLQJ VSHFLILF 69 '1$ LQ WKH ELQGLQJ UHDFWLRQ ZKLOH RWKHUV DUH XQDIIHFWHG 7KHVH K\SHUVHQVLWLYH EDQGV DUH WKRXJKW EH D UHVXOW RI WKH '1$ELQGLQJ IDFWRUV LQWHUDFWLQJ ZLWK WKHLU VSHFLILF VLWHV DQG DOWHULQJ FRQIRUPDWLRQV RI QHLJKERULQJ VHTXHQFHV ZKLFK PDNHV WKHP PRUH VXVFHSWLEOH WR '1DVH GLJHVWLRQ $QRWKHU SRVVLEOH FDXVH PD\ LQYROYH WKH ERXQG QXFOHDU IDFWRU EORFNLQJ WKH '1DVH HQ]\PH DQG FDXVLQJ WKH HQ]\PH WR VHOHFWLYHO\ GLJHVW DW H[SRVHG VLWHV DW WKH ERXQGDULHV RI WKH SURWHLQ'1$ FRPSOH[HV 7KH ODWWHU SRVVLELOLW\ VHHPV WR EH WKH FDVH IRU WKH VR\EHDQ IDFWRUV ELQGLQJ WR WKH DFWLYDWRU HOHPHQW VLQFH PDQ\ RI WKHVH HQKDQFHG EDQGV DSSHDU EHWZHHQ SURWHFWHG DUHDV OHDYLQJ RQO\ VKRUW VWUHWFKHV RI '1$ H[SRVHG IRU GLJHVWLRQ 6RPH RI WKH SURWHFWHG UHJLRQV RI WKH DFWLYDWRU HOHPHQW LQFOXGH WKH VKRUW UHSHDWV IRXQG LQ WKH SURPRWHU VHH )LJ f 7KH PRVW GLVWDO D DQG F UHSHDWV UHVLGH LQ WZR RI WKHVH DUHDV 7KH VHFRQG F UHSHDW FHQWHUHG DW SRVLWLRQ

PAGE 111

ES VHHPV DOVR WR EH SURWHFWHG IURP '1DVH GLJHVWLRQ 6LQFH WKH n GHOHWLRQ WR ES GLG QRW VLJQLILFDQWO\ DIIHFW WUDQVFULSWLRQ RI WKH JHQH WKH SURWHFWHG UHJLRQV EHWZHHQ f§ WR f§ ES PD\ QRW EH DV LPSRUWDQW WR SURPRWHU DFWLYLW\ DV UHJLRQV FORVHU WR WKHVH UHSHDW PRWLIV 5HPRYDO RI WKH n IODQNLQJ UHJLRQ WR SRVLWLRQ ES UHGXFHG WKH OHYHO RI WUDQVFULSWLRQ WR b VHH )LJ f WKHUHIRUH WKH SURWHFWHG UHJLRQV EHWZHHQ DQG ES XQGRXEWHGO\ FRQWULEXWH WR WKH IXQFWLRQ RI WKH DFWLYDWRU LQ SURPRWLQJ WUDQVFULSWLRQ 'HOHWLRQ RI WKH UHPDLQGHU RI WKH DFWLYDWRU HOHPHQW YLUWXDOO\ HOLPLQDWHG WUDQVFULSWLRQ WR EDUHO\ GHWHFWDEOH OHYHOV LQGLFDWLQJ WKDW WKH SURWHFWHG UHJLRQV EHWZHHQ WR ES DOVR ZHUH UHTXLUHG IRU QRUPDO IXQFWLRQ RI WKLV HOHPHQW ,W LV HYLGHQW WKDW WKH DFWLYDWRU UHJLRQ RI WKH JHQH VSHFLILFDOO\ LQWHUDFWV ZLWK IDFWRUV SUHVHQW LQ FUXGH QXFOHDU H[WUDFWV IURP KLJKHU SODQWV 6LQFH WKH DFWLYDWRU ZDV SUHYLRXVO\ VKRZQ WR EH UHTXLUHG IRU WKH JHQH WUDQVFULSWLRQ DQG FRXOG IXQFWLRQ XSVWUHDP LQGHSHQGHQW RI SRVLWLRQ RU SRODULW\ WKH SURWHFWHG VLWHV PD\ EH FDXVHG E\ WKH ELQGLQJ RI VDPH IDFWRUV UHTXLUHG IRU DFWLYDWRU IXQFWLRQ LQ YLYR 7KLV TXHVWLRQ FDQ QRW EH GLUHFWO\ DGGUHVVHG XQWLO D UHOLDEOH SODQW LQ YLWUR WUDQVFULSWLRQ V\VWHP KDV EHHQ GHYHORSHG WKDW ZLOO DOORZ UHFRQVWLWXWLRQ RI SXULILHG RU SDUWLDOO\ SXULILHG QXFOHDU IDFWRUV WR DFWLYDWH IDLWKIXO WUDQVFULSWLRQ DW OHYHOV UHIOHFWLQJ LQ YLYR V\VWHPV

PAGE 112

&+$37(5 6800$5< 3URPRWHU GRPDLQV RI WKH JHQH ZHUH H[DPLQHG E\ WKH 6, QXFOHDVH PDSSLQJ XVLQJ D GRXEOH JHQH VKXWWOH YHFWRU V\VWHP GHYHORSHG IRU WKLV VWXG\ 7KH YHFWRU V\VWHP LQFRUSRUDWHG D FRS\ RI WKH WHVW DQG UHIHUHQFH JHQH SURYLGLQJ DQ LQWHUQDO VWDQGDUG IRU SUHFLVH DVVHVVPHQW RI HDFK PXWDWLRQ LQWURGXFHG LQWR WKH WHVW JHQH SURPRWHU 7KH GRXEOH JHQH VKXWWOH YHFWRU V\VWHP KDV SURYLGHG D PHDQV RI TXDQWLI\LQJ OHYHOV RI WUDQVFULSWLRQ UHSURGXFLEO\ DQG FRXOG EH DSSOLHG WR RWKHU SODQW JHQHV DV ZHOO 7KLV YHFWRU V\VWHP KDV VHYHUDO DGYDQWDJHV RYHU RWKHU JHQH H[SUHVVLRQ V\VWHPV IRU VWXG\LQJ QRQWLVVXHVSHFLILF FRQVWLWXWLYHO\ H[SUHVVHG SODQW JHQHV 2QH DGYDQWDJH LV WKDW WUDQVFULSW OHYHOV FDQ EH GHWHUPLQHG GLUHFWO\ UDWKHU WKDQ GHSHQG RQ HQ]\PH IXQFWLRQ WR TXDQWLWDWH H[SUHVVLRQ OHYHOV 6HFRQGO\ JHQH FRS\ QXPEHU GLVFUHSDQFLHV EHWZHHQ WKH WHVW DQG UHIHUHQFH JHQH FDQ EH DYRLGHG VLQFH RQH FRS\ RI HDFK LV SUHVHQW RQ WKH VDPH '1$ LQWURGXFHG LQWR WKH SODQWV 7KLUGO\ XVLQJ D KRPRORJRXV UHIHUHQFH JHQH DV DQ LQWHUQDO VWDQGDUG YLUWXDOO\ HOLPLQDWHV WKH SRVVLELOLW\ RI GLIIHUHQWLDO H[SUHVVLRQ EHWZHHQ KHWHURORJRXV SURPRWHUV WKDW PD\ RFFXU GXH WR YDULDEOH JURZWK FRQGLWLRQV EHWZHHQ JURXSV RI SRROHG WXPRUV )LQDOO\ WKLV $ WXPHIDFLHQV EDVHG V\VWHP UHVXOWV LQ D ORZ FRS\ QXPEHU SHU JHQRPHf DQG LQVHUWLRQ LQWR WKH SODQW JHQRPH IDFLOLWDWHV SRROLQJ RI ODUJH SRSXODWLRQV RI VHSDUDWH SODQW WUDQVIRUPDWLRQ HYHQWV 7KH QXPEHU RI WXPRUV SRROHG ZDV VXIILFLHQW WR PLQLPL]H YDULDELOLW\ EHWZHHQ

PAGE 113

LQGLYLGXDO WXPRUV VLQFH PXWDQW SURPRWHU DFWLYLW\ EHWZHHQ LQGHSHQGHQW H[SHULPHQWV YDULHG b RU OHVV %DVHG RQ WKH 6, QXFOHDVH PDSSLQJ DQDO\VLV WZR VWDUW VLWHV RI WUDQVFULSWLRQ ZHUH IRXQG LQ WKH JHQH SURPRWHU 7KHVH VWDUW VLWHV DUH SRVLWLRQHG DSSUR[LPDWHO\ ES GRZQVWUHDP IURP WKHLU UHVSHFWLYH 7$7$ ER[HV 7KH JHQH WKHUHIRUH FRQWDLQV WZR RYHUODSSLQJ SURPRWHUV WKH PLQRU SURPRWHU EHLQJ PXFK OHVV DFWLYH WKDQ WKH PDMRU SURPRWHU 'XDO WUDQVFULSWLRQDO LQLWLDWLRQ VLWHV H[LVW LQ RWKHU SODQW DQG DQLPDO JHQHV VXFK DV WKH PRXVH WK\PLGLODWH V\QWKDVH f RYDOEXPLQ f 'URVRSKLOD $GK f VR\EHDQ QRGXOLQ DQG VR\EHDQ OHJKHPRJORELQ JHQHV f $OWHUQDWH VWDUW VLWHV DUH XVXDOO\ GLIIHUHQWLDOO\ XWLOL]HG DV D PHFKDQLVP IRU GHYHORSPHQWDO RU WLVVXHVSHFLILF FRQWURO )RU H[DPSOH WKH PRXVH D MDP\ODVH JHQH KDV WZR VWDUW VLWHV RQH LV XWLOL]HG LQ WKH VDOLYDU\ JODQGV ZKLOH WKH RWKHU LQLWLDWHV LQ OLYHU FHOOV f ,Q DQRWKHU H[DPSOH WKH WZR LQLWLDWLRQ VLWHV RI WKH 'URVRSKLOD $GK JHQH DUH GLIIHUHQWLDOO\ UHJXODWHG GXULQJ GHYHORSPHQW DQG PD\ SRVVLEO\ LQYROYH D VSHFLILF QXFOHDU IDFWRU f $OWKRXJK QR HYLGHQFH H[LVWV IRU GLIIHUHQWLDO H[SUHVVLRQ RI WKH JHQH WKH WZR VWDUW VLWHV FRXOG EH GLIIHUHQWLDOO\ XVHG GHSHQGLQJ RQ WKH WLVVXH RU KRVW SODQW 7KUHH IXQFWLRQDO GRPDLQV LQ WKH SURPRWHU RI WKH JHQH ZHUH LGHQWLILHG DQG DUH SUHVHQWHG LQ )LJ 7KH VFKHPDWLF SUHVHQWV WKH n IODQNLQJ UHJLRQ DV WZR RYHUODSSLQJ SURPRWHUV FRUUHVSRQGLQJ WR WKH PDMRU DQG PLQRU SURPRWHU %RWK SURPRWHUV KDYH EHHQ VXEGLYLGHG LQWR WKUHH PDMRU JURXSV WKH DFWLYDWRU XSVWUHDP HOHPHQW DQG 7$7$ ER[ EDVHG RQ VHTXHQFH DQG IXQFWLRQ DV GHWHUPLQHG E\ WKLV VWXG\ 7KH PRVW FRPPRQ HOHPHQW WKH 7$7$ ER[ ZDV VKRZQ WR EH HVVHQWLDO IRU WUDQVFULSWLRQ RI WKH JHQH VLQFH UHPRYDO RI WKH 7$7$ ER[ GUDVWLFDOO\ UHGXFHG WUDQVFULSWLRQ :KHQ WKH FDS VLWH RI WKH PLQRU SURPRWHU ZDV GHOHWHG WKH VWDUW RI WUDQVFULSWLRQ ZDV VWLOO SRVLWLRQHG

PAGE 114

f§P $&7,9$725 n &$$7 7$7$ f§ 0LQRU 0DMRU )LJXUH 6FKHPDWLF RI WKH PDMRU DQG PLQRU SURPRWHU RI WKH JHQH 7KH WULDQJOHV UHSUHVHQW WKH 7$7$ ER[HV ZKLOH WKH VPDOO ER[HV GHQRWH SRVLWLRQV RI WKH &$$7 ER[HV 7KH n ERXQGDU\ RI WKH XSVWUHDP HOHPHQW ORQJURXQGHG ER[f LV QRW ZHOO GHILQHG 7KH DUURZ UHSUHVHQWV WKH DFWLYDWRU HOHPHQW

PAGE 115

DSSUR[LPDWHO\ ES GRZQVWUHDP RI WKH 7$7$ ER[ ORFDWLRQ GHPRQVWUDWLQJ WKH UROH RI 7$7$ LQ SRVLWLRQLQJ WUDQVFULSWLRQDO LQLWLDWLRQV %DVHG RQ LQWHUQDO GHOHWLRQV WKH XSVWUHDP HOHPHQW ZDV VKRZQ WR EH UHTXLUHG XQGHU FHUWDLQ FRQGLWLRQV VLQFH VPDOO GLVUXSWLRQV DGYHUVHO\ DIIHFWHG WUDQVFULSWLRQDO DFWLYLW\
PAGE 116

PHFKDQLVP RI DFWLYDWRU IXQFWLRQ PD\ LQYROYH ORRSLQJ RXW WKH LQWHUYHQLQJ '1$ 7KLV W\SH RI PHFKDQLVP KDV EHHQ SRVWXODWHG LQ WKH FDVH RI WKH ; UHSUHVVRU ERXQG WR WKH RSHUDWHU VLWHV $SSUR[LPDWHO\ WR ES FDQ EH LQVHUWHG LQ EHWZHHQ WKH WZR DGMDFHQW RSHUDWRU VLWHV LQ WKH O\WLF SURPRWHU RI ; f :LWK D UHSUHVVRU GLPHU ELQGLQJ WR HDFK VLWH WKH UHSUHVVRUV VWLOO FDQ LQWHUDFW ZKLFK HDFK RWKHU E\ EHQGLQJ WKH '1$ LQ EHWZHHQ 0DQ\ PRUH H[SHULPHQWV FRXOG IROORZ WKLV VWXG\ LQ H[DPLQLQJ WKH WUDQVFULSWLRQDO FRQWURO RI WKH JHQH 3UREDEO\ WKH PRVW XVHIXO H[SHULPHQWDO DSSURDFK LQ SURYLGLQJ DFFXUDWH LQIRUPDWLRQ RQ WKH SURPRWHU VXEVWUXFWXUH ZRXOG UHO\ RQ OLQNHUVFDQ PXWDWLRQV 7KLV DSSURDFK UHSODFHV VKRUW VHTXHQFHV LQ WKH SURPRWHU ZLWK OLQNHU '1$ ZLWKRXW DOWHULQJ VSDFLQJ $ ODUJH QXPEHU RI OLQNHUVFDQ PXWDWLRQV ZRXOG DFFXUDWHO\ GHOLQHDWH WKH ERXQGDULHV RI LQWHUQDO GRPDLQV SUHVHQW LQ WKH SURPRWHU )ROORZLQJ VXFK DQ DQDO\VLV WKH TXHVWLRQV RI VSDFLQJ DQG KHOLFDO DOLJQPHQW RI GLVWLQFW SURPRWHU GRPDLQV FRXOG WKHQ EH DGGUHVVHG PRUH FDUHIXOO\ %\ DGGLQJ RU GHOHWLQJ VHTXHQFHV EHWZHHQ SURPRWHU HOHPHQWV PRUH LQIRUPDWLRQ FRXOG EH JDLQHG FRQFHUQLQJ WKH PHFKLQLVP RI WUDQVFULSWLRQDO IDFWRUV LQWHUDFWLQJ ZLWK HDFK RWKHU 6XFK DQ DQDO\VLV ZDV SUHYLRXVO\ PDGH RQ WKH 69 SURPRWHU E\ 7DNDKDVKL HW DO f LQ ZKLFK WKH\ LQWURGXFHG OLQNHU '1$ LQ YDULRXV VL]HV EHWZHHQ WKH 7$7$ XSVWUHDP HOHPHQW DQG WKH HQKDQFHU HOHPHQW 7KH\ IRXQG WKDW WKH HOHPHQWV RI WKH 69 SURPRWHU UHTXLUH D VWULQJHQW DOLJQPHQW WR HIILFLHQWO\ DFWLYDWH WUDQVFULSWLRQ ,Q DGGLWLRQ WKH DFWLYDWRU HOHPHQW FRXOG EH H[DPLQHG PRUH FORVHO\ E\ SRLQW PXWDWLRQV ZLWKLQ WKH WR ES VHTXHQFH GHWHUPLQLQJ LI SDUWLFXODU VHTXHQFHV DUH HVVHQWLDO IRU DFWLYDWRU IXQFWLRQ 6LWHGLUHFWHG PXWDJHQHVLV RI WKH VKRUW UHSHDW VHTXHQFHV SUHVHQW LQ WKLV HOHPHQW RU RI RWKHU UHJLRQV FDQ FRQFOXVLYHO\ HVWDEOLVK IXQFWLRQDO UROHV IRU VXFK VHTXHQFHV 7KH DELOLW\ RI WKH DFWLYDWRU HOHPHQW WR IXQFWLRQ RQ KHWHURORJRXV SURPRWHUV FRXOG DOVR EH

PAGE 117

H[DPLQHG 7KLV DQDO\VLV ZRXOG GHWHUPLQH LI WKH DFWLYDWRU DFWV DV D JHQHUDOL]HG SURPRWHU HOHPHQW RU FDQ RQO\ SURPRWH DFWLYLW\ H[FOXVLYHO\ ZLWK WKH SURPRWHU 7KH IXQFWLRQDO GRPDLQV RI 7'1$ SURPRWHUV SUREDEO\ FRQVLVW RI KLJKO\ FRQVHUYHG WUDQVFULSWLRQDO FRQWURO HOHPHQWV 6LQFH WKH 7'1$ SURPRWHUV KDYH D KLJK GHJUHH RI FRQVHUYDWLRQ LQ SURPRWHU IXQFWLRQ WKHVH SURPRWHUV PD\ VHUYH DV PRGHOV IRU WKH VWUXFWXUH RI FRQVWLWXWLYH SURPRWHUV LQ SODQWV 'XH WR WKH IDFW WKDW $JUREDFWHULXP KDV VXFK D EURDG KRVW UDQJH WKH SURPRWHUV RI 7'1$ JHQHV DUH VHOHFWHG DQG PDLQWDLQHG IRU IXQFWLRQLQJ LQ D ZLGH YDULHW\ RI SODQWV $OWKRXJK WKHVH SURPRWHUV PD\ RULJLQDWH RQ D EDFWHULDO SODVPLG VXFK D VHOHFWLRQ SUHVVXUH ZRXOG IDYRU DGDSWLRQ RI WKH PRVW KLJKO\ FRQVHUYHG DQG QRQVSHFLDOL]HG DVSHFWV RI SODQW SURPRWHU VWUXFWXUH DQG IXQFWLRQ 7KH 7'1$ JHQHV LQFOXGLQJ WKH JHQH FRXOG WKXV SURYLGH IXQGDPHQWDO LQIRUPDWLRQ FRQFHUQLQJ SODQW WUDQVFULSWLRQDO UHJXODWLRQ DQG HVWDEOLVK EDVLF IRXQGDWLRQV IRU IXWXUH FRQVWUXFWLRQV RI RWKHU SODQW JHQHV

PAGE 118

5()(5(1&(6 $GK\D 6 DQG 0 *RWWHVPDQ &HOO $Q 3 5 (EHUW % <
PAGE 119

&RUGHQ % :DV\O\N $ %XFKZDOGHU 3 6DVVRQH&RUVL & .GLQJHU DQG 3 &KDPEQ 6FLHQFH &XUULHU 7 & DQG ( : 1HVWHU %DFWHULRO &]DUQHFND ( / (GHOPDQ ) 6FKIIO DQG / .H\ 3ODQW 0RO %LRO &]DUQHFND ( : % *XUOH\ 5 7 1DJDR / $ 0RVTXHUD DQG / .H\ 3URF 1DWO $FDG 6FL 86$ 'DYLGVRQ % 0 (JO\ ( 5 0XOYLKLOO DQG 3 &KDPEQ 1DWXUH /RQGRQf 'H&OHHQH 0 DQG 'H/H\ %RW 5HY 'HQJ 7 / 'DZHL &+ -HQK DQG / ) -RKQVRQ %LRO &KHP GH 9LOOLHUV : 6FKDIIQHU & 7\QGDOO 6 /XSWRQ DQG 5 .DPHQ 1DWXUH /RQGRQf GH 9LOOLHUV DQG : 6FKDIIQHU 1XF $FLGV 5HV 'LHUNV 3 $ YDQ 2R\HQ 0 &RFKUDQ & 'RENLQ 5HLVHU DQG & :HLVVPDQQ &HOO 'LWWD 6 6WDQILHOG &RUELQ DQG 5 +HOLQVNL 3URF 1DWL $FDG 6FL 86$ 'XGOH\ 5 DQG $ $ 7UDYHUV &HOO '\QDQ : 6 6 6D]HU 5 7MLDQ DQG 5 6FKLPNH 1DWXUH /RQGRQf '\QDQ : 6 DQG 5 7MLDQ &HOO '\QDQ : 6 DQG 5 7MLDQ 1DWXUH /RQGRQf (IVWUDWLDGLV $ : 3RVDNRQ\ 7 0DQLDWLV 5 0 /DZQ & 2n&RQQHOO 5 $ 6SULW] 5LHO % GH )RUJHW 6 : :HLVVPDQQ / 6OLJKWRP $ ( %OHFKO 2 6PLWKLHV ) ( %DUDOOH & & 6KRXOGHUV DQG 1 3URXGIRRW &HOO (OOLV 0 5\GHU DQG 0 7DWH 0RO *HQ *HQHW (SKUXVVL $ 0 &KXUFK 6 7RQHJDZD DQG : *LOEHUW 6FLHQFH (SVWHLQ : DQG 5 %HFNZLWK $QQ 5HY %LRFKHP )DUQKDP 3 DQG 5 7 6FKLPNH 0RO &HOO %LRO

PAGE 120

)HUO 5 0RO *HQ *HQHW )LUDN 7 DQG 1 6XEUDPDQLDQ 0RO &HOO %LRO )OXKU 5 & .XKOHPHLHU ) 1DJ\ DQG 1+ &KXD 6FLHQFH )UDOH\ 5 7 6 5RJHUV 5 % +RUVFK 3 6DQGHUV )OLFN 6 $GDPV 0 / %LWWQHU / )LQN 6 )U\ 5 *DOOXSSL 6 % *ROGEHUJ 1 / +RIIPDQQ DQG 6 & :RR 3URF 1DWO $FDG 6FL 86$ )UHQFK 5 0 -DQGD DQG 3 $KOTXLVW 6FLHQFH )URPP 0 DQG 3 %HUJ 0RO $SSO *HQHW )XMLWD 7 6 2KQR +
PAGE 121

+RFKVFKLOG $ + 1 ,UZLQ DQG 0 3WDVKQH &HOO +RFKVFKLOG $ +f DQG 0 3WDVKQH &HOO +RR\NDDVYDQ 6ORJWHUHQ 0 6 3 +RR\NDDV DQG 5 $ 6FKLOSHURRUW 1DWXUH /RQGRQf +RUVFK 5 )U\ 1 +RIIPDQQ 1 (LFKKROW] 6 5RJHUV DQG 5 )UDOH\ 6FLHQFH +URPDV 5 DQG % 9 1HVV 1XFO $FLGV 5HV +XWFKLVRQ & $ 6 3KLOOLSV 0 + (GJHOO 6 *LOODP 3 -DKQNH DQG 0 6PLWK %LRO &KHP -DFNVRQ 0 DQG ,QJOH 3ODQW 3K\VLRO -HQVHQ 6 $ 0DUFNHU / 2WWHQ DQG 6FKHOO 1DWXUH /RQGRQf -RQHV $ DQG 5 7MLDQ 1DWXUH /RQGRQf -RQHV $
PAGE 122

.ULHJOHU 0 DQG 0 %RWFKDQ 0RO &HOO %LRO /DLPLQV / $ .KRXU\ & *RUPDQ % +RZDUG DQG 3 *UDVV 3URF 1DWO $FDG 6FL 86$ /DPSSD .f 0RUHOOL DQG 1+ &KXD 0RO &HOO %LRO /DUVHQ DQG % 8 -RFKLPVHQ (0%2 /DZUHQFH & : ) 6KHUPDQ 0 -DFNVRQ DQG 5 *LOPRUH *HQHWLFV /HQWZLOHU / ( 0 0H\HURZLW] DQG ( 0 7RELQ 1XFO $FLGV 5HV /HZLV 0 DQG 5 5 %XUJHVV (XFDU\RWLF 51$ SRO\PHUDVHV ,Q 7KH (Q]\PHV UG HG YRO % 3 %R\HU HG $FDGHPLF 3UHVV 1HZ
PAGE 123

0HOWRQ :f & 0F(ZDQ $ % 0F.LH DQG $ 0 5HLG &HOO 0HUFOD 0 *RYHUPDQ & 0LUHOO DQG &DDPH 6FLHQFH 0HUOR 5 1XWWHU $ 0RQWR\D *DUILQNHO 0 'UXPPRQG 0' &KLOWRQ 0 *RUGRQ DQG ( 1HVWHU 0RO *HQ *HQHW 0LOOHU + ([SHULPHQWV ,Q 0ROHFXODU *HQHWLFV &ROG 6SULQJ +DUERU /DERUDWRU\ &ROG 6SULQJ +DUERU 1
PAGE 124

5H\QROGV $ 6 %DVX 7 6 2VERUQH &KLQ *LO 0 6 %URZQ / *ROGVWHLQ DQG / /XVNH\ &HOO 5LFKDUGV 5 $ +HJX\ DQG 0 .DULQ &HOO 5RFKHVWHU :LQWHU DQG 0 6KDK (0%2 5RWKVWHLQ 6 5 $ -RUJHQVHQ 3RVWOH DQG : 6 5H]QLNRII &HOO 6DORPRQ ) 5 'HEODHUH /HHPDQV +HUQDOVWHHQV 0 9DQ 0RQWDJXH DQG 6FKHOO (0%2 6DQJHU ) 0 $LU % %DUUHOO 1 / %URZQ $ 5 &RXOVRQ & )LGGHV & $ +XWFKLQVRQ 3 0 6ORFRPEH DQG 0 6PLWK 1DWXUH /RQGRQf 6DQJHU ) $ 5 &RXOVRQ % %DUUHOO $ + 6PLWK DQG % $ 5RH 0RO %LRO 6DVVRQH&RUVL 3 &RUGHQ & .GLQJHU DQG 3 &KDPEQ 1XF $FLGV 5HV 6D]HU 6 DQG 5 6FKLPNH %LRO &KHP 6FKLEOHU 8 2 +DJHQEFKOH 3 :HOODXHU DQG $ & 3LWWHW 3URF 1DWO $FDG 6FL 86$ 6FKOHU + 5f DQG 3 *UDVV &HOO 6HDUOH 3 )f : 6WXDUW DQG 5 3DOPLWHU 0RO &HOO %LRO 6HGHURII 5 $0 6WRPS : 6 &KLOWRQ DQG / : 0RRUH %LRO7HFKQRORJ\ 6HQ 5 DQG %DOWLPRUH &HOO 6HUIOLQJ ( 0 -DVLQ DQG : 6FKDIIQHU 7UHQGV *HQHW 6KDXO < : 5XWWHU DQG 2 /DPE (0%2 6KDZ & + + &DUWHU 0 :DWVRQ & + 6KDZ 1XFO $FLGV 5HV 6KXH\ DQG & 6 3DUNHU %LRO &KHP 6KXH\ DQG & 6 3DUNHU 1DWXUH /RQGRQf 6LHEHQOLVW 8 5 % 6LPSVRQ DQG : *LOEHUW &HOO 6LOIORZ & 5 +DPPHWW DQG / .H\ %LRFKHP

PAGE 125

6LPSVRQ 6FKHOO 0 9DQ 0RQWDJXH DQG / +HUUHUD(VWUHOOD 1DWXUH /RQGRQf 6LPSVRQ 0 7LPNR $ &DVKPRUH 6FKHOO 0 9DQ 0RQWDJXH DQG / +HUUHUD(VWUHOOD (0%2 6LQJK + 5 6HQ %DOWLPRUH DQG 3 $ 6KDUS 1DWXUH /RQGRQf 6RXWKHUQ ( 0 0RO %LRO 6RXWKJDWH 5 $ $\PH DQG 5 9RHOOP\ 0RO %LRO 6SHQD $ 5 +DLQ 8 =LHUYRJHO + 6DHGOHU DQG 6FKHOO (0%2 7DNDKDVKL 0 9LJQHURQ + 0DWWKHV $ :LOGHPDQ 0 =HQNH DQG 3 &KDPEQ 1DWXUH /RQGRQf 7KRPDVKRZ 0 5 1XWWHU $ 0RQWR\D 0 *RUGRQ DQG ( 1HVWHU &HOO 7LPNR 0 $ .DXVFK & &DVWUHVDQD )DVVOHU / +HUUHUD(VWUHOOD 9DQ GHQ %URHFN 0 9DQ 0RQWDJXH 6FKHOO DQG $ &DVKPRUH 1DWXUH /RQGRQf 7RNXQDJD 6 +LURVH DQG < 6X]XNL 1XFO $FLGV 5HV 7RSRO 5XGHQ DQG & 6 3DUNHU &HOO 7UHLVPDQ 5 0 5 *UHHQ DQG 7 0DQLDWLV 3URF 1DWO $FDG 6FL 86$ 9DQ 2QFNHOHQ + ( 3ULQVHQ ,Q] 3 5GHOVKHLQ 0 9DQ /LMVHEHWWHQV $ )ROOLQV 6FKHOO 0 9DQ 0RQWDJXH DQG 'H*UHHI )(%6 /HW :DONHU 0 'f 7 (GOXQG $ 0 %RXOHW DQG : 5XWWHU 1DWXUH /RQGRQf :DV\O\N % 5 'HUE\VKLUH $ *X\ 0RONR $ 5RJHW 5 7RXOH DQG 3 &KDPEQ 3URF 1DWO $FDG 6FL 86$ :DV\O\N % & .GLQJHU &RUGHQ 2 %ULVRQ DQG 3 &KDPEQ 1DWXUH /RQGRQf :DV\O\N % & :DV\O\N 3 $XJHUHDX DQG 3 &KDPEQ &HOO :HL 5 + :LONLQVRQ 3IHLIHU & 6FKQLHGHU 5
PAGE 126

:LOGHPDQ $ 0 =HQNH & 6KDW] 0 :LQWHULWK 7 *UXQVWUP + 0DWWKHV 7DNDKDVKL DQG 3 &KDPEQ 0RO &HOO %LRO :LOOPLW]HU / 3 'KDHVH 3 + 6FKUHLHU : 6FKPDOHQEDFK 0 9DQ 0RQWDJXH DQG 6FKHOO &HOO :LOOPLW]HU / / 2WWHQ 6LPRQV : 6FKPDOHQEDFK 6FKURGHU 6FKURGHU 0 9DQ 0RQWDJXH DQG 6FKHOO 0RO *HQ *HQHW :LOOPLW]HU / 6LPRQV DQG 6FKHOO (0%2 :LQWHU $ 5 / :ULJKW DQG : % *XUOH\ 1XFO $FLGV 5HV :X & 1DWXUH /RQGRQf :X & 1DWXUH /RQGRQf :X & 1DWXUH /RQGRQf :X +0 DQG 0 &URWKHUV 1DWXUH /RQGRQf
PAGE 127

%,2*5$3+,&$/ 6.(7&+ :HVOH\ % %UXFH ZDV ERUQ 1RYHPEHU LQ /DID\HWWH /RXLVLDQD +H DWWHQGHG 7HUU\ 3DUNHU +LJK 6FKRRO LQ -DFNVRQYLOOH ), WKHQ ZDV DGPLWWHG WR WKH 8QLYHUVLW\ RI )ORULGD DV D IUHVKPDQ LQ $XJXVW RI $IWHU UHFHLYLQJ D %DFKHORU RI 6FLHQFH GHJUHH LQ PLFURELRORJ\ LQ $XJXVW RI KH LPPHGLDWHO\ EHJDQ JUDGXDWH VFKRRO DW WKH 'HSDUWPHQW RI 0LFURELRORJ\ DQG &HOO 6FLHQFH XQGHU WKH VXSHUYLVLRQ RI 'U :LOOLDP % *XUOH\ 8SRQ UHFHLYLQJ KLV 3K' KH ZLOO MRLQ 'U 3HWHU 4XDLOnV ODERUDWRU\ DW WKH 8QLYHUVLW\ RI :LVFRQVLQ DW 0DGLVRQ :LVFRQVLQ DV D UHVHDUFK DVVRFLDWH DQG ZLOO FRQWLQXH VWXGLHV FRQFHUQLQJ PROHFXODU JHQHWLFV RI FURS SODQWV

PAGE 128

, FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ :LOOLDP % *XUOH\ &KDLUUSWIUI $VVRFLDWH 3URIHVVRU RI 0LFURELRORJ\ DQG &HOO 6FLHQFH FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ )UDQFLV & 'DYLV -U &RFKDLQUWDQ $VVRFLDWH 3URIHVVRU RI 0LFURELRORJ\ DQG &HOO 6FLHQFH FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ QUn Y n Y -DPHV 3UHVWRQ 3URIHVVRU RI 0LFURELRORJ\ DQG &HOO 6FLHQFH FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ DRLUALL/ 5REHUW )HUO $VVRFLDWH 3URIHVVRU RI %RWDQ\

PAGE 129

, FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ / &XUW +DQQDK 3URIHVVRU RI +RUWLFXOWXUH 6FLHQFH 7KLV GLVVHUWDWLRQ ZDV VXEPLWWHG WR WKH *UDGXDWH )DFXOW\ RI WKH &ROOHJH RI $JULFXOWXUH DQG WR WKH *UDGXDWH 6FKRRO DQG ZDV DFFHSWHG DV SDUWLDO IXOILOOPHQW RI WKH UHTXLUHPHQWV IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 0D\ 'HDQ &/& N ; ROOHJH RI $JULFXOWXUH 'HDQ *UDGXDWH 6FKRRO


xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID EF4MAG5UO_ICME07 INGEST_TIME 2017-07-12T21:07:06Z PACKAGE AA00003369_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES