Characterization of the P1 protein of the zucchini yellow mosaic potyvirus

MISSING IMAGE

Material Information

Title:
Characterization of the P1 protein of the zucchini yellow mosaic potyvirus
Physical Description:
xi, 129 leaves : ill. ; 29 cm.
Language:
English
Creator:
Wisler, Gail C., 1954-
Publication Date:

Subjects

Subjects / Keywords:
Zucchini -- Diseases and pests   ( lcsh )
Potyvirus diseases   ( lcsh )
Proteins -- Analysis   ( lcsh )
Plant Pathology thesis Ph. D
Dissertations, Academic -- Plant Pathology -- UF
Genre:
bibliography   ( marcgt )
non-fiction   ( marcgt )

Notes

Thesis:
Thesis (Ph. D.)--University of Florida, 1992.
Bibliography:
Includes bibliographical references (leaves 117-128).
Statement of Responsibility:
by Gail C. Wisler.
General Note:
Typescript.
General Note:
Vita.

Record Information

Source Institution:
University of Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
aleph - 001800192
oclc - 27569031
notis - AJM3941
System ID:
AA00003286:00001

Full Text











CHARACTERIZATION OF THE P1 PROTEIN
OF THE ZUCCHINI YELLOW MOSAIC POTYVIRUS



















By

GAIL C. WISLER


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

1992


- --3 F













ACKNOWLEDGEMENTS


The most important aspect of a graduate student's

career is his or her major professor and advisory committee.

In this respect I have been extremely fortunate to have Dr.

D.E. Purcifull as my major professor and Dr. E. Hiebert as

my co-advisor. They have shared completely their expertise

and enthusiasm for my work, and have been supportive

throughout my project.

Dr. F.W. Zettler was my major professor for my master's

degree, and has continued to be an excellent source of

advice and moral support, and a fine friend as always. Dr.

S. E. Webb, Dr. S. G. Zam, and Dr. J.R. Edwardson have also

been extremely helpful and enthusiastic, and I am grateful

to have had the opportunity to interact with and learn from

them.

The excellent technical assistance and comradery

offered by Eugene Crawford, Kristin Beckham, Gary Marlow,

Carlye Baker, and Maureen Petersen have made my work more

productive and certainly more enjoyable. I greatly admire

their skills and will not forget their kindness.

I am especially thankful to have had the support of my

husband, H. William Brown, who helped me through the

difficult times and made the good times even better. I am

ii








also fortunate to have had the advice and encouragement that

my mother, Caryl M. Wisler has always given me. My father,

Gerry Wisler was always supportive, and encouraged me in all

my endeavors.

Earning this degree has been an excellent learning

experience for me, and this, plus the relationships I have

developed while a student here at the University of Florida,

have made it all very worthwhile.


iii














TABLE OF CONTENTS



ACKNOWLEDGEMENTS . . ii

LIST OF TABLES . .. v

LIST OF FIGURES . ... vi

KEY TO ABBREVIATIONS . . viii

ABSTRACT . . .. x

CHAPTER 1 INTRODUCTION. . .. 1

CHAPTER 2 CLONING AND SEQUENCING OF A FLORIDA ISOLATE
OF ZUCCHINI YELLOW MOSAIC VIRUS

Introduction .. . .. 11
Materials and Methods .. .. 12
Results . . 20
Discussion . .. 51

CHAPTER 3 SEROLOGICAL CHARACTERIZATION OF THE P1
PROTEIN OF ZUCCHINI YELLOW MOSAIC VIRUS
FROM FLORIDA

Introduction . . 55
Materials and Methods . .. 56
Results . . .. 66
Discussion .. . ... 88

CHAPTER 4 SUMMARY AND CONCLUSIONS. ... 91


APPENDIX: MONOCLONAL ANTIBODIES TO THE CAPSID PROTEIN
OF ZUCCHINI YELLOW MOSAIC VIRUS 97

REFERENCE LIST. ....... . 117

BIOGRAPHICAL SKETCH . . 129














LIST OF TABLES


Table Paqi

2-1 ZYMV-FL/AT cDNA clones identified by immuno-
screening in Agtll.................................22

2-2 ZYMV-FL/AT cDNA clones identified by immuno-
screening in AZAPII. ..............................23

2-3 Percentage of nucleotide and amino acid sequence
homologies of four ZYMV isolates and five distantly
related potyviruses with respect to ZYMV-FL/AT.....49

3-1 List of zucchini yellow mosaic virus isolates used
for serological studies of the P1 protein..........57

3-2 Evidence for variation in molecular weight and
reactivity of P1-related proteins of ZYMV isolates
in western blots...................................72

3-3 Summary of reactions of antisera to the P1 of
ZYMV-FL/AT and ZYMV-RU in immunofluorescence tests.87














LIST OF FIGURES


Figure Page

2-1 Map of selected cDNA clones from Agtll and
AZAPII which represent the genome of
ZYMV-FL/AT....................................24

2-2 Sequencing strategy used for the cDNA clones
representing P1-, HC/Pro(AI)-, and P3-
encoding regions..............................25

2-3 Nucleotide and deduced amino acid sequence of
ZYMV-FL/AT....................................28

2-4 Hydrophobicity of P1 of ZYMV-FL/AT plotted
according to Kyte and Doolittle (1982) ........37

2-5 Map of acidic and basic residues of the P1
protein of ZYMV-FL/AT.........................38

2-6 Hydrophobicity plot of the P3 sequence of
ZYMV-FL/AT....................................39

2-7 Map of the acidic and basic residues of the
P3 protein of ZYMV-FL/AT ......................40

2-8 PCR products of P1 from ZYMV-MD and ZYMV-SV
using primers specific to the P1 coding
region .......................................42

2-9 Nucleotide sequence alignments of the P1
coding regions from ZYMV-FL/AT with that of
ZYMV-CA, -SV, -MD,and -RU.....................44

2-10 Amino acid sequence alignment of the P1
proteins of five ZYMV isolates: ZYMV-FL/AT,
-MD, -RU -SV, and -CA..........................47

3-1 Expression of P1 protein of ZYMV-FL/AT cloned
into the pETh plasmid..........................67

3-2 Characterization of the reactions of the P1-
related proteins of 22 isolates of zucchini
yellow mosaic virus (ZYMV) in western blots...71

vi








3-3 Western blots of extracts from plants singly
infected with selected ZYMV isolates..........73

3-4 Western blots showing 8% and 15% SDS-PAGE gel
concentrations............................... 74

3-5 Detection of the P1 protein in extracts from
plants of four cucurbit cultivars singly
infected with three isolates of zucchini
yellow mosaic virus ...........................75

3-6 Western blots of extracts from pumpkin singly
infected with selected ZYMV isolates using
antisera to P1, CI, and CP of ZYMV-FL/AT,
and to the AI of PRSV-W as probes.............76

3-7 Specificity of antiserum to P1 of ZYMV-FL/AT
in western blots..............................78

3-8 Reactivity of 22 zucchini yellow mosaic virus
isolates in western blots using antiserum to
the P1 of ZYMV-RU as a probe...................79

3-9 Immunoprecipitation of wheat germ in vitro
translation products..........................80

3-10 Localization of P1 in epidermal tissue in
stems of watermelon infected with ZYMV-FL/AT..83

3-11 Epidermal strips of watermelon tissue infected
with ZYMV-FL/AT treated with preimmune serum,
stained with Rhodamine-protein A, and
photographed with epifluorescence.............84

3-12 Aggregates of P1 protein in watermelon tissue
infected with ZYMV-RU treated with antiserum
to the P1 of ZYMV-FL/AT (1181), stained with
Rhodamine-protein A, and photographed with
epifluorescence optics.........................85

3-13 Epidermal strips from mock-inoculated
watermelon tissue treated with antiserum to
the P1 of ZYMV-FL/AT (1181) and stained with
Rhodamine-protein A.......................... 86


vii














KEY TO ABBREVIATIONS


AI
bp
CP
C-terminus
cDNA
CMV
CI
MCi
dpm
DIECA
ELISA
ES buffer
HC/Pro
kDa
LB
LDS
mw
N-terminus
NIa
NIb
nm
nt
oligo dT
P1
P3
PCR
PPV
PSbMV
PVYN
RT
SDS-PAGE

TEV
TVMV
VPg
WG
ZYFV
ZYMV-FL/AT

ZYMV-CA
ZYMV-MD


amorphous inclusion
base pairs
capsid protein
carboxy-terminus
complementary DNA
cucumber mosaic virus
cylindrical inclusion
microCurie
disintegrations per minute
diethyldithiocarbamate
enzyme-linked immunosorbent assay
extraction buffer
helper component/protease
kilodalton
Luria broth
Laemmli dissociating solution
molecular weight
amino-terminus
nuclear inclusion a
nuclear inclusion b
nanometer
nucleotide
oligonucleotide deoxy-thymidine
P1 protein
P3 protein
polymerase chain reaction
plum pox virus
pea seed-borne mosaic virus
necrotic strain of potato virus Y
room temperature
sodium dodecyl sulfate polyacrylamide
gel electrophoresis
tobacco etch virus
tobacco vein mottling virus
genome-linked viral protein
wheat germ
zucchini yellow fleck virus
aphid-transmissible isolate of zucchini
yellow mosaic virus from Florida
ZYMV isolate from California
mild isolate of ZYMV from Florida


viii








ZYMV isolate from Reunion Island
severe isolate of ZYMV from Florida


ZYMV-RU
ZYMV-SV













Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

CHARACTERIZATION OF THE P1 PROTEIN OF THE
ZUCCHINI YELLOW MOSAIC POTYVIRUS

By

Gail Clara Wisler

August, 1992


Chairperson: Dan E. Purcifull
Major Department: Plant Pathology

The nucleotide sequence of the 5'-terminal P1 coding

region of an aphid transmissible isolate of zucchini yellow

mosaic virus (ZYMV-FL/AT) was compared to the P1 coding

region of four other ZYMV isolates. Mild (ZYMV-MD) and

severe (ZYMV-SV) isolates from Florida and an isolate from

California (ZYMV-CA) had 95-98% homologies to ZYMV-FL/AT,

whereas the P1 coding region of ZYMV from Reunion Island

(ZYMV-RU) had 60% homology to ZYMV-FL/AT. The ZYMV-MD had

an 18 nucleotide insert following the start codon of the P1

coding region. The P1 proteins of all ZYMV isolates shared

conserved amino acids in areas of the C-terminus that have

been reported to be conserved in other potyviruses.

The P1 protein from ZYMV-FL/AT was expressed in

Escherichia coli and used for polyclonal antiserum

production. This antiserum reacted in western blots with








extracts of pumpkin (Cucurbita pepo L.) singly infected with

22 ZYMV isolates but did not react with extracts from

noninfected plants or from plants infected with three other

potyviruses, a potexvirus, a cucumovirus. The P1 proteins

of ZYMV isolates ranged from 33- to 35-kDa. The P1 protein

of ZYMV-MD, which contained a six amino acid insert, was

larger (ca. 35-kDa) than the P1 of ZYMV-FL/AT. Possible

protein breakdown products (26-27-kDa) were noted for some

isolates. Three isolates showed an 88-kDa product; one was

tested and it reacted with antiserum to amorphous inclusion

protein (AI), indicating incomplete processing between the

P1 and AI cleavage site. Antiserum made to the P1 of ZYMV-

RU gave similar results in western blots with respect to

size heterogeneity of the P1 protein among ZYMV isolates,

but it only reacted with 16 of 22 ZYMV isolates tested.

Indirect immunofluorescence tests with antisera to the

P1 proteins of ZYMV-FL/AT and ZYMV-RU indicated that the P1

protein aggregates in ZYMV-infected tissues.

The P1 coding region is more variable than other

regions of the genome among ZYMV isolates that have been

studied. The occurrence of breakdown products, incomplete

processing between P1 and AI, and different sizes of P1

proteins with certain isolates are likely due to sequence

differences in the respective P1 proteins. Antisera to the

P1 proteins have potential as serological probes for

identifying ZYMV and distinguishing among ZYMV isolates.














CHAPTER 1
INTRODUCTION


The Potyviridae is the largest group of plant

viruses, consisting of at least 180 members, most of which

are aphid transmitted (Barnett, 1991). Collectively,

potyviruses infect a wide range of agriculturally important

crops, causing severe yield losses (Hollings and Brunt,

1981; Matthews, 1982). The potyviral genome is a message-

sense, single stranded RNA molecule, consisting of about

10,000 nucleotides (nt). A characteristic feature of all

potyviruses is the production of proteinaceous cylindrical

inclusions (CI) in the cytoplasm of infected plants

(Edwardson, 1974; Edwardson and Christie, 1991). The

potyviral genome consists of a single open reading frame

(ORF) which is translated into a polyprotein of about 3.5 X

105 kilodaltons (kDa) which is subsequently cleaved into at

least eight individual proteins by viral-encoded proteases

(de Mejia et al., 1985b; Carrington et al., 1989a; Dougherty

and Carrington, 1988; Allison et al., 1986; Garcia et al,

1989; Verchot et al., 1991). Six of these proteins have

been characterized, but little is known about two proteins

referred to as P1 and P3, which are the first and third

proteins encoded from the 5'-terminus of the genome. The P1









and P3 proteins flank the helper component/protease

(HC/Pro), or amorphous inclusion (AI), region.

Because of the large number of potyviruses and the

close relationships among many members, identification and

distinction among potyviruses have received a considerable

amount of attention. Properties of the capsid protein (CP)

and the nucleotide (nt) sequence of the CP-encoding region

have received the most attention as criteria for

classification, with nt sequences of 20 distinct potyviruses

and 42 strains having been determined (Ward and Shukla,

1991). This attention can be attributed to the gene

encoding the CP being the first gene to be transcribed from

the 3'-end of the genome by reverse transcriptase using

oligo dT primers (Quemada et al., 1990; Gal-On et al.,

1990), and because the CP can be extracted from virions

which are easily purified from virus infected plant tissue.

The CP functions to protect the viral RNA by encapsidation

and it also is involved in aphid transmission (Gal-On et

al., 1990; Lecoq and Purcifull, 1992). Sequence analyses

have shown that a change in the amino acid triplet Asp-Ala-

Gly (DAG) in the amino-terminus (N-terminus) of the CP

alters aphid transmissibility (Atreya et al., 1990; 1991;

Harrison and Robinson, 1988; Gal-On et al., 1990; Salomon

and Raccah, 1990). The CP of two potyviruses, papaya

ringspot virus type P (papaya) and soybean mosaic virus,

have also been used in plant transformations to protect










against super-infection by strains of the same virus and by

other potyviruses (Ling et al., 1991; Stark and Beachy,

1989).

The two nuclear inclusion proteins, NIa (49-kda) and

NIb (54 to 58-kDa) aggregate in equimolar amounts in some

potyviral infections, are localized in the nucleus of

infected plants, and contain nuclear targeting signals

(Restrepo et al., 1990). The carboxy-terminal (C-terminal)

portion of the NIa is a protease responsible for processing

in cis and in trans at a minimum of six sites on the

polyprotein (Carrington and Dougherty, 1987a, 1987b, 1988;

Carrington et al., 1988; Chang et al., 1988; Dougherty and

Parks, 1989, 1991; Dougherty et al., 1988, 1989; Garcia et

al., 1989; Hellmann et al., 1988; Martin et al., 1990;

Riechmann et al., 1992). The NIa resembles the proteases of

como-, nepo-, and picornaviruses (Domier et al., 1987;

Goldbach and Wellinck, 1988), and is related to the trypsin-

like family of serine proteases (Bazan and Fletterick,

1988). The N-terminal portion of the NIa is now known to be

the genome-linked viral protein (VPg) attached to the 5'-

terminus of the viral RNA (Siaw et al., 1985; Hari, 1981;

Shahabuddin et al., 1988; Murphy et al., 1990).

The large nuclear inclusion protein, NIb, is the most

highly conserved of the potyviral genes among those which

have been sequenced (Ward and Shukla, 1991), and has high

sequence similarity with RNA-dependent-RNA-polymerases










encoded by plus-sense RNA viruses (Domier et al., 1987;

Bruenn, 1991).

The CI are produced by all members of the Potyviridae

examined so far (Edwardson and Christie, 1991). They are

found free in the cytoplasm (Baunoch et al., 1988), in

association with the endoplasmic reticulum (Langenberg,

1986), and attached to cell membranes and plasmodesmata.

Langenberg has suggested a possible involvement of CI in

cell-to-cell movement of viruses because of the association

of CI with virus particles and plasmodesmata (Langenberg and

Purcifull, 1989; Langenberg et al., 1989). Recently, the CI

have been shown to have helicase activity and to possess

nucleoside triphosphate (NTP)-binding activity (Lain et al.,

1988, 1989, 1990, 1991; Robaglia, et al., 1989; Riechmann et

al., 1992).

The coding region between the CI and HC/Pro, designated

as P3, exhibits a low sequence similarity among those

potyviruses which have been sequenced. The 42-kDa P3

protein of tobacco vein mottling virus (TVMV) has been

expressed in E. coli and antiserum has been prepared to it

(Rodriguez-Cerezo and Shaw, 1991). In western blots, this

antiserum reacted with a 42-kDa and a 37-kDa protein in

infected plants indicating that there may be an alternate

processing site between P3 and CI. Although it has been

suggested that there is limited sequence homology between P3

and the 2A protease of picornaviruses (Domier et al., 1987;










Dougherty and Carrington, 1988), no protease activity of P3

has been demonstrated (Shukla et al., 1991).

The role of the HC/Pro in aphid transmission has been

well established (Berger and Pirone, 1986; Govier and

Kassanis, 1974; Pirone and Thornbury, 1983; Thornbury et

al., 1985). Immunochemical studies have shown that the

coding region for the amorphous inclusion (AI) is the same

as the HC/Pro (Baunoch et al., 1988; de Mejia et al.,

1985a), but whereas antiserum to the HC/Pro blocks aphid

transmission of potato virus Y and TVMV, antiserum to the AI

does not (Thornbury et al., 1985). It has been suggested

that the inclusion form of this protein may be inactive in

terms of aphid transmission (Dougherty and Carrington,

1988). The C-terminus of the HC/Pro functions as a

protease, responsible for the cleavage between the HC/Pro

and P3 (Carrington et al., 1989a, 1989b, 1990) at a

conserved gly-gly (G-G) amino acid residue. Identification

of two essential amino acids in the C-terminal half of the

HC/Pro indicate that it is a member of the cysteine-type

family of proteases (Oh and Carrington, 1989). Sequence

comparisons have shown a high homology of the protease of

HC/Pro with that of a dsRNA hypovirulence-associated virus

of the chestnut blight fungus (Choi et al., 1991), and both

proteases autocatalytically cleave between the G-G residues.

The protein encoded by the 5'-terminal region of the

potyviral genome is the most variable of those which have








6

been sequenced (Shukla et al., 1991), and shows the greatest

molecular weight (mw) variation of over 30 potyviruses which

have been studied by in vitro translations (E. Hiebert,

personal comm.; Hiebert and Dougherty, 1988), with a size

range from 32 to 68-kDa. The C-terminus of P1 has recently

been identified as a serine-type protease responsible for

the autocatalytic cleavage between P1 and HC/Pro (Verchot et

al., 1991). Since this cleavage occurs efficiently in the

wheat germ in vitro translation system, but not in the

rabbit reticulocyte lysate system, it has been suggested

that an alternate cofactor may be required for the

processing event. Rodriguez-Cerezo and Shaw (1991)

expressed P1 in E. coli and antiserum was prepared to the

expressed P1 protein. A 31-kDa protein was detected in low

levels in infected tissue extracts which had been enriched

for endoplasmic reticulum and mitochondria. Rodriguez-

Cerezo and Shaw are the first to demonstrate the existence

of both P1 and P3 in infected plants. Yeh et al. (1992), by

using monoclonal antibodies (MAbs) to a 112-kDa protein

product of papaya ringspot virus-type W (PRSV-W), were able

to detect both 51- and 64-kDa proteins which presumably

correspond to the HC/Pro and the Pi proteins, respectively.

Zucchini yellow mosaic virus (ZYMV) is one of several

members of the Potyviridae which cause serious losses of

cucurbitaceous crops worldwide. ZYMV was first detected in

1973 in Italy (Lisa et al., 1981), and has since been









identified in the U.S. (Adlerz et al., 1983; Purcifull et

al., 1984; Provvidenti et al., 1984; Nameth et al., 1985),

Israel (Antignus et al., 1989), Turkey (Davis, 1986), Japan

(Suzuki et al., 1988), Australia (Greber et al., 1988),

France (Lecoq et al., 1983), Lebanon (Lesemann et al.,

1983), and Jordan (Al-Musa, 1989).

Both serological and biological variations have been

reported for ZYMV isolates (Lisa and Lecoq, 1984; Lecoq and

Purcifull, 1992; Wang et al., 1988; 1992). Serological

relationships are often complex and ZYMV has been reported

to cross react with watermelon mosaic virus-2 (WMV-2) in

serological studies of the CP (Davis et al., 1984; Huang et

al., 1986; Lisa and Lecoq, 1984; Purcifull et al., 1984;

Somowiyarjo et al., 1989) and CI protein (Suzuki et al.,

1988). Biological variants range from strains which induce

very mild symptoms to those which induce severe and necrotic

symptoms (Petersen et al., 1991; Lecoq and Purcifull, 1992).

These types of variants have been detected in geographically

distinct regions including France and the U.S. (Lecoq and

Purcifull, 1992). Biological variants have also been

observed which differ in the ability to be aphid transmitted

(Lecoq et al., 1991a; Lecoq and Purcifull, 1992). Some

isolates are aphid transmitted, whereas others are

inefficiently transmissible or not transmitted by aphids.

Zucchini yellow mosaic virus has reportedly been

responsible for severe yield losses in France (Lisa and









Lecoq, 1984), Israel (Cohen, 1986), and the U.S. (Blua and

Perring, 1989). Recent studies (Lecoq et al., 1991b: Wang

et al., 1991) report the use of mild isolates of ZYMV for

cross protection against more severe isolates. This means

of control appears promising for ZYMV. Some workers have

reported that ZYMV may be transmitted at a low rate through

seed (Schrijnwerkers et al., 1991; Davis and Mizuki, 1986),

and many isolates are efficiently aphid transmitted.

In addition to ZYMV, several other potyviruses, such as

papaya ringspot virus type-W (PRSV-W), watermelon mosaic

virus-2 (WMV-2), zucchini yellow fleck virus (ZYFV), bean

yellow mosaic virus, Bryonia mottle virus (Lovisolo, 1980),

and Telfairia mosaic virus (Shoyinka et al., 1987) have been

reported to infect cucurbits in the field. As a result, the

possibility for genetic recombination among these cucurbit

potyviruses exists (King, 1987; Morozov et al., 1989).

Consequently, the ability to accurately diagnose and

differentiate isolates is important in breeding programs

designed to control ZYMV through the development and use of

resistant cucurbit cultivars. Differentiation of ZYMV

isolates is also important in cross-protection studies.

Diagnosis and distinction of ZYMV isolates have been

based in part on differential host reactions.

Immunochemical assays involving both polyclonal (PAb) and

monoclonal (MAb) antisera to the CP are useful for diagnosis










of ZYMV, but are not completely definitive for distinction

between isolates.

Studies of both structural and nonstructural proteins

of potyviruses have been based on their ease of isolation,

either because they are readily purified, they aggregate in

infected tissue, or, as with the CP, they can be easily

cloned by oligo dT priming. Neither P1 nor P3 have been

shown to accumulate or aggregate in infected plants and thus

they have not been well characterized. As an early part of

this study, several MAbs to the CP of ZYMV were evaluated

for their ability to distinguish and diagnose ZYMV isolates,

as described in Appendix 1. The primary focus of this study,

however, was to further characterize the P1 and P3 of ZYMV.

To achieve this goal, the objectives of this study included

(1) characterization of the P1 and P3 proteins and coding

regions of an aphid-transmissible isolate of ZYMV from

Florida (ZYMV-FL/AT); (2) comparison of the P1 and P3

proteins and their coding regions from ZYMV-FL/AT to those

of other ZYMV isolates and other cucurbit potyviruses; (3)

evaluation of antisera to these proteins as serological

probes for studying the variability of ZYMV isolates; and

(4) evaluation of the antigenic relationships of these

proteins among ZYMV isolates and other potyviruses infecting

the Cucurbitaceae. The high sequence variability of P1 and

P3 make both of them interesting protein coding regions for

study, and knowledge gained in this research should lead to










a better understanding of the roles of P1 and P3 in the

viral infection process.

This study reports nucleotide sequence variability

among the P1 coding region of five ZYMV isolates. Antisera

to the P1 proteins of two ZYMV isolates detected size

differences in the P1 proteins, incompletely processed P1

products, possible breakdown products, and antigenic

differences among several ZYMV isolates. Nucleotide

sequence information only is presented for the P3 coding

region of ZYMV-FL/AT due to the inability to express this

protein in E. coli as a result of its apparent toxicity.














CHAPTER 2
CLONING AND SEQUENCING OF A FLORIDA ISOLATE
OF ZUCCHINI YELLOW MOSAIC VIRUS



Introduction


It has been hypothesized that potyvirus strains "show

an overall high sequence identity irrespective of the gene

product being considered, while distinct viruses have a

significantly lower degree of identity between gene

products" (Shukla et al., 1991, p.181). The nucleotide (nt)

sequence identities for the CP gene of distinct potyviruses

range approximately from 30 to 60%, while the nucleic acid

sequence identities determined for strains of a potyvirus

are greater than 95% (Ward and Shukla, 1991). These authors

point out that for the four potyviruses that have been

sequenced, the P1 coding region of the potyviral genome has

a lower homology than other coding regions, and that this

appears to be the most variable region of the genome. They

also suggest that this variability may indicate a possible

role for P1 in specific virus-host interactions.

The major goal in this study was to characterize and

compare the P1 and P3 proteins of several ZYMV isolates. A

means of achieving this goal was to produce P1 and P3 of

ZYMV-FL/AT in a high level expression system, and produce

11









specific antisera to each. The first step in this process

was to clone the ZYMV genome and determine the nt and

deduced amino acid sequence of the region encoding P1

through P3.

Materials and Methods


Virus Isolates

An isolate of ZYMV from Florida (Purcifull et al.,

1984), which has been maintained in a greenhouse by aphid

transmission for the past three years, FC-1119AT, was used

as the type isolate throughout this study, and it will be

referred to as ZYMV-FL/AT. The sequence of P1 through P3 of

ZYMV-FL/AT was compared to a ZYMV isolate from California

(ZYMV-CA) which was sequenced by R.Balint (personal comm.),

one from Reunion Island (ZYMV-RU, Baker et al., 1991b), a

severe, necrotic isolate from Florida (FC-2088) designated

as ZYMV-FL/SV, and a mild isolate from Florida (FC-1994)

designated as ZYMV/MD.

Virus Purification and RNA Extraction

The protocol used for virus purification is similar to

that described by Lecoq and Pitrat (1985). ZYMV-infected

Cucurbita Depo L. 'Small Sugar' tissue was harvested 14 days

post inoculation and homogenized for 10 sec with 3.75

volumes of 0.3 M K2HPO4, pH 8.5, with freshly added 0.2%

sodium diethyldithiocarbamate (DIECA) and 0.2% 2-

mercaptoethanol. The resulting slurry was then homogenized

with 2/3 volume of trichlorofluorethane (Freon) for one min.









After centrifugation at 5,000 g for 10 min, the aqueous

phase was made 1% with Triton X-100 and was stirred for 20

min at 4 C. Partially purified virus was collected by

ultracentri-fugation at 37,000 rpm in a Beckman Ti70 rotor

for 1.5 hr at 4 C and was resuspended in 0.02 M HEPES, pH

8.2 with a tissue homogenizer. After stirring for one hr at

4 C, the suspension was partially clarified by

centrifugation at 2,500 g for 2 min. The supernatant was

layered onto a Cs2SO4 gradient (10 g/27 ml 0.01 M HEPES, pH

8.2) and centrifuged for 16 hr at 32,000 g in a Beckman SW41

rotor at 4 C. The opalescent virus zone 24-27 mm from the

bottom of the tube was collected, diluted with one volume of

0.02 M HEPES, pH 8.2, and was centrifuged at 10,000 g for 10

min. The supernate was made 8% with polyethylene glycol

(PEG) 8000 and was stirred for 20 min at 4 C. A pellet

containing virus was collected by centrifugation at 10,000 g

for 10 min, and resuspended in 0.02 M HEPES, pH 8.2.

Concentrations of the virus preparations were estimated by

spectrophotometry using an approximate extinction

coefficient of A260=2.5 (1 mg/ml, 1 cm light path).

Preparations were divided into aliquots and stored at -80 C.

A virus preparation containing approximately 3 mg/ml

was added to an equal volume (1 ml) of RNA dissociating

solution [200 mM Tris-HCl, 2 mM EDTA, 2% sodium dodecyl

sulfate (SDS), pH 9.0], and six pl of protease K. After a

10 min incubation at room temperature (RT), the preparation










was layered onto a linear-log sucrose density gradient

(Brakke and Van Pelt, 1970) and was subjected to

ultracentrifugation at 39,000 rpm for 5 hr at 15 C with a

Beckman SW41 rotor. Gradient zones containing RNA were

collected using an ISCO UV analyzer. The RNA was

precipitated by adding 0.1 volume of 3 M sodium acetate and

2-5 volumes of 100% ethanol (Sambrook et al., 1989).

Pellets were resuspended in 50 Al diethyl- pyrocarbonate

(DEPC) treated water and stored at -80 C.

Synthesis of cDNA

The initial cDNA library of the ZYMV RNA was made using

Agtll (Lambda Librarian, Stratagene, LaJolla, CA), which is

based on a modification of a procedure described by Gubler

and Hoffman (1983). Freshly prepared viral RNA was used for

cloning, with 8.3 Mg RNA as the template in the first strand

synthesis reaction. Both random and oligo dT primers were

used in two separate first strand synthesis reactions which

were labeled by the addition of [32P]dCTP. Incorporation of

label was measured in fractions eluted from P-60 columns

(100-200 mesh Bio-Gel P-60; Bio-Rad, Melville, NY). Those

fractions with counts between 2,000 and 30,000

disintegrations per minute (dpm) were combined, and nucleic

acid was precipitated with ethanol. Second strand synthesis

and the ligation of EcoRI/NotI linkers were performed

according to the manufacturer's instructions.










Size analysis of cDNA was performed on a 0.9% agarose

gel. The gel was exposed to X-ray film and compared to a 1-

kb ladder molecular weight standard (BRL, Gaithersburg, MD).

A zone corresponding to 800-7,000 base pairs (bp) was cut

from the gel and electroeluted with a Bio-Rad (Melville, NY)

electroeluter according to manufacturer's instructions. The

volume of the eluted cDNA was reduced with water-saturated

n-butanol, followed by an ethanol precipitation. The cDNA

preparations with linkers from both random and oligo dT

priming were combined and they were ligated to EcoRl-

digested, calf intestinal alkaline phosphatase (CIAP)-

treated Agtll DNA (Protoclone Agtll System, Promega,

Madison, WI) for three hr at 22 C (Huynh et al., 1984.).

Molar ratios of vector to insert ranged from 1:1 to 1:2 to

1:3. The ligated cDNA was packaged and titered according to

manufacturer's instructions using the Packagene Lambda DNA

Packaging System (Promega, Madison, WI). Packaged phage was

titered on Escherichia coli strain Y1090 grown from a single

colony to an O.D.600 of 0.6 to 0.8 in Luria broth (LB)

(Sambrook et al., 1989), supplemented with 10 mM MgSO and

0.2% maltose.

A library made specifically to the 5'-terminus of the

ZYMV genome was constructed using the Lambda ZAP II/EcoRI

Cloning Kit (Stratagene, La Jolla, CA). A primer, with the

sequence of 5'-CGGTGTGTGCGCTAC-3', which corresponded to an

area encoding the cylindrical inclusion (CI) protein was









used in this cloning experiment and was synthesized at the

University of Florida DNA Synthesis Core. The host strain

used for this vector system was E. coli XL1-Blue.

Nucleic Acid Hybridization of ZYMV Clones

Nucleic acid probes prepared from viral RNA were

labeled with [32P]dCTP using either a Nick Translation Kit

(Promega, Madison, WI) or a Random Primed DNA Labeling Kit

(Boehringer Mannheim (Indianapolis, IN) according to

manufacturer's instructions. Nylon Hybond membranes, 0.45 j

pore size (Amersham, Inc., Arlington Heights, IL) cut to fit

media plates containing plaques, were laid onto the agar

surface for approximately 15 min. Membranes were then

placed onto filter paper pads soaked in three solutions

sequentially for 15 min each: (1) 0.5 M NaOH, 1.5 M NaC1,

(2) 1 M Tris-HCl, pH 7.5, 1.5 M NaC1, and (3) 2X SSC

(Sambrook et al., 1989). They were placed in a UV

Crosslinker for 2 min, after which they were prehybridized

in 10 ml of 1% SDS, 1 M NaCl, 10% PEG 8000, with 5 mg/ml

denatured salmon sperm. Membranes were placed in a heat seal

bag and incubated at 55 C for 15 min with agitation, after

which 100-200 ACi/ml denatured probe was added. This was

followed by an overnight incubation at 55 C. Membranes were

washed twice in 100 ml of 2X SSC for 5 min each at room

temperature (RT), followed by two rinses in 200 ml of 2X SSC

containing 1% SDS at 55 C for 30 min each. A final rinse

was in 100 ml of 0.1X SSC at RT for 30 min. Washed









membranes were exposed to X-ray film with an intensifying

screen.

Immunoscreening of ZYMV Clones

Immunoscreening for clones expressing specific regions

of the ZYMV genome was conducted essentially according to

manufacturer's instructions as described in the picoBlue

Immunoscreening Kit (Stratagene) and by Short et al.,

(1988). Recombinant bacteriophage library lysate was added

to 200 .l of the appropriate strain of E. coli cells, and

allowed to absorb at 37 C for 15 min. This was added to 3

ml of LB soft agar containing 10 mM MgSO4, which was poured

onto LB plates and incubated at 42 C for 3-4 hr until

plaques appeared. A nitrocellulose membrane (NCM) which had

previously been saturated with 10 mM isopropyl-B-D-

thiogalactopyranoside (IPTG) was laid onto each plate. The

IPTG is a gratuitous inducer used to induce the expression

of the B-galactosidase fusion protein. Plates were then

moved to 37 C and allowed to incubate an additional 4-6 hr.

Membranes were removed, rinsed three times for 5 min in a

solution containing 20 mM Tris-HCl, pH 7.5, 150 mM NaCl,

0.05% Tween-20 (TBST), and then incubated in TBST containing

5% Carnation dry milk powder for 15 min to block protein

binding sites. E. coli lysate was prepared as described in

Huynh et al., (1984) and added at 1 mg/ml to the blocking

solution. Antisera to the CP and CI of ZYMV, to the small

nuclear inclusion protein (NIa) of tobacco etch virus (TEV),









the HC/Pro of TVMV, and to the AI of papaya ringspot virus

type-W (PRSV-W) were used for primary antibody screening.

The virus antisera used in screening were known to cross-

react with corresponding proteins of ZYMV and other

potyviruses. Primary antibody was diluted in the blocking

solution at 1/500 to 1/1000 and incubated overnight at 4 C

with shaking. Each step was followed by three 5 min washes

with TBST. The secondary antibody, alkaline phosphatase-

conjugated goat anti-rabbit IgG (Sigma Chemical Co., St.

Louis, MO), was added at a dilution of 1/2000 in blocking

solution and was incubated with shaking at RT for 1-2 hr.

After rinsing in TBST, a final rinse was made in development

buffer (0.1 M Tris-HCl, 0.1 M NaCl, pH 9.6.). The color

substrates (Gibco BRL, Gaithersburg, MD), nitroblue

tetrazolium (NBT) (22 jl of a 75 mg/ml solution) and 5-

bromo-4-chloro-3-indolylphosphate (BCIP) (20 pl of a 50

mg/ml solution) were added to 20 ml development buffer with

50 Al of 2M MgC12. Color development was allowed to proceed

for approximately 30 min before reactions were stopped by

rinsing with deionized water. Positive clones were isolated

with a sterile pipette and placed in a buffer containing 100

mM NaCl, 50 mM Tris, pH 7.5, 10 mM MgSO4 (SM buffer) with 5%

chloroform and stored at 4 C. Clones were purified by 2 to

3 rounds of plating and screening.










Analysis of ZYMV Clones

Plaque purified clones in Agtll which were positive in

immunoscreening were raised in a 5 ml culture in the

lysogenic host E. coli Y1089 and were prepared by a mini-

prep procedure. Preparations were digested with EcoRI, run

on an agarose gel, transferred to a nylon membrane using an

agarose gel transfer unit (Millipore MilliBlot-V System,

Bedford, MA), and exposed to a [32P]dCTP labeled ZYMV probe.

Clones in both Agtll and AZAPII were analyzed by

polymerase chain reaction (PCR) using Agtll forward and

reverse primers. Plaques were placed into 20 pl of SM

buffer and frozen at -20 C. Ten pl were used as the

template in a BIOS thermocycler with three cycles of 94 C

for 3 min, 45 C for 1 min, and 72 C for 3 min. This was

followed by 35 cycles at 93 C for 1 min, 45 C for 1 min, and

72 C for 3 min. Plasmid clones were analyzed with PCR by

placing individual colonies in 20 pl of 20 mM Tris-HCl, pH

8, containing 1% Triton X-100, heating to 95 C for 10 min,

and centrifuging at 10,000 g for 2 min. Ten Ml of this

template was used in PCR with the appropriate primers.

Subcloninq of Recombinant Bacteriophage

Clones identified in Agtll were digested as described,

and extracted from an agarose gel using a Prep-A-Gene DNA

Purification Kit (Bio-Rad). Fragments were then subcloned

by lighting into EcoRl digested pGEMEX-1 (Promega) which had

been treated with CIAP (Sambrook et al., 1989). Plasmid








20

clones (pBluescript SK-) were isolated from AZAP II with the

use of the helper phage R408 according to manufacturer's

instructions (Stratagene). Recombinant plasmid cultures

were prepared for further analysis by the alkaline lysis

miniprep procedure (Sambrook et al., 1989).

Two additional Pl-encoding regions, one from ZYMV-SV

and one from ZYMV-MD, were cloned into the pETh vector

(McCarty et al., 1991) after increase of cDNA by PCR using

primers specific for PI, following procedures similar to

those described by Robertson et al. (1991).

DNA Sequencing of ZYMV Clones

The nucleotide sequences of plasmid preparations and

PCR products were determined using the standard Sanger

dideoxy chain termination method (1977) employed in both US

Biochemical Corp., Cleveland, OH, and Pharmacia LKB,

Piscataway, NJ, sequencing kits. Both 6% and 4% acrylamide

gels with 7 M urea were used. Sequence analysis and

comparisons were made using the University of Wisconsin

Genetics Computer Group Sequence Software (GCG) available at

the University of Florida ICBR Biological Computing

Facility.


Results


Clones Representing the ZYMV Genome

The initial cloning experiment using Agtll yielded an

estimated 73 x 106 clear (positive) plaques, and the yield









from AZAPII was estimated to be 14 x 106 clear plaques.

After serological screening with antisera to the CP, NIa,

CI, AI, and HC/Pro, several clones were selected which were

specific to each of these protein-encoding regions on the

ZYMV genome. In the Agtll cloning experiment, ten clones

were identified by the reactivity of their expressed

products with CP antiserum. Nine of these clones were

specific for the CP and an additional, large clone of 4.5-

kilobase pairs (kbp), was reactive with both CP and NIa

antisera (Table 2-1). Two clones were identified which

represented the CI, and two which represented the AI coding

region. Preliminary sequencing indicated that the AI-

positive clones were not large enough to include the Pl-

encoding region. Subsequent cloning experiments using

AZAPII yielded six additional CI-positive clones, seven

additional AI-positive clones, and three clones that were

both CI- and AI-positive (Table 2-2). Three of the CI

clones were large enough to code for both the CI and AI

regions, and their products reacted with antisera to both CI

and AI proteins. An AI-positive clone of 2.9-kbp was

selected (AI6) which included all of Pl, AI, and a portion

(ca. 600-bp) of P3. Clone AI6 also represented 55-bp of the

leader sequence. None of the 30 clones was identified that

represented the entire leader sequence, which, based on the

ZYMV-CA sequence, is approximately 141-bp.













Table 2-1. ZYMV-FL/AT cDNA clones identified
by immunoscreening in Xgtll.


Clone
designation
CP1

CP2

CP3

CP4

CP5

CP6

CP7

CP8

CP9

CP10

CI1

CI2

All

AI2


Approximate
size (kbp)
0.85

1.40

0.60

0.40

1.75

0.75

4.50

1.80

3.30

1.30

2.30

2.20

1.60

0.90


Serologicala
reactivity
CP

CP

CP

CP

CP

CP

CP,NIa

CP

CP

CP

CI

CI

AI

AI


coding regions listed refer to clones, the
products of which reacted with antisera to
the capsid protein (CP), small nuclear inclusion
protein (NIa), cylindrical inclusion protein
(CI), or amorphous inclusion protein (AI) in
immunoscreening assays.













Table 2-2. ZYMV-FL/AT cDNA clones identified
by immunoscreening in XZAPII.


Clone
designation

CI3

CI4

CI5

CI6

CI7

CI8

CI9

CI10

CI11

AI3

AI4

AI5

AI6

AI7

AI8

AI9


Approximate
size (kbp)

1.80

3.50

3.00

2.90

2.80

2.00

1.60

1.80

2.50

1.50

1.60

1.90

2.90

1.50

3.00

3.00


Serologicala
reactivity

CI

CI,AI

CI,AI

CI,AI

CI

CI

CI

CI

CI

AI

AI

AI

AI

AI

AI

AI


coding regions listed refer to clones, the
products of which reacted with antisera to
the cylindrical inclusion protein (CI), or
amorphous inclusion protein (AI) in immuno-
screening assays.
















































































0

Pc4H

UY



'-4



04


















0
(n 4)


u 1

Qii
C3 0-O


Q)0 J-r4 0








#$4 r
IL) 00




400
lW *-I 0o


) a 4) 0


u m0








0 04
r*4














41 00)




4) 0
OSA





























M) 4-14 0
*045










I H 0
t 4 ) 0
0 rI M ^
















S$4 0
- aI .



N 04 *




a
S uO






*

04













0




















V-4
04









Sequences Representing the 5'-terminus of ZYMV

Four clones were selected which together represent the

entire ZYMV-FL/AT genome; AI6 (2.9-kbp), AI8 (3.0-kbp), CI1

(2.3-kbp), and CP7 (4.5-kbp) (Fig. 2-1). Several additional

clones were used to sequence the entire region from P1

through the P3-encoding region (Fig. 2-2).

The sequence of ZYMV-FL/AT, from the 55-bp of the

leader through P3, with the corresponding amino acid

sequence, is presented in Fig. 2-3. Based on consensus

sequences (Oh and Carrington, 1989; Mavankal & Rhoads, 1991;

Thornbury et al., 1990; Verchot et al., 1991), the P1-

encoding region of ZYMV-FL/AT is 912-bp, the AI is 1,386-bp,

and P3 is 1,191-bp in length. The cleavage site between P1

and Al is at amino acid position 304-305 (tyr/ser), whereas

the site between AI and P3 is at amino acid position 766-767

(gly/gly), and between P3 and CI is at position 1,164-1,165

(glu/gly).

In the Pi-encoding region, the consensus sequence for

the predicted protease at the C-terminus is Gly-Xaa-Ser-Gly-

--Phe-Ile-Val-Arg-Gly (Verchot et al., 1991), Xaa being any

amino acid, whereas that for ZYMV-FL/AT is Gly-Cys-Ser-Gly--

-Leu-Val-Ile-Arg-Gly. In addition, Ser and His were found

at positions 264 and 223, respectively. These amino acids

are strictly conserved among potyviruses. Both the Ser and

His have been shown by point mutations in tobacco etch virus




























Fig. 2-3. Nucleotide and deduced amino acid sequence of
ZYMV-FL/AT. Amino acids are represented by a single
letter code. Underlined residues represent sequences
similar to conserved potyviral sequences. Asterisks
indicate amino acids strictly conserved among potyviruses
that have been sequenced. Slash(/) indicates cleavage
sites between proteins.










1 60

AACTCTTACAGTATTTAGAAATTCTCCAATCACTTCGTTTACTTCAGACATAACAATGGC



M A

61 120

CTCTATCATGATTGGTTCAATCTCCGTACCCATTGCAAAGACTAAGCAGTGTGCAAACAC

S I M I G S I S V P I A K T K Q C A N T

121 180

TCAAGTAAGTAATCGGGTTAATATAGTGGCACCTGGCCACATGGCAACATGCCCATTGCC

Q V S N R V N I V A P G H M A T C P L P

181 240

ACTGAAAACGCACATGTATTACAGGCATGAGTCCAAGAAGTTGATGCAATCAAACAAAAG

L K T H M Y Y R H E S K K L M Q S N K S

241 300

CATTGACATTCTGAACAATTTCTTCAGCACTGACGAGATGAAGTTTAGGCTCACTCGAAA

I D I L N N F F S T D E M K F R L T R N

301 360

CGAGATGAGCAAGGTGAAAAAGGGTCCGAGTGGGAGGATAGTCCTCCGCAAGCCGAGTAA

E M S K V K KG PS G RI V L R K P S K

361 420

GCAGCGGGTTTTCGCTCGTATTGAGCAGGATGAGGCAGCACGCAAGAAAGAGACTGTTTT

Q R V F A R I E Q D E A A R K K E T V F

421 480

CCTCGAAGGAAATTATGACGATTCTATCACAAATCTAGCACGTGTTCTTCCACCTGAAGT

L E G N Y D D S I T N L A R V L P P E V

Fig. 2-3--continued.










481 540

GACTCACAACGTTGATGTGAGCTTGACGTCATCGTTTACAAGCGCACATACAAGAAGGA

T H N V D V S L T S S F Y K R T Y K K E


541


600


AAGGAAGAAAGTGGCGCAAAAGCAAATTGTGCAAGCACCACTCAATAGCTTGTGCACACG

R K K V A Q K Q I V Q A P L N S L C T R


601


660


TGTTCTTAAAATTGCACGCAATAAAAATATCCCTGTTGAGATGATTGGCAACAAGAAGGC

V L K I A R N K N I P V E M I G N K K A


661


720


GAGACATACACTCACCTTCAAGAGGTTTAGGGGATATTTTGTTGGAAAGGTGTCAGTTGC

R H T L T F K R F R G Y F V G K V S V A

721 780

GCATGAAGAAGGACGAATGCGGCGCACTGAGATGTCGTATGAGCAGTTTAAATGGATTCT



H E E G R M R R T E M S Y E Q F K W I L


781


840


AAAAGCCATTTGTCAGGTCACCCATACAGAGCGAATTCGTGAGGAAGATATTAAACCAGG

K A IC Q V T H T ER I R E E D IK PG


841


900


TTGTAGTGGGTGGGTGTTGGGCACTAATCATACATTGACTAAAAGATATTCAAGATTGCC



C S G W V L G T N H T L T K R Y S R L P


Fig. 2-3--continued.










901 960

ACATTTGGTGATTCGAGGTAGAGACGACGATGGGATTGTGAACGCGCTGGAACAGGTGTT

H L V I R G R D D D G I V N A L E Q V L

961 1020

ATTTTATAGCGAAGTTGACCACTATTCGTCGCAACCGGAAGTTCAGTTCTTCCAAGGATG

F Y/ S E V D H Y S S Q P E V Q F F Q G W

1021 1080

GCGACGAATGTTTGACAAGTTTAGGCCCAGCCCAGATCATGTGTGCAAAGTTGACCACAA

R R M F D K F R P S P D H V C K V D H N

1081 1140

CAACGAGGAATGTGGTGAGTTAGCAGCAATCTTTTGTCAGGCTTTATTCCCAGTAGTGAA

*

N E E C G E L A A I F C Q A L F P V V K

1141 1200

ACTATCGTGCCAAACATGCAGAGAAAGCTTAGTAGAAGTTAGCTTTCGAGGAATTAAAGA

L S C Q T C R E S L V E V S F R G I K D

1201 1260

TTCTTTGAACGCAAACTTTATTGTCCACAAGGATGAATGGGGTAGTTTCAAGGAAGGCTA

S L N A N F I V H K D E W G S F K E G Y

1261 1320

TCAATACGATAATATTTTCAAATTAATCAAAGTGGCAACACAGGCAACTCAGAATCTCAA

Q Y D N I F K L I K V A T Q A T Q N L K

1321 1380

GCTCTCATCTGAAGTTATGAAATTAGTTCAGAACCACACAAGCACTCACATGAAGCAAAT

L S S E V M K L V Q N H T S T H M K Q I

Fig. 2-3--continued.










1381 1440

ACAAGACATCAACAAGGCGCTCATGAAAGGTTCGGTTATTGGTTACGCAAGACGAATTGGACTT

Q D I N K A L M K G S L V T Q D E L D L

1441 1500

AGCTTTGAAACAGCTTCTTGAAATGACTCAGTGGTTTAAGAACCACATGCACCTGACTGG

A L K Q L L E M T Q W F K N H M H L T G

1501 1560

TGAGGAGGCATTGAAGATGTTCAGAAATAAGCGTTCTAGCAAGGCCATGATAAATCCTAG

E E A L K M F R N K R S S K A M I N P S

1561 1620

CCTTCTATGTGACAACCAATTGGACAAAAATGGAAATTTTGTTTGGGGAGAAAGAGGATA

L L C D N Q L D K N G N F V W GE R G Y

1621 1680

CCATTCCAAGCGATTATTCAAGAACTTCTTCGAAGAAGTAATACCAAGCGAAGGATATAC

H S K R L F K N F F E E V I P S E G Y T

1681 1740

GAAGTACGTAGTGCGAAACTTTCCAAATGGTACTCGTAAGTTGGCCATAGGCTCGTTGAT

K Y V V R N F P N G T R K L A I G S L I

1741 1800

TGTACCACTCAATTTGGATAGGGCACGCACTGCACTACTTGGAGAGAGTATTGAGAAGAA

V P L N L D R A R T A L L G E S I E K K

1801 1860

GCCACTCACATCAGCGGTGTGCTCCCAACAGAATGGAAATTATATACACTCATGCTGCTG

P L T S A C V S Q Q N G N Y I H S C C C


Fig. 2-3--continued.











1861 1920

TGTAACGATGGATGATGGAACCCCGATGTACTCCGAGCTTAAGAGCCCGACGAAGAGGCA

V T MD D G T PM Y S E L K S PT K R H

1921 1980

TCTAGTTATAGGAGCTTCTGGTGATCCAAAGTACATTGATCTGCCAGCATCTGAGGCAGA

L V I G A S G D P K Y I D L P A S E A E

1981 2040

ACGCATGTATATAGCAAAGGAAGGTTATTGCTATCTCAATATTTTCCTCGCAATGCTTGT



R M Y I A K E G Y C Y L N I F L A M L V

2041 2100

AAATGTTAATGAGAACGAAGCAAAGGATTTCACCAAAATGATTCGTGATGTTTTGATCCC

N V N E N E A K D F T K M I R D V L I P

2101 2160

CATGCTTGGGCAGTGGCCTTCATTGATGGATGTTGCAACTGCAGCATATATTCTAGGTGT

M L G Q W P S L M D V A T A A Y I L G V

2161 2220

ATTCCATCCTGAAACGCGATGCGCTGAATTACCCAGGATCCTTGTTGACCACGCTACACA

F H P E T R C A E L P R I L V D H A T Q

2221 2280

AACCATGCATGTCATTGATTCTTATGGATCACTAACTGTTGGGTATCACGTGCTCAAGGC



T M H V I D S Y G S L T V G Y H V L K A


Fig. 2-3--continued.










2281 2340

CGGAACTGTTAATCATTTAATTCAATTTGCCTCAAATGATCTGCAAAGCGAGATGAAACA

G T V N H L I Q F A S N D L Q S E M K H

2341 2400

TTACAGAGTTGGCGGAACACCAACACAGCGCATTAAACTCGAGGAGCAGCTGATTAAAGG

Y R V G/ G T P T Q R I K L E E Q L I K G

2401 2460

AATTTTCAAACCAAAACTTATGATGCAGCTCCTGCATGATGACCCATACATATTATTGCT

I F K P K L M M Q L L H D D P Y I L L L

2461 2520

TGGCATGATCTCACCCACCATTCTTGTACATATGTATAGGATGCGTCATTTTGAGCGGGG

G M I S P T I L V H M Y R M R H F E R G

2521 2580

TATTGAGATATGGATTAAGAGGGATCATGAAATCGGAAAGATTTTCGTCATATTAGAGCA

I E I W I K R D H E I G K I F V I L E Q

2581 2640

GCTCACACGCAAGGTTGCTCTGGCTGAAGTTCTTGTGGATCAACTTAACTTGATAAGTGA

L T R K V A L A E V L V D Q L N L I S E

2641 2700

AGCTTCACCACATTTACTTGAAATTATGAAGGGTTGTCAAGATAATCAGAGGGCATACGT

A S P H L L E I M K G C Q D N Q R A Y V

2701 2760

ACCTGCGCTGGATTTGTTAACGATACAAGTGGAGCGTGAGTTTTCAAATAAAGAACTCAA

P A L D L L T I Q V E R E F S N K E L K


Fig. 2-3--continued.










2761 2820

AACCAATGGTTATCCCGATTTGCAGCAAACGCTCTTCGATATGAGGGAAAAAATGTATGC

T N G Y P D L Q Q T L F D M R E K M Y A

2821 2880

AAAGCAGCTGCACAATTCATGGCAAGAGCTAAGCTTGCTGGAAAAATCCTGTGTAACCGT

K Q L H N S W Q E L S L L E K S C V T V

2881 2940

GCGATTGAAGCAATTCTCGATTTTTACGGAAAGAAATTTAATCCAGCGAGCAAAAGAAGG

R L K Q F S I F T E R N L I Q R A K E G

2941 3000

AAAGCGCGCATCTTCGCTACAATTTGTTCACGAGTGTTTTATCACGACCCGAGTACATGC

K R A S S L Q F V H E C F I T T R V H A

3001 3060

GAAGAGCATTCGCGATGCAGGCGTGCGCAAACTAAATGAGGCTCTCGTCGGAATTTGTAA

K S I R D A G V R K L N E A L V G I C K

3061 3120

ATTCTTTTTCTCTTGTGGTTTCAAAATTTTTGCACGATGCTATAGCGACATAATATACCT

F F F S C G F K I F A R C Y S D I I Y L

3121 3180

TGTGAACGTGTGTTTGGTTTTCTCCTTGCTGCTACAAATGTCCAATACTGTGCGCAGTAT

V N V C L V F S L L L Q M S N T V R S M

3181 3240

GATAGCAGCGACAAGGGAAGAAAAAGAGAGAGCGATGGCAAATAAAGCTGATGAAAATGA

I A A T R E E K E R A M A N K A D E N E


Fig. 2-3--continued.










3241 3300

AAGGACGTTAATGCATATGTACCACATTTTCAGCAAGAAACAGGATGATGCGCCCATATA

R T L M H M Y H I F S K K Q D D A P I Y

3301 3360

CAATGACTTTCTTGAACATGTGCGTAATGTGAGACCAGATCTTGAGGAAACTCTCTTGTA

N D F L E H V R N V R P D L E E T L L Y

3361 3420

CATGGCTGGCGTAGAAGTTGTTTCAACACAGGCTAAGTCAGCGGTTCAGATTCAATTCGA

M A G V E V V S T Q A K S A V Q I Q F E

3421 3480

GAAAATTATAGCTGTGTTGGCGCTGCTTACCATGTGCTTTGACGCCGAAAGAAGCGATGC

K I I A V L A L L T M C F D A E R S D A

3481 3540

CATTTTCAAGATTTTGACAAAACTCAAAACAGTTTTTGGTACGGTTGGAGAAACGGTCCG

I F K I L T K L K T V F G T V G E T V R

3541 3547

ACTTCAA

L Q /

Fig. 2-3--continued.








36

(TEV, Verchot et al., 1991) to be important for proteolytic

processing between P1 and AI proteins.

In the N-terminus of the AI region, the consensus

sequence for aphid transmission is reported to be Cys-Gly-

Val-Ala-Ala----Pro-Cys-Lys-Ile-Tyr-Cys--Cys (Thornbury et

al., 1990), where Lys is the putative amino acid required

for aphid transmission. The corresponding sequence for

ZYMV-FL/AT is Cys-Gly-Leu-Ala-Ala----Pro-Val-Lys-Leu-Ser-

Cys--C (Fig. 2-3). This consensus sequence for ZYMV-FL/AT

is the same as that for ZYMV-CA and ZYMV-RU (Baker et al.,

1991b). The two amino acid residues required for protease

activity of the HC/Pro (Oh and Carrington, 1989) are also

conserved with a Cys at position 652 and a His at position

725 (Fig. 2.3).

The deduced amino acid sequence of P1 of ZYMV-FL/AT was

used to prepare a hydrophobicity plot according to Kyte &

Doolittle (1982) (Fig. 2-4). The P1 protein is highly

hydrophilic except for a strongly hydrophobic N-terminal 20

amino acids. There is no obvious pattern to suggest a

transmembrane motif. The P1 of ZYMV-FL/AT also has a high

proportion of basic amino acids (Fig. 2-5) and is thus

highly positively charged. In contrast, the hydrophobicity

map for P3 (Fig. 2-6) shows a distribution of both

hydrophobic and hydrophilic regions, and a fairly random

distribution of acidic as well as basic amino acids (Fig. 2-

7). Interestingly, this plot is quite similar to that of



















100 200 300
3 111' I 1 II I I 1111 I 11 It 3

2 2

0- 0

-1 -1
-2 -2
-3 -3
-4 -4

100 200 300






Fig. 2-4. Hydrophobicity of P1 of ZYMV-FL/AT
plotted according to Kyte and Doolittle (1982).
Horizontal scale represents amino acid residues of
PI. Vertical scale represents hydrophobic amino
acids (above the midline) and hydrophilic amino
acids (below the midline).



















100 200 300

A A i


100 200 300




Fig. 2-5. Map of acidic (A) and basic (B)
residues of the P1 protein of ZYMV-FL/AT.

















100 200 300

3
2 -
1 -
0-
-1
-2


100 200 300





Fig. 2-6. Hydrophobicity plot of the P3 sequence of
ZYMV-FL/AT. The horizontal scale indicates amino acid
residues in the P3 protein. The hydrophobicity (vertical)
scale is that of Kyte and Doolittle (1982), with hydrophobic
amino acids above the midline and hydrophilic amino acids
below the midline. Residues for ca. 35-50 and ca. 260-280
correspond to those suggested for P3 of TVMV to be involved
in the formation of membrane spanning helices
(Rodriguez-Cerezo and Shaw, 1991).








40














100 200 300




100 200 300
100 200 300


Fig. 2-7. Map of acidic (A) and basic (B) amino acid
residues of the P3 protein of ZYMV-FL/AT.








41

the P3 of TVMV (Rodriguez-Cerezo and Shaw, 1991). Two areas

of the P3 of ZYMV-FL/AT, indicated in Fig. 2-6, corresponded

to the possible membrane spanning helices suggested by

Rodriguez-Cerezo and Shaw.

Homologies Between the P1 of ZYMV Isolates

Comparisons were made between the P1 encoding regions

of five ZYMV isolates: ZYMV-CA, ZYMV-RU, ZYMV-FL/AT, ZYMV-

SV, and ZYMV-MD. The latter three isolates were sequenced

in the present study. The sequence of P1 from ZYMV-FL/AT

was derived from clones produced in Agtll and AZAPII. The

sequences of P1 from ZYMV-SV and ZYMV-MD were derived from

clones produced by RNA-PCR products using custom primers for

P1. The specific primers for production of P1 were, on the

5'-terminus, 5'-CATGAGAATTCAAGCTTACATGGCCTCTATCATG-3', and

on the 3'-terminus, 5'-CTGACTTCTAGACCTGTTCCAGCGCGTTCA-3'.

Initial comparison of P1 products from RNA-PCR in agarose

gels between the mild and severe isolates showed a size

difference between the two, with the mild being slightly

larger (Fig. 2-8). Nucleotide sequence comparisons showed

an 18 nt insert in the mild isolate immediately after the

start codon (Fig. 2-9), thus accounting for the size

difference noted in agarose gels. The sequences between the

ZYMV-FL/AT, ZYMV-SV and ZYMV-MD were quite similar, with a

nt homology of 98% between ZYMV-FL/AT and the ZYMV-SV

isolate, and a 95% homology between the ZYMV-FL/AT and the

ZYMV-MD isolate. Of ten amino acid changes in the ZYMV-SV

























p r


-2,036
-1,636

-1, 018




506
396
344
298





Fig. 2-8. Electrophoretic analysis of PCR products
of P1 from ZYMV-MD and ZYMV-SV using primers
specific to the P1 coding region in a 0.9% agarose
gel.



























Fig. 2-9. Nucleotide sequence alignments of the P1
coding region from ZYMV-FL/AT with that of ZYMV-CA,
-SV, -MD, and -RU. Clones of ZYMV-SV and ZYMV-MD
extend only to the GGAACAGG motif as shown due to
the primer selection for PCR cloning.













1
ATG.......
ATG........
ATG .......
ATGAGAATTC
ATG.......

51
ACCCATTGCA
ACCCATTGCA
ACCCATTGCA
ACCCATTGCA
CCCTATCGTT

101
TTAATATAGT
CTAATATAGT
TTAGTATAGT
TTAATATAGT
TGAATATTGT

151
ACGCACATGT
ACGCACATGT
ACGCACATGT
ACGCACATGT
TCGCACTCAT

201
CAAAAGCATT
CAAGAGCATT
CAAAAGCATT
CAAAAGTATT
TGAAAGCATT

251
AGTTTAGGCT
AGTTTAGGCT
AGTTTAGGCT
AGTTTAGTGT
GTTTTAGGCT

301
GGGAGGATAG
GGGAGGATAG
GGGAGGATAG
GGGAGGATAG
GGAAGGATGA


AAGCTTTACA


AAGACTAAGC
AAGACTGAGC
AAGACTGAGC
AAGACTGAGC
GAGTCTGCTC


GGCACCTGGC
GGCACCTGGC
GCCACCTGG.
GGCACCTGGC
GGCACCTGGC


ATTACAGGCA
ATTACAGGCA
ATTACAGGCA
ATTACAGGCA
ATTACAAACA


GACATTCTGA
GACATTCTGA
GACATTCTGA
GACATTCTGA
AATATCCTCA


CACTCGAAAC
CACTCGAAAC
CACTCGAAAC
CACTCGAAAC
CACTCGCAAT


TCCTCCGCAA
TCCTCCGCAA
TCCTCCGCAA
CCCTCCGCAA
TACTCCGCAA


.GCCTCTATC
.GCCTCCATC
.GCCTCTATC
TGCCTCTATC
.GCCGCTATC


AGTGTGCAAA
AGTGTGCAAA
AGTGTGCAAA
ACTGTGCAAA
GGTGTGCAAC


CACATGGCAA
CACATGGCAA
..CATGGCAA
CACATGGCAA
CACGTGGCAG


TGAGTCCAAG
TGAGTCCAAG
TGAGTCCAAG
TGAGTCCAAG
TGCATCAGAG


ACAATTTCTT
ACAACTTCTT
ACAATTTCTT
ACAATTTCTT
ATAGTTTCTT


GAGATGAGCA
GAGATGAGCA
GAGATGAGCA
GAGATGAGCA
GAGATGAGCA


GCCGAGTAAG
GCCGAGTAAG
GCCGAGTAAG
GCCGAGTAAG
ACCAAGAGCA


ATGATTGGTT
ATGATTGGTT
ATGATTGGTT
ATGATTGGTT
ATGATTGGTT


CACTCAAGTA
CACTCAAGTA
CACTCAAGTA
CACTCAAGTA
GGTTCAAACT


CATGCCCATT
CATGCCCATT
CATGCCCATT
TATGCCCATT
TTTGCAAGCC


AA...GTTGA
AA...GTTGA
AA...GTTGA
AA...GTTGA
AAACTCTCCA


CAGCACTGA.
CAGCACTGA.
CAGCACTGA.
CAGCACTGA.
TGACACTGAT


AGGTGAAAAA
AGCTGAAAAA
AGGTGAAAAA
AGGTTAAAAA
AGGTAAAGAA


CAGCGGGTTT
CAGCGGGTTT
CAGAGGGTTT
CAGCGGGTTT
CAACGTGTTT


CAATCTCCGT
CAATCTCTGT
CAATCTCGGT
CAATCTCTGT
CAATCTCTGT

100
AGTAATCGGG
AGTAATCGGG
AGTAATCGGG
AGTAATCGGG
GGAAACCGTG

150
GCCACTGAAA
GCCACTGAAA
GCCACTGAAA
GCCACTGAAA
ACAAATGAAA

200
TGCAATCAAA
TGCAATCAAA
TGCAATCAAA
TGCAATCAAA
AACAAGCTAG

250
..CGAGATGA
..CGAGATGA
..CGAGATGA
..CGAGATGA
CCAGAGATGC

300
GGGTCCGAGT
GGGTCCGAGC
GGGTCCGAGT
GGGTCCGAGT
GGGGCCAAAT

350
TCGCTCGTAT
TCGCTCGTAT
TCGCTCGTAT
TCGCTCGTAT
TGGAGCGTAT













351
TGAGCAGGAT
CGAGCAGGAT
TGAGCAGGAT
TGAGCAGGAT
CAGCTTTGAA

401
ATTATGACGA
ATTATGACGA
ATTATGACGA
ATTATGACGA
GAGTATATGC

451
ACTCACAACG
ACTCACAACG
ACTCACAACG
ACTCACAACG
AATGGCATAG

501
CAAGAAGGAA
CAAGAAGGAA
CAAGAAGGAA
CAAGAAGGAA
CAGAAAGGAA

551
CACTCAATAG
CACTTAATAG
CACTTAATAG
CACTTAATAG
GTGTTAATAA

601
ATCCCTGTTG
ATCCCTGTTG
ATCCCTGTTG
ATCCCTGTTG
ATTCCAGTTG


GAGGCAGCAC
GAGGCAGCAC
GAGGCAGCAC
GAGGCAGCAC
AAGATCGAAA


TTCTATCACA
TTCCATCACA
TTCGATCATA
TTCGATCACA
TACTGTGACG


TTGATGTGAG
TTGATGTGAG
TTGATGTGAG
TTGATGTGAG
CTAACTCAAG


AGGAAGAAAG
AGGAAGAAAG
AGGAAGAAAG
AGGAAGAAAG
AAGAAGAAAA


CTTGTGCACA
CTTGTGCACA
TTTGTGCACA
CTTGTGCACA
TCTGTGCGAT


AGATGATTGG
AGATGATTGG
AGATGATTGG
AGATGATTGG
AAATGATTGG


651
FL CAAGAGGTTT AGGGGATATT
CA CAAGAGGTTT AGGGGATGTT
SV CAAGAGGTTT AGGGGATGTT
MD CAAGAGGTTT AGGGGATATT
RU CAAGAACTTT AAGGGATCTT
Fig. 2-9--continued.


GCAAGAAAGA
GCAAGGAAGA
GCAAGGAAGA
GCAAGGAAGA
AAGGAGCAGA


AATCTAGCAC
AATCTAGCAC
AGTCTAGCAC
AATCTAGCAC
TCCATCATTA


CTTGACGTCA
CTTGCGATCA
CTTGACGTCA
CTTGACGTCA
TTTGCGCTCA


TGGCGCAAAA
TGGCGCAAAA
TGGCGCAAAA
TGGCGCAAAA
TAGTATGTGA


CGTGTTCTTA
CGTGTTCTTA
CGTGTTCTTA
CGTGTTCTTA
CGCGTTCTCA


CAACAAGAAG
CAACAAGAAG
CAACAAGAAG
CAACAAGAAG
AAAGAAAAAG


TTGTTGGAAA
TTGTTGGAAA
TTGTTGGAAA
TTGTTGGAAA
TCATTGGGAA


GACTGTTTTC
GGCTGTTTTC
GGCTGTTTTC
GGCTGTTTTC
AAGACAAGTT


GTGTTCTTCC
GTGTTCTTCC
GTGTTCTTCC
GTGTTCTTCC
ATACATTCAC


TCGTTTTACA
CCGTTTTACA
CCGTTTTACA
CCATTTTACA
CCGTTCTATA


GCAAATTGTG
GCAAATTGTG
GCAAATTGTG
GCAGATTGTG
AAATGTTGTG


AAATTGCACG
AAATTGCACG
AAATTGCACG
AAATTGCACG
AGATAGCGCG


GCGAGACATA
ACGAGACATA
GCGAGACATA
GCGAGACATA
AATCGACACA


GGTGTCAGTT
GGTGTCAGTT
GGTGTCAGTT
GGTGTCAGTT
AGTTTCATTA


400
CTCGAAGGAA
CTCGAAGGAA
CTCGAAGGAA
CTCGAAGGAA
CTACCATGGC

450
ACCTGAAGTG
ACCTGCCGTG
ACCTGAAGTG
ACCTGAAGTG
AGATGAAAGG

500
AGCGCACATA
AGCGCACATA
AGCGCACATA
AGCGCACATA
AACGTTCATG

550
C...AAGCAC
C...AAGCAC
C...AAGCAC
C...AAGCAC
CGTTCAGCCA

600
CAATAAAAAT
CAATAAAAAT
CAATAAAAAT
CAATAAAAAT
GGAGAAAAAC

650
CACTCACCTT
CACTCACCTT
CACTCACCTT
CACTCACCTT
CCCTCACCTT

700
GCGCATGAAG
GCGCATGAAG
GCGCATGAAG
GCGCATGAAG
GCACACGAAA















701
AAGGACGAAT
AAGGACGAAT
AAGGACGAAT
AAGGACGAAT
GGGGCCAAAT

751
CTAAAAGCCA
CTTAAAGCCA
CTAAAACCCA
CTAAAAGCCA
CTACAAGCCA

801
TATTAAACCA
TATTAAACCA
TATTAAACCA
TATTAAACCA
CATCAAGCCG

851
CTAAAAGATA
CTAAAAGATA
CTAAAAGATA
CTAAAAGATA
CTCAGAAATT

901
GATGGGATTG
GATGGGATTG
GATGGGATTG
GATGGGATTG
GAAGGAATTG


GCGGCGCACT
GCGGCACACT
GCGGCGCACT
GCGGCGCACT
GAGACATGTT


TTTGTCAGGT
TTTGTCAGGT
TTTGTCAGGT
TTTGTCAGGT
TCTGTCGGGT


GGTTGTAGTG
GGTTGTAGTG
GGTTGTAGTG
GGTTGTAGTG
GGGTGTAGCG


TTCAAGATTG
TTCAAGATTG
TTCAAGATTG
TTCAAGATTG
TTCGAGGTTA


TGAACGCGCT
TGAACGCGCT
TGAACGCGCT
TGAACGCGCT
TGAATGCATT


750
GAGATGTCGT ATGAGCAGTT TAAATGGATT
GAGATGTCGT ATGAGCAGTT TAAATGGCTT
GAGATGTCGT ATGAGCAGTT TAAATGGATT
GAGATGTCGT ATGAGCAGTT TAAATGGATT
GAGATGTCGT ACGAACAGTT TGGATTCATT


CACCCATACA
CACCCATACA
CACCTATACA
CACCCATACA
TACGAACACA


GGTGGGTGTT
GGTGGGTGTT
GGTGGGTGTT
GGTGGGTGTT
GATGGGTTCT


CCACATTTGG
CCACATTTGG
CCACATTTGG
CCACATTTGG
CCATGCCTAG


GGAACAGGTG
GGAACAGGTG
GGAACAGG..
GGAACAGG..
AGAACCAGTG


GAGCGAATTC
GAGCGAATTC
GAGCGAATTC
GAGCGAATTC
AGATGTGTGC


GGGCACTAAT
GGGCACTAAT
GGGCACTAAT
GGGCACTAAT
AGGCGATGAT


TGATTCGAGG
TGATTCGAGG
TGATTCGAGG
TGATTCGAGG
TAATTCGTGG


800
GTGAGGAAGA
GTGAGGAAGA
GCGAGGAAGA
GTGAGGAAGA
GCGATGAGGA

850
CATACATTGA
CATACATTGA
CATACATTGA
CATACATTGA
CACGAACTTA

900
TAGAGACGAC
TAGAGACGAC
TAGAGATGAC
TAGAGACGAC
TAGAGATGAT


942
TTATTTTATA GC
TTATTTTATA GC


TTCTTCTATG AT


Fig. 2-9--continued.

















1
M----ASI
.RIQALH...
S----.A.

. M I- Il 1 *

51
THMYYRHESK
..........
S.S..K.A.E
..........


101
GRIVLRKPSK
...A......
..MIL...RA
..........
..........
151
PEVTHNVDVS
..........
NGIA-NS--.
..........
.A........
201
NKNIPVEMIG


E..........
E.........


..........
251
KWILKAICQV


GF..Q...R.
.....P....


301
RDDDGIVNAL


...E......
...Eooeoe


MIGSISVPIA


S. .V





KLMQSNK-SI


..SKQASE..





QRVFARIEQD


...LE..SFE





LTSSFYKRTY
...P......
.R.P .... SC
...P......
.R.P......


KTKQCANTQV
..EH ......
ESAR..TV.T
..E.......
..E.......


DILNNFFSTD
..........
N...S..D..





--E-AARKKE
--.-...E.
KI.KG.ERQV
--.-...E.
--.-....E.


KKERKKVAQK


R..K..IVCE
..........


NKKARHTLTF KRFRGYFVGK


...... ..
K..N......

S. .T......
...T ......


THTERIREED


.N.RCV.D..
.Y ........
.........
orreeoee


.N.K.S.I..


.....C....
*
IKPGCSGWVL



..........
ee ee


SNRVNIVAPG

G..........
G.........
.... S..P..
. .A. ... .


-EMKFRLTRN
-....SV...
P..R ......





TVFLEGNYDD
A..........
LPWRVYATVT
A.........
A.........


QIVQAP-LNS


NV.RSASV.N



*
VSVAHEEGRM


..L...R.Q.





GTNHTLTKRY


.DD.E..QKF

..........e o


50
HMATCPLPLK
...1......
.V.V.KPQM.


..........
100
EMSKVKKGPS
..........
.........N


... L.....
150
SITNLARVLP
..........
..I.TFTDER
..IS......
..........
200
LCTRVLKIAR
..........
..D.......
..........
..........
250
RRTEMSYEQF

.HV.......

.HV.......


300
SRLPHLVIRG


..C-.....
..PC-......
..........


EQVLFYS


.P.F..D


CA RDDDGIVNAL EQVLFYS


Fig. 2-10. Amino acid sequence alignment of the P1 proteins
of five ZYMV isolates: ZYMV-FL/AT, -MD, -RU, -SV, and
-CA. Conserved residues among ZYMV isolates are underlined.
Asterisks indicate strictly conserved residues among
potyviruses. ZYMV-MD and -SV terminate at -EQ due to
primer selection for PCR.









isolate compared to ZYMV-FL/AT, five made a difference in

the polarity or charge, and five changes made no difference.

In addition there was a deletion of a His at position 41 in

the ZYMV-SV isolate. The P1 from the ZYMV-MD isolate had an

insert of 6 additional amino acids immediately following the

initiation codon, compared to ZYMV-FL/AT. There were nine

different amino acids in the N-terminal half of ZYMV-MD,

seven of which made a difference in the charge or polarity.

The P1 of ZYMV-CA had a high degree of similarity

compared to ZYMV-FL/AT (96%), whereas ZYMV-RU was highly

divergent with only a 60% nt sequence homology compared to

the P1 of ZYMV-FL/AT (Table 2-3). In spite of the

variability seen among five P1 regions, certain consensus

regions and amino acids believed to be involved or required

for protease activity of P1 were conserved. For example,

all five isolates had the amino acid consensus Gly-Xaa-Ser-

Gly, the His at position 223 and Ser at position 264 (Fig.

2-10). The conserved potyvirus sequence of Phe-Ile-Val-

Arg-Gly (Verchot et al., 1991) close to the P1/AI cleavage

site, was slightly different, with a sequence of Leu-Val-

Ile-Arg-Gly for all five isolates (Fig. 2-10).

Homologies Between P1. AI. and P3 of ZYMV Isolates and Other

Potyviruses

Nucleotide and amino acid sequence comparisons were

made between the P1, AI, and P3 of ZYMV-FL/AT with ZYMV-CA,














Table 2-3. Percentage of nucleotide and amino acid
sequence homologies of the P1, amorphous inclusion
(AI), and P3 regions of four ZYMV isolates and five
distantly related potyviruses with respect to
ZYMV-FL/AT.


Virus/isolate


ZYMV-CA

ZYMV-SV

ZYMV-MD

ZYMV-RU

TEV

PVYN

TVMV

PPV

PSbMV


96(97)

98(97)

95(97)

60(70)

42(45)

37(46)

39(48)

41(38)

39(37)


98(98)

ndb

nd

88 (96)

52 (63)

51 (64)

52 (64)

52 (65)

50 (58)


98(99)

nd

nd

84 (96)

43 (54)

44 (49)

44 (52)

45 (50)

45 (52)


a
Homologies were determined using the GAP alignment
of the University of Wisconsin Genetics Computer
Group Program. GAP calculates alignment of two
complete sequences that maximizes the number of
matches and minimizes the number of gaps.
Nucleotide sequence homologies are listed first
with amino acid homologies in ().


b
nd=not determined










ZYMV-RU, TEV (Allison et al., 1986), potato virus Y-strain

N(PVY") (Robaglia et al., 1989), TVMV (Domier et al., 1986),

plum pox virus (PPV) (Lain et al., 1990), and pea seed-borne

mosaic virus (PSbMV) (Johansen et al., 1991) (Table 2-3).

Sequence comparisons also were made between ZYMV-FL/AT, and

ZYMV-SV, and ZYMV-MD for P1.

The P1 of ZYMV-CA, ZYMV-SV, and ZYMV-MD had high nt and

amino acid sequence homologies to ZYMV-FL/AT ranging from

96% (CA) to 98% (SV). However, the P1 gene of ZYMV-RU had a

60% nt and a 70% amino acid homology compared to the P1 of

ZYMV-FL/AT, and this was the greatest difference seen

between a single gene among five ZYMV isolates studied to

date. These nt homology values are also compared to the P1

of TEV (42%), PVY" (37%), TVMV (39%), PPV (41%), and PSbMV

(39%). The amino acid homologies were higher than the nt

homologies for each virus in most cases (Table 2-3).

The AI nt coding region of ZYMV-FL/AT was also compared

to that of ZYMV-CA (98% homology) and ZYMV-RU (88%). The

deduced amino acid sequence for ZYMV-CA was the same as the

nt homology compared to ZYMV-FL/AT. However, the amino acid

homology for the Al of ZYMV-RU was 98%, indicating that many

of the nt changes made no difference in the amino acid

sequence. The AI sequence comparisons to unrelated

potyviruses were from 50% homology for PSbMV to 52% for TEV,

TVMV, and PPV.










The nt sequence of the P3 of ZYMV-FL/AT showed a 98%

homology with the P3 of ZYMV-CA and 84% homology with ZYMV-

RU. The ZYMV-FL/AT and distantly related potyviruses had nt

homologies to ZYMV-FL/AT ranging from 43-45%. The amino

acid sequence homologies of P3 compared to ZYMV-FL/AT were

slightly higher than the nt homologies (Table 2-3). In all

nt and amino acid comparisons, the P1 was the least

conserved region whereas the HC/Pro was more highly

conserved than either P1 or P3.


Discussion


Attempts to clone the entire 5'-terminus of the ZYMV

genome necessitated the use of custom primers to force

cloning specifically for the 5'-end. This resulted in a

series of clones which represented the entire ORF of the

ZYMV genome.

High nucleotide sequence similarities among the P1 of

ZYMV-FL/AT, -SV, -MD, and -CA isolates were noted, but a

significant divergence was seen with the P1 of the ZYMV-RU

isolate. The larger size of the P1 from ZYMV-MD as seen in

PCR analysis in agarose gels was verified by sequences which

showed a six amino acid insert after the start codon.

Whereas the first five amino acids were Met-Ala-Ser-Ile-Met

for ZYMV-FL/AT, -SV, and -CA, and Met-Ala-Ala-Ile-Met for

ZYMV-RU, the corresponding sequence for ZYMV-MD was Met-Arg-

Ile-Glu-Ale-Leu-His-Ala-Ser-Ile-Met. All the differences








52

seen in the amino acid sequence for the ZYMV-MD were in the

N-terminal half of P1. Eight of the 11 amino acid

differences (which include one deletion) in the ZYMV-SV

isolate were also in the N-terminal half of P1.

The conserved residues in the C-terminus of P1 have

been maintained to some degree in the five ZYMV isolates

studied. The His and Ser residues important for protease

activity were present in all five isolates of ZYMV.

However, the consensus sequence reported for the five

potyviruses analyzed by Verchot et al. (1991) is slightly

different. Instead of Phe-Ile-Val-Arg-Gly, the sequence for

ZYMV isolates is Leu-Val-Ile-Arg-Gly. This sequence

suggests a possible inversion of amino acids Val and Ile at

this point. In spite of the lower conservation of ZYMV-RU,

it is interesting to note that the conserved regions are the

same among all ZYMV isolates, as well as the putative

Tyr/Ser cleavage site between P1 and AI.

Among the five ZYMV isolates in this study, and five

other potyviruses which have been completely sequenced

(Verchot et al., 1991), the P1 is the most variable region

on the potyviral genome. In addition, the N-terminus of P1

is more variable than its C-terminus.

Although the AI was not the primary focus of this

research, the homologies of the potyviruses and three ZYMV

isolates addressed in this study were compared. The AI-

encoding region was more highly conserved than that of P1,









with a high homology (98%) noted between ZYMV-FL and ZYMV-

CA, and a lower (88%) homology between ZYMV-FL/AT and ZYMV-

RU. Other potyviruses had sequence homologies compared to

ZYMV-FL/AT in the range (51-52%) expected for distinct

potyviruses (Shukla et al., 1991).

The homologies seen for the P3-encoding region were

similar to those seen for the AI-encoding region, with a

high homology (98%) between ZYMV-FL/AT and -CA, and a lower

homology (84%) between ZYMV-FL/AT and -RU isolates. The

homologies of distinct potyviruses compared to ZYMV-FL/AT

were lower (43-44%), as expected.

It is clear from the sequence analyses presented in

this study, that there is variation in the P1 coding region

among ZYMV isolates. There is also greater variation in the

P1 region than in the AI or the P3 regions. The ZYMV-RU

isolate appears to have a more highly diverged P1 nt

sequence than the other ZYMV isolates addressed in this

study. According to the criteria proposed by Shukla et al.

(1991), ZYMV-RU does not fit the category of either a strain

or a distinct potyvirus, regardless of whether the P1, AI,

or P3 regions are considered. In addition, the CP region of

ZYMV-RU is 88% similar to that of ZYMV-CA (Baker, et al.,

1991b). Polyclonal antisera to the CP of ZYMV-FL/AT and

ZYMV-RU cross react in reciprocal SDS-immunodiffusion tests

with the formation of spurs (Baker, et al., 1991a). Several

monoclonal antibodies (MAbs) produced to ZYMV-FL/AT








54

(Appendix 1) show a low affinity to ZYMV-RU. The

symptomatology of ZYMV-RU on a range of susceptible hosts is

very similar to classical ZYMV symptoms (Baker et al.,

1991a; H.Lecoq, unpublished).













CHAPTER 3
SEROLOGICAL CHARACTERIZATION OF THE P1 PROTEIN OF
ZUCCHINI YELLOW MOSAIC VIRUS FROM FLORIDA

Introduction


The nt sequences of the P1 and and P3 coding regions

are less conserved than other coding regions on the

potyviral genome (Shukla et al., 1991). Furthermore, the N-

terminus of the P1 protein is less conserved than its C-

terminus. For these reasons, it was hypothesized that the

antigenic characterization of the P1 and P3 proteins would

prove useful in distinguishing different isolates of

potyviruses.

In order to evaluate the potential of antigenic

properties of P1 and P3 for distinction of ZYMV isolates,

the following experimental approach was attempted: cloning

and sequencing of the P1 and P3 encoding regions as

described in chapter 2, expression of the encoded proteins

in E. coli, production of antisera to the expressed

proteins, and development of serological detection methods.

These procedures were successful for the P1 protein of ZYMV-

FL/At and ZYMV-RU, and this chapter describes the antigenic

detection and characterization of the P1 proteins of ZYMV

isolates by western blots of extracts from infected plants








56

and by immunofluorescence in infected tissues. Although the

P3 of ZYMV was cloned and sequenced, the toxicity of this

protein in E. coli prevented expression of P3 and

preparation of antisera, so that no serological studies were

conducted with the P3 protein. During the course of this

study, Rodriguez-Cerezo and Shaw (1991) used a similar

approach to obtain antisera to P1 and P3 of TVMV. Although

the P3 of TVMV appeared to be toxic to E. coli, as seen by

cessation of cell growth, P3 was expressed in low levels.

They detected the P1 and P3 proteins of TVMV serologically

in extracts from infected plants and protoplasts. The P3 of

TEV is likewise toxic to E. coli and cannot be expressed in

its entirety (V. Doljas, personal comm.).




Materials and Methods


Culture of Virus Isolates

Table 3-1 lists the isolates of ZYMV used in this

study, their source, and the original host from which they

were isolated. Host plants were maintained in a growth room

under a ca. 16 hr day length with an average temperature of

23 C or in a greenhouse. Isolates obtained from outside the

state of Florida were kept under quarantine conditions in a

locked growth room. Two ZYMV isolates from Israel were

kindly provided by Y. Antignus (Volcani Center, Bet Dagan,

Israel). Three ZYMV isolates from France were kindly










Table 3-1. List of zucchini yellow mosaic virus isolates
used for serological studies of the P1 protein.


Isolate
FC-2000

FC-2050

FC-2154

ZYMV-RU

Italy

ZYMV-FL/AT
a
ZYMV-FL/GH

ZYMV-SV

ZYMV-MD

81-25

FC-3182

HAT

NAT

Egypt

Connecticut

Taiwan

PAT

weak

E15

FC-3179

FC-3180

FC-3181


Origin
FL-Alachua Co.

FL-Dade Co.

FL-Collier Co.

Reunion Island

Italy

FL-Sumter Co.

FL-Sumter Co.

FL-Palm Beach Co.

FL-Alachua Co.

FL-Sumter Co.

FL-DeSoto Co.

Israel

Israel

ATCC 405

ATCC 594

ATCC 622

France

France

France

FL-DeSoto Co.

FL-DeSoto Co.

FL-DeSoto Co.


Host
squash

squash

watermelon

Momordica charantia

zucchini

zucchini

zucchini

squash

squash

squash

zucchini

zucchini

zucchini

squash

squash

squash

muskmelon

muskmelon

muskmelon

zucchini

zucchini

zucchini


a
ZYMV-FL/GH=an isolate of ZYMV maintained for several years
by mechanical inoculation.










provided by H. Lecoq (INRA, Station de Pathologie Vegetale,

Montfavet, France). Three additional isolates were obtained

from the American Type Culture Collection (ATCC). The 81-25

culture was isolated by W.C. Adlerz and was obtained from

D.E. Purcifull. All the remaining Florida isolates were

from the collection of D.E. Purcifull and G.W. Simone. Host

plants used for routine assay and maintenance were pumpkin

(Cucurbita pepo L. 'Small Sugar'). Squash (C. pepo L.

'Early Prolific Straightneck'), watermelon [Citrullus

lanatus (Thunb.) Matsumi & Nakai 'Crimson Sweet'], and

cantaloupe (C. melo L. 'Hales Best Jumbo') were also used

for some studies.

For mechanical inoculations, tissues were triturated in

a mortar and pestle with 0.02 M potassium phosphate buffer,

pH 7.5, with the addition of 600 mesh carborundum. The

slurry was rubbed onto fully expanded cotyledons with

sterile cheesecloth pads, and plants were rinsed gently with

water several minutes after inoculation. Mock inoculations

were made using extracts from noninoculated plants.

Increase of P1 and P3 by PCR for Subcloning and Expression

Based on the nt sequence of P1 and P3 of ZYMV-FL/AT,

primers were made which correspond to the beginning and end

of each protein encoding region with special attention to

areas with a high GC content. For cloning of P1 of ZYMV-

FL/AT, restriction sites with five flanking bases on the 5'-

end were incorporated into the primers to provide for










directional cloning into the pETh vector (McCarty et al.,

1991) at HindIII and BglII sites on the polylinker. The

pETh vector was selected as the expression vector in this

study. It is a modification of the original pET vector

developed by Studier et al. (1990) for high level expression

of genes under the control of the T7 RNA polymerase from

bacteriophage T7. In this system, if the protein product is

not toxic to E. coli, host transcription cannot compete

after induction of the T7 promoter and almost all

transcription becomes due to the T7 RNA polymerase.

Primers used for increase of the P1 of ZYMV-FL/AT are

presented in chapter 2. The P1 of ZYMV-RU was also

increased by PCR for subcloning and expression. The primer

for the 5'-end of the ZYMV-RU P1 gene was the same as for

ZYMV-FL/AT P1, but for the 3'-end the primer was 5'-

GGGCTCTAGATGGTTCTAATGCAT-3', which included a BglII site and

four flanking bases on the 5'-end. Primers for increase of

P3 by PCR were, on the 5'-terminus, 5'-GGCGGAACACCAACA-3'

and on the 3'-terminus was 5'-CCAACCGTACCAAAA-3'. The

primers for P3 did not include restriction sites, and the P3

gene was blunt-end ligated into the pETh vector.

The correct reading frames were selected for P1 and P3,

based on the nt and deduced amino acid sequence, to be in

frame with the ATG initiation codon of pETh. For P1 of both

ZYMV-FL/AT and ZYMV-RU the plasmid providing the correct

reading frame was pETh-3b, and for P3 it was pETh-3c. In










all cases digestion at the engineered restriction sites on

the primers was unsuccessful (even after protease K

digestion and phenol/chloroform extraction), so the PCR

product was blunt-end ligated into the SmaI-digested, CIAP-

treated plasmid.

An intermediate E. coli host, strain HB101, was

transformed (Sambrook et al., 1989) for initial studies.

Plasmid mini-preps were made from transformants to

determine, by sequence data, the presence of the correct

gene, its orientation, and verification of the correct

reading frame for expression. Primers used for sequencing

were the T7 promoter primer and the pBR322 EcoRI site

clockwise primer, both obtained from the University of

Florida DNA synthesis facility.

Induction and Expression of P1 and P3 Proteins

Plasmid cultures which were identified as P1 and P3 in

the correct orientation and reading frame were used to

transform the appropriate host for expression, E. coli

strain BL21DE3pLysS. A single transformant colony grown on

LB containing ampicillin (50 gg/ml) and chloramphenicol (25

Ag/ml) was raised in 5 ml of M9 medium (Sambrook et al.,

1989) with 0.4% glucose and 0.5% tryptone at 37 C with

shaking to an O.D.600 of 0.6. Cultures were divided into 2.5

ml aliquots. One 2.5 ml aliquot was induced with 1 mM IPTG.

Both induced and noninduced cultures were allowed to grow an

additional 3-4 hr at 37 C. Cells were harvested by









centrifugation at 5,000 g, pellets were resuspended in one

half the original volume of TE buffer (10 mM Tris-HCl, 1 mM

EDTA, pH 8.0), and frozen at -20 C overnight. The viscosity

of the cell lysate necessitated sonication for 5 sec to

allow for pipetting. Ten pl of each sample was mixed with

an equal volume of Laemmli dissociating solution (LDS)

(Laemmli, 1970), the mixtures were boiled for 2 min, and

were subjected to analysis by sodium dodecyl sulfate-

polyacrylamide gel electrophoresis (SDS-PAGE). Gels were

stained with Coomassie Brilliant Blue R-250 (BRL,

Gaithersburg, MD) for detection of expressed proteins. In

all cases, both induced and noninduced recombinant plasmid

cultures were tested, as well as plasmid cultures containing

no inserted gene.

Since P3 appeared to be toxic to E. coli in this

system, as determined by lack of cell growth and protein

expression following induction, an alternate induction

procedure was attempted using the bacteriophage CE6 to

infect pETh plasmids containing P3 in the E. coli host

HMS174. The HMS174 has no T7 RNA polymerase and the enzyme

is provided by infection with CE6 bacteriophage. This

expression can be useful for expression of toxic gene

products (Studier et al., 1990).

Antigen Preparation and Antibody Production

Since the P1 proteins expressed by both ZYMV-FL/AT and

ZYMV-RU were insoluble, the proteins were partially









purified, after sonication, by three cycles of

centrifugation of the precipitate at 10,000 g and washing

with TE buffer, followed by preparative SDS-PAGE on a 3 mm

gel. Protein bands were visualized by incubating in 0.2 M

KC1 for 7 min at 4 C. The protein bands were excised,

washed three times in cold distilled water, frozen at -20 C,

and eluted using a Bio-Rad Electroeluter at 10 mAmp/tube,

with constant current for 5 hr. Polarity was reversed for 1

min, and the extracted proteins were dialyzed overnight

against distilled water. Purity of the eluted protein was

checked by analytical SDS-PAGE, after which the protein was

lyophilized.

A New Zealand white rabbit (no. 1181) was immunized on

day one with 2 mg of ZYMV-FL/AT P1 protein in 0.5 ml sterile

distilled water which was emulsified with 0.5 ml of Freund's

complete adjuvant. Injections were made using 0.25 ml of

emulsion per site, with two intramuscular sites per hip. On

day 14 and day 21, 1 mg protein was used with 0.5 ml water

and 0.5 ml Freund's incomplete adjuvant. The same schedule

was followed for rabbit no. 1186 which was immunized with

the P1 protein of ZYMV-RU. Rabbits were bled on a weekly

basis starting on day 28 for 2 months, with a 4 week

interval before a booster injection on day 112 and

subsequent bleeding.










Western Blotting Procedure

The western blotting procedure was conducted

essentially as described by Towbin et al. (1979) using a

Bio-Rad Mini-Protean II Electrophoresis Cell and Bio-Rad

Trans-Blot Electrophoretic Transfer Cell. Ten per cent gels

were used primarily, with occasional 8 and 15% gels being

run for special purposes.

Young, symptomatic leaves of inoculated test plants

were harvested between days 5 and 21 post-inoculation.

Extracts for immunoblots were initially prepared by

triturating leaf tissue in LDS (1:1, w:v), followed by

boiling for 2 min. However, for adequate extraction of P1

from plant tissues, an alternate extraction buffer (ES

buffer) (Rodriguez-Cerezo and Shaw, 1991) was used which

gave improved results. The ES buffer consisted of 75 mM

Tris-HCl, pH 6.1 containing 9 M urea, 7.5% 2-

mercaptoethanol, and 4.5% SDS. One part plant tissue was

triturated in a mortar and pestle with 2 parts of ES buffer.

The triturate was squeezed through a single layer of

moistened cheesecloth, boiled 2 min, and centrifuged at

5,000 g for 5 min. Centrifuged samples were stored at -20 C.

Each isolate was tested from at least two different sources

of tissue.

Nitrocellulose membranes (Bio-Rad Trans-Blot, 0.4A)

were rinsed three times with TBST after transfer, followed

by incubation for 15 min at RT with 10 ml blocking solution









containing E. coli lysate at 1 mg/ml and extracts from

noninfected plants. The noninfected plant extract was

prepared by triturating leaf tissue in water (1:9, w:v) and

straining through a single layer of moistened cheesecloth.

The specific primary antibody was added at 1/1000 dilution.

The procedure for the secondary antibody and development are

as described in chapter 2 for immunoscreening. Reactions

were allowed to develop at RT and were stopped by rinsing in

deionized water.

In Vitro Translation and Immunoprecipitation

The wheat germ (WG) in vitro translation procedure was

the same as described by Cline et al. (1985). Three pg of

RNA from ZYMV-FL/AT in a 50 Al WG extract mixture,

containing 40 MCi of [H3]leucine was incubated at 25 C for

60 min. Immunoprecipitation analyses were performed as

described by Dougherty and Hiebert (1980). Precipitated

products were separated on a 10% SDS-PAGE and detected on

dried gels by fluorography as described by Bonner and Lasky

(1974). Antisera used for immunoprecipitation of in vitro

translation products were to the P1 and CP of ZYMV, and to

the AI of PRSV-W.

Production of Antisera to Synthetic Peptides

Synthetic peptides to the N-terminus of both the P1 and

P3 proteins of ZYMV were prepared by the University of

Florida protein synthesizing facility. The amino acid

sequence of the peptide prepared to P1 was Met-Ala-Ser-Ile-









Met-Ile-Gly-Ser-Ile-Ser-Val-Pro and to P3 was Gly-Thr-Pro-

Thr-Gln-Arg-Ile-Lys-Leu-Glu-Glu-Gln. Both free peptide and

peptide conjugated to BSA were used as immunogens. Peptides

were coupled to BSA according to Harlow and Lane (1988).

One mg peptide and 1 mg BSA were each dissolved in 1 ml of

0.1 M potassium phosphate buffer, pH 7.0. Two hundred Al of

fresh 25% glutaraldehyde was added to 1 ml of the

protein:peptide solution and stirred overnight at room

temperature. This was followed by dialysis against

deionized water three times over a 24 hr period. The

material was lyophilized and stored at -20 C. Immunization

protocols followed were as described for the expressed P1

protein from E. coli. Rabbit numbers for P3 peptide and the

conjugated P3 peptide were 1167 and 1169, respectively. The

rabbit numbers for the P1 peptide and the conjugated P1

peptide were 1168 and 1170, respectively.

Light Microscopy and Immunofluorescence Tests

Indirect immunofluorescence tests were conducted as

described by Hiebert et al. (1984) with some modifications.

Six Al of 10% dimethyl sulfoxide (DMSO) in phosphate

buffered saline (PBS), 27 pl of healthy plant extract (1/10

in PBS containing 1% ovalbumin), and 27 pl of antiserum were

incubated together for 30 min prior to addition of epidermal

strips from plant tissue. Epidermal strips were incubated

in the antibody preparation in a 1.5 ml microfuge tube after

vortexing for 10 sec to ensure complete exposure of the










tissue to the antibody solution. Tissue was incubated in

the antibody solution on a shaker for 3-4 hr at RT in the

dark. Rinsing between steps was done twice in 1 ml of TBST

after vortexing for 10 sec and once for 1 hr in PBS while

shaking at RT in the dark. Rhodamine-conjugated protein A

(Sigma Chemical Co., St. Louis, MO) was used as a

fluorescent probe. The rhodamine-conjugate was diluted 1

g/ml in PBS. Eight gl of the conjugate was mixed with 40 gl

of 10% DMSO and 352 pl of PBS. After vortexing, rinsed

tissue was incubated in this solution at RT for 3-4 hr in

the dark while shaking. After a final rinse, tissue was

mounted on microscope slides using Aqua-mount (Lerner Labs,

New Haven, CT). 'Crimson Sweet' watermelon was used as the

host for immunofluorescence tests. Tissue sections were

photographed with epifluorescence optics using a Nikon

Fluophot microscope with a G2A filter.




Results


Expression of P1 and P3 Coding Regions in E. coli

Initial efforts to clone P1 by cohesive end ligation at

digested sites of PCR products were unsuccessful.

Subsequently, PCR products of P1 and P3 were blunt-end

ligated successfully into the pETh plasmid. Clones were

sequenced to determine the correct orientation and reading




















1 2 3 4 5 6


..~ p. '-L
- r


200
97

- 68



43



29


Fig. 3-1. Expression of P1 protein of ZYMV-FL/AT cloned
into the pETh plasmid. A: Cultures expressing P1 were grown
for 3 hrs after induction with IPTG. Noninduced cultures
were processed the same as induced cultures. Lanes 2 and 4
are induced cultures carrying the P1 gene. Lanes 1 and 3
are noninduced cultures carrying the P1 gene. Lane 5 is a
noninduced culture carrying the pETh plasmid only, and lane
6 is the same culture, induced. B: Lane 1 is the P1
protein which was partially purified by centrifugation prior
to preparative electrophoresis, and lane 2 is the supernate
from the same preparation. Arrow indicates the P1 expressed
protein at ca. 35-kDa.


1 2


~i










frame, and were then used to transform the appropriate E.

coli host for expression, BL21DE3pLysS.

Induction of P1 from ZYMV-FL/AT resulted in

overexpression of an insoluble protein product of ca. 36-kDa

(Fig. 3-1A). Fifty ml cultures were induced for large scale

P1 protein production. The P1 protein was insoluble and

thus was easily purified by three cycles of centrifugation

and washing, thereby providing a product free of

mostbacterial proteins (Fig. 3-1B). Further purification of

P1 protein from bacterial lysates was accomplished by

preparative SDS-PAGE and electroelution. The protein

product was then lyophilized and used for antiserum

production in rabbits. Bleeding dates for P1 of ZYMV-FL/AT

used were from 4 weeks to 7 months after the original series

of immunizations. For the P1 of ZYMV-FL/AT, rabbit 1181 was

bled from September 13, 1991 through July 16, 1992. The P1

of ZYMV-RU was expressed and purified in a similar manner

for use as an immunogen. For the P1 of ZYVM-RU, rabbit 1186

was bled from May 28, 1992 through July 16, 1992.

Induction of the P3 protein was unsuccessful in both

the pETh/BL21DE3pLysS system and when using the

bacteriophage CE6 to infect the host HMS174 carrying the

pETh plasmid (data not shown). These results are similar

to the results with the TEV P3 protein (V. Doljas, personal

comm.), which is toxic in E. coli and thus cannot be

expressed in its entirety. Rodriguez-Cerezo and Shaw (1991)









expressed P3 of TVMV in E. coli. The induced bacterial

cells ceased growth following induction with IPTG, and thus

the level of expression was low (E. Rodriguez-Cerezo,

personal comm.). Apparently the P3 protein of all three

potyviruses is toxic to varying degrees in E. coli.

Detection of P1 Protein in Plants Infected with ZYMV

Initial extraction of ZYMV-infected plant tissues with

LDS gave very weak reactions in western blots. Extraction

with ES buffer gave satisfactory reactions with ZYMV-

infected plant tissues in western blots using antiserum to

P1 of ZYMV-FL/AT as a probe. The antiserum reacted

specifically to a ca. 34-kDa protein in plant tissue

infected with ZYMV-FL/AT. No protein was detected in

extracts from healthy plant tissues. Western blots with

preimmune serum did not result in a detectable protein

reaction.

In western blots using antiserum to the P1 of ZYMV-

FL/AT (1181), a P1 protein reaction at ca. 34-kDa for ZYMV-

FL/AT was noted. Some heterogeneity was seen among the

other ZYMV isolates used in this study (Fig. 3-2). A higher

molecular weight (mw) of ca. 35-kDa was noted for some ZYMV

isolates including ZYMV-MD, FC-2000, FC-2050, and three

isolates from France (PAT, weak, and E15) (Table 3-2). P1

products that were slightly smaller than that of ZYMV-FL/AT

included those of ZYMV-SV, three ATCC isolates of ZYMV (from

Egypt, Taiwan, and Connecticut), and the original ZYMV










isolate from Italy. In addition to size differences of P1

protein, some isolates showed a possible breakdown product

of ca. 26-27-kDa whereas others (FC-3182, weak and E15 from

France) showed an incomplete processing of P1 and HC/Pro by

the reaction of a band of ca. 88-kDa. This 88-kDa band of

FC-3182 was tested and also reacted with antiserum to the AI

of PRSV-W (Fig. 3-3).

The size heterogeneity between ZYMV-MD, ZYMV-FL/AT, and

ZYMV-SV seen in SDS-PAGE using 10% acrylamide gels with

antisera to the P1 of ZYMV-FL/AT as a probe, was further

examined by subjecting them to SDS-PAGE in 8% and 15%

acrylamide gels (Fig. 3-4). These size differences were

also noted in the 8% and 15% gels, providing evidence that

the heterogeneity seen is due to true mw differences between

P1 proteins and not solely due to charge differences

(Hedrick and Smith, 1968).

The size differences between the P1 proteins of ZYMV-

FL/AT, ZYMV-MD, and ZYMV-SV were consistent regardless of

the host used for western blot assays. These three isolates

were tested in pumpkin, watermelon, cantaloupe, and squash

(Fig. 3-5).

Of the ZYMV isolates tested in this study, ZYMV-RU

reacted weakly or not at all with the antiserum to the P1 of

ZYMV-FL/AT. This isolate did react with antisera to the CP

and CI of ZYMV and to the AI of PRSV-W (Fig. 3-6). Extracts

from pumpkin singly infected with any of several other
































in .In.. I cc '
.S =







S97
EI



O0r4 >-U ir if f i



a

ID .tn e I La .*?


.:c .t y...O I


a0 O


Awr.


*- a





4-


Fig. 3-2. Characterization of the reactions of the Pl-
related proteins of 22 isolates of zucchini yellow mosaic
virus (ZYMV) in western blots. Blots were probed with
antiserum no. 1181 (collection date 3-17-92) to the P1
protein of ZYMV-FL/AT.


"!* ,







72

Table 3-2. Evidence for antigenic and size variation of P1-
related proteins among ZYMV isolates in western blots using
antiserum to ZYMV-FL/AT (1181) and ZYMV-RU (1186).
Approximate Reaction Reaction
TnnlatP molecular weight pattern(1181) pattern(1186)
FC-2000 35 a 35 35

FC-2050 35 35 35

FC-2154 34 34,26 34
b
ZYMV-RU 33(+/-) 33(+/-) 33

Italy 33 33 33(+/-)

ZYMV-FL/AT 34 34,26 -

ZYMV-FL/GH 34 34,26

ZYMV-SV 33.5 33.5

ZYMV-MD 35 35 35

81-25 34 34 34

3182 34 88,34,26 88,34

HAT 34 34 34

NAT 34 34 34

Egypt 33 33

Connecticut 33 33

Taiwan 33 33 33

PAT 35 35,27 35

weak 35 88,35,27 35

E15 35 88,35,27 35

FC-3179 34 34,26 34

FC-3180 34 34,26 34

FC-3181 34 34
a molecular weights are in kDa.
b (+/-)=extremely weak reactions; not detectable
in every test.
c = no detectable reaction.
















































Fig. 3-3. Western blots of extracts from plants singly
infected with selected ZYMV isolates. Blots were probed
with antisera to P1 of ZYMV-FL/AT (PI) and to the AI of
PRSV-W (AI). Arrow indicates the position of the 88-kDa
protein of isolate FC-3182 which reacts with both P1 and AI
antisera.























JJ i l l
S~~h 02!P" -

A B N M M Q


15%

34?
;i? i '
jj i l l

JJ


-200


-97
-68


-43
^^ *....* W ^^ 4.


-29


Fig. 3-4. Western blots showing 8% and 15% SDS-PAGE gel
concentrations. Antiserum used to probe blots was to the P1
of ZYMFV-FL/AT. The size differences among the isolates
shown were consistent regardless of the gel concentration.
Pl=protein expressed from E. coli. mw=molecular weight
markers.


-43

-29


-18



















pumpkin


squash


cantaloupe watermelon


EI I I E I a g g





*-97
*i ....
43, 8

-43


" .O


m ...... q*0


- 29


Fig. 3-5. Detection of the P1 protein in western blots of
extracts from plants of four cucurbit cultivars singly
infected with three isolates of zucchini yellow mosaic
virus. The hosts were pumpkin (Cucurbita pepo 'Small
Sugar'), squash (C. peDo 'Early Prolific Straightneck'),
cantaloupe (Cucumis melo 'Hale's Best Jumbo'), and
watermelon (Citrullus lanatus 'Crimson Sweet'). Antiserum
no. 1181 (collection date 3-17-92) to P1 of ZYMV-FL/AT was
used as the probe.


WWI















a a



8 .1^ '.... '*l l ii


Fig. 3-6. Western blots of extracts from pumpkin singly
infected with selected ZYMV isolates using antiserum to P1
of ZYMV-FL/AT, CI, and CP of ZYMV-FL/AT, and to the AI of
PRSV-W as probes. The ZYMV-RU isolate reacted weakly or not
at all with antiserum to the P1 of ZYMV-FL/AT, but reacts
with other antisera. P1, membrane probed with antiserum to
the P1 protein of ZYMV-FL/AT. AI, membrane probed with
antiserum to the AI of PRSV-W. CI, membrane probed with
antiserum to the CI of ZYMV-FL/AT. CP, membrane probed with
antiserum to the CP of ZYMV-FL/AT. Arrangement of isolates
is the same for all four membranes. Arrows indicate
position of respective proteins in each membrane.










viruses that infect cucurbits but are distinct from ZYMV

were also tested in western blots. These included PRSV-W,

WMV-2, an named potyvirus (FC-2932) which is

antigenically different from ZYMV, PRSV-W, and WMV-2

(Purcifull et al., 1991), cucumber mosaic virus (CMV), and a

possible potexvirus of cucurbits (FC-1860, Purcifull et al.,

1988). All of these extracts were negative in western blot

tests when tested against antiserum to the P1 of ZYMV-FL/AT

(Fig. 3-7). Antiserum to the P1 protein of ZYMV-RU was also

negative when tested against PRSV-W, WMV-2, FC-1860, and FC-

2932 (data not shown). This antiserum showed differential

reactivity to several ZYMV isolates (Table 3-2, Fig. 3-8).

For those isolates which reacted with antisera to both ZYMV-

FL/AT P1 and ZYMV-RU P1, the approximate mw estimates for

those isolates were the same.

Immunoprecipitation Analysis of In Vitro Translation

Products

Translation products obtained in the WG in vitro

translation system were immunoprecipitated with antisera to

the P1 and CP of ZYMV-FL/AT, to the Al of PRSV-W and with

preimmune serum. Since the WG translation system does not

yield large products, analysis of SDS-PAGE showed only the

P1 and Al present in total translation products (Fig. 3-9).

The antisera to P1 and AI precipitated products of the

appropriate mw for each, ca. 34-kDa and 52-kDa,

























200

97
68

43



29



18





Fig. 3-7. Specificity of antiserum (no. 1181, collection
date 3-17-92) to P1 of ZYMV-FL/AT in western blots.
Extracts from samples infected with ZYMV-FL/AT show a
prominent band at ca. 34-kDa and a weak band at ca. 26-kDa.
Note lack of reactivity with extracts from pumpkin singly
infected with any of three potyviruses (PRSV-W, WMV-2,
2932), a cucumovirus (CMV), a possible potexvirus (FC-1860,
potex), or from noninoculated pumpkin leaves (HSSP/healthy).















































Fig. 3-8. Reactivity of 22 zucchini yellow mosaic virus
(ZYMV) isolates in western blots using antiserum to the P1
of ZYMV-RU as a probe. Blots were probed with antiserum no.
1186 (collection date 6-10-92).



















at H I H tI oQ

200
97
68
<52
43 34

29



18
14




Fig. 3-9. Immunoprecipitation of wheat germ in vitro
translation products. TP=total products, Pl=products
immunoprecipitated with ZYMV-FL/AT P1 antiserum, AI=products
immunoprecipitated with antiserum to the AI of PRSV-W,
CP=products immunoprecipitated with antiserum to the CP of
ZYMV-FL/AT, and NS=products immunoprecipitated with
preimmune serum. mw=molecular weights are from top to
bottom: 200-, 97-, 68-, 43-, 29-, 18-, 14-kDa.










respectively. Neither the CP nor preimmune serum

precipitated a protein product. Interestingly, the P1

antiserum precipitated a smaller product, ca. 25-kDa, which

may be similar to the possible breakdown product usually

seen in immunoblots for that isolate.

Detection of P1 Protein by Indirect Immunofluorescence

Fluorescence microscopy of rhodamine-conjugated protein

A labeled antiserum to the P1 protein showed the presence of

aggregates in the cytoplasm of epidermal strips from ZYMV-

infected watermelon. Isolate ZYMV-FL/AT showed accumulation

of amorphous aggregates with particulate fluorescing bodies

in cells of epidermal tissues (Fig. 3-10) when treated with

antiserum to the P1 of ZYMV-FL/AT. Similar results were

seen with isolates ZYMV-SV and FC-3182. It is possible,

judging from the location of the fluorescing material, that

these bodies might be associated with the CI protein

inclusions. Further studies using electron microscopy of

ultrathin sections will be needed to ascertain this.

Epidermal strips of ZYMV-FL/AT, ZYMV-SV and FC-3182 showed

no fluorescence with preimmune serum as a probe (Fig. 3-11;

Table 3-3), and the aggregates could be seen unstained in

epidermal tissue. Likewise, tissues of watermelon infected

with ZYMV-RU and healthy watermelon (mock-inoculated) were

negative for fluorescence with both antiserum to the P1 of

ZYMV-FL/AT and preimmune sera. As with the ZYMV-FL/AT,

ZYMV-SV, and FC-3182, aggregates of P1 like those seen in










fluorescence tests could be seen in ZYMV-RU infected

tissues, although the aggregates did not fluoresce (Fig. 3-

12). Mock-inoculated watermelon tissues showed no

fluorescence when stained with either immune (Fig. 3-13) or

preimmune serum.

Tissues of ZYMV-FL/AT, ZYMV-SV, ZYMV-RU, FC-3182, and

mock-inoculated watermelon were also tested in

immunofluorescence studies using antiserum to the P1 of

ZYMV-RU. Only watermelon tissue infected with ZYMV-RU or

FC-3182 showed the particulate fluorescing aggregates,

whereas ZYMV-FL/AT, -SV, and mock-inoculated tissues showed

no fluorescing aggregates (Table 3-3). Although aggregates

were seen in ZYMV-FL/AT and in ZYMV-SV infected tissues,

they did not fluoresce.

Serological Studies of Synthetic Peptides to P1 and P3 of

ZYMV

Antisera to the N-terminal 12 amino acids of P1 and P3

were used in SDS-immunodiffusion, ELISA, dot-immunoblots,

and immunoblotting assays. None of the antisera, whether to

the conjugated peptide or to the free peptide, reacted with

any detectable protein product from ZYMV-infected plant

tissues.




























A


















B

Fig. 3-10. Localization of P1 in epidermal tissue from
stems of watermelon infected with ZYMV-FL/AT. Antiserum to
the P1 of ZYMV-FL/AT (rabbit no. 1181, collection date 3-17-
92)was used as the detecting antibody, and tissues were
stained with Rhodamine-protein A and photographed with
epifluorescence optics. Note the specific fluorescence of
granular aggregates. Magnification =1,714 X. A, tissue
photographed with epifluorescence optics; B, same field of
view photographed with visible light.





























A




















Fig. 3-11. Epidermal strips of watermelon tissue infected
with ZYMV-FL/AT treated with preimmune serum, stained with
Rhodamine protein A. Magnification =1714 X. A, tissue
photographed with epifluorescence optics; B, same field of
view photographed with visible light.





























A




















Fig. 3-12. Aggregates of P1 protein in watermelon stem
epidermal tissue infected with ZYMV-RU treated with
antiserum to the P1 of ZYMV-FL/AT (1181, collection date 3-
17-92), stained with Rhodamine-protein A. Note granular
aggregates are clearly visible, but do not fluoresce.
Magnification =1714 X. A, tissue photographed with
epifluorescence optics; B, same field of view photographed
with visible light.











































Fig. 3-13. Epidermal strips from mock-inoculated watermelon
tissue treated with antiserum to the P1 of ZYMV-FL/AT (1181)
and stained with Rhodamine-protein A. Note absence of
fluorescent granular bodies. Magnification =1714 X.















Table 3-3. Summary of reactions of antisera to the P1
of ZYMV-FL/AT and ZYMV-RU in immunofluorescence tests.


Reactivity a


b Antiserum to
Isolate P1 of ZYMV-FL/AT


Antiserum to preimmune
P1 of ZYMV-RU serum


ZYMV-FL/AT

ZYMV-SV

ZYMV-RU

FC-3182


Mock


a
Reactivity determined as positive (+) by the
presence of yellow, fluorescent aggregates in plant
cells. Lack of reactivity (-) determined by absence
of fluorescent aggregates.
b
The isolates indicated were inoculated to watermelon
plants.
Mock=mock-inoculated control plants.












Discussion


As was demonstrated in Chapter 2 for five ZYMV

isolates, variability exists in the P1 nt and deduced amino

acid sequences. Results from serological assays in

immunoblots are in agreement with the sequence data. For

example, the larger size seen in the nt and amino acid

sequence of ZYMV-MD is reflected in the larger size of the

P1 protein observed in western blots. The slightly smaller

size of the P1 from ZYMV-SV in western blots was also

reflected in a slightly smaller size of its respective gene

in PCR analysis. The amino acids differences, reflecting

different charges and polarities, may also influence the

migration of P1 in SDS-PAGE.

Among the ZYMV isolates in this study, heterogeneity in

the size of P1 was seen, as well as the presence of

degradation products and differences in the capacity to

fully process the cleavage site between P1 and HC/Pro. The

size differences seen between ZYMV-FL/AT, ZYMV-SV, and ZYMV-

MD P1 proteins were consistent regardless of the percent

acrylamide, or of the plant host infected. The low nt (60%)

and amino acid (70%) sequence homology between P1 of ZYMV-RU

and ZYMV-FL/AT is reflected in the weak reactivity of the

ZYMV-RU isolate in western blots when tested against

antiserum to the P1 of ZYMV-FL/AT.









The P1 antiserum produced to ZYMV-FL/AT was specific

for ZYMV. It neither reacted with extracts from plants

infected singly with any of several other viruses that

infect cucurbits, nor with extracts from noninfected

cucurbit tissues. The ZYMV-FL/AT P1 antiserum precipitated

a product of the predicted mw (ca. 34kDa) for P1 from WG

translation products, with a smaller product of ca. 25-kDa.

The small product may correspond to a similar sized product

from infected tissue extracts seen in western blots.

Antiserum to P3 of ZYMV-FL/AT was not produced due to

the toxicity of P3 to E. coli which precluded its production

in vitro. Toxicity of P3 in E. coli has been reported with

two other potyviruses (V. Doljas, E. Rodriguez-Cerezo,

personal comm.). It was indicated by Rodriguez-Cerezo and

Shaw (1991) that two regions on the P3 protein of TVMV were

possible membrane spanning regions. These regions may

somehow be involved in the toxicity of P3 to E. coli.

Antiserum to the P1 of ZYMV-FL/AT distinguished

differences among ZYMV isolates. These differences were

reflected in size variation in the P1 protein, possible

breakdown products for some isolates, and incompletely

processed polyprotein. Antiserum to the P1 of ZYMV-RU also

showed differences in the size variation of the Pl protein

like that seen with antiserum to the P1 of ZYMV-FL/AT.

Antiserum to the P1 of ZYMV-RU also detected antigenic

differences in western blots by lack of reactivity with some