Citation
Identification and characterization of cDNA clones for chromoplast-associated proteins in tomato fruit

Material Information

Title:
Identification and characterization of cDNA clones for chromoplast-associated proteins in tomato fruit
Creator:
Lawrence, Susan D
Publication Date:
Language:
English
Physical Description:
vi, 153 leaves : ill. ; 29 cm.

Subjects

Subjects / Keywords:
Carotenoids ( jstor )
Chloroplasts ( jstor )
Chromoplasts ( jstor )
Complementary DNA ( jstor )
Enzymes ( jstor )
Imports ( jstor )
Plastids ( jstor )
Ripening ( jstor )
RNA ( jstor )
Tomatoes ( jstor )
Tomatoes -- Genetics ( lcsh )
Tomatoes -- Ripening ( lcsh )
Genre:
bibliography ( marcgt )
theses ( marcgt )
non-fiction ( marcgt )

Notes

Thesis:
Thesis (Ph. D.)--University of Florida, 1993.
Bibliography:
Includes bibliographical references (leaves 136-152).
General Note:
Typescript.
General Note:
Vita.
Statement of Responsibility:
by Susan D. Lawrence.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright [name of dissertation author]. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Resource Identifier:
001952611 ( ALEPH )
AKC9183 ( NOTIS )
31280128 ( OCLC )

Downloads

This item has the following downloads:


Full Text















IDENTIFICATION AND CHARACTERIZATION OF cDNA CLONES FOR
CHROMOPLAST-ASSOCIATED PROTEINS
IN TOMATO FRUIT











By

SUSAN D. LAWRENCE


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


1993














ACKNOWLEDGEMENTS


I wish to thank Drs. Donald Grierson and Wolfgang Schuch for providing us

with clones from their ripening tomato fruit cDNA library. I would also like to take

this opportunity to thank the members of my committee Drs. Gloria Moore, Ken

Cline, Eduardo Vallejos, Don Huber and Bill Gurley for their advice and support.

I am especially indebted to Eduardo Vallejos for extensive years of committee

service. This dissertation is dedicated to Mike McCaffery for his tireless computing

assistance and to Ralph Henry for his photographic skills. Finally, I would like to

express my appreciation to all my Fifield Hall lab pals, past and present, for making

this an experience I will fondly recollect.















TABLE OF CONTENTS


ACKNOWLEDGMENTS ...................................... ii

ABSTRACT ................................................ v

CHAPTERS

1 INTRODUCTION ................................. 1
2 LITERATURE REVIEW ............................ 3
Morphological Changes .............................. 5
Biochemistry and Molecular Biology ..................... 6
Changes in Plastid Structure .......................... 15
Regulation of Photosynthetic Proteins ................... 16
The Role of Ethylene in Tomato Fruit Ripening ........... 18
Transcriptional Regulation of Fruit Ripening .............. 19
Processes Associated with Chromoplast
Development ..................................... 20
Heat Shock Proteins and Oxidative
Stress .......................................... 40
Conclusions ...................................... 51

3 CHROMOPLAST-TARGETED PROTEINS
IN TOMATO FRUIT .............................. 54
Introduction ..................................... 54
Materials and Methods .............................. 55
Results and Discussion .............................. 58

4 CHARACTERIZATION OF TWO cDNAS FOR
CHROMOPLAST-TARGETED PROTEINS ............. 74

Introduction ..................................... 74
Materials and Methods .............................. 75
R results ......................................... 82
D discussion ...................................... 105

5 CONCLUSIONS ................................. 118








APPENDIX CONSTRUCTION AND EXPRESSION OF ANTISENSE
pTOM 41 AND Ptom 111 PLASMIDS IN TOBACCO ..... 120

REFERENCES ............................................ 136

BIOGRAPHICAL SKETCH .................................. 153













Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

IDENTIFICATION AND CHARACTERIZATION OF cDNA CLONES FOR
CHROMOPLAST-ASSOCIATED PROTEINS
IN TOMATO FRUIT

By

Susan D. Lawrence

December 1993

Chairman: Dr. Gloria A. Moore
Major Program: Plant Molecular and Cellular Biology

The chloroplast to chromoplast transition during tomato fruit ripening is

characterized by a dramatic change in plastid structure and function. The thylakoid

membranes of photosynthetically competent chloroplasts are broken down and the

carotenoid pigment lycopene is deposited within the developing chromoplast. A goal

of this investigation was to determine whether this process is mediated by an increase

in the steady-state level of RNA for plastid-targeted proteins. Assays for import of

radiolabeled translation products into isolated pea chloroplasts were used to monitor

levels of chromoplast-targeted proteins at four stages of tomato fruit development.

During development, striking increases in levels of translatable RNA for two such

proteins were found. Additionally, the import of in vitro translation products was

examined for seven individual cDNA clones known to encode RNA that increases








during fruit ripening. Three of these clones produced in vitro translation products

that imported into pea chloroplasts. One clone, pTOM5, has recently been shown by

others to encode the enzyme responsible for the first committed step in the synthesis

of lycopene.

Subsequent sequence analysis of another cDNA, pTOM 111, revealed that it

encodes a plastid-localized low MW heat shock protein. Not only does this transcript

increase during development at normal temperatures, but it is increasingly inducible

by elevated temperatures as ripening progresses. This is the first report of the

developmental induction of a plastid-localized low MW heat shock protein.

Identification of the induction of a heat stress protein during this transition suggests

that either the plastid is subjected to an increasingly stressful environment or, as is

consistent for the developmental induction of other heat stress proteins, a massive

structural reprogramming is underway.

These studies imply that there is synthesis and import of new proteins during

the transition from chloroplast to chromoplast, and that the plastid conversion is an

active developmental program rather than a simple decline in synthesis of the

photosynthetic apparatus. Furthermore, these results demonstrate the utility of this

method for identification of structural genes involved in plastid morphogenesis.














CHAPTER 1
INTRODUCTION



Ripening of tomato fruit involves a wide variety of developmental changes

that include but are not limited to changes in cell wall structure, in metabolism, in

ultrastructure, and an especially dramatic change in the form and function of the

plastid. Biochemical and molecular studies suggest that most or all of these changes

are mediated by the enhanced expression of ripening specific genes. I have chosen

this system as a means to investigate plastid development and interconversion.

We are interested in determining how the transition from chloroplast to

chromoplast is regulated, e.g., does a subset of plastid proteins increase during this

process? In an initial examination of this question, we have asked whether an

increase in the accumulation of RNA for a subset of plastid proteins correlates with

the chloroplast to chromoplast transition. Since transcription and/or translation of

the plastid genome seems to diminish during chromoplast formation (Kobayashi,

1991), chromoplast-specific proteins are probably encoded in the nucleus. Nuclear-

encoded plastid proteins are synthesized in the cytosol and posttranslationally

imported into plastids. The import of proteins into plastids is a highly specific

process (Keegstra, 1989). The proteins are made as precursors with transient amino

terminal "transit peptides," which are both necessary and sufficient for the correct








2
targeting into this organelle. It is this latter observation that makes the import into

plastids a potentially diagnostic assay for the identification of chromoplast associated

proteins.

The approach described within this dissertation has been to monitor

chloroplast import of in vitro translation products from RNA of tomato fruit isolated

at different ripening stages. We have also studied translation products programmed

with transcripts from cDNAs (Slater et al., 1985) whose steady state RNA level

increases during ripening. Since individual cDNAs were analyzed, subsequent

sequence analysis allowed further characterization of the proteins that mediate this

transition. Eventually the role of chromoplast-associated proteins in chromoplast

development can be assessed directly via antisense technology. The final outcome of

such a study should be an understanding of the role new protein synthesis plays in

this process and the isolation, identification and characterization of genes that

mediate this transition.













CHAPTER 2
REVIEW OF LITERATURE



The manner in which the transition from chloroplast to chromoplast is

regulated is largely unknown. Electron micrographic analysis has shown that a

massive reordering of plastid structure occurs during the conversion (Thelander et

al., 1986). In tomato fruit, this is characterized by the overall breakdown of

chloroplast specific components, e.g. the thylakoid membrane system and starch, with

the concomitant accumulation of membrane-associated deposits of the carotenoid

lycopene (Thelander et al., 1986). It has not been determined whether the

breakdown of chloroplast structures is caused simply by the decrease in synthesis of

photosynthetic proteins or if increases in degradative enzymes actually enhance this

process. An examination of nuclear-encoded, plastid-targeted, photosynthetic proteins

has shown that their transcription stops 5 to 10 days before the fruit reaches full size

(Piechulla et al., 1986). Analysis of plastid-encoded transcripts has demonstrated that

some are greatly reduced, whereas others persist, and one appears to increase during

chromoplast formation (Kobayashi, 1991; Richards et al., 1991). Similarly, little has

been ascertained about the function or expression of genes involved in the synthesis

of chromoplast structures as few clones specific to this developmental stage have

been available for analysis (for example, Kuntz et al., 1992).








4
In considering what aspects of fruit ripening directly affect the proteins that

are targeted to the plastid, it quickly became apparent that two types of functions

could cause increases in proteins directed to the developing chromoplast. First,

proteins involved in the degradation of the photosynthetic apparatus or the build up

in carotenoids are excellent candidates for chromoplast-targeting and enhanced

synthesis during fruit ripening. A broad description of plastid senescence will be

considered, since that transition also involves the degradation of chloroplast

structures and because an examination of RNA from senescing leaves has shown that

many of the same transcripts are also present. Secondly, other aspects of maturation

may have indirect effects on the environment in which the developing plastid resides.

For example, the autocatalytic production of ethylene, the respiratory climacteric or

an increase in oxidative stress during ripening could secondarily create increases in

plastid-targeted proteins. Since the plastid is responsible for a number of basic

biosynthetic functions, such as the synthesis of aromatic amino acids, fatty acids and

8-aminolevulinic acid these changes outside of the plastid could create a need for

substrates synthesized within this organelle.

A consequence of the work described in this dissertation was the

characterization of a cDNA that encodes a plastid-localized low molecular weight

(MW) heat shock protein (hsp). Because transcript for this hsp increases during

ripening at normal temperatures, it was necessary to assess how this unexpected

finding fit into chromoplast development or fruit ripening. Since oxidative stress has

been associated with senescence and hsps have been induced by oxidative stress in








5
animal tissues, a consideration of heat stress proteins and oxidative stress during fruit

ripening will also be examined.



Morphological Changes

The overall changes that occur during the ripening of tomato fruit are as

familiar to ones mother as they are to any post-harvest physiologist. Full sized green

fruit harvested from the garden and brought into the kitchen will ripen normally. The

color changes observed during the ripening of tomato fruit are due to the breakdown

of chlorophyll and the deposition of lycopene within the fruit plastids. The breaker

stage is identified by the appearance of external color at the blossom end. The exact

fruit color that then develops is dependent on variety and consequently, the fruit may

turn yellow, pink, or orange-red. As the fruit becomes uniformly red, the cell walls

begin to soften. The characteristic flavor of ripe tomatoes is created by a

combination of glucose, fructose, citric and glutamic acids, which accumulate in the

vacuoles, along with the synthesis of hundreds of volatile compounds (Davies and

Hobson 1981; Grierson, 1986).

The young fruit is green because it contains chlorophyll in photosynthetically

functional chloroplasts. It is considered immature green (IMG) until it reaches its

full size. Growth is complete at mature green (MG). A green tomato may appear

morphologically quiescent; however, it is undergoing important ripening changes. Its

locular tissue transforms from a solid to a gelatinous substance, it can respond

rapidly to exogenous ethylene and the endogenous ethylene level also increases at








6
this time. By late MG, carotenoids begin to appear in the locules. Thus the color

change begins in the interior of the fruit (Kader and Morris, 1976). After the fruit

has passed through mature green, the transformation to a red ripe soft tomato

proceeds rapidly.



Biochemistry and Molecular Biology

Although the change in fruit color is a convenient method of classifying

tomato fruit ripening, a number of other biochemical changes also occur. For

example, a dramatic rise in respiration and ethylene production takes place. This

phenomenon is known as the climacteric. Climacteric ethylene levels reach about one

half of their maximum by the breaker stage (Picton and Grierson, 1988). The

respiratory peak occurs soon after the rise in ethylene (Grierson, 1986).



Alterations in Basic Metabolism During Fruit Ripening

Changes take place in the type of carbohydrate that accumulates as tomato

fruit ripens. Starch granules transiently appear between 14-28 days postanthesis in

the immature green chloroplasts (Davies and Cocking, 1965). Although these

plastids can fix carbon at up to 35% of the rate attained by leaf plastids, the starch

granules are mostly the product of sucrose imported from the leaves (Thelander et

al., 1986). Since the import of carbohydrate from the leaves stops by MG (Thelander

et al., 1986), fruit at this stage will develop normally if harvested from the plant.

About 28-35 days after anthesis degradation of starch occurs as an increase in soluble








7
sugars takes place. Consequently, little starch remains in the mature green fruit

(Yelle et al., 1988). The rapid degradation of starch precedes the climacteric rise in

respiration (Davies and Cocking, 1965) and this carbohydrate is stored as glucose

and fructose in the vacuole (Grierson, 1986). The degradation of starch seems to

occur via phosphorylase (Robinson et al., 1988), and the further steps of hexose to

triose occur via the pentose phosphate pathway and glycolysis (Thelander et al.,

1986). Therefore, as the tomato fruit matures, a shift of stored carbohydrate occurs

from starch in the plastid to hexose sugars in the vacuole. In fact, the red ripe

tomato contains no measurable starch and 47% hexose by dry weight (Davies and

Hobson, 1981). The changes in stored carbohydrate precede the breakdown of the

thylakoid membranes and consequently, any plastid associated enzymes responsible

for starch degradation are not expected to increase during chromoplast development.

It is unclear what causes the increase in CO, during ripening and,

consequently, the molecular regulation of this increase is also unknown (Solomos,

1988). Fluctuations in enzymes involved in the tricarboxylic acid (TCA) cycle and

glycolysis occur but it has not been determined whether these changes are due to a

variation in the level of enzymatic effectors or are caused by alterations in the

amount of de novo synthesis of these enzymes during ripening. Solomos (1988)

reviewed the literature on respiration in ripening fruit and concluded that the

respiratory burst measured is probably a result of an increase in substrate level

phosphorylation caused by enhanced glycolysis. An increase in the activities of

cytosolic NADP linked malic enzyme (Goodenough et al., 1986) and the glycolytic








8
enzyme phosphofructokinase (PFK) have been observed (Grierson, 1986). PFK is a

control point in glycolysis and an increase in this enzyme activity probably results in

an increase in carbon flow through this pathway (Solomos, 1988). Indeed, an increase

in the accumulation of ATP is generally noted during the respiratory rise (Solomos,

1988). Investigation of mitochondrial electron transport in ripening fruit suggested

that it remains unchanged (Solomos, 1988). However, the TCA cycle enzymes citrate

synthase, malate dehydrogenase, NAD-linked malic enzyme, and isocitrate

dehydrogenase decrease in ripening tomato fruit (Grierson, 1986; Jeffery et al.,1986).

Overall, these data do not explain why an increase in respiration is measured during

ripening. Since these changes are underway during the plastid conversion while

photosynthesis is declining, it is unclear how this may effect the synthesis of proteins

targeted to the plastid.



Other Changes Associated with Fruit Ripening

Apparently, the level of the anoxia-responsive enzyme, alcohol dehydrogenase

(ADH), increases during ripening in tomato fruit (Longhurst et al., 1990; Van Der

Straeten et al., 1991). Longhurst et al. (1990) concluded that the increase in ADH

during ripening may be caused by the cytoplasmic increase in pH. It has been

hypothesized that low oxygen levels could result within such a bulky organ, but by

exposing ripening fruit to different levels of 02 and CO2 these authors surmised that

the change in pH leads to an induction of this enzyme.








9
As fruit matures, the cell walls soften and an increase in soluble pectin occurs

(Grierson, 1986). Characterization of the regulation of the enzymes involved in cell

wall degradation has begun. These data suggest that the pattern of expression for

enzymes involved in cell wall degradation is complex and can even involve more than

one isozyme (DellaPenna et al., 1986; Grierson et al., 1986; Fisher and Bennett,

1991; Harriman et al., 1991). For example, antisense mutagenesis of the cell wall

softening enzyme, polygalacturonase (PG), has shown that although this enzyme is

dramatically induced during fruit ripening, loss of this enzymatic function has little

overall effect on maturation (Sheehy et al., 1988; Smith et al., 1988 and 1990).

The synthesis of hundreds of volatile compounds occurs as tomato fruit ripens

(Davies and Hobson, 1981). However, little is known about how these compounds

are synthesized during maturation.



Oxidative Stress and Fruit Ripening

Since a chromoplast-associated low MW heat shock protein was identified in

this work, it is important to understand the role this stress protein may play in fruit

development. Oxidative stress occurs when the cell's ability to respond is exceeded

by the level of reactive oxygen species present (Barja de Quiroga, 1992). The

induction of hsps by compounds that cause oxidative stress has been shown in animal

tissues (Drummond and Steinhardt, 1987; Cajone and Bernemmi-Zazzera, 1988;

Courgeon et al., 1988). In addition, oxidative stress has often been associated with

ripening and senescence. One theory postulates that a buildup in the deleterious








10

effects of free radicals results in the physiological manifestations of aging (Harman,

1992).

Free radical production during normal cellular metabolism

Reactive oxygen compounds can cause damage to proteins and especially

membrane components of the cell. A number of normal cellular functions result in

the production of these species, which can be a side effect of reactions that reduce

molecular oxygen. For example, at least one percent of the oxygen utilized during

respiratory electron transport is incompletely reduced (Fleming et al., 1992).

Furthermore, an increase in basal metabolism can result in an increase in the

amount of reactive oxygen generated even without invoking a breakdown in oxidative

phosphorylation (Barja de Quiroga, 1992). Photosynthesis is another normal cellular

function during which a large amount of free radicals can form (Scandalios, 1993).

In addition, some enzymatic reactions directly produce reactive molecules. Examples

of this latter group include xanthine oxidase (an ATP degrading enzyme) and beta

oxidation of fatty acids (Scandalios, 1993). Finally, certain environmental stresses can

enhance the level of reactive molecules. For example, radiation, herbicides,

pathogens, hyperoxia, and temperature fluctuations can induce free radical

production (Scandalios, 1993). Perhaps a buildup of these deleterious compounds

occurs during the ripening of tomato fruit. Since any cellular function that involves

the reduction of oxygen causes production of reactive oxygen, either autocatalytic

ethylene synthesis or the respiratory climacteric would be excellent sources of free

radicals.








11
One source of reactive oxygen is lipoxygenase activity, which increases during

ripening (Thompson et al., 1987). This enzyme incorporates oxygen into

polyunsaturated fatty acids (Hatanaka et al., 1992) and leads to a build up of the

reactive oxygen compounds hydroperoxide or superoxide. Recently, Bowsher et al.

(1992) have purified a membrane associated lipoxygenase from breaker stage tomato

fruit. They find that the activity fractionates with the thylakoid membrane.

Consequently, this could result in increases in the amount of reactive oxygen species

in the developing chromoplast.

The change in membrane integrity during fruit ripening

A decrease in membrane fluidity, which may be created by oxidative stress,

occurs during ripening and senescence along with a progressive loss of specialized

membrane function (Thompson et al., 1987). Many aspects of membrane structure

can affect the level of membrane viscosity. For example, the length or degree of

unsaturation of the hydrocarbons and the level of sterols all can play a part.

Although a decrease in membrane fluidity occurs in the plasma membrane of tomato

fruit (Legge et al., 1986) and pepper microsomal membranes (Whitaker, 1991), no

change in plastid membrane fluidity occurs in either tomato or pepper chromplasts.

Neither fluorescent membrane probes, which directly assess the structure within

specific environments of the membrane used by Legge et al. (1986), nor

measurements of the free sterol or total sterol to phospholipid ratios determined by

Whitaker (1991) could detect a change in the developing chromoplast membrane.

Considering the increase in carotenoid biosynthesis during ripening, which is








12
associated with plastid envelope membranes, it is appropriate that the integrity of

this membrane persists.

Free radical scavengers and oxidative stress

Initially, an increase in free radicals results in an increase in enzymes or

antioxidants that neutralize these reactive species. For example, a family of

superoxide dismutases (SOD) acts to scavenge superoxide and create oxygen and

hydrogen peroxide. Five isozymes of this enzyme have been described in tomatoes.

Two are cytoplasmic, one is mitochondrial and two occur in chloroplasts (Perl-Treves

and Galun, 1991). Also, ascorbic acid and a-tocopherol can act as antioxidants

(Leshem, 1988). A number of enzymes are also involved in reducing the levels of

hydrogen peroxide. Catalase, peroxidase and glutathione peroxidase all act in this

manner (Leshem, 1988). Additionally, glutathione reductase is required to regenerate

glutathione lost by interaction with hydrogen peroxide (Leshem, 1988).

Consequently,the increase in these enzymes is correlated with an increase in reactive

oxygen molecules. Any decrease in these enzymes with senescence, therefore, could

contribute to degeneration of membranes and disturbance of cellular function.

Increases in basal metabolism may induce SODs in plant tissue. Bowler et al.

(1989) concluded that the mitochondrial SOD may respond to changes in the activity

of respiratory electron transport, because the induction of this enzyme in tobacco

correlated with increased activity for cytochrome oxidase.

In addition, oxidative stress in one compartment can lead to the induction of

free radical scavengers in another part of the cell. This was shown when paraquat,








13
which is thought to act mainly on chloroplasts, was applied to tobacco and caused

a strong induction of SOD transcript in the mitochondria, cytoplasm and chloroplast

(Tsang et al., 1991).

The level to which SOD is induced within a cellular compartment may depend

on the amount of SOD that is currently present. This was the explanation of Perl-

Treves and Galun (1991) when they found that the addition of paraquat resulted in

a greater induction of the cytoplasmic SOD in comparison to the plastid message in

tomato leaves. The level of plastidial enzyme activity in mature leaves is already high

in comparison with transcript level. They suggested that induction of plastidial SOD

transcript may therefore be unnecessary.

Ethylene has been shown to induce cytoplasmic and plastidial SOD transcripts

and enzyme activity in tomato leaves (Perl-Treves and Galun, 1991) and

mitochondrial SOD message in tobacco leaves (Bowler et al., 1989). In response to

ethylene, therefore, an increase in reactive oxygen species has been noted and

enzymes within all three cellular compartments can be affected.

Free radical scavengers in ripening fruit

The role of free radical scavengers during fruit ripening, however, is somewhat

confusing. Peroxidase has been shown to decrease during ripening (Rabinowitch et

al., 1982) or peak during the pink stage in tomato fruit (Rothan and Nicolas, 1989).

Perhaps the techniques used by Rabinowith et al. (1982) were not sensitive enough

to detect this peak of activity. The transient increase in basic peroxidase activity

paralleled the increase in ethylene (Rothan and Nicolas, 1989). Since the conversion








14
of 1-aminocyclopropane-l-carboxylate (ACC) to ethylene requires oxygen, this may

lead to a transient increase in reactive oxygen molecules and an increase in this free

radical scavenger.

Changes in SOD have been reported during tomato fruit ripening but results

were contradictory. SOD activity has been found to peak at the pink or orange phase

(Rabinowitch et al., 1982; Livine and Gepstein, 1988). However, no change in the

two plastidial SOD isozymes was reported by Perl-Treves and Galun (1991), nor was

a peak of the cytoplasmic or plastidial SOD message noted during ripening. In fact,

they found that the plastid-associated message actually decreased with maturation.

They explain these contradictory results by suggesting that the enzyme could be quite

stable and turnover very slowly. It is hard to explain all of the varied data reported

by these three groups. More work needs to be done before a conclusion can be made

about free radical scavengers and ripening in tomato fruit. Since the messages for the

additional plastidial and cytoplasmic SODs have not been examined, perhaps these

additional data will help reconcile these dissimilar observations.

Pepper chromoplasts do appear to respond to an oxidative stress during fruit

maturation (Romer et al., 1992). The antioxidant producing enzyme cysteine synthase

was purified and a cDNA was isolated. They found not only did this enzyme increase

during ripening but the activity of glutathione reductase, glutathione synthetase and

glutathione content within chromoplasts also increased during their development.

Since all these compounds protect organisms from oxidative damage and an increase

in a-tocopherol also occurs during ripening, they concluded that these increases in








15
antioxidants and peroxide scavenging compounds may allow protection of the

overaccumulated carotenoids and other membrane components from oxidative stress.

Since the results from tomato fruit on the induction of free radical scavengers

is contradictory, information from other systems may help predict what occurs in

tomato fruit chromoplasts. Leaf tissue responds to an increases in basal metabolism

and the addition of ethylene by inducing SOD (Bowler et al., 1989; Perl-Treves and

Galun, 1991). In addition, a compound expected to affect predominantly one

compartment can induce SOD in other portions of the cell (Tsang et al., 1991).

Finally, the level of induction may be dependent on current levels of enzyme activity

(Perl-Treves and Galun, 1991). Perhaps the results from pepper chromoplasts where

increases in a number of these free radical scavengers has been measured, explains

how the chromoplast, unlike the plasma membrane, avoids oxidative damage and

maintains membrane integrity (Whitaker, 1991; Romer et al., 1992). One might

predict that the plastid can respond to an environment that contains an increasing

amount of reactive oxygen and consequently it is able to maintain chromoplast

membrane integrity during ripening. These data also suggest that the production of

ethylene and/or the respiratory climacteric may induce the production of

chromoplast-associated proteins involved in free radical scavenging.



Changes in Plastid Structure

Massive changes take place in plastid ultrastructure during the chloroplast to

chromoplast transition. The thylakoid membranes are dismantled and chlorophyll








16
degrades (Thelander et al., 1986). Concomitantly, lycopene begins to accumulate in

the stroma. The green flesh mutant, which is inhibited in chlorophyll degradation

during ripening, is helpful in the determination of how pigment accumulates in the

developing chromoplast. Electron micrographs show that the granal stacks persist in

this mutant even as pigment is deposited (Goodwin, 1980), and suggests that

lycopene builds up around the disintegrating thylakoids. By the time a normal tomato

is fully ripe, the chromoplasts contain little else but large stores of lycopene, which

accumulate as lipophilic globules and crystals of pigment (Harris and Spurr, 1969).

The type of chromoplast that develops may be dependent on the type of

carotenoids that accumulate. The 'r' mutant, for example, with its low level of both

lycopene and B-carotene, contains only plastoglobules (Goodwin, 1980).



Regulation of Photosynthetic Proteins

Transcripts for the nuclear-encoded components of photosynthesis decrease

long before the breakdown of the thylakoid membranes. The mRNA for rbcS and

cab (Rubisco small subunit and chlorophyll a/b binding protein respectively) are not

detected after 30 days post anthesis (Piechulla et al., 1985, 1986). This loss of nuclear

transcripts occurs 5 to 10 days before MG, and precedes the end of chlorophyll

synthesis and the disassembly of the thylakoid membranes by 2-3 weeks.

The plastid encoded messages rbcL and psbA (Rubisco large subunit and the

32kD photosystem II protein), however, persist throughout development (Piechulla

et al., 1986). Most of the other plastid transcribed proteins, such as the photosystem








17
I and II proteins (psaA psbB psbC or psbD), all diminish in message levels

throughout development.

Once ripening has progressed to an intermediate stage of development beyond

mature green, levels of photosynthetic activity have greatly diminished and this is

reflected in decreased amounts of photosynthetic proteins. For example, by the

yellow stage of development, the amount of LHCP protein has declined to 10% of

the level present in IMG fruit (Livine and Gepstein, 1988).

At the yellow-orange stage, the level of Rubisco activity has diminished to 2%

of the level present at MG (Piechulla et al, 1987) while the amount of measurable

protein for the large subunit has also decreased. The level of photosynthetic electron

transport has decreased to 13% of what was observed at MG (Piechulla et al., 1987).

Only plastocyanin and the 32kD protein were detected by this stage of development.

These data underscore the dramatic change in the protein components of the

plastid that occurs between mature green and this intermediate stage of ripening. It

is unclear from this type of analysis whether the loss of photosynthetic proteins is

simply due to a decrease in synthesis or is also caused by an enhanced production

of degradative enzymes.

Examination of plastid gene expression during chromoplast development has

shown a reduction in the level of plastid transcript during this process. It is uncertain

whether this is the result of posttranscriptional regulation (Gruissem et al., 1989;

Marano and Carillo, 1991), or whether the rate of transcription is decreased due to

methylation of the plastid genome (Ngernprasirtsiri et al., 1988; Kobayashi et al.,








18

1990). The level of translation is also dramatically reduced in Capsicum plastids

(Kuntz et al., 1989) where ultrastructural analysis has shown that red fruit contain

no ribosomes or rRNA (Carde et al., 1988). Richards et al. (1991) have identified

a plastid transcript that is more abundant in chromoplast RNA than chloroplast

RNA of tomato fruit. However, given the lack of functional translation in pepper

chromoplasts and the decreased amount of transcripts present in tomato

chromoplasts, it is expected that most proteins that are increasingly present in

chromoplasts will be nuclear-encoded.



The Role of Ethylene in Tomato Fruit Ripening

The rise in ethylene during the climacteric is mediated by de novo synthesis

of at least the final two enzymes in the biosynthetic pathway (Holdsworth et al. 1987;

OIson et al., 1991; Rottmann et al., 1991). To date, only the genes for the enzymes

that catalyze these final two steps in ethylene biosynthesis have been isolated.

Ethylene is synthesized from methionine via S-adenosyl-L-methionine and 1-

aminocyclopropane-1-carboxylic acid (ACC). The enzyme that synthesizes ACC

(ACC synthase) is thought to be a pyridoxal 5'-phosphate utilizing enzyme (Yip et

al., 1990). The final step in the synthesis of ethylene is mediated by ethylene oxidase

(EFE), requires oxygen, and can be inhibited by the addition of free radical

quenchers (Matoo and Aharoni, 1988). The synthesis of ACC is considered the rate

limiting step in ethylene biosynthesis. However, EFE is also increasingly synthesized








19
during ripening in tomato and avocado fruit, (Holdsworth et al., 1987, McGarvey et

al., 1992) and during the senescence of carnation petals (Wang and Woodson, 1991).

Production of transgenic tomato plants that contain antisense transcripts for

the enzyme ACC synthase has shown that ripening involves both ethylene dependent

and independent pathways (Theologis, 1992). A number of laboratories have

produced transgenic tomato plants with reduced levels of ethylene (Hamilton et al.,

1990, Klee et al., 1991, Oeller et al., 1991). The most dramatic decrease occurred in

a transgenic plant carrying ten antisense copies of part of a gene for ACC synthase.

The authors reported that the plant has a 99.5% reduction in the level of ethylene

(Oeller et al., 1991) and produces fruit that remain firm and green until exogenous

ethylene is applied. If no ethylene is added, the mutant fruit still express RNA for

the ripening induced cell wall softening enzyme, polygalacturonase (PG) (Oeller et

al., 1991). This result was unexpected because ethylene is required for the expression

of PG. This suggests that the regulation of ripening by ethylene is more complex than

just simple transcriptional control. While the transcription of PG is ethylene

independent, the expression of the enzyme is dependent on the continued presence

of this hormone.



Transcriptional Regulation of Fruit Ripening


A molecular analysis of fruit ripening in tomato has led to the conclusion that

the de novo synthesis of ripening specific proteins occurs and is responsible for many

of the changes associated with maturation. Several researchers have characterized








20

changes in the profile of in vitro translation products that occur during development

of tomato fruit (Rattanapanone et al., 1978; Speirs et al., 1984; Biggs et al., 1986;

Lincoln et al., 1987). A number of groups have constructed cDNA libraries enriched

in ripening specific sequences (Mannsson et al., 1985; and Slater et al., 1985; Lincoln

et al., 1987). Generally, the onset of ripening in tomato fruit is mediated by an

increase in a specific subset of transcripts, including those for PG, EFE and ACC

synthase (DellaPenna et al., 1986; Grierson et al., 1986; Holdsworth et al., 1987;

Olson et al., 1991; Rottman et al., 1991).

Examination of the clones isolated by Grierson's group has shown that, for

most of their cDNAs, RNA fails to accumulate when the fruit is held at high

temperature (Picton and Grierson, 1988). High temperature (35C) has an inhibitory

effect on fruit ripening, depressing the synthesis of lycopene, PG, and ethylene

(Picton and Grierson, 1988). Perhaps this effect of high temperature represents a

heat shock response (Picton and Grierson, 1988). This was not an overall effect for

all clones, however, since RNA increased initially, for some clones, in response to

an increase in temperature. Unfortunately, many of these clones have yet to be

assigned a function.



Processes Associated with Chromoplast Development

Upon review of the work characterizing the molecular changes that occur

during the chloroplast to chromoplast transition, it is notable that mainly

photosynthetic proteins have been examined during this phase (Piechulla et al., 1985,








21
1986, 1987; Livine and Gepstein, 1988). To undertake the investigation of proteins

that increase during chromoplast development, a method must be found to identify

proteins specific to this process. Isolation of chromoplasts and the subsequent

comparison of proteins on SDS-PAGE from different developmental stages has been

attempted and proteins that increase in amount have been identified (Iwatsuki et al.,

1984, Bathgate et al., 1985, Wrench et al., 1987, Hadjeb et al., 1988). Using this

method, specific chromoplast-associated proteins have been isolated from only

pepper chromoplasts (Hadjeb et al., 1988). Antibody has been purified for two

proteins that increase during Capsicum chromoplast development (Newman et al.,

1989). One of these proteins binds carotenoids and is a major constituent of

Capsicum chromoplast membranes (Cervantes-Cervantes et al., 1990). However, this

protein probably binds capsanthin since the antibody does not react to any protein

present in chloroplasts or tomato fruit chromoplasts (Cervantes-Cervantes et al.,

1990). While this type of approach has resulted in the characterization of a few

proteins involved in chromoplast function, only abundant proteins can be identified

in this manner.

The plastid is involved in the synthesis of many compounds necessary for cell

function. For example, the synthesis of fatty acids, aromatic amino acids and other

substances such as 8-aminolevulinic acid have all been localized to plastids. Many of

these compounds are precursors to a wide array of secondary metabolites, so it is

possible that an increased synthesis of these plastid-synthesized compounds is

required during chromoplast development. A recent review by Hrazdina and Jensen








22
(1992) however documented that in many instances isozymes for the synthesis of

amino acids involved in secondary metabolism may be present in the cytoplasm

rather than in the plastids. More information on the compartmentalization of these

pathways is needed before conclusions about the localization of enzymes for

secondary metabolism can be drawn.



Carotenoids

Enzymes responsible for the synthesis of carotenoids are obviously the most

likely candidates for proteins that may be increasingly produced during chromoplast

development. Therefore, it is necessary to consider what enzymes and cofactors may

be involved in this pathway and how it may be regulated.

Carotenoid function

In the chloroplast, carotenoids are an integral part of the photosynthetic

apparatus, where they act as accessory pigments funneling light energy into the

reaction centers. If light intensity becomes too great, the photosynthetic carotenoids

can also trap excessive light energy. Without these peripheral pigments, the plants

may photobleach (Mayfield et al., 1986). The necessity of carotenoids to forestall this

deleterious event is apparent when synthesis of carotenoids is blocked by inhibitors

or mutation.

Another function of carotenoids, however, is the pigmentation of many

flowers and fruits. Most of the orange, yellow or red pigments found in these tissues

can be attributed to carotenoids, which accumulate in the chromoplasts.










Carotenoid structure

Carotenoids are long chain hydrocarbons. The conjugated double bonds give

them their color. The synthetic pathway produces carotenes, xanthophylls and

abscissic acid. The desaturations that occur in the biosynthesis of carotenoids can

create either a cis or trans configuration. Cyclization at one or both ends can occur

(Goodwin, 1980). A beta, epsilon or gamma ring forms based on the position of the

double bond (Goodwin, 1980). The end groups can be acyclic in the case of lycopene.

If the pigment is a long chain hydrocarbon then it is a carotene. Xanthophylls on the

other hand, are carotenoids that contain oxygen.

A number of different modifications are possible to this basic long

hydrocarbon chain; 500 different structures have been described. The complement

of carotenoids found in green leaves are relatively uniform throughout the higher

plant kingdom (Goodwin and Mercer, 1983). This may be expected considering the

importance these compounds play in photosynthesis and the conservation of structure

required of the proteins and pigments of the thylakoid membranes. However, wide

structural variety occurs in carotenoids found in petals and fruit. The type of

molecule that accumulates is species dependent.

Carotenoid synthesis

The basic scheme for the synthesis of higher plant carotenoids is shown in

Figure 2-1. The production of phytoene represents the first committed step in the

synthesis of carotenoids. Usually, step-wise desaturation of phytoene leads to all-

trans-lycopene. The normal product of phytoene synthase is 15-cis-phytoene. Where








24

does the cis-trans isomerization take place? Beyond zeta-carotene, trans

intermediates are involved. Four stepwise removals of 2 hydrogen molecules occur

from phytoene to lycopene, as oxygen is reduced in this reaction. Proton attack of

the C1 double bond of lycopene is involved in the formation of the ring structures.

Different enzymes are responsible for the different rings that are formed. Little

interconversion of these rings occurs. Xanthophyll formation results from the

addition of hydroxyl groups.

Location of carotenoid biosynthesis

Where are the enzymes of carotenoid synthesis located? All activities after the

synthesis of isopentyl pyrophosphate (IPP) have been shown to occur in the plastids

(Gray, 1987). Compartmentalization of the enzyme activity has been best analyzed

in chloroplasts as opposed to chromoplasts, since they are most amenable to

fractionation. Mayfield (1986) examined the chloroplasts of spinach, and concluded

that phytoene desaturase is located on the inner envelope membrane. Ultrastructural

examination of developing chromoplasts suggests that pigments associate with

membrane as they are produced in the inner envelope, which is followed by

vesiculation of this membrane pigment complex (Camara and Brangeon, 1981). In

addition, examination of the lipid component of these membranes confirms that they

are a product of the inner envelope (Sitte et al., 1980).

Genetic studies have mapped all the known tomato mutants to the nuclear

genome (Tomato Genetic Cooperative Report, 1987), which suggests that the genes

involved in the synthesis of carotenoids are nuclear-encoded. Furthermore, inhibition













Isopenlenyl pyrophosplile

Geranylgeronyl pyrophosphole

Phyloene


Cis-C-orolene

1
Proneursporene

Prolycopene


.'Corolene
v Co*C tene


y -Corolene


*-CaCoroene


Fig. 2-1 Pathway for the Biosynthesis of Carotenoids in Higher Plants








26
of plastid translation has demonstrated that this process is not necessary for

carotenoid accumulation (Camara, 1984). Finally, the enhanced synthesis of phytoene

caused by the addition of CPTA is blocked by the cytoplasmic translation inhibitor

cycloheximide. Therefore, the evidence indicates that the enzymes required for

carotenoid synthesis are imported into the plastid.

Enzymology of carotenoid biosynthesis in tomato fruit

The purification of the carotenoid biosynthetic enzymes is difficult because all

the enzymes in this pathway beyond the synthesis of phytoene are associated with

plastid membranes. Consequently, studies that characterize the number and type of

enzymatic steps responsible for the synthesis of these compounds in higher plants

have relied on adding radioactive precursors to solubilized crude enzyme

preparations. The distribution of radioactivity between the different carotenoids is

then measured. These experiments have shown that when, for example, red tomato

extracts are fed labeled lycopene, cyclic carotenoids are produced (Quershi et al.,

1974). This suggests that the enzymes for the production of these compounds are

present, but do not normally accept the lycopene that is produced in vivo. Perhaps

an inhibitor is present in vivo that has been diluted out in vitro. Alternatively, a

spatial separation between these enzymes may exist in vivo that is disrupted in vitro

(Papastephanou et al., 1973). These in vitro studies involved the addition of

quantities of substrate and cofactors that may drastically differ from the situation in

vivo. These unexpected results demonstrate that the pathway for the synthesis of








27
carotenoids is complicated and a more thorough understanding of the production of

carotenoids requires analysis in less disrupted systems.

Examination of mutants in the synthesis of tomato fruit carotenoids has

predicted that the photosynthetic pigments are produced by different isozymes. A

number of tomato mutants have been studied (for review see Goodwin and Goad,

1970). Many have been mapped, their complement of carotenoids has been measured

and the position of the genetic lesion in the biosynthetic pathway has been predicted

(Goodwin and Goad, 1970; and Khudari, 1972; Tomato Genetic Cooperative Report,

1987). Many of these mutants affect only fruit color, while the photosynthetic

pigments found in the leaves are completely normal (Thelander et al., 1986).

Genetic evidence suggests that fruit carotenoids are produced by two separate

pathways. One pathway produces the abundant amount of lycopene generally

associated with red ripe tomatoes, while the other pathway appears to make a small

amount of B-carotene. Evidence that two pathways exist includes the tomato mutant

apricot, which is deficient in the accumulation of lycopene without affecting the level

of B-carotene in the fruit (Goodwin, 1980). Additional evidence includes the fact that

the production of lycopene is sensitive to high temperatures in normal red tomatoes

(Thelander et al., 1986), while the high f3 mutant has reduced lycopene and enhanced

temperature sensitive synthesis of B-carotene. In other words, the dominant high f.

tomato seems to have used the same temperature sensitive pathway to augment the

levels of B-carotene. Both the existence of the apricot mutant and the residual non-








28

temperature sensitive amount of B-carotene found in high f fruit imply that a second

pathway exists.

The residual, but ever present, level of total carotenoids found in some

mutants, the presence of temperature sensitive B-carotene, and enzymes that function

in vitro but fail to accumulate their product in vivo suggest that a major ripening

enhanced inducible pathway for carotenoid biosynthesis may exist along with a minor,

possibly constitutive, path. If the minor pathway is responsible for the production of

the cyclic carotenoids, this predicts that enzymes for the production of cyclic

carotenoids may not necessarily be enhanced during ripening in normal red

tomatoes.

Characterization of carotenoid biosynthesis in bacteria: a model for higher plant
analysis

The cloning and subsequent complementation of genes for carotenoid

biosynthesis in bacteria demonstrates how powerful such a systematic analysis can be

in the understanding of how the pathway functions. These genes are organized into

clusters in the bacteria Erwinia herbicola and Erwinia uredovora. In addition, the

carotenoids in these species are similar to the pigments that accumulate in higher

plants. A number of investigators have used these genes to transform E. coli,

Agrobacterium and Zymomonas (Misawa et al., 1990; Hundle et al., 1991; Misawa et

al., 1991; Naagawa and Misawa, 1991). Deletion analysis of the cluster transformed

into E. coli allowed an unambiguous ordering of the pathway by analysis of the

carotenoids that accumulated in the resulting mutants (Misawa et al., 1990).








29
The power of the characterization of carotenoid biosynthesis in E. coli is

demonstrated by the analysis of individual genes from different species by Linden et

al. (1991). A plasmid containing the genes responsible for the synthesis of phytoene

in Erwinia uredovora can be transformed into E. coli and sequentially cotransformed

with a plasmid containing a phytoene desaturase (PDS) gene. The type of pigment

that is produced by the specific PDS enzymes can then be monitored. The PDS

cDNAs cloned from Synechococcus, Rhodobacter and Erwinia uredovora were tested.

Analysis of the carotenoids produced in these transgenic E. coli showed that the

different enzymes produced a different complement of products. For example, the

Synechococcus enzyme was able to introduce two double bonds in phytoene while the

Rhodobacter enzyme introduces three double bonds. This analysis also shed some

light on the level of cis-trans isomerizations that accumulate in the various

complemented bacteria. The authors concluded that a gradual shift from cis to trans

carotenoids occurs with an increase in the number of conjugated double bonds

produced by the different enzymes. This suggests that a specific cis-trans isomerase

may not be required for this interconversion. Finally, since the Rhodobacter PDS

adds 3 double bonds, the specificity of the Erwinia lycopene cyclase and beta-

carotene hydroxylase on the asymmetrical molecule formed could be assessed. This

experiment was performed by the introduction of a plasmid containing the entire

Erwinia gene cluster except for a mutant PDS gene. Cotransformation of this plasmid

with theRhodobacter PDS created unique carotenoids. This experiment demonstrated

that the cyclase or the hydroxylase recognizes half of the carotenoid molecule. This








30

type of analysis can allow a careful identification of the number and types of enzymes

required to produce a specific complement of carotenoids. The sequential cloning

and analysis of the different carotenoid biosynthetic genes in transgenic bacteria

demonstrate how powerful such an approach could be for the dissection of this

pathway in higher plants. If the higher plant carotenoid genes were cloned, a similar

series of experiments could be undertaken.

Molecular biology of carotenoid biosynthesis in higher plants

The gene for phytoene synthesis has been isolated from tomato fruit.

Originally, the clone for the phytoene synthase cDNA (pTOM5) was isolated by

Slater et al. (1985) simply because it recognized increasing amounts of RNA as

ripening progressed. Significant homology to the deduced amino acid sequence of the

tomato cDNA, pTOM5, to a clone for phytoene synthase in Rhodobacter was

identified (Armstrong et al., 1990a). Bartley et al. (1992) used this information to

clone a similar cDNA from tomato fruit and provided evidence, by complimenting

a mutant Rhodobacter, that it indeed coded for phytoene synthase. Recently, a

normal red variety of tomato has been transformed with a constituitively expressed

antisense version of pTOM5 (Bird et al., 1991). This resulted in yellow fruit and pale

flowers. Chlorophyll a and b levels were normal in the leaves of the transformed

plants, which suggested that the leaf carotenoids were unaffected by the constitutively

expressed antisense message. These results confirm that pTOM5 codes for a

phytoene synthase that is specific for ripening fruit. A more complete analysis of the

transgenic plants by Bramley et al. (1992) confirmed that antisense pTOM5 alters








31
carotenoid accumulation in the flower and fruit but not the leaves of transgenic

plants.

The gene for geranylgeranyl pyrophosphate (GGPP) synthase has been cloned

from pepper fruit (Kuntz et al., 1992). The enzyme was purified, antibody was

produced, and a cDNA was isolated from a ripe pepper fruit expression library. Both

the mRNA and the protein increased during fruit ripening. Immunological

examination has shown that this stromal enzyme is mainly found concentrated

around chromoplast plastoglobuli (Cheniclet et al., 1992).

The deduced amino acid sequence from the cyanobacterium Synechococcus

PDS allowed the cloning of a cDNA from soybean cotyledon by Scolnik's lab

(Bartley et al., 1991). Similar work by Pecker et al. (1992) produced a PDS from

ripening tomato fruit. An interesting observation resulting from this work is that,

while the cyanobacterium and higher plant PDSs share more than 65% deduced

amino acid identity, no homology beyond a short amino terminal region that contains

a conserved dinucleotide-binding motif exists with the fungal, Rhodobacter or Erwinia

PDS. This suggests that separate PDSs may have evolved for higher plants and green

algae in contrast with other photosynthetic organisms. Following a different

approach, Camara's lab purified a phytoene desaturase from Capsicum and used

antibody to isolate a cDNA clone (Hugueney et al., 1992). The deduced amino acid

sequence of that clone has striking homology to the tomato fruit sequence. Only

slight increases in the steady-state level of RNA that hybridizes to this clone occur

at MG. This is in contrast with the analysis of the protein and the enzyme activity,








32
which increases significantly with ripening. It appears from the evidence provided by

both laboratories (Hugueney et al., 1992; Pecker et al., 1992) that the quantity of this

mRNA is low during ripening. Perhaps during chromoplast development large

increases in mRNA occur only for the early enzymes involved in carotenoid

biosynthesis.

Mayer et al. (1992) have purified an oxidoreductase that is specific for

chromoplasts and crucial for desaturation of carotenoids. The peripheral nature of

the involvement of this enzyme in carotenoid synthesis is supported by the fact that

antibody to this protein does not inhibit the synthesis of carotenoids. However,

oxidized quinones are required for carotenoid desaturation, so it is assumed that this

enzyme acts to affect the redox state of the chromoplast membranes where a large

amount of oxidized quinones and tocopherols found. Perhaps the oxidoreductase and

the increased amount of antioxidants in pepper chromoplasts point to an

environment that contains an escalating amount of reactive oxygen (Romer et al.,

1992). The desaturation of phytoene requires the transfer of electrons to oxygen.

This might cause an increase in reactive oxygen and lead to the induction of enzymes

that generate antioxidants.

Two pathways are predicted for the synthesis of carotenoids in ripening

tomato fruit. None of the genes for the enzymes responsible for steps in the pathway

beyond the synthesis of zeta-carotene have been cloned. It is interesting that only

minor increases in the steady-state level of RNA for PDS occur during fruit ripening.

Since large increases in steady-state levels of RNA accumulate for both phytoene








33
synthase in tomato and GGPP synthase in pepper fruit (Slater et al., 1985; Kuntz et

al., 1992), perhaps only the very early steps of this pathway are transcriptionally

induced during ripening, while transcript for the later steps will be constitutively

expressed at a low level. Conceivably the dominant mutants del+ and b+, which

produce increased amounts of 8 and B carotenoids respectively, will contain increased

levels of RNA for the the enzymes responsible for these later steps in the

biosynthetic pathway.



Chloroplast Senescence

Chloroplast senescence involves the degradation of chlorophyll and the

dismantling of photosynthetic membranes. Considering that the analysis of

chloroplast breakdown during chromoplast formation has relied on ultrastructural

analysis and characterization of mostly the decrease in steady-state levels of

photosynthetic proteins, perhaps an understanding of how this process occurs during

leaf sensecence will allow predictions for the plastid transition in ripening fruit.

Indeed, 7 out of 12 fruit ripening enhanced clones share homology to transcripts that

increase in senescing leaves (Davies and Grierson, 1989). During ripening and

senescence starch, chlorophyll and photosynthetic proteins degrade (Davies and

Grierson, 1989). A burst in ethylene synthesis has been correlated with senescence

in leaf tissue (Davies and Grierson, 1989) and respiration also increases.










Photosynthetic protein synthesis during leaf senescence

A decrease in the synthesis of photosynthetic proteins occurs during

chloroplast senescence (Roberts et al., 1987). This loss of proteins follows a similar

pattern as described for chromoplast development by Piechulla. The synthesis of

protein in different ages of Phaseolus leaves was measured, and the amounts of

cytochrome f, cytochrome b6, a and b subunits of the ATPase, 68kD PSI protein, and

LHCP decline in leaves. However, the 32 kD protein persists throughout senescence.

Ultrastructural analysis of chloroplast senescence

Plastid senescence is a gradual ordered process, which occurs within the

plastid. It was initially assumed that chloroplasts were engulfed and degraded within

vacuoles (reviewed by Gepstein, 1988). These early studies concluded that senescing

leaves actually contained fewer plastids. However, reappraisal of this work suggested

that the isolation of fewer plastids in senescing leaves was due to the increased

difficulty in isolating these fragile organelles (reviewed by Gepstein, 1988).

Additional ultrastructural analysis showed that plastids in senescing leaves undergo

a transition in which thylakoids become unstacked and plastoglobuli accumulate

(Gepstein, 1988). This suggests that the degradation of plastid components during

senescence occurs within the plastid itself (Thayer et al., 1987), and is gradual and

ordered. The plastid envelope maintains its integrity until very late in senescence,

long after the degradation of thylakoid membranes is complete (Thomson and Platt-

Aloia, 1987). Furthermore, this means that if enhanced degradation of plastid








35
components occurs during sensecence then it is possible that new proteins would be

imported into the plastid for this purpose.

The degradation of chlorophyll during chloroplast senescence

The degradation of chlorophyll has been suggested to be the trigger for the

proteolysis of the protein components of the thylakoid membranes. Unfortunately,

the pathway for the catabolism of chlorophyll is not well understood. Work with the

non-yellowing mutant of the temperate grass festuca suggested that an initial step in

thylakoid degradation involves dephytlation of the chlorophyll molecule while it

remains in the pigment-protein complex (Thomas et al., 1989). A polar green

chlorophyll degradation product can be isolated from purified light harvesting

complexes (LHCs) of these mutant plastids. This degradation product is also

produced in normal plastids exposed to anoxic conditions. The buildup of this

intermediate occurs in the mutant plant because a downstream step in the

chlorophyll catabolism pathway is missing. Since the product could be isolated from

purified LHCs the authors concluded that the first step in the degradation of

chlorophyll occurs within the protein-pigment complexes of the thylakoid membrane.

Chlorophyllase has been isolated from chloroplasts and could perform this function

(Matile et al., 1989). However, the protein does not seem to increase during

senescence. Alternatively, the enzyme could remain latent in the plastid and be

activated when necessary. Perhaps the activation of the chlorophyllase requires a

newly synthesized protein?








36
The next step in the catabolism of chlorophyll is probably an oxidation.

However, it is not clear whether this occurs in the plastid or vacuole (Matile et al.,

1989). One theory suggested that a thylakoid associated chlorophyll oxidase is

induced by an increase in linolenic acid during senescence (Luthy et al., 1984), which

triggers the catabolism of chlorophyll and the resulting cascade of degradative

reactions. This idea may require reappraisal in light of the fact that oxidized pyyroles

have been found in vacuoles and not isolated from senescing plastids (Matile et al.,

1989).

Degradation of the thylakoid membranes during chloroplast senescence

The analysis of stay-green mutants in soybean and the previously described

mutant in festuca demonstrates that the degradation of the thylakoid membrane is

mediated by at least two separate pathways and is the result of both nuclear and

plastid-encoded proteins.

For example, the cytoplasmic mutant cytG of soybean specifically retains the

(LHCs) (Guiamet et al., 1991). Clearly the breakdown of the core proteins involves

a separate path from the degradation of the LHCs. Since chlorophyll a and b are still

catabolized in this plant, these data suggest that a plastid-encoded protease is lacking

and is involved in LHC breakdown.

When two homeologous recessive nuclear-encoded genes (did2) of soybean are

present in this tetraploid plant, most of the chlorophyll is retained and all of the

thylakoid proteins appear to be present, in contrast with nonmutant leaves (Guiamet








37

et al., 1991). These data imply that the degradation of the thylakoid membrane in

soybean is also mediated by nuclear-encoded genes.

Evidence from the mutant festuca underscores the complexity of the

degradation of thylakoids. The phenotype of this recessive mutant is a selective

maintenance of components of the photosynthetic membranes. For example, the level

of LHCP is maintained in the mutant plant long after the amount of this protein has

begun to diminish in normal plants (Thomas and Hilditch, 1987). Additionally, the

degradation of the plastid D1 protein, which normally turns over in either the light

or the dark, is inhibited in the dark, but not the light (Thomas and Hilditch, 1987).

The 33Kd protein, however, degrades normally in this mutant (Thomas and Hilditch,

1987). These mutant plants are also able to photobleach if they are subjected to high

light intensities (Thomas and Hilditch, 1987). These data suggest that two separate

protease systems are responsible for the degradation of thylakoid membranes. One

system is light activated and unaffected by this mutation and another functions in the

dark and is inhibited by this genetic lesion.

Degradation of Rubisco

An examination of the degradation of Rubisco suggests how a stromal protein

may be broken down during senescence. The breakdown of Rubisco can be induced

by oxidative stress, in a process that appears to mimic natural senescence (Mehta et

al., 1992). A specific and highly conserved cysteine is oxidized by the addition of

CuSO4 and leads to dimerization of the protein. This is followed by a transient

accumulation of this stromal protein on the membrane, and, finally, degradation. In








38
vitro studies have also demonstrated that the oxidized form of Rubisco is inactive and

more susceptible to proteolytic digestion (Penarrubia and Moreno, 1990). This

suggests that the turnover of stromal protein is selective and may involve membrane

associated proteases. It is uncertain whether this response to oxidative damage is

analogous to senescence, however, it does demonstrate that an ordered system of

stromal protein degradation exists in the plastid. It remains to be seen if natural

senescence involves a build up of oxidized protein that enters into this degradation

pathway, or if it is developmentally manifested in some other manner.

Changes in other components of the chloroplast during senescence

A decrease in the level of galactolipids has been noted in senescing

chloroplasts (Woolhouse, 1984). However, Woolhouse (1984) pointed out that it is

uncertain whether this change in lipid content is caused by decreased biosynthesis or

increased degradation.

The isolation of proteases involved in plastid protein degradation has been

fairly unsuccessful (Dalling, 1987). The majority of proteases are found in the

vacuole, and their presence masks an examination of changes in plastid proteases

during senescence.

Control of chloroplast senescence

Overall, plastid senescence requires continued protein synthesis, since the

process can be inhibited by cycloheximide (reviewed by Gepstein, 1988). Although

plastid senescence can be triggered by a number of environmental stimuli such as

darkness, oxidative compounds, or nitrogen deprivation, it is still unclear whether this








39
process is mediated by an increase in de novo synthesis of specific proteins. In the

case of Rubisco, turnover is slow until a nuclear encoded event (assumed since it is

inhibited by cycloheximide or kinetin) triggers the rapid degradation of this abundant

photosynthetic protein (Thayer et al., 1987).

Perhaps the breakdown of chlorophyll acts as a signal for the degradation of

photosynthetic membrane proteins (Nock et al., 1992). This has been suggested by

the results from studies of the mutant festuca where a mutation in chlorophyll

catabolism inhibits the breakdown of the protein components of the thylakoid

membranes. The production of the dephytlated chlorophyll degradation product

requires protein synthesis (Thomas et al., 1989), which implies that the synthesis of

a cytoplasmic protein is required for induction of chloroplast senescence.

Conclusions about chloroplast senescence

To date, ultrastructural analysis has suggested that the senescence of

chloroplasts is a gradual event within the organelle. The degradation of plastid

proteins is a complex process involving multiple proteases with different properties.

Since the breakdown of chloroplasts is inhibited by cycloheximide, this suggests that

senescence requires continued protein synthesis (Gepstein, 1988). Additionally, the

rapid degradation of Rubisco during senescence implies that this upsurge in protein

loss may require a de novo increase in proteins involved in this degradative process

rather than simply continued constitutive expression.

It is difficult to draw generalizations about what may trigger senescence from

the analysis of the few mutants available. The mutant phenotype could simply result








40

from the accumulation of particular plastid components due to loss of a single

function and may not represent a protein that is developmentally induced during

senescence. It seems safe to assume that the non-yellowingfestuca demonstrates that

although the thylakoid membranes can degrade in response to photooxidative stress,

the more gradual and perhaps dark associated breakdown requires proteases that are

not active until the pigment component has been modified.

It would be extremely helpful if proteins or the genes responsible for the

senescence of chloroplasts could be isolated. An understanding of their regulation

could suggest how senescence is controlled. It is possible that the conversion from

chloroplast to chromoplast may represent an ideal system for the isolation and

identification of cDNA clones for proteins involved in this degradative process since

the chromoplast transition does not take place in a sensecing tissue.



Heat Shock Proteins and Oxidative Stress

The identification of a chromoplast-associated low MW heat shock proteins

(hsp) during this study provoked an investigation into the literature on why this hsp

may have been induced during the chloroplast to chromoplast transition. One

possibility is that the low MW hsp is induced during certain developmental stages.

Historically, the induction of low MW hsps occurs during times when rapid

restructuring of the tissue is underway (Arrigo, 1987). It is also feasible that the hsp

is induced because the tissue is enduring an oxidative stress. Hsp induction by

compounds that create oxidative damage has been described in animal tissues








41
(Drummond and Steinhardt, 1987; Cajone and Bernelli-Zazzera, 1988; Courgeon et

al., 1988). Both the induction of hsps during development and oxidative stress will

be considered.



Introduction to Heat Shock Proteins

Heat shock proteins were first identified by their massive induction upon

increases of about 100C above ambient temperature (recently reviewed for plants by

Vierling, 1991; and generally by Jaattela and Wissing, 1992). Hsps have been found

in a diverse range of organisms from bacteria to mammals. These proteins are

broadly categorized by their molecular weight in SDS-PAGE. An individual organism

may contain a number of spatially and functionally distinct proteins from each size

class. For example, a number of different hsp 70 proteins have been described, some

of which are present constitutively (hsc).

The function of these proteins has been best characterized for the constitutive

members of the hsp60 and 70 classes. The 60 kD protein plays a role in the assembly

of the multisubunit Rubisco enzyme complex (Roy, 1989). Involvement in the

assembly of multimeric proteins in the mitochondria has also been shown (Cheng et

al., 1989). The 70 kD proteins have been implicated in moving newly synthesized

proteins from ribosomes to the cellular compartment in which they function (Weber,

1992). The role of the hsps during heat shock has been inferred from the function

of their constitutive forms. It is thought that the hsps bind to proteins denatured by

superoptimal temperatures and may facilitate refolding (Weber, 1992). A role for








42
hsps in providing thermotolerance has been suggested by experiments that create

protection from severe heat shock by the induction of these proteins with a brief or

moderate increase in temperature (reviewed by Lindquist and Craig, 1988).

The induction of hsp messages is rapid and transient (reviewed by Neumann

et al., 1989). Examination of the steady-state level of RNA for a number of different

hsps in soybean revealed that levels decay more quickly at normal temperatures than

during heat stress and the absolute amount of hsps induced is lower in plants that

have been previously exposed to a small heat stress (Kimpel et al., 1990). This is

reminiscent of the thermotolerance response in that the reaction to heat shock is

reduced by heat pretreatment. The transient nature of this response is apparent in

the fact that the hsp message had already begun to decay while the temperature was

still high, and the message was undetectable within 17 hours after the peak

temperature (Kimpel et al., 1990). The induction of heat shock proteins in field

grown plants has also been demonstrated (Burke et al., 1985; Kimpel and Key, 1985).

Kimpel and Key (1985) found that a transient increase in the message for both low

and high MW hsps occurs under fairly normal Georgia summer field conditions with

soybean. This induction is dramatically enhanced in non-irrigated plants. Burke et

al. (1985) also showed similar responses in material from irrigated versus non-

irrigated fields. However, they compared the canopy temperatures and found that the

non-irrigated field was 100C above the temperature in the irrigated field. This is an

important point since the quantity of hsp message produced increases with increasing

temperature (Chen et al., 1990; Kimpel et al., 1990).










Low MW Heat Shock Proteins

In plants the low MW hsps are generally not present at detectable levels in

leaves under nonstress conditions (Vierling, 1991). The low MW hsps represent a

small multigene family that has been subdivided on the basis of amino acid sequence

similarity (Vierling, 1991). Classes of this family have been found in the cytosol,

plastid, and endoplasmic reticulum. In fact, one class of low MW hsp is induced

during meiosis (Bouchard, 1990). Upon induction, the low MW hsps can accumulate

to massive amounts and form large crystalline deposits within the cytoplasm.



Low MW Heat Shock Proteins and Development

The low MW hsps have been found to increase transiently at different times

during development. The best characterized developmental induction of these

proteins is found during Drosophila embryonic development. Arrigo (1987) suggested

that the period of development in which these proteins are most highly induced

represents a time of massive developmental change when the cell may need carefully

controlled mechanisms for overall transformation. Four low MW hsps (ranging in

size from 22 to 27 kD) follow a complex pattern of expression that appears to be

mediated by the molting hormone ecdysterone. Addition of this hormone to

embryonic cell lines induces these proteins (reviewed in Bond and Schlesinger, 1987).

Deletion analysis of their promoters indicated that regions of the DNA responsive

to hormone and heat induction reside in separate portions of the gene. The same hsp

is, therefore, induced developmentally and by heat stress. Since heat causes








44
destabilization and unfolding of proteins and embryo development suggests rapid

protein biogenesis, the induction of the same group of proteins during both events

implies that they are involved in either stabilizing or degrading incorrectly folded

proteins.

Evidence for a developmental change in low MW hsps has begun to

accumulate in higher plants. The 14 and 40 kD hsps are present in dry embryos of

wheat and their mRNA has also been isolated from quiescent wheat embryos not

subjected to heat stress (Helm and Abernethy, 1990). These authors propose that

these hsps may act to protect the seed early in development from the effects of

excess heat. Since the germinating wheat embryo has fewer mechanisms to control

ambient temperature in comparison to an older seedling, maybe the production of

hsps allows the organism to tolerate this transiently harsh environment (Helms and

Abernethy, 1990).

The wheat embryo hsps also demonstrate how the genes for hsps may respond

differently to heat stress at different stages of development. These proteins are heat

inducible at early times during imbibition. However, they are not induced after as

little as 12 hours of imbibition (Helm et al., 1989). The wheat seed is initially quite

tolerant to heat stress, such that pretreatment with a low but hsp inducing

temperature does not improve this thermotolerance (Abernethy et al., 1989). By 9

hours of imbibition, however, a pretreatment can improve the survival of the seed

to heat stress (Abernethy et al., 1989). Another interpretation of these data from

wheat, however, could be that rather than protecting the young embryo from heat









45
stress perhaps the hsps are present in preparation for development and consequently,

additional induction by heat may be unnecessary.

Messages for low MW hsps have been found in dry embryos in other plant

species. The mRNA to a 17.6 kD hsp is present in dry seed and accumulates during

embryo development of sunflower (Almoguera and Jordano, 1992). This cDNA also

hybridizes to mRNA from 3-day-old seedlings subjected to ABA, mannitol or heat

stress. The mRNA for an alfalfa hsp 18.1 has been found to be present in

microcallus suspension and increases transiently during embryo formation at normal

temperatures (Gyorgyey et al., 1991). This cDNA also hybridizes to RNA from callus

subjected to CdCI2, sucrose and heat stress. These data demonstrate that transcripts

for low MW hsps have been found in plant embryos and appear to be

developmentally produced at nonheat stress temperatures. However, it is unclear

from these data whether the transcript induced by stress is encoded by the same

developmentally induced gene or represents another member of a multigene family.



Plastid-Localized Low MW Heat Shock Proteins

A structural analysis of plastid-localized low MW heat shock proteins may

suggest a possible function. Chen and Vierling (1991) have compared the deduced

amino acid sequences of 5 of these plastid proteins, and have reported three

conserved regions. Two of these regions are also present in the low MW hsps found

in the cytoplasm. A third carboxyl terminal consensus region, which is abundant in

methionine, is unique to the plastid-localized low MW proteins. Computer analysis








46
of the tertiary structure of the protein in this methionine rich region suggested that

an alpha helix with a hydrophobic and hydrophilic face could form (Chen and

Vierling, 1991). This same type of three dimensional structure is predicted for three

such methionine rich regions of the SRP 54 (signal recognition particle), which is

involved in transporting newly synthesized proteins in the endoplasmic reticulum

(Lutke et al., 1992). Careful structure/function analysis of this region in SRP 54 and

its interaction with signal peptides using crosslinking reagents, antibodies produced

against specific fragments of the SRP 54 and deletion analysis of this protein

revealed that binding of signal sequences of nascent proteins occurs here (Lutcke et

al., 1992). Binding experiments with the 7S RNA showed that this same region is

involved in interaction with the RNA. High and Dobberstein (1991) suggested that

the SRP 54 interacts with signal peptide on the methionine rich hydrophobic face

and with RNA on the hydrophilic face. It is tempting to speculate that the low MW

plastid-localized hsp is involved in a similar protein-protein interaction. Perhaps the

need for these hsps is increased during times when excessive incorrectly folded

proteins are present.

The sublocalization of the plastid-localized low MW hsp has been

controversial. Work by Kloppstech and colleagues suggested that this hsp becomes

associated with thylakoid membranes upon heat stress (Kloppstech et al., 1985).

However, this occurs only with plants grown at low light intensities (Glaczinski and

Kloppstech, 1988). Binding of hsp to the membrane occurs most abundantly at a light

intensity below the level at which net carbon is fixed. Considering the transient








47
nature of these proteins, and that their transcription usually requires heat stress, this

combination of circumstances could occur at dusk in summer or on the floor of a

tropical rain forest. Chen et al. (1990) have shown that under heat stress and higher

light levels this hsp remains predominantly in the stroma. They reported that the only

plastid-localized low MW hsp from pea associates into 200 kD stromal complexes.

Clarke and Critchley (1992) showed that one of the two low MW plastid-localized

hsps, the 32 kD form, from heat stressed barley leaves associates into 250 to 265 kD

complexes within the stroma and contains no RNA, DNA or the a-subunit of the

Rubisco binding protein. This protein is reminiscent of an hsp 28 found in soybean

plastids, which also contains two low MW hsps of 22 and 28 kD (Clark and Critchley,

1992).

The idea that the methionine rich region could interact with denatured

proteins during heat stress suggests that these complexes could sequester unfolded

proteins. The hsp 60 also associates into an 800-900 kD oligomer of 14 subunits

(Roy, 1989). Perhaps the role of the plastid-localized low MW hsp will be easier to

resolve if, like the hsp 60 and 70s, a constitutive or developmentally associated form

can be identified. Maybe the chromoplast-associated low MW hsp described within

this work is induced by the degradation of proteins for the photosynthetic apparatus

that occurs between mature green and intermediate stages of fruit ripening.

Induction of Heat Shock Proteins By Other Stresses

Hsps can also be induced by heavy metals, ethanol, amino acid analogues and

glucose starvation (Vierling, 1991). Arsenite and cadmium produced the greatest








48
induction of hsps (Czarnecka et al., 1984; Edelman et al., 1988). At lower

concentrations of these compounds, the response, like the heat stress response, was

also transient. By 12 hours of exposure, the messages had begun to diminish

(Edelman et al., 1988).

Oxidative stress and the induction of hsps

The initial correlation between heat and oxidative stress was made in an

examination of Drosophila salivary glands. Puffs, representing high levels of

transcription, may occur at the same loci along the chromosome when either a heat

or oxidative stress is applied (reviewed by Loven, 1988). A combination of heat

treatment and application of an oxidizing agent can act synergistically to reduce the

deleterious effect of a subsequent heat stress (Issels et al., 1987). This

thermotolerance developed from oxidative stress inducers can be blocked by the

addition of catalase during the induction period (Issels et al., 1987).

Studies in Drosophila cells (Drummond and Steinhardt, 1987; Courgeon et al.,

1988) and rat hepatocytes (Cajone and Bernelli-Zazzera, 1988) show a mild induction

of some hsps by oxidative stress. In addition, different hsps were induced by different

chemicals (Cajone and Bernelli-Zazzera, 1988). Hsps are also induced by oxidative

stress in Drosophila cells (Courgeon et al., 1988) where hsp 70 and hsp 23 were

induced by hydrogen peroxide. These experiments point to the conclusion that

oxidative stress and heat shock, which induce many of the same proteins, do not

provoke an identical response.










Heat stress and the induction of free radical scavenging enzymes

It still is not entirely clear how heat and oxidative stress are related. Heat

shock uncouples oxidative phosphorylation and this creates an increased level of

reactive oxygen species (Loven, 1988). Additionally, a link has been made between

the application of a heat stress and an induction of free radical scavenging enzymes.

A hyperthermia induced increase in SOD, CAT and glutathione levels occurs with

exercise training of skeletal muscle (reviewed in Barja de Quiroga, 1992). The

implication is that these antioxidants are induced by mild heat stress produced during

exercise. These additional antioxidants reduce the long term deleterious effects of

free radicals produced in this tissue from the uncoupling of oxidative

phosphorylation.

The heat induced induction of plant SOD was also noted by Tsang et al.

(1991) in tobacco. The cytosolic form of SOD was induced most dramatically

compared with the mitochondrial or plastid form in tobacco. This infers that plants

also may respond to heat stress by inducing enzymes involved in oxidative stress.

Conclusions about the relationship of heat and oxidative stress

Since both heat and oxidative stresses produce a similar response, a number

of hypotheses have been developed to explain how they are related. Some authors

have suggested that the deleterious effects of heat stress are due solely to oxidative

damage (Loven, 1988). This idea may be a bit extreme in view of the fact that hsps

can be induced under anoxia in Drosophila cells (Drummond and Steinhardt, 1987).

Rather than the induction of antioxidants, therefore, this type of assertion requires








50

that direct oxidative damage be measured, which can be done by examining the

amount of lipid peroxidation. However, few studies have been preformed in which

hyperthermia is directly correlated with oxidative stress (Barja de Quiroga, 1992). A

corollary to this idea was developed in Ame's lab (Lee et al., 1983), in which the

synthesis of bisnucleoside polyphosphates, also termed alarmones, acts as the signal

for oxidative stress induction of hsps. Apparently an increase in these compounds is

observed during both of these stresses. However, it was soon demonstrated that the

synthesis of alarmones is inhibited by heat stress rather than induced. A buildup in

these compounds occurs because their degradation is actually inhibited by heat.

Addition of alarmones to cells was also shown to have no effect on the induction of

hsps and hsps could actually be induced without an increase in the amount of these

compounds (Guedon et al., 1986).

The hypothesis that is currently favored for the induction of hsps by oxidative

stress is that both heat and free radicals create aberrant proteins that lead to the

production of hsps (Neumann et al., 1989). This probably explains why the two stress

responses do not completely overlap. Since hyperthermia creates unstable proteins

and uncouples oxidative phosphorylation, the increase in free radicals and the

resulting response may occur secondarily. Oxidative stress may mainly induce free

radical scavengers, which can forestall the production of large numbers of aberrant

proteins.










Conclusions

The molecular characterization of fruit ripening has shown that the events that

characterize the maturation of tomato fruit involve the de novo synthesis of a subset

of ripening associated transcripts. At this point, however, only a few genes involved

in this process have been identified and their mode of regulation assessed.

Even though the conversion of chloroplasts into chromoplasts involves the

degradation of chlorophyll and the breakdown of thylakoid membranes along with

a rapid synthesis of carotenoids, only a small number of genes have been identified

that encode proteins that may be involved in this transformation. To date, two genes

in tomato fruit and one in pepper that code for proteins involved in carotenoid

biosynthesis have been isolated. In addition, only a single gene for synthesis of

cysteine synthase has been identified in pepper chromoplasts. Therefore, it is unclear

how many proteins may be involved in this process and whether their synthesis

increases during development.

Historically the characterization of carotenoid biosynthesis in higher plants

involved following the incorportaion of radiolabeled precursors into crude enzyme

preparations or the identification of the compliment of carotenoids produced by

mutants in the biosynthetic pathway. This type of examination was complicated by

the presence of multiple pathways and by the complexity inherent in assays of

disrupted tissue. The analysis of carotenoid biosynthesis, as demonstrated in bacteria,

in which individual genes can be cloned and the activity can be assessed by

complementation in E. coli may now be possible in higher plants. In this way, an








52
unambiguous assessment of the role an individual enzyme plays on the synthesis of

carotenoids can finally be evaluated. The determination of how many enzymes are

involved in the biosynthesis of fruit carotenoids can be determined. In addition, the

cloning and characterization of the genes involved in this pathway will allow an

understanding of how the synthesis of carotenoids is controlled during chromoplast

formation.

The senescence of chloroplasts in leaves involves the breakdown of

photosynthetic structures, in a gradual process within the plastid. It is clear from

evidence accumulated from the analysis of stay-green mutants that the degradation

of thylakoid membranes involves at least two different systems of protein

degradation, portions of which are encoded in both the nucleus and the cytoplasm.

However, it is uncertain whether de novo synthesis of new proteins occurs during

chloroplast senescence in the leaves.

During the transition of chloroplast to chromoplast in pepper chromoplasts,

an increase of compounds that scavenge free radicals occurs. Since the induction of

hsps has been observed during oxidative stress, it is possible that the induction of an

hsp during fruit ripening is caused by such an increasingly harsh environment.

Clearly, the ripening-associated hormone ethylene can induce SOD in tomato and

tobacco leaves. However, the evidence for an increase in enzymes involved in

oxidative stress in tomatoes remains contradictory. More information is needed

before conclusions can be drawn about what role oxidative stress plays during tomato

fruit ripening.








53
Clearly the transition within the developing chromoplast involves a rapid

degradation of proteins. The period between mature green and yellow fruit appears

to be one in which a particularly rapid degradation of plastid proteins occurs. Since

an increase in hsps has been associated with developmental stages where a great deal

of structural change occurs, the chloroplast to chromoplast transition may be an ideal

environment for the induction of these proteins.














CHAPTER 3
CHROMOPAST-TARGETED PROTEINS IN TOMATO FRUIT



Introduction

The transformation of chloroplasts into chromoplasts results in a dramatic

alteration of organellar structure. The thylakoid membranes are dismantled in a

ordered process while carotenoids build up within the plastid (Thelander et al.,

1986). The structural changes that occur during this transition have been documented

by electron microscopy (Harris and Spurr, 1969). However, it is unclear how this

event is regulated.

One of the objectives of this project was to determine whether the

development of chromoplasts during tomato fruit ripening is mediated by an increase

in nuclear-encoded transcripts of chromoplast-associated proteins. Since plastid

transcription and translation is greatly reduced during chromoplast development

(Kobayashi, 1991) we have focused on proteins that are nuclear-encoded, translated

in the cytoplasm and imported into the plastid. The import of proteins into plastids

is highly specific and requires an amino-terminal transit peptide, which is necessary

and sufficient for targeting into the organelle (Keegstra, 1989). We have monitored

chloroplast import of in vitro translation products from RNA of tomato fruit isolated

at different ripening stages. We have also examined translation products from








55
transcripts encoded from cDNAs (slater et al, 1985) whose steady-state RNA level

increases during ripening.



Materials and Methods



Plant Material

Tomato plants (Lycopersicon esculentum Mill. cv. Rutgers) were grown in a

greenhouse in Gainesville, Florida. Fruit were harvested at four ripening stages.

MG1 was characterized by full-size green fruit with firm locular tissue; MG3 fruit

had completely developed locular gel; the 20-50% ripe fruit were red over less than

half of the outer pericarp; and >80% ripe fruit were red over 80% of the outer

pericarp. The pericarp was frozen in liquid nitrogen immediately after harvesting.



Preparation and Translation of RNA

Total RNA was extracted by combining the protocols of McCarty (1986) and

Grierson et al.(1985). Briefly, this involved grinding the frozen tissue with a coffee

grinder and homogenizing in extraction buffer with a polytron. The extraction buffer

consisted of 100 mM Tris-HCl pH 9.0, 200 mM NaCI, 5 mM DTT, 1% SDS and 20

mM EDTA. The insoluble material was pelleted and reextracted with 1/2 volume of

extraction buffer. The supernatant was extracted 2 times with phenol/chloroform

(1:1) and one time with chloroform. The final supernatant was brought to 0.1M KCI

and precipitated overnight with 2 volumes of ethanol at 40C. The precipitate was








56
washed several times as described in Grierson et al. (1985) and the soluble material

was applied to a cellulose (Sigmacell type 50) column to remove substances that

interfere with extraction of poly (A)' RNA (Grierson et al., 1985). Poly (A)* RNA

was isolated from total RNA by one passage over oligo(dT)-cellulose (BRL).

Individual pTOM clones pTOM 5, 25, 36, 41, 92, 111, and 114 (Slater et al.,

1985) were subcloned into the in vitro transcription vector pSport (BRL) at the PstI

site. Plasmid DNA was isolated by the alkaline lysis method of Lee and Rasheed

(1990). The plasmid DNA was linearized and transcribed with either SP6 polymerase

or T7 polymerase as described in Cline (1988). The poly (A)+ RNA and the in vitro

transcribed RNA were translated (see Figure legends for specific experiments) with

either a wheat germ system (Cline, 1988) or a rabbit reticulocyte lysate system from

Promega (Madison,Wi.) in the presence of [35S]-methionine.



Chloroplast Isolation and Import Assay

Chloroplasts were isolated from pea (Pisum sativum L. cv Laxton's Progress

9) shoots by a combination of differential centrifugation and Percoll gradient

centrifugation (Cline et al., 1989). Import assays were conducted as described by

Cline (1988) except that translation products were diluted 1:3 with unlabelled

methionine in import buffer; 50 Vl of the diluted translation products were added to

100 pil of chloroplasts (1 mg chlorophyll/ml). Import assays were conducted for 20

min at 250 with white light and 10mM Mg-ATP. After incubation, intact chloroplasts

were reisolated by centrifugation through 35% Percoll with or without a treatment








57

of the protease thermolysin to remove surface bound proteins (Cline, 1988).

Repurified plastids were lysed in 30 pil of 10mM Hepes/KOH pH 8.0. Experiments

testing the requirement of ATP were conducted in foil wrapped tubes to maintain

darkness.



Subfractionation and Treatment of Plastids after Import

In experiments examining import of translation products from total poly (A)+

RNA, the repurified plastids were lysed in 10mM Hepes/KOH pH 8.0 and

subsequently subfractionated into stromal (soluble) and membrane (pellet) fractions

by centrifugation for 10 min at 10,000 x g. In experiments with translation products

from individual cDNA clones, the soluble fraction was isolated from the membranes

by lysing the plastids in 10mM Hepes/KOH pH 8.0 on ice for 5 min and centrifuging

30 min at 37,500 x g. The membranes were washed one time with 1 ml of 10mM

Hepes/KOH pH 8.0 and resuspended in the same solution. Alternatively, the

membrane fraction was washed with 0.1 N NaOH (Cline, 1986). Envelopes were

separated from thylakoid membranes as described in Cline (1986), however, 1.3 ml

of plastids (1 mg chlorophyll/ml) were used for each import reaction.

Sensitivity of the imported proteins to thermolysin was tested as follows: A

standard import assay was carried out and divided into two equal fractions. These

fractions were either resuspended in import buffer or lysed with 10mM Hepes/KOH

pH 8.0. Aliquots of 25 pl (1mg chlorophyll/ml) were incubated with 0 or 20 pg of

thermolysin for 45 min at 40 C. EDTA was added to 5mM and the samples were








58
immediately frozen. An equal volume of 2X-SDS PAGE buffer (Cline, 1986) was

added to freshly thawed samples and the tubes were heated to 980 C for 3 min.



Analysis of Import Products

Import products from total poly (A)+ RNA were examined by SDS-PAGE

and fluorography on 7.5%-20% gradient gels (Cline, 1986). Gel lanes received

equivalent amounts of protein as determined by chlorophyll estimation of the

recovered plastids. Import products from in vitro transcribed RNA were examined

on 12.5% SDS PAGE gels.



Results and Discussion

Profiles of in vitro translation products of poly (A)+ RNA differed

markedly between ripe fruit and mature green tissue (Fig.3-1A). The profiles of the

two later ripening stages closely resembled one another, as did the translation

products from the two samples of mature green tissue. Speirs et al. (1984) reported

a similar result from a more detailed analysis of the polypeptide profiles of total

mRNA from ripening tomato fruit.

Pea chloroplasts were chosen to analyze import into plastids because of their

ease of isolation. The isolation of tomato chromoplasts has been reported by others

(Iwatsuki et al., 1984; Bathgate et al., 1985; Hunt et al., 1986; Wrench et al., 1987),

but we were unable to isolate pure and intact fruit chromoplasts that withstand the

handling required to demonstrate successful import. However, in vitro import of an








59
amyloplast specific protein into chloroplasts (Klosgen et al., 1989) and the in vivo

import of a chloroplast protein into non-green plastids using transgenic plants

(deBoer et al., 1988) implied that chromoplast proteins should also be imported into

pea chloroplasts.

Changes in the profile of imported proteins during chromoplast development

were detected (Fig.3-1B). A number of proteins decreased during this period (Fig.

3-1B). For example, a 30kD and a 14kD soluble fraction protein diminished as

ripening progressed. Two imported translation products dramatically increased in the

later ripening stages. A 26 kD protein fractionated with the soluble plastid proteins,

whereas a 17 kD protein was associated with the membrane fraction. These results

imply that there is synthesis and import of new proteins during the transition from

chloroplast to chromoplast and that the plastid conversion may be an active

developmental program rather than a simple decline in synthesis of the

photosynthetic apparatus.

We next asked whether an import assay could be used to identify individual

clones coding for chromoplast-targeted proteins. A specific cDNA clone, pTOM5,

was selected to evaluate this system. Slater et al. (1985) originally isolated this cDNA

because its RNA becomes more abundant as ripening proceeds. Armstrong et al.

(1990) recognized that the deduced protein sequence shares approximately 25%

identity with the predicted polypeptide of a bacterial prephytoene synthase. Bird et

al. (1991) confirmed the involvement of pTOM5 in carotenoid synthesis by creating


























Figure 3-1. Profiles of in vitro translation products and import products are altered
during tomato fruit ripening. A, In vitro translation of total poly (A)+
RNA with four different ripening stages from tomato fruit pericarp.
1 ug of total poly (A)+ RNA per 50 ul reaction was translated in vitro
in a wheat germ system in the presence of [35S]-methionine.
Translation products were examined by SDS-PAGE and fluorography
on 7.5%-20% gradient gels. (MG1) mature green 1, (MG3) mature
green 3, (20-50%) 20-50% red over the outer pericarp, (>80%)
greater than 80% red over the outer pericarp. B, Import into pea
chloroplasts with in vitro translation products of total poly (A)+ RNA
extracted from tomato fruit pericarp at four different ripening stages.
Import assays were conducted and fractionated as described in
Materials and Methods. The (soluble) fraction was isolated from the
(membranes) of the re-purified lysed plastids by centrifugation for 10
min at 10,000 x g. Equivalent amounts of plastid protein (as
determined by chlorophyll estimation) from the +/- protease treated
plastids were separated on 7.5%-20% SDS-PAGE gradient gels and
fluorographed. ["C]-labelled 10 to 70 kD molecular weight standards
(Sigma) appear as arrows on the left side of the figure. The size of the
two import products were derived from a standard curve and are
designated by arrows on the right side of the figure.




































~DG)


-protease +protease
total total


e e C


+protease
soluble






,P-

4WD


*protease
membrane


~ 5 esA








26
A 17


66
45
36 ,
29 ,


20.1 ,
14.20.


,low 4w








62
an antisense pTOM5 tomato transformant that produces yellow rather than normal

red fruit. The transgenic fruit are blocked in the synthesis of phytoene from its

immediate precursor, implying that pTOM5 encodes phytoene synthase (Bramley et

al., 1992). We selected this clone because enzymological data suggest that synthesis

of this nonpigmented carotenoid occurs in plastids (Lutke-Brinkhaus et al., 1982;

Mayfield et al., 1986; Dogbo et al., 1987;).

The major translation product of the pTOM5 transcript was 46 kD (Fig. 3-2,

lane 1); this is in agreement with the size of the hybrid-selected translation product

for pTOM5 identified by Slater et al. (1985). Minor lower molecular weight

translation products were also produced from this transcript and may represent

commencement of translation from internal methionines because these products are

not imported into plastids. Incubation with pea chloroplasts resulted in the

appearance of a 41 kD polypeptide that fractionated with intact plastids and was

resistant to protease treatment of the chloroplasts (Fig. 3-2, lane 4). Protease

resistance was not due to an inherent property of the 41 kD protein because it was

degraded by thermolysin if the plastids were lysed prior to treatment (data not

shown). This result is expected of a protein produced in the cytosol, imported into

the plastid, protected from protease by the organellar envelope, and cleaved of its

transit peptide.

Additional criteria must also be demonstrated for the confirmation of import

into plastids. Import is an energy dependent process (Keegstra, 1989); white light or

















+ Protease


- ATP


Figure 3-2.


The 41 kD form of pTOMS is protected from protease digestion by the
plastid envelope and its appearance requires the addition of ATP.
Lane 1) In vitro transcribed RNA was translated with a rabbit
reticulocyte lysate system in the presence of ["S]-methionine. Import
assays and post assay treatments were conducted as described in
Materials and Methods. Lanes 2-5) Import of pTOM5 in vitro
translation products was conducted with (lanes 2,4) or without (lanes
3,5) 10mM Mg-ATP in darkness. Intact chloroplasts were re-isolated
with (lanes 4,5) or without (lanes 2,3) protease post-treatment.
Proteins from lysed plastids were separated on 12.5% SDS-PAGE gels
and flurographed.


m .m


+


1 2


+


+


4








64

exogenous ATP must be provided for the successful import of proteins. Fig. 3-2,

lanes 2 and 3 show that processing of the 46 kD protein into the 41 kD peptide

required exogenous ATP. In the absence of ATP, the 46 kD putative precursor

bound to the chloroplasts but was destroyed by the protease (Fig. 3-2, lanes 3 and

5). The import into plastids should also be time dependent; this was found to be the

case for the production of the 41 kD protein (Fig. 3-3). Thus, the successful import

of the pTOM5 translation product verified the utility of import assays for the

identification of genes encoding chromoplast-targeted proteins.

Pea chloroplasts were fractionated into soluble and membrane fractions to

allow analysis of the sublocalization of the 41 kD protein. The protein distributed

between these two compartments (Fig 3-3). Parallel import assays with the thylakoid

localized light-harvesting chlorophyll a/b protein (LHCP) and the stromal small

subunit of Rubisco (SS) were used to assess the quality of our subfractionation.

LHCP was exclusively found in the membrane fraction whereas virtually all of the

SS was recovered in the soluble fraction (data not shown). During preparation of this

manuscript, Bartley et al. (1992) have reported the isolation of a cDNA from a

tomato fruit library by hybridization with a PCR fragment produced with

oligonucleotides derived from the sequence of pTOMS. They found that their clone

differs from pTOM5 in 19 amino acids that reside 5 amino acids away from the

deduced carboxyl terminal end. They also demonstrated that their in vitro translation

product imports via an ATP requiring process and that their import product also

appears in both stromal and membrane fractions of pea chloroplasts.






























Membrane


0 1 2 4 6 8 10 0 1 2 4 6 8 10


Min


t""

;


. ... .':


Figure 3-3. The production of the 41 kD form of pTOM5 was time dependent
This protein associated with both stromal and membrane fractions.
pTOM5 import assays were conducted as described in Materials and
Methods. One half of a standard import assay was immediately repurified
on a 35% Percoll cushion after 0, 1, 2, 4, 6, 8, or 10 minutes of
incubation. Chloroplasts were protease treated, repurified and
subfractionated as described in the Materials and Methods. Samples were
analyzed by SDS-PAGE and fluorography.


Stroma








66
The membranes of pea chloroplasts were further subfractionated into

envelopes and thylakoid membranes (Cline, 1986); upon fractionation of the

membranes after import of pTOM5, virtually all of the mature-sized protein was

found to be associated with the thylakoid fraction (data not shown). A mild NaOH

wash removed the pTOM5 protein from the membrane (data not shown). This

suggested that the protein was only peripherally associated with this fraction (Cline,

1986).

Previous attempts by others to localize the site of phytoene synthesis within

the plastid via enzyme assays have resulted in conflicting conclusions. Lutke-

Brinkhaus et al. (1982) concluded that the production of phytoene is associated with

the plastid envelope. However, Mayfield et al. (1986), and independently, Dogbo et

al. (1987) deduced that phytoene is synthesized in the stroma. The unexpected

association of the protein with thylakoids in import assays and its peripheral

association with the membranes demonstrated by the NaOH extraction may have

provided additional evidence that this protein is functionally associated with the

stroma. Alternatively, perhaps the 41 Kd protein has not folded or localized correctly

in pea chloroplasts. Bartley et al. (1991) reported the import of phytoene desaturase

from soybean leaf into pea chloroplasts. Although this protein imported effectively,

Bartley et al. found that it does not also fractionate into the plastid compartment

expected from biochemical analysis. Immunocytolocalization may clarify these

contradicting results. Therefore, it appears that import assays can be useful for the

identification of chromoplast-targeted proteins; however, it is currently unclear what








67
conclusions can be made from the in vitro organellar sublocalization when using

heterologous systems.

Six additional ripening enhanced pTOM cDNA clones (pTOM 25, 36, 41, 92,

111, 114) of unknown function (Slater et al., 1985) were tested to determine whether

they encode plastid targeted proteins. These particular clones were selected because

a comparison of the published sizes of the cDNA inserts with the size of their

respective mRNA suggested that they might be full length (Slater et al., 1985;

Maunders et al., 1987). In vitro transcription of the cDNAs was carried out in both

directions because the orientation of the clones within the vector was unknown. In

vitro translation products of these transcript pairs failed to import in four of the six

clones. Fig. 3-4, lanes 1 to 7 shows examples of the translation products and lack of

import products produced from these clones. However, since the transit peptide,

which is required for successful import of the protein, is located on the amino

terminal end, and since in vitro translation can begin from any internally situated

methionine, any cDNAs that produced an in vitro translation product but not an

imported product may simply not include the entire coding sequence. Translation

products from pTOM41 and pTOM111 were imported successfully into pea

chloroplasts (Fig. 3-4, lanes 9 and 11). The imported product from both proteins was

smaller than the translation product, which is consistent with processing of the plastid

transit peptide. These proteins were sensitive to protease treatment (see chapter 4),

but resistant after import into plastids (Fig. 3-4). As with pTOMS, import of

pTOM111 and pTOM41 translation products were ATP and time dependent (see



















1 23 4 5 6 7 8 9 1011

AMEN -

OIL..


Figure 3-4.


Translation products from transcripts of additional pTOM clones were
tested for their ability to import into isolated pea chloroplasts. In vitro
translation products from pTOM41 and pTOM111 imported into
isolated pea chloroplasts. In vitro transcribed RNA was translated with
a rabbit reticulocyte lysate system in the presence of [35S]-methionine.
Import assays were conducted as described in Materials and Methods.
Samples were analyzed by SDS-PAGE and fluorography. In vitro
translation with no added RNA (lane 1). pTOM92 transcribed in vitro
with SP6 polymerase, translated in vitro, (lane 2) and imported (lane
3). pTOM92 transcribed in vitro with T7 polymerase, translated in
vitro, (lane 4) and imported (lane 5). pTOM36 transcribed in vitro
with T7 polymerase, translated in vitro, (lane 6) and imported (lane 7).
pTOM41 transcribed in vitro with T7 polymerase, translated in vitro,
(lane 8) and imported (lane 9). pTOM111 transcribed in vitro with T7
polymerase, translated in vitro, (lane 10) and imported (lane 11).








69
chapter 4). These data support the idea that the cDNAs do indeed code for plastid-

targeted genes. We have begun sequence analysis (see chapter 4) and antisense

transformation experiments of these cDNAs (see Appendix) to investigate their role

in chromoplast function.

We wondered whether our initial examination of import from total poly (A)+

translation products (Fig. 3-1B) might underestimate the number of chromoplast-

targeted proteins. Therefore, we asked whether the pTOM import products could be

recognized among the total poly (A)' RNA import products. The pTOM5 protein

comigrated with a band shown to increase in the import products from the

membrane fraction of late stage fruit (Fig. 3-5, lanes 5 and 6). It is interesting that

the 26kD soluble import product (Fig. 3-1B) migrates similarly to the pTOM111

import product (Fig. 3-5). However, analysis of these two proteins on several gels

suggested that the pTOM111 product was slightly larger. Consequently, it is unclear

if pTOM111 represents a different isozyme or a completely dissimilar protein. Since

the import of the in vitro translation product of pTOM41 associates with the stromal

fraction, this was compared with the soluble fraction of total poly A' import

products. No protein appears to increase in the later stages of ripening fruit which

comigrates with this band (Fig. 3-5, lanes 2 and 3). We concluded, therefore, that not

all of the chromoplast-targeted proteins could be detected in our analysis of total

poly (A)+ RNA import products.



















Figure 3-5.


Import products corresponding in size to those for pTOM111 and
pTOM5 were enhanced in late stage tomato fruit. However, no
polypeptide was seen that coincided to the pTOM41 import product.
pTOM41, pTOM5 and pTOM111 were transcribed in vitro with T7
polymerase. RNA was translated with rabbit reticulocyte lysate in the
presence of [35S]-methionine. In vitro translation, import assays and
subfractionation were conducted as described for analysis of individual
translation products in Materials and Methods. Lane 1) Soluble
fraction of the pTOM111 import product. Lane 2) Soluble fraction of
the pTOM41 import product. Lane 3) Soluble fraction of imported in
vitro translation products of total poly (A)+ RNA from >80% ripe
fruit. Lane 4) Soluble fraction from imported, in vitro translation
products of immature green total poly (A)+ RNA. Lane 5) Membrane
fraction of the pTOM5 import product. Lane 6) Membrane fraction
from imported, in vitro translation products of total poly (A)' RNA
from >80% red ripe fruit. Lane 7) Membrane fraction from imported,
in vitro translation products of immature green total poly (A)+ RNA.
















1 2 3 4


5 6 7


amM


--ib
MON&

----








72
It is presently unclear how many plastid targeted proteins increase during the

chloroplast to chromoplast transition. The data presented in Fig. 3-4 and 5 clearly

demonstrate that our original examination of chromoplast targeted proteins shown

in Fig. 3-1 underrepresents the number of proteins that increase during this process.

In fact, this is not surprising when considering the limited sensitivity of import of

total poly (A+) translation products. Therefore, we believe that individual testing of

ripening enhanced cDNA clones, with the inherent increase in the quantity of the

individual protein product, is required to clearly identify all the chromoplast targeted

proteins whose RNA increases during this developmental process.

Little detailed analysis of the regulation of ripening enhanced genes has been

undertaken. Lincoln and Fisher (1988) and DellaPenna et al. (1989) concluded that

increases in transcription rate were mainly responsible for the increases in steady-

state RNA levels for the ripening enhanced genes they have analyzed. However, they

also invoked post-transcriptional mechanisms to explain differences between the rate

of transcription and accumulation. Although we cannot exclude post-transcriptional

mechanisms for the increase in steady-state levels of the RNAs we have analyzed,

the simplest interpretation for our data that is consistent with other ripening

enhanced genes is that the processes involved in the development of the chromoplast

are directed at a transcriptional level in the nucleus.

Utilizing an in vitro assay for the import of proteins into plastids we have

identified two proteins from in vitro translation products of total poly (A)+ RNA that

increase during the ripening of tomato fruit. Additionally, we have shown that the








73
in vitro translation products from three individual ripening enhanced cDNA clones

import into plastids. Therefore, the transition from chloroplast to chromoplast

coincides with an increase in steady-state levels of RNA for proteins destined to this

organelle. This suggests that this process is not a simple decline in the synthesis of

photosynthetic proteins that causes a breakdown of the thylakoid membranes and a

shunting of substrates into the carotenoid pathway, but an active developmental

program.












CHAPTER 4
CHARACTERIZATION OF TWO cDNAS FOR CHROMOPLAST-
TARGETED PROTEINS





Introduction

As tomato fruit ripens, cell walls soften, hexoses are deposited into vacuoles,

and carotenoids accumulate in developing chromoplasts. The transformation of

chloroplasts into chromoplasts is distinguished by the breakdown of the

photosynthetic apparatus and a massive synthesis and deposition of carotenoids.

Little is known about how the catabolism of thylakoid membranes or the synthesis

of carotenoids is regulated. Only two tomato genes for early steps in the carotenoid

biosynthetic pathway have been cloned (Bird et al., 1991; Bartley et al., 1992; Pecker

et al., 1992). Besides proteins involved in the synthesis of carotenoids, only the

plastidial superoxide dismutase, characterized by Livine and Gepstein (1988), has

been shown to increase during tomato fruit ripening. However, Romer et al. (1992)

have also isolated and cloned a cysteine synthase from pepper chromoplasts. These

latter findings suggest, therefore, that the chromoplast may be responding to an

increase in oxidative stress during development.

In order to understand how the transformation from chloroplast to

chromoplast is mediated one objective of the present study was to identify and clone








75
genes for proteins involved in chromoplast development. We have identified plastid

proteins that may be increasingly synthesized during chromoplast development by

examining cDNAs isolated from a ripening enhanced tomato fruit library, translating

their transcripts in vitro and testing whether the resulting proteins can be imported

into isolated pea chloroplasts. This chapter describes the characterization of two

cDNAs that code for transcripts whose steady-state level increases during

chromoplast development and whose proteins can be imported into plastids. The

characterization of these two cDNAs represents a novel use of import assays to

examine chromoplast development. Since this type of analysis is free of functional

bias, the identification of unexpected components of chromoplast development is

possible.



Materials and Methods



Plant Material

Tomato plants (Lycopersicon esculentum Mill cv. Sunbeam) were grown in the

field at the Horticultural Unit of the University of Florida in Gainesville, Florida.

Fruit were harvested at 9:00 am on June 19, 1992 from five different ripening stages.

Mature green 2 (MG2) was characterized by full size green fruit with fully developed

gel in at least one but not all of the locules; mature green 3 (MG3) fruit had

completely developed locular gel; breaker stage fruit were characterized by the

appearance of carotenoids at the blossom end; 20-50% ripe fruit were red over less








76
than half but more than 20% of the outer pericarp; and >80% ripe fruit were red

over 80% of the outer pericarp. Pericarp from fruit of each stage was frozen in liquid

nitrogen immediately after harvesting at -700C for analysis at a later date.

For the examination of ripening under controlled temperature, MG fruit were

placed in jars with a flow through system of humidified air and allowed to ripen at

220C in the dark. This prevented water stress or a buildup of respiratory CO2. Fruit

from three different ripening stages (MG3, breaker, and 20-50% ripe) were selected

and exposed for 6 hours to 360C in this humidified environment. Following the

incubation period, pericarp was frozen in liquid nitrogen.



Preparation of RNA

Total RNA was extracted by combining the methods of Chomczyinski and

Sacchi (1987) and Cathala et al. (1983). Briefly, this involved grinding 30 g of frozen

tissue in a coffee grinder and homogenizing in 60 ml of extraction buffer with three

30 sec bursts of a Brinckman polytron. The extraction buffer contained 4M guanidine

isothiocyanate (Bethesda Research Laboratories), 0.5% sarkosyl, 25 mM sodium

citrate pH 7.0, and 0.1M 2-mercaptoethanol. Sodium acetate pH 4.0 was added to

0.18M, followed by one volume of phenol and 1/10 volume chloroform. The

homogenate was shaken for 10 sec after each addition and then cooled on ice for 15

min. The phases were separated by centrifugation at 10,000 x g for 20 min, the

aqueous phase filtered through 2 layers of Miracloth (Calbiochem), and nucleic acids

precipitated with an equal volume of isopropanol for one hour at -200C. The








77
precipitate was collected by centrifugation for 45 min at 10,000 x g. The pellet was

dissolved in extraction buffer and RNA was precipitated with 5 volumes of 4M LiCI

for 15 hours at 40C. Following centrifugation for 90 min at 10,000 x g, the pellet was

washed with 3M LiCI and recovered by centrifugation for 1 hour. The RNA was

dissolved in 0.1% SDS, extracted with 1 volume of phenol/ chloroform (1:1), then

reextracted with 1 volume chloroform, and precipitated with 0.3M sodium acetate

and 2.5 volumes of ethanol. Precipitated RNA was dissolved in sterile water and

stored at -700C.



Template Preparation, In Vitro Transcription and In Vitro Translation

A cDNA for the hsp 21 from heat stressed pea leaves, pHSP 21, was provided

by E. Vierling (Vierling et al., 1988). The pTOM 111 and pTOM 41 cDNA were

provided by D. Grierson (Slater et al., 1985). The pTOM cDNAs were digested with

Pstl and ligated into pSport 1 (Bethesda Research Laboratories) at the PstI site, and

transformed into E. coli strain TB1. Plasmid DNA was isolated by the alkaline lysis

method of Lee and Rasheed (1990). The pHSP 21 plasmid was linearized with Barn

HI and in vitro transcribed with SP6 polymerase as described in Cline (1988). The

pTOM 41 and pTOM 111 plasmid DNAs were linearized with Eco RI and in vitro

transcribed with T7 polymerase (Bethesda Research Laboratories). The in vitro

transcribed RNA transcripts were translated with a rabbit reticulocyte lysate system

from Promega (Madison, Wi.) in the presence of either [3S]-Met or [3H]-Leu

according to procedures described in the Promega manual.










Northern Hybridization

Total RNA, quantified by spectrophotometric absorbance at A2, was loaded

(15 Ig/lane) onto a formaldehyde denaturing gel (Sambrook et al., 1989). After

electrophoresis the gel was washed in sterile water and stained in ethidium bromide

(l1g/ml) for 30 min and destined in 20X SSC, which contained 0.3 M sodiun citrate

and 3 M sodium chloride, for 45 min. The amount of ribosomal RNA was visually

assessed to ensure that approximately equivalent amounts of RNA were loaded. The

RNA was capillary blotted onto nylon membrane (Amersham Corp.) in 20X SSC

overnight. The blot was washed with 10X SSC and exposed to 1.5 J/cm2 UV light

with a transilluminator (Bios).

For hybridization probes, the entire cDNA insert was excised with PstI,

isolated by gel electrophoresis, and electro-eluted. 100 ng of DNA was radiolabeled

with 75 pCi of a32P-dCTP by random primer labelling with a kit (Boehringer

Mannheim).

Prehybridization and hybridization conditions were as described in Church and

Gilbert (1984). The prehybridization buffer contained 0.5M sodium phosphate pH

7.2, 7% SDS and 1% bovine serum albumin (Sigma, fraction V) at 650C. Blots were

prehybridized in 40 ml of buffer for at least 1 hour at 650C. The labeled probe was

denatured at 1000C for 5 min and added to the blot with 5 ml of prehybridization

solution. This was incubated overnight at 65*C. The blot was washed one time in 1X

SSC and 0.1% SDS at room temperature and then 3 times in 0.2X SSC and 0.1%

SDS for 30 min. X-ray film (Kodak, X-OMAT) was exposed to the blot overnight








79
with two intensifying screens (DuPont) to locate bands. Bands were excised from the

membrane and quantified by liquid scintillation counting.



DNA Sequencing

The PstI excised pTOM 111 cDNA insert was subcloned into pBluescript (SK)

plasmid (Stratagene) at the PstI site. This was restricted with either XbaI and SstI or

KpnI and Eco RV for production of ExoIII/Mungbean nested deletion plasmids

following the protocol described in the manual (Stratagene). The resulting plasmids

were precipitated, resuspended in TE, ligated directly, and transformed into E. coli

strain TB1. Plasmids containing nested deletions from either direction were selected

and sequenced using the T3 or M13-40 primer of the pBluescript vector. Double

stranded plasmid DNA was used as a template and prepared as described by Lee

and Rasheed (1990). DNA sequencing procedures were as described in the

Sequenase sequencing kit manual (US Biochemical).

The pTOM 41 cDNA was blunt end ligated (Sambrook et al., 1989) into

pGEM-4Z (Promega) at the Smal site. Both the pGem constructs described above

and the pSport constructs described in the section on in vitro transcription were used

as template for double stranded DNA sequencing as described above. Initially the

T7 or M13-40 sites of the pSport or pGem vectors were used as primer sites.

Oligomers (15mers) specific to pTOM 41 were synthesized by the UF-ICBR DNA

Synthesis Core and used in subsequent sequencing reactions. Some portions of the

sequence were generated by the ICBR DNA Sequencing Core. Sequences were








80
analyzed with the University of Wisconsin Genetics Computer Group computer

programs (Devereux et al., 1984). Protein sequence comparisons were performed at

the National Center for Biotechnology Information using the GENINFO(R) program

of the Experimental Blast Network Service (Altschul et al., 1990) made available by

the ICBR Biological Computing Facility. The petunia hsp 21 sequence (Chen and

Vierling, 1991) is available as EMBL accession #X54103. The pTOM66 sequence

(Fray et al.,1990) is available as EMBL accession #X56138. The sequence for the

hypothetical 30.9 Kd protein from E. coli (Post et al., 1992) is available in GenBank

accession #M77236.



Chloroplast Isolation and Import Assays

Chloroplasts were isolated from pea (Pisum sativum L. cv Laxton's Progress

9) shoots by a combination of differential centrifugation and Percoll gradient

centrifugation (Cline et al., 1989). Import assays were conducted as described by

Cline (1988) except that translation products were diluted 1:3 with unlabelled

methionine or leucine in import buffer; and that 50 l of diluted translation products

were added to 100 pl of chloroplasts (1 mg chlorophyll/ml) for a 300 pl total assay

volume. Import assays were conducted for 15 minutes at 250C with white light and

10mM Mg-ATP unless indicated otherwise. Experiments testing the requirement of

ATP for import of pTOM 111 protein involved incubation of 200 pl of the

translation mixture with or without 4 units of apyrase (Sigma) for 5 min at 25C. The

import assays were conducted in foil wrapped tubes to maintain darkness at 250C.








81
After incubation, intact chloroplasts were reisolated by centrifugation through 35%

Percoll with or without a treatment of the protease thermolysin (Sigma) to remove

surface bound proteins (Cline, 1988). Plastids were treated with 50 tig thermolysin

for 40 min at 4C unless indicated otherwise. Import products were diluted 1:1 with

2X-SDS PAGE buffer, incubated 8 min at 600C and analyzed by SDS-PAGE and

fluorography (Cline, 1986) on 12.5% gels.

In order to demonstrate that the imported protein was sensitive to

thermolysin, an import assay was performed and the chloroplasts were lysed before

the addition of the protease. One fraction of a standard assay was resuspended in

100 jIl import buffer, the other fraction was lysed with the same amount of 10mM

Hepes/KOH pH 8.0. Thirty pl aliquots (0.5mg chlorophyll/ml) were incubated with

0, 12, and 24 pg of thermolysin for 45 min at 40C. For the pTOM 41 protein, [3H]-

leucine was used in the in vitro translation and 1/2 of a standard import reaction (50

pl of plastids at 1mg chlorophyll/ml) was resuspended in 25 pl 10mM Hepes/KOH

pH 8.0. This sample was divided in half and 5 ig of thermolysin was added to an

aliquot. After 40 min incubation at 40C, EDTA was added to a final concentration

of 5mM and the samples were immediately frozen. An equal volume of 2X-SDS

PAGE buffer (Cline, 1986) was added to freshly thawed samples, the tubes were

heated at 980C for 3 min and 10 pc was loaded onto 12.5% SDS-PAGE gels.

For analysis of the location of imported proteins, chloroplasts recovered from

assays were lysed in 50 p1 10 mM Hepes/KOH pH 8.0, and incubated for 5 min.

Stroma was separated from membranes by centrifugation for 30 min at 37,500 x g.








82
The membranes were washed with 1 ml of import buffer, centrifuged for 30 min at

37,500 x g. and finally resuspended in 40 tl of 10mM Hepes/KOH pH 8.0.



Results

The tomato fruit cDNAs pTOM 111 and 41 were selected by Slater et al.

(1985) because transcripts homologous to these clones increased during ripening.

Data presented in the previous chapter have shown that in vitro transcripts from

these clones can be translated in vitro and the translation products can be imported

by pea chloroplasts. Further studies were performed in order to ensure that all the

criteria for successful import were met, such as the energy and time dependence of

the reaction along with sensitivity of the mature form of the protein to protease.



Import Studies of pTOM 111 Protein

The pTOM 111 in vitro transcript was translated into a 30 kD protein and

processed by the isolated plastids into a 24 kD form in an energy (Fig.4-1A) and

time (Fig.4-1C) dependent reaction. The production of this processed form was

virtually prevented by the addition of apyrase, an ATPase, to the translation mix in

the no ATP assay (Fig. 4-1A lanes 1 and 2 versus lanes 3 and 4). Only the 30 kD

precursor, which remains outside of the plastid, was removed by the protease

treatment (Fig. 4-1A lanes 1 and 4). The mature protein was sensitive to the protease

only after the plastids had been lysed prior to addition of this enzyme (Fig. 4-1B).





















+ +
- +
3 4


24 N in


Protease pg
Lysis
Lane #


jw 4


Min 0 1.5 2 4 6 8 10
Lane # 1 2 3 4 5 6 7

ii*."


The 30 kD pTOM 111 translation product can be imported into pea
chloroplasts and processed into a 24kD form in an energy and time
dependent process. In vitro transcribed RNA was translated with a
rabbit reticulocyte lysate system in the presence of [3S]-Met. Import
assays were conducted as described in the Materials and Methods. A)
Production of the mature form of the protein requires ATP and is
protected from protease digestion. A standard import assay was
conducted with (lanes 3 and 4) or without (lanes 1 and 2) 10mM Mg-
ATP. Plastids were pelleted and resuspended with (lanes 2 and 4) or
without (lanes 1 and 3) protease. B) The plastid membrane protects
the mature form of pTOM 111 from the added protease. Plastids were
(lanes 4, 5 and 6) and were not lysed (lanes 1, 2, and 3) after import
with 0 (lanes 1 and 4) 12 pg (lanes 2 and 5) or 24 pg (lanes 3 and 6)
of protease. C) The production of the mature form of pTOM 111 is
time dependent. Assays were of 100 pl of plastids (1mg/ml chlorophyll)
for each time point. The reactions were terminated with 3.3 mM HgCI2
to quickly stop the reaction.


ATP
Protease
Lane#


12 24
+ +
5 6


Figure 4-1








84
When HgClz was used to terminate the assays, a small amount of protease-resistant

precursor was observed in the early time points (Fig. 4-1B). This may reflect a stage

in the reaction prior to cleavage of the transit peptide but after import into the

organelle.

As will be discussed in the following section, sequence analysis identified

pTOM 111 as encoding a plastid-localized low MW heat shock protein (hsp).

Consequently, we asked whether our hsp would localize in vitro in the same manner

as a plastid localized low MW hsp that was isolated from heat stressed pea leaves.

Chloroplasts recovered from import assays were separated into membrane and

soluble fractions in Fig. 4-2. The proteins from both pTOM 111 and the pea cDNA

were recovered in the soluble fraction. Even though the tomato cDNA was isolated

from ripening fruit, the protein behaves in a manner similar to one isolated from

heat stressed leaves.



Import Studies of pTOM 41 Protein

A similar analysis of the import of an in vitro translation product from pTOM

41 was performed (Fig 4-3). In this case, a 47 kD protein was produced upon in vitro

translation of the pTOM 41 transcript (Fig. 4-3B). When the translation product was

incubated with isolated pea chloroplasts, a 41 kD protein was generated (Fig. 3B).

This predicts that a 6 kD transit peptide is cleaved upon import into the plastid.

Little of the 47 kD precursor was associated with chloroplasts recovered from assays

without added ATP, even without protease post-treatment (Fig. 4-3A, lane 1). Since

















pTOM 111
Tr St Mem
1 2 3


Figure 4-2.


pHSP 21
Tr St Mem
4 5 6


The pTOM 111 and an hsp 21 from heat stressed peas localize
predominantly to the stroma. In vitro transcript was translated with a
rabbit reticulocyte lysate system in the presence of [5S]-Met and
import assays were conducted as described in the Materials and
Methods. Translation products (Tr), stroma (St) and membrane
(Mem) fractions were analyzed by SDS-PAGE gels and fluorography.














Lysis
ATP
Protease
Lane #


- + -
- +
1 2 3


T St Mem

+ + + +
+ + + +
4 5 6 7


- ~ ~


Min
Lane #


01 2
1 23 4


8 10
7 8


47
41 .m.




Figure 4-3. The 47 kD pTOM 41 translation product can be imported into pea
chloroplasts and processed into a 41 kD form in an energy and time
dependent process. A) Production of the mature form of the protein
requires ATP and is protected from protease digestion. The mature
form of PTOM 41 can be digested by the protease if the plastids are
lysed. Import assays contained 10mM Mg-ATP (lanes 2, 4, 5, 6, 7, 8,
and 9). Thermolysin was added after import (lanes 3, 4, 5, 6, 7, and 9).
Plastids were lysed after import in 10mM Hepes/ KOH pH 8.0 and
treated with thermolysin (lane 9). Stromal (St) and membrane (mem)
fractions were separated from total (T) plastids following an import
reaction as described in the Materials and Methods. B) The
production of the mature form of pTOM 41 is time dependent. Assays
contained 50 gl of plastids (1mg/ml chlorophyll) for each time point.
[H]-leucine replaced [35]-methionine in the in vitro translation
reactions.









87
the plastids were repurified before the assays were analyzed, this suggests that little

of the pTOM 41 translation product attaches to the outside of the plastid.

Subfractionation of recovered chloroplasts showed the pTOM 41 imported protein

to be in the soluble fraction (Fig. 4-3A, lane 7). If plastids were lysed after import

and treated with protease, the pTOM 41 mature protein was digested (Fig.4-3A, lane

9 versus lane 8), which demonstrates that it is not inherently resistant to this

treatment A small amount of protease-resistant precursor was also found in the

early time points after import of the pTOM 41 protein (Fig. 4-3B).

These data demonstrate that the in vitro translation products of both pTOM

41 and 111 are imported into the plastid, are protected from protease by the

organellar envelope and are cleaved of their transit peptides. In order to further

characterize these chromoplast-associated proteins, the cDNAs were sequenced and

the corresponding amino acid sequences deduced (Materials and Methods).



The pTOM 111 cDNA Codes for a Low MW HSP

The pTOM 111 sequence (Fig. 4-4) shows significant homology to those of

low MW plastid-localized heat shock proteins isolated from heat stressed leaves.

Proteins from soybean, pea (Vierling et al., 1988) Arabidopsis, petunia (Chen and

Vierling, 1991) and maize (Mieto-Sotelo et al., 1990) have been cloned and

sequenced. The pTOM 111 sequence is 81% homologous to a cDNA isolated from

heat stressed petunia leaves. Low MW hsps from plants have been categorized on












88



-30 -10 10 30
GGGGCTATTTCTGTGATTAAAAATCTAAATAACTATAATGGCTTACACAAGTCTTACATCTTCTCCATTAGTGTCAAATG
----------........--------......-.......---------..-------------------.....................................
N A Y T S L T S S P L V S N V 15

50 70 90 110
TTAGCGTTGGTGGAACCTCTAAGATTAATAACAACAAGGTATCTGCACCTTGCTCTGTTTTCGTTCCGTCGATGAGAAGG
----------- ----------------......... --------------------------....... ................ .... ---------
15 S V G G T S K I N N N K V S A P C S V F V P S N R R 41

130 150 170 190
CCGACGACTAGCTGGTAGCTGCTGACcGGCGATAACAAAGATACGTCAGTCGACGTACACCACAGCAGTGCTCAAGG
---------..........--.-------4-----------------..-----------------------------------------
42 P T T R L V A R A T 6 D N K 0 T S V D V H H S S A 0 G 68

210 230 250 270
AGGAAACAACCAAGGCACTGCGTCGAACCGTTAAGATCGCTTGATGTTTCCCCTTTTGGAGTGTTAGATC
---------- ------.....................................---.......-------.........---------
69 G N N Q G T A V E R R P T R N A L 0 V S P F G V L o P 95

290 310 330 350
CAATGTCACCAATGAGAACAATGCGGCAGATGATAGACACTATGGACAGATTATTCGAAGATACAATGATTCCAGGAAGA
........ -----------..------------------------+.........-----------.......... -----------......... ........---------
95 S P M R T M R Q M I D T M D R L F E D T M I P G R 121

370 390 410 430
AACAGAGCATCAGGAACAGGGGAAATACGCACTCCATGGGACATTCATGATGATGAAAACGAAATCAAGATGCGTTTCGA
+----------.... --------... -------.. ------... ---------.. ................--........
122 N R A S G T G E I R T P U D I H D D E N E I K N R F D 148

450 470 490 510
CATGCCGGGACTGTCCAAGGAAGATGTAAAAGTATCAGTAGAAAATGACATGCTTGTCATTAAAGGGGAACACAAAAAGG
4.---------...-... ........ 4 .-- ..................-----------...---- ......------------------
149 N P G L S K E D V K V S V E N D N L V I K G E H K K E 175

530 550 570 590
AAGAAGACGGAAGAGATAAACACTCATGGGGTAGGAATTATAGCTCTTACGACACTCGTTTAGTCTCCAGATAATGTT
.-------- .-------.-----------.-----------4.-------.----------------------.-----------
175 E D G R D K H S W G R N Y S S Y D T R L S L P D N V 201

610 630 650 670
GTGAAGGATAAAATCAAAGCGGAACTGAAGAATGGAGTTCTTTTCATCTCGATTCCAAAGACTGAAGTGGAGAAAAAGGT
---......-----------..................................-----------...........------------------
202 V K D K I K A E L K N G V L F I S I P K T E V E K K V 228

690 710 730 750
GATTGATGTCCAAATTAACTAACATTCAGAATCGCCATGCTTTTGTTGTTCTGGTTCTTTGTAACCTTGTGTAAAATG
.---. ---.------ ------.. .---..-----------..... -----------....--........---------
229 I D V Q I N 255

770 790
TATGTTCGCATATGAATATAAAACAAGTAGTGCATCTTTGACA
---------... --------------------..... 4------- ......... -




Figure 4-4. Nucleotide and deduced amino acid sequence of pTOM 111. The
sequence was analyzed using the University of Wisconsin Genetics
Computer Group programs. The position of the specific nucleotides
appears above the sequence while the position of the specific amino
acid appears to the side.








89
the basis of deduced amino acid sequence similarity (Vierling, 1991). There are three

classes of cytoplasmically-localized low MW hsps, one class associated with the

chloroplast, and another affiliated with the endoplasmic reticulum. A comparison of

the deduced amino acid sequence of pTOM 111 to these proteins revealed the

greatest similarity with the petunia plastid hsp (77% identity) (Fig. 4-5). This is not

surprising since these species are evolutionarily most alike. Comparison to the only

other characterized low MW hsp from tomato fruit, pTOM 66 (Fray et al., 1990), a

cytoplasmically-localized hsp, revealed only 32% identity to pTOM 111 (Fig. 4-5).

The pTOM 66 protein shares more sequence similarity to cytosolically localized hsps

from other species (data not shown). Overall these hsp classes share more sequence

identity among members from different species than they do with hsps from other

families within the same species. The homology of pTOM 111 to a cDNA for a

known plastid-localized protein supports the use of import assays to identify cDNAs

for chromoplast-associated proteins.

Chen and Vierling (1991) have identified 3 conserved regions in 5 plastid

localized low MW hsps they have examined. While the first two regions are found

in all low MW hsps, the third region is unique to the plastid-localized proteins. It is

in these three regions that pTOM 111 has the highest homology to other low MW

hsps. A 90% amino acid identity to the petunia protein is found in these regions in

contrast with the 77% overall homology (Fig. 4-5).















111/hsp21
pTOM111
Petcphsp21
pTOM66



111/66
111/hsp21
pTOM111
Petcphsp21
pTOM66


++ ++ + +++++ + ++ ++ ++ ++ + + +
MAYTSLT.S. SPLVSNVSVG GTSKINNNK. VSAPCSVFVP ....SNRRPT
macktttcsa sptvsngws atsrtnnkkt ttapfsvcfp yskcsvrkpa
.......... .......... .......... .......... ..........

Putative Transit Peptide
51 100
+ + .+ + + +
+4-4+ +4"+4 +4+-H- + + +++++++++++ + ++ +4+++
TRLVARATGD NKDTSVDVHH S.SAQGGNNQ GTAVERRPTR MALDVSPFGV
srlvaqatgd nkdtsvdvhv snnnqggnnq gsaverrprr maldvspfgL
NSLIPRIFGD RRSSSN.... .....................FDPFSIDV


111/66
111/hsp21
pTOM111
Petcphsp21
pTOM66



111/66
111/hsp21
pTOM111
Petcphsp21
pTOM66



111/66
111/hsp21
pTOM111
Petcphsp21
pTOM66


+ + +


44+ 4-+H4a +4. 44++.+
LDPMSPMRTM RQNIDTMDRL
Ldpmspnirtm rqmmdtmdrl
FDP....... ..........


+ +


4++++ + -+++- 44+4- 4+4+
FEDTMIPGRN RASGTGEIRT PWDIHDDENE
fedtmtfpgs rnrgtgeira pwdikddene
FRELGFPSTN SGESSAFANT RIDUKETPEP


sensus Region III


+ +++ + + ++++ +

IKMRFDNPGL SKEDVKVSVE
ikmrfdmpgt skeevkvsve
HVFKVDLPGL KKEEVKVEVE


+ ++ ++44 + +
+ ++++ ++ +++ + + ++++++
ND.MLVIKGE HK..KEEDGR DKHSUGRNYS
dd.vtvikge hk..keesgk d.dswgrys
EDRVLQISGE RNVEKEDKND KWHRMERSSG


Consensus Region II


201
+ +44 + + +
++4+++4++444 4+4 +4 +4- +
SYDTRLSLPD NWKDKIKAE
sydtrlstpd nvdkdkvkae
KFMRRFRLPE NAKMDQVKAS


247
4*4+** *+ + +
+++++ +++ 4+4 +4+4 ++ ++ +
LKNGVLFISI PKTEVEK.KV IDVQIN.
Lkngvllisi pktkvek.kv tdveik.
MENGVLTVTV PKEEVKKPEV KSIEISG


Consensus Region I


Figure 4-5.


The pTOM 111 shares 77% amino acid sequence identity to an hsp 21
from petunia and 32% identity to pTOM 66 from tomato fruit. The
deduced amino acid sequences were compared with the University of
Wisconsin GCG program, "pileup", as described in the Materials and
Methods. The + symbol represents exact matches between proteins,
while dots represent spaces built into the protein by the pileup
alignment The putative transit peptide (Vierling, 1991) is delineated
by a solid underline. The three consensus regions described by Chen
and Vierling (1991) are also marked with a solid line.








91
The putative transit peptide of pTOM 111 protein is identified in Fig. 4-5.

(Vierling, 1991). Although this part of the protein is the least similar to the petunia

hsp shown in Fig. 4-5 (63% amino acid identity), the region still contains a number

of features characteristic of transit peptides (Keegstra et al., 1989). For example, it

is rich in serine, valine and alanine and deficient in the acidic amino acids glutamic

and aspartic acid. In addition, some basic amino acids (arginine and lysine) are also

present. Where the sequence varies from the petunia hsp within this region the

substitutions are generally those residues characteristic of transit peptides. The

observation that this portion of the protein is least similar to other plastid localized

low MW hsps is not surprising, since an examination of transit peptides for the 5

plastid-localized low MW hsps analyzed by Chen and Vierling (1991) has also shown

that they are the most diverged portion of the protein.

Even though the structure and function of the chromoplast differs drastically

from the chloroplast, a similar hsp is produced. Our data agree with the conclusion

of Vierling (1991) that localization to the plastid appears to predict more sequence

conservation than does the tissue or organism in which the protein is expressed.

Although the increases in low MW hsps pTOM 66 and pTOM 111 may be a general

result of ripening, sequence conservation suggests that their role may be more

pertinent to the compartment in which they function.



Sequence Analysis of pTOM 41

The sequence obtained for pTOM 41 is shown in Fig 4-6. The cDNA is 1423





















10 30 50 70
CTTCTTGAAATGGGTTGGGA TT TCATTTTTTCATTTTTTGTATTATTTCACTTGOAAACA TAMCTA
.-..........-- ..+----.............. -....... .......-+...........-
L 1
90 110 130 150
TOGCTTCCTGTATATTCTTTGTAGTGTCAAACCCCAATTGATTCTTTTAAAAAGATTGTTTTTTTTCAGTCATGGTC
---------.........+---------.........+----------........--..................4...........................
2 W L P V I F F V V 8 N P K L I L L K R V V F F 0 8 W 8 28

170 190 210 230
AAATAGCCACATTTCATCCTATTT CAAGAATATCCTTTTTTTAAAGAACATTTTGTTATTGTGAAGGCTTCAG
.........----------------...........................4........ ......... .........4-.........4
29 N R P H G 8 Y F N K N I 0 F R R N 8 F V I V K A 8 G 55

250 270 290 310
GTTCAAGAACTTAAAAAACAASTAGAGATAACATATATCCTGAAGAAAGATM TAAATTAGCTGATGMAGTGAT
.--.. ---...... ...-....- -.............. --...-....-4.......-...- ---.----.........
56 R T K K Q V E I T Y N P E E K F N K L A E V 82

330 350 370 390
AGAGAAGCTGGCTTTCAAGACTCACTCTTTTTCTCCTTCAAGATAAATGTTTTCTTGAGAATAACAAQCAAGAGGA
-------... .+......-..-.......+.........4.........-........4-.........--.........
82 R E A G L 8 R L T L F S P C K I N V F L R I T 8 K R 0 108

410 430 450 470
TGACGGATATCA TCGTCTCTCTTTCATTGATTAGTCTAGGAGATAAAATAAAGTTCTCCTGTCACCATCGA
.........-.........-.........4.........4........................... 4. ........4
109 D G Y H D L A 8 L F H V I 8 L 0 D K I K F 8 L 8 P 8 K 135
490 510 530 550
AGTCAAAGGATCGtTTATCTACTAATGTTGACGGAGTTCCATCGATGAGAGAAATCTGATTATAAAG CAATCTT
.........----------------................... ------.................----.......-... .........4
136 SKD R L T N V A V P L D E R N LII K A L N L 162

570 590 610 630
TATAG AAAGACTGGAACAGACMTTACTTTTGATTCATCTTGATAAAAAGTGCCTACTGGAGCTGGTCTTGGTG
----......-.........------.... .....-...........4.................------.........
162 Y R K K T 0 T 0 N Y F W I H L 0 K K V P T G A G L G G 188

650 670 690 710
TOGGAGCATAATGCTOCTCAAC CTCTGTGGCAGCAAATCAATTCAGTGGTTGTGTTGCCACTGAAAGCATCCAAG
-------------------------*--------- +--------- ---------------
................................................4. ...4..................4
189 G 8 8 N A A T T L W A A N 0 F S G C V A T E K E L Q E 215

730 750 770 790
AGTGGTCTOGTGAGATTGGTTCTGATATTCCTTTCTTTTCTCTCATGGACACCTACTTACGGTAGGGGTGAGGTT
..........................................................................4
216 W 8 E I G S D I P F F F 8 H G A A Y C T G R G E V 242
810 830 850 870
GTTCAGATATCCOTCACCCATACCATTTGACATTCCAATGTCCTCATAAAGCCTCAACACATOCTCCACTOCTGA
.........+.........4.........4.........4..........4..........4....................+
----------------------------------* ---------* -----.----*------
242 V Q D I P 8 P I P F 0 I P M V L I K P 0Q A C 8 T A E 268

890 910 930 950
AGTTTACAAGCGTTTCAGTTOGATCTOTCTAGTAAGGTTGATCCCTTGAGOTTACTOGAG ATCTCACTAGTOGAA
................ ....4.........4.........4.........4....................4
---------+---------+----------------------------------------
269 V Y K R F Q L D L 8 8 K V D P L 8 L L E K I 8 T 8 G I 295

970 990 1010 1030
TATCTCAAGATGTaTOTGTCAATGATTTAGAACCTCCTCCTTTGAAGTTCTTCCATCTCTTAAAAG TTAAACAACQA
---------*---------+--------------------- --------------------
.........-.........4.........4.-......4.4. + 4. 4..........
296 8 Q 0 V C V N 0 L E P P A F E V L P 8 L K R L K Q R 322

1050 1070 1090 1110
GTMTTGCTGCTGGCCTAGGACMATGATGCAGTCTTCATTCTGGAAGTGGAACACAATATAGGGGTTGGCTCTCC
......---.--.......---..-------.........-........4......... --..................
322 V I A A G R G Q Y D A V F M 8 G 8 G 8 T I V 6 V 6 8 P 348
1130 1150 1170 1190
AGATCCACCACAATTTGTCTATGATGATAAGAATACAAGGATGTCTTCTTGTCA aCAAGTTTCATCACTCGACCAG
.........---------+ ---.........----------......... -----.........4.........4.........-------4..........
349 D P P O F V Y 0 0 E E Y K D V F L 8 E A 8 F I T R P A 375

1210 1230 1250 1270
CCMACATGGTATGTTGAACCTGTTTCGGTACACTATTOGTGATCAATGAGTTTCTACATCTTTTGACATGTCT
---....-----.......-..-- ......+.-...... ........4-.........4.-........4-.........
376 N E W Y V E P V G T I D P E F 8 T 8 F D 402

1290 1310 1330 1350
TAAAACTCAG AGAGCTTAAAATTGMCAATAGGAGAAGTTTTTGTTGTAAATGTTATATCCTATTTTCTGTA
-...-------........- .........-- ........4.-................- -.......4-........-4

1370 1390 1410
TATCCT ACTTGATCCATTC AAAATAAAATTAGTCACAATCTGATCGAAA
---------... .. ..... ............---- -...........------- .. ..----

Figure 4-6. Nucleotide sequence and deduced amino acid sequence of pTOM 41.

Numbers appearing above the sequence refer to the nucleotide

sequence. Numbers appearing to the side of the sequence refer to the

deduced amino acid sequence.










9B 0




_-_ .- o








S o


-oo




-o "
ci
-- I 1












-D
_- _- M ,,.
- -o MSs













0 to1 1" 0
oe









-- ,^



4) 4) 0

n- =
-- o


-
= 1 g1




Ia
I1S








94
bases long. Only 1 long open reading frame (ORF) is present, but it starts with a

leucine, not a methionine (Fig. 4-6 and 4-7). This is hard to understand, given that

the pTOM 41 transcript directed production of a 47 kD translation product. A

methionine does occur within 12 nucleotides of the beginning of the long reading

frame; however, two stop codons are encountered within the next 57 bases. Another

small ORF of 28 residues is found two nucleotides 3' of the large ORF. This begins

with a methionine in a favorable initiation context (Kozak, 1991). Two possible

explanations for the observed anomaly are: 1) a sequencing error, or 2) a +1

frameshift during translation. The first possibility was addressed by additional

sequence analysis of the areas in the vicinity of the 5' and 3' ends of the long ORF.

The cDNA sequence in Fig. 4-6 shows that the long ORF starts at 78 bases

and ends at 1280. It is clear that an ORF of approximately this length is required to

produce the protein observed on SDS-PAGE, all other potential reading frames are

littered with stop codons, therefore, if a simple sequence error was generated, it

would be found within the first few hundred bases. The first 290 bases were

reexamined using a number of different modifications to the sequencing reactions.

Figure 4-8 is a compilation of these individual sequencing results. For example, both

strands of the sequence (R1 and Fl) were examined by comparing incorporation of

dITP instead of dGTP to the standard Sequenase double stranded sequencing

reactions. This region of the sequence was also analyzed by the ICBR DNA

sequencing core. They used either Klenow (R4) or TAQ polymerases (F2 and R2)

in generating these sequences. Since the template that was used for most of the




Full Text

PAGE 1

,'(17,),&$7,21 $1' &+$5$&7(5,=$7,21 2) F'1$ &/21(6 )25 &+52023/$67$662&,$7(' 3527(,16 ,1 720$72 )58,7 %\ 686$1 /$:5(1&( $ ',66(57$7,21 35(6(17(' 72 7+( *5$'8$7( 6&+22/ 2) 7+( 81,9(56,7< 2) )/25,'$ ,1 3$57,$/ )8/),//0(17 2) 7+( 5(48,5(0(176 )25 7+( '(*5(( 2) '2&725 2) 3+,/2623+< 81,9(56,7< 2) )/25,'$

PAGE 2

$&.12:/('*(0(176 ZLVK WR WKDQN 'UV 'RQDOG *ULHUVRQ DQG :ROIJDQJ 6FKXFK IRU SURYLGLQJ XV ZLWK FORQHV IURP WKHLU ULSHQLQJ WRPDWR IUXLW F'1$ OLEUDU\ ZRXOG DOVR OLNH WR WDNH WKLV RSSRUWXQLW\ WR WKDQN WKH PHPEHUV RI P\ FRPPLWWHH 'UV *ORULD 0RRUH .HQ &OLQH (GXDUGR 9DOOHMRV 'RQ +XEHU DQG %LOO *XUOH\ IRU WKHLU DGYLFH DQG VXSSRUW DP HVSHFLDOO\ LQGHEWHG WR (GXDUGR 9DOOHMRV IRU H[WHQVLYH \HDUV RI FRPPLWWHH VHUYLFH 7KLV GLVVHUWDWLRQ LV GHGLFDWHG WR 0LNH 0F&DIIHU\ IRU KLV WLUHOHVV FRPSXWLQJ DVVLVWDQFH DQG WR 5DOSK +HQU\ IRU KLV SKRWRJUDSKLF VNLOOV )LQDOO\ ZRXOG OLNH WR H[SUHVV P\ DSSUHFLDWLRQ WR DOO P\ )LILHOG +DOO ODE SDOV SDVW DQG SUHVHQW IRU PDNLQJ WKLV DQ H[SHULHQFH ZLOO IRQGO\ UHFROOHFW OL

PAGE 3

7$%/( 2) &217(176 $&.12:/('*0(176 LL $%675$&7 Y &+$37(56 ,1752'8&7,21 /,7(5$785( 5(9,(: 0RUSKRORJLFDO &KDQJHV %LRFKHPLVWU\ DQG 0ROHFXODU %LRORJ\ &KDQJHV LQ 3ODVWLG 6WUXFWXUH 5HJXODWLRQ RI 3KRWRV\QWKHWLF 3URWHLQV 7KH 5ROH RI (WK\OHQH LQ 7RPDWR )UXLW 5LSHQLQJ 7UDQVFULSWLRQDO 5HJXODWLRQ RI )UXLW 5LSHQLQJ 3URFHVVHV $VVRFLDWHG ZLWK &KURPRSODVW 'HYHORSPHQW +HDW 6KRFN 3URWHLQV DQG 2[LGDWLYH 6WUHVV &RQFOXVLRQV &+52023/$677$5*(7(' 3527(,16 ,1 720$72 )58,7 ,QWURGXFWLRQ 0DWHULDOV DQG 0HWKRGV 5HVXOWV DQG 'LVFXVVLRQ &+$5$&7(5,=$7,21 2) 7:2 F'1$6 )25 &+52023/$677$5*(7(' 3527(,16 ,QWURGXFWLRQ 0DWHULDOV DQG 0HWKRGV 5HVXOWV 'LVFXVVLRQ &21&/86,216 P

PAGE 4

$33(1',; &216758&7,21 $1' (;35(66,21 2) $17,6(16( S720 $1' 3WRP S/$60,'6 ,1 72%$&&2 5()(5(1&(6 %,2*5$3+,&$/ 6.(7&+ ,9

PAGE 5

$EVWUDFW RI 'LVVHUWDWLRQ 3UHVHQWHG WR WKH *UDGXDWH 6FKRRO RI WKH 8QLYHUVLW\ RI )ORULGD LQ 3DUWLDO )XOILOOPHQW RI WKH 5HTXLUHPHQWV IRU WKH 'HJUHH RI 'RFWRU RI 3KLORVRSK\ ,'(17,),&$7,21 $1' &+$5$&7(5,=$7,21 2) F'1$ &/21(6 )25 &+52023/$67$662&,$7(' 3527(,16 ,1 720$72 )58,7 %\ 6XVDQ /DZUHQFH 'HFHPEHU &KDLUPDQ 'U *ORULD $ 0RRUH 0DMRU 3URJUDP 3ODQW 0ROHFXODU DQG &HOOXODU %LRORJ\ 7KH FKORURSODVW WR FKURPRSODVW WUDQVLWLRQ GXULQJ WRPDWR IUXLW ULSHQLQJ LV FKDUDFWHUL]HG E\ D GUDPDWLF FKDQJH LQ SODVWLG VWUXFWXUH DQG IXQFWLRQ 7KH WK\ODNRLG PHPEUDQHV RI SKRWRV\QWKHWLFDOO\ FRPSHWHQW FKORURSODVWV DUH EURNHQ GRZQ DQG WKH FDURWHQRLG SLJPHQW O\FRSHQH LV GHSRVLWHG ZLWKLQ WKH GHYHORSLQJ FKURPRSODVW $ JRDO RI WKLV LQYHVWLJDWLRQ ZDV WR GHWHUPLQH ZKHWKHU WKLV SURFHVV LV PHGLDWHG E\ DQ LQFUHDVH LQ WKH VWHDG\VWDWH OHYHO RI 51$ IRU SODVWLGWDUJHWHG SURWHLQV $VVD\V IRU LPSRUW RI UDGLRODEHOHG WUDQVODWLRQ SURGXFWV LQWR LVRODWHG SHD FKORURSODVWV ZHUH XVHG WR PRQLWRU OHYHOV RI FKURPRSODVWWDUJHWHG SURWHLQV DW IRXU VWDJHV RI WRPDWR IUXLW GHYHORSPHQW 'XULQJ GHYHORSPHQW VWULNLQJ LQFUHDVHV LQ OHYHOV RI WUDQVODWDEOH 51$ IRU WZR VXFK SURWHLQV ZHUH IRXQG $GGLWLRQDOO\ WKH LPSRUW RI LQ YLWUR WUDQVODWLRQ SURGXFWV ZDV H[DPLQHG IRU VHYHQ LQGLYLGXDO F'1$ FORQHV NQRZQ WR HQFRGH 51$ WKDW LQFUHDVHV Y

PAGE 6

GXULQJ IUXLW ULSHQLQJ 7KUHH RI WKHVH FORQHV SURGXFHG LQ YLWUR WUDQVODWLRQ SURGXFWV WKDW LPSRUWHG LQWR SHD FKORURSODVWV 2QH FORQH S720 KDV UHFHQWO\ EHHQ VKRZQ E\ RWKHUV WR HQFRGH WKH HQ]\PH UHVSRQVLEOH IRU WKH ILUVW FRPPLWWHG VWHS LQ WKH V\QWKHVLV RI O\FRSHQH 6XEVHTXHQW VHTXHQFH DQDO\VLV RI DQRWKHU F'1$ S720 UHYHDOHG WKDW LW HQFRGHV D SODVWLGORFDOL]HG ORZ 0: KHDW VKRFN SURWHLQ 1RW RQO\ GRHV WKLV WUDQVFULSW LQFUHDVH GXULQJ GHYHORSPHQW DW QRUPDO WHPSHUDWXUHV EXW LW LV LQFUHDVLQJO\ LQGXFLEOH E\ HOHYDWHG WHPSHUDWXUHV DV ULSHQLQJ SURJUHVVHV 7KLV LV WKH ILUVW UHSRUW RI WKH GHYHORSPHQWDO LQGXFWLRQ RI D SODVWLGORFDOL]HG ORZ 0: KHDW VKRFN SURWHLQ ,GHQWLILFDWLRQ RI WKH LQGXFWLRQ RI D KHDW VWUHVV SURWHLQ GXULQJ WKLV WUDQVLWLRQ VXJJHVWV WKDW HLWKHU WKH SODVWLG LV VXEMHFWHG WR DQ LQFUHDVLQJO\ VWUHVVIXO HQYLURQPHQW RU DV LV FRQVLVWHQW IRU WKH GHYHORSPHQWDO LQGXFWLRQ RI RWKHU KHDW VWUHVV SURWHLQV D PDVVLYH VWUXFWXUDO UHSURJUDPPLQJ LV XQGHUZD\ 7KHVH VWXGLHV LPSO\ WKDW WKHUH LV V\QWKHVLV DQG LPSRUW RI QHZ SURWHLQV GXULQJ WKH WUDQVLWLRQ IURP FKORURSODVW WR FKURPRSODVW DQG WKDW WKH SODVWLG FRQYHUVLRQ LV DQ DFWLYH GHYHORSPHQWDO SURJUDP UDWKHU WKDQ D VLPSOH GHFOLQH LQ V\QWKHVLV RI WKH SKRWRV\QWKHWLF DSSDUDWXV )XUWKHUPRUH WKHVH UHVXOWV GHPRQVWUDWH WKH XWLOLW\ RI WKLV PHWKRG IRU LGHQWLILFDWLRQ RI VWUXFWXUDO JHQHV LQYROYHG LQ SODVWLG PRUSKRJHQHVLV YL

PAGE 7

&+$37(5 ,1752'8&7,21 5LSHQLQJ RI WRPDWR IUXLW LQYROYHV D ZLGH YDULHW\ RI GHYHORSPHQWDO FKDQJHV WKDW LQFOXGH EXW DUH QRW OLPLWHG WR FKDQJHV LQ FHOO ZDOO VWUXFWXUH LQ PHWDEROLVP LQ XOWUDVWUXFWXUH DQG DQ HVSHFLDOO\ GUDPDWLF FKDQJH LQ WKH IRUP DQG IXQFWLRQ RI WKH SODVWLG %LRFKHPLFDO DQG PROHFXODU VWXGLHV VXJJHVW WKDW PRVW RU DOO RI WKHVH FKDQJHV DUH PHGLDWHG E\ WKH HQKDQFHG H[SUHVVLRQ RI ULSHQLQJ VSHFLILF JHQHV KDYH FKRVHQ WKLV V\VWHP DV D PHDQV WR LQYHVWLJDWH SODVWLG GHYHORSPHQW DQG LQWHUFRQYHUVLRQ :H DUH LQWHUHVWHG LQ GHWHUPLQLQJ KRZ WKH WUDQVLWLRQ IURP FKORURSODVW WR FKURPRSODVW LV UHJXODWHG HJ GRHV D VXEVHW RI SODVWLG SURWHLQV LQFUHDVH GXULQJ WKLV SURFHVV" ,Q DQ LQLWLDO H[DPLQDWLRQ RI WKLV TXHVWLRQ ZH KDYH DVNHG ZKHWKHU DQ LQFUHDVH LQ WKH DFFXPXODWLRQ RI 51$ IRU D VXEVHW RI SODVWLG SURWHLQV FRUUHODWHV ZLWK WKH FKORURSODVW WR FKURPRSODVW WUDQVLWLRQ 6LQFH WUDQVFULSWLRQ DQGRU WUDQVODWLRQ RI WKH SODVWLG JHQRPH VHHPV WR GLPLQLVK GXULQJ FKURPRSODVW IRUPDWLRQ .RED\DVKL f FKURPRSODVWVSHFLILF SURWHLQV DUH SUREDEO\ HQFRGHG LQ WKH QXFOHXV 1XFOHDU HQFRGHG SODVWLG SURWHLQV DUH V\QWKHVL]HG LQ WKH F\WRVRO DQG SRVWWUDQVODWLRQDOO\ LPSRUWHG LQWR SODVWLGV 7KH LPSRUW RI SURWHLQV LQWR SODVWLGV LV D KLJKO\ VSHFLILF SURFHVV .HHJVWUD f 7KH SURWHLQV DUH PDGH DV SUHFXUVRUV ZLWK WUDQVLHQW DPLQR WHUPLQDO WUDQVLW SHSWLGHV ZKLFK DUH ERWK QHFHVVDU\ DQG VXIILFLHQW IRU WKH FRUUHFW

PAGE 8

WDUJHWLQJ LQWR WKLV RUJDQHOOH ,W LV WKLV ODWWHU REVHUYDWLRQ WKDW PDNHV WKH LPSRUW LQWR SODVWLGV D SRWHQWLDOO\ GLDJQRVWLF DVVD\ IRU WKH LGHQWLILFDWLRQ RI FKURPRSODVW DVVRFLDWHG SURWHLQV 7KH DSSURDFK GHVFULEHG ZLWKLQ WKLV GLVVHUWDWLRQ KDV EHHQ WR PRQLWRU FKORURSODVW LPSRUW RI LQ YLWUR WUDQVODWLRQ SURGXFWV IURP 51$ RI WRPDWR IUXLW LVRODWHG DW GLIIHUHQW ULSHQLQJ VWDJHV :H KDYH DOVR VWXGLHG WUDQVODWLRQ SURGXFWV SURJUDPPHG ZLWK WUDQVFULSWV IURP F'1$V 6ODWHU HW DO f ZKRVH VWHDG\ VWDWH 51$ OHYHO LQFUHDVHV GXULQJ ULSHQLQJ 6LQFH LQGLYLGXDO F'1$V ZHUH DQDO\]HG VXEVHTXHQW VHTXHQFH DQDO\VLV DOORZHG IXUWKHU FKDUDFWHUL]DWLRQ RI WKH SURWHLQV WKDW PHGLDWH WKLV WUDQVLWLRQ (YHQWXDOO\ WKH UROH RI FKURPRSODVWDVVRFLDWHG SURWHLQV LQ FKURPRSODVW GHYHORSPHQW FDQ EH DVVHVVHG GLUHFWO\ YLD DQWLVHQVH WHFKQRORJ\ 7KH ILQDO RXWFRPH RI VXFK D VWXG\ VKRXOG EH DQ XQGHUVWDQGLQJ RI WKH UROH QHZ SURWHLQ V\QWKHVLV SOD\V LQ WKLV SURFHVV DQG WKH LVRODWLRQ LGHQWLILFDWLRQ DQG FKDUDFWHUL]DWLRQ RI JHQHV WKDW PHGLDWH WKLV WUDQVLWLRQ

PAGE 9

&+$37(5 5(9,(: 2) /,7(5$785( 7KH PDQQHU LQ ZKLFK WKH WUDQVLWLRQ IURP FKORURSODVW WR FKURPRSODVW LV UHJXODWHG LV ODUJHO\ XQNQRZQ (OHFWURQ PLFURJUDSKLF DQDO\VLV KDV VKRZQ WKDW D PDVVLYH UHRUGHULQJ RI SODVWLG VWUXFWXUH RFFXUV GXULQJ WKH FRQYHUVLRQ 7KHODQGHU HW DO f ,Q WRPDWR IUXLW WKLV LV FKDUDFWHUL]HG E\ WKH RYHUDOO EUHDNGRZQ RI FKORURSODVW VSHFLILF FRPSRQHQWV HJ WKH WK\ODNRLG PHPEUDQH V\VWHP DQG VWDUFK ZLWK WKH FRQFRPLWDQW DFFXPXODWLRQ RI PHPEUDQHDVVRFLDWHG GHSRVLWV RI WKH FDURWHQRLG O\FRSHQH 7KHODQGHU HW DO f ,W KDV QRW EHHQ GHWHUPLQHG ZKHWKHU WKH EUHDNGRZQ RI FKORURSODVW VWUXFWXUHV LV FDXVHG VLPSO\ E\ WKH GHFUHDVH LQ V\QWKHVLV RI SKRWRV\QWKHWLF SURWHLQV RU LI LQFUHDVHV LQ GHJUDGDWLYH HQ]\PHV DFWXDOO\ HQKDQFH WKLV SURFHVV $Q H[DPLQDWLRQ RI QXFOHDUHQFRGHG SODVWLGWDUJHWHG SKRWRV\QWKHWLFSURWHLQV KDV VKRZQ WKDW WKHLU WUDQVFULSWLRQ VWRSV WR GD\V EHIRUH WKH IUXLW UHDFKHV IXOO VL]H 3LHFKXOOD HW DO f $QDO\VLV RI SODVWLGHQFRGHG WUDQVFULSWV KDV GHPRQVWUDWHG WKDW VRPH DUH JUHDWO\ UHGXFHG ZKHUHDV RWKHUV SHUVLVW DQG RQH DSSHDUV WR LQFUHDVH GXULQJ FKURPRSODVW IRUPDWLRQ .RED\DVKL 5LFKDUGV HW DO f 6LPLODUO\ OLWWOH KDV EHHQ DVFHUWDLQHG DERXW WKH IXQFWLRQ RU H[SUHVVLRQ RI JHQHV LQYROYHG LQ WKH V\QWKHVLV RI FKURPRSODVW VWUXFWXUHV DV IHZ FORQHV VSHFLILF WR WKLV GHYHORSPHQWDO VWDJH KDYH EHHQ DYDLODEOH IRU DQDO\VLV IRU H[DPSOH .XQW] HW DO f

PAGE 10

,Q FRQVLGHULQJ ZKDW DVSHFWV RI IUXLW ULSHQLQJ GLUHFWO\ DIIHFW WKH SURWHLQV WKDW DUH WDUJHWHG WR WKH SODVWLG LW TXLFNO\ EHFDPH DSSDUHQW WKDW WZR W\SHV RI IXQFWLRQV FRXOG FDXVH LQFUHDVHV LQ SURWHLQV GLUHFWHG WR WKH GHYHORSLQJ FKURPRSODVW )LUVW SURWHLQV LQYROYHG LQ WKH GHJUDGDWLRQ RI WKH SKRWRV\QWKHWLF DSSDUDWXV RU WKH EXLOG XS LQ FDURWHQRLGV DUH H[FHOOHQW FDQGLGDWHV IRU FKURPRSODVWWDUJHWLQJ DQG HQKDQFHG V\QWKHVLV GXULQJ IUXLW ULSHQLQJ $ EURDG GHVFULSWLRQ RI SODVWLG VHQHVFHQFH ZLOO EH FRQVLGHUHG VLQFH WKDW WUDQVLWLRQ DOVR LQYROYHV WKH GHJUDGDWLRQ RI FKORURSODVW VWUXFWXUHV DQG EHFDXVH DQ H[DPLQDWLRQ RI 51$ IURP VHQHVFLQJ OHDYHV KDV VKRZQ WKDW PDQ\ RI WKH VDPH WUDQVFULSWV DUH DOVR SUHVHQW 6HFRQGO\ RWKHU DVSHFWV RI PDWXUDWLRQ PD\ KDYH LQGLUHFW HIIHFWV RQ WKH HQYLURQPHQW LQ ZKLFK WKH GHYHORSLQJ SODVWLG UHVLGHV )RU H[DPSOH WKH DXWRFDWDO\WLF SURGXFWLRQ RI HWK\OHQH WKH UHVSLUDWRU\ FOLPDFWHULF RU DQ LQFUHDVH LQ R[LGDWLYH VWUHVV GXULQJ ULSHQLQJ FRXOG VHFRQGDULO\ FUHDWH LQFUHDVHV LQ SODVWLGWDUJHWHG SURWHLQV 6LQFH WKH SODVWLG LV UHVSRQVLEOH IRU D QXPEHU RI EDVLF ELRV\QWKHWLF IXQFWLRQV VXFK DV WKH V\QWKHVLV RI DURPDWLF DPLQR DFLGV IDWW\ DFLGV DQG 6DPLQROHYXOLQLF DFLG WKHVH FKDQJHV RXWVLGH RI WKH SODVWLG FRXOG FUHDWH D QHHG IRU VXEVWUDWHV V\QWKHVL]HG ZLWKLQ WKLV RUJDQHOOH $ FRQVHTXHQFH RI WKH ZRUN GHVFULEHG LQ WKLV GLVVHUWDWLRQ ZDV WKH FKDUDFWHUL]DWLRQ RI D F'1$ WKDW HQFRGHV D SODVWLGORFDOL]HG ORZ PROHFXODU ZHLJKW 0:f KHDW VKRFN SURWHLQ KVSf %HFDXVH WUDQVFULSW IRU WKLV KVS LQFUHDVHV GXULQJ ULSHQLQJ DW QRUPDO WHPSHUDWXUHV LW ZDV QHFHVVDU\ WR DVVHVV KRZ WKLV XQH[SHFWHG ILQGLQJ ILW LQWR FKURPRSODVW GHYHORSPHQW RU IUXLW ULSHQLQJ 6LQFH R[LGDWLYH VWUHVV KDV EHHQ DVVRFLDWHG ZLWK VHQHVFHQFH DQG KVSV KDYH EHHQ LQGXFHG E\ R[LGDWLYH VWUHVV LQ

PAGE 11

DQLPDO WLVVXHV D FRQVLGHUDWLRQ RI KHDW VWUHVV SURWHLQV DQG R[LGDWLYH VWUHVV GXULQJ IUXLW ULSHQLQJ ZLOO DOVR EH H[DPLQHG 0RUSKRORJLFDO &KDQJHV 7KH RYHUDOO FKDQJHV WKDW RFFXU GXULQJ WKH ULSHQLQJ RI WRPDWR IUXLW DUH DV IDPLOLDU WR RQHV PRWKHU DV WKH\ DUH WR DQ\ SRVWKDUYHVW SK\VLRORJLVW )XOO VL]HG JUHHQ IUXLW KDUYHVWHG IURP WKH JDUGHQ DQG EURXJKW LQWR WKH NLWFKHQ ZLOO ULSHQ QRUPDOO\ 7KH FRORU FKDQJHV REVHUYHG GXULQJ WKH ULSHQLQJ RI WRPDWR IUXLW DUH GXH WR WKH EUHDNGRZQ RI FKORURSK\OO DQG WKH GHSRVLWLRQ RI O\FRSHQH ZLWKLQ WKH IUXLW SODVWLGV 7KH EUHDNHU VWDJH LV LGHQWLILHG E\ WKH DSSHDUDQFH RI H[WHUQDO FRORU DW WKH EORVVRP HQG 7KH H[DFW IUXLW FRORU WKDW WKHQ GHYHORSV LV GHSHQGHQW RQ YDULHW\ DQG FRQVHTXHQWO\ WKH IUXLW PD\ WXUQ \HOORZ SLQN RU RUDQJHUHG $V WKH IUXLW EHFRPHV XQLIRUPO\ UHG WKH FHOO ZDOOV EHJLQ WR VRIWHQ 7KH FKDUDFWHULVWLF IODYRU RI ULSH WRPDWRHV LV FUHDWHG E\ D FRPELQDWLRQ RI JOXFRVH IUXFWRVH FLWULF DQG JOXWDPLF DFLGV ZKLFK DFFXPXODWH LQ WKH YDFXROHV DORQJ ZLWK WKH V\QWKHVLV RI KXQGUHGV RI YRODWLOH FRPSRXQGV 'DYLHV DQG +REVRQ *ULHUVRQ f 7KH \RXQJ IUXLW LV JUHHQ EHFDXVH LW FRQWDLQV FKORURSK\OO LQ SKRWRV\QWKHWLFDOO\ IXQFWLRQDO FKORURSODVWV ,W LV FRQVLGHUHG LPPDWXUH JUHHQ ,0*f XQWLO LW UHDFKHV LWV IXOO VL]H *URZWK LV FRPSOHWH DW PDWXUH JUHHQ 0*f $ JUHHQ WRPDWR PD\ DSSHDU PRUSKRORJLFDOO\ TXLHVFHQW KRZHYHU LW LV XQGHUJRLQJ LPSRUWDQW ULSHQLQJ FKDQJHV ,WV ORFXODU WLVVXH WUDQVIRUPV IURP D VROLG WR D JHODWLQRXV VXEVWDQFH LW FDQ UHVSRQG UDSLGO\ WR H[RJHQRXV HWK\OHQH DQG WKH HQGRJHQRXV HWK\OHQH OHYHO DOVR LQFUHDVHV DW

PAGE 12

WKLV WLPH %\ ODWH 0* FDURWHQRLGV EHJLQ WR DSSHDU LQ WKH ORFXOHV 7KXV WKH FRORU FKDQJH EHJLQV LQ WKH LQWHULRU RI WKH IUXLW .DGHU DQG 0RUULV f $IWHU WKH IUXLW KDV SDVVHG WKURXJK PDWXUH JUHHQ WKH WUDQVIRUPDWLRQ WR D UHG ULSH VRIW WRPDWR SURFHHGV UDSLGO\ %LRFKHPLVWU\ DQG 0ROHFXODU %LRORJ\ $OWKRXJK WKH FKDQJH LQ IUXLW FRORU LV D FRQYHQLHQW PHWKRG RI FODVVLI\LQJ WRPDWR IUXLW ULSHQLQJ D QXPEHU RI RWKHU ELRFKHPLFDO FKDQJHV DOVR RFFXU )RU H[DPSOH D GUDPDWLF ULVH LQ UHVSLUDWLRQ DQG HWK\OHQH SURGXFWLRQ WDNHV SODFH 7KLV SKHQRPHQRQ LV NQRZQ DV WKH FOLPDFWHULF &OLPDFWHULF HWK\OHQH OHYHOV UHDFK DERXW RQH KDOI RI WKHLU PD[LPXP E\ WKH EUHDNHU VWDJH 3LFWRQ DQG *ULHUVRQ f 7KH UHVSLUDWRU\ SHDN RFFXUV VRRQ DIWHU WKH ULVH LQ HWK\OHQH *ULHUVRQ f $OWHUDWLRQV LQ %DVLF 0HWDEROLVP 'XULQJ )UXLW 5LSHQLQJ &KDQJHV WDNH SODFH LQ WKH W\SH RI FDUERK\GUDWH WKDW DFFXPXODWHV DV WRPDWR IUXLW ULSHQV 6WDUFK JUDQXOHV WUDQVLHQWO\ DSSHDU EHWZHHQ GD\V SRVWDQWKHVLV LQ WKH LPPDWXUH JUHHQ FKORURSODVWV 'DYLHV DQG &RFNLQJ f $OWKRXJK WKHVH SODVWLGV FDQ IL[ FDUERQ DW XS WR b RI WKH UDWH DWWDLQHG E\ OHDI SODVWLGV WKH VWDUFK JUDQXOHV DUH PRVWO\ WKH SURGXFW RI VXFURVH LPSRUWHG IURP WKH OHDYHV 7KHODQGHU HW DO f 6LQFH WKH LPSRUW RI FDUERK\GUDWH IURP WKH OHDYHV VWRSV E\ 0* 7KHODQGHU HW DO f IUXLW DW WKLV VWDJH ZLOO GHYHORS QRUPDOO\ LI KDUYHVWHG IURP WKH SODQW $ERXW GD\V DIWHU DQWKHVLV GHJUDGDWLRQ RI VWDUFK RFFXUV DV DQ LQFUHDVH LQ VROXEOH

PAGE 13

VXJDUV WDNHV SODFH &RQVHTXHQWO\ OLWWOH VWDUFK UHPDLQV LQ WKH PDWXUH JUHHQ IUXLW
PAGE 14

HQ]\PH SKRVSKRIUXFWRNLQDVH 3).f KDYH EHHQ REVHUYHG *ULHUVRQ f 3). LV D FRQWURO SRLQW LQ JO\FRO\VLV DQG DQ LQFUHDVH LQ WKLV HQ]\PH DFWLYLW\ SUREDEO\ UHVXOWV LQ DQ LQFUHDVH LQ FDUERQ IORZ WKURXJK WKLV SDWKZD\ 6RORPRV f ,QGHHG DQ LQFUHDVH LQ WKH DFFXPXODWLRQ RI $73 LV JHQHUDOO\ QRWHG GXULQJ WKH UHVSLUDWRU\ ULVH 6RORPRV f ,QYHVWLJDWLRQ RI PLWRFKRQGULDO HOHFWURQ WUDQVSRUW LQ ULSHQLQJ IUXLW VXJJHVWHG WKDW LW UHPDLQV XQFKDQJHG 6RORPRV f +RZHYHU WKH 7&$ F\FOH HQ]\PHV FLWUDWH V\QWKDVH PDODWH GHK\GURJHQDVH 1$'OLQNHG PDOLF HQ]\PH DQG LVRFLWUDWH GHK\GURJHQDVH GHFUHDVH LQ ULSHQLQJ WRPDWR IUXLW *ULHUVRQ -HIIHU\ HW DOf 2YHUDOO WKHVH GDWD GR QRW H[SODLQ ZK\ DQ LQFUHDVH LQ UHVSLUDWLRQ LV PHDVXUHG GXULQJ ULSHQLQJ 6LQFH WKHVH FKDQJHV DUH XQGHUZD\ GXULQJ WKH SODVWLG FRQYHUVLRQ ZKLOH SKRWRV\QWKHVLV LV GHFOLQLQJ LW LV XQFOHDU KRZ WKLV PD\ HIIHFW WKH V\QWKHVLV RI SURWHLQV WDUJHWHG WR WKH SODVWLG 2WKHU &KDQJHV $VVRFLDWHG ZLWK )UXLW 5LSHQLQJ $SSDUHQWO\ WKH OHYHO RI WKH DQR[LDUHVSRQVLYH HQ]\PH DOFRKRO GHK\GURJHQDVH $'+f LQFUHDVHV GXULQJ ULSHQLQJ LQ WRPDWR IUXLW /RQJKXUVW HW DO 9DQ 'HU 6WUDHWHQ HW DO f /RQJKXUVW HW DO f FRQFOXGHG WKDW WKH LQFUHDVH LQ $'+ GXULQJ ULSHQLQJ PD\ EH FDXVHG E\ WKH F\WRSODVPLF LQFUHDVH LQ S+ ,W KDV EHHQ K\SRWKHVL]HG WKDW ORZ R[\JHQ OHYHOV FRXOG UHVXOW ZLWKLQ VXFK D EXON\ RUJDQ EXW E\ H[SRVLQJ ULSHQLQJ IUXLW WR GLIIHUHQW OHYHOV RI 2] DQG & WKHVH DXWKRUV VXUPLVHG WKDW WKH FKDQJH LQ S+ OHDGV WR DQ LQGXFWLRQ RI WKLV HQ]\PH

PAGE 15

$V IUXLW PDWXUHV WKH FHOO ZDOOV VRIWHQ DQG DQ LQFUHDVH LQ VROXEOH SHFWLQ RFFXUV *ULHUVRQ f &KDUDFWHUL]DWLRQ RI WKH UHJXODWLRQ RI WKH HQ]\PHV LQYROYHG LQ FHOO ZDOO GHJUDGDWLRQ KDV EHJXQ 7KHVH GDWD VXJJHVW WKDW WKH SDWWHUQ RI H[SUHVVLRQ IRU HQ]\PHV LQYROYHG LQ FHOO ZDOO GHJUDGDWLRQ LV FRPSOH[ DQG FDQ HYHQ LQYROYH PRUH WKDQ RQH LVR]\PH 'HOOD3HQQD HW DO *ULHUVRQ HW DO )LVKHU DQG %HQQHWW +DUULPDQ HW DO f )RU H[DPSOH DQWLVHQVH PXWDJHQHVLV RI WKH FHOO ZDOO VRIWHQLQJ HQ]\PH SRO\JDODFWXURQDVH 3*f KDV VKRZQ WKDW DOWKRXJK WKLV HQ]\PH LV GUDPDWLFDOO\ LQGXFHG GXULQJ IUXLW ULSHQLQJ ORVV RI WKLV HQ]\PDWLF IXQFWLRQ KDV OLWWOH RYHUDOO HIIHFW RQ PDWXUDWLRQ 6KHHK\ HW DO 6PLWK HW DO DQG f 7KH V\QWKHVLV RI KXQGUHGV RI YRODWLOH FRPSRXQGV RFFXUV DV WRPDWR IUXLW ULSHQV 'DYLHV DQG +REVRQ f +RZHYHU OLWWOH LV NQRZQ DERXW KRZ WKHVH FRPSRXQGV DUH V\QWKHVL]HG GXULQJ PDWXUDWLRQ 2[LGDWLYH 6WUHVV DQG )UXLW 5LSHQLQJ 6LQFH D FKURPRSODVWDVVRFLDWHG ORZ 0: KHDW VKRFN SURWHLQ ZDV LGHQWLILHG LQ WKLV ZRUN LW LV LPSRUWDQW WR XQGHUVWDQG WKH UROH WKLV VWUHVV SURWHLQ PD\ SOD\ LQ IUXLW GHYHORSPHQW 2[LGDWLYH VWUHVV RFFXUV ZKHQ WKH FHOOfV DELOLW\ WR UHVSRQG LV H[FHHGHG E\ WKH OHYHO RI UHDFWLYH R[\JHQ VSHFLHV SUHVHQW %DUMD GH 4XLURJD f 7KH LQGXFWLRQ RI KVSV E\ FRPSRXQGV WKDW FDXVH R[LGDWLYH VWUHVV KDV EHHQ VKRZQ LQ DQLPDO WLVVXHV 'UXPPRQG DQG 6WHLQKDUGW &DMRQH DQG %HUQHPPL=D]]HUD &RXUJHRQ HW DO f ,Q DGGLWLRQ R[LGDWLYH VWUHVV KDV RIWHQ EHHQ DVVRFLDWHG ZLWK ULSHQLQJ DQG VHQHVFHQFH 2QH WKHRU\ SRVWXODWHV WKDW D EXLOGXS LQ WKH GHOHWHULRXV

PAGE 16

HIIHFWV RI IUHH UDGLFDOV UHVXOWV LQ WKH SK\VLRORJLFDO PDQLIHVWDWLRQV RI DJLQJ +DUPDQ f )UHH UDGLFDO SURGXFWLRQ GXULQJ QRUPDO FHOOXODU PHWDEROLVP 5HDFWLYH R[\JHQ FRPSRXQGV FDQ FDXVH GDPDJH WR SURWHLQV DQG HVSHFLDOO\ PHPEUDQH FRPSRQHQWV RI WKH FHOO $ QXPEHU RI QRUPDO FHOOXODU IXQFWLRQV UHVXOW LQ WKH SURGXFWLRQ RI WKHVH VSHFLHV ZKLFK FDQ EH D VLGH HIIHFW RI UHDFWLRQV WKDW UHGXFH PROHFXODU R[\JHQ )RU H[DPSOH DW OHDVW RQH SHUFHQW RI WKH R[\JHQ XWLOL]HG GXULQJ UHVSLUDWRU\ HOHFWURQ WUDQVSRUW LV LQFRPSOHWHO\ UHGXFHG )OHPLQJ HW DO f )XUWKHUPRUH DQ LQFUHDVH LQ EDVDO PHWDEROLVP FDQ UHVXOW LQ DQ LQFUHDVH LQ WKH DPRXQW RI UHDFWLYH R[\JHQ JHQHUDWHG HYHQ ZLWKRXW LQYRNLQJ D EUHDNGRZQ LQ R[LGDWLYH SKRVSKRU\ODWLRQ %DLMD GH 4XLURJD f 3KRWRV\QWKHVLV LV DQRWKHU QRUPDO FHOOXODU IXQFWLRQ GXULQJ ZKLFK D ODUJH DPRXQW RI IUHH UDGLFDOV FDQ IRUP 6FDQGDOLRV f ,Q DGGLWLRQ VRPH HQ]\PDWLF UHDFWLRQV GLUHFWO\ SURGXFH UHDFWLYH PROHFXOHV ([DPSOHV RI WKLV ODWWHU JURXS LQFOXGH [DQWKLQH R[LGDVH DQ $73 GHJUDGLQJ HQ]\PHf DQG EHWD R[LGDWLRQ RI IDWW\ DFLGV 6FDQGDOLRV f )LQDOO\ FHUWDLQ HQYLURQPHQWDO VWUHVVHV FDQ HQKDQFH WKH OHYHO RI UHDFWLYH PROHFXOHV )RU H[DPSOH UDGLDWLRQ KHUELFLGHV SDWKRJHQV K\SHUR[LD DQG WHPSHUDWXUH IOXFWXDWLRQV FDQ LQGXFH IUHH UDGLFDO SURGXFWLRQ 6FDQGDOLRV f 3HUKDSV D EXLOGXS RI WKHVH GHOHWHULRXV FRPSRXQGV RFFXUV GXULQJ WKH ULSHQLQJ RI WRPDWR IUXLW 6LQFH DQ\ FHOOXODU IXQFWLRQ WKDW LQYROYHV WKH UHGXFWLRQ RI R[\JHQ FDXVHV SURGXFWLRQ RI UHDFWLYH R[\JHQ HLWKHU DXWRFDWDO\WLF HWK\OHQH V\QWKHVLV RU WKH UHVSLUDWRU\ FOLPDFWHULF ZRXOG EH H[FHOOHQW VRXUFHV RI IUHH UDGLFDOV

PAGE 17

2QH VRXUFH RI UHDFWLYH R[\JHQ LV OLSR[\JHQDVH DFWLYLW\ ZKLFK LQFUHDVHV GXULQJ ULSHQLQJ 7KRPSVRQ HW DO f 7KLV HQ]\PH LQFRUSRUDWHV R[\JHQ LQWR SRO\XQVDWXUDWHG IDWW\ DFLGV +DWDQDND HW DO f DQG OHDGV WR D EXLOG XS RI WKH UHDFWLYH R[\JHQ FRPSRXQGV K\GURSHUR[LGH RU VXSHUR[LGH 5HFHQWO\ %RZVKHU HW DO f KDYH SXULILHG D PHPEUDQH DVVRFLDWHG OLSR[\JHQDVH IURP EUHDNHU VWDJH WRPDWR IUXLW 7KH\ ILQG WKDW WKH DFWLYLW\ IUDFWLRQDWHV ZLWK WKH WK\ODNRLG PHPEUDQH &RQVHTXHQWO\ WKLV FRXOG UHVXOW LQ LQFUHDVHV LQ WKH DPRXQW RI UHDFWLYH R[\JHQ VSHFLHV LQ WKH GHYHORSLQJ FKURPRSODVW 7KH FKDQJH LQ PHPEUDQH LQWHJULW\ GXULQJ IUXLW ULSHQLQJ $ GHFUHDVH LQ PHPEUDQH IOXLGLW\ ZKLFK PD\ EH FUHDWHG E\ R[LGDWLYH VWUHVV RFFXUV GXULQJ ULSHQLQJ DQG VHQHVFHQFH DORQJ ZLWK D SURJUHVVLYH ORVV RI VSHFLDOL]HG PHPEUDQH IXQFWLRQ 7KRPSVRQ HW DO f 0DQ\ DVSHFWV RI PHPEUDQH VWUXFWXUH FDQ DIIHFW WKH OHYHO RI PHPEUDQH YLVFRVLW\ )RU H[DPSOH WKH OHQJWK RU GHJUHH RI XQVDWXUDWLRQ RI WKH K\GURFDUERQV DQG WKH OHYHO RI VWHUROV DOO FDQ SOD\ D SDUW $OWKRXJK D GHFUHDVH LQ PHPEUDQH IOXLGLW\ RFFXUV LQ WKH SODVPD PHPEUDQH RI WRPDWR IUXLW /HJJH HW DO f DQG SHSSHU PLFURVRPDO PHPEUDQHV :KLWDNHU f QR FKDQJH LQ SODVWLG PHPEUDQH IOXLGLW\ RFFXUV LQ HLWKHU WRPDWR RU SHSSHU FKURPSODVWV 1HLWKHU IOXRUHVFHQW PHPEUDQH SUREHV ZKLFK GLUHFWO\ DVVHVV WKH VWUXFWXUH ZLWKLQ VSHFLILF HQYLURQPHQWV RI WKH PHPEUDQH XVHG E\ /HJJH HW DO f QRU PHDVXUHPHQWV RI WKH IUHH VWHURO RU WRWDO VWHURO WR SKRVSKROLSLG UDWLRV GHWHUPLQHG E\ :KLWDNHU f FRXOG GHWHFW D FKDQJH LQ WKH GHYHORSLQJ FKURPRSODVW PHPEUDQH &RQVLGHULQJ WKH LQFUHDVH LQ FDURWHQRLG ELRV\QWKHVLV GXULQJ ULSHQLQJ ZKLFK LV

PAGE 18

DVVRFLDWHG ZLWK SODVWLG HQYHORSH PHPEUDQHV LW LV DSSURSULDWH WKDW WKH LQWHJULW\ RI WKLV PHPEUDQH SHUVLVWV )UHH UDGLFDO VFDYHQJHUV DQG R[LGDWLYH VWUHVV ,QLWLDOO\ DQ LQFUHDVH LQ IUHH UDGLFDOV UHVXOWV LQ DQ LQFUHDVH LQ HQ]\PHV RU DQWLR[LGDQWV WKDW QHXWUDOL]H WKHVH UHDFWLYH VSHFLHV )RU H[DPSOH D IDPLO\ RI VXSHUR[LGH GLVPXWDVHV 62'f DFWV WR VFDYHQJH VXSHUR[LGH DQG FUHDWH R[\JHQ DQG K\GURJHQ SHUR[LGH )LYH LVR]\PHV RI WKLV HQ]\PH KDYH EHHQ GHVFULEHG LQ WRPDWRHV 7ZR DUH F\WRSODVPLF RQH LV PLWRFKRQGULDO DQG WZR RFFXU LQ FKORURSODVWV 3HUO7UHYHV DQG *DOXQ f $OVR DVFRUELF DFLG DQG DWRFRSKHURO FDQ DFW DV DQWLR[LGDQWV /HVKHP f $ QXPEHU RI HQ]\PHV DUH DOVR LQYROYHG LQ UHGXFLQJ WKH OHYHOV RI K\GURJHQ SHUR[LGH &DWDODVH SHUR[LGDVH DQG JOXWDWKLRQH SHUR[LGDVH DOO DFW LQ WKLV PDQQHU /HVKHP f $GGLWLRQDOO\ JOXWDWKLRQH UHGXFWDVH LV UHTXLUHG WR UHJHQHUDWH JOXWDWKLRQH ORVW E\ LQWHUDFWLRQ ZLWK K\GURJHQ SHUR[LGH /HVKHP f &RQVHTXHQWO\WKH LQFUHDVH LQ WKHVH HQ]\PHV LV FRUUHODWHG ZLWK DQ LQFUHDVH LQ UHDFWLYH R[\JHQ PROHFXOHV $Q\ GHFUHDVH LQ WKHVH HQ]\PHV ZLWK VHQHVFHQFH WKHUHIRUH FRXOG FRQWULEXWH WR GHJHQHUDWLRQ RI PHPEUDQHV DQG GLVWXUEDQFH RI FHOOXODU IXQFWLRQ ,QFUHDVHV LQ EDVDO PHWDEROLVP PD\ LQGXFH 62'V LQ SODQW WLVVXH %RZOHU HW DO f FRQFOXGHG WKDW WKH PLWRFKRQGULDO 62' PD\ UHVSRQG WR FKDQJHV LQ WKH DFWLYLW\ RI UHVSLUDWRU\ HOHFWURQ WUDQVSRUW EHFDXVH WKH LQGXFWLRQ RI WKLV HQ]\PH LQ WREDFFR FRUUHODWHG ZLWK LQFUHDVHG DFWLYLW\ IRU F\WRFKURPH R[LGDVH ,Q DGGLWLRQ R[LGDWLYH VWUHVV LQ RQH FRPSDUWPHQW FDQ OHDG WR WKH LQGXFWLRQ RI IUHH UDGLFDO VFDYHQJHUV LQ DQRWKHU SDUW RI WKH FHOO 7KLV ZDV VKRZQ ZKHQ SDUDTXDW

PAGE 19

ZKLFK LV WKRXJKW WR DFW PDLQO\ RQ FKORURSODVWV ZDV DSSOLHG WR WREDFFR DQG FDXVHG D VWURQJ LQGXFWLRQ RI 62' WUDQVFULSW LQ WKH PLWRFKRQGULD F\WRSODVP DQG FKORURSODVW 7VDQJ HW DO f 7KH OHYHO WR ZKLFK 62' LV LQGXFHG ZLWKLQ D FHOOXODU FRPSDUWPHQW PD\ GHSHQG RQ WKH DPRXQW RI 62' WKDW LV FXUUHQWO\ SUHVHQW 7KLV ZDV WKH H[SODQDWLRQ RI 3HUO 7UHYHV DQG *DOXQ f ZKHQ WKH\ IRXQG WKDW WKH DGGLWLRQ RI SDUDTXDW UHVXOWHG LQ D JUHDWHU LQGXFWLRQ RI WKH F\WRSODVPLF 62' LQ FRPSDULVRQ WR WKH SODVWLG PHVVDJH LQ WRPDWR OHDYHV 7KH OHYHO RI SODVWLGLDO HQ]\PH DFWLYLW\ LQ PDWXUH OHDYHV LV DOUHDG\ KLJK LQ FRPSDULVRQ ZLWK WUDQVFULSW OHYHO 7KH\ VXJJHVWHG WKDW LQGXFWLRQ RI SODVWLGLDO 62' WUDQVFULSW PD\ WKHUHIRUH EH XQQHFHVVDU\ (WK\OHQH KDV EHHQ VKRZQ WR LQGXFH F\WRSODVPLF DQG SODVWLGLDO 62' WUDQVFULSWV DQG HQ]\PH DFWLYLW\ LQ WRPDWR OHDYHV 3HUO7UHYHV DQG *DOXQ f DQG PLWRFKRQGULDO 62' PHVVDJH LQ WREDFFR OHDYHV %RZOHU HW DO f ,Q UHVSRQVH WR HWK\OHQH WKHUHIRUH DQ LQFUHDVH LQ UHDFWLYH R[\JHQ VSHFLHV KDV EHHQ QRWHG DQG HQ]\PHV ZLWKLQ DOO WKUHH FHOOXODU FRPSDUWPHQWV FDQ EH DIIHFWHG )UHH UDGLFDO VFDYHQJHUV LQ ULSHQLQJ IUXLW 7KH UROH RI IUHH UDGLFDO VFDYHQJHUV GXULQJ IUXLW ULSHQLQJ KRZHYHU LV VRPHZKDW FRQIXVLQJ 3HUR[LGDVH KDV EHHQ VKRZQ WR GHFUHDVH GXULQJ ULSHQLQJ 5DELQRZLWFK HW DO f RU SHDN GXULQJ WKH SLQN VWDJH LQ WRPDWR IUXLW 5RWKDQ DQG 1LFRODV f 3HUKDSV WKH WHFKQLTXHV XVHG E\ 5DELQRZLWK HW DO f ZHUH QRW VHQVLWLYH HQRXJK WR GHWHFW WKLV SHDN RI DFWLYLW\ 7KH WUDQVLHQW LQFUHDVH LQ EDVLF SHUR[LGDVH DFWLYLW\ SDUDOOHOHG WKH LQFUHDVH LQ HWK\OHQH 5RWKDQ DQG 1LFRODV f 6LQFH WKH FRQYHUVLRQ

PAGE 20

RI DPLQRF\FORSURSDQHOFDUER[\ODWH $&&f WR HWK\OHQH UHTXLUHV R[\JHQ WKLV PD\ OHDG WR D WUDQVLHQW LQFUHDVH LQ UHDFWLYH R[\JHQ PROHFXOHV DQG DQ LQFUHDVH LQ WKLV IUHH UDGLFDO VFDYHQJHU &KDQJHV LQ 62' KDYH EHHQ UHSRUWHG GXULQJ WRPDWR IUXLW ULSHQLQJ EXW UHVXOWV ZHUH FRQWUDGLFWRU\ 62' DFWLYLW\ KDV EHHQ IRXQG WR SHDN DW WKH SLQN RU RUDQJH SKDVH 5DELQRZLWFK HW DO /LYLQH DQG *HSVWHLQ f +RZHYHU QR FKDQJH LQ WKH WZR SODVWLGLDO 62' LVR]\PHV ZDV UHSRUWHG E\ 3HUO7UHYHV DQG *DOXQ f QRU ZDV D SHDN RI WKH F\WRSODVPLF RU SODVWLGLDO 62' PHVVDJH QRWHG GXULQJ ULSHQLQJ ,Q IDFW WKH\ IRXQG WKDW WKH SODVWLGDVVRFLDWHG PHVVDJH DFWXDOO\ GHFUHDVHG ZLWK PDWXUDWLRQ 7KH\ H[SODLQ WKHVH FRQWUDGLFWRU\ UHVXOWV E\ VXJJHVWLQJ WKDW WKH HQ]\PH FRXOG EH TXLWH VWDEOH DQG WXUQRYHU YHU\ VORZO\ ,W LV KDUG WR H[SODLQ DOO RI WKH YDULHG GDWD UHSRUWHG E\ WKHVH WKUHH JURXSV 0RUH ZRUN QHHGV WR EH GRQH EHIRUH D FRQFOXVLRQ FDQ EH PDGH DERXW IUHH UDGLFDO VFDYHQJHUV DQG ULSHQLQJ LQ WRPDWR IUXLW 6LQFH WKH PHVVDJHV IRU WKH DGGLWLRQDO SODVWLGLDO DQG F\WRSODVPLF 62'V KDYH QRW EHHQ H[DPLQHG SHUKDSV WKHVH DGGLWLRQDO GDWD ZLOO KHOS UHFRQFLOH WKHVH GLVVLPLODU REVHUYDWLRQV 3HSSHU FKURPRSODVWV GR DSSHDU WR UHVSRQG WR DQ R[LGDWLYH VWUHVV GXULQJ IUXLW PDWXUDWLRQ 5RPHU HW DO f 7KH DQWLR[LGDQW SURGXFLQJ HQ]\PH F\VWHLQH V\QWKDVH ZDV SXULILHG DQG D F'1$ ZDV LVRODWHG 7KH\ IRXQG QRW RQO\ GLG WKLV HQ]\PH LQFUHDVH GXULQJ ULSHQLQJ EXW WKH DFWLYLW\ RI JOXWDWKLRQH UHGXFWDVH JOXWDWKLRQH V\QWKHWDVH DQG JOXWDWKLRQH FRQWHQW ZLWKLQ FKURPRSODVWV DOVR LQFUHDVHG GXULQJ WKHLU GHYHORSPHQW 6LQFH DOO WKHVH FRPSRXQGV SURWHFW RUJDQLVPV IURP R[LGDWLYH GDPDJH DQG DQ LQFUHDVH LQ DWRFRSKHURO DOVR RFFXUV GXULQJ ULSHQLQJ WKH\ FRQFOXGHG WKDW WKHVH LQFUHDVHV LQ

PAGE 21

DQWLR[LGDQWV DQG SHUR[LGH VFDYHQJLQJ FRPSRXQGV PD\ DOORZ SURWHFWLRQ RI WKH RYHUDFFXPXODWHG FDURWHQRLGV DQG RWKHU PHPEUDQH FRPSRQHQWV IURP R[LGDWLYH VWUHVV 6LQFH WKH UHVXOWV IURP WRPDWR IUXLW RQ WKH LQGXFWLRQ RI IUHH UDGLFDO VFDYHQJHUV LV FRQWUDGLFWRU\ LQIRUPDWLRQ IURP RWKHU V\VWHPV PD\ KHOS SUHGLFW ZKDW RFFXUV LQ WRPDWR IUXLW FKURPRSODVWV /HDI WLVVXH UHVSRQGV WR DQ LQFUHDVHV LQ EDVDO PHWDEROLVP DQG WKH DGGLWLRQ RI HWK\OHQH E\ LQGXFLQJ 62' %RZOHU HW DO 3HUO7UHYHV DQG *DOXQ f ,Q DGGLWLRQ D FRPSRXQG H[SHFWHG WR DIIHFW SUHGRPLQDQWO\ RQH FRPSDUWPHQW FDQ LQGXFH 62' LQ RWKHU SRUWLRQV RI WKH FHOO 7VDQJ HW DO f )LQDOO\ WKH OHYHO RI LQGXFWLRQ PD\ EH GHSHQGHQW RQ FXUUHQW OHYHOV RI HQ]\PH DFWLYLW\ 3HUO7UHYHV DQG *DOXQ f 3HUKDSV WKH UHVXOWV IURP SHSSHU FKURPRSODVWV ZKHUH LQFUHDVHV LQ D QXPEHU RI WKHVH IUHH UDGLFDO VFDYHQJHUV KDV EHHQ PHDVXUHG H[SODLQV KRZ WKH FKURPRSODVW XQOLNH WKH SODVPD PHPEUDQH DYRLGV R[LGDWLYH GDPDJH DQG PDLQWDLQV PHPEUDQH LQWHJULW\ :KLWDNHU 5RPHU HW DO f 2QH PLJKW SUHGLFW WKDW WKH SODVWLG FDQ UHVSRQG WR DQ HQYLURQPHQW WKDW FRQWDLQV DQ LQFUHDVLQJ DPRXQW RI UHDFWLYH R[\JHQ DQG FRQVHTXHQWO\ LW LV DEOH WR PDLQWDLQ FKURPRSODVW PHPEUDQH LQWHJULW\ GXULQJ ULSHQLQJ 7KHVH GDWD DOVR VXJJHVW WKDW WKH SURGXFWLRQ RI HWK\OHQH DQGRU WKH UHVSLUDWRU\ FOLPDFWHULF PD\ LQGXFH WKH SURGXFWLRQ RI FKURPRSODVWDVVRFLDWHG SURWHLQV LQYROYHG LQ IUHH UDGLFDO VFDYHQJLQJ &KDQJHV LQ 3ODVWLG 6WUXFWXUH 0DVVLYH FKDQJHV WDNH SODFH LQ SODVWLG XOWUDVWUXFWXUH GXULQJ WKH FKORURSODVW WR FKURPRSODVW WUDQVLWLRQ 7KH WK\ODNRLG PHPEUDQHV DUH GLVPDQWOHG DQG FKORURSK\OO

PAGE 22

GHJUDGHV 7KHODQGHU HW DO f &RQFRPLWDQWO\ O\FRSHQH EHJLQV WR DFFXPXODWH LQ WKH VWURPD 7KH JUHHQ IOHVK PXWDQW ZKLFK LV LQKLELWHG LQ FKORURSK\OO GHJUDGDWLRQ GXULQJ ULSHQLQJ LV KHOSIXO LQ WKH GHWHUPLQDWLRQ RI KRZ SLJPHQW DFFXPXODWHV LQ WKH GHYHORSLQJ FKURPRSODVW (OHFWURQ PLFURJUDSKV VKRZ WKDW WKH JUDQDO VWDFNV SHUVLVW LQ WKLV PXWDQW HYHQ DV SLJPHQW LV GHSRVLWHG *RRGZLQ f DQG VXJJHVWV WKDW O\FRSHQH EXLOGV XS DURXQG WKH GLVLQWHJUDWLQJ WK\ODNRLGV %\ WKH WLPH D QRUPDO WRPDWR LV IXOO\ ULSH WKH FKURPRSODVWV FRQWDLQ OLWWOH HOVH EXW ODUJH VWRUHV RI O\FRSHQH ZKLFK DFFXPXODWH DV OLSRSKLOLF JOREXOHV DQG FU\VWDOV RI SLJPHQW +DUULV DQG 6SXUU f 7KH W\SH RI FKURPRSODVW WKDW GHYHORSV PD\ EH GHSHQGHQW RQ WKH W\SH RI FDURWHQRLGV WKDW DFFXPXODWH 7KH 9 PXWDQW IRU H[DPSOH ZLWK LWV ORZ OHYHO RI ERWK O\FRSHQH DQG FDURWHQH FRQWDLQV RQO\ SODVWRJOREXOHV *RRGZLQ f 5HJXODWLRQ RI 3KRWRV\QWKHWLF 3URWHLQV 7UDQVFULSWV IRU WKH QXFOHDUHQFRGHG FRPSRQHQWV RI SKRWRV\QWKHVLV GHFUHDVH ORQJ EHIRUH WKH EUHDNGRZQ RI WKH WK\ODNRLG PHPEUDQHV 7KH P51$ IRU UEF6 DQG FDE 5XELVFR VPDOO VXEXQLW DQG FKORURSK\OO DE ELQGLQJ SURWHLQ UHVSHFWLYHO\f DUH QRW GHWHFWHG DIWHU GD\V SRVW DQWKHVLV 3LHFKXOOD HW DO f 7KLV ORVV RI QXFOHDU WUDQVFULSWV RFFXUV WR GD\V EHIRUH 0* DQG SUHFHGHV WKH HQG RI FKORURSK\OO V\QWKHVLV DQG WKH GLVDVVHPEO\ RI WKH WK\ODNRLG PHPEUDQHV E\ ZHHNV 7KH SODVWLG HQFRGHG PHVVDJHV UEF/ DQG SVE$ 5XELVFR ODUJH VXEXQLW DQG WKH N' SKRWRV\VWHP ,, SURWHLQf KRZHYHU SHUVLVW WKURXJKRXW GHYHORSPHQW 3LHFKXOOD HW DO f 0RVW RI WKH RWKHU SODVWLG WUDQVFULEHG SURWHLQV VXFK DV WKH SKRWRV\VWHP

PAGE 23

, DQG ,, SURWHLQV SVD$ SVE% SVE& RU SVE'f DOO GLPLQLVK LQ PHVVDJH OHYHOV WKURXJKRXW GHYHORSPHQW 2QFH ULSHQLQJ KDV SURJUHVVHG WR DQ LQWHUPHGLDWH VWDJH RI GHYHORSPHQW EH\RQG PDWXUH JUHHQ OHYHOV RI SKRWRV\QWKHWLF DFWLYLW\ KDYH JUHDWO\ GLPLQLVKHG DQG WKLV LV UHIOHFWHG LQ GHFUHDVHG DPRXQWV RI SKRWRV\QWKHWLF SURWHLQV )RU H[DPSOH E\ WKH \HOORZ VWDJH RI GHYHORSPHQW WKH DPRXQW RI /+&3 SURWHLQ KDV GHFOLQHG WR b RI WKH OHYHO SUHVHQW LQ ,0* IUXLW /LYLQH DQG *HSVWHLQ f $W WKH \HOORZRUDQJH VWDJH WKH OHYHO RI 5XELVFR DFWLYLW\ KDV GLPLQLVKHG WR b RI WKH OHYHO SUHVHQW DW 0* 3LHFKXOOD HW DO f ZKLOH WKH DPRXQW RI PHDVXUDEOH SURWHLQ IRU WKH ODUJH VXEXQLW KDV DOVR GHFUHDVHG 7KH OHYHO RI SKRWRV\QWKHWLF HOHFWURQ WUDQVSRUW KDV GHFUHDVHG WR b RI ZKDW ZDV REVHUYHG DW 0* 3LHFKXOOD HW DO f 2QO\ SODVWRF\DQLQ DQG WKH N' SURWHLQ ZHUH GHWHFWHG E\ WKLV VWDJH RI GHYHORSPHQW 7KHVH GDWD XQGHUVFRUH WKH GUDPDWLF FKDQJH LQ WKH SURWHLQ FRPSRQHQWV RI WKH SODVWLG WKDW RFFXUV EHWZHHQ PDWXUH JUHHQ DQG WKLV LQWHUPHGLDWH VWDJH RI ULSHQLQJ ,W LV XQFOHDU IURP WKLV W\SH RI DQDO\VLV ZKHWKHU WKH ORVV RI SKRWRV\QWKHWLF SURWHLQV LV VLPSO\ GXH WR D GHFUHDVH LQ V\QWKHVLV RU LV DOVR FDXVHG E\ DQ HQKDQFHG SURGXFWLRQ RI GHJUDGDWLYH HQ]\PHV ([DPLQDWLRQ RI SODVWLG JHQH H[SUHVVLRQ GXULQJ FKURPRSODVW GHYHORSPHQW KDV VKRZQ D UHGXFWLRQ LQ WKH OHYHO RI SODVWLG WUDQVFULSW GXULQJ WKLV SURFHVV ,W LV XQFHUWDLQ ZKHWKHU WKLV LV WKH UHVXOW RI SRVWWUDQVFULSWLRQDO UHJXODWLRQ *UXLVVHP HW DO 0DUDR DQG &DULOOR f RU ZKHWKHU WKH UDWH RI WUDQVFULSWLRQ LV GHFUHDVHG GXH WR PHWK\ODWLRQ RI WKH SODVWLG JHQRPH 1JHUQSUDVLUWVLUL HW DO .RED\DVKL HW DO

PAGE 24

f 7KH OHYHO RI WUDQVODWLRQ LV DOVR GUDPDWLFDOO\ UHGXFHG LQ &DSVLFXP SODVWLGV .XQW] HW DO f ZKHUH XOWUDVWUXFWXUDO DQDO\VLV KDV VKRZQ WKDW UHG IUXLW FRQWDLQ QR ULERVRPHV RU U51$ &DUGH HW DO f 5LFKDUGV HW DO f KDYH LGHQWLILHG D SODVWLG WUDQVFULSW WKDW LV PRUH DEXQGDQW LQ FKURPRSODVW 51$ WKDQ FKORURSODVW 51$ RI WRPDWR IUXLW +RZHYHU JLYHQ WKH ODFN RI IXQFWLRQDO WUDQVODWLRQ LQ SHSSHU FKURPRSODVWV DQG WKH GHFUHDVHG DPRXQW RI WUDQVFULSWV SUHVHQW LQ WRPDWR FKURPRSODVWV LW LV H[SHFWHG WKDW PRVW SURWHLQV WKDW DUH LQFUHDVLQJO\ SUHVHQW LQ FKURPRSODVWV ZLOO EH QXFOHDUHQFRGHG 7KH 5ROH RI (WK\OHQH LQ 7RPDWR )UXLW 5LSHQLQJ 7KH ULVH LQ HWK\OHQH GXULQJ WKH FOLPDFWHULF LV PHGLDWHG E\ GH QRYR V\QWKHVLV RI DW OHDVW WKH ILQDO WZR HQ]\PHV LQ WKH ELRV\QWKHWLF SDWKZD\ +ROGVZRUWK HW DO 2OVRQ HW DO 5RWWPDQQ HW DO f 7R GDWH RQO\ WKH JHQHV IRU WKH HQ]\PHV WKDW FDWDO\]H WKHVH ILQDO WZR VWHSV LQ HWK\OHQH ELRV\QWKHVLV KDYH EHHQ LVRODWHG (WK\OHQH LV V\QWKHVL]HG IURP PHWKLRQLQH YLD 6DGHQRV\O/PHWKLRQLQH DQG DPLQRF\FORSURSDQHOFDUER[\OLF DFLG $&&f 7KH HQ]\PH WKDW V\QWKHVL]HV $&& $&& V\QWKDVHf LV WKRXJKW WR EH D S\ULGR[DO fSKRVSKDWH XWLOL]LQJ HQ]\PH
PAGE 25

GXULQJ ULSHQLQJ LQ WRPDWR DQG DYRFDGR IUXLW +ROGVZRUWK HW DO 0F*DUYH\ HW DO f DQG GXULQJ WKH VHQHVFHQFH RI FDUQDWLRQ SHWDOV :DQJ DQG :RRGVRQ f 3URGXFWLRQ RI WUDQVJHQLF WRPDWR SODQWV WKDW FRQWDLQ DQWLVHQVH WUDQVFULSWV IRU WKH HQ]\PH $&& V\QWKDVH KDV VKRZQ WKDW ULSHQLQJ LQYROYHV ERWK HWK\OHQH GHSHQGHQW DQG LQGHSHQGHQW SDWKZD\V 7KHRORJLV f $ QXPEHU RI ODERUDWRULHV KDYH SURGXFHG WUDQVJHQLF WRPDWR SODQWV ZLWK UHGXFHG OHYHOV RI HWK\OHQH +DPLOWRQ HW DO .OHH HW DO 2HOOHU HW DO f 7KH PRVW GUDPDWLF GHFUHDVH RFFXUUHG LQ D WUDQVJHQLF SODQW FDUU\LQJ WHQ DQWLVHQVH FRSLHV RI SDUW RI D JHQH IRU $&& V\QWKDVH 7KH DXWKRUV UHSRUWHG WKDW WKH SODQW KDV D b UHGXFWLRQ LQ WKH OHYHO RI HWK\OHQH 2HOOHU HW DO f DQG SURGXFHV IUXLW WKDW UHPDLQ ILUP DQG JUHHQ XQWLO H[RJHQRXV HWK\OHQH LV DSSOLHG ,I QR HWK\OHQH LV DGGHG WKH PXWDQW IUXLW VWLOO H[SUHVV 51$ IRU WKH ULSHQLQJ LQGXFHG FHOO ZDOO VRIWHQLQJ HQ]\PH SRO\JDODFWXURQDVH 3*f 2HOOHU HW DO f 7KLV UHVXOW ZDV XQH[SHFWHG EHFDXVH HWK\OHQH LV UHTXLUHG IRU WKH H[SUHVVLRQ RI 3* 7KLV VXJJHVWV WKDW WKH UHJXODWLRQ RI ULSHQLQJ E\ HWK\OHQH LV PRUH FRPSOH[ WKDQ MXVW VLPSOH WUDQVFULSWLRQDO FRQWURO :KLOH WKH WUDQVFULSWLRQ RI 3* LV HWK\OHQH LQGHSHQGHQW WKH H[SUHVVLRQ RI WKH HQ]\PH LV GHSHQGHQW RQ WKH FRQWLQXHG SUHVHQFH RI WKLV KRUPRQH 7UDQVFULSWLRQDO 5HJXODWLRQ RI )UXLW 5LSHQLQJ $ PROHFXODU DQDO\VLV RI IUXLW ULSHQLQJ LQ WRPDWR KDV OHG WR WKH FRQFOXVLRQ WKDW WKH GH QRYR V\QWKHVLV RI ULSHQLQJ VSHFLILF SURWHLQV RFFXUV DQG LV UHVSRQVLEOH IRU PDQ\ RI WKH FKDQJHV DVVRFLDWHG ZLWK PDWXUDWLRQ 6HYHUDO UHVHDUFKHUV KDYH FKDUDFWHUL]HG

PAGE 26

FKDQJHV LQ WKH SURILOH RI LQ YLWUR WUDQVODWLRQ SURGXFWV WKDW RFFXU GXULQJ GHYHORSPHQW RI WRPDWR IUXLW 5DWWDQDSDQRQH HW DO 6SHLUV HW DO %LJJV HW DO /LQFROQ HW DO f $ QXPEHU RI JURXSV KDYH FRQVWUXFWHG F'1$ OLEUDULHV HQULFKHG LQ ULSHQLQJ VSHFLILF VHTXHQFHV 0DQQVVRQ HW DO DQG 6ODWHU HW DO /LQFROQ HW DO f *HQHUDOO\ WKH RQVHW RI ULSHQLQJ LQ WRPDWR IUXLW LV PHGLDWHG E\ DQ LQFUHDVH LQ D VSHFLILF VXEVHW RI WUDQVFULSWV LQFOXGLQJ WKRVH IRU 3* ()( DQG $&& V\QWKDVH 'HOOD3HQQD HW DO *ULHUVRQ HW DO +ROGVZRUWK HW DO 2OVRQ HW DO 5RWWPDQ HW DO f ([DPLQDWLRQ RI WKH FORQHV LVRODWHG E\ *ULHUVRQfV JURXS KDV VKRZQ WKDW IRU PRVW RI WKHLU F'1$V 51$ IDLOV WR DFFXPXODWH ZKHQ WKH IUXLW LV KHOG DW KLJK WHPSHUDWXUH 3LFWRQ DQG *ULHUVRQ f +LJK WHPSHUDWXUH r&f KDV DQ LQKLELWRU\ HIIHFW RQ IUXLW ULSHQLQJ GHSUHVVLQJ WKH V\QWKHVLV RI O\FRSHQH 3* DQG HWK\OHQH 3LFWRQ DQG *ULHUVRQ f 3HUKDSV WKLV HIIHFW RI KLJK WHPSHUDWXUH UHSUHVHQWV D KHDW VKRFN UHVSRQVH 3LFWRQ DQG *ULHUVRQ f 7KLV ZDV QRW DQ RYHUDOO HIIHFW IRU DOO FORQHV KRZHYHU VLQFH 51$ LQFUHDVHG LQLWLDOO\ IRU VRPH FORQHV LQ UHVSRQVH WR DQ LQFUHDVH LQ WHPSHUDWXUH 8QIRUWXQDWHO\ PDQ\ RI WKHVH FORQHV KDYH \HW WR EH DVVLJQHG D IXQFWLRQ 3URFHVVHV $VVRFLDWHG ZLWK &KURPRSODVW 'HYHORSPHQW 8SRQ UHYLHZ RI WKH ZRUN FKDUDFWHUL]LQJ WKH PROHFXODU FKDQJHV WKDW RFFXU GXULQJ WKH FKORURSODVW WR FKURPRSODVW WUDQVLWLRQ LW LV QRWDEOH WKDW PDLQO\ SKRWRV\QWKHWLF SURWHLQV KDYH EHHQ H[DPLQHG GXULQJ WKLV SKDVH 3LHFKXOOD HW DO

PAGE 27

/LYLQH DQG *HSVWHLQ f 7R XQGHUWDNH WKH LQYHVWLJDWLRQ RI SURWHLQV WKDW LQFUHDVH GXULQJ FKURPRSODVW GHYHORSPHQW D PHWKRG PXVW EH IRXQG WR LGHQWLI\ SURWHLQV VSHFLILF WR WKLV SURFHVV ,VRODWLRQ RI FKURPRSODVWV DQG WKH VXEVHTXHQW FRPSDULVRQ RI SURWHLQV RQ 6'63$*( IURP GLIIHUHQW GHYHORSPHQWDO VWDJHV KDV EHHQ DWWHPSWHG DQG SURWHLQV WKDW LQFUHDVH LQ DPRXQW KDYH EHHQ LGHQWLILHG ,ZDWVXNL HW DO %DWKJDWH HW DO :UHQFK HW DO +DGMHE HW DO f 8VLQJ WKLV PHWKRG VSHFLILF FKURPRSODVWDVVRFLDWHG SURWHLQV KDYH EHHQ LVRODWHG IURP RQO\ SHSSHU FKURPRSODVWV +DGMHE HW DO f $QWLERG\ KDV EHHQ SXULILHG IRU WZR SURWHLQV WKDW LQFUHDVH GXULQJ &DSVLFXP FKURPRSODVW GHYHORSPHQW 1HZPDQ HW DO f 2QH RI WKHVH SURWHLQV ELQGV FDURWHQRLGV DQG LV D PDMRU FRQVWLWXHQW RI &DSVLFXP FKURPRSODVW PHPEUDQHV &HUYDQWHV&HUYDQWHVHW DO f +RZHYHU WKLV SURWHLQ SUREDEO\ ELQGV FDSVDQWKLQ VLQFH WKH DQWLERG\ GRHV QRW UHDFW WR DQ\ SURWHLQ SUHVHQW LQ FKORURSODVWV RU WRPDWR IUXLW FKURPRSODVWV &HUYDQWHV&HUYDQWHV HW DO f :KLOH WKLV W\SH RI DSSURDFK KDV UHVXOWHG LQ WKH FKDUDFWHUL]DWLRQ RI D IHZ SURWHLQV LQYROYHG LQ FKURPRSODVW IXQFWLRQ RQO\ DEXQGDQW SURWHLQV FDQ EH LGHQWLILHG LQ WKLV PDQQHU 7KH SODVWLG LV LQYROYHG LQ WKH V\QWKHVLV RI PDQ\ FRPSRXQGV QHFHVVDU\ IRU FHOO IXQFWLRQ )RU H[DPSOH WKH V\QWKHVLV RI IDWW\ DFLGV DURPDWLF DPLQR DFLGV DQG RWKHU VXEVWDQFHV VXFK DV 6DPLQROHYXOLQLF DFLG KDYH DOO EHHQ ORFDOL]HG WR SODVWLGV 0DQ\ RI WKHVH FRPSRXQGV DUH SUHFXUVRUV WR D ZLGH DUUD\ RI VHFRQGDU\ PHWDEROLWHV VR LW LV SRVVLEOH WKDW DQ LQFUHDVHG V\QWKHVLV RI WKHVH SODVWLGV\QWKHVL]HG FRPSRXQGV LV UHTXLUHG GXULQJ FKURPRSODVW GHYHORSPHQW $ UHFHQW UHYLHZ E\ +UD]GLQD DQG -HQVHQ

PAGE 28

f KRZHYHU GRFXPHQWHG WKDW LQ PDQ\ LQVWDQFHV LVR]\PHV IRU WKH V\QWKHVLV RI DPLQR DFLGV LQYROYHG LQ VHFRQGDU\ PHWDEROLVP PD\ EH SUHVHQW LQ WKH F\WRSODVP UDWKHU WKDQ LQ WKH SODVWLGV 0RUH LQIRUPDWLRQ RQ WKH FRPSDUWPHQWDOL]DWLRQ RI WKHVH SDWKZD\V LV QHHGHG EHIRUH FRQFOXVLRQV DERXW WKH ORFDOL]DWLRQ RI HQ]\PHV IRU VHFRQGDU\ PHWDEROLVP FDQ EH GUDZQ &DURWHQRLGV (Q]\PHV UHVSRQVLEOH IRU WKH V\QWKHVLV RI FDURWHQRLGV DUH REYLRXVO\ WKH PRVW OLNHO\ FDQGLGDWHV IRU SURWHLQV WKDW PD\ EH LQFUHDVLQJO\ SURGXFHG GXULQJ FKURPRSODVW GHYHORSPHQW 7KHUHIRUH LW LV QHFHVVDU\ WR FRQVLGHU ZKDW HQ]\PHV DQG FRIDFWRUV PD\ EH LQYROYHG LQ WKLV SDWKZD\ DQG KRZ LW PD\ EH UHJXODWHG &DURWHQRLG IXQFWLRQ ,Q WKH FKORURSODVW FDURWHQRLGV DUH DQ LQWHJUDO SDUW RI WKH SKRWRV\QWKHWLF DSSDUDWXV ZKHUH WKH\ DFW DV DFFHVVRU\ SLJPHQWV IXQQHOLQJ OLJKW HQHUJ\ LQWR WKH UHDFWLRQ FHQWHUV ,I OLJKW LQWHQVLW\ EHFRPHV WRR JUHDW WKH SKRWRV\QWKHWLF FDURWHQRLGV FDQ DOVR WUDS H[FHVVLYH OLJKW HQHUJ\ :LWKRXW WKHVH SHULSKHUDO SLJPHQWV WKH SODQWV PD\ SKRWREOHDFK 0D\ILHOG HW DO f 7KH QHFHVVLW\ RI FDURWHQRLGV WR IRUHVWDOO WKLV GHOHWHULRXV HYHQW LV DSSDUHQW ZKHQ V\QWKHVLV RI FDURWHQRLGV LV EORFNHG E\ LQKLELWRUV RU PXWDWLRQ $QRWKHU IXQFWLRQ RI FDURWHQRLGV KRZHYHU LV WKH SLJPHQWDWLRQ RI PDQ\ IORZHUV DQG IUXLWV 0RVW RI WKH RUDQJH \HOORZ RU UHG SLJPHQWV IRXQG LQ WKHVH WLVVXHV FDQ EH DWWULEXWHG WR FDURWHQRLGV ZKLFK DFFXPXODWH LQ WKH FKURPRSODVWV

PAGE 29

&DURWHQRLG VWUXFWXUH &DURWHQRLGV DUH ORQJ FKDLQ K\GURFDUERQV 7KH FRQMXJDWHG GRXEOH ERQGV JLYH WKHP WKHLU FRORU 7KH V\QWKHWLF SDWKZD\ SURGXFHV FDURWHQHV [DQWKRSK\OOV DQG DEVFLVVLF DFLG 7KH GHVDWXUDWLRQV WKDW RFFXU LQ WKH ELRV\QWKHVLV RI FDURWHQRLGV FDQ FUHDWH HLWKHU D FLV RU WUDQV FRQILJXUDWLRQ &\FOL]DWLRQ DW RQH RU ERWK HQGV FDQ RFFXU *RRGZLQ f $ EHWD HSVLORQ RU JDPPD ULQJ IRUPV EDVHG RQ WKH SRVLWLRQ RI WKH GRXEOH ERQG *RRGZLQ f 7KH HQG JURXSV FDQ EH DF\FOLF LQ WKH FDVH RI O\FRSHQH ,I WKH SLJPHQW LV D ORQJ FKDLQ K\GURFDUERQ WKHQ LW LV D FDURWHQH ;DQWKRSK\OOV RQ WKH RWKHU KDQG DUH FDURWHQRLGV WKDW FRQWDLQ R[\JHQ $ QXPEHU RI GLIIHUHQW PRGLILFDWLRQV DUH SRVVLEOH WR WKLV EDVLF ORQJ K\GURFDUERQ FKDLQ GLIIHUHQW VWUXFWXUHV KDYH EHHQ GHVFULEHG 7KH FRPSOHPHQW RI FDURWHQRLGV IRXQG LQ JUHHQ OHDYHV DUH UHODWLYHO\ XQLIRUP WKURXJKRXW WKH KLJKHU SODQW NLQJGRP *RRGZLQ DQG 0HUFHU f 7KLV PD\ EH H[SHFWHG FRQVLGHULQJ WKH LPSRUWDQFH WKHVH FRPSRXQGV SOD\ LQ SKRWRV\QWKHVLV DQG WKH FRQVHUYDWLRQ RI VWUXFWXUH UHTXLUHG RI WKH SURWHLQV DQG SLJPHQWV RI WKH WK\ODNRLG PHPEUDQHV +RZHYHU ZLGH VWUXFWXUDO YDULHW\ RFFXUV LQ FDURWHQRLGV IRXQG LQ SHWDOV DQG IUXLW 7KH W\SH RI PROHFXOH WKDW DFFXPXODWHV LV VSHFLHV GHSHQGHQW &DURWHQRLG V\QWKHVLV 7KH EDVLF VFKHPH IRU WKH V\QWKHVLV RI KLJKHU SODQW FDURWHQRLGV LV VKRZQ LQ )LJXUH 7KH SURGXFWLRQ RI SK\WRHQH UHSUHVHQWV WKH ILUVW FRPPLWWHG VWHS LQ WKH V\QWKHVLV RI FDURWHQRLGV 8VXDOO\ VWHSZLVH GHVDWXUDWLRQ RI SK\WRHQH OHDGV WR DOO WUDQVO\FRSHQH 7KH QRUPDO SURGXFW RI SK\WRHQH V\QWKDVH LV FLVSK\WRHQH :KHUH

PAGE 30

GRHV WKH FLVWUDQV LVRPHUL]DWLRQ WDNH SODFH" %H\RQG ]HWDFDURWHQH WUDQV LQWHUPHGLDWHV DUH LQYROYHG )RXU VWHSZLVH UHPRYDOV RI K\GURJHQ PROHFXOHV RFFXU IURP SK\WRHQH WR O\FRSHQH DV R[\JHQ LV UHGXFHG LQ WKLV UHDFWLRQ 3URWRQ DWWDFN RI WKH &O GRXEOH ERQG RI O\FRSHQH LV LQYROYHG LQ WKH IRUPDWLRQ RI WKH ULQJ VWUXFWXUHV 'LIIHUHQW HQ]\PHV DUH UHVSRQVLEOH IRU WKH GLIIHUHQW ULQJV WKDW DUH IRUPHG /LWWOH LQWHUFRQYHUVLRQ RI WKHVH ULQJV RFFXUV ;DQWKRSK\OO IRUPDWLRQ UHVXOWV IURP WKH DGGLWLRQ RI K\GUR[\O JURXSV /RFDWLRQ RI FDURWHQRLG ELRV\QWKHVLV :KHUH DUH WKH HQ]\PHV RI FDURWHQRLG V\QWKHVLV ORFDWHG" $OO DFWLYLWLHV DIWHU WKH V\QWKHVLV RI LVRSHQW\O S\URSKRVSKDWH ,33f KDYH EHHQ VKRZQ WR RFFXU LQ WKH SODVWLGV *UD\ f &RPSDUWPHQWDOL]DWLRQ RI WKH HQ]\PH DFWLYLW\ KDV EHHQ EHVW DQDO\]HG LQ FKORURSODVWV DV RSSRVHG WR FKURPRSODVWV VLQFH WKH\ DUH PRVW DPHQDEOH WR IUDFWLRQDWLRQ 0D\ILHOG f H[DPLQHG WKH FKORURSODVWV RI VSLQDFK DQG FRQFOXGHG WKDW SK\WRHQH GHVDWXUDVH LV ORFDWHG RQ WKH LQQHU HQYHORSH PHPEUDQH 8OWUDVWUXFWXUDO H[DPLQDWLRQ RI GHYHORSLQJ FKURPRSODVWV VXJJHVWV WKDW SLJPHQWV DVVRFLDWH ZLWK PHPEUDQH DV WKH\ DUH SURGXFHG LQ WKH LQQHU HQYHORSH ZKLFK LV IROORZHG E\ YHVLFXODWLRQ RI WKLV PHPEUDQH SLJPHQW FRPSOH[ &DPDUD DQG %UDQJHRQ f ,Q DGGLWLRQ H[DPLQDWLRQ RI WKH OLSLG FRPSRQHQW RI WKHVH PHPEUDQHV FRQILUPV WKDW WKH\ DUH D SURGXFW RI WKH LQQHU HQYHORSH 6LWWH HW DO f *HQHWLF VWXGLHV KDYH PDSSHG DOO WKH NQRZQ WRPDWR PXWDQWV WR WKH QXFOHDU JHQRPH 7RPDWR *HQHWLF &RRSHUDWLYH 5HSRUW f ZKLFK VXJJHVWV WKDW WKH JHQHV LQYROYHG LQ WKH V\QWKHVLV RI FDURWHQRLGV DUH QXFOHDUHQFRGHG )XUWKHUPRUH LQKLELWLRQ

PAGE 31

,VRSHQWHQ\O S\URSKRVSOLRLH 7UDQV &DURWHQH 3URQHRURVSRUHQH 1HXURVSRUHQH 3URO\FRSHQH /\FRSHQH n$ &RUROHQH \6 A \ &RUROHQH \ !2YAY9YA A \Y [ !YY8$$
PAGE 32

RI SODVWLG WUDQVODWLRQ KDV GHPRQVWUDWHG WKDW WKLV SURFHVV LV QRW QHFHVVDU\ IRU FDURWHQRLG DFFXPXODWLRQ &DPDUD f )LQDOO\ WKH HQKDQFHG V\QWKHVLV RI SK\WRHQH FDXVHG E\ WKH DGGLWLRQ RI &37$ LV EORFNHG E\ WKH F\WRSODVPLF WUDQVODWLRQ LQKLELWRU F\FORKH[LPLGH 7KHUHIRUH WKH HYLGHQFH LQGLFDWHV WKDW WKH HQ]\PHV UHTXLUHG IRU FDURWHQRLG V\QWKHVLV DUH LPSRUWHG LQWR WKH SODVWLG (Q]YPRORJY RI FDURWHQRLG ELRV\QWKHVLV LQ WRPDWR IUXLW 7KH SXULILFDWLRQ RI WKH FDURWHQRLG ELRV\QWKHWLF HQ\PHV LV GLIILFXOW EHFDXVH DOO WKH HQ]\PHV LQ WKLV SDWKZD\ EH\RQG WKH V\QWKHVLV RI SK\WRHQH DUH DVVRFLDWHG ZLWK SODVWLG PHPEUDQHV &RQVHTXHQWO\ VWXGLHV WKDW FKDUDFWHUL]H WKH QXPEHU DQG W\SH RI HQ]\PDWLF VWHSV UHVSRQVLEOH IRU WKH V\QWKHVLV RI WKHVH FRPSRXQGV LQ KLJKHU SODQWV KDYH UHOLHG RQ DGGLQJ UDGLRDFWLYH SUHFXUVRUV WR VROXELOL]HG FUXGH HQ]\PH SUHSDUDWLRQV 7KH GLVWULEXWLRQ RI UDGLRDFWLYLW\ EHWZHHQ WKH GLIIHUHQW FDURWHQRLGV LV WKHQ PHDVXUHG 7KHVH H[SHULPHQWV KDYH VKRZQ WKDW ZKHQ IRU H[DPSOH UHG WRPDWR H[WUDFWV DUH IHG ODEHOHG O\FRSHQH F\FOLF FDURWHQRLGV DUH SURGXFHG 4XHUVKL HW DO f 7KLV VXJJHVWV WKDW WKH HQ]\PHV IRU WKH SURGXFWLRQ RI WKHVH FRPSRXQGV DUH SUHVHQW EXW GR QRW QRUPDOO\ DFFHSW WKH O\FRSHQH WKDW LV SURGXFHG LQ YLYR 3HUKDSV DQ LQKLELWRU LV SUHVHQW LQ YLYR WKDW KDV EHHQ GLOXWHG RXW LQ YLWUR $OWHUQDWLYHO\ D VSDWLDO VHSDUDWLRQ EHWZHHQ WKHVH HQ]\PHV PD\ H[LVW LQ YLYR WKDW LV GLVUXSWHG LQ YLWUR 3DSDVWHSKDQRX HW DK f 7KHVH LQ YLWUR VWXGLHV LQYROYHG WKH DGGLWLRQ RI TXDQWLWLHV RI VXEVWUDWH DQG FRIDFWRUV WKDW PD\ GUDVWLFDOO\ GLIIHU IURP WKH VLWXDWLRQ LQ YLYR 7KHVH XQH[SHFWHG UHVXOWV GHPRQVWUDWH WKDW WKH SDWKZD\ IRU WKH V\QWKHVLV RI

PAGE 33

FDURWHQRLGV LV FRPSOLFDWHG DQG D PRUH WKRURXJK XQGHUVWDQGLQJ RI WKH SURGXFWLRQ RI FDURWHQRLGV UHTXLUHV DQDO\VLV LQ OHVV GLVUXSWHG V\VWHPV ([DPLQDWLRQ RI PXWDQWV LQ WKH V\QWKHVLV RI WRPDWR IUXLW FDURWHQRLGV KDV SUHGLFWHG WKDW WKH SKRWRV\QWKHWLF SLJPHQWV DUH SURGXFHG E\ GLIIHUHQW LVR]\PHV $ QXPEHU RI WRPDWR PXWDQWV KDYH EHHQ VWXGLHG IRU UHYLHZ VHH *RRGZLQ DQG *RDG f 0DQ\ KDYH EHHQ PDSSHG WKHLU FRPSOHPHQW RI FDURWHQRLGV KDV EHHQ PHDVXUHG DQG WKH SRVLWLRQ RI WKH JHQHWLF OHVLRQ LQ WKH ELRV\QWKHWLF SDWKZD\ KDV EHHQ SUHGLFWHG *RRGZLQ DQG *RDG DQG .KXGDUL 7RPDWR *HQHWLF &RRSHUDWLYH 5HSRUW f 0DQ\ RI WKHVH PXWDQWV DIIHFW RQO\ IUXLW FRORU ZKLOH WKH SKRWRV\QWKHWLF SLJPHQWV IRXQG LQ WKH OHDYHV DUH FRPSOHWHO\ QRUPDO 7KHODQGHU HW DO f *HQHWLF HYLGHQFH VXJJHVWV WKDW IUXLW FDURWHQRLGV DUH SURGXFHG E\ WZR VHSDUDWH SDWKZD\V 2QH SDWKZD\ SURGXFHV WKH DEXQGDQW DPRXQW RI O\FRSHQH JHQHUDOO\ DVVRFLDWHG ZLWK UHG ULSH WRPDWRHV ZKLOH WKH RWKHU SDWKZD\ DSSHDUV WR PDNH D VPDOO DPRXQW RI FDURWHQH (YLGHQFH WKDW WZR SDWKZD\V H[LVW LQFOXGHV WKH WRPDWR PXWDQW DSULFRW ZKLFK LV GHILFLHQW LQ WKH DFFXPXODWLRQ RI O\FRSHQH ZLWKRXW DIIHFWLQJ WKH OHYHO RI FDURWHQH LQ WKH IUXLW *RRGZLQ f $GGLWLRQDO HYLGHQFH LQFOXGHV WKH IDFW WKDW WKH SURGXFWLRQ RI O\FRSHQH LV VHQVLWLYH WR KLJK WHPSHUDWXUHV LQ QRUPDO UHG WRPDWRHV 7KHODQGHU HW DO f ZKLOH WKH KLJK ML PXWDQW KDV UHGXFHG O\FRSHQH DQG HQKDQFHG WHPSHUDWXUH VHQVLWLYH V\QWKHVLV RI FDURWHQH ,Q RWKHU ZRUGV WKH GRPLQDQW KLJK ML WRPDWR VHHPV WR KDYH XVHG WKH VDPH WHPSHUDWXUH VHQVLWLYH SDWKZD\ WR DXJPHQW WKH OHYHOV RI FDURWHQH %RWK WKH H[LVWHQFH RI WKH DSULFRW PXWDQW DQG WKH UHVLGXDO QRQ

PAGE 34

WHPSHUDWXUH VHQVLWLYH DPRXQW RI FDURWHQH IRXQG LQ KLJK IL IUXLW LPSO\ WKDW D VHFRQG SDWKZD\ H[LVWV 7KH UHVLGXDO EXW HYHU SUHVHQW OHYHO RI WRWDO FDURWHQRLGV IRXQG LQ VRPH PXWDQWV WKH SUHVHQFH RI WHPSHUDWXUH VHQVLWLYH FDURWHQH DQG HQ]\PHV WKDW IXQFWLRQ LQ YLWUR EXW IDLO WR DFFXPXODWH WKHLU SURGXFW LQ YLYR VXJJHVW WKDW D PDMRU ULSHQLQJ HQKDQFHG LQGXFLEOH SDWKZD\ IRU FDURWHQRLG ELRV\QWKHVLV PD\ H[LVW DORQJ ZLWK D PLQRU SRVVLEO\ FRQVWLWXWLYH SDWK ,I WKH PLQRU SDWKZD\ LV UHVSRQVLEOH IRU WKH SURGXFWLRQ RI WKH F\FOLF FDURWHQRLGV WKLV SUHGLFWV WKDW HQ]\PHV IRU WKH SURGXFWLRQ RI F\FOLF FDURWHQRLGV PD\ QRW QHFHVVDULO\ EH HQKDQFHG GXULQJ ULSHQLQJ LQ QRUPDO UHG WRPDWRHV &KDUDFWHUL]DWLRQ RI FDURWHQRLG ELRV\QWKHVLV LQ EDFWHULD D PRGHO IRU KLJKHU SODQW DQDO\VLV 7KH FORQLQJ DQG VXEVHTXHQW FRPSOHPHQWDWLRQ RI JHQHV IRU FDURWHQRLG ELRV\QWKHVLV LQ EDFWHULD GHPRQVWUDWHV KRZ SRZHUIXO VXFK D V\VWHPDWLF DQDO\VLV FDQ EH LQ WKH XQGHUVWDQGLQJ RI KRZ WKH SDWKZD\ IXQFWLRQV 7KHVH JHQHV DUH RUJDQL]HG LQWR FOXVWHUV LQ WKH EDFWHULD (UZLQLD KHUELFROD DQG (UZLQLD XUHGRYRUD ,Q DGGLWLRQ WKH FDURWHQRLGV LQ WKHVH VSHFLHV DUH VLPLODU WR WKH SLJPHQWV WKDW DFFXPXODWH LQ KLJKHU SODQWV $ QXPEHU RI LQYHVWLJDWRUV KDYH XVHG WKHVH JHQHV WR WUDQVIRUP ( FROL $JUREDFWHULXP DQG =\PRPRQDV 0LVDZD HW DO +XQGOH HW DO 0LVDZD HW DO 1DDJDZD DQG 0LVDZD f 'HOHWLRQ DQDO\VLV RI WKH FOXVWHU WUDQVIRUPHG LQWR ( FROL DOORZHG DQ XQDPELJXRXV RUGHULQJ RI WKH SDWKZD\ E\ DQDO\VLV RI WKH FDURWHQRLGV WKDW DFFXPXODWHG LQ WKH UHVXOWLQJ PXWDQWV 0LVDZD HW DO f

PAGE 35

7KH SRZHU RI WKH FKDUDFWHUL]DWLRQ RI FDURWHQRLG ELRV\QWKHVLV LQ ( FROL LV GHPRQVWUDWHG E\ WKH DQDO\VLV RI LQGLYLGXDO JHQHV IURP GLIIHUHQW VSHFLHV E\ /LQGHQ HW DO f $ SODVPLG FRQWDLQLQJ WKH JHQHV UHVSRQVLEOH IRU WKH V\QWKHVLV RI SK\WRHQH LQ (UZLQLD XUHGRYRUD FDQ EH WUDQVIRUPHG LQWR ( FROL DQG VHTXHQWLDOO\ FRWUDQVIRUPHG ZLWK D SODVPLG FRQWDLQLQJ D SK\WRHQH GHVDWXUDVH 3'6f JHQH 7KH W\SH RI SLJPHQW WKDW LV SURGXFHG E\ WKH VSHFLILF 3'6 HQ]\PHV FDQ WKHQ EH PRQLWRUHG 7KH 3'6 F'1$V FORQHG IURP 6\QHFKRFRFFXV 5KRGREDFWHU DQG (UZLQLD XUHGRYRUD ZHUH WHVWHG $QDO\VLV RI WKH FDURWHQRLGV SURGXFHG LQ WKHVH WUDQVJHQLF ( FROL VKRZHG WKDW WKH GLIIHUHQW HQ]\PHV SURGXFHG D GLIIHUHQW FRPSOHPHQW RI SURGXFWV )RU H[DPSOH WKH 6\QHFKRFRFFXV HQ]\PH ZDV DEOH WR LQWURGXFH WZR GRXEOH ERQGV LQ SK\WRHQH ZKLOH WKH 5KRGREDFWHU HQ]\PH LQWURGXFHV WKUHH GRXEOH ERQGV 7KLV DQDO\VLV DOVR VKHG VRPH OLJKW RQ WKH OHYHO RI FLVWUDQV LVRPHUL]DWLRQV WKDW DFFXPXODWH LQ WKH YDULRXV FRPSOHPHQWHG EDFWHULD 7KH DXWKRUV FRQFOXGHG WKDW D JUDGXDO VKLIW IURP FLV WR WUDQV FDURWHQRLGV RFFXUV ZLWK DQ LQFUHDVH LQ WKH QXPEHU RI FRQMXJDWHG GRXEOH ERQGV SURGXFHG E\ WKH GLIIHUHQW HQ]\PHV 7KLV VXJJHVWV WKDW D VSHFLILF FLVWUDQV LVRPHUDVH PD\ QRW EH UHTXLUHG IRU WKLV LQWHUFRQYHUVLRQ )LQDOO\ VLQFH WKH 5KRGREDFWHU 3'6 DGGV GRXEOH ERQGV WKH VSHFLILFLW\ RI WKH (UZLQLD O\FRSHQH F\FODVH DQG EHWD FDURWHQH K\GUR[\ODVH RQ WKH DV\PPHWULFDO PROHFXOH IRUPHG FRXOG EH DVVHVVHG 7KLV H[SHULPHQW ZDV SHUIRUPHG E\ WKH LQWURGXFWLRQ RI D SODVPLG FRQWDLQLQJ WKH HQWLUH (UZLQLD JHQH FOXVWHU H[FHSW IRU D PXWDQW 3'6 JHQH &RWUDQVIRUPDWLRQ RI WKLV SODVPLG ZLWK WKH 5KRGREDFWHU 3'6 FUHDWHG XQLTXH FDURWHQRLGV 7KLV H[SHULPHQW GHPRQVWUDWHG WKDW WKH F\FODVH RU WKH K\GUR[\ODVH UHFRJQL]HV KDOI RI WKH FDURWHQRLG PROHFXOH 7KLV

PAGE 36

W\SH RI DQDO\VLV FDQ DOORZ D FDUHIXO LGHQWLILFDWLRQ RI WKH QXPEHU DQG W\SHV RI HQ]\PHV UHTXLUHG WR SURGXFH D VSHFLILF FRPSOHPHQW RI FDURWHQRLGV 7KH VHTXHQWLDO FORQLQJ DQG DQDO\VLV RI WKH GLIIHUHQW FDURWHQRLG ELRV\QWKHWLF JHQHV LQ WUDQVJHQLF EDFWHULD GHPRQVWUDWH KRZ SRZHUIXO VXFK DQ DSSURDFK FRXOG EH IRU WKH GLVVHFWLRQ RI WKLV SDWKZD\ LQ KLJKHU SODQWV ,I WKH KLJKHU SODQW FDURWHQRLG JHQHV ZHUH FORQHG D VLPLODU VHULHV RI H[SHULPHQWV FRXOG EH XQGHUWDNHQ 0ROHFXODU ELRORJ\ RI FDURWHQRLG ELRV\QWKHVLV LQ KLJKHU SODQWV 7KH JHQH IRU SK\WRHQH V\QWKHVLV KDV EHHQ LVRODWHG IURP WRPDWR IUXLW 2ULJLQDOO\ WKH FORQH IRU WKH SK\WRHQH V\QWKDVH F'1$ S720f ZDV LVRODWHG E\ 6ODWHU HW DO f VLPSO\ EHFDXVH LW UHFRJQL]HG LQFUHDVLQJ DPRXQWV RI 51$ DV ULSHQLQJ SURJUHVVHG 6LJQLILFDQW KRPRORJ\ WR WKH GHGXFHG DPLQR DFLG VHTXHQFH RI WKH WRPDWR F'1$ S720 WR D FORQH IRU SK\WRHQH V\QWKDVH LQ 5KRGREDFWHU ZDV LGHQWLILHG $UPVWURQJ HW DO Df %DUWOH\ HW DO f XVHG WKLV LQIRUPDWLRQ WR FORQH D VLPLODU F'1$ IURP WRPDWR IUXLW DQG SURYLGHG HYLGHQFH E\ FRPSOLPHQWLQJ D PXWDQW 5KRGREDFWHU WKDW LW LQGHHG FRGHG IRU SK\WRHQH V\QWKDVH 5HFHQWO\ D QRUPDO UHG YDULHW\ RI WRPDWR KDV EHHQ WUDQVIRUPHG ZLWK D FRQVWLWXLWLYHO\ H[SUHVVHG DQWLVHQVH YHUVLRQ RI S720 %LUG HW DO f 7KLV UHVXOWHG LQ \HOORZ IUXLW DQG SDOH IORZHUV &KORURSK\OO D DQG E OHYHOV ZHUH QRUPDO LQ WKH OHDYHV RI WKH WUDQVIRUPHG SODQWV ZKLFK VXJJHVWHG WKDW WKH OHDI FDURWHQRLGV ZHUH XQDIIHFWHG E\ WKH FRQVWLWXWLYHO\ H[SUHVVHG DQWLVHQVH PHVVDJH 7KHVH UHVXOWV FRQILUP WKDW S720 FRGHV IRU D SK\WRHQH V\QWKDVH WKDW LV VSHFLILF IRU ULSHQLQJ IUXLW $ PRUH FRPSOHWH DQDO\VLV RI WKH WUDQVJHQLF SODQWV E\ %UDPOH\ HW DO f FRQILUPHG WKDW DQWLVHQVH S720 DOWHUV

PAGE 37

FDURWHQRLG DFFXPXODWLRQ LQ WKH IORZHU DQG IUXLW EXW QRW WKH OHDYHV RI WUDQVJHQLF SODQWV 7KH JHQH IRU JHUDQ\OJHUDQ\O S\URSKRVSKDWH **33f V\QWKDVH KDV EHHQ FORQHG IURP SHSSHU IUXLW .XQW] HW DO f 7KH HQ]\PH ZDV SXULILHG DQWLERG\ ZDV SURGXFHG DQG D F'1$ ZDV LVRODWHG IURP D ULSH SHSSHU IUXLW H[SUHVVLRQ OLEUDU\ %RWK WKH P51$ DQG WKH SURWHLQ LQFUHDVHG GXULQJ IUXLW ULSHQLQJ ,PPXQRORJLFDO H[DPLQDWLRQ KDV VKRZQ WKDW WKLV VWURPDO HQ]\PH LV PDLQO\ IRXQG FRQFHQWUDWHG DURXQG FKURPRSODVW SODVWRJOREXOL &KHQLFOHW HW DO f 7KH GHGXFHG DPLQR DFLG VHTXHQFH IURP WKH F\DQREDFWHULXP 6\QHFKRFRFFXV 3'6 DOORZHG WKH FORQLQJ RI D F'1$ IURP VR\EHDQ FRW\OHGRQ E\ 6FROQLNfV ODE %DUWOH\ HW DO f 6LPLODU ZRUN E\ 3HFNHU HW DO f SURGXFHG D 3'6 IURP ULSHQLQJ WRPDWR IUXLW $Q LQWHUHVWLQJ REVHUYDWLRQ UHVXOWLQJ IURP WKLV ZRUN LV WKDW ZKLOH WKH F\DQREDFWHULXP DQG KLJKHU SODQW 3'6V VKDUH PRUH WKDQ b GHGXFHG DPLQR DFLG LGHQWLW\ QR KRPRORJ\ EH\RQG D VKRUW DPLQR WHUPLQDO UHJLRQ WKDW FRQWDLQV D FRQVHUYHG GLQXFOHRWLGHELQGLQJ PRWLI H[LVWV ZLWK WKH IXQJDO 5KRGREDFWHU RU (UZLQLD 3'6 7KLV VXJJHVWV WKDW VHSDUDWH 3'6V PD\ KDYH HYROYHG IRU KLJKHU SODQWV DQG JUHHQ DOJDH LQ FRQWUDVW ZLWK RWKHU SKRWRV\QWKHWLF RUJDQLVPV )ROORZLQJ D GLIIHUHQW DSSURDFK &DPDUDfV ODE SXULILHG D SK\WRHQH GHVDWXUDVH IURP &DSVLFXP DQG XVHG DQWLERG\ WR LVRODWH D F'1$ FORQH +XJXHQH\ HW DO f 7KH GHGXFHG DPLQR DFLG VHTXHQFH RI WKDW FORQH KDV VWULNLQJ KRPRORJ\ WR WKH WRPDWR IUXLW VHTXHQFH 2QO\ VOLJKW LQFUHDVHV LQ WKH VWHDG\VWDWH OHYHO RI 51$ WKDW K\EULGL]HV WR WKLV FORQH RFFXU DW 0* 7KLV LV LQ FRQWUDVW ZLWK WKH DQDO\VLV RI WKH SURWHLQ DQG WKH HQ]\PH DFWLYLW\

PAGE 38

ZKLFK LQFUHDVHV VLJQLILFDQWO\ ZLWK ULSHQLQJ ,W DSSHDUV IURP WKH HYLGHQFH SURYLGHG E\ ERWK ODERUDWRULHV +XJXHQH\ HW DO 3HFNHU HW DO f WKDW WKH TXDQWLW\ RI WKLV P51$ LV ORZ GXULQJ ULSHQLQJ 3HUKDSV GXULQJ FKURPRSODVW GHYHORSPHQW ODUJH LQFUHDVHV LQ P51$ RFFXU RQO\ IRU WKH HDUO\ HQ]\PHV LQYROYHG LQ FDURWHQRLG ELRV\QWKHVLV 0D\HU HW DO f KDYH SXULILHG DQ R[LGRUHGXFWDVH WKDW LV VSHFLILF IRU FKURPRSODVWV DQG FUXFLDO IRU GHVDWXUDWLRQ RI FDURWHQRLGV 7KH SHULSKHUDO QDWXUH RI WKH LQYROYHPHQW RI WKLV HQ]\PH LQ FDURWHQRLG V\QWKHVLV LV VXSSRUWHG E\ WKH IDFW WKDW DQWLERG\ WR WKLV SURWHLQ GRHV QRW LQKLELW WKH V\QWKHVLV RI FDURWHQRLGV +RZHYHU R[LGL]HG TXLRQHV DUH UHTXLUHG IRU FDURWHQRLG GHVDWXUDWLRQ VR LW LV DVVXPHG WKDW WKLV HQ]\PH DFWV WR DIIHFW WKH UHGR[ VWDWH RI WKH FKURPRSODVW PHPEUDQHV ZKHUH D ODUJH DPRXQW RI R[LGL]HG TXLRQHV DQG WRFRSKHUROV IRXQG 3HUKDSV WKH R[LGRUHGXFWDVH DQG WKH LQFUHDVHG DPRXQW RI DQWLR[LGDQWV LQ SHSSHU FKURPRSODVWV SRLQW WR DQ HQYLURQPHQW WKDW FRQWDLQV DQ HVFDODWLQJ DPRXQW RI UHDFWLYH R[\JHQ 5RPHU HW DO f 7KH GHVDWXUDWLRQ RI SK\WRHQH UHTXLUHV WKH WUDQVIHU RI HOHFWURQV WR R[\JHQ 7KLV PLJKW FDXVH DQ LQFUHDVH LQ UHDFWLYH R[\JHQ DQG OHDG WR WKH LQGXFWLRQ RI HQ]\PHV WKDW JHQHUDWH DQWLR[LGDQWV 7ZR SDWKZD\V DUH SUHGLFWHG IRU WKH V\QWKHVLV RI FDURWHQRLGV LQ ULSHQLQJ WRPDWR IUXLW 1RQH RI WKH JHQHV IRU WKH HQ]\PHV UHVSRQVLEOH IRU VWHSV LQ WKH SDWKZD\ EH\RQG WKH V\QWKHVLV RI ]HWDFDURWHQH KDYH EHHQ FORQHG ,W LV LQWHUHVWLQJ WKDW RQO\ PLQRU LQFUHDVHV LQ WKH VWHDG\VWDWH OHYHO RI 51$ IRU 3'6 RFFXU GXULQJ IUXLW ULSHQLQJ 6LQFH ODUJH LQFUHDVHV LQ VWHDG\VWDWH OHYHOV RI 51$ DFFXPXODWH IRU ERWK SK\WRHQH

PAGE 39

V\QWKDVH LQ WRPDWR DQG **33 V\QWKDVH LQ SHSSHU IUXLW 6ODWHU HW DO .XQW] HW DO f SHUKDSV RQO\ WKH YHU\ HDUO\ VWHSV RI WKLV SDWKZD\ DUH WUDQVFULSWLRQDOO\ LQGXFHG GXULQJ ULSHQLQJ ZKLOH WUDQVFULSW IRU WKH ODWHU VWHSV ZLOO EH FRQVWLWXWLYHO\ H[SUHVVHG DW D ORZ OHYHO &RQFHLYDEO\ WKH GRPLQDQW PXWDQWV GHO DQG E ZKLFK SURGXFH LQFUHDVHG DPRXQWV RI DQG FDURWHQRLGV UHVSHFWLYHO\ ZLOO FRQWDLQ LQFUHDVHG OHYHOV RI 51$ IRU WKH WKH HQ]\PHV UHVSRQVLEOH IRU WKHVH ODWHU VWHSV LQ WKH ELRV\QWKHWLF SDWKZD\ &KORURSODVW 6HQHVFHQFH &KORURSODVW VHQHVFHQFH LQYROYHV WKH GHJUDGDWLRQ RI FKORURSK\OO DQG WKH GLVPDQWOLQJ RI SKRWRV\QWKHWLF PHPEUDQHV &RQVLGHULQJ WKDW WKH DQDO\VLV RI FKORURSODVW EUHDNGRZQ GXULQJ FKURPRSODVW IRUPDWLRQ KDV UHOLHG RQ XOWUDVWUXFWXUDO DQDO\VLV DQG FKDUDFWHUL]DWLRQ RI PRVWO\ WKH GHFUHDVH LQ VWHDG\VWDWH OHYHOV RI SKRWRV\QWKHWLF SURWHLQV SHUKDSV DQ XQGHUVWDQGLQJ RI KRZ WKLV SURFHVV RFFXUV GXULQJ OHDI VHQVHFHQFH ZLOO DOORZ SUHGLFWLRQV IRU WKH SODVWLG WUDQVLWLRQ LQ ULSHQLQJ IUXLW ,QGHHG RXW RI IUXLW ULSHQLQJ HQKDQFHG FORQHV VKDUH KRPRORJ\ WR WUDQVFULSWV WKDW LQFUHDVH LQ VHQHVFLQJ OHDYHV 'DYLHV DQG *ULHUVRQ f 'XULQJ ULSHQLQJ DQG VHQHVFHQFH VWDUFK FKORURSK\OO DQG SKRWRV\QWKHWLF SURWHLQV GHJUDGH 'DYLHV DQG *ULHUVRQ f $ EXUVW LQ HWK\OHQH V\QWKHVLV KDV EHHQ FRUUHODWHG ZLWK VHQHVFHQFH LQ OHDI WLVVXH 'DYLHV DQG *ULHUVRQ f DQG UHVSLUDWLRQ DOVR LQFUHDVHV

PAGE 40

3KRWRVYQWKHWLF SURWHLQ V\QWKHVLV GXULQJ OHDI VHQHVFHQFH $ GHFUHDVH LQ WKH V\QWKHVLV RI SKRWRV\QWKHWLF SURWHLQV RFFXUV GXULQJ FKORURSODVW VHQHVFHQFH 5REHUWV HW DO f 7KLV ORVV RI SURWHLQV IROORZV D VLPLODU SDWWHUQ DV GHVFULEHG IRU FKURPRSODVW GHYHORSPHQW E\ 3LHFKXOOD 7KH V\QWKHVLV RI SURWHLQ LQ GLIIHUHQW DJHV RI 3KDVHROXV OHDYHV ZDV PHDVXUHG DQG WKH DPRXQWV RI F\WRFKURPH I F\WRFKURPH E D DQG E VXEXQLWV RI WKH $73DVH N' 36, SURWHLQ DQG /+&3 GHFOLQH LQ OHDYHV +RZHYHU WKH N' SURWHLQ SHUVLVWV WKURXJKRXW VHQHVFHQFH 8OWUDVWUXFWXUDO DQDO\VLV RI FKORURSODVW VHQHVFHQFH 3ODVWLG VHQHVFHQFH LV D JUDGXDO RUGHUHG SURFHVV ZKLFK RFFXUV ZLWKLQ WKH SODVWLG ,W ZDV LQLWLDOO\ DVVXPHG WKDW FKORURSODVWV ZHUH HQJXOIHG DQG GHJUDGHG ZLWKLQ YDFXROHV UHYLHZHG E\ *HSVWHLQ f 7KHVH HDUO\ VWXGLHV FRQFOXGHG WKDW VHQHVFLQJ OHDYHV DFWXDOO\ FRQWDLQHG IHZHU SODVWLGV +RZHYHU UHDSSUDLVDO RI WKLV ZRUN VXJJHVWHG WKDW WKH LVRODWLRQ RI IHZHU SODVWLGV LQ VHQHVFLQJ OHDYHV ZDV GXH WR WKH LQFUHDVHG GLIILFXOW\ LQ LVRODWLQJ WKHVH IUDJLOH RUJDQHOOHV UHYLHZHG E\ *HSVWHLQ f $GGLWLRQDO XOWUDVWUXFWXUDO DQDO\VLV VKRZHG WKDW SODVWLGV LQ VHQHVFLQJ OHDYHV XQGHUJR D WUDQVLWLRQ LQ ZKLFK WK\ODNRLGV EHFRPH XQVWDFNHG DQG SODVWRJOREXOL DFFXPXODWH *HSVWHLQ f 7KLV VXJJHVWV WKDW WKH GHJUDGDWLRQ RI SODVWLG FRPSRQHQWV GXULQJ VHQHVFHQFH RFFXUV ZLWKLQ WKH SODVWLG LWVHOI 7KD\HU HW DO f DQG LV JUDGXDO DQG RUGHUHG 7KH SODVWLG HQYHORSH PDLQWDLQV LWV LQWHJULW\ XQWLO YHU\ ODWH LQ VHQHVFHQFH ORQJ DIWHU WKH GHJUDGDWLRQ RI WK\ODNRLG PHPEUDQHV LV FRPSOHWH 7KRPVRQ DQG 3ODWW $ORLD f )XUWKHUPRUH WKLV PHDQV WKDW LI HQKDQFHG GHJUDGDWLRQ RI SODVWLG

PAGE 41

FRPSRQHQWV RFFXUV GXULQJ VHQVHFHQFH WKHQ LW LV SRVVLEOH WKDW QHZ SURWHLQV ZRXOG EH LPSRUWHG LQWR WKH SODVWLG IRU WKLV SXUSRVH 7KH GHJUDGDWLRQ RI FKORURSK\OO GXULQJ FKORURSODVW VHQHVFHQFH 7KH GHJUDGDWLRQ RI FKORURSK\OO KDV EHHQ VXJJHVWHG WR EH WKH WULJJHU IRU WKH SURWHRO\VLV RI WKH SURWHLQ FRPSRQHQWV RI WKH WK\ODNRLG PHPEUDQHV 8QIRUWXQDWHO\ WKH SDWKZD\ IRU WKH FDWDEROLVP RI FKORURSK\OO LV QRW ZHOO XQGHUVWRRG :RUN ZLWK WKH QRQ\HOORZLQJ PXWDQW RI WKH WHPSHUDWH JUDVV IHVWXFD VXJJHVWHG WKDW DQ LQLWLDO VWHS LQ WK\ODNRLG GHJUDGDWLRQ LQYROYHV GHSK\WODWLRQ RI WKH FKORURSK\OO PROHFXOH ZKLOH LW UHPDLQV LQ WKH SLJPHQWSURWHLQ FRPSOH[ 7KRPDV HW DO f $ SRODU JUHHQ FKORURSK\OO GHJUDGDWLRQ SURGXFW FDQ EH LVRODWHG IURP SXULILHG OLJKW KDUYHVWLQJ FRPSOH[HV /+&Vf RI WKHVH PXWDQW SODVWLGV 7KLV GHJUDGDWLRQ SURGXFW LV DOVR SURGXFHG LQ QRUPDO SODVWLGV H[SRVHG WR DQR[LF FRQGLWLRQV 7KH EXLOGXS RI WKLV LQWHUPHGLDWH RFFXUV LQ WKH PXWDQW SODQW EHFDXVH D GRZQVWUHDP VWHS LQ WKH FKORURSK\OO FDWDEROLVP SDWKZD\ LV PLVVLQJ 6LQFH WKH SURGXFW FRXOG EH LVRODWHG IURP SXULILHG /+&V WKH DXWKRUV FRQFOXGHG WKDW WKH ILUVW VWHS LQ WKH GHJUDGDWLRQ RI FKORURSK\OO RFFXUV ZLWKLQ WKH SURWHLQSLJPHQW FRPSOH[HV RI WKH WK\ODNRLG PHPEUDQH &KORURSK\OODVH KDV EHHQ LVRODWHG IURP FKORURSODVWV DQG FRXOG SHUIRUP WKLV IXQFWLRQ 0DWLOH HW DO f +RZHYHU WKH SURWHLQ GRHV QRW VHHP WR LQFUHDVH GXULQJ VHQHVFHQFH $OWHUQDWLYHO\ WKH HQ]\PH FRXOG UHPDLQ ODWHQW LQ WKH SODVWLG DQG EH DFWLYDWHG ZKHQ QHFHVVDU\ 3HUKDSV WKH DFWLYDWLRQ RI WKH FKORURSK\OODVH UHTXLUHV D QHZO\ V\QWKHVL]HG SURWHLQ"

PAGE 42

7KH QH[W VWHS LQ WKH FDWDEROLVP RI FKORURSK\OO LV SUREDEO\ DQ R[LGDWLRQ +RZHYHU LW LV QRW FOHDU ZKHWKHU WKLV RFFXUV LQ WKH SODVWLG RU YDFXROH 0DWLOH HW DO f 2QH WKHRU\ VXJJHVWHG WKDW D WK\ODNRLG DVVRFLDWHG FKORURSK\OO R[LGDVH LV LQGXFHG E\ DQ LQFUHDVH LQ OLQROHQLF DFLG GXULQJ VHQHVFHQFH /XWK\ HW DO f ZKLFK WULJJHUV WKH FDWDEROLVP RI FKORURSK\OO DQG WKH UHVXOWLQJ FDVFDGH RI GHJUDGDWLYH UHDFWLRQV 7KLV LGHD PD\ UHTXLUH UHDSSUDLVDO LQ OLJKW RI WKH IDFW WKDW R[LGL]HG S\\UROHV KDYH EHHQ IRXQG LQ YDFXROHV DQG QRW LVRODWHG IURP VHQHVFLQJ SODVWLGV 0DWLOH HW DO f 'HJUDGDWLRQ RI WKH WK\ODNRLG PHPEUDQHV GXULQJ FKORURSODVW VHQHVFHQFH 7KH DQDO\VLV RI VWD\JUHHQ PXWDQWV LQ VR\EHDQ DQG WKH SUHYLRXVO\ GHVFULEHG PXWDQW LQ IHVWXFD GHPRQVWUDWHV WKDW WKH GHJUDGDWLRQ RI WKH WK\ODNRLG PHPEUDQH LV PHGLDWHG E\ DW OHDVW WZR VHSDUDWH SDWKZD\V DQG LV WKH UHVXOW RI ERWK QXFOHDU DQG SODVWLGHQFRGHG SURWHLQV )RU H[DPSOH WKH F\WRSODVPLF PXWDQW F\W* RI VR\EHDQ VSHFLILFDOO\ UHWDLQV WKH /+&Vf *XLDPHW HW DO f &OHDUO\ WKH EUHDNGRZQ RI WKH FRUH SURWHLQV LQYROYHV D VHSDUDWH SDWK IURP WKH GHJUDGDWLRQ RI WKH /+&V 6LQFH FKORURSK\OO D DQG E DUH VWLOO FDWDEROL]HG LQ WKLV SODQW WKHVH GDWD VXJJHVW WKDW D SODVWLGHQFRGHG SURWHDVH LV ODFNLQJ DQG LV LQYROYHG LQ /+& EUHDNGRZQ :KHQ WZR KRPHRORJRXV UHFHVVLYH QXFOHDUHQFRGHG JHQHV GMGf RI VR\EHDQ DUH SUHVHQW LQ WKLV WHWUDSORLG SODQW PRVW RI WKH FKORURSK\OO LV UHWDLQHG DQG DOO RI WKH WK\ODNRLG SURWHLQV DSSHDU WR EH SUHVHQW LQ FRQWUDVW ZLWK QRQPXWDQW OHDYHV *XLDPHW

PAGE 43

HW DO f 7KHVH GDWD LPSO\ WKDW WKH GHJUDGDWLRQ RI WKH WK\ODNRLG PHPEUDQH LQ VR\EHDQ LV DOVR PHGLDWHG E\ QXFOHDUHQFRGHG JHQHV (YLGHQFH IURP WKH PXWDQW IHVWXFD XQGHUVFRUHV WKH FRPSOH[LW\ RI WKH GHJUDGDWLRQ RI WK\ODNRLGV 7KH SKHQRW\SH RI WKLV UHFHVVLYH PXWDQW LV D VHOHFWLYH PDLQWHQDQFH RI FRPSRQHQWV RI WKH SKRWRV\QWKHWLF PHPEUDQHV )RU H[DPSOH WKH OHYHO RI /+&3 LV PDLQWDLQHG LQ WKH PXWDQW SODQW ORQJ DIWHU WKH DPRXQW RI WKLV SURWHLQ KDV EHJXQ WR GLPLQLVK LQ QRUPDO SODQWV 7KRPDV DQG +LOGLWFK f $GGLWLRQDOO\ WKH GHJUDGDWLRQ RI WKH SODVWLG SURWHLQ ZKLFK QRUPDOO\ WXUQV RYHU LQ HLWKHU WKH OLJKW RU WKH GDUN LV LQKLELWHG LQ WKH GDUN EXW QRW WKH OLJKW 7KRPDV DQG +LOGLWFK f 7KH .G SURWHLQ KRZHYHU GHJUDGHV QRUPDOO\ LQ WKLV PXWDQW 7KRPDV DQG +LOGLWFK f 7KHVH PXWDQW SODQWV DUH DOVR DEOH WR SKRWREOHDFK LI WKH\ DUH VXEMHFWHG WR KLJK OLJKW LQWHQVLWLHV 7KRPDV DQG +LOGLWFK f 7KHVH GDWD VXJJHVW WKDW WZR VHSDUDWH SURWHDVH V\VWHPV DUH UHVSRQVLEOH IRU WKH GHJUDGDWLRQ RI WK\ODNRLG PHPEUDQHV 2QH V\VWHP LV OLJKW DFWLYDWHG DQG XQDIIHFWHG E\ WKLV PXWDWLRQ DQG DQRWKHU IXQFWLRQV LQ WKH GDUN DQG LV LQKLELWHG E\ WKLV JHQHWLF OHVLRQ 'HJUDGDWLRQ RI 5XELVFR $Q H[DPLQDWLRQ RI WKH GHJUDGDWLRQ RI 5XELVFR VXJJHVWV KRZ D VWURPDO SURWHLQ PD\ EH EURNHQ GRZQ GXULQJ VHQHVFHQFH 7KH EUHDNGRZQ RI 5XELVFR FDQ EH LQGXFHG E\ R[LGDWLYH VWUHVV LQ D SURFHVV WKDW DSSHDUV WR PLPLF QDWXUDO VHQHVFHQFH 0HKWD HW DO f $ VSHFLILF DQG KLJKO\ FRQVHUYHG F\VWHLQH LV R[LGL]HG E\ WKH DGGLWLRQ RI &X6 DQG OHDGV WR GLPHUL]DWLRQ RI WKH SURWHLQ 7KLV LV IROORZHG E\ D WUDQVLHQW DFFXPXODWLRQ RI WKLV VWURPDO SURWHLQ RQ WKH PHPEUDQH DQG ILQDOO\ GHJUDGDWLRQ ,Q

PAGE 44

YLWUR VWXGLHV KDYH DOVR GHPRQVWUDWHG WKDW WKH R[LGL]HG IRUP RI 5XELVFR LV LQDFWLYH DQG PRUH VXVFHSWLEOH WR SURWHRO\WLF GLJHVWLRQ 3HQDUUXELD DQG 0RUHQR f 7KLV VXJJHVWV WKDW WKH WXUQRYHU RI VWURPDO SURWHLQ LV VHOHFWLYH DQG PD\ LQYROYH PHPEUDQH DVVRFLDWHG SURWHDVHV ,W LV XQFHUWDLQ ZKHWKHU WKLV UHVSRQVH WR R[LGDWLYH GDPDJH LV DQDORJRXV WR VHQHVFHQFH KRZHYHU LW GRHV GHPRQVWUDWH WKDW DQ RUGHUHG V\VWHP RI VWURPDO SURWHLQ GHJUDGDWLRQ H[LVWV LQ WKH SODVWLG ,W UHPDLQV WR EH VHHQ LI QDWXUDO VHQHVFHQFH LQYROYHV D EXLOG XS RI R[LGL]HG SURWHLQ WKDW HQWHUV LQWR WKLV GHJUDGDWLRQ SDWKZD\ RU LI LW LV GHYHORSPHQWDOO\ PDQLIHVWHG LQ VRPH RWKHU PDQQHU &KDQJHV LQ RWKHU FRPSRQHQWV RI WKH FKORURSODVW GXULQJ VHQHVFHQFH $ GHFUHDVH LQ WKH OHYHO RI JDODFWROLSLGV KDV EHHQ QRWHG LQ VHQHVFLQJ FKORURSODVWV :RROKRXVH f +RZHYHU :RROKRXVH f SRLQWHG RXW WKDW LW LV XQFHUWDLQ ZKHWKHU WKLV FKDQJH LQ OLSLG FRQWHQW LV FDXVHG E\ GHFUHDVHG ELRV\QWKHVLV RU LQFUHDVHG GHJUDGDWLRQ 7KH LVRODWLRQ RI SURWHDVHV LQYROYHG LQ SODVWLG SURWHLQ GHJUDGDWLRQ KDV EHHQ IDLUO\ XQVXFFHVVIXO 'DOOLQJ f 7KH PDMRULW\ RI SURWHDVHV DUH IRXQG LQ WKH YDFXROH DQG WKHLU SUHVHQFH PDVNV DQ H[DPLQDWLRQ RI FKDQJHV LQ SODVWLG SURWHDVHV GXULQJ VHQHVFHQFH &RQWURO RI FKORURSODVW VHQHVFHQFH 2YHUDOO SODVWLG VHQHVFHQFH UHTXLUHV FRQWLQXHG SURWHLQ V\QWKHVLV VLQFH WKH SURFHVV FDQ EH LQKLELWHG E\ F\FORKH[LPLGH UHYLHZHG E\ *HSVWHLQ f $OWKRXJK SODVWLG VHQHVFHQFH FDQ EH WULJJHUHG E\ D QXPEHU RI HQYLURQPHQWDO VWLPXOL VXFK DV GDUNQHVV R[LGDWLYH FRPSRXQGV RU QLWURJHQ GHSULYDWLRQ LW LV VWLOO XQFOHDU ZKHWKHU WKLV

PAGE 45

SURFHVV LV PHGLDWHG E\ DQ LQFUHDVH LQ GH QRYR V\QWKHVLV RI VSHFLILF SURWHLQV ,Q WKH FDVH RI 5XELVFR WXUQRYHU LV VORZ XQWLO D QXFOHDU HQFRGHG HYHQW DVVXPHG VLQFH LW LV LQKLELWHG E\ F\FORKH[LPLGH RU NLQHWLQf WULJJHUV WKH UDSLG GHJUDGDWLRQ RI WKLV DEXQGDQW SKRWRV\QWKHWLF SURWHLQ 7KD\HU HW DO f 3HUKDSV WKH EUHDNGRZQ RI FKORURSK\OO DFWV DV D VLJQDO IRU WKH GHJUDGDWLRQ RI SKRWRV\QWKHWLF PHPEUDQH SURWHLQV 1RFN HW DO f 7KLV KDV EHHQ VXJJHVWHG E\ WKH UHVXOWV IURP VWXGLHV RI WKH PXWDQW IHVWXFD ZKHUH D PXWDWLRQ LQ FKORURSK\OO FDWDEROLVP LQKLELWV WKH EUHDNGRZQ RI WKH SURWHLQ FRPSRQHQWV RI WKH WK\ODNRLG PHPEUDQHV 7KH SURGXFWLRQ RI WKH GHSK\WODWHG FKORURSK\OO GHJUDGDWLRQ SURGXFW UHTXLUHV SURWHLQ V\QWKHVLV 7KRPDV HW DO f ZKLFK LPSOLHV WKDW WKH V\QWKHVLV RI D F\WRSODVPLF SURWHLQ LV UHTXLUHG IRU LQGXFWLRQ RI FKORURSODVW VHQHVFHQFH &RQFOXVLRQV DERXW FKORURSODVW VHQHVFHQFH 7R GDWH XOWUDVWUXFWXUDO DQDO\VLV KDV VXJJHVWHG WKDW WKH VHQHVFHQFH RI FKORURSODVWV LV D JUDGXDO HYHQW ZLWKLQ WKH RUJDQHOOH 7KH GHJUDGDWLRQ RI SODVWLG SURWHLQV LV D FRPSOH[ SURFHVV LQYROYLQJ PXOWLSOH SURWHDVHV ZLWK GLIIHUHQW SURSHUWLHV 6LQFH WKH EUHDNGRZQ RI FKORURSODVWV LV LQKLELWHG E\ F\FORKH[LPLGH WKLV VXJJHVWV WKDW VHQHVFHQFH UHTXLUHV FRQWLQXHG SURWHLQ V\QWKHVLV *HSVWHLQ f $GGLWLRQDOO\ WKH UDSLG GHJUDGDWLRQ RI 5XELVFR GXULQJ VHQHVFHQFH LPSOLHV WKDW WKLV XSVXUJH LQ SURWHLQ ORVV PD\ UHTXLUH D GH QRYR LQFUHDVH LQ SURWHLQV LQYROYHG LQ WKLV GHJUDGDWLYH SURFHVV UDWKHU WKDQ VLPSO\ FRQWLQXHG FRQVWLWXWLYH H[SUHVVLRQ ,W LV GLIILFXOW WR GUDZ JHQHUDOL]DWLRQV DERXW ZKDW PD\ WULJJHU VHQHVFHQFH IURP WKH DQDO\VLV RI WKH IHZ PXWDQWV DYDLODEOH 7KH PXWDQW SKHQRW\SH FRXOG VLPSO\ UHVXOW

PAGE 46

IURP WKH DFFXPXODWLRQ RI SDUWLFXODU SODVWLG FRPSRQHQWV GXH WR ORVV RI D VLQJOH IXQFWLRQ DQG PD\ QRW UHSUHVHQW D SURWHLQ WKDW LV GHYHORSPHQWDOO\ LQGXFHG GXULQJ VHQHVFHQFH ,W VHHPV VDIH WR DVVXPH WKDW WKH QRQ\HOORZLQJHVZD] GHPRQVWUDWHV WKDW DOWKRXJK WKH WK\ODNRLG PHPEUDQHV FDQ GHJUDGH LQ UHVSRQVH WR SKRWRR[LGDWLYH VWUHVV WKH PRUH JUDGXDO DQG SHUKDSV GDUN DVVRFLDWHG EUHDNGRZQ UHTXLUHV SURWHDVHV WKDW DUH QRW DFWLYH XQWLO WKH SLJPHQW FRPSRQHQW KDV EHHQ PRGLILHG ,W ZRXOG EH H[WUHPHO\ KHOSIXO LI SURWHLQV RU WKH JHQHV UHVSRQVLEOH IRU WKH VHQHVFHQFH RI FKORURSODVWV FRXOG EH LVRODWHG $Q XQGHUVWDQGLQJ RI WKHLU UHJXODWLRQ FRXOG VXJJHVW KRZ VHQHVFHQFH LV FRQWUROOHG ,W LV SRVVLEOH WKDW WKH FRQYHUVLRQ IURP FKORURSODVW WR FKURPRSODVW PD\ UHSUHVHQW DQ LGHDO V\VWHP IRU WKH LVRODWLRQ DQG LGHQWLILFDWLRQ RI F'1$ FORQHV IRU SURWHLQV LQYROYHG LQ WKLV GHJUDGDWLYH SURFHVV VLQFH WKH FKURPRSODVW WUDQVLWLRQ GRHV QRW WDNH SODFH LQ D VHQVHFLQJ WLVVXH +HDW 6KRFN 3URWHLQV DQG 2[LGDWLYH 6WUHVV 7KH LGHQWLILFDWLRQ RI D FKURPRSODVWDVVRFLDWHG ORZ 0: KHDW VKRFN SURWHLQV KVSf GXULQJ WKLV VWXG\ SURYRNHG DQ LQYHVWLJDWLRQ LQWR WKH OLWHUDWXUH RQ ZK\ WKLV KVS PD\ KDYH EHHQ LQGXFHG GXULQJ WKH FKORURSODVW WR FKURPRSODVW WUDQVLWLRQ 2QH SRVVLELOLW\ LV WKDW WKH ORZ 0: KVS LV LQGXFHG GXULQJ FHUWDLQ GHYHORSPHQWDO VWDJHV +LVWRULFDOO\ WKH LQGXFWLRQ RI ORZ 0: KVSV RFFXUV GXULQJ WLPHV ZKHQ UDSLG UHVWUXFWXULQJ RI WKH WLVVXH LV XQGHUZD\ $UULJR f ,W LV DOVR IHDVLEOH WKDW WKH KVS LV LQGXFHG EHFDXVH WKH WLVVXH LV HQGXULQJ DQ R[LGDWLYH VWUHVV +VS LQGXFWLRQ E\ FRPSRXQGV WKDW FUHDWH R[LGDWLYH GDPDJH KDV EHHQ GHVFULEHG LQ DQLPDO WLVVXHV

PAGE 47

'UXPPRQG DQG 6WHLQKDUGW &DMRQH DQG %HUQHOOL=D]]HUD &RXUJHRQ HW DO f %RWK WKH LQGXFWLRQ RI KVSV GXULQJ GHYHORSPHQW DQG R[LGDWLYH VWUHVV ZLOO EH FRQVLGHUHG ,QWURGXFWLRQ WR +HDW 6KRFN 3URWHLQV +HDW VKRFN SURWHLQV ZHUH ILUVW LGHQWLILHG E\ WKHLU PDVVLYH LQGXFWLRQ XSRQ LQFUHDVHV RI DERXW r& DERYH DPELHQW WHPSHUDWXUH UHFHQWO\ UHYLHZHG IRU SODQWV E\ 9LHUOLQJ DQG JHQHUDOO\ E\ -DDWWHOD DQG :LVVLQJ f +VSV KDYH EHHQ IRXQG LQ D GLYHUVH UDQJH RI RUJDQLVPV IURP EDFWHULD WR PDPPDOV 7KHVH SURWHLQV DUH EURDGO\ FDWHJRUL]HG E\ WKHLU PROHFXODU ZHLJKW LQ 6'63$*( $Q LQGLYLGXDO RUJDQLVP PD\ FRQWDLQ D QXPEHU RI VSDWLDOO\ DQG IXQFWLRQDOO\ GLVWLQFW SURWHLQV IURP HDFK VL]H FODVV )RU H[DPSOH D QXPEHU RI GLIIHUHQW KVS SURWHLQV KDYH EHHQ GHVFULEHG VRPH RI ZKLFK DUH SUHVHQW FRQVWLWXWLYHO\ KVFf 7KH IXQFWLRQ RI WKHVH SURWHLQV KDV EHHQ EHVW FKDUDFWHUL]HG IRU WKH FRQVWLWXWLYH PHPEHUV RI WKH KVS DQG FODVVHV 7KH N' SURWHLQ SOD\V D UROH LQ WKH DVVHPEO\ RI WKH PXOWLVXEXQLW 5XELVFR HQ]\PH FRPSOH[ 5R\ f ,QYROYHPHQW LQ WKH DVVHPEO\ RI PXOWLPHULF SURWHLQV LQ WKH PLWRFKRQGULD KDV DOVR EHHQ VKRZQ &KHQJ HW DO f 7KH N' SURWHLQV KDYH EHHQ LPSOLFDWHG LQ PRYLQJ QHZO\ V\QWKHVL]HG SURWHLQV IURP ULERVRPHV WR WKH FHOOXODU FRPSDUWPHQW LQ ZKLFK WKH\ IXQFWLRQ :HEHU f 7KH UROH RI WKH KVSV GXULQJ KHDW VKRFN KDV EHHQ LQIHUUHG IURP WKH IXQFWLRQ RI WKHLU FRQVWLWXWLYH IRUPV ,W LV WKRXJKW WKDW WKH KVSV ELQG WR SURWHLQV GHQDWXUHG E\ VXSHURSWLPDO WHPSHUDWXUHV DQG PD\ IDFLOLWDWH UHIROGLQJ :HEHU f $ UROH IRU

PAGE 48

KVSV LQ SURYLGLQJ WKHUPRWROHUDQFH KDV EHHQ VXJJHVWHG E\ H[SHULPHQWV WKDW FUHDWH SURWHFWLRQ IURP VHYHUH KHDW VKRFN E\ WKH LQGXFWLRQ RI WKHVH SURWHLQV ZLWK D EULHI RU PRGHUDWH LQFUHDVH LQ WHPSHUDWXUH UHYLHZHG E\ /LQGTXLVW DQG &UDLJ f 7KH LQGXFWLRQ RI KVS PHVVDJHV LV UDSLG DQG WUDQVLHQW UHYLHZHG E\ 1HXPDQQ HW DO f ([DPLQDWLRQ RI WKH VWHDG\VWDWH OHYHO RI 51$ IRU D QXPEHU RI GLIIHUHQW KVSV LQ VR\EHDQ UHYHDOHG WKDW OHYHOV GHFD\ PRUH TXLFNO\ DW QRUPDO WHPSHUDWXUHV WKDQ GXULQJ KHDW VWUHVV DQG WKH DEVROXWH DPRXQW RI KVSV LQGXFHG LV ORZHU LQ SODQWV WKDW KDYH EHHQ SUHYLRXVO\ H[SRVHG WR D VPDOO KHDW VWUHVV .LPSHO HW DO f 7KLV LV UHPLQLVFHQW RI WKH WKHUPRWROHUDQFH UHVSRQVH LQ WKDW WKH UHDFWLRQ WR KHDW VKRFN LV UHGXFHG E\ KHDW SUHWUHDWPHQW 7KH WUDQVLHQW QDWXUH RI WKLV UHVSRQVH LV DSSDUHQW LQ WKH IDFW WKDW WKH KVS PHVVDJH KDG DOUHDG\ EHJXQ WR GHFD\ ZKLOH WKH WHPSHUDWXUH ZDV VWLOO KLJK DQG WKH PHVVDJH ZDV XQGHWHFWDEOH ZLWKLQ KRXUV DIWHU WKH SHDN WHPSHUDWXUH .LPSHO HW DO f 7KH LQGXFWLRQ RI KHDW VKRFN SURWHLQV LQ ILHOG JURZQ SODQWV KDV DOVR EHHQ GHPRQVWUDWHG %XUNH HW DO .LPSHO DQG .H\ f .LPSHO DQG .H\ f IRXQG WKDW D WUDQVLHQW LQFUHDVH LQ WKH PHVVDJH IRU ERWK ORZ DQG KLJK 0: KVSV RFFXUV XQGHU IDLUO\ QRUPDO *HRUJLD VXPPHU ILHOG FRQGLWLRQV ZLWK VR\EHDQ 7KLV LQGXFWLRQ LV GUDPDWLFDOO\ HQKDQFHG LQ QRQLUULJDWHG SODQWV %XUNH HW DO f DOVR VKRZHG VLPLODU UHVSRQVHV LQ PDWHULDO IURP LUULJDWHG YHUVXV QRQ LUULJDWHG ILHOGV +RZHYHU WKH\ FRPSDUHG WKH FDQRS\ WHPSHUDWXUHV DQG IRXQG WKDW WKH QRQLUULJDWHG ILHOG ZDV r& DERYH WKH WHPSHUDWXUH LQ WKH LUULJDWHG ILHOG 7KLV LV DQ LPSRUWDQW SRLQW VLQFH WKH TXDQWLW\ RI KVS PHVVDJH SURGXFHG LQFUHDVHV ZLWK LQFUHDVLQJ WHPSHUDWXUH &KHQ HW DO .LPSHO HW DO f

PAGE 49

/RZ 0: +HDW 6KRFN 3URWHLQV ,Q SODQWV WKH ORZ 0: KVSV DUH JHQHUDOO\ QRW SUHVHQW DW GHWHFWDEOH OHYHOV LQ OHDYHV XQGHU QRQVWUHVV FRQGLWLRQV 9LHUOLQJ f 7KH ORZ 0: KVSV UHSUHVHQW D VPDOO PXOWLJHQH IDPLO\ WKDW KDV EHHQ VXEGLYLGHG RQ WKH EDVLV RI DPLQR DFLG VHTXHQFH VLPLODULW\ 9LHUOLQJ f &ODVVHV RI WKLV IDPLO\ KDYH EHHQ IRXQG LQ WKH F\WRVRO SODVWLG DQG HQGRSODVPLF UHWLFXOXP ,Q IDFW RQH FODVV RI ORZ 0: KVS LV LQGXFHG GXULQJ PHLRVLV %RXFKDUG f 8SRQ LQGXFWLRQ WKH ORZ 0: KVSV FDQ DFFXPXODWH WR PDVVLYH DPRXQWV DQG IRUP ODUJH FU\VWDOOLQH GHSRVLWV ZLWKLQ WKH F\WRSODVP /RZ 0: +HDW 6KRFN 3URWHLQV DQG 'HYHORSPHQW 7KH ORZ 0: KVSV KDYH EHHQ IRXQG WR LQFUHDVH WUDQVLHQWO\ DW GLIIHUHQW WLPHV GXULQJ GHYHORSPHQW 7KH EHVW FKDUDFWHUL]HG GHYHORSPHQWDO LQGXFWLRQ RI WKHVH SURWHLQV LV IRXQG GXULQJ 'URVRSKLOD HPEU\RQLF GHYHORSPHQW $UULJR f VXJJHVWHG WKDW WKH SHULRG RI GHYHORSPHQW LQ ZKLFK WKHVH SURWHLQV DUH PRVW KLJKO\ LQGXFHG UHSUHVHQWV D WLPH RI PDVVLYH GHYHORSPHQWDO FKDQJH ZKHQ WKH FHOO PD\ QHHG FDUHIXOO\ FRQWUROOHG PHFKDQLVPV IRU RYHUDOO WUDQVIRUPDWLRQ )RXU ORZ 0: KVSV UDQJLQJ LQ VL]H IURP WR N'f IROORZ D FRPSOH[ SDWWHUQ RI H[SUHVVLRQ WKDW DSSHDUV WR EH PHGLDWHG E\ WKH PROWLQJ KRUPRQH HFG\VWHURQH $GGLWLRQ RI WKLV KRUPRQH WR HPEU\RQLF FHOO OLQHV LQGXFHV WKHVH SURWHLQV UHYLHZHG LQ %RQG DQG 6FKOHVLQJHU f 'HOHWLRQ DQDO\VLV RI WKHLU SURPRWHUV LQGLFDWHG WKDW UHJLRQV RI WKH '1$ UHVSRQVLYH WR KRUPRQH DQG KHDW LQGXFWLRQ UHVLGH LQ VHSDUDWH SRUWLRQV RI WKH JHQH 7KH VDPH KVS LV WKHUHIRUH LQGXFHG GHYHORSPHQWDOO\ DQG E\ KHDW VWUHVV 6LQFH KHDW FDXVHV

PAGE 50

GHVWDELOL]DWLRQ DQG XQIROGLQJ RI SURWHLQV DQG HPEU\R GHYHORSPHQW VXJJHVWV UDSLG SURWHLQ ELRJHQHVLV WKH LQGXFWLRQ RI WKH VDPH JURXS RI SURWHLQV GXULQJ ERWK HYHQWV LPSOLHV WKDW WKH\ DUH LQYROYHG LQ HLWKHU VWDELOL]LQJ RU GHJUDGLQJ LQFRUUHFWO\ IROGHG SURWHLQV (YLGHQFH IRU D GHYHORSPHQWDO FKDQJH LQ ORZ 0: KVSV KDV EHJXQ WR DFFXPXODWH LQ KLJKHU SODQWV 7KH DQG N' KVSV DUH SUHVHQW LQ GU\ HPEU\RV RI ZKHDW DQG WKHLU P51$ KDV DOVR EHHQ LVRODWHG IURP TXLHVFHQW ZKHDW HPEU\RV QRW VXEMHFWHG WR KHDW VWUHVV +HOP DQG $EHUQHWK\ f 7KHVH DXWKRUV SURSRVH WKDW WKHVH KVSV PD\ DFW WR SURWHFW WKH VHHG HDUO\ LQ GHYHORSPHQW IURP WKH HIIHFWV RI H[FHVV KHDW 6LQFH WKH JHUPLQDWLQJ ZKHDW HPEU\R KDV IHZHU PHFKDQLVPV WR FRQWURO DPELHQW WHPSHUDWXUH LQ FRPSDULVRQ WR DQ ROGHU VHHGOLQJ PD\EH WKH SURGXFWLRQ RI KVSV DOORZV WKH RUJDQLVP WR WROHUDWH WKLV WUDQVLHQWO\ KDUVK HQYLURQPHQW +HOPV DQG $EHUQHWK\ f 7KH ZKHDW HPEU\R KVSV DOVR GHPRQVWUDWH KRZ WKH JHQHV IRU KVSV PD\ UHVSRQG GLIIHUHQWO\ WR KHDW VWUHVV DW GLIIHUHQW VWDJHV RI GHYHORSPHQW 7KHVH SURWHLQV DUH KHDW LQGXFLEOH DW HDUO\ WLPHV GXULQJ LPELELWLRQ +RZHYHU WKH\ DUH QRW LQGXFHG DIWHU DV OLWWOH DV KRXUV RI LPELELWLRQ +HOP HW DO f 7KH ZKHDW VHHG LV LQLWLDOO\ TXLWH WROHUDQW WR KHDW VWUHVV VXFK WKDW SUHWUHDWPHQW ZLWK D ORZ EXW KVS LQGXFLQJ WHPSHUDWXUH GRHV QRW LPSURYH WKLV WKHUPRWROHUDQFH $EHUQHWK\ HW DO f %\ KRXUV RI LPELELWLRQ KRZHYHU D SUHWUHDWPHQW FDQ LPSURYH WKH VXUYLYDO RI WKH VHHG WR KHDW VWUHVV $EHUQHWK\ HW DO f $QRWKHU LQWHUSUHWDWLRQ RI WKHVH GDWD IURP ZKHDW KRZHYHU FRXOG EH WKDW UDWKHU WKDQ SURWHFWLQJ WKH \RXQJ HPEU\R IURP KHDW

PAGE 51

VWUHVV SHUKDSV WKH KVSV DUH SUHVHQW LQ SUHSDUDWLRQ IRU GHYHORSPHQW DQG FRQVHTXHQWO\ DGGLWLRQDO LQGXFWLRQ E\ KHDW PD\ EH XQQHFHVVDU\ 0HVVDJHV IRU ORZ 0: KVSV KDYH EHHQ IRXQG LQ GU\ HPEU\RV LQ RWKHU SODQW VSHFLHV 7KH P51$ WR D N' KVS LV SUHVHQW LQ GU\ VHHG DQG DFFXPXODWHV GXULQJ HPEU\R GHYHORSPHQW RI VXQIORZHU $OPRJXHUD DQG -RUGDQR f 7KLV F'1$ DOVR K\EULGL]HV WR P51$ IURP GD\ROG VHHGOLQJV VXEMHFWHG WR $%$ PDQQLWRO RU KHDW VWUHVV 7KH P51$ IRU DQ DOIDOID KVS KDV EHHQ IRXQG WR EH SUHVHQW LQ PLFURFDOOXV VXVSHQVLRQ DQG LQFUHDVHV WUDQVLHQWO\ GXULQJ HPEU\R IRUPDWLRQ DW QRUPDO WHPSHUDWXUHV *\RUJ\H\ HW DO f 7KLV F'1$ DOVR K\EULGL]HV WR 51$ IURP FDOOXV VXEMHFWHG WR &G&O VXFURVH DQG KHDW VWUHVV 7KHVH GDWD GHPRQVWUDWH WKDW WUDQVFULSWV IRU ORZ 0: KVSV KDYH EHHQ IRXQG LQ SODQW HPEU\RV DQG DSSHDU WR EH GHYHORSPHQWDOO\ SURGXFHG DW QRQKHDW VWUHVV WHPSHUDWXUHV +RZHYHU LW LV XQFOHDU IURP WKHVH GDWD ZKHWKHU WKH WUDQVFULSW LQGXFHG E\ VWUHVV LV HQFRGHG E\ WKH VDPH GHYHORSPHQWDOO\ LQGXFHG JHQH RU UHSUHVHQWV DQRWKHU PHPEHU RI D PXOWLJHQH IDPLO\ 3ODVWLG/RFDOL]HG /RZ 0: +HDW 6KRFN 3URWHLQV $ VWUXFWXUDO DQDO\VLV RI SODVWLGORFDOL]HG ORZ 0: KHDW VKRFN SURWHLQV PD\ VXJJHVW D SRVVLEOH IXQFWLRQ &KHQ DQG 9LHUOLQJ f KDYH FRPSDUHG WKH GHGXFHG DPLQR DFLG VHTXHQFHV RI RI WKHVH SODVWLG SURWHLQV DQG KDYH UHSRUWHG WKUHH FRQVHUYHG UHJLRQV 7ZR RI WKHVH UHJLRQV DUH DOVR SUHVHQW LQ WKH ORZ 0: KVSV IRXQG LQ WKH F\WRSODVP $ WKLUG FDUER[\O WHUPLQDO FRQVHQVXV UHJLRQ ZKLFK LV DEXQGDQW LQ PHWKLRQLQH LV XQLTXH WR WKH SODVWLGORFDOL]HG ORZ 0: SURWHLQV &RPSXWHU DQDO\VLV

PAGE 52

RI WKH WHUWLDU\ VWUXFWXUH RI WKH SURWHLQ LQ WKLV PHWKLRQLQH ULFK UHJLRQ VXJJHVWHG WKDW DQ DOSKD KHOL[ ZLWK D K\GURSKRELF DQG K\GURSKLOLF IDFH FRXOG IRUP &KHQ DQG 9LHUOLQJ f 7KLV VDPH W\SH RI WKUHH GLPHQVLRQDO VWUXFWXUH LV SUHGLFWHG IRU WKUHH VXFK PHWKLRQLQH ULFK UHJLRQV RI WKH 653 VLJQDO UHFRJQLWLRQ SDUWLFOHf ZKLFK LV LQYROYHG LQ WUDQVSRUWLQJ QHZO\ V\QWKHVL]HG SURWHLQV LQ WKH HQGRSODVPLF UHWLFXOXP /XWNH HW DO f &DUHIXO VWUXFWXUHIXQFWLRQ DQDO\VLV RI WKLV UHJLRQ LQ 653 DQG LWV LQWHUDFWLRQ ZLWK VLJQDO SHSWLGHV XVLQJ FURVVOLQNLQJ UHDJHQWV DQWLERGLHV SURGXFHG DJDLQVW VSHFLILF IUDJPHQWV RI WKH 653 DQG GHOHWLRQ DQDO\VLV RI WKLV SURWHLQ UHYHDOHG WKDW ELQGLQJ RI VLJQDO VHTXHQFHV RI QDVFHQW SURWHLQV RFFXUV KHUH /XWFNH HW DO f %LQGLQJ H[SHULPHQWV ZLWK WKH ,6 51$ VKRZHG WKDW WKLV VDPH UHJLRQ LV LQYROYHG LQ LQWHUDFWLRQ ZLWK WKH 51$ +LJK DQG 'REEHUVWHLQ f VXJJHVWHG WKDW WKH 653 LQWHUDFWV ZLWK VLJQDO SHSWLGH RQ WKH PHWKLRQLQH ULFK K\GURSKRELF IDFH DQG ZLWK 51$ RQ WKH K\GURSKLOLF IDFH ,W LV WHPSWLQJ WR VSHFXODWH WKDW WKH ORZ 0: SODVWLGORFDOL]HG KVS LV LQYROYHG LQ D VLPLODU SURWHLQSURWHLQ LQWHUDFWLRQ 3HUKDSV WKH QHHG IRU WKHVH KVSV LV LQFUHDVHG GXULQJ WLPHV ZKHQ H[FHVVLYH LQFRUUHFWO\ IROGHG SURWHLQV DUH SUHVHQW 7KH VXEORFDOL]DWLRQ RI WKH SODVWLGORFDOL]HG ORZ 0: KVS KDV EHHQ FRQWURYHUVLDO :RUN E\ .ORSSVWHFK DQG FROOHDJXHV VXJJHVWHG WKDW WKLV KVS EHFRPHV DVVRFLDWHG ZLWK WK\ODNRLG PHPEUDQHV XSRQ KHDW VWUHVV .ORSSVWHFK HW DO f +RZHYHU WKLV RFFXUV RQO\ ZLWK SODQWV JURZQ DW ORZ OLJKW LQWHQVLWLHV *ODF]LQVNL DQG .ORSSVWHFK f %LQGLQJ RI KVS WR WKH PHPEUDQH RFFXUV PRVW DEXQGDQWO\ DW D OLJKW LQWHQVLW\ EHORZ WKH OHYHO DW ZKLFK QHW FDUERQ LV IL[HG &RQVLGHULQJ WKH WUDQVLHQW

PAGE 53

QDWXUH RI WKHVH SURWHLQV DQG WKDW WKHLU WUDQVFULSWLRQ XVXDOO\ UHTXLUHV KHDW VWUHVV WKLV FRPELQDWLRQ RI FLUFXPVWDQFHV FRXOG RFFXU DW GXVN LQ VXPPHU RU RQ WKH IORRU RI D WURSLFDO UDLQ IRUHVW &KHQ HW DO f KDYH VKRZQ WKDW XQGHU KHDW VWUHVV DQG KLJKHU OLJKW OHYHOV WKLV KVS UHPDLQV SUHGRPLQDQWO\ LQ WKH VWURPD 7KH\ UHSRUWHG WKDW WKH RQO\ SODVWLGORFDOL]HG ORZ 0: KVS IURP SHD DVVRFLDWHV LQWR N' VWURPDO FRPSOH[HV &ODUNH DQG &ULWFKOH\ f VKRZHG WKDW RQH RI WKH WZR ORZ 0: SODVWLGORFDOL]HG KVSV WKH N' IRUP IURP KHDW VWUHVVHG EDUOH\ OHDYHV DVVRFLDWHV LQWR WR N' FRPSOH[HV ZLWKLQ WKH VWURPD DQG FRQWDLQV QR 51$ '1$ RU WKH DVXEXQLW RI WKH 5XELVFR ELQGLQJ SURWHLQ 7KLV SURWHLQ LV UHPLQLVFHQW RI DQ KVS IRXQG LQ VR\EHDQ SODVWLGV ZKLFK DOVR FRQWDLQV WZR ORZ 0: KVSV RI DQG N' &ODUN DQG &ULWFKOH\ f 7KH LGHD WKDW WKH PHWKLRQLQH ULFK UHJLRQ FRXOG LQWHUDFW ZLWK GHQDWXUHG SURWHLQV GXULQJ KHDW VWUHVV VXJJHVWV WKDW WKHVH FRPSOH[HV FRXOG VHTXHVWHU XQIROGHG SURWHLQV 7KH KVS DOVR DVVRFLDWHV LQWR DQ N' ROLJRPHU RI VXEXQLWV 5R\ f 3HUKDSV WKH UROH RI WKH SODVWLGORFDOL]HG ORZ 0: KVS ZLOO EH HDVLHU WR UHVROYH LI OLNH WKH KVS DQG V D FRQVWLWXWLYH RU GHYHORSPHQWDOO\ DVVRFLDWHG IRUP FDQ EH LGHQWLILHG 0D\EH WKH FKURPRSODVWDVVRFLDWHG ORZ 0: KVS GHVFULEHG ZLWKLQ WKLV ZRUN LV LQGXFHG E\ WKH GHJUDGDWLRQ RI SURWHLQV IRU WKH SKRWRV\QWKHWLF DSSDUDWXV WKDW RFFXUV EHWZHHQ PDWXUH JUHHQ DQG LQWHUPHGLDWH VWDJHV RI IUXLW ULSHQLQJ ,QGXFWLRQ RI +HDW 6KRFN 3URWHLQV %\ 2WKHU 6WUHVVHV +VSV FDQ DOVR EH LQGXFHG E\ KHDY\ PHWDOV HWKDQRO DPLQR DFLG DQDORJXHV DQG JOXFRVH VWDUYDWLRQ 9LHUOLQJ f $UVHQLWH DQG FDGPLXP SURGXFHG WKH JUHDWHVW

PAGE 54

LQGXFWLRQ RI KVSV &]DUQHFND HW DO (GHOPDQ HW DO f $W ORZHU FRQFHQWUDWLRQV RI WKHVH FRPSRXQGV WKH UHVSRQVH OLNH WKH KHDW VWUHVV UHVSRQVH ZDV DOVR WUDQVLHQW %\ KRXUV RI H[SRVXUH WKH PHVVDJHV KDG EHJXQ WR GLPLQLVK (GHOPDQ HW DO f 2[LGDWLYH VWUHVV DQG WKH LQGXFWLRQ RI KVSV 7KH LQLWLDO FRUUHODWLRQ EHWZHHQ KHDW DQG R[LGDWLYH VWUHVV ZDV PDGH LQ DQ H[DPLQDWLRQ RI 'URVRSKLOD VDOLYDU\ JODQGV 3XIIV UHSUHVHQWLQJ KLJK OHYHOV RI WUDQVFULSWLRQ PD\ RFFXU DW WKH VDPH ORFL DORQJ WKH FKURPRVRPH ZKHQ HLWKHU D KHDW RU R[LGDWLYH VWUHVV LV DSSOLHG UHYLHZHG E\ /RYHQ f $ FRPELQDWLRQ RI KHDW WUHDWPHQW DQG DSSOLFDWLRQ RI DQ R[LGL]LQJ DJHQW FDQ DFW V\QHUJLVWLFDOO\ WR UHGXFH WKH GHOHWHULRXV HIIHFW RI D VXEVHTXHQW KHDW VWUHVV ,VVHOV HW DO f 7KLV WKHUPRWROHUDQFH GHYHORSHG IURP R[LGDWLYH VWUHVV LQGXFHUV FDQ EH EORFNHG E\ WKH DGGLWLRQ RI FDWDODVH GXULQJ WKH LQGXFWLRQ SHULRG ,VVHOV HW DO f 6WXGLHV LQ 'URVRSKLOD FHOOV 'UXPPRQG DQG 6WHLQKDUGW &RXUJHRQ HW DO f DQG UDW KHSDWRF\WHV &DMRQH DQG %HUQHOOL=D]]HUD f VKRZ D PLOG LQGXFWLRQ RI VRPH KVSV E\ R[LGDWLYH VWUHVV ,Q DGGLWLRQ GLIIHUHQW KVSV ZHUH LQGXFHG E\ GLIIHUHQW FKHPLFDOV &DMRQH DQG %HUQHOOL=D]]HUD f +VSV DUH DOVR LQGXFHG E\ R[LGDWLYH VWUHVV LQ 'URVRSKLOD FHOOV &RXUJHRQ HW DO f ZKHUH KVS DQG KVS ZHUH LQGXFHG E\ K\GURJHQ SHUR[LGH 7KHVH H[SHULPHQWV SRLQW WR WKH FRQFOXVLRQ WKDW R[LGDWLYH VWUHVV DQG KHDW VKRFN ZKLFK LQGXFH PDQ\ RI WKH VDPH SURWHLQV GR QRW SURYRNH DQ LGHQWLFDO UHVSRQVH

PAGE 55

+HDW VWUHVV DQG WKH LQGXFWLRQ RI IUHH UDGLFDO VFDYHQJLQJ HQ]\PHV ,W VWLOO LV QRW HQWLUHO\ FOHDU KRZ KHDW DQG R[LGDWLYH VWUHVV DUH UHODWHG +HDW VKRFN XQFRXSOHV R[LGDWLYH SKRVSKRU\ODWLRQ DQG WKLV FUHDWHV DQ LQFUHDVHG OHYHO RI UHDFWLYH R[\JHQ VSHFLHV /RYHQ f $GGLWLRQDOO\ D OLQN KDV EHHQ PDGH EHWZHHQ WKH DSSOLFDWLRQ RI D KHDW VWUHVV DQG DQ LQGXFWLRQ RI IUHH UDGLFDO VFDYHQJLQJ HQ]\PHV $ K\SHUWKHUPLD LQGXFHG LQFUHDVH LQ 62' &$7 DQG JOXWDWKLRQH OHYHOV RFFXUV ZLWK H[HUFLVH WUDLQLQJ RI VNHOHWDO PXVFOH UHYLHZHG LQ %DLMD GH 4XLURJD f 7KH LPSOLFDWLRQ LV WKDW WKHVH DQWLR[LGDQWV DUH LQGXFHG E\ PLOG KHDW VWUHVV SURGXFHG GXULQJ H[HUFLVH 7KHVH DGGLWLRQDO DQWLR[LGDQWV UHGXFH WKH ORQJ WHUP GHOHWHULRXV HIIHFWV RI IUHH UDGLFDOV SURGXFHG LQ WKLV WLVVXH IURP WKH XQFRXSOLQJ RI R[LGDWLYH SKRVSKRU\ODWLRQ 7KH KHDW LQGXFHG LQGXFWLRQ RI SODQW 62' ZDV DOVR QRWHG E\ 7VDQJ HW DO f LQ WREDFFR 7KH F\WRVROLF IRUP RI 62' ZDV LQGXFHG PRVW GUDPDWLFDOO\ FRPSDUHG ZLWK WKH PLWRFKRQGULDO RU SODVWLG IRUP LQ WREDFFR 7KLV LQIHUV WKDW SODQWV DOVR PD\ UHVSRQG WR KHDW VWUHVV E\ LQGXFLQJ HQ]\PHV LQYROYHG LQ R[LGDWLYH VWUHVV &RQFOXVLRQV DERXW WKH UHODWLRQVKLS RI KHDW DQG R[LGDWLYH VWUHVV 6LQFH ERWK KHDW DQG R[LGDWLYH VWUHVVHV SURGXFH D VLPLODU UHVSRQVH D QXPEHU RI K\SRWKHVHV KDYH EHHQ GHYHORSHG WR H[SODLQ KRZ WKH\ DUH UHODWHG 6RPH DXWKRUV KDYH VXJJHVWHG WKDW WKH GHOHWHULRXV HIIHFWV RI KHDW VWUHVV DUH GXH VROHO\ WR R[LGDWLYH GDPDJH /RYHQ f 7KLV LGHD PD\ EH D ELW H[WUHPH LQ YLHZ RI WKH IDFW WKDW KVSV FDQ EH LQGXFHG XQGHU DQR[LD LQ 'URVRSKLOD FHOOV 'UXPPRQG DQG 6WHLQKDUGW f 5DWKHU WKDQ WKH LQGXFWLRQ RI DQWLR[LGDQWV WKHUHIRUH WKLV W\SH RI DVVHUWLRQ UHTXLUHV

PAGE 56

WKDW GLUHFW R[LGDWLYH GDPDJH EH PHDVXUHG ZKLFK FDQ EH GRQH E\ H[DPLQLQJ WKH DPRXQW RI OLSLG SHUR[LGDWLRQ +RZHYHU IHZ VWXGLHV KDYH EHHQ SUHIRUPHG LQ ZKLFK K\SHUWKHUPLD LV GLUHFWO\ FRUUHODWHG ZLWK R[LGDWLYH VWUHVV %DLMD GH 4XLURJD f $ FRUROODU\ WR WKLV LGHD ZDV GHYHORSHG LQ $UQHfV ODE /HH HW DO f LQ ZKLFK WKH V\QWKHVLV RI ELVQXFOHRVLGH SRO\SKRVSKDWHV DOVR WHUPHG DODUPRQHV DFWV DV WKH VLJQDO IRU R[LGDWLYH VWUHVV LQGXFWLRQ RI KVSV $SSDUHQWO\ DQ LQFUHDVH LQ WKHVH FRPSRXQGV LV REVHUYHG GXULQJ ERWK RI WKHVH VWUHVVHV +RZHYHU LW ZDV VRRQ GHPRQVWUDWHG WKDW WKH V\QWKHVLV RI DODUPRQHV LV LQKLELWHG E\ KHDW VWUHVV UDWKHU WKDQ LQGXFHG $ EXLOGXS LQ WKHVH FRPSRXQGV RFFXUV EHFDXVH WKHLU GHJUDGDWLRQ LV DFWXDOO\ LQKLELWHG E\ KHDW $GGLWLRQ RI DODUPRQHV WR FHOOV ZDV DOVR VKRZQ WR KDYH QR HIIHFW RQ WKH LQGXFWLRQ RI KVSV DQG KVSV FRXOG DFWXDOO\ EH LQGXFHG ZLWKRXW DQ LQFUHDVH LQ WKH DPRXQW RI WKHVH FRPSRXQGV *XHGRQ HW DO f 7KH K\SRWKHVLV WKDW LV FXUUHQWO\ IDYRUHG IRU WKH LQGXFWLRQ RI KVSV E\ R[LGDWLYH VWUHVV LV WKDW ERWK KHDW DQG IUHH UDGLFDOV FUHDWH DEHUUDQW SURWHLQV WKDW OHDG WR WKH SURGXFWLRQ RI KVSV 1HXPDQQ HW DO f 7KLV SUREDEO\ H[SODLQV ZK\ WKH WZR VWUHVV UHVSRQVHV GR QRW FRPSOHWHO\ RYHUODS 6LQFH K\SHUWKHUPLD FUHDWHV XQVWDEOH SURWHLQV DQG XQFRXSOHV R[LGDWLYH SKRVSKRU\ODWLRQ WKH LQFUHDVH LQ IUHH UDGLFDOV DQG WKH UHVXOWLQJ UHVSRQVH PD\ RFFXU VHFRQGDULO\ 2[LGDWLYH VWUHVV PD\ PDLQO\ LQGXFH IUHH UDGLFDO VFDYHQJHUV ZKLFK FDQ IRUHVWDOO WKH SURGXFWLRQ RI ODUJH QXPEHUV RI DEHUUDQW SURWHLQV

PAGE 57

&RQFOXVLRQV 7KH PROHFXODU FKDUDFWHUL]DWLRQ RI IUXLW ULSHQLQJ KDV VKRZQ WKDW WKH HYHQWV WKDW FKDUDFWHUL]H WKH PDWXUDWLRQ RI WRPDWR IUXLW LQYROYH WKH GH QRYR V\QWKHVLV RI D VXEVHW RI ULSHQLQJ DVVRFLDWHG WUDQVFULSWV $W WKLV SRLQW KRZHYHU RQO\ D IHZ JHQHV LQYROYHG LQ WKLV SURFHVV KDYH EHHQ LGHQWLILHG DQG WKHLU PRGH RI UHJXODWLRQ DVVHVVHG (YHQ WKRXJK WKH FRQYHUVLRQ RI FKORURSODVWV LQWR FKURPRSODVWV LQYROYHV WKH GHJUDGDWLRQ RI FKORURSK\OO DQG WKH EUHDNGRZQ RI WK\ODNRLG PHPEUDQHV DORQJ ZLWK D UDSLG V\QWKHVLV RI FDURWHQRLGV RQO\ D VPDOO QXPEHU RI JHQHV KDYH EHHQ LGHQWLILHG WKDW HQFRGH SURWHLQV WKDW PD\ EH LQYROYHG LQ WKLV WUDQVIRUPDWLRQ 7R GDWH WZR JHQHV LQ WRPDWR IUXLW DQG RQH LQ SHSSHU WKDW FRGH IRU SURWHLQV LQYROYHG LQ FDURWHQRLG ELRV\QWKHVLV KDYH EHHQ LVRODWHG ,Q DGGLWLRQ RQO\ D VLQJOH JHQH IRU V\QWKHVLV RI F\VWHLQH V\QWKDVH KDV EHHQ LGHQWLILHG LQ SHSSHU FKURPRSODVWV 7KHUHIRUH LW LV XQFOHDU KRZ PDQ\ SURWHLQV PD\ EH LQYROYHG LQ WKLV SURFHVV DQG ZKHWKHU WKHLU V\QWKHVLV LQFUHDVHV GXULQJ GHYHORSPHQW +LVWRULFDOO\ WKH FKDUDFWHUL]DWLRQ RI FDURWHQRLG ELRV\QWKHVLV LQ KLJKHU SODQWV LQYROYHG IROORZLQJ WKH LQFRUSRUWDLRQ RI UDGLRODEHOHG SUHFXUVRUV LQWR FUXGH HQ]\PH SUHSDUDWLRQV RU WKH LGHQWLILFDWLRQ RI WKH FRPSOLPHQW RI FDURWHQRLGV SURGXFHG E\ PXWDQWV LQ WKH ELRV\QWKHWLF SDWKZD\ 7KLV W\SH RI H[DPLQDWLRQ ZDV FRPSOLFDWHG E\ WKH SUHVHQFH RI PXOWLSOH SDWKZD\V DQG E\ WKH FRPSOH[LW\ LQKHUHQW LQ DVVD\V RI GLVUXSWHG WLVVXH 7KH DQDO\VLV RI FDURWHQRLG ELRV\QWKHVLV DV GHPRQVWUDWHG LQ EDFWHULD LQ ZKLFK LQGLYLGXDO JHQHV FDQ EH FORQHG DQG WKH DFWLYLW\ FDQ EH DVVHVVHG E\ FRPSOHPHQWDWLRQ LQ ( FROL PD\ QRZ EH SRVVLEOH LQ KLJKHU SODQWV ,Q WKLV ZD\ DQ

PAGE 58

XQDPELJXRXV DVVHVVPHQW RI WKH UROH DQ LQGLYLGXDO HQ]\PH SOD\V RQ WKH V\QWKHVLV RI FDURWHQRLGV FDQ ILQDOO\ EH HYDOXDWHG 7KH GHWHUPLQDWLRQ RI KRZ PDQ\ HQ]\PHV DUH LQYROYHG LQ WKH ELRV\QWKHVLV RI IUXLW FDURWHQRLGV FDQ EH GHWHUPLQHG ,Q DGGLWLRQ WKH FORQLQJ DQG FKDUDFWHUL]DWLRQ RI WKH JHQHV LQYROYHG LQ WKLV SDWKZD\ ZLOO DOORZ DQ XQGHUVWDQGLQJ RI KRZ WKH V\QWKHVLV RI FDURWHQRLGV LV FRQWUROOHG GXULQJ FKURPRSODVW IRUPDWLRQ 7KH VHQHVFHQFH RI FKORURSODVWV LQ OHDYHV LQYROYHV WKH EUHDNGRZQ RI SKRWRV\QWKHWLF VWUXFWXUHV LQ D JUDGXDO SURFHVV ZLWKLQ WKH SODVWLG ,W LV FOHDU IURP HYLGHQFH DFFXPXODWHG IURP WKH DQDO\VLV RI VWD\JUHHQ PXWDQWV WKDW WKH GHJUDGDWLRQ RI WK\ODNRLG PHPEUDQHV LQYROYHV DW OHDVW WZR GLIIHUHQW V\VWHPV RI SURWHLQ GHJUDGDWLRQ SRUWLRQV RI ZKLFK DUH HQFRGHG LQ ERWK WKH QXFOHXV DQG WKH F\WRSODVP +RZHYHU LW LV XQFHUWDLQ ZKHWKHU GH QRYR V\QWKHVLV RI QHZ SURWHLQV RFFXUV GXULQJ FKORURSODVW VHQHVFHQFH LQ WKH OHDYHV 'XULQJ WKH WUDQVLWLRQ RI FKORURSODVW WR FKURPRSODVW LQ SHSSHU FKURPRSODVWV DQ LQFUHDVH RI FRPSRXQGV WKDW VFDYHQJH IUHH UDGLFDOV RFFXUV 6LQFH WKH LQGXFWLRQ RI KVSV KDV EHHQ REVHUYHG GXULQJ R[LGDWLYH VWUHVV LW LV SRVVLEOH WKDW WKH LQGXFWLRQ RI DQ KVS GXULQJ IUXLW ULSHQLQJ LV FDXVHG E\ VXFK DQ LQFUHDVLQJO\ KDUVK HQYLURQPHQW &OHDUO\ WKH ULSHQLQJDVVRFLDWHG KRUPRQH HWK\OHQH FDQ LQGXFH 62' LQ WRPDWR DQG WREDFFR OHDYHV +RZHYHU WKH HYLGHQFH IRU DQ LQFUHDVH LQ HQ]\PHV LQYROYHG LQ R[LGDWLYH VWUHVV LQ WRPDWRHV UHPDLQV FRQWUDGLFWRU\ 0RUH LQIRUPDWLRQ LV QHHGHG EHIRUH FRQFOXVLRQV FDQ EH GUDZQ DERXW ZKDW UROH R[LGDWLYH VWUHVV SOD\V GXULQJ WRPDWR IUXLW ULSHQLQJ

PAGE 59

&OHDUO\ WKH WUDQVLWLRQ ZLWKLQ WKH GHYHORSLQJ FKURPRSODVW LQYROYHV D UDSLG GHJUDGDWLRQ RI SURWHLQV 7KH SHULRG EHWZHHQ PDWXUH JUHHQ DQG \HOORZ IUXLW DSSHDUV WR EH RQH LQ ZKLFK D SDUWLFXODUO\ UDSLG GHJUDGDWLRQ RI SODVWLG SURWHLQV RFFXUV 6LQFH DQ LQFUHDVH LQ KVSV KDV EHHQ DVVRFLDWHG ZLWK GHYHORSPHQWDO VWDJHV ZKHUH D JUHDW GHDO RI VWUXFWXUDO FKDQJH RFFXUV WKH FKORURSODVW WR FKURPRSODVW WUDQVLWLRQ PD\ EH DQ LGHDO HQYLURQPHQW IRU WKH LQGXFWLRQ RI WKHVH SURWHLQV

PAGE 60

&+$37(5 &+52023$677$5*(7(' 3527(,16 ,1 720$72 )58,7 ,QWURGXFWLRQ 7KH WUDQVIRUPDWLRQ RI FKORURSODVWV LQWR FKURPRSODVWV UHVXOWV LQ D GUDPDWLF DOWHUDWLRQ RI RUJDQHOODU VWUXFWXUH 7KH WK\ODNRLG PHPEUDQHV DUH GLVPDQWOHG LQ D RUGHUHG SURFHVV ZKLOH FDURWHQRLGV EXLOG XS ZLWKLQ WKH SODVWLG 7KHODQGHU HW DO f 7KH VWUXFWXUDO FKDQJHV WKDW RFFXU GXULQJ WKLV WUDQVLWLRQ KDYH EHHQ GRFXPHQWHG E\ HOHFWURQ PLFURVFRS\ +DUULV DQG 6SXUU f +RZHYHU LW LV XQFOHDU KRZ WKLV HYHQW LV UHJXODWHG 2QH RI WKH REMHFWLYHV RI WKLV SURMHFW ZDV WR GHWHUPLQH ZKHWKHU WKH GHYHORSPHQW RI FKURPRSODVWV GXULQJ WRPDWR IUXLW ULSHQLQJ LV PHGLDWHG E\ DQ LQFUHDVH LQ QXFOHDUHQFRGHG WUDQVFULSWV RI FKURPRSODVWDVVRFLDWHG SURWHLQV 6LQFH SODVWLG WUDQVFULSWLRQ DQG WUDQVODWLRQ LV JUHDWO\ UHGXFHG GXULQJ FKURPRSODVW GHYHORSPHQW .RED\DVKL f ZH KDYH IRFXVHG RQ SURWHLQV WKDW DUH QXFOHDUHQFRGHG WUDQVODWHG LQ WKH F\WRSODVP DQG LPSRUWHG LQWR WKH SODVWLG 7KH LPSRUW RI SURWHLQV LQWR SODVWLGV LV KLJKO\ VSHFLILF DQG UHTXLUHV DQ DPLQRWHUPLQDO WUDQVLW SHSWLGH ZKLFK LV QHFHVVDU\ DQG VXIILFLHQW IRU WDUJHWLQJ LQWR WKH RUJDQHOOH .HHJVWUD f :H KDYH PRQLWRUHG FKORURSODVW LPSRUW RI LQ YLWUR WUDQVODWLRQ SURGXFWV IURP 51$ RI WRPDWR IUXLW LVRODWHG DW GLIIHUHQW ULSHQLQJ VWDJHV :H KDYH DOVR H[DPLQHG WUDQVODWLRQ SURGXFWV IURP

PAGE 61

WUDQVFULSWV HQFRGHG IURP F'1$V VODWHU HW DO f ZKRVH VWHDG\VWDWH 51$ OHYHO LQFUHDVHV GXULQJ ULSHQLQJ 0DWHULDOV DQG 0HWKRGV 3ODQW 0DWHULDO 7RPDWR SODQWV /\FRSHUVLFRQ HVFXOHQWXP 0LOO FY 5XWJHUVf ZHUH JURZQ LQ D JUHHQKRXVH LQ *DLQHVYLOOH )ORULGD )UXLW ZHUH KDUYHVWHG DW IRXU ULSHQLQJ VWDJHV 0* ZDV FKDUDFWHUL]HG E\ IXOOVL]H JUHHQ IUXLW ZLWK ILUP ORFXODU WLVVXH 0* IUXLW KDG FRPSOHWHO\ GHYHORSHG ORFXODU JHO WKH b ULSH IUXLW ZHUH UHG RYHU OHVV WKDQ KDOI RI WKH RXWHU SHULFDUS DQG !b ULSH IUXLW ZHUH UHG RYHU b RI WKH RXWHU SHULFDUS 7KH SHULFDUS ZDV IUR]HQ LQ OLTXLG QLWURJHQ LPPHGLDWHO\ DIWHU KDUYHVWLQJ 3UHSDUDWLRQ DQG 7UDQVODWLRQ RI 51$ 7RWDO 51$ ZDV H[WUDFWHG E\ FRPELQLQJ WKH SURWRFROV RI 0F&DUW\ f DQG *ULHUVRQ HW DOf %ULHIO\ WKLV LQYROYHG JULQGLQJ WKH IUR]HQ WLVVXH ZLWK D FRIIHH JULQGHU DQG KRPRJHQL]LQJ LQ H[WUDFWLRQ EXIIHU ZLWK D SRO\WURQ 7KH H[WUDFWLRQ EXIIHU FRQVLVWHG RI P0 7ULV+&O S+ P0 1D&O P0 '77 b 6'6 DQG P0 ('7$ 7KH LQVROXEOH PDWHULDO ZDV SHOOHWHG DQG UHH[WUDFWHG ZLWK YROXPH RI H[WUDFWLRQ EXIIHU 7KH VXSHUQDWDQW ZDV H[WUDFWHG WLPHV ZLWK SKHQROFKORURIRUP f DQG RQH WLPH ZLWK FKORURIRUP 7KH ILQDO VXSHUQDWDQW ZDV EURXJKW WR 0 .& DQG SUHFLSLWDWHG RYHUQLJKW ZLWK YROXPHV RI HWKDQRO DW r& 7KH SUHFLSLWDWH ZDV

PAGE 62

ZDVKHG VHYHUDO WLPHV DV GHVFULEHG LQ *ULHUVRQ HW DO f DQG WKH VROXEOH PDWHULDO ZDV DSSOLHG WR D FHOOXORVH 6LJPDFHOO W\SH f FROXPQ WR UHPRYH VXEVWDQFHV WKDW LQWHUIHUH ZLWK H[WUDFWLRQ RI SRO\ $f 51$ *ULHUVRQ HW DO f 3RO\ $f 51$ ZDV LVRODWHG IURP WRWDO 51$ E\ RQH SDVVDJH RYHU ROLJRG7fFHOOXORVH %5/f ,QGLYLGXDO S720 FORQHV S720 DQG 6ODWHU HW DO f ZHUH VXEFORQHG LQWR WKH LQ YLWUR WUDQVFULSWLRQ YHFWRU S6SRUW %5/f DW WKH 3VW, VLWH 3ODVPLG '1$ ZDV LVRODWHG E\ WKH DONDOLQH O\VLV PHWKRG RI /HH DQG 5DVKHHG f 7KH SODVPLG '1$ ZDV OLQHDUL]HG DQG WUDQVFULEHG ZLWK HLWKHU 63 SRO\PHUDVH RU 7 SRO\PHUDVH DV GHVFULEHG LQ &OLQH f 7KH SRO\ $f 51$ DQG WKH LQ YLWUR WUDQVFULEHG 51$ ZHUH WUDQVODWHG VHH )LJXUH OHJHQGV IRU VSHFLILF H[SHULPHQWVf ZLWK HLWKHU D ZKHDW JHUP V\VWHP &OLQH f RU D UDEELW UHWLFXORF\WH O\VDWH V\VWHP IURP 3URPHJD 0DGLVRQ:Lf LQ WKH SUHVHQFH RI >6@PHWKLRQLQH &KORURSODVW ,VRODWLRQ DQG ,PSRUW $VVD\ &KORURSODVWV ZHUH LVRODWHG IURP SHD 3LVXP VDWLYXP / FY /D[WRQfV 3URJUHVV f VKRRWV E\ D FRPELQDWLRQ RI GLIIHUHQWLDO FHQWULIXJDWLRQ DQG 3HUFROO JUDGLHQW FHQWULIXJDWLRQ &OLQH HW DO f ,PSRUW DVVD\V ZHUH FRQGXFWHG DV GHVFULEHG E\ &OLQH f H[FHSW WKDW WUDQVODWLRQ SURGXFWV ZHUH GLOXWHG ZLWK XQODEHOOHG PHWKLRQLQH LQ LPSRUW EXIIHU SL RI WKH GLOXWHG WUDQVODWLRQ SURGXFWV ZHUH DGGHG WR SL RI FKORURSODVWV PJ FKORURSK\OOPOf ,PSRUW DVVD\V ZHUH FRQGXFWHG IRU PLQ DW r ZLWK ZKLWH OLJKW DQG O2P0 0J$73 $IWHU LQFXEDWLRQ LQWDFW FKORURSODVWV ZHUH UHLVRODWHG E\ FHQWULIXJDWLRQ WKURXJK b 3HUFROO ZLWK RU ZLWKRXW D WUHDWPHQW

PAGE 63

RI WKH SURWHDVH WKHUPRO\VLQ WR UHPRYH VXUIDFH ERXQG SURWHLQV &OLQH f 5HSXULILHG SODVWLGV ZHUH O\VHG LQ SL RI O2P0 +HSHV.2+ S+ ([SHULPHQWV WHVWLQJ WKH UHTXLUHPHQW RI $73 ZHUH FRQGXFWHG LQ IRLO ZUDSSHG WXEHV WR PDLQWDLQ GDUNQHVV 6XEIUDFWLRQDWLRQ DQG 7UHDWPHQW RI 3ODVWLGV DIWHU ,PSRUW ,Q H[SHULPHQWV H[DPLQLQJ LPSRUW RI WUDQVODWLRQ SURGXFWV IURP WRWDO SRO\ $f 51$ WKH UHSXULILHG SODVWLGV ZHUH O\VHG LQ O2P0 +HSHV.2+ S+ DQG VXEVHTXHQWO\ VXEIUDFWLRQDWHG LQWR VWURPDO VROXEOHf DQG PHPEUDQH SHOOHWf IUDFWLRQV E\ FHQWULIXJDWLRQ IRU PLQ DW [ J ,Q H[SHULPHQWV ZLWK WUDQVODWLRQ SURGXFWV IURP LQGLYLGXDO F'1$ FORQHV WKH VROXEOH IUDFWLRQ ZDV LVRODWHG IURP WKH PHPEUDQHV E\ O\VLQJ WKH SODVWLGV LQ O2P0 +HSHV.2+ S+ RQ LFH IRU PLQ DQG FHQWULIXJLQJ PLQ DW [ J 7KH PHPEUDQHV ZHUH ZDVKHG RQH WLPH ZLWK PO RI O2P0 +HSHV.2+ S+ DQG UHVXVSHQGHG LQ WKH VDPH VROXWLRQ $OWHUQDWLYHO\ WKH PHPEUDQH IUDFWLRQ ZDV ZDVKHG ZLWK 1 1D2+ &OLQH f (QYHORSHV ZHUH VHSDUDWHG IURP WK\ODNRLG PHPEUDQHV DV GHVFULEHG LQ &OLQH f KRZHYHU PO RI SODVWLGV PJ FKORURSK\OOPOf ZHUH XVHG IRU HDFK LPSRUW UHDFWLRQ 6HQVLWLYLW\ RI WKH LPSRUWHG SURWHLQV WR WKHUPRO\VLQ ZDV WHVWHG DV IROORZV $ VWDQGDUG LPSRUW DVVD\ ZDV FDUULHG RXW DQG GLYLGHG LQWR WZR HTXDO IUDFWLRQV 7KHVH IUDFWLRQV ZHUH HLWKHU UHVXVSHQGHG LQ LPSRUW EXIIHU RU O\VHG ZLWK O2P0 +HSHV.2+ S+ $OLTXRWV RI SL OPJ FKORURSK\OOPOf ZHUH LQFXEDWHG ZLWK RU SJ RI WKHUPRO\VLQ IRU PLQ DW r & ('7$ ZDV DGGHG WR P0 DQG WKH VDPSOHV ZHUH

PAGE 64

LPPHGLDWHO\ IUR]HQ $Q HTXDO YROXPH RI ;6'6 3$*( EXIIHU &OLQH f ZDV DGGHG WR IUHVKO\ WKDZHG VDPSOHV DQG WKH WXEHV ZHUH KHDWHG WR r & IRU PLQ $QDO\VLV RI ,PSRUW 3URGXFWV ,PSRUW SURGXFWV IURP WRWDO SRO\ $f 51$ ZHUH H[DPLQHG E\ 6'63$*( DQG IOXRURJUDSK\ RQ bb JUDGLHQW JHOV &OLQH f *HO ODQHV UHFHLYHG HTXLYDOHQW DPRXQWV RI SURWHLQ DV GHWHUPLQHG E\ FKORURSK\OO HVWLPDWLRQ RI WKH UHFRYHUHG SODVWLGV ,PSRUW SURGXFWV IURP LQ YLWUR WUDQVFULEHG 51$ ZHUH H[DPLQHG RQ b 6'6 3$*( JHOV 5HVXOWV DQG 'LVFXVVLRQ 3URILOHV RI LQ YLWUR WUDQVODWLRQ SURGXFWV RI SRO\ $f 51$ GLIIHUHG PDUNHGO\ EHWZHHQ ULSH IUXLW DQG PDWXUH JUHHQ WLVVXH )LJ$f 7KH SURILOHV RI WKH WZR ODWHU ULSHQLQJ VWDJHV FORVHO\ UHVHPEOHG RQH DQRWKHU DV GLG WKH WUDQVODWLRQ SURGXFWV IURP WKH WZR VDPSOHV RI PDWXUH JUHHQ WLVVXH 6SHLUV HW DO f UHSRUWHG D VLPLODU UHVXOW IURP D PRUH GHWDLOHG DQDO\VLV RI WKH SRO\SHSWLGH SURILOHV RI WRWDO P51$ IURP ULSHQLQJ WRPDWR IUXLW 3HD FKORURSODVWV ZHUH FKRVHQ WR DQDO\]H LPSRUW LQWR SODVWLGV EHFDXVH RI WKHLU HDVH RI LVRODWLRQ 7KH LVRODWLRQ RI WRPDWR FKURPRSODVWV KDV EHHQ UHSRUWHG E\ RWKHUV ,ZDWVXNL HW DO %DWKJDWH HW DO +XQW HW DO :UHQFK HW DO f EXW ZH ZHUH XQDEOH WR LVRODWH SXUH DQG LQWDFW IUXLW FKURPRSODVWV WKDW ZLWKVWDQG WKH KDQGOLQJ UHTXLUHG WR GHPRQVWUDWH VXFFHVVIXO LPSRUW +RZHYHU LQ YLWUR LPSRUW RI DQ

PAGE 65

DP\ORSODVW VSHFLILF SURWHLQ LQWR FKORURSODVWV .ORVJHQ HW DO f DQG WKH LQ YLYR LPSRUW RI D FKORURSODVW SURWHLQ LQWR QRQJUHHQ SODVWLGV XVLQJ WUDQVJHQLF SODQWV GH%RHU HW DO f LPSOLHG WKDW FKURPRSODVW SURWHLQV VKRXOG DOVR EH LPSRUWHG LQWR SHD FKORURSODVWV &KDQJHV LQ WKH SURILOH RI LPSRUWHG SURWHLQV GXULQJ FKURPRSODVW GHYHORSPHQW ZHUH GHWHFWHG )LJ,%f $ QXPEHU RI SURWHLQV GHFUHDVHG GXULQJ WKLV SHULRG )LJ %f )RU H[DPSOH D N' DQG D N' VROXEOH IUDFWLRQ SURWHLQ GLPLQLVKHG DV ULSHQLQJ SURJUHVVHG 7ZR LPSRUWHG WUDQVODWLRQ SURGXFWV GUDPDWLFDOO\ LQFUHDVHG LQ WKH ODWHU ULSHQLQJ VWDJHV $ N' SURWHLQ IUDFWLRQDWHG ZLWK WKH VROXEOH SODVWLG SURWHLQV ZKHUHDV D N' SURWHLQ ZDV DVVRFLDWHG ZLWK WKH PHPEUDQH IUDFWLRQ 7KHVH UHVXOWV LPSO\ WKDW WKHUH LV V\QWKHVLV DQG LPSRUW RI QHZ SURWHLQV GXULQJ WKH WUDQVLWLRQ IURP FKORURSODVW WR FKURPRSODVW DQG WKDW WKH SODVWLG FRQYHUVLRQ PD\ EH DQ DFWLYH GHYHORSPHQWDO SURJUDP UDWKHU WKDQ D VLPSOH GHFOLQH LQ V\QWKHVLV RI WKH SKRWRV\QWKHWLF DSSDUDWXV :H QH[W DVNHG ZKHWKHU DQ LPSRUW DVVD\ FRXOG EH XVHG WR LGHQWLI\ LQGLYLGXDO FORQHV FRGLQJ IRU FKURPRSODVWWDUJHWHG SURWHLQV $ VSHFLILF F'1$ FORQH S720 ZDV VHOHFWHG WR HYDOXDWH WKLV V\VWHP 6ODWHU HW DO f RULJLQDOO\ LVRODWHG WKLV F'1$ EHFDXVH LWV 51$ EHFRPHV PRUH DEXQGDQW DV ULSHQLQJ SURFHHGV $UPVWURQJ HW DO f UHFRJQL]HG WKDW WKH GHGXFHG SURWHLQ VHTXHQFH VKDUHV DSSUR[LPDWHO\ b LGHQWLW\ ZLWK WKH SUHGLFWHG SRO\SHSWLGH RI D EDFWHULDO SUHSK\WRHQH V\QWKDVH %LUG HW DO f FRQILUPHG WKH LQYROYHPHQW RI S720 LQ FDURWHQRLG V\QWKHVLV E\ FUHDWLQJ

PAGE 66

)LJXUH 3URILOHV RI LQ YLWUR WUDQVODWLRQ SURGXFWV DQG LPSRUW SURGXFWV DUH DOWHUHG GXULQJ WRPDWR IUXLW ULSHQLQJ $ ,Q YLWUR WUDQVODWLRQ RI WRWDO SRO\ $f 51$ ZLWK IRXU GLIIHUHQW ULSHQLQJ VWDJHV IURP WRPDWR IUXLW SHULFDUS XJ RI WRWDO SRO\ $f 51$ SHU XO UHDFWLRQ ZDV WUDQVODWHG LQ YLWUR LQ D ZKHDW JHUP V\VWHP LQ WKH SUHVHQFH RI >6@PHWKLRQLQH 7UDQVODWLRQ SURGXFWV ZHUH H[DPLQHG E\ 6'63$*( DQG IOXRURJUDSK\ RQ bb JUDGLHQW JHOV 0*f PDWXUH JUHHQ 0*f PDWXUH JUHHQ bf b UHG RYHU WKH RXWHU SHULFDUS !bf JUHDWHU WKDQ b UHG RYHU WKH RXWHU SHULFDUS % ,PSRUW LQWR SHD FKORURSODVWV ZLWK LQ YLWUR WUDQVODWLRQ SURGXFWV RI WRWDO SRO\ $f 51$ H[WUDFWHG IURP WRPDWR IUXLW SHULFDUS DW IRXU GLIIHUHQW ULSHQLQJ VWDJHV ,PSRUW DVVD\V ZHUH FRQGXFWHG DQG IUDFWLRQDWHG DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV 7KH VROXEOHf IUDFWLRQ ZDV LVRODWHG IURP WKH PHPEUDQHVf RI WKH UHSXULILHG O\VHG SODVWLGV E\ FHQWULIXJDWLRQ IRU PLQ DW [ J (TXLYDOHQW DPRXQWV RI SODVWLG SURWHLQ DV GHWHUPLQHG E\ FKORURSK\OO HVWLPDWLRQf IURP WKH SURWHDVH WUHDWHG SODVWLGV ZHUH VHSDUDWHG RQ bb 6'63$*( JUDGLHQW JHOV DQG IOXRURJUDSKHG >&@ODEHOOHG WR N' PROHFXODU ZHLJKW VWDQGDUGV 6LJPDf DSSHDU DV DUURZV RQ WKH OHIW VLGH RI WKH ILJXUH 7KH VL]H RI WKH WZR LPSRUW SURGXFWV ZHUH GHULYHG IURP D VWDQGDUG FXUYH DQG DUH GHVLJQDWHG E\ DUURZV RQ WKH ULJKW VLGH RI WKH ILJXUH

PAGE 67

!b b 0* 0* &' !b ,@ b 0* 0* 4! !b b R 4& 0* 0* 4! !b &W 4! b SUR IRID 0* 0* p !b D} R b J 0* 0* 7 , W r UW L L , L L O LQ +, 0 ,'1O Lnm+ OO N N N N N N 8 ii

PAGE 68

DQ DQWLVHQVH S70 WRPDWR WUDQVIRUPDQW WKDW SURGXFHV \HOORZ UDWKHU WKDQ QRUPDO UHG IUXLW 7KH WUDQVJHQLF IUXLW DUH EORFNHG LQ WKH V\QWKHVLV RI SK\WRHQH IURP LWV LPPHGLDWH SUHFXUVRU LPSO\LQJ WKDW S720 HQFRGHV SK\WRHQH V\QWKDVH %UDPOH\ HW DO f :H VHOHFWHG WKLV FORQH EHFDXVH HQ]\PRORJLFDO GDWD VXJJHVW WKDW V\QWKHVLV RI WKLV QRQSLJPHQWHG FDURWHQRLG RFFXUV LQ SODVWLGV /XWNH%ULQNKDXV HW DO 0D\ILHOG HW DO 'RJER HW DO f 7KH PDMRU WUDQVODWLRQ SURGXFW RI WKH S720 WUDQVFULSW ZDV N' )LJ ODQH f WKLV LV LQ DJUHHPHQW ZLWK WKH VL]H RI WKH K\EULGVHOHFWHG WUDQVODWLRQ SURGXFW IRU S720 LGHQWLILHG E\ 6ODWHU HW DO f 0LQRU ORZHU PROHFXODU ZHLJKW WUDQVODWLRQ SURGXFWV ZHUH DOVR SURGXFHG IURP WKLV WUDQVFULSW DQG PD\ UHSUHVHQW FRPPHQFHPHQW RI WUDQVODWLRQ IURP LQWHUQDO PHWKLRQLQHV EHFDXVH WKHVH SURGXFWV DUH QRW LPSRUWHG LQWR SODVWLGV ,QFXEDWLRQ ZLWK SHD FKORURSODVWV UHVXOWHG LQ WKH DSSHDUDQFH RI D N' SRO\SHSWLGH WKDW IUDFWLRQDWHG ZLWK LQWDFW SODVWLGV DQG ZDV UHVLVWDQW WR SURWHDVH WUHDWPHQW RI WKH FKORURSODVWV )LJ ODQH f 3URWHDVH UHVLVWDQFH ZDV QRW GXH WR DQ LQKHUHQW SURSHUW\ RI WKH N' SURWHLQ EHFDXVH LW ZDV GHJUDGHG E\ WKHUPRO\VLQ LI WKH SODVWLGV ZHUH O\VHG SULRU WR WUHDWPHQW GDWD QRW VKRZQf 7KLV UHVXOW LV H[SHFWHG RI D SURWHLQ SURGXFHG LQ WKH F\WRVRO LPSRUWHG LQWR WKH SODVWLG SURWHFWHG IURP SURWHDVH E\ WKH RUJDQHOODU HQYHORSH DQG FOHDYHG RI LWV WUDQVLW SHSWLGH $GGLWLRQDO FULWHULD PXVW DOVR EH GHPRQVWUDWHG IRU WKH FRQILUPDWLRQ RI LPSRUW LQWR SODVWLGV ,PSRUW LV DQ HQHUJ\ GHSHQGHQW SURFHVV .HHJVWUD f ZKLWH OLJKW RU

PAGE 69

3URWHDVH $73 )LJXUH 7KH N' IRUP RI S720 LV SURWHFWHG IURP SURWHDVH GLJHVWLRQ E\ WKH SODVWLG HQYHORSH DQG LWV DSSHDUDQFH UHTXLUHV WKH DGGLWLRQ RI $73 /DQH f ,Q YLWUR WUDQVFULEHG 51$ ZDV WUDQVODWHG ZLWK D UDEELW UHWLFXORF\WH O\VDWH V\VWHP LQ WKH SUHVHQFH RI >6@PHWKLRQLQH ,PSRUW DVVD\V DQG SRVW DVVD\ WUHDWPHQWV ZHUH FRQGXFWHG DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV /DQHV f ,PSRUW RI S720 LQ YLWUR WUDQVODWLRQ SURGXFWV ZDV FRQGXFWHG ZLWK ODQHV f RU ZLWKRXW ODQHV f O2P0 0J$73 LQ GDUNQHVV ,QWDFW FKORURSODVWV ZHUH UHLVRODWHG ZLWK ODQHV f RU ZLWKRXW ODQHV f SURWHDVH SRVWWUHDWPHQW 3URWHLQV IURP O\VHG SODVWLGV ZHUH VHSDUDWHG RQ b 6'63$*( JHOV DQG IOXURJUDSKHG

PAGE 70

H[RJHQRXV $73 PXVW EH SURYLGHG IRU WKH VXFFHVVIXO LPSRUW RI SURWHLQV )LJ ODQHV DQG VKRZ WKDW SURFHVVLQJ RI WKH N' SURWHLQ LQWR WKH N' SHSWLGH UHTXLUHG H[RJHQRXV $73 ,Q WKH DEVHQFH RI $73 WKH N' SXWDWLYH SUHFXUVRU ERXQG WR WKH FKORURSODVWV EXW ZDV GHVWUR\HG E\ WKH SURWHDVH )LJ ODQHV DQG f 7KH LPSRUW LQWR SODVWLGV VKRXOG DOVR EH WLPH GHSHQGHQW WKLV ZDV IRXQG WR EH WKH FDVH IRU WKH SURGXFWLRQ RI WKH N' SURWHLQ )LJ f 7KXV WKH VXFFHVVIXO LPSRUW RI WKH S720 WUDQVODWLRQ SURGXFW YHULILHG WKH XWLOLW\ RI LPSRUW DVVD\V IRU WKH LGHQWLILFDWLRQ RI JHQHV HQFRGLQJ FKURPRSODVWWDUJHWHG SURWHLQV 3HD FKORURSODVWV ZHUH IUDFWLRQDWHG LQWR VROXEOH DQG PHPEUDQH IUDFWLRQV WR DOORZ DQDO\VLV RI WKH VXEORFDOL]DWLRQ RI WKH N' SURWHLQ 7KH SURWHLQ GLVWULEXWHG EHWZHHQ WKHVH WZR FRPSDUWPHQWV )LJ f 3DUDOOHO LPSRUW DVVD\V ZLWK WKH WK\ODNRLG ORFDOL]HG OLJKWKDUYHVWLQJ FKORURSK\OO DE SURWHLQ /+&3f DQG WKH VWURPDO VPDOO VXEXQLW RI 5XELVFR 66f ZHUH XVHG WR DVVHVV WKH TXDOLW\ RI RXU VXEIUDFWLRQDWLRQ /+&3 ZDV H[FOXVLYHO\ IRXQG LQ WKH PHPEUDQH IUDFWLRQ ZKHUHDV YLUWXDOO\ DOO RI WKH 66 ZDV UHFRYHUHG LQ WKH VROXEOH IUDFWLRQ GDWD QRW VKRZQf 'XULQJ SUHSDUDWLRQ RI WKLV PDQXVFULSW %DUWOH\ HW DO f KDYH UHSRUWHG WKH LVRODWLRQ RI D F'1$ IURP D WRPDWR IUXLW OLEUDU\ E\ K\EULGL]DWLRQ ZLWK D 3&5 IUDJPHQW SURGXFHG ZLWK ROLJRQXFOHRWLGHV GHULYHG IURP WKH VHTXHQFH RI S720 7KH\ IRXQG WKDW WKHLU FORQH GLIIHUV IURP S720 LQ DPLQR DFLGV WKDW UHVLGH DPLQR DFLGV DZD\ IURP WKH GHGXFHG FDUER[\O WHUPLQDO HQG 7KH\ DOVR GHPRQVWUDWHG WKDW WKHLU LQ YLWUR WUDQVODWLRQ SURGXFW LPSRUWV YLD DQ $73 UHTXLULQJ SURFHVV DQG WKDW WKHLU LPSRUW SURGXFW DOVR DSSHDUV LQ ERWK VWURPDO DQG PHPEUDQH IUDFWLRQV RI SHD FKORURSODVWV

PAGE 71

6WURPD 0HPEUDQH 0LQ )LJXUH 7KH SURGXFWLRQ RI WKH N' IRUP RI S720 ZDV WLPH GHSHQGHQW 7KLV SURWHLQ DVVRFLDWHG ZLWK ERWK VWURPDO DQG PHPEUDQH IUDFWLRQV S720 LPSRUW DVVD\V ZHUH FRQGXFWHG DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV 2QH KDOI RI D VWDQGDUG LPSRUW DVVD\ ZDV LPPHGLDWHO\ UHSXULILHG RQ D b 3HUFROO FXVKLRQ DIWHU RU PLQXWHV RI LQFXEDWLRQ &KORURSODVWV ZHUH SURWHDVH WUHDWHG UHSXULILHG DQG VXEIUDFWLRQDWHG DV GHVFULEHG LQ WKH 0DWHULDOV DQG 0HWKRGV 6DPSOHV ZHUH DQDO\]HG E\ 6'63$*( DQG IOXRURJUDSK\

PAGE 72

7KH PHPEUDQHV RI SHD FKORURSODVWV ZHUH IXUWKHU VXEIUDFWLRQDWHG LQWR HQYHORSHV DQG WK\ODNRLG PHPEUDQHV &OLQH f XSRQ IUDFWLRQDWLRQ RI WKH PHPEUDQHV DIWHU LPSRUW RI S720 YLUWXDOO\ DOO RI WKH PDWXUHVL]HG SURWHLQ ZDV IRXQG WR EH DVVRFLDWHG ZLWK WKH WK\ODNRLG IUDFWLRQ GDWD QRW VKRZQf $ PLOG 1D2+ ZDVK UHPRYHG WKH S720 SURWHLQ IURP WKH PHPEUDQH GDWD QRW VKRZQf 7KLV VXJJHVWHG WKDW WKH SURWHLQ ZDV RQO\ SHULSKHUDOO\ DVVRFLDWHG ZLWK WKLV IUDFWLRQ &OLQH f 3UHYLRXV DWWHPSWV E\ RWKHUV WR ORFDOL]H WKH VLWH RI SK\WRHQH V\QWKHVLV ZLWKLQ WKH SODVWLG YLD HQ]\PH DVVD\V KDYH UHVXOWHG LQ FRQIOLFWLQJ FRQFOXVLRQV /XWNH %ULQNKDXV HW DO f FRQFOXGHG WKDW WKH SURGXFWLRQ RI SK\WRHQH LV DVVRFLDWHG ZLWK WKH SODVWLG HQYHORSH +RZHYHU 0D\ILHOG HW DO f DQG LQGHSHQGHQWO\ 'RJER HW DO f GHGXFHG WKDW SK\WRHQH LV V\QWKHVL]HG LQ WKH VWURPD 7KH XQH[SHFWHG DVVRFLDWLRQ RI WKH SURWHLQ ZLWK WK\ODNRLGV LQ LPSRUW DVVD\V DQG LWV SHULSKHUDO DVVRFLDWLRQ ZLWK WKH PHPEUDQHV GHPRQVWUDWHG E\ WKH 1D2+ H[WUDFWLRQ PD\ KDYH SURYLGHG DGGLWLRQDO HYLGHQFH WKDW WKLV SURWHLQ LV IXQFWLRQDOO\ DVVRFLDWHG ZLWK WKH VWURPD $OWHUQDWLYHO\ SHUKDSV WKH .G SURWHLQ KDV QRW IROGHG RU ORFDOL]HG FRUUHFWO\ LQ SHD FKORURSODVWV %DUWOH\ HW DO f UHSRUWHG WKH LPSRUW RI SK\WRHQH GHVDWXUDVH IURP VR\EHDQ OHDI LQWR SHD FKORURSODVWV $OWKRXJK WKLV SURWHLQ LPSRUWHG HIIHFWLYHO\ %DUWOH\ HW DO IRXQG WKDW LW GRHV QRW DOVR IUDFWLRQDWH LQWR WKH SODVWLG FRPSDUWPHQW H[SHFWHG IURP ELRFKHPLFDO DQDO\VLV ,PPXQRF\WRORFDOL]DWLRQ PD\ FODULI\ WKHVH FRQWUDGLFWLQJ UHVXOWV 7KHUHIRUH LW DSSHDUV WKDW LPSRUW DVVD\V FDQ EH XVHIXO IRU WKH LGHQWLILFDWLRQ RI FKURPRSODVWWDUJHWHG SURWHLQV KRZHYHU LW LV FXUUHQWO\ XQFOHDU ZKDW

PAGE 73

FRQFOXVLRQV FDQ EH PDGH IURP WKH LQ YLWUR RUJDQHOODU VXEORFDOL]DWLRQ ZKHQ XVLQJ KHWHURORJRXV V\VWHPV 6L[ DGGLWLRQDO ULSHQLQJ HQKDQFHG S720 F'1$ FORQHV S720 f RI XQNQRZQ IXQFWLRQ 6ODWHU HWDO f ZHUH WHVWHG WR GHWHUPLQH ZKHWKHU WKH\ HQFRGH SODVWLG WDUJHWHG SURWHLQV 7KHVH SDUWLFXODU FORQHV ZHUH VHOHFWHG EHFDXVH D FRPSDULVRQ RI WKH SXEOLVKHG VL]HV RI WKH F'1$ LQVHUWV ZLWK WKH VL]H RI WKHLU UHVSHFWLYH P51$ VXJJHVWHG WKDW WKH\ PLJKW EH IXOO OHQJWK 6ODWHU HW DO 0DXQGHUV HW DO f ,Q YLWUR WUDQVFULSWLRQ RI WKH F'1$V ZDV FDUULHG RXW LQ ERWK GLUHFWLRQV EHFDXVH WKH RULHQWDWLRQ RI WKH FORQHV ZLWKLQ WKH YHFWRU ZDV XQNQRZQ ,Q YLWUR WUDQVODWLRQ SURGXFWV RI WKHVH WUDQVFULSW SDLUV IDLOHG WR LPSRUW LQ IRXU RI WKH VL[ FORQHV )LJ ODQHV WR VKRZV H[DPSOHV RI WKH WUDQVODWLRQ SURGXFWV DQG ODFN RI LPSRUW SURGXFWV SURGXFHG IURP WKHVH FORQHV +RZHYHU VLQFH WKH WUDQVLW SHSWLGH ZKLFK LV UHTXLUHG IRU VXFFHVVIXO LPSRUW RI WKH SURWHLQ LV ORFDWHG RQ WKH DPLQR WHUPLQDO HQG DQG VLQFH LQ YLWUR WUDQVODWLRQ FDQ EHJLQ IURP DQ\ LQWHUQDOO\ VLWXDWHG PHWKLRQLQH DQ\ F'1$V WKDW SURGXFHG DQ LQ YLWUR WUDQVODWLRQ SURGXFW EXW QRW DQ LPSRUWHG SURGXFW PD\ VLPSO\ QRW LQFOXGH WKH HQWLUH FRGLQJ VHTXHQFH 7UDQVODWLRQ SURGXFWV IURP S720 DQG S720OOO ZHUH LPSRUWHG VXFFHVVIXOO\ LQWR SHD FKORURSODVWV )LJ ODQHV DQG f 7KH LPSRUWHG SURGXFW IURP ERWK SURWHLQV ZDV VPDOOHU WKDQ WKH WUDQVODWLRQ SURGXFW ZKLFK LV FRQVLVWHQW ZLWK SURFHVVLQJ RI WKH SODVWLG WUDQVLW SHSWLGH 7KHVH SURWHLQV ZHUH VHQVLWLYH WR SURWHDVH WUHDWPHQW VHH FKDSWHU f EXW UHVLVWDQW DIWHU LPSRUW LQWR SODVWLGV )LJ f $V ZLWK S720 LPSRUW RI S720OOO DQG S720 WUDQVODWLRQ SURGXFWV ZHUH $73 DQG WLPH GHSHQGHQW VHH

PAGE 74

)LJXUH 7UDQVODWLRQ SURGXFWV IURP WUDQVFULSWV RI DGGLWLRQDO S720 FORQHV ZHUH WHVWHG IRU WKHLU DELOLW\ WR LPSRUW LQWR LVRODWHG SHD FKORURSODVWV ,Q YLWUR WUDQVODWLRQ SURGXFWV IURP S720 DQG S720OOO LPSRUWHG LQWR LVRODWHG SHD FKORURSODVWV ,Q YLWUR WUDQVFULEHG 51$ ZDV WUDQVODWHG ZLWK D UDEELW UHWLFXORF\WH O\VDWH V\VWHP LQ WKH SUHVHQFH RI >6@PHWKLRQLQH ,PSRUW DVVD\V ZHUH FRQGXFWHG DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV 6DPSOHV ZHUH DQDO\]HG E\ 6'63$*( DQG IOXRURJUDSK\ ,Q YLWUR WUDQVODWLRQ ZLWK QR DGGHG 51$ ODQH f S720 WUDQVFULEHG LQ YLWUR ZLWK 63 SRO\PHUDVH WUDQVODWHG LQ YLWUR ODQH f DQG LPSRUWHG ODQH f S720 WUDQVFULEHG LQ YLWUR ZLWK 7 SRO\PHUDVH WUDQVODWHG LQ YLWUR ODQH f DQG LPSRUWHG ODQH f S720 WUDQVFULEHG LQ YLWUR ZLWK 7 SRO\PHUDVH WUDQVODWHG LQ YLWUR ODQH f DQG LPSRUWHG ODQH f S720 WUDQVFULEHG LQ YLWUR ZLWK 7 SRO\PHUDVH WUDQVODWHG LQ YLWUR ODQH f DQG LPSRUWHG ODQH f S720OOO WUDQVFULEHG LQ YLWUR ZLWK 7 SRO\PHUDVH WUDQVODWHG LQ YLWUR ODQH f DQG LPSRUWHG ODQH f

PAGE 75

FKDSWHU f 7KHVH GDWD VXSSRUW WKH LGHD WKDW WKH F'1$V GR LQGHHG FRGH IRU SODVWLG WDUJHWHG JHQHV :H KDYH EHJXQ VHTXHQFH DQDO\VLV VHH FKDSWHU f DQG DQWLVHQVH WUDQVIRUPDWLRQ H[SHULPHQWV RI WKHVH F'1$V VHH $SSHQGL[f WR LQYHVWLJDWH WKHLU UROH LQ FKURPRSODVW IXQFWLRQ :H ZRQGHUHG ZKHWKHU RXU LQLWLDO H[DPLQDWLRQ RI LPSRUW IURP WRWDO SRO\ $f WUDQVODWLRQ SURGXFWV )LJ %f PLJKW XQGHUHVWLPDWH WKH QXPEHU RI FKURPRSODVW WDUJHWHG SURWHLQV 7KHUHIRUH ZH DVNHG ZKHWKHU WKH S720 LPSRUW SURGXFWV FRXOG EH UHFRJQL]HG DPRQJ WKH WRWDO SRO\ $f 51$ LPSRUW SURGXFWV 7KH S720 SURWHLQ FRPLJUDWHG ZLWK D EDQG VKRZQ WR LQFUHDVH LQ WKH LPSRUW SURGXFWV IURP WKH PHPEUDQH IUDFWLRQ RI ODWH VWDJH IUXLW )LJ ODQHV DQG f ,W LV LQWHUHVWLQJ WKDW WKH N' VROXEOH LPSRUW SURGXFW )LJ %f PLJUDWHV VLPLODUO\ WR WKH S720OOO LPSRUW SURGXFW )LJ f +RZHYHU DQDO\VLV RI WKHVH WZR SURWHLQV RQ VHYHUDO JHOV VXJJHVWHG WKDW WKH S720OOO SURGXFW ZDV VOLJKWO\ ODUJHU &RQVHTXHQWO\ LW LV XQFOHDU LI S720OOO UHSUHVHQWV D GLIIHUHQW LVR]\PH RU D FRPSOHWHO\ GLVVLPLODU SURWHLQ 6LQFH WKH LPSRUW RI WKH LQ YLWUR WUDQVODWLRQ SURGXFW RI S720 DVVRFLDWHV ZLWK WKH VWURPDO IUDFWLRQ WKLV ZDV FRPSDUHG ZLWK WKH VROXEOH IUDFWLRQ RI WRWDO SRO\ $ LPSRUW SURGXFWV 1R SURWHLQ DSSHDUV WR LQFUHDVH LQ WKH ODWHU VWDJHV RI ULSHQLQJ IUXLW ZKLFK FRPLJUDWHV ZLWK WKLV EDQG )LJ ODQHV DQG f :H FRQFOXGHG WKHUHIRUH WKDW QRW DOO RI WKH FKURPRSODVWWDUJHWHG SURWHLQV FRXOG EH GHWHFWHG LQ RXU DQDO\VLV RI WRWDO SRO\ $f 51$ LPSRUW SURGXFWV

PAGE 76

)LJXUH ,PSRUW SURGXFWV FRUUHVSRQGLQJ LQ VL]H WR WKRVH IRU S720OOO DQG S720 ZHUH HQKDQFHG LQ ODWH VWDJH WRPDWR IUXLW +RZHYHU QR SRO\SHSWLGH ZDV VHHQ WKDW FRLQFLGHG WR WKH S720 LPSRUW SURGXFW S720 S720 DQG S720OOO ZHUH WUDQVFULEHG LQ YLWUR ZLWK 7 SRO\PHUDVH 51$ ZDV WUDQVODWHG ZLWK UDEELW UHWLFXORF\WH O\VDWH LQ WKH SUHVHQFH RI >6@PHWKLRQLQH ,Q YLWUR WUDQVODWLRQ LPSRUW DVVD\V DQG VXEIUDFWLRQDWLRQ ZHUH FRQGXFWHG DV GHVFULEHG IRU DQDO\VLV RI LQGLYLGXDO WUDQVODWLRQ SURGXFWV LQ 0DWHULDOV DQG 0HWKRGV /DQH f 6ROXEOH IUDFWLRQ RI WKH S720OOO LPSRUW SURGXFW /DQH f 6ROXEOH IUDFWLRQ RI WKH S720 LPSRUW SURGXFW /DQH f 6ROXEOH IUDFWLRQ RI LPSRUWHG LQ YLWUR WUDQVODWLRQ SURGXFWV RI WRWDO SRO\ $f 51$ IURP !b ULSH IUXLW /DQH f 6ROXEOH IUDFWLRQ IURP LPSRUWHG LQ YLWUR WUDQVODWLRQ SURGXFWV RI LPPDWXUH JUHHQ WRWDO SRO\ $f 51$ /DQH f 0HPEUDQH IUDFWLRQ RI WKH S720 LPSRUW SURGXFW /DQH f 0HPEUDQH IUDFWLRQ IURP LPSRUWHG LQ YLWUR WUDQVODWLRQ SURGXFWV RI WRWDO SRO\ $f 51$ IURP !b UHG ULSH IUXLW /DQH f 0HPEUDQH IUDFWLRQ IURP LPSRUWHG LQ YLWUR WUDQVODWLRQ SURGXFWV RI LPPDWXUH JUHHQ WRWDO SRO\ $f 51$

PAGE 78

,W LV SUHVHQWO\ XQFOHDU KRZ PDQ\ SODVWLG WDUJHWHG SURWHLQV LQFUHDVH GXULQJ WKH FKORURSODVW WR FKURPRSODVW WUDQVLWLRQ 7KH GDWD SUHVHQWHG LQ )LJ DQG FOHDUO\ GHPRQVWUDWH WKDW RXU RULJLQDO H[DPLQDWLRQ RI FKURPRSODVW WDUJHWHG SURWHLQV VKRZQ LQ )LJ XQGHUUHSUHVHQWV WKH QXPEHU RI SURWHLQV WKDW LQFUHDVH GXULQJ WKLV SURFHVV ,Q IDFW WKLV LV QRW VXUSULVLQJ ZKHQ FRQVLGHULQJ WKH OLPLWHG VHQVLWLYLW\ RI LPSRUW RI WRWDO SRO\ $f WUDQVODWLRQ SURGXFWV 7KHUHIRUH ZH EHOLHYH WKDW LQGLYLGXDO WHVWLQJ RI ULSHQLQJ HQKDQFHG F'1$ FORQHV ZLWK WKH LQKHUHQW LQFUHDVH LQ WKH TXDQWLW\ RI WKH LQGLYLGXDO SURWHLQ SURGXFW LV UHTXLUHG WR FOHDUO\ LGHQWLI\ DOO WKH FKURPRSODVW WDUJHWHG SURWHLQV ZKRVH 51$ LQFUHDVHV GXULQJ WKLV GHYHORSPHQWDO SURFHVV /LWWOH GHWDLOHG DQDO\VLV RI WKH UHJXODWLRQ RI ULSHQLQJ HQKDQFHG JHQHV KDV EHHQ XQGHUWDNHQ /LQFROQ DQG )LVKHU f DQG 'HOOD3HQQD HW DO f FRQFOXGHG WKDW LQFUHDVHV LQ WUDQVFULSWLRQ UDWH ZHUH PDLQO\ UHVSRQVLEOH IRU WKH LQFUHDVHV LQ VWHDG\ VWDWH 51$ OHYHOV IRU WKH ULSHQLQJ HQKDQFHG JHQHV WKH\ KDYH DQDO\]HG +RZHYHU WKH\ DOVR LQYRNHG SRVWWUDQVFULSWLRQDO PHFKDQLVPV WR H[SODLQ GLIIHUHQFHV EHWZHHQ WKH UDWH RI WUDQVFULSWLRQ DQG DFFXPXODWLRQ $OWKRXJK ZH FDQQRW H[FOXGH SRVWWUDQVFULSWLRQDO PHFKDQLVPV IRU WKH LQFUHDVH LQ VWHDG\VWDWH OHYHOV RI WKH 51$V ZH KDYH DQDO\]HG WKH VLPSOHVW LQWHUSUHWDWLRQ IRU RXU GDWD WKDW LV FRQVLVWHQW ZLWK RWKHU ULSHQLQJ HQKDQFHG JHQHV LV WKDW WKH SURFHVVHV LQYROYHG LQ WKH GHYHORSPHQW RI WKH FKURPRSODVW DUH GLUHFWHG DW D WUDQVFULSWLRQDO OHYHO LQ WKH QXFOHXV 8WLOL]LQJ DQ LQ YLWUR DVVD\ IRU WKH LPSRUW RI SURWHLQV LQWR SODVWLGV ZH KDYH LGHQWLILHG WZR SURWHLQV IURP LQ YLWUR WUDQVODWLRQ SURGXFWV RI WRWDO SRO\ $f 51$ WKDW LQFUHDVH GXULQJ WKH ULSHQLQJ RI WRPDWR IUXLW $GGLWLRQDOO\ ZH KDYH VKRZQ WKDW WKH

PAGE 79

LQ YLWUR WUDQVODWLRQ SURGXFWV IURP WKUHH LQGLYLGXDO ULSHQLQJ HQKDQFHG F'1$ FORQHV LPSRUW LQWR SODVWLGV 7KHUHIRUH WKH WUDQVLWLRQ IURP FKORURSODVW WR FKURPRSODVW FRLQFLGHV ZLWK DQ LQFUHDVH LQ VWHDG\VWDWH OHYHOV RI 51$ IRU SURWHLQV GHVWLQHG WR WKLV RUJDQHOOH 7KLV VXJJHVWV WKDW WKLV SURFHVV LV QRW D VLPSOH GHFOLQH LQ WKH V\QWKHVLV RI SKRWRV\QWKHWLF SURWHLQV WKDW FDXVHV D EUHDNGRZQ RI WKH WK\ODNRLG PHPEUDQHV DQG D VKXQWLQJ RI VXEVWUDWHV LQWR WKH FDURWHQRLG SDWKZD\ EXW DQ DFWLYH GHYHORSPHQWDO SURJUDP

PAGE 80

&+$37(5 &+$5$&7(5,=$7,21 2) 7:2 F'1$6 )25 &+52023/$67 7$5*(7(' 3527(,16 ,QWURGXFWLRQ $V WRPDWR IUXLW ULSHQV FHOO ZDOOV VRIWHQ KH[RVHV DUH GHSRVLWHG LQWR YDFXROHV DQG FDURWHQRLGV DFFXPXODWH LQ GHYHORSLQJ FKURPRSODVWV 7KH WUDQVIRUPDWLRQ RI FKORURSODVWV LQWR FKURPRSODVWV LV GLVWLQJXLVKHG E\ WKH EUHDNGRZQ RI WKH SKRWRV\QWKHWLF DSSDUDWXV DQG D PDVVLYH V\QWKHVLV DQG GHSRVLWLRQ RI FDURWHQRLGV /LWWOH LV NQRZQ DERXW KRZ WKH FDWDEROLVP RI WK\ODNRLG PHPEUDQHV RU WKH V\QWKHVLV RI FDURWHQRLGV LV UHJXODWHG 2QO\ WZR WRPDWR JHQHV IRU HDUO\ VWHSV LQ WKH FDURWHQRLG ELRV\QWKHWLF SDWKZD\ KDYH EHHQ FORQHG %LUG HW DO %DUWOH\ HW DO 3HFNHU HW DO f %HVLGHV SURWHLQV LQYROYHG LQ WKH V\QWKHVLV RI FDURWHQRLGV RQO\ WKH SODVWLGLDO VXSHUR[LGH GLVPXWDVH FKDUDFWHUL]HG E\ /LYLQH DQG *HSVWHLQ f KDV EHHQ VKRZQ WR LQFUHDVH GXULQJ WRPDWR IUXLW ULSHQLQJ +RZHYHU 5RPHU HW DO f KDYH DOVR LVRODWHG DQG FORQHG D F\VWHLQH V\QWKDVH IURP SHSSHU FKURPRSODVWV 7KHVH ODWWHU ILQGLQJV VXJJHVW WKHUHIRUH WKDW WKH FKURPRSODVW PD\ EH UHVSRQGLQJ WR DQ LQFUHDVH LQ R[LGDWLYH VWUHVV GXULQJ GHYHORSPHQW ,Q RUGHU WR XQGHUVWDQG KRZ WKH WUDQVIRUPDWLRQ IURP FKORURSODVW WR FKURPRSODVW LV PHGLDWHG RQH REMHFWLYH RI WKH SUHVHQW VWXG\ ZDV WR LGHQWLI\ DQG FORQH

PAGE 81

JHQHV IRU SURWHLQV LQYROYHG LQ FKURPRSODVW GHYHORSPHQW :H KDYH LGHQWLILHG SODVWLG SURWHLQV WKDW PD\ EH LQFUHDVLQJO\ V\QWKHVL]HG GXULQJ FKURPRSODVW GHYHORSPHQW E\ H[DPLQLQJ F'1$V LVRODWHG IURP D ULSHQLQJ HQKDQFHG WRPDWR IUXLW OLEUDU\ WUDQVODWLQJ WKHLU WUDQVFULSWV LQ YLWUR DQG WHVWLQJ ZKHWKHU WKH UHVXOWLQJ SURWHLQV FDQ EH LPSRUWHG LQWR LVRODWHG SHD FKORURSODVWV 7KLV FKDSWHU GHVFULEHV WKH FKDUDFWHUL]DWLRQ RI WZR F'1$V WKDW FRGH IRU WUDQVFULSWV ZKRVH VWHDG\VWDWH OHYHO LQFUHDVHV GXULQJ FKURPRSODVW GHYHORSPHQW DQG ZKRVH SURWHLQV FDQ EH LPSRUWHG LQWR SODVWLGV 7KH FKDUDFWHUL]DWLRQ RI WKHVH WZR F'1$V UHSUHVHQWV D QRYHO XVH RI LPSRUW DVVD\V WR H[DPLQH FKURPRSODVW GHYHORSPHQW 6LQFH WKLV W\SH RI DQDO\VLV LV IUHH RI IXQFWLRQDO ELDV WKH LGHQWLILFDWLRQ RI XQH[SHFWHG FRPSRQHQWV RI FKURPRSODVW GHYHORSPHQW LV SRVVLEOH 0DWHULDOV DQG 0HWKRGV 3ODQW 0DWHULDO 7RPDWR SODQWV ^/\FRSHUVLFRQ HVFLGHQWXP 0LOO FY 6XQEHDPf ZHUH JURZQ LQ WKH ILHOG DW WKH +RUWLFXOWXUDO 8QLW RI WKH 8QLYHUVLW\ RI )ORULGD LQ *DLQHVYLOOH )ORULGD )UXLW ZHUH KDUYHVWHG DW DP RQ -XQH IURP ILYH GLIIHUHQW ULSHQLQJ VWDJHV 0DWXUH JUHHQ 0*f ZDV FKDUDFWHUL]HG E\ IXOO VL]H JUHHQ IUXLW ZLWK IXOO\ GHYHORSHG JHO LQ DW OHDVW RQH EXW QRW DOO RI WKH ORFXOHV PDWXUH JUHHQ 0*f IUXLW KDG FRPSOHWHO\ GHYHORSHG ORFXODU JHO EUHDNHU VWDJH IUXLW ZHUH FKDUDFWHUL]HG E\ WKH DSSHDUDQFH RI FDURWHQRLGV DW WKH EORVVRP HQG b ULSH IUXLW ZHUH UHG RYHU OHVV

PAGE 82

WKDQ KDOI EXW PRUH WKDQ b RI WKH RXWHU SHULFDUS DQG !b ULSH IUXLW ZHUH UHG RYHU b RI WKH RXWHU SHULFDUS 3HULFDUS IURP IUXLW RI HDFK VWDJH ZDV IUR]HQ LQ OLTXLG QLWURJHQ LPPHGLDWHO\ DIWHU KDUYHVWLQJ DW r& IRU DQDO\VLV DW D ODWHU GDWH )RU WKH H[DPLQDWLRQ RI ULSHQLQJ XQGHU FRQWUROOHG WHPSHUDWXUH 0* IUXLW ZHUH SODFHG LQ MDUV ZLWK D IORZ WKURXJK V\VWHP RI KXPLGLILHG DLU DQG DOORZHG WR ULSHQ DW r& LQ WKH GDUN 7KLV SUHYHQWHG ZDWHU VWUHVV RU D EXLOGXS RI UHVSLUDWRU\ &2] )UXLW IURP WKUHH GLIIHUHQW ULSHQLQJ VWDJHV 0* EUHDNHU DQG b ULSHf ZHUH VHOHFWHG DQG H[SRVHG IRU KRXUV WR r& LQ WKLV KXPLGLILHG HQYLURQPHQW )ROORZLQJ WKH LQFXEDWLRQ SHULRG SHULFDUS ZDV IUR]HQ LQ OLTXLG QLWURJHQ 3UHSDUDWLRQ RI 51$ 7RWDO 51$ ZDV H[WUDFWHG E\ FRPELQLQJ WKH PHWKRGV RI &KRPF]\LQVNL DQG 6DFFKL f DQG &DWKDOD HW DO f %ULHIO\ WKLV LQYROYHG JULQGLQJ J RI IUR]HQ WLVVXH LQ D FRIIHH JULQGHU DQG KRPRJHQL]LQJ LQ PO RI H[WUDFWLRQ EXIIHU ZLWK WKUHH VHF EXUVWV RI D %ULQFNPDQ SRO\WURQ 7KH H[WUDFWLRQ EXIIHU FRQWDLQHG 0 JXDQLGLQH LVRWKLRF\DQDWH %HWKHVGD 5HVHDUFK /DERUDWRULHVf b VDUNRV\O P0 VRGLXP FLWUDWH S+ DQG 0 PHUFDSWRHWKDQRO 6RGLXP DFHWDWH S+ ZDV DGGHG WR 0 IROORZHG E\ RQH YROXPH RI SKHQRO DQG YROXPH FKORURIRUP 7KH KRPRJHQDWH ZDV VKDNHQ IRU VHF DIWHU HDFK DGGLWLRQ DQG WKHQ FRROHG RQ LFH IRU PLQ 7KH SKDVHV ZHUH VHSDUDWHG E\ FHQWULIXJDWLRQ DW [ J IRU PLQ WKH DTXHRXV SKDVH ILOWHUHG WKURXJK OD\HUV RI 0LUDFORWK &DOELRFKHPf DQG QXFOHLF DFLGV SUHFLSLWDWHG ZLWK DQ HTXDO YROXPH RI LVRSURSDQRO IRU RQH KRXU DW r& 7KH

PAGE 83

SUHFLSLWDWH ZDV FROOHFWHG E\ FHQWULIXJDWLRQ IRU PLQ DW [ J 7KH SHOOHW ZDV GLVVROYHG LQ H[WUDFWLRQ EXIIHU DQG 51$ ZDV SUHFLSLWDWHG ZLWK YROXPHV RI 0 /L&O IRU KRXUV DW r& )ROORZLQJ FHQWULIXJDWLRQ IRU PLQ DW [ J WKH SHOOHW ZDV ZDVKHG ZLWK 0 /L&O DQG UHFRYHUHG E\ FHQWULIXJDWLRQ IRU KRXU 7KH 51$ ZDV GLVVROYHG LQ b 6'6 H[WUDFWHG ZLWK YROXPH RI SKHQRO FKORURIRUP f WKHQ UHH[WUDFWHG ZLWK YROXPH FKORURIRUP DQG SUHFLSLWDWHG ZLWK 0 VRGLXP DFHWDWH DQG YROXPHV RI HWKDQRO 3UHFLSLWDWHG 51$ ZDV GLVVROYHG LQ VWHULOH ZDWHU DQG VWRUHG DW r& 7HPSODWH 3UHSDUDWLRQ ,Q 9LWUR 7UDQVFULSWLRQ DQG ,Q 9LWUR 7UDQVODWLRQ $ F'1$ IRU WKH KVS IURP KHDW VWUHVVHG SHD OHDYHV S+63 ZDV SURYLGHG E\ ( 9LHUOLQJ 9LHUOLQJ HW DO f 7KH S720 DQG S720 F'1$ ZHUH SURYLGHG E\ *ULHUVRQ 6ODWHU HW DO f 7KH S720 F'1$V ZHUH GLJHVWHG ZLWK 3VWO DQG OLJDWHG LQWR S6SRUW %HWKHVGD 5HVHDUFK /DERUDWRULHVf DW WKH 3VW, VLWH DQG WUDQVIRUPHG LQWR( FROL VWUDLQ 7% 3ODVPLG '1$ ZDV LVRODWHG E\ WKH DONDOLQH O\VLV PHWKRG RI /HH DQG 5DVKHHG f 7KH S+63 SODVPLG ZDV OLQHDUL]HG ZLWK %DP +, DQG LQ YLWUR WUDQVFULEHG ZLWK 63 SRO\PHUDVH DV GHVFULEHG LQ &OLQH f 7KH S720 DQG S720 SODVPLG '1$V ZHUH OLQHDUL]HG ZLWK (FR 5, DQG LQ YLWUR WUDQVFULEHG ZLWK 7 SRO\PHUDVH %HWKHVGD 5HVHDUFK /DERUDWRULHVf 7KH LQ YLWUR WUDQVFULEHG 51$ WUDQVFULSWV ZHUH WUDQVODWHG ZLWK D UDEELW UHWLFXORF\WH O\VDWH V\VWHP IURP 3URPHJD 0DGLVRQ :Lf LQ WKH SUHVHQFH RI HLWKHU >6@0HW RU >+@/HX DFFRUGLQJ WR SURFHGXUHV GHVFULEHG LQ WKH 3URPHJD PDQXDO

PAGE 84

1RUWKHUQ +\EULGL]DWLRQ 7RWDO 51$ TXDQWLILHG E\ VSHFWURSKRWRPHWULF DEVRUEDQFH DW $A ZDV ORDGHG SJODQHf RQWR D IRUPDOGHK\GH GHQDWXULQJ JHO 6DPEURRN HW DO f $IWHU HOHFWURSKRUHVLV WKH JHO ZDV ZDVKHG LQ VWHULOH ZDWHU DQG VWDLQHG LQ HWKLGLXP EURPLGH OSJPOf IRU PLQ DQG GHVWDLQHG LQ ; 66& ZKLFK FRQWDLQHG 0 VRGLXQ FLWUDWH DQG 0 VRGLXP FKORULGH IRU PLQ 7KH DPRXQW RI ULERVRPDO 51$ ZDV YLVXDOO\ DVVHVVHG WR HQVXUH WKDW DSSUR[LPDWHO\ HTXLYDOHQW DPRXQWV RI 51$ ZHUH ORDGHG 7KH 51$ ZDV FDSLOODU\ EORWWHG RQWR Q\ORQ PHPEUDQH $PHUVKDP &RUSf LQ ; 66& RYHUQLJKW 7KH EORW ZDV ZDVKHG ZLWK ; 66& DQG H[SRVHG WR -FP 89 OLJKW ZLWK D WUDQVLOOXPLQDWRU %LRVf )RU K\EULGL]DWLRQ SUREHV WKH HQWLUH F'1$ LQVHUW ZDV H[FLVHG ZLWK 3VW, LVRODWHG E\ JHO HOHFWURSKRUHVLV DQG HOHFWURHOXWHG QJ RI '1$ ZDV UDGLRODEHOHG ZLWK S&L RI D3G&73 E\ UDQGRP SULPHU ODEHOOLQJ ZLWK D NLW %RHKULQJHU 0DQQKHLPf 3UHK\EULGL]DWLRQ DQG K\EULGL]DWLRQ FRQGLWLRQV ZHUH DV GHVFULEHG LQ &KXUFK DQG *LOEHUW f 7KH SUHK\EULGL]DWLRQ EXIIHU FRQWDLQHG 0 VRGLXP SKRVSKDWH S+ b 6'6 DQG b ERYLQH VHUXP DOEXPLQ 6LJPD IUDFWLRQ 9f DW r& %ORWV ZHUH SUHK\EULGL]HG LQ PO RI EXIIHU IRU DW OHDVW KRXU DW r& 7KH ODEHOHG SUREH ZDV GHQDWXUHG DW r& IRU PLQ DQG DGGHG WR WKH EORW ZLWK PO RI SUHK\EULGL]DWLRQ VROXWLRQ 7KLV ZDV LQFXEDWHG RYHUQLJKW DW r& 7KH EORW ZDV ZDVKHG RQH WLPH LQ ,; 66& DQG b 6'6 DW URRP WHPSHUDWXUH DQG WKHQ WLPHV LQ ; 66& DQG b 6'6 IRU PLQ ;UD\ ILOP .RGDN ;20$7f ZDV H[SRVHG WR WKH EORW RYHUQLJKW

PAGE 85

ZLWK WZR LQWHQVLI\LQJ VFUHHQV 'X3RQWf WR ORFDWH EDQGV %DQGV ZHUH H[FLVHG IURP WKH PHPEUDQH DQG TXDQWLILHG E\ OLTXLG VFLQWLOODWLRQ FRXQWLQJ '1$ 6HTXHQFLQJ 7KH 3VW, H[FLVHG S720 F'1$ LQVHUW ZDV VXEFORQHG LQWR S%OXHVFULSW 6.f SODVPLG 6WUDWDJHQHf DW WKH 3VW, VLWH 7KLV ZDV UHVWULFWHG ZLWK HLWKHU ;EDO DQG 6VW, RU .SQO DQG (FR 59 IRU SURGXFWLRQ RI ([R,,,0XQJEHDQ QHVWHG GHOHWLRQ SODVPLGV IROORZLQJ WKH SURWRFRO GHVFULEHG LQ WKH PDQXDO 6WUDWDJHQHf 7KH UHVXOWLQJ SODVPLGV ZHUH SUHFLSLWDWHG UHVXVSHQGHG LQ 7( OLJDWHG GLUHFWO\ DQG WUDQVIRUPHG LQWR ( FROL VWUDLQ 7% 3ODVPLGV FRQWDLQLQJ QHVWHG GHOHWLRQV IURP HLWKHU GLUHFWLRQ ZHUH VHOHFWHG DQG VHTXHQFHG XVLQJ WKH 7 RU 0 SULPHU RI WKH S%OXHVFULSW YHFWRU 'RXEOH VWUDQGHG SODVPLG '1$ ZDV XVHG DV D WHPSODWH DQG SUHSDUHG DV GHVFULEHG E\ /HH DQG 5DVKHHG f '1$ VHTXHQFLQJ SURFHGXUHV ZHUH DV GHVFULEHG LQ WKH 6HTXHQDVH VHTXHQFLQJ NLW PDQXDO 86 %LRFKHPLFDOf 7KH S720 F'1$ ZDV EOXQW HQG OLJDWHG 6DPEURRN HW DO f LQWR S*(0= 3URPHJDf DW WKH 6PDO VLWH %RWK WKH S*HP FRQVWUXFWV GHVFULEHG DERYH DQG WKH S6SRUW FRQVWUXFWV GHVFULEHG LQ WKH VHFWLRQ RQ LQ YLWUR WUDQVFULSWLRQ ZHUH XVHG DV WHPSODWH IRU GRXEOH VWUDQGHG '1$ VHTXHQFLQJ DV GHVFULEHG DERYH ,QLWLDOO\ WKH 7 RU 0 VLWHV RI WKH S6SRUW RU S*HP YHFWRUV ZHUH XVHG DV SULPHU VLWHV 2OLJRPHUV PHUVf VSHFLILF WR S720 ZHUH V\QWKHVL]HG E\ WKH 8),&%5 '1$ 6\QWKHVLV &RUH DQG XVHG LQ VXEVHTXHQW VHTXHQFLQJ UHDFWLRQV 6RPH SRUWLRQV RI WKH VHTXHQFH ZHUH JHQHUDWHG E\ WKH ,&%5 '1$ 6HTXHQFLQJ &RUH 6HTXHQFHV ZHUH

PAGE 86

DQDO\]HG ZLWK WKH 8QLYHUVLW\ RI :LVFRQVLQ *HQHWLFV &RPSXWHU *URXS FRPSXWHU SURJUDPV 'HYHUHX[ HW DO f 3URWHLQ VHTXHQFH FRPSDULVRQV ZHUH SHUIRUPHG DW WKH 1DWLRQDO &HQWHU IRU %LRWHFKQRORJ\ ,QIRUPDWLRQ XVLQJ WKH *(1,1)25f SURJUDP RI WKH ([SHULPHQWDO %ODVW 1HWZRUN 6HUYLFH $OWVFKXO HW DO f PDGH DYDLODEOH E\ WKH ,&%5 %LRORJLFDO &RPSXWLQJ )DFLOLW\ 7KH SHWXQLD KVS VHTXHQFH &KHQ DQG 9LHUOLQJ f LV DYDLODEOH DV (0%/ DFFHVVLRQ ; 7KH S720 VHTXHQFH )UD\ HW DOf LV DYDLODEOH DV (0%/ DFFHVVLRQ ; 7KH VHTXHQFH IRU WKH K\SRWKHWLFDO .G SURWHLQ IURP ( FROL 3RVW HW DO f LV DYDLODEOH LQ *HQ%DQN DFFHVVLRQ 0 &KORURSODVW ,VRODWLRQ DQG ,PSRUW $VVD\V &KORURSODVWV ZHUH LVRODWHG IURP SHD 3LVXP VDWLYXP / FY /D[WRQfV 3URJUHVV f VKRRWV E\ D FRPELQDWLRQ RI GLIIHUHQWLDO FHQWULIXJDWLRQ DQG 3HUFROO JUDGLHQW FHQWULIXJDWLRQ &OLQH HW DO f ,PSRUW DVVD\V ZHUH FRQGXFWHG DV GHVFULEHG E\ &OLQH f H[FHSW WKDW WUDQVODWLRQ SURGXFWV ZHUH GLOXWHG ZLWK XQODEHOOHG PHWKLRQLQH RU OHXFLQH LQ LPSRUW EXIIHU DQG WKDW SL RI GLOXWHG WUDQVODWLRQ SURGXFWV ZHUH DGGHG WR SL RI FKORURSODVWV PJ FKORURSK\OOPOf IRU D SL WRWDO DVVD\ YROXPH ,PSRUW DVVD\V ZHUH FRQGXFWHG IRU PLQXWHV DW r& ZLWK ZKLWH OLJKW DQG O2P0 0J$73 XQOHVV LQGLFDWHG RWKHUZLVH ([SHULPHQWV WHVWLQJ WKH UHTXLUHPHQW RI $73 IRU LPSRUW RI S720 SURWHLQ LQYROYHG LQFXEDWLRQ RI SL RI WKH WUDQVODWLRQ PL[WXUH ZLWK RU ZLWKRXW XQLWV RI DS\UDVH 6LJPDf IRU PLQ DW r& 7KH LPSRUW DVVD\V ZHUH FRQGXFWHG LQ IRLO ZUDSSHG WXEHV WR PDLQWDLQ GDUNQHVV DW r&

PAGE 87

$IWHU LQFXEDWLRQ LQWDFW FKORURSODVWV ZHUH UHLVRODWHG E\ FHQWULIXJDWLRQ WKURXJK b 3HUFROO ZLWK RU ZLWKRXW D WUHDWPHQW RI WKH SURWHDVH WKHUPRO\VLQ 6LJPDf WR UHPRYH VXUIDFH ERXQG SURWHLQV &OLQH f 3ODVWLGV ZHUH WUHDWHG ZLWK SJ WKHUPRO\VLQ IRU PLQ DW r& XQOHVV LQGLFDWHG RWKHUZLVH ,PSRUW SURGXFWV ZHUH GLOXWHG ZLWK ;6'6 3$*( EXIIHU LQFXEDWHG PLQ DW r& DQG DQDO\]HG E\ 6'63$*( DQG IOXRURJUDSK\ &OLQH f RQ b JHOV ,Q RUGHU WR GHPRQVWUDWH WKDW WKH LPSRUWHG SURWHLQ ZDV VHQVLWLYH WR WKHUPRO\VLQ DQ LPSRUW DVVD\ ZDV SHUIRUPHG DQG WKH FKORURSODVWV ZHUH O\VHG EHIRUH WKH DGGLWLRQ RI WKH SURWHDVH 2QH IUDFWLRQ RI D VWDQGDUG DVVD\ ZDV UHVXVSHQGHG LQ SL LPSRUW EXIIHU WKH RWKHU IUDFWLRQ ZDV O\VHG ZLWK WKH VDPH DPRXQW RI O2P0 +HSHV.2+ S+ 7KLUW\ SL DOLTXRWV PJ FKORURSK\OOPOf ZHUH LQFXEDWHG ZLWK DQG SJ RI WKHUPRO\VLQ IRU PLQ DW r& )RU WKH S720 SURWHLQ >+@ OHXFLQH ZDV XVHG LQ WKH LQ YLWUR WUDQVODWLRQ DQG RI D VWDQGDUG LPSRUW UHDFWLRQ SL RI SODVWLGV DW OPJ FKORURSK\OOPOf ZDV UHVXVSHQGHG LQ SL O2P0 +HSHV.2+ S+ 7KLV VDPSOH ZDV GLYLGHG LQ KDOI DQG SJ RI WKHUPRO\VLQ ZDV DGGHG WR DQ DOLTXRW $IWHU PLQ LQFXEDWLRQ DW r& ('7$ ZDV DGGHG WR D ILQDO FRQFHQWUDWLRQ RI P0 DQG WKH VDPSOHV ZHUH LPPHGLDWHO\ IUR]HQ $Q HTXDO YROXPH RI ;6'6 3$*( EXIIHU &OLQH f ZDV DGGHG WR IUHVKO\ WKDZHG VDPSOHV WKH WXEHV ZHUH KHDWHG DW r& IRU PLQ DQG SL ZDV ORDGHG RQWR b 6'63$*( JHOV )RU DQDO\VLV RI WKH ORFDWLRQ RI LPSRUWHG SURWHLQV FKORURSODVWV UHFRYHUHG IURP DVVD\V ZHUH O\VHG LQ SL P0 +HSHV.2+ S+ DQG LQFXEDWHG IRU PLQ 6WURPD ZDV VHSDUDWHG IURP PHPEUDQHV E\ FHQWULIXJDWLRQ IRU PLQ DW [ J

PAGE 88

7KH PHPEUDQHV ZHUH ZDVKHG ZLWK PO RI LPSRUW EXIIHU FHQWULIXJHG IRU PLQ DW [ J DQG ILQDOO\ UHVXVSHQGHG LQ SL RI O2P0 +HSHV.2+ S+ 5HVXOWV 7KH WRPDWR IUXLW F'1$V S720 DQG ZHUH VHOHFWHG E\ 6ODWHU HW DO f EHFDXVH WUDQVFULSWV KRPRORJRXV WR WKHVH FORQHV LQFUHDVHG GXULQJ ULSHQLQJ 'DWD SUHVHQWHG LQ WKH SUHYLRXV FKDSWHU KDYH VKRZQ WKDW LQ YLWUR WUDQVFULSWV IURP WKHVH FORQHV FDQ EH WUDQVODWHG LQ YLWUR DQG WKH WUDQVODWLRQ SURGXFWV FDQ EH LPSRUWHG E\ SHD FKORURSODVWV )XUWKHU VWXGLHV ZHUH SHUIRUPHG LQ RUGHU WR HQVXUH WKDW DOO WKH FULWHULD IRU VXFFHVVIXO LPSRUW ZHUH PHW VXFK DV WKH HQHUJ\ DQG WLPH GHSHQGHQFH RI WKH UHDFWLRQ DORQJ ZLWK VHQVLWLYLW\ RI WKH PDWXUH IRUP RI WKH SURWHLQ WR SURWHDVH ,PSRUW 6WXGLHV RI S720 3URWHLQ 7KH S720 LQ YLWUR WUDQVFULSW ZDV WUDQVODWHG LQWR D N' SURWHLQ DQG SURFHVVHG E\ WKH LVRODWHG SODVWLGV LQWR D N' IRUP LQ DQ HQHUJ\ )LJ$f DQG WLPH )LJO&f GHSHQGHQW UHDFWLRQ 7KH SURGXFWLRQ RI WKLV SURFHVVHG IRUP ZDV YLUWXDOO\ SUHYHQWHG E\ WKH DGGLWLRQ RI DS\UDVH DQ $73DVH WR WKH WUDQVODWLRQ PL[ LQ WKH QR $73 DVVD\ )LJ $ ODQHV DQG YHUVXV ODQHV DQG f 2QO\ WKH N' SUHFXUVRU ZKLFK UHPDLQV RXWVLGH RI WKH SODVWLG ZDV UHPRYHG E\ WKH SURWHDVH WUHDWPHQW )LJ $ ODQHV DQG f 7KH PDWXUH SURWHLQ ZDV VHQVLWLYH WR WKH SURWHDVH RQO\ DIWHU WKH SODVWLGV KDG EHHQ O\VHG SULRU WR DGGLWLRQ RI WKLV HQ]\PH )LJ %f

PAGE 89

$ % $73 3URWHDVH /DQH F 0LQ /DQH )LJXUH 7KH N' S720 WUDQVODWLRQ SURGXFW FDQ EH LPSRUWHG LQWR SHD FKORURSODVWV DQG SURFHVVHG LQWR D N' IRUP LQ DQ HQHUJ\ DQG WLPH GHSHQGHQW SURFHVV ,Q YLWUR WUDQVFULEHG 51$ ZDV WUDQVODWHG ZLWK D UDEELW UHWLFXORF\WH O\VDWH V\VWHP LQ WKH SUHVHQFH RI >6@0HW ,PSRUW DVVD\V ZHUH FRQGXFWHG DV GHVFULEHG LQ WKH 0DWHULDOV DQG 0HWKRGV $f 3URGXFWLRQ RI WKH PDWXUH IRUP RI WKH SURWHLQ UHTXLUHV $73 DQG LV SURWHFWHG IURP SURWHDVH GLJHVWLRQ $ VWDQGDUG LPSRUW DVVD\ ZDV FRQGXFWHG ZLWK ODQHV DQG f RU ZLWKRXW ODQHV DQG f P0 0J $73 3ODVWLGV ZHUH SHOOHWHG DQG UHVXVSHQGHG ZLWK ODQHV DQG f RU ZLWKRXW ODQHV DQG f SURWHDVH %f 7KH SODVWLG PHPEUDQH SURWHFWV WKH PDWXUH IRUP RI S720 IURP WKH DGGHG SURWHDVH 3ODVWLGV ZHUH ODQHV DQG f DQG ZHUH QRW O\VHG ODQHV DQG f DIWHU LPSRUW ZLWK ODQHV DQG f SJ ODQHV DQG f RU SJ ODQHV DQG f RI SURWHDVH &f 7KH SURGXFWLRQ RI WKH PDWXUH IRUP RI S720 LV WLPH GHSHQGHQW $VVD\V ZHUH RI SL RI SODVWLGV OPJPO FKORURSK\OOf IRU HDFK WLPH SRLQW 7KH UHDFWLRQV ZHUH WHUPLQDWHG ZLWK P0 +J&O WR TXLFNO\ VWRS WKH UHDFWLRQ

PAGE 90

:KHQ +J&O ZDV XVHG WR WHUPLQDWH WKH DVVD\V D VPDOO DPRXQW RI SURWHDVHUHVLVWDQW SUHFXUVRU ZDV REVHUYHG LQ WKH HDUO\ WLPH SRLQWV )LJ %f 7KLV PD\ UHIOHFW D VWDJH LQ WKH UHDFWLRQ SULRU WR FOHDYDJH RI WKH WUDQVLW SHSWLGH EXW DIWHU LPSRUW LQWR WKH RUJDQHOOH $V ZLOO EH GLVFXVVHG LQ WKH IROORZLQJ VHFWLRQ VHTXHQFH DQDO\VLV LGHQWLILHG S720 DV HQFRGLQJ D SODVWLGORFDOL]HG ORZ 0: KHDW VKRFN SURWHLQ KVSf &RQVHTXHQWO\ ZH DVNHG ZKHWKHU RXU KVS ZRXOG ORFDOL]H LQ YLWUR LQ WKH VDPH PDQQHU DV D SODVWLG ORFDOL]HG ORZ 0: KVS WKDW ZDV LVRODWHG IURP KHDW VWUHVVHG SHD OHDYHV &KORURSODVWV UHFRYHUHG IURP LPSRUW DVVD\V ZHUH VHSDUDWHG LQWR PHPEUDQH DQG VROXEOH IUDFWLRQV LQ )LJ 7KH SURWHLQV IURP ERWK S720 DQG WKH SHD F'1$ ZHUH UHFRYHUHG LQ WKH VROXEOH IUDFWLRQ (YHQ WKRXJK WKH WRPDWR F'1$ ZDV LVRODWHG IURP ULSHQLQJ IUXLW WKH SURWHLQ EHKDYHV LQ D PDQQHU VLPLODU WR RQH LVRODWHG IURP KHDW VWUHVVHG OHDYHV ,PSRUW 6WXGLHV RI S720 3URWHLQ $ VLPLODU DQDO\VLV RI WKH LPSRUW RI DQ LQ YLWUR WUDQVODWLRQ SURGXFW IURP S720 ZDV SHUIRUPHG )LJ f ,Q WKLV FDVH D N' SURWHLQ ZDV SURGXFHG XSRQ LQ YLWUR WUDQVODWLRQ RI WKH S720 WUDQVFULSW )LJ %f :KHQ WKH WUDQVODWLRQ SURGXFW ZDV LQFXEDWHG ZLWK LVRODWHG SHD FKORURSODVWV D N' SURWHLQ ZDV JHQHUDWHG )LJ %f 7KLV SUHGLFWV WKDW D N' WUDQVLW SHSWLGH LV FOHDYHG XSRQ LPSRUW LQWR WKH SODVWLG /LWWOH RI WKH N' SUHFXUVRU ZDV DVVRFLDWHG ZLWK FKORURSODVWV UHFRYHUHG IURP DVVD\V ZLWKRXW DGGHG $73 HYHQ ZLWKRXW SURWHDVH SRVWWUHDWPHQW )LJ $ ODQH f 6LQFH

PAGE 91

S720 7U 6W 0HP S+63 7U 6W 0HP )LJXUH 7KH S720 DQG DQ KVS IURP KHDW VWUHVVHG SHDV ORFDOL]H SUHGRPLQDQWO\ WR WKH VWURPD ,Q YLWUR WUDQVFULSW ZDV WUDQVODWHG ZLWK D UDEELW UHWLFXORF\WH O\VDWH V\VWHP LQ WKH SUHVHQFH RI >6@0HW DQG LPSRUW DVVD\V ZHUH FRQGXFWHG DV GHVFULEHG LQ WKH 0DWHULDOV DQG 0HWKRGV 7UDQVODWLRQ SURGXFWV 7Uf VWURPD 6Wf DQG PHPEUDQH 0HPf IUDFWLRQV ZHUH DQDO\]HG E\ 6'63$*( JHOV DQG IOX RURJUDSK\

PAGE 92

$ /\VLV $73 3URWHDVH /DQH 7 6W 0HP % N' 0LQ /DQH )LJXUH 7KH N' S720 WUDQVODWLRQ SURGXFW FDQ EH LPSRUWHG LQWR SHD FKORURSODVWV DQG SURFHVVHG LQWR D N' IRUP LQ DQ HQHUJ\ DQG WLPH GHSHQGHQW SURFHVV $f 3URGXFWLRQ RI WKH PDWXUH IRUP RI WKH SURWHLQ UHTXLUHV $73 DQG LV SURWHFWHG IURP SURWHDVH GLJHVWLRQ 7KH PDWXUH IRUP RI 3720 FDQ EH GLJHVWHG E\ WKH SURWHDVH LI WKH SODVWLGV DUH O\VHG ,PSRUW DVVD\V FRQWDLQHG O2P0 0J$73 ODQHV DQG f 7KHUPRO\VLQ ZDV DGGHG DIWHU LPSRUW ODQHV DQG f 3ODVWLGV ZHUH O\VHG DIWHU LPSRUW LQ O2P0 +HSHV .2+ S+ DQG WUHDWHG ZLWK WKHUPRO\VLQ ODQH f 6WURPDO 6Wf DQG PHPEUDQH PHPf IUDFWLRQV ZHUH VHSDUDWHG IURP WRWDO 7f SODVWLGV IROORZLQJ DQ LPSRUW UHDFWLRQ DV GHVFULEHG LQ WKH 0DWHULDOV DQG 0HWKRGV %f 7KH SURGXFWLRQ RI WKH PDWXUH IRUP RI S720 LV WLPH GHSHQGHQW $VVD\V FRQWDLQHG SL RI SODVWLGV OPJPO FKORURSK\OOf IRU HDFK WLPH SRLQW >+@OHXFLQH UHSODFHG >6@PHWKLRQLQH LQ WKH LQ YLWUR WUDQVODWLRQ UHDFWLRQV

PAGE 93

WKH SODVWLGV ZHUH UHSXULILHG EHIRUH WKH DVVD\V ZHUH DQDO\]HG WKLV VXJJHVWV WKDW OLWWOH RI WKH S720 WUDQVODWLRQ SURGXFW DWWDFKHV WR WKH RXWVLGH RI WKH SODVWLG 6XEIUDFWLRQDWLRQ RI UHFRYHUHG FKORURSODVWV VKRZHG WKH S720 LPSRUWHG SURWHLQ WR EH LQ WKH VROXEOH IUDFWLRQ )LJ $ ODQH f ,I SODVWLGV ZHUH O\VHG DIWHU LPSRUW DQG WUHDWHG ZLWK SURWHDVH WKH S720 PDWXUH SURWHLQ ZDV GLJHVWHG )LJ $ ODQH YHUVXV ODQH f ZKLFK GHPRQVWUDWHV WKDW LW LV QRW LQKHUHQWO\ UHVLVWDQW WR WKLV WUHDWPHQW $ VPDOO DPRXQW RI SURWHDVHUHVLVWDQW SUHFXUVRU ZDV DOVR IRXQG LQ WKH HDUO\ WLPH SRLQWV DIWHU LPSRUW RI WKH S720 SURWHLQ )LJ %f 7KHVH GDWD GHPRQVWUDWH WKDW WKH LQ YLWUR WUDQVODWLRQ SURGXFWV RI ERWK S720 DQG DUH LPSRUWHG LQWR WKH SODVWLG DUH SURWHFWHG IURP SURWHDVH E\ WKH RUJDQHOODU HQYHORSH DQG DUH FOHDYHG RI WKHLU WUDQVLW SHSWLGHV ,Q RUGHU WR IXUWKHU FKDUDFWHUL]H WKHVH FKURPRSODVWDVVRFLDWHG SURWHLQV WKH F'1$V ZHUH VHTXHQFHG DQG WKH FRUUHVSRQGLQJ DPLQR DFLG VHTXHQFHV GHGXFHG 0DWHULDOV DQG 0HWKRGVf 7KH S720 F'1$ &RGHV IRU D /RZ 0: +63 7KH S720 VHTXHQFH )LJ f VKRZV VLJQLILFDQW KRPRORJ\ WR WKRVH RI ORZ 0: SODVWLGORFDOL]HG KHDW VKRFN SURWHLQV LVRODWHG IURP KHDW VWUHVVHG OHDYHV 3URWHLQV IURP VR\EHDQ SHD 9LHUOLQJ HW DO f $UDELGRSVLV SHWXQLD &KHQ DQG 9LHUOLQJ f DQG PDL]H 0LHWR6RWHOR HW DO f KDYH EHHQ FORQHG DQG VHTXHQFHG 7KH S720 VHTXHQFH LV b KRPRORJRXV WR D F'1$ LVRODWHG IURP KHDW VWUHVVHG SHWXQLD OHDYHV /RZ 0: KVSV IURP SODQWV KDYH EHHQ FDWHJRUL]HG RQ

PAGE 94

****&7$777&7*7*$77$$$$$7&7$$$7$$&7$7$$7**&77$&$&$$*7&77$&$7&77&7&&$77$*7*7&$$$7* f§ 0$<76/7663/9619 77$*&*77**7**$$&&7&7$$*$77$$7$$&$$&$$**7$7&7*&$&&77*&7&7*7777&*77&&*7&*$7*$*$$** W A A A f§ 69**76.,111.96$3&69)936055 &&*$&*$&7$**&7 **7 $*&7 &***&7$&F**&*$7 $$&$$$*$7 $&*7 &$*7 &*$&*7 $&$&&$&$*&$*7 *&7 &$$** A A A A A 3775,9$5$7*'1.'769'9++66$4* $**$$$&$$&&$$**&$&7*&F*7&*$$&*&&*7&&7$&*$**$7**&*&77*$7*777&&&&7777**$*7*77$*$7& *114*7$9(553750$/'963)*9/'3 &$$7 *7 &$&&$$7 *$*$$&$$7 *&**&$*$7 *$7$*$&$&7$7 **$&$*$77$77&*$$*$7$&$$7*$7 7 &&$**$$*$ f§ f§ A 0630570540,'70'5/)('70,3*5 $$&$*$*&$7&$**$$&$****$$$7$&*&$&7&&$7***$&$77&$7*$7*$7*$$$$&*$$$7&$$*$7*&*777&*$ A A 15$6*7*(,573:',+''(1(,.05)' &$7 *&&***$&7 *7 &&$$**$$*$7 *7 $$$$*7 $7 &$*7 $*$$$$7 *$&$7 *&77*7 &$7 7 $$$****$$&$&$$$$$** A Af§ f§ f§ f§ f§ A f§ f§A 03*/6.('9.969(1'0/9, .*(+..( $$*$$*$&**$$*$*$7$$$&$&7&$7****7$**$$77$7$*&7&77$&*$&$&7&*777$$*7&7&&&$*$7$$7*77 f§ f§ ('*5'.+68*51<66<'75/6/3'19 *7*$$**$7$$$$7&$$$*&**$$&7*$$*$$7**$*77&7777&$7&7&*$77&&$$$*$&7*$$*7**$*$$$$$**7 r A A f§ 9.'.,.$(/.1*9/),6,3.7(9(..9 *$77*$7*7&&$$$77$$&7$$&$77&$*$$7&*&&$7*&7777*77*77&7$**77&$777*7$$&&77*7*7$$$$7* f§ A f§A Af§ f 9 4 1 r 7$7*77&*&$7$7 *$$7 $7 $$$$&$$*7 $*7*&$7 &77 7 *$&$ f§ )LJXUH 1XFOHRWLGH DQG GHGXFHG DPLQR DFLG VHTXHQFH RI S720 7KH VHTXHQFH ZDV DQDO\]HG XVLQJ WKH 8QLYHUVLW\ RI :LVFRQVLQ *HQHWLFV &RPSXWHU *URXS SURJUDPV 7KH SRVLWLRQ RI WKH VSHFLILF QXFOHRWLGHV DSSHDUV DERYH WKH VHTXHQFH ZKLOH WKH SRVLWLRQ RI WKH VSHFLILF DPLQR DFLG DSSHDUV WR WKH VLGH

PAGE 95

WKH EDVLV RI GHGXFHG DPLQR DFLG VHTXHQFH VLPLODULW\ 9LHUOLQJ f 7KHUH DUH WKUHH FODVVHV RI F\WRSODVPLFDOO\ORFDOL]HG ORZ 0: KVSV RQH FODVV DVVRFLDWHG ZLWK WKH FKORURSODVW DQG DQRWKHU DIILOLDWHG ZLWK WKH HQGRSODVPLF UHWLFXOXP $ FRPSDULVRQ RI WKH GHGXFHG DPLQR DFLG VHTXHQFH RI S720 WR WKHVH SURWHLQV UHYHDOHG WKH JUHDWHVW VLPLODULW\ ZLWK WKH SHWXQLD SODVWLG KVS b LGHQWLW\f )LJ f 7KLV LV QRW VXUSULVLQJ VLQFH WKHVH VSHFLHV DUH HYROXWLRQDULO\ PRVW DOLNH &RPSDULVRQ WR WKH RQO\ RWKHU FKDUDFWHUL]HG ORZ 0: KVS IURP WRPDWR IUXLW S720 )UD\ HW DO f D F\WRSODVPLFDOO\ORFDOL]HG KVS UHYHDOHG RQO\ b LGHQWLW\ WR S720 )LJ f 7KH S720 SURWHLQ VKDUHV PRUH VHTXHQFH VLPLODULW\ WR F\WRVROLFDOO\ ORFDOL]HG KVSV IURP RWKHU VSHFLHV GDWD QRW VKRZQf 2YHUDOO WKHVH KVS FODVVHV VKDUH PRUH VHTXHQFH LGHQWLW\ DPRQJ PHPEHUV IURP GLIIHUHQW VSHFLHV WKDQ WKH\ GR ZLWK KVSV IURP RWKHU IDPLOLHV ZLWKLQ WKH VDPH VSHFLHV 7KH KRPRORJ\ RI S720 WR D F'1$ IRU D NQRZQ SODVWLGORFDOL]HG SURWHLQ VXSSRUWV WKH XVH RI LPSRUW DVVD\V WR LGHQWLI\ F'1$V IRU FKURPRSODVWDVVRFLDWHG SURWHLQV &KHQ DQG 9LHUOLQJ f KDYH LGHQWLILHG FRQVHUYHG UHJLRQV LQ SODVWLG ORFDOL]HG ORZ 0: KVSV WKH\ KDYH H[DPLQHG :KLOH WKH ILUVW WZR UHJLRQV DUH IRXQG LQ DOO ORZ 0: KVSV WKH WKLUG UHJLRQ LV XQLTXH WR WKH SODVWLGORFDOL]HG SURWHLQV ,W LV LQ WKHVH WKUHH UHJLRQV WKDW S720 KDV WKH KLJKHVW KRPRORJ\ WR RWKHU ORZ 0: KVSV $ b DPLQR DFLG LGHQWLW\ WR WKH SHWXQLD SURWHLQ LV IRXQG LQ WKHVH UHJLRQV LQ FRQWUDVW ZLWK WKH b RYHUDOO KRPRORJ\ )LJ f

PAGE 96

KVS S720 3HWFSKVS S70 KVS S720 3HWFSKVS S70 KVS S720 3HWFSKVS S70 KVS S720 3HWFSKVS S70 KVS 3720 3HWFSKVS S70 )LJXUH A 0$<76/76 63/961969* *76.,111. 96$3&69)93 605537 PDFNWOWFVD VSOYVQJYYV DWVUWQQNNW WWDSIVYFIS \VNFVYUNSD 3XWDWLYH 7UDQVLW 3HSWLGH 75/9$5$7*' 1.'769'9++ 66$4**114 *7$9(55375 0$/'963)*9 VUOYDTDWJG QNGWVYGYKY VQQQTJJQQT JVDYHUUSUU PDOGYVSIJO 06/,35, )*' 556660 )'3)6,'9 &RQ /'30630570 540,'70'5/ )('70,3*51 5$6*7*(,57 38',+''(1( ,GSPVSPUWP UTPPGWPGUO IHGWPWISJV UQUJWJHLUD SZGLNGGHQH )'3 )5(/*)3671 6*(66$)$17 5,':.(73(3 VHQVXV 5HJLRQ ,,, A ,.05)'03*/ 6.('9.969( 1'+/9,.*( +..(('*5 '.+68*51<6 LNPUIGPSJO VNHHYNYVYH GGYOYLNJH KNNHHVJN GGVZJUQ\V +9).9'/3*/ ..((9.9(9( (259/4,6*( 519(.('N1' .:+50(566* &RQVHQVXV 5HJLRQ ,, 6<'75/6/3' 1:.'.,.$( /.1*9/),6, 3.7(9(..9 ,'94,1 V\GWUOVOSG QYGNGNYNDH ,NQJYOOLVL SNWNYHNNY WGYHLN .)055)5/3( 1$.0'49.$6 0(1*9/7979 3.((9..3(9 .6,(,6* &RQVHQVXV 5HJLRQ 7KH S720 VKDUHV b DPLQR DFLG VHTXHQFH LGHQWLW\ WR DQ KVS IURP SHWXQLD DQG b LGHQWLW\ WR S720 IURP WRPDWR IUXLW 7KH GHGXFHG DPLQR DFLG VHTXHQFHV ZHUH FRPSDUHG ZLWK WKH 8QLYHUVLW\ RI :LVFRQVLQ *&* SURJUDP SLOHXS DV GHVFULEHG LQ WKH 0DWHULDOV DQG 0HWKRGV 7KH V\PERO UHSUHVHQWV H[DFW PDWFKHV EHWZHHQ SURWHLQV ZKLOH GRWV UHSUHVHQW VSDFHV EXLOW LQWR WKH SURWHLQ E\ WKH SLOHXS DOLJQPHQW 7KH SXWDWLYH WUDQVLW SHSWLGH 9LHUOLQJ f LV GHOLQHDWHG E\ D VROLG XQGHUOLQH 7KH WKUHH FRQVHQVXV UHJLRQV GHVFULEHG E\ &KHQ DQG 9LHUOLQJ f DUH DOVR PDUNHG ZLWK D VROLG OLQH

PAGE 97

7KH SXWDWLYH WUDQVLW SHSWLGH RI S720 SURWHLQ LV LGHQWLILHG LQ )LJ 9LHUOLQJ f $OWKRXJK WKLV SDUW RI WKH SURWHLQ LV WKH OHDVW VLPLODU WR WKH SHWXQLD KVS VKRZQ LQ )LJ b DPLQR DFLG LGHQWLW\f WKH UHJLRQ VWLOO FRQWDLQV D QXPEHU RI IHDWXUHV FKDUDFWHULVWLF RI WUDQVLW SHSWLGHV .HHJVWUD HW DO f )RU H[DPSOH LW LV ULFK LQ VHULQH YDOLQH DQG DODQLQH DQG GHILFLHQW LQ WKH DFLGLF DPLQR DFLGV JOXWDPLF DQG DVSDUWLF DFLG ,Q DGGLWLRQ VRPH EDVLF DPLQR DFLGV DUJLQLQH DQG O\VLQHf DUH DOVR SUHVHQW :KHUH WKH VHTXHQFH YDULHV IURP WKH SHWXQLD KVS ZLWKLQ WKLV UHJLRQ WKH VXEVWLWXWLRQV DUH JHQHUDOO\ WKRVH UHVLGXHV FKDUDFWHULVWLF RI WUDQVLW SHSWLGHV 7KH REVHUYDWLRQ WKDW WKLV SRUWLRQ RI WKH SURWHLQ LV OHDVW VLPLODU WR RWKHU SODVWLG ORFDOL]HG ORZ 0: KVSV LV QRW VXUSULVLQJ VLQFH DQ H[DPLQDWLRQ RI WUDQVLW SHSWLGHV IRU WKH SODVWLGORFDOL]HG ORZ 0: KVSV DQDO\]HG E\ &KHQ DQG 9LHUOLQJ f KDV DOVR VKRZQ WKDW WKH\ DUH WKH PRVW GLYHUJHG SRUWLRQ RI WKH SURWHLQ (YHQ WKRXJK WKH VWUXFWXUH DQG IXQFWLRQ RI WKH FKURPRSODVW GLIIHUV GUDVWLFDOO\ IURP WKH FKORURSODVW D VLPLODU KVS LV SURGXFHG 2XU GDWD DJUHH ZLWK WKH FRQFOXVLRQ RI 9LHUOLQJ f WKDW ORFDOL]DWLRQ WR WKH SODVWLG DSSHDUV WR SUHGLFW PRUH VHTXHQFH FRQVHUYDWLRQ WKDQ GRHV WKH WLVVXH RU RUJDQLVP LQ ZKLFK WKH SURWHLQ LV H[SUHVVHG $OWKRXJK WKH LQFUHDVHV LQ ORZ 0: KVSV S720 DQG S720 PD\ EH D JHQHUDO UHVXOW RI ULSHQLQJ VHTXHQFH FRQVHUYDWLRQ VXJJHVWV WKDW WKHLU UROH PD\ EH PRUH SHUWLQHQW WR WKH FRPSDUWPHQW LQ ZKLFK WKH\ IXQFWLRQ 6HTXHQFH $QDO\VLV RI S720 7KH VHTXHQFH REWDLQHG IRU S720 LV VKRZQ LQ )LJ 7KH F'1$ LV

PAGE 98

&77 &77 *$$$$$7 ****77 *$**$$77 *$$7 &$7777 *77 &$$$7777 *&77777 $777 &$&77 **$$$&$&$*7$*&7$ / 7 **&77 &27 *7 $$7 $77 &777 *7 $*7 *7 &$$$&&&&$$$77*$77 &7777 $$$$$*$*77 *77777777 &$*7 &$7 **7 & A :/39,))99613./,//.599))46:6 $$$7 $**&&$&$7 **77 &$7 &&7 $7777 $$&$$*$$7 $7 &&$$777 $*$$*$$$&$*7777 *77 $77 *7 *$$**&77 &$* 153+*66<)1.1,4)5516)9,9.$6* *77&$$*$$&7 $*7 $$$$$$&$$*7 $*$*$7 $$&$7 $7 $$7 &&7 *$$*$*$$*777 $$7 $$$77 $*&7 *$7 *$$*7 **$7 A 6576..49(,7<13((.)1./$'(9' $*$*$$*&7 ***&777 &$$*$&7&$&7&777777&7&&77*&$$*$7$$$7*7777&77*$*$$7$$&$$*&$$*$***$ A 5($*/65/7/)63&.,19)/5,76.5' 7 *$&**$7 $7 &$7 *$777 **&*7&7&7&777&$7*7$$77$*7&7$**$*$7$$$$7$$$*77&7&*&7 *7&$&&$7&*$ 2*<+'/$6/)+9,6/*2., .)6/636. $*7 &$$$**$7 &*W 77$7 &7 $&7 $$7 *77 *&7 **$*77 &&$&7 &*$7 *$*$*$$$7 &7 *$77 $7 $$$**&&&7 &$$7 &77 6.'5/6719$*93/'(51/, ,.$/1/ 7 $7 $**$$$$$*$&7 **$$&$*$&$$7 7$&7777**$77&$7&77*$7$$*$$$*7*&&7$&7**$*&7**7&77**7** <5..7 *7 '1<):, +/'..937 *$*/** 7 ***$*&$*7$$7*&7*&$$&$$&7&7*7***&$*&$$$7&$$77&$*7**77*7*77*&&$&7*$$$$**$*&7&&$$* *661$$77/:$$14)6*&9$7(.(/4( $*7 **7 &7 **7 *$*$7 7 **7 7 &7 *$7 $77&&7 77&77 &77 &7 &7 &$7 **$*&$*&&7 $&7 *7 $&***7 $****7 *$**77 :6*(,*6',3)))6+*$$<&7*5*(9 *77 &$**$7 $7 &&&*7 &$&&&$7 $&&$777*$&$77 &&$$7 **7 &&7 &$7 $$$*&&7 &$$&$**&$7*&7&&$&7*&7*$ 94',363,3)',309/,.344$&67$( $*777 $&$$*&*7777 &$*77 **$7 &7 *7 &7 $*7 $$**77 *$7 &&&77 *$*&77 $&7 **$*$$$$7 &7 &$$&7 $*7 **$$ 9<.5)4/'/66.9'3/6//(.,676*, 7 $7 &7 &$$*$7 *7 *7 *7 *7 &$$7 *$777 $*$$&&7 &&7 *&&777 *$$*77 &77 &2$7 &7 &77 $$$$**77$$$$&$$&*$ 64'9&91'/(33$)(9/36/.5/.45 *7 $$77 *&7 *&7 **&&*$**$&$$7 $7 *$7 *&$*7 &77 &$7 *7 &7 **$$*7 **$$*& $&$$7 $*7 $****77 **&7 &7 && 9,$$*5*4<'$9)06*6*67 9*9*63 $*$7 &&$&&$&$$777 *7 &7 $7 *$7 *$7 *$$*$$7 $&$$**$7 *7 &77&77*7 &$*$$*&$$*777 &$7 &$&7 &*$&&$* '334)9<''((<.'9)/6($6),753$ &&$$&*$*7 **7 $7 *77 *$$&&7 *777 &$**7 $*&$&7 $77 **7 *$7 &$$&&7 *$*77 &7 &7 $&$7 &7777 *$&$7 *7 &7 1(:<9(396*67,*'43()676)'06 7 $$$$**&7&$*$$*$*&7*7$$$$77 *$$*&$$7$**$*$$*77777*77*7$$$7*77$7$7&&7$7$$777&7*7$* 7 $7 &$7 &&7777 $&777 **$7 *&$&7 $77 &$$*$$$$7 $$$$77 $*7 &$&$$7 &7 *$7 &*$$$ )LJXUH 1XFOHRWLGH VHTXHQFH DQG GHGXFHG DPLQR DFLG VHTXHQFH RI S720 1XPEHUV DSSHDULQJ DERYH WKH VHTXHQFH UHIHU WR WKH QXFOHRWLGH VHTXHQFH 1XPEHUV DSSHDULQJ WR WKH VLGH RI WKH VHTXHQFH UHIHU WR WKH GHGXFHG DPLQR DFLG VHTXHQFH

PAGE 99

, Q LPU L L LQ 7LP Q a7a 77, r L L LL L U ,77 L LL PX LL Q L L L L L LL L L L L L L f§L QUUQU L LL L L f ,7 L L L L f L L L L LOO f L L L L L L L L LL ‘ L L L L Q P L L ,,, ,, /QU L 777 QLQU LLnL L L L L L L LL U L L Q L LQL U L L L LL L L L QUQ L L L L L LL L L L L L L L L ,,, L )LJXUH *UDSKLF UHSUHVHQWDWLRQ RI SRWHQWLDO UHDGLQJ IUDPHV RI S720 0HWKLRQLQHV DUH UHSUHVHQWHG E\ OLQHV DSSHDULQJ DERYH WKH UHDGLQJ IUDPH 6WRS FRGRQV DUH UHSUHVHQWHG E\ OLQHV DSSHDULQJ EHORZ WKH UHDGLQJ IUDPH 7KH WRS WKUHH IUDPHV ZHUH SURGXFHG E\ UHDGLQJ WKH VHTXHQFH IURP DQ DUELWUDU\ f HQG 7KH ERWWRP WKUHH IUDPHV UHIHU WR WKH UHDGLQJ IUDPHV SURGXFHG IURP WKH RSSRVLWH VWUDQG FR

PAGE 100

EDVHV ORQJ 2QO\ ORQJ RSHQ UHDGLQJ IUDPH 25)f LV SUHVHQW EXW LW VWDUWV ZLWK D OHXFLQH QRW D PHWKLRQLQH )LJ DQG f 7KLV LV KDUG WR XQGHUVWDQG JLYHQ WKDW WKH S720 WUDQVFULSW GLUHFWHG SURGXFWLRQ RI D N' WUDQVODWLRQ SURGXFW $ PHWKLRQLQH GRHV RFFXU ZLWKLQ QXFOHRWLGHV RI WKH EHJLQQLQJ RI WKH ORQJ UHDGLQJ IUDPH KRZHYHU WZR VWRS FRGRQV DUH HQFRXQWHUHG ZLWKLQ WKH QH[W EDVHV $QRWKHU VPDOO 25) RI UHVLGXHV LV IRXQG WZR QXFOHRWLGHV f RI WKH ODUJH 25) 7KLV EHJLQV ZLWK D PHWKLRQLQH LQ D IDYRUDEOH LQLWLDWLRQ FRQWH[W .R]DN f 7ZR SRVVLEOH H[SODQDWLRQV IRU WKH REVHUYHG DQRPDO\ DUH f D VHTXHQFLQJ HUURU RU f D IUDPHVKLIW GXULQJ WUDQVODWLRQ 7KH ILUVW SRVVLELOLW\ ZDV DGGUHVVHG E\ DGGLWLRQDO VHTXHQFH DQDO\VLV RI WKH DUHDV LQ WKH YLFLQLW\ RI WKH f DQG f HQGV RI WKH ORQJ 25) 7KH F'1$ VHTXHQFH LQ )LJ VKRZV WKDW WKH ORQJ 25) VWDUWV DW EDVHV DQG HQGV DW ,W LV FOHDU WKDW DQ 25) RI DSSUR[LPDWHO\ WKLV OHQJWK LV UHTXLUHG WR SURGXFH WKH SURWHLQ REVHUYHG RQ 6'63$*( DOO RWKHU SRWHQWLDO UHDGLQJ IUDPHV DUH OLWWHUHG ZLWK VWRS FRGRQV WKHUHIRUH LI D VLPSOH VHTXHQFH HUURU ZDV JHQHUDWHG LW ZRXOG EH IRXQG ZLWKLQ WKH ILUVW IHZ KXQGUHG EDVHV 7KH ILUVW EDVHV ZHUH UHH[DPLQHG XVLQJ D QXPEHU RI GLIIHUHQW PRGLILFDWLRQV WR WKH VHTXHQFLQJ UHDFWLRQV )LJXUH LV D FRPSLODWLRQ RI WKHVH LQGLYLGXDO VHTXHQFLQJ UHVXOWV )RU H[DPSOH ERWK VWUDQGV RI WKH VHTXHQFH 5 DQG ),f ZHUH H[DPLQHG E\ FRPSDULQJ LQFRUSRUDWLRQ RI G,73 LQVWHDG RI G*73 WR WKH VWDQGDUG 6HTXHQDVH GRXEOH VWUDQGHG VHTXHQFLQJ UHDFWLRQV 7KLV UHJLRQ RI WKH VHTXHQFH ZDV DOVR DQDO\]HG E\ WKH ,&%5 '1$ VHTXHQFLQJ FRUH 7KH\ XVHG HLWKHU .OHQRZ 5f RU 7$4 SRO\PHUDVHV ) DQG 5f LQ JHQHUDWLQJ WKHVH VHTXHQFHV 6LQFH WKH WHPSODWH WKDW ZDV XVHG IRU PRVW RI WKH

PAGE 101

)LJXUH ,QGLYLGXDO VHTXHQFLQJ UHVXOWV RI WKH ILUVW EDVHV RI S720 1XPEHUV DSSHDULQJ DERYH WKH OLQH UHIHU WR WKH SRVLWLRQ RI WKH QXFOHRWLGH ZLWKLQ WKH VHTXHQFH 7KH FRQVHQVXVf VHTXHQFH ZDV GHGXFHG IURP WKH LQGLYLGXDO UXQV ,QFRQVLVWHQFLHV WR WKH FRQVHQVXV VHTXHQFH DUH XQGHUOLQHG ),f ZDV REWDLQHG E\ FRPSDULQJ VHTXHQFH UHDFWLRQV UXQ ZLWK G*73 RU GO73 LQ WKH IRUZDUG GLUHFWLRQ RU 5Of IURP WKH RSSRVLWH VWUDQG )f DQG 5f ZHUH REWDLQHG LQ VHTXHQFH UHDFWLRQV ZLWK SULPHUV VSHFLILF IRU HLWKHU VWUDQG XVLQJ 7$4 SRO\PHUDVH DW WKH ,&%5 '1$ VHTXHQFLQJ FRUH )f DQG 5f ZHUH REWDLQHG ZLWK SULPHUV VSHFLILF IRU HLWKHU VWUDQG XVLQJ D VWDQGDUG 6HTXHQDVH VHTXHQFLQJ UHDFWLRQ )Df ZDV REWDLQHG ZLWK D S6SRUW EDVHG WHPSODWH ZKLOH )Ef ZDV GHULYHG IURP D S*(0= EDVHG WHPSODWH 5f ZDV REWDLQHG E\ WKH ,&%5 '1$ VHTXHQFLQJ FRUH XVLQJ .OHQRZ SRO\PHUDVH

PAGE 102

&RQVHQVXV &77&77*$$$ $$7****77* $**$$77*$$ 7&$7777*77 &$$$7777*& ) FWWFWWJDDD DDWJJJJWWJ DJJDDWWJDD WFDWWWWJWW FDDDWWWWJF 5 FWWJDJD DDWJJJJWWJ DJJDDWWJDD WFDWWWWJWW FDDDWWWWJF ) &77**71$$$ $$7****77* $**$$771$$ 7&$7777171 &$$$7777*& 5 &77&77*$$$ $$7****77* $**$$77*$$ 7&$7777*77 &$$$7777*& )D &77&77*$$$ $$7****77* $**$$77*$$ 7&$7777*77 &$$$7777*& )E WWFWWJDDD DDWJJJJWWJ DJJDDWWJDD WFDWWWWJWW FDDDWWWWJF 5 JFWFWWJDDD DDWJJJJWWJ DJJDDWWJDD FDWWWWJWW FDDDWWWWJF 5 FWWFWWJDDD DDWJJJJWWJ DJJDDWWJDD WFDWWWWJWQ FDDDWWWWJF &216(1686 77777$777& $&77**$$$& $&$*7$*&7$ 7**&77&&7* 7$$7$77&77 ) WWWWWDWWWF DFWWJJDDDF DFDJWDJFWD WJJFWWFFWJ WDDWDWWFW7 5 WWWWWDWWWF DFWWJJDDDF DFDJWDJFWD WJJFWWFFWJ WDDWDWWFW7 ) 77771$777& $&71**$$$& $&$*7$*&7$ 7**&77&&7* 7$$7$71&77 5 77777$777& $&77**$$$& $&$*7$*&7$ 7**&77&&7* 7$$7$77&77 )D 77777$777& $&77**$$$& $&$*7$*&7$ 7**&77&&7* 7$$7$77&77 )E WWWWWDWWWF DFWWJJDDDF DFDJWDJFWD WJJFWWFFWJ WDDWDWWFWW 5 WWWWWDWWWF DFWWJJDDDF DFDJWDJFWD WJJFWWFFWJ WDDWDWWFW7 5 WWWWWDWWWF DFWWJJDDDF DFDJWDJFWD WJJFWWFFWJ WDDWDWWFW7 &216(1686 7*7$*7*7&$ $$&&&&$$$7 7*$77&7777 $$$$$*$*77 *77777777& ) WJWDJWJWFD DDFFFFDDDW WJDWWFWWWW DDDDDJDJWW JWWWWWWWWF 5 WJWDJWJWFD DDFFFFDDDW WJDWWFWWWW DDDDDJDJWW JWWWWWWWWF ) 7*7$*7*71$ $$&&&&$$$7 7*$77&7777 $$$$$*$*77 *77777777& 5 7*7$*7*7&$ $$&&&&$$$7 7*$77&7777 $$$$$*$*77 *77777777& )D 7*7$*7*7&$ $$&&&&$$$7 7*$77&7777 $$$$$*$*77 *77777777& )E WJWDJWJWFD DDFFFFDDDW WJDWWFWWWW DDDDDJDJWW JWWWWWWWWF 5 WJWDJWJWFD DDFFFFDDDW WJDWWFWWWW DDDDDJDJWW JWWWWWWWWF 5 WJWDJWJWFD DDFFFFDDDW WJDWWFWWWW DDDDDJDJWW JWWWWWWWWF &216(1686 $*7&$7**7& $$$7$**&&$ &$7**77&$7 &&7$7777$$ &$$*$$7$77 ) DJWFDWJJWF DDDWDJJFFD FDWJJWWFDW FFWDWWWWDD FDDJDDWDWF 5 DJWFDWJJWF DDDWDJJFFD FDWJJWWFDW FFWDWWWWDD FDDJDDWDWF ) $*7&$7**7& $$$7$**&&$ &$7**77&$7 &&7$777*$$ &$$*$17$7& 5 $*7&$7**7& $$$7$*1&&$ &$7**77&$7 &&7$7777$$ &$$*$$7$7& )D $*7&$7**7& $$$7$**&&$ &$7**77&$7 &&7$7777$$ &$$*$$7$7& )E DJWFDWJJWF DDDWDJJFFD FDWJJWWFDW FFWDWWWWDD FDDJDDWDWF 5 DJWFDWJJWF DDDWDJJFFD FDWJJWWFDW FFWDWWWWDD FDDJDDWDWF 5 DJWFDWJJFF DDDWDJQFFD FDWJJWWFDW FFWDWWWWDD FDDJDDWDWF &216(1686 &$$777$*$$ *$$$&$*777 7*77$77*7* $$**&77&$* *77&$$*$$& ) FDDWWWDJDD JDDDFDJWWW WJWWDWWJWJ DDJJFWWFDJ JWWFDDJDDF 5 FDDWWWDJDD JDDDFDJWWW WJWWDWWJWJ DDJJFWWFDJ JWWFDDJDDF ) &$$777$*$$ *$$$&$*777 7*77$71*7* $$*1&77&$* *77&$**$$& 5 &$$777$*$$ *$$$&$*777 7*77$77*7* $$**&77&$* *77&$$*$$& )D &$$777$*$* *$$$&$*777 7*77$77*7* $$**&77&$* *77&$$*$$& )E FDDWWWDJDD JDDDFDJWWW WJWWDWWJWJ DDJJFWWFDJ JWWFDDJDDF 5 FDDWWWDJDD JDDDFDJWWW WJWWDWWJWJ DDJJFWWFDJ JWWFDDJDDF 5 FDDWWWDJDD JDDDFDJWWW WJWWDWWJWJ DDJJFWWFDJ JWWFDDJDDF &216(1686 7$*7$$$$$$ &$$*7$*$*$ 7$$&$7$7$$ 7&&7*$$*$* ) WDJWDDDDDD FDDJWDJDJD WDDFDWDWDD WFFWJDDJDJ 5 WDJWDDDDDD FDDJWDJDJD WDDFDWDWDD WFFWJDDJD ) 7$*7$$$$$1 &$$*7$***$ 7$$&$7$7$$ 7&&7*$ 5 7$*7$$$$$$ &$$*7$*$*$ 7$$&$7$7$$ 7&&7*$$*$* )D 7$*7$$$$$& &$**7**$*$ 7$$&$717$$ 7&&&*$**** )E WDJWDDDDDD FDDJWDJDJD WDDFDWDWDD WFWJDDJDJ 5 WDJWDDDDDD FDDJWDJDJD W 5 WDJWDDDDDD FDDJWDJDJD WDDFDWDWDD WFFWJDDJDJ

PAGE 103

VHTXHQFLQJ ZDV FORQHG LQWR S*(0 DQG WKHUHIRUH UHSUHVHQWV D VHFRQG JHQHUDWLRQ DZD\ IURP WKH S6SRUW F'1$ WKDW ZDV XVHG IRU LQ YLWUR WUDQVFULSWLRQ WKH S6SRUW F'1$ )Df ZDV DOVR VHTXHQFHG LQ WKLV UHJLRQ 6PDOO VLQJOH EDVH GLIIHUHQFHV ZHUH REWDLQHG ZLWK WKH GLIIHUHQW VHTXHQFH UHDFWLRQV +RZHYHU QR GLIIHUHQFH LQ WKH VHTXHQFH ZDV REVHUYHG EHWZHHQ WKH UHDFWLRQ WKDW XVHG WKH S6SRUW WHPSODWH DQG WKH FRQVHQVXV VHTXHQFH GHULYHG IURP RWKHU LQGLYLGXDO VHTXHQFLQJ UHDFWLRQV )LJ f 7KHVH UHVXOWV YHULI\ WKDW QR VLPSOH VHTXHQFH HUURU ZDV PDGH ZLWKLQ WKH ILUVW EDVHV 7R HVWDEOLVK WKDW DQ HUURU DW WKH HQG RI WKH VHTXHQFH KDG QRW SURGXFHG D SUHPDWXUHO\ VPDOOHU 25) WKH EDVHV DURXQG WKH VWRS FRGRQ RI WKH ORQJ 25) ZHUH DOVR UHH[DPLQHG )LJ f 7KH VHTXHQFHV VKRZQ LQ )LJ KDYH DOO EHHQ JHQHUDWHG E\ VWDQGDUG 6HTXHQDVH VHTXHQFLQJ ,QWURGXFWLRQ RI DQ\ FKDQJHV WR WKH FRQVHQVXV IRXQG LQ LQGLYLGXDO VHTXHQFLQJ UHDFWLRQVf VLQJO\ RU LQ FRPELQDWLRQ GRHV QRW DOWHU WKH OHQJWK RI WKH 25) ,Q DGGLWLRQ VLQFH DGMXVWPHQWV WR WKH ILUVW EDVHV DUH UHTXLUHG WR SODFH D PHWKLRQLQH LQ WKH ORQJ 25) DQ\ FKDQJHV WR WKH HQG RI WKH VHTXHQFH FDQQRW VLJQLILFDQWO\ DOWHU WKH FRQFOXVLRQV 7KHVH GDWD VXJJHVW WKDW WKLV SDUWLFXODU F'1$ JHQHUDWHV D WUDQVFULSW WKDW LV HLWKHU DOWHUHG GXULQJ LQ YLWUR WUDQVFULSWLRQ RU LV WUDQVODWHG LQ DQ XQXVXDO IDVKLRQ $WWHPSWV WR GLUHFWO\ VHTXHQFH WKH LQ YLWUR WUDQVFULSW LQ WKLV UHJLRQ RI S720 ZHUH QRW VXFFHVVIXO GDWD QRW VKRZQf 7KLV DUHD RI WKH F'1$ LV H[WUHPHO\ $7 ULFK bf )RU H[DPSOH DQ EDVH UXQ RI WK\PLQHV EHWZHHQ DQG QXFOHRWLGHV FRPSOHWHO\ VWRSV IXUWKHU 51$ VHTXHQFH FKDUDFWHUL]DWLRQ GRZQVWUHDP

PAGE 104

&RQVHQVXV $&$7&7777* $&$7*7&77$ *DP DFDWFWWWWJ DFDWJWFWWD *DPE DFDWFWWWWJ DFDWJWFWWD *DPE DFDWFWWWWJ DFDWJWFWWD *DP DFDWFWWWWJ DFDWJWFWWD &216(1686 &$$7$**$*$ $*77777*77 *DP FDDWDJJDJD DJWWWWWJWW *DPE FDDWDJJDJD LJWWWAJWW *DPE FDDWDJJDJD DJWWWWWJWW *DP FDDWDJJDJD DJWWWWWJWW $$$**&7&$* $$*$*&7*7 $$$$77*$$* DDDJJFWFDJ DDJDJFWJW DDDDWWJDDJ DDDJJFWFDJ DDJDJFWJW DDDDWWJDDJ DDDJJFWFDJ DDJDJFFWJW DDDDWWJDDJ DDDJJFWFDJ DDJDJFFWJW DDDDWWJDDJ *7$$$7*77$ 7$7&&7$7$$ 777&7*7$*7 FWDDDWJWWD WDWFFWDWDD WWWFWJWDJW JWDADWJAWD WDWM&WDWDA WWWFWJWDJ JWDDDWJWWD WDWFFWDWDD WWWFWJWDJW JW )LJXUH ,QGLYLGXDO VHTXHQFH UHVXOWV REWDLQHG E\ VHTXHQFLQJ ERWK VWUDQGV RI WKH S720 F'1$ EHWZHHQ QXFOHRWLGH DQG XVLQJ VWDQGDUG 6HTXHQDVH VHTXHQFLQJ UHDFWLRQV 7KH FRQVHQVXVf VHTXHQFH ZDV REWDLQHG E\ FRPSDULVRQ WR WKH LQGLYLGXDO VHTXHQFLQJ UHVXOWV *DP DQG UHSUHVHQW VSHFLILF SULPHUV IRU WKH S720 VHTXHQFH

PAGE 105

7KLV UHVXOW PD\ H[SODLQ KRZ DQ HUURU E\ WKH UHYHUVH WUDQVFULSWDVH FRXOG KDYH EHHQ PDGH ZKHQ WKH S720 F'1$ ZDV RULJLQDOO\ SURGXFHG 7KH S720 25) 6KDUHV +RPRORJ\ WR DQ ( &ROL 25) &RPSDULVRQ RI WKH ORQJ 25) RI S720 WR RWKHU GHGXFHG DPLQR DFLG VHTXHQFHV UHYHDOHG b VHTXHQFH VLPLODULW\ WR DQ 25) IURP ( FROL )LJ f $ JO\FLQH ULFK UHJLRQ EHWZHHQ SHSWLGH DQG LV SDUWLFXODUO\ VWULNLQJ 3RVW HW DO f LGHQWLILHG WKLV UHJLRQ LQ WKH ( FROL 25) DV D QXFOHRWLGH ELQGLQJ GRPDLQ EDVHG RQ VLPLODULW\ WR RWKHU SURWHLQV 7KH VHTXHQFH VLPLODULW\ EHWZHHQ WKHVH WZR SURWHLQV VWDUWV DW WKH WK DPLQR DFLG RI S720 +RZHYHU LW UXQV WKURXJKRXW WKH HQWLUH EDFWHULDO VHTXHQFH ,I WKH ILUVW DPLQR DFLGV RI WKH S720 25) DUH UHPRYHG D N' WUDQVLW SHSWLGH DQG D N' PDWXUH SURWHLQ ZRXOG EH SUHGLFWHG 7KH PROHFXODU ZHLJKW RQ 6'63$*( VXJJHVWHG WKDW D N' WUDQVLW SHSWLGH ZRXOG EH SURGXFHG %DUWOH\ HW DO f VKRZHG D VLPLODU UHVXOW ZKHQ WKH\ DQDO\]HG D WRPDWR SK\WRHQH V\QWKDVH WKH\ LVRODWHG $ DPLQR DFLG WUDQVLW SHSWLGH ZRXOG EH FOHDYHG XSRQ LPSRUW LQWR SODVWLGV ZKLOH KRPRORJ\ WR WKH EDFWHULDO SK\WRHQH V\QWKDVH SUHGLFWHG D WUDQVLW SHSWLGH RI DPLQR DFLGV 7KHVH DXWKRUV VXJJHVWHG WKDW SHUKDSV WKH DPLQR WHUPLQDO HQG RI WKH SODQW SURWHLQ LV VLPSO\ ORQJHU WKDQ WKH EDFWHULDO SHSWLGH 6WHDG\ 6WDWH 51$ $QDO\VLV RI WKH &KURPRSODVW$VVRFLDWHG +VS ,W ZDV LPSRUWDQW WR GHWHUPLQH ZKHWKHU WKH DFFXPXODWLRQ RI S720

PAGE 106

/HQJWK *DSV 3HUFHQW 6LPLODULW\ 3HUFHQW ,GHQWLW\ 574:363$./1/)/<,7*45$'*<+7/47/)4)/'<*'7,6,(/5''*%2 ‘ ‘ ,, f ‘ f f 0 f f f f ‘ ‘ 5/7/)63&.,19)/5,76.5''*<+'/$6/)+9,6/*'.,.)6/636.6. ,5//739(*9(+('1/,95$$5//0.7ƒ$'6*5/37*6*$1,6,'.5/% ,, 0O +,0 f f f f f f f f ___ '5/6719$*93/'(51/,,.$/1/<5..7*7'1<) :,+/'..93 0***/***661$$79/9$/1+/:4&*/60'(/$(0*/7/*$'939)95*,, 7*$OJ661$$77/:$$14)6*&9$7(.(/*(:6*(,*6',3)))6+ $$)$(*9*(,/739'33(.:
PAGE 107

WUDQVFULSWV LQ ULSH IUXLW ZDV WKH UHVXOW RI ULSHQLQJ RU RI KHDW VWUHVV 7KLV ZDV DFFRPSOLVKHG E\ PHDVXULQJ WKH VWHDG\ VWDWH OHYHO RI WUDQVFULSW LQ IUXLW KDUYHVWHG IURP WKH ILHOG DQG FRPSDULQJ WKDW WR WUDQVFULSW IURP IUXLW WKDW KDG EHHQ SLFNHG DQG KHOG DW r& GXULQJ ULSHQLQJ RU DOWHUQDWLYHO\ HOHYDWHG WR r& 7KH ILHOG JURZQ IUXLW UHSUHVHQWHG WLVVXH WKDW SUHVXPDEO\ GLIIHUV RQO\ LQ ULSHQLQJ VWDJH )UXLW ZDV LVRODWHG IURP ILHOG JURZQ SODQWV DW DP LQ RUGHU WR DYRLG SULRU KHDW LQGXFWLRQ 7KH S720 WUDQVFULSW ZDV LQFUHDVLQJO\ DEXQGDQW LQ ILHOGULSHQHG IUXLW DV GHYHORSPHQW SURFHHGHG )LJ ODQHV f )RU H[DPSOH EUHDNHU IUXLW FRQWDLQHG WLPHV DV PXFK WUDQVFULSW DV 0* )UXLW ZDV DOVR KDUYHVWHG DQG VWRUHG LQ MDUV ZLWK D IORZ WKURXJK V\VWHP RI KXPLGLILHG DLU DW r& 1R FKDQJH LQ LQWHUQDO WHPSHUDWXUH ZDV REVHUYHG GXULQJ ULSHQLQJ )UXLW PDLQWDLQHG DW r& WRRN GD\V WR UHDFK b ULSH IURP WKH EUHDNHU VWDJH ([DPLQDWLRQ RI WKH VWHDG\VWDWH 51$ WKDW K\EULGL]HV WR S720 UHYHDOHG WKDW DQ LQFUHDVH LQ WUDQVFULSW RFFXUUHG DV GHYHORSPHQW SURJUHVVHG )LJ ODQH f $ERXW WR WLPHV PRUH S720 VSHFLILF 51$ ZDV SUHVHQW E\ WKH b ULSH VWDJH LQ IUXLW KHOG DW QRQVWUHVV WHPSHUDWXUHV )LJ ODQHV f $SSUR[LPDWHO\ WLPHV PRUH 51$ K\EULGL]HG WR S720 IURP ILHOG JURZQ EUHDNHU VWDJH WLVVXH LQ FRPSDULVRQ WR IUXLW KHOG DW r& )LJ ODQH YHUVXV ODQH f 0RUH S720 K\EULGL]LQJ 51$ ZDV IRXQG LQ DOO ODWHU VWDJH ILHOGJURZQ WLVVXH LQ FRPSDULVRQ WR IUXLW KHOG DW r& 7KLV GLIIHUHQFH PD\ EH FDXVHG E\ DQ LQFUHDVH LQ VRPH VWUHVV LQGXFLQJ IDFWRU LQ WKH ILHOGJURZQ IUXLW &OHDUO\ FRQGLWLRQV LQ WKH ILHOG

PAGE 108

)LJXUH 7KH VWHDG\ VWDWH OHYHO RI 51$ IRU S720 LQFUHDVHV GXULQJ GHYHORSPHQW LQ WRPDWR IUXLW LVRODWHG IURP ILHOG JURZQ IUXLW ODQHV f DQG IUXLW KDUYHVWHG DW 0* DQG KHOG DW r& ODQHV f 7KH DPRXQW RI 51$ WKDW LV LQGXFHG GXULQJ KHDW VWUHVV DOVR LQFUHDVHV DV IUXLW ULSHQV ODQH f 51$ IURP PDWXUH JUHHQ 0*f PDWXUH JUHHQ 0*f EUHDNHU %Uf b UHG ULSH f DQG PRUH WKDQ b UHG ULSH !f SHULFDUS WLVVXH ZDV VHSDUDWHG E\ HOHFWURSKRUHVLV RQ GHQDWXULQJ DJDURVH JHOV SJ WRWDO 51$ SHU ODQHf DQG EORWWHG RQWR Q\ORQ PHPEUDQH /DQHV DQG FRQWDLQ S720 LQ YLWUR WUDQVFULSW DQG D GLOXWLRQ UHVSHFWLYHO\ IRU FRPSDULVRQ EHWZHHQ GLIIHUHQW EORWV 7KH PHPEUDQHV ZHUH SUREHG ZLWK>3@ODEHOHG S720 )LOPV ZHUH H[SRVHG IRU KRXUV ZLWK LQWHQVLI\LQJ VFUHHQV

PAGE 109

OHG WR D JUHDWHU DFFXPXODWLRQ RI WKLV WUDQVFULSW GXULQJ ULSHQLQJ WKDQ LI IUXLW ZDV KDUYHVWHG DQG ULSHQHG LQ WKH GDUN DW D XQLIRUPO\ QRQKHDW VWUHVV WHPSHUDWXUH )UXLW DW GLIIHUHQW GHYHORSPHQWDO VWDJHV ZDV VXEMHFWHG WR KRXUV RI r& 7KH LQWHUQDO WHPSHUDWXUH RI IUXLW WUDQVIHUUHG IURP r& WR r& WRRN DERXW KRXUV WR ULVH DERYH r& 7RPDWRHV KHOG FRQWLQXRXVO\ DW WKLV WHPSHUDWXUH ZHUH YLVLEO\ LQKLELWHG LQ FDURWHQRLG DFFXPXODWLRQ ([SRVXUH WR KHDW VWUHVV DOVR UHVXOWHG LQ LQFUHDVHG DFFXPXODWLRQ RI S720 WUDQVFULSW LQ DOO ULSHQLQJ VWDJHV )LJ ODQHV YHUVXV YHUVXV RU YHUVXV f 7KH 0* IUXLW DFFXPXODWHG DERXW KDOI RI WKH 51$ XSRQ KHDW VWUHVV WKDQ GLG PRUH PDWXUH IUXLW 7KHVH GDWD VKRZ WKDW WKLV JHQH FRGHV IRU D PHVVDJH WKDW LV DVVRFLDWHG ZLWK ULSHQLQJ ,W DOVR VKRZV WKDW WKH VDPH JHQH RU D KLJKO\ KRPRORJRXV JHQH LV LQGXFHG E\ KHDW VWUHVV &KDUDFWHUL]DWLRQ RI S720 7UDQVFULSWV LQ 9LYR 51$ IURP WKH VDPH WLVVXH ZDV DOVR SUREHG ZLWK S720 7KH DPRXQW RI WUDQVFULSW SUHVHQW LQ WRPDWR IUXLW WKDW K\EULGL]HV WR WKLV F'1$ LQFUHDVHG DV ULSHQLQJ SURJUHVVHG )LJ ODQH f $ FRPSDULVRQ RI 51$ IURP WLVVXH KHOG DW KLJK DQG ORZ WHPSHUDWXUH UHYHDOHG WKDW D VHFRQG VPDOOHU K\EULGL]LQJ WUDQVFULSW DERXW EDVHV OHVVf ZDV SURGXFHG LQ PDWHULDO WKDW KDG EHHQ H[SRVHG WR KHDW VWUHVV )LJ ODQHV f 7KH 51$ LVRODWHG IURP ILHOGJURZQ IUXLW FRQWDLQHG SURSRUWLRQDOO\ OHVV RI WKLV VPDOOHU WUDQVFULSW WKDQ IUXLW KHOG DW r& %HFDXVH RI WKH SURGXFWLRQ RI WKLV VPDOOHU WUDQVFULSW KHDW VWUHVVHG PDWHULDO FRQWDLQHG PRUH WRWDO PHVVDJH WKDW K\EULGL]HG WR S720 6LQFH WKH GLVFRYHU\ RI D VPDOOHU VL]HG WUDQVFULSW DQG DQ

PAGE 110

)LJXUH 7KH VWHDG\ VWDWH OHYHO RI 51$ IRU S720 LQFUHDVHV GXULQJ ULSHQLQJ LQ WRPDWR IUXLW LVRODWHG IURP WKH ILHOG ODQHV f DQG IUXLW KDUYHVWHG DW 0* DQG KHOG DW r& ODQHV f $ VHFRQG VPDOOHU WUDQVFULSW DSSHDUV ZKLFK DOVR LQFUHDVHV ZLWK GHYHORSPHQWDO VWDJH ZKHQ IUXLW LV VXEMHFWHG WR KHDW VWUHVV DW r& IRU KRXUV ODQHV f 51$ IURP PDWXUH JUHHQ 0*f PDWXUH JUHHQ 0*f EUHDNHU %Uf b UHG ULSH f DQG PRUH WKDQ b UHG ULSH !f SHULFDUS WLVVXH ZDV VHSDUDWHG E\ HOHFWURSKRUHVLV RQ GHQDWXULQJ DJDURVH JHOV SJ WRWDO 51$ SHU ODQHf DQG EORWWHG RQWR Q\ORQ PHPEUDQH /DQHV DQG FRQWDLQ S720 LQ YLWUR WUDQVFULSW DQG GLOXWLRQV UHVSHFWLYHO\ IRU FRPSDULVRQ EHWZHHQ GLIIHUHQW EORWV 7KH PHPEUDQHV ZHUH SUREHG ZLWK >3@ODEHOHG S720 )LOPV ZHUH H[SRVHG RYHUQLJKW ZLWK LQWHQVLI\LQJ VFUHHQV

PAGE 111

LQFUHDVH LQ S720 WUDQVFULSW GXULQJ KHDW VWUHVV ZDV XQH[SHFWHG WKH VDPH VDPSOHV ZHUH K\EULGL]HG ZLWK D VHTXHQFH RI NQRZQ IXQFWLRQ 7KH S720 F'1$ ZKLFK FRGHV IRU WKH ULSHQLQJ DVVRFLDWHG HQ]\PH SRO\JDODFWXURQDVH 3*f ZDV FKRVHQ EHFDXVH WKH OHYHO RI LWV PHVVDJH ZDV QRW H[SHFWHG WR FKDQJH DIWHU VXFK D VKRUW KHDW VWUHVV $V H[SHFWHG WKH WUDQVFULSW IRU S720 LQFUHDVHG GXULQJ ULSHQLQJ LQ DOO WKUHH WUHDWPHQW JURXSV +RZHYHU QR QHZ VL]HG WUDQVFULSW RU GUDPDWLF FKDQJH LQ WKH DPRXQW RI WUDQVFULSW WKDW K\EULGL]HG WR S720 GXH WR KHDW VWUHVV ZDV REVHUYHG GDWD QRW VKRZQf 'LVFXVVLRQ 7R EHJLQ DQ H[DPLQDWLRQ RI WKH WUDQVLWLRQ RI FKORURSODVWV LQWR FKURPRSODVWV ZH ZHUH LQWHUHVWHG LQ LGHQWLI\LQJ SODVWLG SURWHLQV WKDW DUH LQFUHDVLQJO\ V\QWKHVL]HG GXULQJ WKLV SHULRG 3UHYLRXV VWXGLHV KDYH HLWKHU IRFXVHG RQ WKH GHFUHDVH LQ V\QWKHVLV RI SKRWRV\QWKHWLF SURWHLQV 3LHFKXOOD HW DO DQG /LYLQH DQG *HSVWHLQ f RU KDYH UHOLHG RQ WKH LGHQWLILFDWLRQ RI VSHFLILF FKURPRSODVW DVVRFLDWHG SURWHLQV IURP WRWDO SODVWLG H[WUDFWV 1HZPDQ HW DO f %HFDXVH WKH ODWWHU PHWKRG FDQ RQO\ EH DSSOLHG WR DEXQGDQW SURWHLQV ZH FKRVH WR XVH LPSRUW DVVD\V WR LGHQWLI\ F'1$V IRU DQ\ WUDQVFULSWV WKDW DUH ULSHQLQJ HQKDQFHG DQG HQFRGH FKURPRSODVWWDUJHWHG SURWHLQV 7KH LGHQWLILFDWLRQ RI D SODVWLG ORFDOL]HG ORZ 0: KVS ZDV ERWK JUDWLI\LQJ DQG SX]]OLQJ 6LQFH WKH IUXLW XVHG WR FORQH S720 ZDV QRW NQRZQ WR EH VSHFLILFDOO\

PAGE 112

KHDW VWUHVVHG WKH ILQGLQJ RI VXFK D SURWHLQ GXULQJ ULSHQLQJ ZDV XQH[SHFWHG 2WKHU KVS F'1$V KDYH EHHQ LVRODWHG IURP KHDW VWUHVVHG PDWHULDO DQG ODWHU WKH SURWHLQV KDYH EHHQ ORFDOL]HG WR WKH SODVWLG &RQVHTXHQWO\ WKH UHVXOWV IURP VHTXHQFH DQDO\VLV RI WKLV F'1$ VXSSRUWHG WKH SODVWLG ORFDOL]DWLRQ LGHQWLILHG E\ WKH LPSRUW DVVD\ 7KH ODFN RI D VWDQGDUG 25) LQ S720 FRXOG EH WKH UHVXOW RI D F'1$ V\QWKHVLV DUWLIDFW RU FRXOG UHSUHVHQW D QRYHO PHWKRG RI UHJXODWRU\ FRQWURO 6LQFH WKH ILUVW VHTXHQFHG F'1$ IURP WKLV OLEUDU\ IRU S720 ZDV DOVR DOWHUHG LQ D VLPLODU PDQQHU +DPLOWRQ HW DO f WKH ILUVW H[SODQDWLRQ FDQQRW EH LJQRUHG 7KH IDFW WKDW S720 FDQ SURGXFH DQ LQ YLWUR WUDQVODWLRQ SURGXFW FDSDEOH RI EHLQJ LPSRUWHG VXJJHVWV WKDW WKH F'1$ LV DW ZRUVW RQO\ VOLJKWO\ FKDQJHG IURP LWV IXQFWLRQDO VHTXHQFH 7UDQVODWLRQ RI WKH LQ YLWUR WUDQVFULSW FDQ EH H[SODLQHG DV IUDPHVKLIWLQJ FDXVHG E\ WKH SUHVHQFH RI QXPHURXV FRQVHFXWLYH UXQV RI LQGLYLGXDO EDVHV ZLWKLQ WKH ILUVW QXFOHRWLGHV RI WKH S720 VHTXHQFH )LJ f 6XFK VLQJOH EDVH UHSHDWV KDYH EHHQ FDOOHG VOLSSHU\ UXQV $WNLQV HW DO f EHFDXVH WKH\ FDQ IDFLOLWDWH IUDPHVKLIWV GXULQJ WUDQVODWLRQ 7KH EHVW FKDUDFWHUL]HG H[DPSOHV RI WKLV SKHQRPHQRQ KDYH EHHQ GRFXPHQWHG LQ WKH 5)f JHQH RI ( FROL DQG LQ UHWURYLUXVHV 7KHVH VHTXHQFHV DUH FRQVLGHUHG WR EH D PHFKDQLVP IRU WUDQVODWLRQDO FRQWURO EHFDXVH WKH\ FDQ DOWHU WKH HIILFLHQF\ RI WUDQVODWLRQ IRU VSHFLILF JHQHV ,Q WKH UHWURWUDQVSRVRQ 7\O RI \HDVW D VLPSOH VHTXHQFH &88 $** & KDV EHHQ VKRZQ WR FDXVH D IUDPHVKLIW XS WR b RI WKH WLPH :HLVV f 7KH W51$NX UHFRJQL]HV WKH &88 FRGRQ KRZHYHU LW FDQ DOVR XWLOL]H WKH IUDPHVKLIW FRGRQ 88$ $Q DGGLWLRQDO UHTXLUHPHQW IRU HIILFLHQW

PAGE 113

WUDQVODWLRQDO IUDPHVKLIW LQ WKLV VHTXHQFH LV WKH SUHVHQFH RI WKH UDUH DUJLQLQH FRGRQ $** SUHVHQW FRGRQV LQ \HDVWf 3HUKDSV ZKHQ WKLV UDUH $** FRGRQ LV HQFRXQWHUHG WKH ULERVRPHV SDXVH ZKLOH ZDLWLQJ IRU WKH PLQRU W51$ DQG WKLV DOORZV WKH UHVLGHQW OHXFLQH W51$ WR VOLS 7KH ULERVRPHV FDQ DFWXDOO\ VWDFN XS DORQJ WKH WUDQVFULSW EHFDXVH WUDQVODWLRQ HIIHFLHQF\ LV VR FRPSURPLVHG 2YHUH[SUHVVLRQ RI WKH DUJLQLQH W51$ E\ WUDQVIRUPDWLRQ RI LWV JHQH RQ D KLJK FRS\ SODVPLG UHGXFHV WKH OHYHO RI IUDPHVKLIWLQJ 7KH FRQVHUYDWLRQ RI WKLV W\SH RI WUDQVODWLRQDO PHFKDQLVP LV GHPRQVWUDWHG E\ WKH DELOLW\ RI UDEELW UHWLFXORF\WHV WR SURGXFH WKH IUDPHVKLIWHG 5)f SURWHLQ RI ( FROL UHYLHZHG E\ :HLVV f $ K\SRWKHVLV RI KRZ D IUDPHVKLIWHG S720 SURWHLQ FRXOG EH SURGXFHG LV SUHVHQWHG LQ )LJ 7KH ILUVW FRGRQV RI WKH QG DQG UG UHDGLQJ IUDPHV DUH VKRZQ $ IUDPHVKLIW FRXOG RFFXU DW FRGRQ 1RW RQO\ LV WKH VDPH FRGRQ XVHG LQ HLWKHU IUDPH VR WKDW WKH VDPH W51$ FRXOG EH XWLOL]HG EXW LI WKH FRGRQ SUHIHUHQFH LV H[DPLQHG ZKLFK KDV EHHQ WDEXODWHG IRU QXPHURXV VSHFLHV :DGD HW DOf LW LV DSSDUHQW WKDW WKH IROORZLQJ WK DQG VW FRGRQV RI IUDPH DUH IDLUO\ UDUH FRGRQV $ FRPSDULVRQ EHWZHHQ FRGRQV XVHG LQ WRPDWR YHUVXV UDEELW DQG ZKHDW )LJ %f UHYHDOHG WKDW WKH WK DQG VW FRGRQV RI WKH VHFRQG UHDGLQJ IUDPH DUH HYHQ OHVV FRPPRQ LQ WKHVH RUJDQLVPV IURP ZKLFK WKH LQ YLWUR WUDQVODWLRQ V\VWHPV KDYH EHHQ LVRODWHG 6LQFH WKH VXFFHVVIXO IUDPHVKLIW LQ 7\O RI \HDVW RFFXUUHG EHFDXVH $** UHSUHVHQWHG HYHU\ FRGRQV :DGD HW DO f LW VHHPV SODXVLEOH WKDW WKH UDEELW DQG ZKHDW V\VWHPV PD\ EH SDUWLFXODUO\ XQGHUUHSUHVHQWHG IRU WKH W51$V QHHGHG DW FRGRQ DQG IRXQG DQG LQ UDEELWf 7KLV VXJJHVWV WKDW OLNH

PAGE 114

$ &2'21 *&7 7&& 7*7 $$7 $77 &77 7*7 $*7 *7& $$$ &&& &$$ $77 )5$0( $ 6 & 1 / & 6 9 3 4 720$72 &77 &&7 *7$ $7$ 77& 777 *7$ *7* 7&$ $$& &&& $$$ 77* )5$0( / 3 9 ) ) 9 9 6 1 3 / 720$72 &2'21 *$7 7&7 777 $$$ $$* $*7 7*7 777 777 7&$ *7& $7* *7& $$$ )5$0( 6 ) . 6 & ) ) 6 9 0 9 720$72 $77 &77 77$ $$$ $*$ *77 *77 777 777 &$* 7&$ 7** 7&$ $$7 )5$0( / / 5 9 9 ) ) 6 8 6 720$72 % F &2221 &2'21 777 $$$ $$* $*7 7*7 )5$0( $$$ $$* $*7 7*7 )5$0( ) . 6 & O LL OO OO L L B 720$72 )5$0( $$$ $*$ *77 *77 5$%%,7 :+($7 )LJXUH 0RGHO H[SODLQLQJ D SRVVLEOH IUDPHVKLIW LQ WKH S720 WUDQVFULSW $f $QDO\VLV RI WKH FRGRQ XVDJH IRU WKH VHFRQG DQG WKLUG IRUZDUG UHDGLQJ IUDPH RI S720 7KH UG IUDPH LV RIIVHW IURP WKH QG IUDPH E\ D VLQJOH EDVH 5HDGLQJ IUDPH DSSHDUV DERYH UHDGLQJ IUDPH &RGRQ XVDJH ZDV WDEXODWHG E\ :DGD HW DO f DV WKH QXPEHU RI WLPHV WKH FRGRQ DSSHDUV SHU FRGRQV %f &RPSDULVRQ RI FRGRQ XVDJH LQ WRPDWR UDEELW DQG ZKHDW IRU WKH FRGRQV DSSHDULQJ LQ SRVLWLRQ WR LQ WKH QG IUDPH RI WKH S720 VHTXHQFH &f 0RGHO IRU SRVVLEOH IUDPHVKLIW DW FRGRQ

PAGE 115

WKH VFHQDULR LQ \HDVW D ODUJH S720 SURWHLQ FRXOG RFFXU E\ D IUDPHVKLIW FDXVHG E\ LQHIILFLHQW WUDQVODWLRQ LQ YLWUR 6LQFH WKH LPSRUW DVVD\ LQYROYHV WKH WUDQVODWLRQ DQG LPSRUW RI D VLQJOH WUDQVFULSW LW LV SRVVLEOH WKDW HYHQ DQ LQHIILFLHQWO\ WUDQVODWHG SURWHLQ FRXOG EH GHWHFWHG 3HUKDSV WKH RQO\ RWKHU SDUWLDOO\ LPSRUW FRPSHWHQW SURWHLQ SURGXFHG LQ WKLV UHDFWLRQ LV WKH DPLQR DFLG SHSWLGH IRXQG LQ WKH VHFRQG UHDGLQJ IUDPH $ SURWHLQ RI WKLV VL]H LV REVHUYHG LQ WKH WUDQVODWLRQ PL[WXUH GDWD QRW VKRZQf 7KLV VPDOO SURWHLQ FRXOG EH LPSRUWHG DQG TXLFNO\ GHJUDGHG LQVLGH RI WKH SODVWLGV VLQFH WKH FOHDYHG WUDQVLW SHSWLGHV DUH DOVR QRW IRXQG LQVLGH WKH RUJDQHOOH $OWHUQDWLYHO\ WKH VPDOOHU SURWHLQ ZKLFK GRHV QRW FRQWDLQ WKH HQWLUH WUDQVLW SHSWLGH PD\ EH RXWFRPSHWHG E\ WKH ODUJHU S720 WUDQVODWLRQ SURGXFW 8QWLO LW FDQ EH GHWHUPLQHG WKDW WKH S720 F'1$ LV D IXQFWLRQDO UHSUHVHQWDWLYH RI WKH JHQH LQ YLYR DWWHPSWV WR FODULI\ D SUHFLVH IUDPHVKLIW PHFKDQLVP VHHP SUHPDWXUH ,Q RUGHU WR GHWHUPLQH KRZ S720 LV WUDQVODWHG LQ YLYR D JHQRPLF FORQH RI S720 VKRXOG EH LVRODWHG DQG VHTXHQFHG LQ WKLV UHJLRQ +DPLOWRQ HW DO f UHVROYHG WKH HUURU JHQHUDWHG LQ WKH S720 F'1$ E\ GLUHFW 51$ VHTXHQFLQJ +RZHYHU JLYHQ WKH $7 ULFKQHVV RI WKLV UHJLRQ LQ S720 DQG WKH UHODWLYHO\ ORZ DEXQGDQFH RI WKLV PHVVDJH GLUHFW VHTXHQFLQJ LV SUREDEO\ QRW SUDFWLFDO ,I DGGLWLRQDO FORQLQJ DQG VHTXHQFLQJ GHPRQVWUDWH WKDW WKLV XQXVXDO VHTXHQFH LV QRUPDOO\ SUHVHQW LQ YLYR WKHQ LW ZRXOG EH LPSRUWDQW WR PDNH DQ DQWLERG\ WR WKH ORQJ 25) SURGXFHG LQ ( FROL LQ RUGHU WR GHWHPLQH WKDW WKLV SURWHLQ LV DFWXDOO\ SUHVHQW LQ ULSHQLQJ WRPDWR IUXLW $W WKLV SRLQW ZH KDYH RQO\ VKRZQ WKDW WKH WUDQVFULSW

PAGE 116

QR LV LQFUHDVLQJO\ SUHVHQW GXULQJ IUXLW PDWXUDWLRQ $GGLWLRQDOO\ WKH DQWLVHQVH PXWDJHQHVLV RI WRPDWR ZLWK S720 VHH $SSHQGL[f LV SUHVHQWO\ XQGHUZD\ 7KLV PD\ SURGXFH D GHPRQVWUDEOH PXWDQW SKHQRW\SH SURYLQJ WKDW WKH WUDQVFULSW LV LPSRUWDQW LQ YLYR )LQDOO\ LW LV SRVVLEOH WKDW WKH IUDPHVKLIW RXWOLQHG DERYH LV D PHFKDQLVP XVHG LQ YLYR WR FRQWURO WUDQVODWLRQ RI WKH S720 WUDQVFULSW ,W LV SRVVLEOH WR VHTXHQFH UDGLRODEHOHG WUDQVODWLRQ SURGXFWV VR WKDW D GHWHUPLQDWLRQ FDQ EH PDGH DERXW ZKDW UHDGLQJ IUDPH KDV EHHQ XVHG WR SURGXFH WKH S720 WUDQVODWLRQ SURGXFW %DVVKDP HW DO f 7KLV WHFKQLTXH GHWHUPLQHV ZKHUH WKH UDGLRODEHOHG DPLQR DFLG LV LQFRUSRUDWHG LQ WKH VHTXHQFH )RU H[DPSOH LI >+@OHXFLQH ZHUH XVHG LQ WKH VHTXHQFLQJ UHDFWLRQ WKH ORQJ XQPRGLILHG 25) LQ IUDPH ZRXOG EH ODEHOHG DW WKH VW UG WK WK DQG WK SRVLWLRQ ,Q WKH ILUVW DPLQR DFLGV RI IUDPH WKH VDPH UHDFWLRQ ZRXOG ODEHO RQO\ WKH WK DPLQR DFLG )LJ f $OWHUQDWLYHO\ O\VLQH FRXOG EH XVHG WR FRQILUP WKH LQLWLDO SURWHLQ VHTXHQFLQJ UHVXOWV ,Q WKLV ZD\ WKH SUHFLVH SRVLWLRQ RI WKH IUDPHVKLIW FRXOG EH GHPRQVWUDWHG 0RUH LQIRUPDWLRQ LV QHHGHG DERXW WKH IXQFWLRQ RI WKH ( FROL 25) EHIRUH FRQFOXVLRQV FDQ EH PDGH DERXW ZKDW WKH KRPRORJ\ WR S720 PHDQV WR WKH XQGHUVWDQGLQJ RI FKURPRSODVW GHYHORSPHQW 7KLV 25) ZKLFK LV UHIHUUHG WR DV 25) LV WUDQVFULEHG DV D WULFLVWURQLF PHVVDJH ZLWK SKRVSKRULERV\OS\URSKRVSKDWH 3533f V\QWKHWDVH 3533 LV DQ LQWHUPHGLDWH LQ WKH V\QWKHVLV RI S\ULGLQH QXFOHRWLGH FRHQ]\PHV KLVWLGLQH WU\SWRSKDQ DQG WKH S\ULPLGLQH DQG SXULQH QXFOHRWLGHV 7KH WULFLVWURQLF PHVVDJH RQO\ UHSUHVHQWV DERXW b RI WKH WRWDO DPRXQW RI 3533

PAGE 117

,OO V\QWKHWDVH PHVVDJH SURGXFHG 3RVW HW DO f 7KH UHVW LV V\QWKHVL]HG IURP D SURPRWHU ZLWKLQ WKH 25) RQ D PRQRFLVWURQLF WUDQVFULSW WKDW LV LQGXFLEOH E\ S\ULPLGLQH VWDUYDWLRQ ,Q DGGLWLRQ WKH 25) KDV EHHQ VKRZQ WR FRPSOHPHQW PXWDQWV LQ DPLQROHYXOLQLF DFLG $/$f V\QWKHVLV ,NHPL HW DO f 7KH $/$ PXWDQWV DUH GHILFLHQW LQ F\WRFKURPHV DQG FRQVHTXHQWO\ UHVXOW LQ UHVSLUDWRU\ GHILFLHQFLHV 7KHVH DXWKRUV KDYH VXJJHVWHG WKDW WKH 25) PD\ V\QWKHVL]H RQH RI WKH VXEXQLWV IRU D W51$ JOXWDP\O 1$'3+ GHK\GURJHQDVH ZKLFK LV D VWHS LQ WKH FDUERQ SDWKZD\ RI $/$ V\QWKHVLV ,W LV XQFOHDU ZK\ WKH V\QWKHVLV RI 3533 DQG $/$ VKRXOG EH FRRUGLQDWHG 7KH RQO\ REYLRXV LQYROYHPHQW RI 3533 LQ WKH $/$ SDWKZD\ PD\ EH LQ WKH SURGXFWLRQ RI WKH 1$'3+ ,Q DGGLWLRQ WKHVH GDWD GR QRW VXJJHVW D IXQFWLRQ IRU WKH 25) RU S720 8QWLO D PXWDQW SKHQRW\SH IRU WKH 25) RU S720 LV SURGXFHG RU D FRQQHFWLRQ LV PDGH EHWZHHQ WKH V\QWKHVLV RI $/$ DQG 3533 WKH IXQFWLRQ RI WKHVH WZR 25)V ZLOO UHPDLQ HQLJPDWLF 7KH VHFRQG WUDQVFULSW WKDW K\EULGL]HV WR S720 PD\ EH SURGXFHG E\ D VHFRQG JHQH RU PD\ UHVXOW IURP SURFHVVLQJ RI S720 LWVHOI 1RUPDOO\ KHDW VWUHVV FDQ LQKLELW WKH WUDQVFULSWLRQ SURFHVVLQJ VWDELOLW\ RI PHVVDJHV DQG WKH WUDQVODWLRQ RI FRQVWLWXWLYHO\ H[SUHVVHG SURWHLQV *XUOH\ DQG .H\ f +RZHYHU WKH RSSRVLWH VHHPV WR RFFXU ZLWK S720 ,Q WKLV FDVH QRW RQO\ LV PRUH WRWDO S720 K\EULGL]LQJ PHVVDJH SURGXFHG GXULQJ KHDW VWUHVV EXW D VPDOOHU WUDQVFULSW LV IRUPHG 6RXWKHUQ DQDO\VLV RI WRPDWR '1$ ZLWK S720 VXJJHVWV WKDW RQO\ RU JHQHV DUH SUHVHQW GDWD QRW VKRZQf 6LQFH PRUH VWHDG\VWDWH 51$ LV SUHVHQW LQ WKH KHDW VWUHVVHG PDWHULDO LW LV XQOLNHO\ WKDW D VWUHVV UHODWHG WUDQVFULSW GHJUDGDWLRQ LV WKH

PAGE 118

SUHGRPLQDQW IDFWRU IRU WKH LQFUHDVH LQ WRWDO DPRXQW RI 51$ WKDW K\EULGL]HV WR S720 LQ KHDW VWUHVVHG PDWHULDO 7KH VLPSOHVW LQWHUSUHWDWLRQ RI WKHVH GDWD LV WKDW KHDW VWUHVV DFWXDOO\ LQGXFHV WKH SURGXFWLRQ RI WKH VHFRQG WUDQVFULSW 3HUKDSV D VHFRQG S720 SURWHLQ LV SURGXFHG WKDW LV QRW WDUJHWHG WR SODVWLGV ,I WKH S720 WUDQVFULSW GLG QRW FRQWDLQ D WUDQVLW SHSWLGH FRPSDULVRQ WR WKH EDFWHULDO 25) VXJJHVWV WKDW WKH WUDQVFULSW ZRXOG EH DSSUR[LPDWHO\ EDVHV VKRUWHU 7KLV VHFRQG WUDQVFULSW FRXOG EH SURGXFHG E\ D VHFRQG JHQH RU UHVXOW IURP DOWHUHG SURFHVVLQJ RI S720 5HFHQWO\ &KLX HW DOf IRXQG WKDW WKH VDPH JHQH LQ \HDVW SURGXFHG WZR WUDQVFULSWV IRU D KLVWLG\OW51$ V\QWKHWDVH 2QH RI WKHVH SURWHLQV ZDV WDUJHWHG WR WKH PLWRFKRQGULD ZKLOH D VKRUWHU WUDQVFULSW FRGHG IRU D F\WRSODVPLF IRUP RI WKH HQ]\PH 6LWH GLUHFWHG PXWDJHQHVLV RI WKH JHQH DQG WUDQVIRUPDWLRQ EDFN LQWR \HDVW FRQILUPHG ZKDW VHTXHQFH DQDO\VLV KDG VXJJHVWHG $QWLVHQVH 51$ WUDQVIRUPDWLRQ RI S720 LV SUHVHQWO\ XQGHUZD\ VHH $SSHQGL[f +RSHIXOO\ WKH SURGXFWLRQ RI DQ DQWLVHQVH PXWDQW LQ WRPDWR ZLOO KHOS WR FODULI\ WKH UROH RI S720 GXULQJ FKURPRSODVW GHYHORSPHQW 7KH UHVXOWV UHSRUWHG LQ )LJ FRQILUP WKDW WKH S720 WUDQVFULSW LV ULSHQLQJ DVVRFLDWHG DW QRUPDO WHPSHUDWXUHV DQG DOVR WKDW PRUH WUDQVFULSW LV SURGXFHG LQ UHVSRQVH WR KHDW VWUHVV DV ULSHQLQJ SURFHHGV 7KHVH UHVXOWV DUH VWULNLQJO\ UHPLQLVFHQW RI GDWD VKRZQ E\ 2OVRQ HW DO f IRU WKH DFFXPXODWLRQ RI $&& V\QWKDVH LQ WRPDWR IUXLW GXULQJ ULSHQLQJ ZLWK DQG ZLWKRXW ZRXQGLQJ 7KH $&& V\QWKDVH WUDQVFULSW FRGHV IRU D PHPEHU RI D VPDOO PXOWLJHQH IDPLO\ WKDW LV LQYROYHG LQ WKH V\QWKHVLV RI HWK\OHQH 7KH LQGXFWLRQ RI WKLV KRUPRQH LV NQRZQ WR RFFXU GXULQJ

PAGE 119

ERWK ULSHQLQJ DQG ZRXQGLQJ )UXLW ZRXQGHG DW GLIIHUHQW VWDJHV RI PDWXULW\ VKRZHG DQ LQFUHDVLQJ DPRXQW RI ZRXQG LQGXFHG $&& V\QWKDVH WUDQVFULSW DV ULSHQLQJ SURJUHVVHG ,Q RWKHU ZRUGV WKH FRPELQDWLRQ RI ULSHQLQJ DQG ZRXQGLQJ DFWV V\QHUJLVWLFDOO\ WR DIIHFW WKH VWHDG\ VWDWH OHYHO RI WKLV WUDQVFULSW 7KLV DQDORJ\ SURSRVHV WKDW WKH LQFUHDVH LQ KVS WUDQVFULSW LV GXH WR FKURPRSODVW GHYHORSPHQW DQG LV HQKDQFHG E\ KHDW VWUHVV 7KH UROH IRU WKH ORZ 0: KHDW VKRFN SURWHLQV UHPDLQV REVFXUH 9LHUOLQJ f ,W LV JHQHUDOO\ DFFHSWHG WKDW WKHVH SURWHLQV DUH LQGXFHG E\ WKH SUHVHQFH RI XQIROGHG RU DEHUUDQW SURWHLQV 1HXPDQQ HW DO f 8QOLNH WKH KVS V DQG V WKH ORZ 0: KVSV LQ SODQWV DUH XVXDOO\ RQO\ REVHUYHG GXULQJ WLPHV RI VWUHVV +RZHYHU D IHZ H[FHSWLRQV WR WKLV KDYH EHHQ QRWHG )RU H[DPSOH ORZ 0: KVS WUDQVFULSW LV SUHVHQW LQ GU\ DQG JHUPLQDWLQJ HPEU\RV RI ZKHDW +HOP DQG $EHUQHWK\ f DQG VXQIORZHU $OPRJXHUD DQG -RUGDQR f ,W KDV DOVR EHHQ REVHUYHG GXULQJ VRPDWLF HPEU\R IRUPDWLRQ LQ DOIDOID *\RUJ\H\ HW DO f +RZHYHU WKHUH KDYH EHHQ QR SUHYLRXV UHSRUWV RI D GHYHORSPHQWDOO\ LQGXFHG SODVWLGORFDOL]HG ORZ 0: KVS 3HUKDSV WKLV W\SH RI HYLGHQFH ZLOO VXJJHVW D IXQFWLRQ IRU WKHVH HQLJPDWLF SURWHLQV 7KH ORZ 0: KVSV KDYH DOVR EHHQ DVVRFLDWHG ZLWK FDGPLXP DUVHQLWH DQG RVPRWLF VWUHVV LQ SODQWV LQ VRPH LQVWDQFHV &]DUQHFND HW DO (GHOPDQ HW DO *\RUJ\H\ HW DO $OPRJXHUD DQG -RUGDQR f /RZ 0: KVSV KDYH DOVR EHHQ DVVRFLDWHG ZLWK R[LGDWLYH VWUHVV LQ 'URVRSKLOD DQG PDPPDOLDQ FHOOV 'UXPPRQG DQG 6WHLQKDUGW &DMRQH DQG %HUQHOOL=D]]HUD &RXUJHRQ HW

PAGE 120

DO f %RWK KHDW DQG R[LGDWLYH VWUHVV DUH EHOLHYHG WR FUHDWH DEHUUDQW DQG XQIROGHG SURWHLQV 1HXPDQQ HW DO f $OWKRXJK WKH UHVSRQVH WR WKHVH VWUHVVHV LV XVXDOO\ ORZHU WKDQ WKH UHVSRQVH WR KHDW VWUHVV WKH IDFW WKDW WKH ORZ 0: KVSV DUH LQGXFHG E\ RWKHU VWUHVVHV GRHV VXJJHVW WKDW FKDQJHV LQ WKH HQYLURQPHQW RI ULSHQLQJ IUXLW VKRXOG EH FRQVLGHUHG 7KH TXHVWLRQ WKDW LPPHGLDWHO\ DULVHV IURP WKHVH REVHUYDWLRQV LV ZKDW UROH GRHV D SODVWLG ORFDOL]HG ORZ 0: KVS SHUIRUP GXULQJ ULSHQLQJ" ,V WKH SURGXFWLRQ RI WKLV WUDQVFULSW GXH WR VRPH PDVVLYH UHSURJUDPPLQJ RI SURWHLQ VWUXFWXUH GXULQJ WKH IRUPDWLRQ RI FKURPRSODVWV RU GRHV VRPH RWKHU DVSHFW RI WKH HQYLURQPHQW ZLWKLQ WKH ULSHQLQJ IUXLW LQGXFH H[SUHVVLRQ RI WKLV KVS" $ UHFHQW SDSHU E\ 5RPHU HW DO f IRXQG WKDW VHYHUDO IUHH UDGLFDO VFDYHQJLQJ HQ]\PHV DQG FRPSRXQGV LQFUHDVH GXULQJ WKH GHYHORSPHQW RI FKURPRSODVWV LQ SHSSHU IUXLW +RZHYHU WKH HYLGHQFH IRU R[LGDWLYH VWUHVV GXULQJ FKURPRSODVW IRUPDWLRQ LQ WRPDWR IUXLW LV FRQWUDGLFWRL\ 3HUO7UHYHV DQG *DOXQ f IRXQG QR LQFUHDVH LQ HLWKHU RI WKH SODVWLGLDO IUHH UDGLFDO VFDYHQJLQJ VXSHUR[LGH GLVPXWDVH 62'f LVR]\PHV GXULQJ WRPDWR IUXLW GHYHORSPHQW $GGLWLRQDOO\ WKH\ IRXQG WKDW WKH VLQJOH SODVWLGLDO WUDQVFULSW WKH\ IROORZHG LV ORZ DW 0* DQG DFWXDOO\ XQGHWHFWDEOH ODWHU LQ GHYHORSPHQW /LYLQH DQG *HSVWHLQ f KRZHYHU IRXQG WKDW FURVVUHDFWLQJ PDWHULDO WR D SODVWLGLDO 62' SHDNV DW WKH RUDQJH VWDJH &RQVHTXHQWO\ LW LV XQFOHDU ZKHWKHU WRPDWR FKURPRSODVWV DUH R[LGDWLYHO\ VWUHVVHG GXULQJ ULSHQLQJ 2QH UHVXOW RI R[LGDWLYH VWUHVV FDQ EH D ORVV LQ PHPEUDQH LQWHJULW\ ([DPLQDWLRQ RI WKH SODVWLG PHPEUDQH GXULQJ FKURPRSODVW GHYHORSPHQW LQ SHSSHU

PAGE 121

DQG WRPDWR IUXLW KDV VKRZQ WKDW QR ORVV LQ LQWHJULW\ RFFXUV /HJJH HW DO :KLWDNHU f ,Q RWKHU ZRUGV DOWKRXJK WKHUH LV HYLGHQFH IRU DQ LQFUHDVH LQ R[LGDWLYH VWUHVV LQ SHSSHU FKURPRSODVWV WKHUH LV FXUUHQWO\ QR HYLGHQFH IRU GDPDJH RI SODVWLG PHPEUDQHV GXH WR R[LGDWLYH VWUHVV GXULQJ FKURPRSODVW GHYHORSPHQW &RQVHTXHQWO\ HYHQ LI WKHUH LV VRPH LQFUHDVH LQ IUHH UDGLFDO VFDYHQJHUV GXULQJ ULSHQLQJ LW LV XQFHUWDLQ LI WKLV FKDQJLQJ HQYLURQPHQW OHDGV WR DQ LQFUHDVH LQ GDPDJHG SODVWLG SURWHLQV 2QH SRVVLEOH H[SODQDWLRQ IRU WKH LQGXFWLRQ RI S720 GXULQJ ULSHQLQJ LV WKDW WKH VWUHVV UHVSRQVH LV D JHQHUDO RQH FDXVHG E\ FKDQJHV LQ WKH F\WRSODVP GXULQJ GHYHORSPHQW 6LQFH S720 DOVR LQFUHDVHV GXULQJ ULSHQLQJ LQ WKH DEVHQFH RI KHDW VWUHVV 3LFWRQ DQG *ULHUVRQ f SHUKDSV WKH LQGXFWLRQ LV GHSHQGHQW RQ WKH WLVVXH UDWKHU WKDQ WKH FRPSDUWPHQW LQ ZKLFK WKH SURWHLQ UHVLGHV +RZHYHU WKLV LGHD UHTXLUHV WKDW WKH LQGXFWLRQ RI VRPH KVSV GXULQJ ULSHQLQJ PD\ EH VXSHUIOXRXV 7KH XOWLPDWH ORFDWLRQ ZLWKLQ WKH SODVWLG PD\ KHOS SUHGLFW WKH IXQFWLRQ RI WKH SODVWLGORFDOL]HG ORZ 0: KVSV KRZHYHU WKHVH GDWD KDYH EHHQ VRPHZKDW FRQIOLFWLQJ .ORSSVWHFK HW DO f KDYH SURSRVHG WKDW WKH SODVWLG KVS SURWHFWV WKH SKRWRV\QWKHWLF PHPEUDQHV IURP KHDW VWUHVV EHFDXVH WKH\ IRXQG LW DVVRFLDWHG ZLWK WKH WK\ODNRLG PHPEUDQHV +RZHYHU ODWHU VWXGLHV UHYHDOHG WKDW RQO\ SODVWLGV H[SRVHG WR KHDW VWUHVV XQGHU ORZ OLJKW LQWHQVLWLHV KDYH DQ KVS DWWDFKHG WR WKLV PHPEUDQH *ODF]LQVNL DQG .ORSSVWHFK f :RUN E\ &KHQ HW DO f DQG &ODUN DQG &ULWKOH\ f VKRZ WKDW WKLV SURWHLQ DFFXPXODWHV SUHGRPLQDQWO\ LQ WKH VWURPD XQGHU QRUPDO OLJKW FRQGLWLRQV HYHQ LQ KHDW VWUHVVHG FKORURSODVWV 6LQFH &KHQ HW DO

PAGE 122

f KDYH IRXQG WKLV KVS LQ KHDW VWUHVVHG SHD URRW DP\ORSODVWV DQG RXU GDWD VKRZHG DQ LQFUHDVLQJ DEXQGDQFH RI WKH WUDQVFULSW DV WKH WK\ODNRLG PHPEUDQHV GHJUDGH D EURDGHU UROH IRU WKLV SURWHLQ WKDQ VLPSO\ SURWHFWLQJ SKRWRV\QWKHWLF PHPEUDQHV PXVW EH SRVWXODWHG $Q H[DPLQDWLRQ RI WKH FRQVHUYHG GRPDLQV RI SODVWLGORFDOL]HG ORZ 0: KVSV KDV VKRZQ WKDW WKH WKLUG GRPDLQ ZKLFK LV XQLTXH WR WKHVH KVSV LV VLPLODU WR WKH PHWKLRQLQH ULFK UHJLRQ LQ 653 D SURWHLQ IRXQG LQ WKH HQGRSODVPLF UHWLFXOXP DQG NQRZQ WR EH UHVSRQVLEOH IRU ELQGLQJ VLJQDO VHTXHQFHV DQG WUDQVSRUWLQJ QHZO\ WUDQVODWHG SURWHLQV &KHQ DQG 9LHUOLQJ f ,W LV WHPSWLQJ WR VSHFXODWH WKDW WKH KVS DFFXPXODWHV LQ WKH VWURPD DQG LV LQYROYHG LQ VHTXHVWHULQJ XQIROGHG SURWHLQV 7KLV UROH FRXOG EH LPSRUWDQW GXULQJ KHDW RU R[LGDWLYH VWUHVV DQG GXULQJ GHYHORSPHQWDO FKDQJHV DV ZHOO VLQFH DOO WKUHH RI WKHVH FRQGLWLRQV PD\ FDXVH DQ DFFXPXODWLRQ RI XQIROGHG SURWHLQV 7KH EUHDNGRZQ RI WKH SKRWRV\QWKHWLF PHPEUDQHV GXULQJ FKRPRSODVW GHYHORSPHQW PD\ EH DQ LPSRUWDQW IDFWRU LQ WKH LQGXFWLRQ RI S720 3LHFKXOOD HW DO f DQG /LYLQH DQG *HSVWHLQ f KDYH H[DPLQHG WKH ORVV RI SKRWRV\QWKHWLF SURWHLQV GXULQJ FKURPRSODVW GHYHORSPHQW LQ WRPDWR IUXLW 7KH\ ILQG WKDW D GUDPDWLF ORVV RI /+&3 EHWZHHQ PDWXUH JUHHQ DQG WKH \HOORZ VWDJH &RQVLGHULQJ WKH DEXQGDQFH RI WKLV SURWHLQ LQ WKH SODVWLG WKLV FRXOG UHSUHVHQW D VLJQLILFDQW LQFUHDVH LQ XQIROGHG SURWHLQV 2XU GDWD VKRZ DQ LQFUHDVH LQ WUDQVFULSW IRU WKH KVS RQO\ DIWHU 0* ,I WKH LQGXFWLRQ RI WKLV SURWHLQ LV FRUUHODWHG ZLWK FKORURSODVW EUHDNGRZQ WKHQ LQFUHDVH LQ WKLV KVS WUDQVFULSW PD\ EH H[SHFWHG DW WKLV WLPH

PAGE 123

&KDUDFWHUL]DWLRQ RI WKH DFFXPXODWLRQ RI WKLV KVS LQ WKH WRPDWR PXWDQW JUHHQ IOHVK PLJKW EH XVHIXO VLQFH WKH WK\ODNRLG PHPEUDQHV SHUVLVW ORQJHU LQ PXWDQW IUXLW WKDQ LQ QRUPDO IUXLW ,I WKH SODVWLG KVS LV DOVR GHWHUUHG LQ WKLV PXWDQW WKHQ SHUKDSV DQ LQYROYHPHQW RI WKLV KVS LQ SODVWLG SURWHLQ EUHDNGRZQ ZRXOG EH VXJJHVWHG ,Q DGGLWLRQ WKH DQWLVHQVH PXWDJHQHVLV RI WRPDWR ZLWK DQ DQWLVHQVH S720 FRQVWUXFW LV FXUUHQWO\ XQGHUZD\ VHH $SSHQGL[f 3HUKDSV LI WKLV SURWHLQ LV UHVSRQVLEOH IRU WKH RUGHUHG GLVPDQWOLQJ RI WK\ODNRLG PHPEUDQHV GXULQJ FKURPRSODVW IRUPDWLRQ WKHQ WKH DQWLVHQVH PXWDQW ZLOO EH LQKLELWHG LQ EUHDNGRZQ RI WKH SKRWRV\QWKHWLF PHPEUDQHV RU PD\ UHVXOW LQ GLPLQLVKHG FDURWHQRLG V\QWKHVLV EHFDXVH WKH SODVWLG FDQQRW DGHTXDWHO\ UHVSRQG WR WKLV GHYHORSPHQWDO VWUHVV $Q LQFUHDVH LQ WKH DPRXQW RI WUDQVFULSW IRU WZR ORZ 0: KVSV RFFXUV GXULQJ WRPDWR IUXLW ULSHQLQJ DW QRQKHDW VWUHVV WHPSHUDWXUHV 7KLV VXJJHVWV WKDW HLWKHU ERWK F\WRSODVP DQG SODVWLG DUH XQGHUJRLQJ PDVVLYH VWUXFWXUDO UHSURJUDPPLQJ RU D JHQHUDO LQFUHDVH LQ VWUHVV RFFXUV LQ WKLV WLVVXH GXULQJ ULSHQLQJ $ FRUUHODWLRQ EHWZHHQ WKH EUHDNGRZQ RI SODVWLG SURWHLQV DQG WKH LQFUHDVH LQ WKH VWHDG\VWDWH OHYHO RI WKLV WUDQVFULSW PD\ H[LVW +RZHYHU LW SUREDEO\ LV QRW VXFK D VLPSOH FRUUHODWLRQ VLQFH WKH WUDQVFULSW UHPDLQV KLJK DIWHU SODVWLG FRQYHUVLRQ DQG D F\WRSODVPLF ORZ 0: KVS LV DOVR LQGXFHG ([DPLQDWLRQ RI WKH EUHDNGRZQ RI WKH SKRWRV\QWKHWLF PHPEUDQHV LQ WKH DQWLVHQVH S720 FRPSDUHG WR QRUPDO IUXLW PD\ KHOS WR FODULI\ WKH LQYROYHPHQW RI WKLV SURWHLQ LQ WKH FKORURSODVW WR FKURPRSODVW WUDQVLWLRQ

PAGE 124

&+$37(5 &21&/86,216 &KURPRSODVW GHYHORSPHQW LV FRUUHODWHG ZLWK DQ LQFUHDVH LQ WKH VWHDG\VWDWH OHYHO RI D VXEVHW RI WUDQVFULSWV HQFRGLQJ SURWHLQV GLUHFWHG WR WKLV RUJDQHOOH :H KDYH LGHQWLILHG SURWHLQV IURP H[SHULPHQWV H[DPLQLQJ WKH LPSRUW RI LQ YLWUR WUDQVODWLRQ SURGXFWV IURP WRWDO SRO\ $ 51$ DQG SURWHLQV IURP WKH DQDO\VLV RI SURWHLQV HQFRGHG E\ F'1$V WKDW DUH LQFUHDVLQJO\ V\QWKHVL]HG GXULQJ WKLV WUDQVLWLRQ 6LQFH S720 FKDSWHU f DQG 3'6 3HFNHU HW DO f DUH LQFUHDVLQJO\ V\QWKHVL]HG DV WRPDWR IUXLW ULSHQV WKHVH GDWD VXJJHVW WKDW WKH GHSRVLWLRQ RI FDURWHQRLGV LV QRW VLPSO\ GXH WR D UHSDUWLWLRQLQJ RI WKH EUHDNGRZQ SURGXFWV RI SKRWRV\QWKHVLV ,Q DGGLWLRQ WKHVH ILQGLQJV LPSO\ WKDW WKH LPSRUW DSSDUDWXV UHPDLQV IXQFWLRQDO GXULQJ WKLV SHULRG 7KH FKDUDFWHUL]DWLRQ RI D FKURPRSODVWDVVRFLDWHG ORZ 0: KVS EULQJV XS PRUH TXHVWLRQV WKHQ LW DQVZHUV 'RHV WKLV LPSO\ WKDW WKH FKURPRSODVW LV XQGHU VWUHVV GXULQJ LWV GHYHORSPHQW" ,V ULSHQLQJ WRPDWR IUXLW JHQHUDOO\ XQGHUJRLQJ VRPH W\SH RI VWUHVV" 'RHV WKH WUDQVIRUPDWLRQ RI WKH FKORURSODVW LQWR D FKURPRSODVW UHVXOW LQ WKH LQGXFWLRQ RI WKLV KVS" 7KH FRUUHODWLRQ EHWZHHQ WKH GHJUDGDWLRQ RI WK\ODNRLG PHPEUDQH SURWHLQV DQG WKH LQGXFWLRQ RI WKH SODVWLGORFDOL]HG ORZ 0: KVS LPSOLHV WKDW LQGXFWLRQ RI WKLV SURWHLQ PD\ EH FDXVHG E\ DQ LQFUHDVH LQ WKH DPRXQW RI XQIROGHG

PAGE 125

SURWHLQV LQ WKH FKURPRSODVW +RZHYHU VLQFH LQGXFWLRQ RI WKH KVS WUDQVFULSW DSSHDUV WR SHUVLVW DIWHU WKH EUHDNGRZQ RI WKH SKRWRV\QWKHWLF DSSDUDWXV SHUKDSV DQ LQFUHDVH LQ R[LGDWLYH VWUHVV GXULQJ ULSHQLQJ DOVR FRQWULEXWHV WR WKH LQGXFWLRQ RI WKLV SURWHLQ 7KH LGHQWLILFDWLRQ RI WKH ORZ 0: KVS GXULQJ FKURPRSODVW GHYHORSPHQW ZDV XQH[SHFWHG ,W GHPRQVWUDWHV WKH SRZHU VXFK DQ XQELDVHG DVVD\ FDQ KDYH RQ WKH FKDUDFWHUL]DWLRQ RI D GHYHORSPHQWDO SURFHVV 3URWHLQV QRW JHQHUDOO\ DVVRFLDWHG ZLWK FKURPRSODVW GHYHORSPHQW RU SURWHLQV RI ORZ DEXQGDQFH FDQ EH LGHQWLILHG ,Q WKLV ZD\ D EURDGHU XQGHUVWDQGLQJ RI WKLV WUDQVLWLRQ LV SRVVLEOH

PAGE 126

$33(1',; &216758&7,21 $1' (;35(66,21 2) $17,6(16( S720 $1' S720 3/$60,'6 ,1 72%$&&2 ,QWURGXFWLRQ $ FRPSOHWH H[DPLQDWLRQ RI WKH SURWHLQV LQYROYHG LQ FKURPRSODVW GHYHORSPHQW LQFOXGHV D IXQFWLRQDO DQDO\VLV RI WKH SURWHLQfV UROH LQ WKLV GHYHORSPHQWDO SURFHVV $Q DGYDQWDJH RI WKH H[SHULPHQWDO DSSURDFK GHVFULEHG ZLWKLQ WKLV GLVVHUWDWLRQ LV WKDW RQFH WKH FKURPRSODVWDVVRFLDWHG SURWHLQ KDV EHHQ LGHQWLILHG LW KDV DOVR EHHQ FORQHG 7KLV SHUPLWV SURGXFWLRQ RI SODVPLGV WKDW HQFRGH VHQVH DQG DQWLVHQVH WUDQVFULSWV WKDW FDQ EH WUDQVIRUPHG LQWR WRPDWR SODQWV DQG KRSHIXOO\ SURGXFH D PXWDQW SKHQRW\SH 1RW RQO\ FDQ WKH WUDQVLWLRQ IURP FKORURSODVW WR FKURPRSODVW EH GHVFULEHG EXW WKH ORVV RI IXQFWLRQ IRU SDUWLFXODU SURWHLQV LQYROYHG LQ WKLV SURFHVV FDQ EH PRQLWRUHG $QWLVHQVH WUDQVIRUPDWLRQ KDV EHHQ XWLOL]HG VXFFHVVIXOO\ IRU D QXPEHU RI ULSHQLQJDVVRFLDWHG JHQHV 7KH H[SUHVVLRQ RI WKH FHOO ZDOO VRIWHQLQJ HQ]\PHV SRO\JDODFWXURQDVH 3*f DQG SHFWLQ PHWK\OHVWHUDVH WKH HWK\OHQH ELRV\QWKHWLF HQ]\PHV $&& R[\GDVH DQG $&& V\QWKHWDVH DQG WKH FDURWHQRLG ELRV\QWKHWLF HQ]\PH SK\WRHQH V\QWKDVH KDYH DOO EHHQ VXFFHVVIXOO\ LQKLELWHG E\ LQWURGXFWLRQ RI SODVPLGV HQFRGLQJ DQWLVHQVH WUDQVFULSWV 6KHHK\ HW DO 6PLWK HW DO +DPLOWRQ HW DO %LUG HW DO 2HOOHU HW DO 7LHPDQ HW DOf

PAGE 127

$QWLVHQVH PXWDJHQHVLV KDV SURGXFHG GUDPDWLF FRQVHTXHQFHV ZLWK $&& V\QWKHWDVH ZKHUH PXWDQW IUXLW IDLO WR VRIWHQ XQGHUJR WKH UHVSLUDWRU\ FOLPDFWHULF RU SURGXFH FDURWHQRLGV 2HOOHU HW DO f 7KH DSSOLFDWLRQ RI HWK\OHQH LV UHTXLUHG EHIRUH WKLV IUXLW ZLOO SURFHHG WKURXJK WKH SURFHVVHV DVVRFLDWHG ZLWK ULSHQLQJ 3* IRU H[DPSOH LV WUDQVFULEHG EXW LW LV QRW H[SUHVVHG ,Q WKLV PDQQHU WKH UHTXLUHPHQW RI HWK\OHQH IRU WKH LQGXFWLRQ RI ULSHQLQJDVVRFLDWHG SURWHLQV FDQ EH H[DPLQHG 7KH UHVXOWV RI DQWLVHQVH PXWDJHQHVLV IRU 3* KRZHYHU KDYH EHHQ OHVV VWULNLQJ 6KHHK\ HW DO 6PLWK HW DO f ,W ZDV LQLWLDOO\ DVVXPHG WKDW VLQFH WKH WUDQVFULSW ZDV HQKDQFHG GXULQJ IUXLW ULSHQLQJ DQG EHFDXVH WKLV SURWHLQ ZDV SURGXFHG LQ VXFK YDVW DPRXQWV WKDW LW FRXOG EH LGHQWLILHG RQ D &RPPDVVLH VWDLQHG JHO LQKLELWLRQ RI 3* H[SUHVVLRQ GXULQJ ULSHQLQJ ZRXOG OHDG WR REYLRXV UHGXFWLRQV LQ FHOO ZDOO VRIWHQLQJ $OWKRXJK WKH SURGXFWLRQ RI WKH SURWHLQ FDQ EH LQKLELWHG E\ DQWLVHQVH PXWDJHQHVLV FHOO ZDOO VRIWHQLQJ LV DOPRVW XQDIIHFWHG 7KLV W\SH RI IXQFWLRQDO DQDO\VLV ZDV UHTXLUHG WR FODULI\ WKH VLJQLILFDQFH RI 3* GXULQJ IUXLW ULSHQLQJ ,Q WKH IROORZLQJ VHFWLRQ WKH FRQVWUXFWLRQ RI D YHFWRU IRU SURGXFWLRQ RI DQWLVHQVH WUDQVFULSWV ZLOO EH GHVFULEHG 7KH DELOLW\ RI WKLV YHFWRU WR H[SUHVV WUDQVFULSWV ZDV WHVWHG LQ WREDFFR 7KH WUDQVIRUPDWLRQ RI VHQVH DQG DQWLVHQVH S720 DQG S720 SODVPLGV LQWR WRPDWR SODQWV LV FXUUHQWO\ XQGHUZD\ *LYHQ RXU FXUUHQW NQRZOHGJH DERXW WKHVH JHQHV WKH SRWHQWLDO SKHQRW\SH IRU VXFFHVVIXO DQWLVHQVH PXWDJHQHVLV ZLOO EH GLVFXVVHG

PAGE 128

0DWHULDOV DQG 0HWKRGV &RQVWUXFWLRQ RI 9HFWRUV IRU 3URGXFWLRQ RI 6HQVHV DQG $QWLVHQVH 7UDQVFULSWV DQG 7UDQVIRUPDWLRQ LQWR $JUREDFWHULXP 7KH YHFWRU V\VWHP FRQVWUXFWHG IRU SURGXFWLRQ RI VHQVH DQG DQWLVHQVH WUDQVFULSWV GHSHQGV RQ WKUHH VHSDUDWH SODVPLGV )LUVW ERWK RULHQWDWLRQV RI WKH S720 F'1$V ZHUH VXEFORQHG LQWR S*(0= 3URPHJDf LQ RUGHU WR EHQHILW IURP WKH JDODFWRVLGDVH VHOHFWLRQ EXLOW LQWR WKLV SODVPLG )LJ $ DQG %f 7KH F'1$V FDQ WKHQ EH GLUHFWLRQDOO\ H[FLVHG IURP S*(0= DQG OLJDWHG LQWR D FDXOLIORZHU PRVDLF YLUXV &D09f 6 SURPRWHU QRSDOLQH V\QWKDVH QRVf WHUPLQDWRU FORQLQJ FDVVHWWH FORQHG LQWR 3HWK F )LJ $f 0F&DUW\ HW DO f )LQDOO\ WKH FORQLQJ FDVVHWWHV FRQWDLQLQJ WKH VHQVH DQG DQWLVHQVH S720 F'1$V DUH OLJDWHG LQWR DQ $JUREDFWHULXP YHFWRU S*$ $Q HW DO f ZKLFK KDV DOVR EHHQ PRGLILHG WR FRQWDLQ WKH JHQH IRU JOXFXURQLGDVH *86f 'HWDLOV RI WKH YHFWRU FRQVWUXFWLRQ DQG GLUHFWLRQDO FORQLQJ RI WKH S720 F'1$V DUH JLYHQ EHORZ ,QLWLDOO\ WKH S720 DQG S720 F'1$V ZHUH EOXQWHQG OLJDWHG LQWR S*(0= )LJ f $OO PROHFXODU PHWKRGV GHVFULEHG LQ WKLV VHFWLRQ ZHUH WDNHQ IURP 6DPEURRN HW DOf XQOHVV LQGLFDWHG RWKHUZLVH 7KH S720 F'1$ ZDV LVRODWHG IURP S%OXHVFULSW .6f 6WUDWDJHQHf VHH FKDSWHU f E\ GLJHVWLRQ ZLWK (FR 59 DQG 6PDO DQG OLJDWHG GLUHFWO\ LQWR S*(0= DW WKH 6PDO VLWH 7KH S720 F'1$ ZDV LVRODWHG IURP S6SRUW %HWKHVGD 5HVHDUFK /DERUDWRULHVf E\ GLJHVWLRQ ZLWK 3VW, DQG PDGH EOXQW HQGHG ZLWK 7 '1$ SRO\PHUDVH %HWKHVGD 5HVHDUFK /DERUDWRULHVf EHIRUH LW ZDV OLJDWHG LQWR WKH S*(0= 6PDO VLWH 3ODVPLGV ZHUH WUDQVIRUPHG LQWR WKH ( FROL VWUDLQ 7% DQG '1$ ZDV LVRODWHG E\ DQ DONDOLQH O\VLV PLQLSUHS PHWKRG

PAGE 129

RI /HH DQG 5DVKHHG f 6HQVH DQG DQWLVHQVH RULHQWDWLRQV RI WKH F'1$V LQ S*(0= ZHUH FRQILUPHG E\ WKH SUHVHQFH RI DV\PPHWULFDO (FR 59 VLWHV LQ S720 )LJ $f DQG D0IHVLWH LQ S720 )LJ ,%f 7KH S*(0= YHFWRU FRQWDLQV .SQO DQG %DP+, VLWHV RQ HLWKHU VLGH RI WKH 6PDO UHVWULFWLRQ VLWH XVHG IRU WKH LQLWLDO FORQLQJ )LJ $ DQG %f 7KH SODVPLGV FRQWDLQLQJ WKH VHQVH DQG DQWLVHQVH RULHQWDWLRQV RI WKH S720 F'1$V ZHUH OLJDWHG LQWR WKH YHFWRU RXWOLQHG LQ )LJ $ 7KLV YHFWRU ZDV FRQVWUXFWHG LQ WKH IROORZLQJ PDQQHU 7KH SODVPLG S%, &ORQHWHFKf FRQWDLQV WKH FRGLQJ UHJLRQ RI *86 EHWZHHQ WKH &D09 6 SURPRWHU DQG WKH QRV WHUPLQDWRU $ SRO\OLQNHU VKRZQ LQ )LJ $ ZDV FUHDWHG DW WKH ,&%5 '1$ 6\QWKHVLV &RUH DQG OLJDWHG LQWR WKH ;EDO DQG 6VW, VLWHV RI S%, 7KLV H[FLVHG WKH *86 FRGLQJ UHJLRQ DQG SODFHG WKH SRO\OLQNHU EHWZHHQ WKH &D09 6 SURPRWHU DQG WKH QRV WHUPLQDWRU 7KH HQWLUH FORQLQJ FDVVHWWH ZKLFK FRQWDLQHG WKH &D09 6 SURPRWHU SRO\OLQNHU DQG QRV WHUPLQDWRU ZDV WKHQ H[FLVHG E\ UHVWULFWLRQ ZLWK +LQGOOO DQG (FR 5, DQG OLJDWHG LQWR 3HWK F 6HQVH DQG DQWLVHQVH RULHQWDWLRQV RI WKH S720 F'1$V ZHUH H[FLVHG IURP WKH S*(0 SODVPLGV E\ UHVWULFWLRQ ZLWK .SQO DQG %DP+, DQG OLJDWHG LQWR WKH SRO\OLQNHU RI WKH FORQLQJ FDVVHWWH DW WKH .SQO DQG %DP+, VLWHV 7KH S720 F'1$V ZHUH QRZ FORQHG LQ ERWK RULHQWDWLRQV EHWZHHQ WKH &D09 6 SURPRWHU DQG WKH QRV WHUPLQDWRU ,Q WKLV PDQQHU ERWK VHQVH DQG DQWLVHQVH WUDQVFULSWV ZRXOG EH SURGXFHG 7KH YHFWRU IRU WUDQVIRUPDWLRQ LQWR $JUREDFWHULXP DQG XOWLPDWHO\ LQWR SODQW PDWHULDO ZDV SUHSDUHG DV IROORZV 7KH YHFWRU S*$ ZDV UHVWULFWHG ZLWK 6HDO 7KH HQWLUH JHQH IRU WKH SURGXFWLRQ RI *86 ZLWK &D09 SURPRWHU DQG QRV WHUPLQDWRU

PAGE 130

ZDV H[FLVHG IURP S%, E\ UHVWULFWLRQ ZLWK +LQGOOO DQG (FR5, 7KH *86 JHQH ZDV PDGH EOXQW HQGHG ZLWK 7 '1$ SRO\PHUDVH DQG OLJDWHG LQWR WKH XQLTXH 6HDO VLWH RI S*$ )LJ %f 7KH FORQLQJ FDVVHWWHV ZKLFK FRQWDLQHG WKH VHQVH DQG DQWLVHQVH S720 F'1$V ZHUH H[FLVHG IURP 3HWK F ZLWK +LQGOOO DQG %J8, DQG OLJDWHG LQWR S*$ *86 ZKLFK KDG EHHQ UHVWULFWHG ZLWK WKH VDPH HQ]\PHV 7KH $JUREDFWHULXP VWUDLQ $*/ /D]R HW DO f ZDV WUDQVIRUPHG $Q f ZLWK WKH SODVPLG '1$ 6XFFHVVIXO WUDQVIRUPDWLRQ LQWR $*/ ZDV FRQILUPHG E\ 3&5 DPSOLILFDWLRQ RI EDFWHULDO '1$ ZLWK SULPHUV VSHFLILF IRU WKH 137,, DQG WKH *86 JHQHV RI WKH PRGLILHG S*$ 7KH WHPSODWH IRU WKH 3&5 UHDFWLRQ ZDV SUHSDUHG E\ JURZLQJ WKH WUDQVIRUPHG $*/ DW r& RYHUQLJKW $ SL DOLTXRW RI WKLV FXOWXUH ZDV GLOXWHG LQ SL RI ZDWHU DQG ERLOHG IRU PLQ 7KH 3&5 UHDFWLRQ FRQWDLQHG SL RI WKLV EDFWHULDO FXOWXUH SL ; 7$4 SRO\PHUDVH EXIIHU %HWKHVGD 5HVHDUFK /DERUDWRULHVf S0 HDFK G173 QJ HDFK SULPHU S RI 7$4 SRO\PHUDVH LQ SL ILQDO YROXPH 3ODQW 0DWHULDO 7REDFFR SODQWV 1LFRWLDQD WDEDFXP / FY .HQWXFN\ f ZHUH JURZQ LQ FXOWXUH FXSV LQ VWHULOH VRLO 7UDQVIRUPDWLRQ RI 7REDFFR 7REDFFR WUDQVIRUPDWLRQ ZHUH SHUIRUPHG DFFRUGLQJ WR WKH SURFHGXUH RXWOLQHG E\ +RUVFK HW DOf GLG QRW SHUVRQDOO\ SHUIRUP WKLV SDUWLFXODU SURFHGXUH VR GHWDLOV RI WKH SURWRFRO ZLOO QRW EH RXWOLQHG KHUH

PAGE 131

3UHSDUDWLRQ RI 51$ 7REDFFR OHDI 51$ ZDV LVRODWHG DV GHVFULEHG E\ 'XQVPXLU HW DO f %ULHIO\ WKLV LQYROYHG JULQGLQJ J RI OHDI WLVVXH LQ OLTXLG 1 ZLWK D PRUWDU DQG SHVWOH $ PO DOLTXRW RI 176 EXIIHU ZKLFK FRQWDLQHG 0 1D&O 0 7ULV+&O S+ P0 ('7$ DQG b 6'6 ZDV DGGHG WR WKH ILQHO\ JURXQG WLVVXH $ PO YROXPH RI SKHQROFKORURIRUPLVRDP\O DOFRKRO f 3&,f ZDV DGGHG DQG WKH WLVVXH ZDV JURXQG XQWLO WKH PL[WXUH WKDZHG 7KLV ZDV SRXUHG LQWR D PO FDSSHG WXEH DQG WKH PRUWDU DQG SHVWOH ZDV ULQVHG ZLWK DQ DGGLWLRQDO PO RI 176 EXIIHU DQG PO RI 3&, 7KH PL[WXUH ZDV YRUWH[HG IRU PLQ DQG WKH SKDVHV VHSDUDWHG E\ FHQWULIXJDWLRQ DW [ J IRU PLQ 7KH DTXHRXV OD\HU ZDV VDYHG DQG WKH SKHQRO OD\HU ZDV ZDVKHG ZLWK PO RI 176 DQG VHSDUDWHG DJDLQ E\ FHQWULIXJDWLRQ 7KH FRPELQHG DTXHRXV OD\HUV ZHUH H[WUDFWHG ZLWK SKHQROFKORURIRUP f UHH[WUDFWHG ZLWK FKORURIRUP DQG SUHFLSLWDWHG E\ LQFXEDWLRQ RYHUQLJKW DW fr& ZLWK YROXPHV RI 0 VRGLXP DFHWDWH DQG YROXPHV RI HWKDQRO 7KH QXFOHLF DFLGV ZHUH FROOHFWHG E\ FHQWULIXJDWLRQ DW [ J IRU PLQ 7KH SHOOHW ZDV ZDVKHG ZLWK b HWKDQRO DQG UHSHOOHWHG 7KH QXFOHLF DFLGV ZHUH UHVXVSHQGHG LQ PO RI VWHULOH ZDWHU DQG PO RI 0 OLWKLXP DFHWDWH ZDV DGGHG 7KH 51$ ZDV SUHFLSLWDWHG E\ LQFXEDWLRQ IRU KRXUV DW r& DQG SHOOHWHG E\ FHQWULIXJDWLRQ IRU PLQ DW [ J 7KH SHOOHW ZDV UHVXVSHQGHG LQ PO VWHULOH ZDWHU UHSUHFLSLWDWHG ZLWK PO 0 VRGLXP DFHWDWH DQG PO HWKDQRO IRU KRXUV DW fr& DQG FROOHFWHG E\ FHQWULIXJDWLRQ IRU PLQ DW

PAGE 132

[ J 7KH SHOOHW ZDV ULQVHG ZLWK b HWKDQRO GLVVROYHG LQ SL ZDWHU DQG VWRUHG DW fr& 1RUWKHUQ +\EULGL]DWLRQ 7RWDO OHDI 51$ SJODQHf ZDV ORDGHG RQWR IRUPDOGHK\GH GHQDWXULQJ JHOV EORWWHG SUHK\EULGL]HG K\EULGL]HG DQG ZDVKHG DV GHVFULEHG LQ FKDSWHU 3UREHV IRU S720 DQG S720 ZHUH SUHSDUHG DV GHVFULEHG LQ WKH SUHYLRXV FKDSWHU $ SRUWLRQ RI WKH *86 JHQH IURP WKH ;EDO WR WKH (FR59 VLWH RI S%, ZDV XVHG DV D SUREH DQG SUHSDUHG IRU K\EULGL]DWLRQ DV GHVFULEHG LQ WKH SUHYLRXV FKDSWHU 5HVXOWV $JUREDFWHULXP WUDQVIRUPDWLRQ SODVPLGV ZHUH FRQVWUXFWHG DV GHVFULEHG LQ WKH 0DWHULDOV DQG 0HWKRGV WKDW SURGXFH VHQVH RU DQWLVHQVH WUDQVFULSWV RI S720 DQG S720 )LJ$ DQG $f 7REDFFR OHDI SLHFHV ZHUH WUDQVIRUPHG ZLWK WKHVH SODVPLGV VHOHFWHG ZLWK NDQDP\FLQ DQG WHVWHG IRU *86 DFWLYLW\ -HIIHUVRQ f GLG QRW SHUIRUP WKH WREDFFR WUDQVIRUPDWLRQ RU *86 VWDLQLQJ VR WKHVH WHFKQLFDO GHWDLOV ZLOO QRW EH GLVFXVVHG DW WKLV WLPH 7RWDO 51$ ZDV H[WUDFWHG IURP OHDI WLVVXH RI JUHHQKRXVH JURZQ WUDQVJHQLF WREDFFR SODQWV UXQ RQ b DJDURVH IRUPDOGHK\GH GHQDWXULQJ JHOV EORWWHG DQG K\EULGL]HG DV GHVFULEHG LQ WKH SUHYLRXV FKDSWHU (DFK EORW ZDV SUREHG ZLWK HLWKHU S720 RU S720 F'1$ VWULSSHG DQG UHSUREHG ZLWK D SRUWLRQ RI WKH JXV

PAGE 133

A S720 LQ S*(0= 6HQVH % S720 LQ S*(0= 6HQVH )LJXUH $O &ORQLQJ RI S720 DQG S720 LQWR S*(0= LQ WKH VHQVH RULHQWDWLRQ $f S720 FRQWDLQV WZR (FR59 VLWHV 2QH RI WKHVH UHVWULFWLRQ VLWHV LV ZLWKLQ WKH ILUVW EDVHV RI WKH f HQG RI WKH FORQH 7KH S720 ZDV FORQHG LQWR S*(0= DW WKH 6PDO VLWH ZKLFK LV ERXQGHG E\ %DP+, DQG .SQ, %f S720 FRQWDLQV D 1GHO VLWH EDVHV IURP WKH f HQG RI WKH FORQH 7KH S*(0= FRQWDLQV DQ 1GHO VLWH a EDVHV IURP WKH .SQ, VLWH

PAGE 134

)LJXUH $ 7KH YHFWRUV XVHG IRU FORQLQJ S720 DQG S720 F'1$V LQ WKH VHQVH DQG DQWLVHQVH RULHQWDWLRQ $f 7KH FORQLQJ FDVVHWWH FRQWDLQV D &D09 6 SURPRWHU SRO\OLQNHU DQG QRV WHUPLQDWRU 7KH SRO\OLQNHU FRQWDLQV DQ ;EDO %DP+, 6PDO .SQO 1FRO ;KRO DQG 6VW, UHVWULFWLRQ VLWHV 7KH S720 F'1$V ZHUH FORQHG LQWR WKLV FDVVHWWH DW WKH .SQO DQG %DP+, VLWHV RI WKH SRO\OLQNHU %f 7KH $JUREDFWHULXP YHFWRU S*$ FRQWDLQV D *86 JHQH DW WKH 6HDO VLWH 7KH FORQLQJ FDVVHWWH LV FORQHG LQWR WKLV YHFWRU DW WKH +LQGOOO DQG %JOOO VLWHV

PAGE 135

JHQH DV GHVFULEHG LQ WKH 0DWHULDOV DQG 0HWKRGV $ UHSUHVHQWDWLYH EORW LV SUHVHQWHG IRU S720 )LJ $f DQG IRU S720 )LJ $f $ WRWDO RI VHSDUDWH WUDQVJHQLF SODQWV ZHUH WHVWHG IRU WKH DELOLW\ WR H[SUHVV WUDQVFULSW 7REDFFR SODQWV GR QRW QRUPDOO\ DSSHDU WR FRQWDLQ DQ\ 51$ WKDW K\EULGL]HV WR S720 RU S720 F'1$ 7KLV ZDV VKRZQ E\ H[DPLQLQJ SODQWV WKDW KDYH EHHQ WUDQVIRUPHG ZLWK D SODVPLG FRQWDLQLQJ WKH *86 JHQH DORQH )LJ $ ODQHV DQG DQG )LJ $ ODQHV DQG f 0RVW SODQWV WUDQVIRUPHG ZLWK WKHVH FRQVWUXFWV H[SUHVVHG WKH *86 JHQH DOWKRXJK VOLJKW GLIIHUHQFHV LQ WKH OHYHO RI H[SUHVVLRQ ZHUH VHHQ LQ WKH LQGLYLGXDO SODQWV 7KLV GHPRQVWUDWHV WKDW WKHVH QHZO\ FRQVWUXFWHG YHFWRUV ZHUH FDSDEOH RI EHLQJ VWDEO\ WUDQVIRUPHG DQG H[SUHVVHG LQ WREDFFR )LJ $ DQG $f +RZHYHU RI WKH SXWDWLYHO\ WUDQVIRUPHG SODQWV GLG QRW FRQWDLQ 51$ WKDW K\EULGL]HG WR WKH *86 SUREH (LWKHU WKH JHQH RU H[SUHVVLRQ RI WKH *86 JHQH ZDV VHOHFWLYHO\ ORVW LQ RI WKHVH SODQWV EHFDXVH *86 QHJDWLYH WUDQVIRUPDQWV ZHUH SRVLWLYH IRU H[SUHVVLRQ RI S720 WUDQVFULSW $ VWULNLQJ H[DPSOH RI WKLV LV VKRZQ LQ )LJ $ ODQH 7KLV SODQW LV SURGXFLQJ FRSLRXV DPRXQWV RI S720 VHQVH WUDQVFULSW EXW DSSDUHQWO\ QR *86 PHVVDJH LV SURGXFHG 3DUWLDO ORVV RI 7'1$ GXULQJ WUDQVIRUPDWLRQ LV QRW XQFRPPRQ QRU LV LQKLELWLRQ RI H[SUHVVLRQ RI LQGLYLGXDO JHQHV IROORZLQJ WUDQVIRUPDWLRQ -RQHV HW DO 'HUROHV DQG *DUGQHU f 7KH OHYHO RI H[SUHVVLRQ RI WKH VHQVH DQG DQWLVHQVH WUDQVFULSWV RI WKH S720 F'1$V YDULHG GUDPDWLFDOO\ EHWZHHQ LQGLYLGXDO WUDQVIRUPDQWV )LJ $ DQG $f ,Q DGGLWLRQ GLIIHUHQW RULHQWDWLRQV H[SUHVVHG YHU\ GLIIHUHQW OHYHOV RI WUDQVFULSW )RU

PAGE 136

/DQH JXV S720 W f0 W )LJXUH $ ,QGLYLGXDO WUDQVJHQLF WREDFFR SODQWV ZHUH WUDQVIRUPHG ZLWK FRQVWUXFWV RI WKH S720 F'1$ WKDW SURGXFHG HLWKHU VHQVH RU DQWLVHQVH WUDQVFULSWV 51$ ZDV H[WUDFWHG IURP OHDI WLVVXH 7RWDO 51$ SJODQHf ZDV ORDGHG RQWR b DJDURVH IRUPDOGHK\GH GHQDWXULQJ JHOV EORWWHG DQG SUREHG DV GHVFULEHG LQ WKH 0DWHULDOV DQG 0HWKRGV 7KH ERWWRP SDQHO UHSUHVHQWV WKH UHVXOWV REWDLQHG ZKHQ WKH EORW ZDV SUREHG ZLWK WKH HQWLUH S720 F'1$ 7KH EORW ZDV VWULSSHG DQG UHSUREHG ZLWK DQ ;EDO WR (FR59 IUDJPHQW RI WKH *86 JHQH /DQHV DQG ZHUH LQGLYLGXDO WUDQVJHQLF SODQWV WKDW SURGXFHG VHQVH WUDQVFULSWV RI WKH S720 F'1$ /DQHV DQG UHSUHVHQW 51$ IURP LQGLYLGXDO WUDQVJHQLF SODQWV FRQWDLQLQJ FRQVWUXFWV WKDW SURGXFH DQWLVHQVH WUDQVFULSWV RI S720 /DQHV DQG FRQWDLQ 51$ IURP SODQWV WUDQVIRUPHG ZLWK S*$ *86 DORQH /DQH FRQWDLQV SJ WRWDO 51$ IURP !b UHG ULSH IUXLW

PAGE 137

/DQH JXV rrr W S720 )LJXUH $ ,QGLYLGXDO WUDQVJHQLF WREDFFR SODQWV WUDQVIRUPHG ZLWK FRQVWUXFWV RI WKH S720 F'1$ WKDW SURGXFHG HLWKHU VHQVH RI DQWLVHQVH WUDQVFULSWV 51$ ZDV H[WUDFWHG IURP OHDI WLVVXH 7RWDO 51$ SJODQHf ZDV ORDGHG RQWR b DJDURVH IRUPDOGHK\GH GHQDWXULQJ JHOV EORWWHG DQG SUREHG DV GHVFULEHG LQ WKH 0DWHULDOV DQG 0HWKRGV 7KH ERWWRP SDQHO UHSUHVHQWV WKH UHVXOWV REWDLQHG ZKHQ WKH EORW ZDV SUREHG ZLWK WKH HQWLUH S720 F'1$ 7KH EORW ZDV VWULSSHG DQG UHSUREHG ZLWK DQ ;EDO WR (FR59 IUDJPHQW RI WKH *86 JHQH 7KLV LV VKRZQ LQ WKH WRS SDQHO /DQHV DQG FRQWDLQ 51$ LVRODWHG IURP LQGLYLGXDO WUDQVJHQLF SODQWV WUDQVIRUPHG ZLWK D SODVPLG WKDW SURGXFHV DQWLVHQVH S720 /DQHV DQG FRQWDLQ 51$ IURP LQGLYLGXDO WUDQVJHQLF SODQWV WUDQVIRUPHG ZLWK D SODVPLG WKDW SURGXFHV VHQVH WUDQVFULSWV RI S720 /DQHV DQG FRQWDLQ 51$ IURP LQGLYLGXDO WUDQVJHQLF SODQWV WKDW KDYH EHHQ WUDQVIRUPHG ZLWK S*$ *86 DORQH /DQH FRQWDLQV 51$ IURP b UHG ULSH WRPDWR IUXLW

PAGE 138

H[DPSOH WKH VHQVH RULHQWDWLRQ RI S720 SURGXFHG ODUJH DPRXQWV RI WUDQVFULSW ZKHUHDV WKH DQWLVHQVH RULHQWDWLRQ GLG QRW )LJ $f 3ODQWV WUDQVIRUPHG ZLWK WKH DQWLVHQVH RULHQWDWLRQ RI S720 RIWHQ FRQWDLQHG K\EULGL]LQJ 51$ WKDW SURGXFHG D ORZ OHYHO VPHDU ZKHQ K\EULGL]HG ZLWK S720 DV D SUREH +RZHYHU WKLV ZDV QRW D JHQHUDO SURSHUW\ RI WKH 51$ VLQFH K\EULGL]DWLRQ RI WKH VDPH EORW ZLWK WKH *86 SUREH SURGXFHG D GLVFUHWH EDQG )LJ $f 7KLV DSSHDUV WR EH DQ LQKHUHQW UHVXOW RI WKH DQWLVHQVH S720 FRQVWUXFW EHFDXVH WKLV ZDV REVHUYHG LQ DW OHDVW RXW RI LQGLYLGXDO WUDQVIRUPDQWV ,Q FRQWUDVW RXW RI SODQWV WUDQVIRUPHG ZLWK WKH VHQVH RULHQWDWLRQ H[SUHVVHG 51$ DW OHYHOV VLPLODU WR WKH DPRXQW H[SUHVVHG GXULQJ FKURPRSODVW GHYHORSPHQW LQ WRPDWR IUXLW 7KLV LV VKRZQ E\ FRPSDULVRQ RI WKH 51$ SURGXFHG E\ WUDQVIRUPHG SODQWV WR WKH 51$ IURP !b UHG ULSH WRPDWR IUXLW )LJ $ ODQHV DQG YHUVXV ODQH f 7KHVH UHVXOWV FRQILUP WKDW WKH FORQLQJ FDVVHWWHV FRQWDLQLQJ HLWKHU WKH VHQVH RU DQWLVHQVH S720 FRQVWUXFWV DUH FDSDEOH RI H[SUHVVLQJ WUDQVFULSW $ VLPLODU DQDO\VLV ZDV SHUIRUPHG ZLWK WREDFFR SODQWV WUDQVIRUPHG ZLWK FRQVWUXFWV FDSDEOH RI SURGXFLQJ VHQVH DQG DQWLVHQVH WUDQVFULSWV RI S720 )LJ $ VKRZV WKDW LQ WKLV FDVH LQGLYLGXDO WUDQVJHQLF SODQWV RI WHVWHG ZKLFK FRQWDLQ DQWLVHQVH S720 SURGXFHG ODUJH DPRXQWV RI DQWLVHQVH WUDQVFULSW &RPSDULVRQ RI WKH DPRXQW RI 51$ SURGXFHG E\ WKHVH SODQWV WR WKH DPRXQW QRUPDOO\ IRXQG LQ b UHG ULSH WRPDWR IUXLW VKRZV WKDW D ODUJH H[FHVV RI DQWLVHQVH 51$ LV SURGXFHG E\ WKH WUDQVJHQLF SODQWV )LJ $ ODQH YHUVXV ODQHV DQG f 8QIRUWXQDWHO\ QR 51$ ZDV SURGXFHG ZLWK WKH VHQVH FRQVWUXFWV RI S720 LQ WKH LQGLYLGXDO WUDQVJHQLF

PAGE 139

SODQWV WHVWHG ,W LV XQFOHDU ZK\ WKH H[SUHVVLRQ RI WKH VHQVH WUDQVFULSW RI S720 LV LQKLELWHG 7KHVH SODQWV SURGXFH PHDVXUDEOH DPRXQWV RI *86 WUDQVFULSW WKHUHIRUH WKH\ KDYH EHHQ VXFFHVVIXOO\ WUDQVIRUPHG (LWKHU D SRUWLRQ RI WKH SODVPLG FRQWDLQLQJ WKH S720 FORQLQJ FDVVHWWH KDV EHHQ VHOHFWLYHO\ ORVW RU WKH H[SUHVVLRQ RI WKLV WUDQVFULSW KDV EHHQ VHOHFWLYHO\ LQKLELWHG 1R REYLRXV SKHQRW\SH UHVXOWHG IURP WKH WUDQVIRUPDWLRQ RI WREDFFR ZLWK WKHVH FRQVWUXFWV +RZHYHU WKH SODQWV KDYH QRW VHW VHHG \HW VR LW LV WRR HDUO\ WR WHOO LI HPEU\R GHYHORSPHQW ZLOO EH DIIHFWHG E\ WKH QHZ JHQHV 'LVFXVVLRQ 7KH SXUSRVH RI WKLV VWXG\ ZDV WR WHVW ZKHWKHU WKH FRQVWUXFWHG SODVPLGV FRXOG HIIHFWLYHO\ SURGXFH WUDQVFULSWV VR WKDW XOWLPDWHO\ WKH\ FRXOG EH XVHG LQ WRPDWR WUDQVIRUPDWLRQ 7KH FRQVWUXFWV ZHUH ILUVW WHVWHG LQ WREDFFR EHFDXVH DOWKRXJK WKHUH DUH UHSRUWV LQ WKH OLWHUDWXUH RQ WRPDWR WUDQVIRUPDWLRQ LW LV QRW DQ HQWLUHO\ VWUDLJKWn IRUZDUG SURFHGXUH :H KDYH VKRZQ WKDW WKH *86 JHQH SODFHG DW WKH 6HDO VLWH RI S*$ LV VWDEO\ H[SUHVVHG LQ PDWXUH WREDFFR OHDYHV 7KH FORQLQJ FDVVHWWH FDQ DOVR EH HIIHFWLYH LQ VWDEOH H[SUHVVLRQ RI ODUJH DPRXQWV RI 51$ 7KHVH SODVPLGV ZLOO KDYH XWLOLW\ EH\RQG WKLV VWXG\ VLQFH WKH\ FDQ EH XVHG LQ RWKHU VLWXDWLRQV DQG ZLWK RWKHU VSHFLHV 7KH SODQWV WUDQVIRUPHG ZLWK WKH DQWLVHQVH FRQVWUXFW RI S720 KRZHYHU GR QRW DSSHDU WR PDLQWDLQ KLJK OHYHOV RI WKLV WUDQVFULSW 7KLV UHVXOW PD\ RFFXU IRU D QXPEHU RI UHDVRQV )LUVW WKH WUDQVIRUPHG WREDFFR SODQWV PD\ VHOHFWLYHO\

PAGE 140

ORVH H[SUHVVLRQ RI WKH JHQH GXULQJ WUDQVIRUPDWLRQ DQG JURZWK RI WKH WUDQVJHQLF SODQW 6HFRQGO\ WKH DQWLVHQVH 51$ PD\ LQWHUDFW ZLWK D WREDFFR OHDI SODVWLGORFDOL]HG ORZ 0: KVS WUDQVFULSW $ ORVV LQ DQWLVHQVH 51$ ZDV REVHUYHG ZKHQ HQGRJHQRXV PHVVDJH WR S720 ZDV LQGXFHG E\ ZRXQGLQJ DQWLVHQVH S720 SODQWV +DPLOWRQ HW DO f 7KH SURGXFWLRQ RI WKH HQGRJHQRXV WUDQVFULSW FDXVHG GHJUDGDWLRQ RI ERWK PHVVDJHV ,W LV XQFOHDU KRZ KRPRORJRXV WKH WREDFFR KVS JHQH LV WR S720 +RZHYHU FRQVLGHULQJ WKH IDFW WKDW D SHWXQLD KVS JHQH LV b KRPRORJRXV WR WKH WRPDWR KVS DQG WKDW VXFFHVVIXO UHGXFWLRQ LQ WREDFFR FKDOFRQH V\QWKDVH PHVVDJH RFFXUUHG ZLWK WUDQVIRUPDWLRQ RI D SHWXQLD DQWLVHQVH FRQVWUXFW WKDW ZDV RQO\ b KRPRORJRXV WR WKH HQGRJHQRXV WUDQVFULSW WKH LGHD WKDW DQ LQWHUDFWLRQ FRXOG RFFXU EHWZHHQ WKH S720 DQWLVHQVH WUDQVFULSW DQG WKH HQGRJHQRXV PHVVDJH VHHPV IHDVLEOH YDQ GHU .URO HW DO f 3HUKDSV WKH SODQWV VKRXOG EH PDLQWDLQHG LQ FRQGLWLRQV WKDW GR QRW OHDG WR VHOHFWLRQ DJDLQVW H[SUHVVLRQ RI WKH DQWLVHQVH WUDQVFULSW ,I DQ LQWHUDFWLRQ LV RFFXUULQJ EHWZHHQ WKH DQWLVHQVH FRQVWUXFW DQG WKH WREDFFR SODQW WKHQ KLJK OHYHO H[SUHVVLRQ RI D VWDEOH WUDQVIRUPDQW LQ WRPDWR WLVVXH ZLOO EH GLIILFXOW 7KH WRPDWR WUDQVIRUPDWLRQ H[SHULPHQW FRXOG EH SHUIRUPHG ZLWK D IUXLW VSHFLILF SURPRWHU UDWKHU WKDQ WKH QRQVSHFLILF &D09 6 SURPRWHU 7KLV ZRXOG QRW EH GLIILFXOW VLQFH KDYH DOVR FRQVWUXFWHG D FORQLQJ YHFWRU ZLWK WKH IUXLW VSHFLILF SURPRWHU ( )LVFKHU SHUVRQDO FRPPXQLFDWLRQf ,Q WKLV ZD\ HYHQ LI WKH HQGRJHQRXV KVS LV SURGXFHG LQ WKH OHDYHV LW ZRXOG QRW EH LQKLELWHG E\ WKH DQWLVHQVH FRQVWUXFW 7KHUHIRUH WKH HIIHFW RI LQKLELWLQJ KVS LQGXFWLRQ ZRXOG EH VWXGLHG RQO\ GXULQJ FKURPRSODVW GHYHORSPHQW

PAGE 141

:KDW W\SH RI SKHQRW\SH PD\ EH H[SHFWHG E\ WKH WUDQVIRUPDWLRQ RI DQWLVHQVH WUDQVFULSWV RI S720 LQWR WRPDWR SODQWV" 7KLV TXHVWLRQ LV H[WUHPHO\ GLIILFXOW WR DQVZHU ,W LV XQFOHDU IURP VHTXHQFH FRPSDULVRQ WR WKH 25) IURP ( FROL ZKDW IXQFWLRQ S720 SHUIRUPV GXULQJ FKURPRSODVW GHYHORSPHQW 6LQFH WKH V\QWKHVLV RI WKH 25) LV FRRUGLQDWHG ZLWK WKH V\QWKHVLV RI 3533 V\QWKHWDVH DQG D JHQH LQYROYHG LQ 6$/$ V\QWKHVLV SHUKDSV LW LV LQYROYHG ZLWK WKH V\QWKHVLV RI 1$'3+ 7KH VWHSZLVH GHK\GURJHQDWLRQ RI SK\WRHQH UHTXLUHV S\ULGLQH QXFOHRWLGHV WR IXQFWLRQ 3HUKDSV S720 LV LQYROYHG LQ WKH V\QWKHVLV RI WKHVH FRIDFWRUV ,Q WKDW FDVH WKH LQKLELWLRQ RI S720 FRXOG UHVXOW LQ ORVV RI FDURWHQRLG V\QWKHVLV 7KH ORVV RI S720 GXULQJ FKURPRSODVW GHYHORSPHQW YLD DQWLVHQVH PXWDJHQHVLV PD\ UHVXOW LQ D IDLOXUH LQ WKH RUGHUHG EUHDNGRZQ RI WKH WK\ODNRLG PHPEUDQHV GXULQJ WKH FKORURSODVW WR FKURPRSODVW FRQYHUVLRQ 7KLV KDV EHHQ VXJJHVWHG E\ WKH FRUUHODWLRQ EHWZHHQ WKH LQGXFWLRQ RI WKH S720 WUDQVFULSW ZLWK WKH ORVV RI /+&3 GXULQJ FKURPRSODVW GHYHORSPHQW ,I WKH LQGXFWLRQ RI S720 RFFXUV EHFDXVH RI DQ LQFUHDVH LQ XQIROGHG SURWHLQV GXULQJ WKH GHJUDGDWLRQ RI SKRWRV\QWKHWLF SURWHLQV WKHQ LW LV SRVVLEOH WKDW WKH GHJUDGDWLYH SURFHVV ZLOO FRQWLQXH 3HUKDSV WKH ORVV RI /+&3 ZLOO EH VORZHG LQ WKH PXWDQW SODQWV DQG WKLV PD\ EH GHPRQVWUDWHG E\ FRPSDULVRQV RI GHYHORSPHQWDO SURILOHV RI SURWHLQV IURP WRPDWR IUXLW H[WUDFWV ,W LV OLNHO\ WKDW WKH FRQWLQXHG V\QWKHVLV DQG GHSRVLWLRQ RI FDURWHQRLGV FRXOG EH LQKLELWHG E\ WKH SODVWLGV LQDELOLW\ WR FRSH ZLWK D EXLOGXS LQ SDUWLDOO\ GHJUDGHG SURWHLQV ,I D IXQFWLRQ RI WKLV SURWHLQ LV XQFRYHUHG GXULQJ FKURPRSODVW GHYHORSPHQW SHUKDSV LW ZLOO VXJJHVW D IXQFWLRQ IRU WKHVH KVSV GXULQJ KHDW VWUHVV

PAGE 142

5()(5(1&(6 $EHUQHWK\ 5+ '6 7KLHO 16 3HWHUVHQ DQG +HOP 7KHUPRWROHUDQFH LV GHYHORSPHQWDOA GHSHQGHQW LQ JHUPLQDWLQJ ZKHDW VHHG 3ODQW 3K\VLRO $OPRJXHUD & DQG -RUGDQD 'HYHORSPHQWDO DQG HQYLURQPHQWDO FRQFXUUHQW H[SUHVVLRQ RI VXQIORZHU GU\VHHGVWRUHG ORZPROHFXODUZHLJKW KHDWVKRFN SURWHLQ DQG /HD P51$V 3ODQW 0RO %LRO $OWVFKXO6) : *LVK : 0LOOHU (: 0\HUV DQG '/LSPDQ $ EDVLF ORFDO DOLJQPHQW VHDUFK WRRO 0RO %LRO $Q %LQDU\ 7L YHFWRUV IRU SODQW WUDQVIRUPDWLRQ DQG SURPRWHU DQDO\VLV 0HWKRGV LQ (Q]\PRO $Q %' :DWVRQ 6 6WDFKHO 03 *RUGRQ (: 1HVWHU 1HZ FORQLQJ YHKLFOHV IRU WUDQVIRUPDWLRQ RI KLJKHU SODQWV (PER -RXUQDO $UPVWURQJ *$ 0 $OEHUWL -( +HDUVW D &RQVHUYHG HQ]\PHV PHGLDWH WKH HDUO\ UHDFWLRQV RI FDURWHQRLG ELRV\QWKHVLV LQ QRQSKRWRV\QWKHWLF DQG SKRWRV\QWKHWLF SURNDU\RWHV 3URF 1DWO $FDG 6FL 86$ $UPVWURQJ *$ $ 6FKPLGW 6DQGPDQQ DQG -( +HDUVW E *HQHWLF DQG ELRFKHPLFDO FKDUDFWHUL]DWLRQ RI FDURWHQRLG ELRV\QWKHVLV PXWDQWV RI 5KRGREDFWHU FDSVXODWXV 7KH %LRO &KHP f $UULJR $3 &HOOXODU ORFDOL]DWLRQ RI KVS GXULQJ 'URVRSKLOD GHYHORSPHQW DQG IROORZLQJ VXEVHTXHQW KHDW VKRFN 'HYHORS %LRO $WNLQV -) 5% :HLVV DQG 5) *HVWHODQG 5LERVRPH J\PQDVWLFV'HJUHH RI GLIILFXOW\ VW\OH &HOO %DUMD GH 4XLURJD %URZQ IDW WKHUPRJHQHVLV DQG H[HUFLVH WZR H[DPSOHV RI SK\VLRORJLFDO R[LGDWLYH VWUHVV )UHH 5DGLFDO %LRORJ\ DQG 0HGLFLQH

PAGE 143

%DUWOH\ *( 39 9LWDQHQ 3HFNHU &KDPERYLW] +LUVFKEHUJ DQG 3$ 6FROQLN 0ROHFXODU FORQLQJ DQG H[SUHVVLRQ LQ SKRWRV\QWKHWLF EDFWHULD RI D VR\EHDQ F'1$ FRGLQJ IRU SK\WRHQH GHVDWXUDVH DQ HQ]\PH LI WKH FDURWHQRLG ELRV\QWKHVLV SDWKZD\ 3URF 1DWO $FDG 6FL 86$ %DUWOH\ *( 3 9 9LWDQHQ 2 %DFRW DQG 3 $ 6FROQLN $ WRPDWR JHQH H[SUHVVHG GXULQJ IUXLW ULSHQLQJ HQFRGHV DQ HQ]\PH RI WKH FDURWHQRLG ELRV\QWKHVLV SDWKZD\ -RXUQDO RI %LRORJLFDO &KHPLVWU\ f %DVVKDP '& %DUOLQJ 50 0RXOG % 'XQEDU 3 :HLVEHHN 5* +HUUPDQQ DQG & 5RELQVRQ 7UDQVSRUW RI SURWHLQV LQWR FKORURSODVWV RI %LRO &KHP f %DWKJDWH % 0( 3XUWRQ *ULHUVRQ DQG 3: *RRGHQRXJK 3ODVWLG FKDQJHV GXULQJ WKH FRQYHUVLRQ RI FKORURSODVWV WR FKURPRSODVWV LQ ULSHQLQJ WRPDWRHV 3ODQWD %HUU\/RZH 6/ DQG *: 6FKPLGW &KORURSODVW SURWHLQ WUDQVSRUW ,Q / %RJRUDG DQG ,. 9DVLO HGVf 7KH 0ROHFXODU %LRORJ\ RI 3ODVWLGV &HOO &XOWXUH DQG 6RPDWLF &HOO *HQHWLFV RI 3ODQWV $FDGHPLF 3UHVV ,QF 1HZ
PAGE 144

%UDPOH\ 3 & 7HXOLHUHV %ODLQ &%LUG DQG : 6FKXFK %LRFKHPLFDO FKDUDFWHUL]DWLRQ RI WUDQVJHQLF WRPDWR SODQWV LQ ZKLFK FDURWHQRLG V\QWKHVLV KDV EHHQ LQKLELWHG WKURXJK WKH H[SUHVVLRQ RI DQWLVHQVH 51$ WR S720 7KH 3ODQW -RXUQDO f %XUNH -+DWILHOG -/ .OHLQ 55 DQG 0XOOHW -( $FFXPXODWLRQ RI KHDW VKRFN SURWHLQV LQ ILHOGJURZQ FRWWRQ 3ODQW 3K\VLRO &DMRQH ) DQG $ %HUQHOOL=D]]HUD 2[LGDWLYH VWUHVV LQGXFHV D VXEVHW RI KHDW VKRFN SURWHLQV LQ UDW KHSDWRF\WHV DQG 0+AM FHOOV &KHP%LRO ,QWHUDFWLRQV &DPDUD % 7HUSHQRLG PHWDEROLVP LQ SODVWLGV 6LWHV RI SK\WRHQH V\QWKHWDVH DFWLYLW\ DQG V\QWKHVLV LQ SODQW FHOOV 3ODQW 3K\VLRO &DPDUD % DQG %UDQJHRQ &DURWHQRLG PHWDEROLVP GXULQJ FKORURSODVW WR FKURPRSODVW WUDQVIRUPDWLRQ LQ &DSVLFXP DQQXXP IUXLW 3ODQWD &DUGH -3 % &DPDUD DQG & &KHQLFOHW $EVHQFH RI ULERVRPHV LQ &DSVLFXP FKURPRSODVWV 3ODQWD &DWKDOD -) 6DYRXUHW % 0HQGH] %/ :HVW 0 .DULQ -$ 0DUWLDO DQG -' %D[WHU $ VLPSOH PHWKRG IRU LVRODWLRQ RI 51$ '1$ f &HUYDQWHV&HUYDQWHV 0 1 +DGMHE /$ 1HZPDQ DQG &$ 3ULFH &KU$ LV D FDURWHQRLGELQGLQJ SURWHLQ LQ FKURPRSODVWV RI &DSVLFXP DQQXXP 3ODQW 3K\VLRO &KHQ 4 DQG ( 9LHUOLQJ $QDO\VLV RI FRQVHUYHG GRPDLQV LGHQWLILHV D XQLTXH VWUXFWXUDO IHDWXUH RI D FKORURSODVW KHDW VKRFN SURWHLQ 0RO *HQ *HQHW &KHQ 4 /0 /DX]RQ $( 'H5RFKHU DQG ( 9LHUOLQJ $FFXPXODWLRQ VWDELOLW\ DQG ORFDOL]DWLRQ RI D PDMRU FKORURSODVW KHDWVKRFN SURWHLQ 7KH RI &HOO %LR &KHQLFOHW & ) 5DILD $ 6DLQW*XLO\ $ 9HUQD DQG -3 &DUGH /RFDOL]DWLRQ RI WKH HQ]\PH JHUDQ\OJHUDQ\OS\URSKRVSKDWH V\QWKDVH LQ &DSVLFXP IUXLWV E\ LPPXQRJROG F\WRFKHPLVWU\ DIWHU FRQYHQWLRQDO FKHPLFDO IL[DWLRQ RU TXLFNIUHH]LQJ IROORZHG E\ IUHH]HVXEVWLWXWLRQ /DEHOOLQJ HYROXWLRQ GXULQJ ULSHQLQJ %LRO FHOO &KRPF]\QVNL 3 DQG 1 6DFFKL 6LQJOHVWHS PHWKRG RI 51$ LVRODWLRQ E\ DFLG *XDQLGLQLXPWKLRF\DQDWHSKHQROFKORURIRUPH[WUDFWLRQ $QDO %LRFKHP

PAGE 145

&ODUNH $. DQG & &ULWFKOH\ 7KH LGHQWLILFDWLRQ RI D KHDWVKRFN SURWHLQ FRPSOH[ LQ FKORURSODVWV RI EDUOH\ OHDYHV 3ODQW 3K\VLRO &OLQH f ,PSRUW RI SURWHLQV LQWR FKORURSODVWV 0HPEUDQH LQWHJUDWLRQ RI D WK\ODNRLG SUHFXUVRU SURWHLQ UHFRQVWLWXWHG LQ FKORURSODVW O\VDWHV %LRO &KHP &OLQH f /LJKWKDUYHVWLQJ FKORURSK\OO DE SURWHLQ 0HPEUDQH LQVHUWLRQ SURWHRO\WLF SURFHVVLQJ DVVHPEO\ LQWR /+& ,, DQG ORFDOL]DWLRQ WR DSSUHVVHG PHPEUDQHV RFFXUV LQ FKORURSODVW O\VDWHV 3ODQW 3K\VLRO &OLQH '5 )XOVRP DQG 39 9LLWDQHQ $Q LPSRUWHG WK\ODNRLG SURWHLQ DFFXPXODWHV LQ WKH VWURPD ZKHQ LQVHUWLRQ LQWR WK\ODNRLGV LV LQKLELWHG %LRO &KHP &RXUJHRQ $0 ( 5ROOHW %HFNHU & 0DLVRQKDXWH DQG 0 %HVW%HOSRPPH +\GURJHQ SHUR[LGH +f LQGXFHV DFWLQ DQG VRPH KHDWVKRFN SURWHLQV LQ 'URVRSKLOD FHOOV (XU %LRFKHP &]DUQHFND ( / (GHOPDQ ) 6FKRIIO DQG -/ .H\ &RPSDUDWLYH DQDO\VLV RI SK\VLFDO VWUHVV UHVSRQVHV LQ VR\EHDQ VHHGOLQJV XVLQJ FORQHG KHDW VKRFN F'1$V 3ODQW 0RO %LRO 'DOOLQJ 03URWHRO\WLF HQ]\PHV DQG OHDI VHQHVFHQFH ,Q :: 7KRPVRQ ($ 1RWKQDJHO DQG 5& +XIIDNHU HGVf 3ODQW VHQHVFHQFH ,WV ELRFKHPLVWU\ DQG SK\VLRORJ\ $PHULFDQ 6RFLHW\ RI 3ODQW 3K\VLRORJLVWV 5RFNYLOOH 0DU\ODQG SS 'DYLHV -: DQG &RFNLQJ (& &KDQJHV LQ FDUERK\GUDWHV SURWHLQV DQG QXFOHLF DFLGV GXULQJ FHOOXODU GHYHORSPHQW LQ WRPDWR IUXLW ORFXOH WLVVXH 3ODQWD 'DYLHV .0 DQG *ULHUVRQ ,GHQWLILFDWLRQ RI F'1$ FORQHV IRU WRPDWR /\FRSHUVLFRQ HVFXOHQWXP 0LOOf P51$V WKDW DFFXPXODWH GXULQJ IUXLW ULSHQLQJ DQG OHDI VHQHVFHQFH 3ODQWD 'DYLHV -1 DQG &( +REVRQ 7KH FRQVWLWXHQWV RI WRPDWR IUXLWWKH LQIOXHQFH RI HQYLURQPHQW QXWULWLRQ DQG JHQRW\SH &5& &ULW 5HY )RRG 6FL 1XWU GH%RHU ) &UHPHUV 5 7HHUWVWUD / 6PLWV +LOOH 6 6PHHNHQV DQG 3 :HLVEHHN f ,Q YLYR LPSRUW RI SODVWRF\DQLQ DQG D IXVLRQ SURWHLQ LQWR GHYHORSPHQWDOO\ GLIIHUHQW SODVWLGV RI WUDQVJHQLF SODQWV (PER 'HOOD3HQQD '& $OH[DQGHU DQG $% %HQQHWW 0ROHFXODU FORQLQJ RI WRPDWR IUXLW SRO\JDODFWXURQDVH $QDO\VLV RI SRO\JDODFWXURQDVH P51$ OHYHOV GXULQJ ULSHQLQJ 3URF 1DWO $FDG 6FL 86$

PAGE 146

'HOOD3HQQD -( /LQFROQ 5 )LVFKHU DQG $% %HQQHWW f 7UDQVFULSWLRQDO DQDO\VLV RI SRO\JDODFWXURQDVH DQG RWKHU ULSHQLQJ DVVRFLDWHG JHQHV LQ 5XWJHUV ULQ QRU DQG 1U WRPDWR IUXLW 3ODQW 3K\VLRO 'HUROHV 6& DQG 5& *DUGQHU $QDO\VLV RI WKH 7'1$ VWUXFWXUH LQ D ODUJH QXPEHU RI WUDQVJHQLF SHWXQLDV JHQHUDWHG E\ $JUREDFWHULXPPHGLDWHG WUDQVIRUPDWLRQ 3ODQW 0RO ELRO 'HYHUHX[ 3 +DHEHUOL DQG 2 6PLWKLHV $ FRPSUHKHQVLYH VHW RI VHTXHQFH DQDO\VLV SURJUDPV IRU WKH 9$; 1XFOHLF $FLGV 5HV 'RJER 2 ) %DUGDW $ /DIHUULHUH 4XHQQHPHW %UDQJHRQ DQG % &DPDUD f 0HWDEROLVP RI SODVWLG WHUSHQRLGV %LRV\QWKHVLV LQ SODVWLG VWURPD LVRODWHG IURP KLJKHU SODQWV 3ODQW 6FL 'UXPPRQG ,$6 DQG 5$ 6WHLQKDUGW 7KH UROH RI R[LGDWLYH VWUHVV LQ WKH LQGXFWLRQ RI 'URVRSKLOD KHDWVKRFN SURWHLQV ([SHULPHQWDO &HOO 5HVHDUFK 'XQVPXLU3 %RQG /HH *LGRQL 7RZQVHQG 6WDELOLW\ RI LQWURGXFHG JHQHV DQG VWDELOLW\ LQ H[SUHVVLRQ 3ODQW 0RO %LR 0DQXDO &O .OXZHU $FDGHPLF 3XEOLFDWLRQV 'RUGUHFKW %HOJXLP (GHOPDQ / ( &]DUQHFND DQG -/ .H\ ,QGXFWLRQ DQG DFFXPXODWLRQ RI KHDW VKRFNVSHFLILF SRO\ $f 51$V DQG SURWHLQV LQ VR\EHDQ VHHGOLQJV GXULQJ DUVHQLWH DQG FDGPLXP WUHDWPHQWV 3ODQW 3K\VLRO )LVFKHU 5/ DQG $% %HQQHWW 5ROH RI FHOO ZDOO K\GURODVHV LQ IUXLW ULSHQLQJ $QQ 5HYLHZ RI 3ODQW 3K\VLRO DQG 3ODQW 0RO %LRO )OHPLQJ -( 5HYHLOODXG DQG $ 1LHG]ZLHFNL 5ROH RI R[LGDWLYH VWUHVV LQ 'URVRSKLOD DJLQJ 0XWDWLRQ 5HVHDUFK )UD\ 5* *: /\FHWW DQG *ULHUVRQ 1XFOHRWLGH VHTXHQFH RI D KHDWVKRFN DQG ULSHQLQJUHODWHG F'1$ IURP WRPDWR 1XFOHLF $FLG 5HVHDUFK f *HSVWHLQ 6 3KRWRV\QWKHVLV ,Q /' 1RRGHQ DQG $& /HRSROG HGVf 6HQHVFHQFH DQG DJLQJ LQ SODQWV $FDGHPLF 3UHVV ,QF 1HZ
PAGE 147

*RRGHQRXJK 3: $ UHYLHZ RI WKH UROH RI HWK\OHQH LQ ELRFKHPLFDO FRQWURO RI ULSHQLQJ LQ WRPDWR IUXLW 3ODQW *URZWK 5HJXODWLRQ *RRGZLQ 7: 7KH %LRFKHPLVWL\ RI WKH &DURWHQRLGV YRO 3ODQWV 1HZ
PAGE 148

+DPLOWRQ $ *: /\FHWW DQG *ULHUVRQ $QWLVHQVH JHQH LQKLELWV V\QWKHVLV RI WKH KRUPRQH HWK\OHQH LQ WUDQVJHQLF SODQWV 1DWXUH +DUPDQ )UHH UDGLFDO WKHRU\ RI DJLQJ 0XWDWLRQ 5HVHDUFK +DUULPDQ 5: '0 7LHPDQ DQG $. +DQGD 0ROHFXODU FORQLQJ RI WRPDWR SHFWLQ PHWK\OHVWHUDVH JHQH DQG LWV H[SUHVVLRQ LQ 5XWJHUV 5LSHQLQJ ,QKLELWRU 1RQULSHQLQJ DQG 1HYHU 5LSH WRPDWR IUXLWV 3ODQW 3K\VLRO +DUULV :0 DQG $5 6SXUU &KURPRSODVWV RI WRPDWR IUXLWV ,, 7KH UHG WRPDWR $PHU %RW f +DWDQDND $ 7 .DMLZDUD 0DWVXL DQG $ .LWDPXUD ([SUHVVLRQ RI OLSR[\JHQDVH DQG K\GURSHUR[LGH O\DVH DFWLYLWLHV LQ WRPDWR IUXLWV = 1DWXUIRUVFK F +HOP .: DQG 5+ $EHUQHWK\ +HDW VKRFN SURWHLQV DQG WKHLU P51$V LQ GU\ DQG HDUO\ LPELELQJ HPEU\RV RI ZKHDW 3ODQW 3K\VLRO +HOP .: 16 3HWHUVHQ DQG 5+ $EHUQHWK\ +HDW VKRFN UHVSRQVH RI JHUPLQDWLQJ HPEU\RV RI ZKHDW HIIHFWV RI LPELELWLRQ WLPH DQG VHHG YLJRU 3ODQW 3K\VLRO +LJK 6 DQG % 'REEHUVWHLQ 7KH VLJQDO VHTXHQFH LQWHUDFWV ZLWK WKH PHWKLRQLQHULFK GRPDLQ RI WKH N' SURWHLQ RI VLJQDO UHFRJQLWLRQ SDUWLFOH &HOO %LRO +ROGVZRUWK 0&5 %LUG 5D\ : 6FKXFK DQG *ULHUVRQ 6WUXFWXUH DQG H[SUHVVLRQ RI DQ HWK\OHQHUHODWHG P51$ IURP WRPDWR 1XFOHLF $FLG 5HVHDUFK f +RUVFK 5% -( )U\ 1/ +RIIPDQQ (LFKKROW] 6* 5RJHUV 57 )UDOH\ $ VLPSOH DQG JHQHUDO PHWKRG IRU WUDQVIHUULQJ JHQHV LQWR SODQWV 6FLHQFH +UD]GLQD DQG 5$ -HQVHQ 6SDWLDO RUJDQL]DWLRQ RI HQ]\PHV LQ SODQW PHWDEROLF SDWKZD\V ,Q :5 %ULJJV HGf $QQXDO UHYLHZ RI 3ODQW 3K\VLRO DQG 3ODQW 0RO %LR $QQXDO 5HYLHZV ,QF 3DOR $OWR &D SS +XJXHQH\ 3 6 5RPHU 0 .XQW] DQG % &DPDUD &KDUDFWHUL]DWLRQ DQG PROHFXODU FORQLQJ RI D IODYRSURWHLQ FDWDO\]LQJ WKH V\QWKHVLV RI SK\WRIOXHQH DQG JDPPDFDURWHQH LQ &DSVLFXP FKURPRSODVWV (XU RI %LRFKHP

PAGE 149

+XQW &0 5& +DUGLVRQ DQG &' %R\HU 5HVWULFWLRQ HQ]\PH DQDO\VLV RI WRPDWR FKORURSODVW DQG FKURPRSODVW '1$ 3ODQW 3K\VLRO +XUWDGR+HUQDQGH] + DQG 3* 6PLWK ,QKHULWDQFH RI PDWXUH IUXLW FRORU LQ &DSVLFXP DQQXXP / 7KH RI +HUHGLW\ ,NHPL 0 0XUDNDPL 0 +DVKLPRWR DQG < 0XURRND &ORQLQJ DQG FKDUDFWHUL]DWLRQ RI JHQHV LQYROYHG LQ WKH V\QWKHVLV RI DPLQROHYXOLQLF DFLG LQ (VFKHULFKLD FROL *HQH ,VVHOV 5' 6 %RXULHU % %RQLQJ *& /L -0DN DQG : :LOPDQQV ,QIOXHQFH RI R[LGDWLYH VWUHVV LQGXFHG E\ F\VWHDPLQH XSRQ WKH LQGXFWLRQ DQG GHYHORSPHQW RI WKHUPRWROHUDQFH LQ &KLQHVH KDPVWHU RYDU\ FHOOV &DQFHU 5HVHDUFK ,ZDWVXNL 1 5 0RUL\DPD DQG 7 $VDKL ,VRODWLRQ DQG SURSHUWLHV RI LQWDFW FKURPRSODVWV IURP WRPDWR IUXLW 3ODQW DQG &HOO 3K\VLRO f -DDWWHOD 0 DQG :LVVLQJ (PHUJLQJ UROH RI KHDW VKRFN SURWHLQV LQ ELRORJ\ DQG PHGLFLQH $QQDOV RI 0HGLFLQH -HIIHUVRQ 5$ $VVD\LQJ FKLPHULF JHQHV LQ SODQWVWKH *86 JHQH IXVLRQ V\VWHP 3ODQW 0RO %LRO 5HS -HIIHU\ 3: *RRGHQRXJK DQG 3':HLW]PDQ (Q]\PH DFWLYLWLHV LQ PLWRFKRQGULD LVRODWHG IURP ULSHQLQJ WRPDWR IUXLW 3ODQWD -RQHV -'* '( *LOEHUW ./ *UDG\ DQG 5$ -RUJHQVHQ 7'1$ VWUXFWXUH DQG JHQH H[SUHVVLRQ LQ SHWXQLD SODQWV WUDQVIRUPHG E\ $JUREDFWHULXP WXPHIDFLHQV & GHULYDWLYHV 0RO *HQ *HQHW .DGHU $$ DQG // 0RUULV &RUUHODWLQJ VXEMHFWLYH DQG REMHFWLYH PHDVXUHPHQWV RI PDWXUDWLRQ DQG ULSHQHVV RI WRPDWRHV 3URF QG 7RPDWR 4XDOLW\ :RUNVKRS 8QLYHUVLW\ RI &DOLIRUQLD 'DYLV S .HHJVWUD 7UDQVSRUW DQG URXWLQJ RI SURWHLQV LQWR FKORURSODVWV &HOO .HHJVWUD /2OVHQ DQG 60 7KHJ &KORURSODVWLF SUHFXUVRUV DQG WKHLU WUDQVSRUW DFURVV WKH HQYHORSH PHPEUDQHV $QQX 5HY 3ODQW 3K\VLRO 3ODQW 0RO %LRO .KXGDLUL $. 7KH ULSHQLQJ RI WRPDWRHV $PHULFDQ 6FLHQWLVW

PAGE 150

.LPSHO -$ DQG -/ .H\ 3UHVHQFH RI KHDW VKRFN P51$V LQ ILHOG JURZQ VR\EHDQV 3ODQW 3K\VLRO .LPSHO -$ 57 1DJDR 9 *RHNMLDQ DQG -/ .H\ 5HJXODWLRQ RI WKH KHDW VKRFN UHVSRQVH LQ VR\EHDQ VHHGOLQJV 3ODQW 3K\VLRO .OHH +0% +D\IRUG .$ .UHW]PHU *) %DUU\ DQG *0 .LVKRUH &RQWURO RI HWK\OHQH ELRV\QWKHVLV E\ H[SUHVVLRQ RI D EDFWHULDO HQ]\PH LQ WUDQVJHQLF WRPDWR SODQWV 7KH 3ODQW &HOO .ORSSVWHFK 0H\HU 6FKXVWHU DQG 2KDG 6\QWKHVLV WUDQVSRUW DQG ORFDOL]DWLRQ RI D QXFOHDU FRGHG N' KHDWVKRFN SURWHLQ LQ WKH FKORURSODVW PHPEUDQHV RI SHDV DQG &KDP\GRPRQDV UHLQKDUGL 7KH (PER f .ORVJHQ 5% + 6DHGOHU DQG -+ :HLO 7KH DP\ORSODVWWDUJHWLQJ WUDQVLW SHSWLGH RI WKH ZD[\ SURWHLQ RI PDL]H DOVR PHGLDWHV SURWHLQ WUDQVSRUW LQ YLWUR LQWR FKORURSODVWV 0RO *HQ *HQHW .RED\DVKL + 'LIIHUHQWLDWLRQ RI DP\ORSODVWV DQG FKURPRSODVWV ,Q / %RJRUDG DQG ,. 9DVLO HGVf 7KH SKRWRV\QWKHWLF DSSDUDWXVPROHFXODU ELRORJ\ DQG RSHUDWLRQ $FDGHPLF 3UHVV 6DQ 'LHJR &$ SS .RED\DVKL + 1JHUQSUDVLUWVLUL DQG 7 $ND]DZD 7UDQVFULSWLRQDO UHJXODWLRQ DQG '1$ PHWK\ODWLRQ LQ SODVWLGV GXULQJ WUDQVLWLRQDO FRQYHUVLRQ RI FKORURSODVWV WR FKURPRSODVWV (PER f .R]DN 0 6WUXFWXUDO IHDWXUHV LQ HXNDU\RWLF P51$V WKDW PRGXODWH WKH LQLWLDWLRQ RI WUDQVODWLRQ -RXUQDO RI %LRO &KHP f .XQW] 0 -/ (YUDUG $ Gf+DUOLQJXH -+ :HLO DQG % &DPDUD ([SUHVVLRQ RI SODVWLG DQG QXFOHDU JHQHV GXULQJ FKURPRSODVW GLIIHUHQWLDWLRQ LQ EHOO SHSSHU &DSVLFXP DQQXPf DQG VXQIORZHU +HOLDQWKXV DQQXVf 0RO *HQ *HQHW .XQW] 0 5RPHU & 6XLUH 3+ +XJXHQH\ -+ :HLO 5 6FKDQW] DQG % &DPDUD ,GHQWLILFDWLRQ RI D F'1$ IRU WKH SODVWLGORFDWHG JHUDQ\OJHUDQ\O S\URSKRVSKDWH V\QWKDVH IURP &DSVLFXP DQQXPFRUUHODWLYH LQFUHDVH LQ HQ]\PH DFWLYLW\ DQG WUDQVFULSW OHYHO GXULQJ IUXLW ULSHQLQJ 3ODQW .XVKZDKD 6& & 6XEEDUD\DQ '$ %HHOHU DQG -: 3RUWHU 7KH FRQYHUVLRQ RI O\FRSHQH f+ WR F\FOLF FDURWHQHV E\ VROXEOH H[WUDFWV RI KLJKHU SODQW SODVWLGV 7KH RI %LRO &KHP f .XVZDKD 6& 6X]XH & 6XEEDUD\DQ DQG -: 3RUWHU 7KH FRQYHUVLRQ RI SK\WRHQH& WR DF\FOLF PRQRF\FOLF DQG ELF\FOLF FDURWHQHV DQG WKH FRQYHUVLRQ RI

PAGE 151

O\FRSHQHf+ WR PRQR DQG GLF\FOLF FDURWHQHV E\ VROXEOH HQ]\PH V\VWHPV REWDLQHG IURP SODVWLGV RI WRPDWR IUXLW 7KH RI %LRO &KHP f /D]R *5 3$ 6WHLQ DQG 5 $ /XGZLJ $ '1$ WUDQVIRUPDWLRQFRPSHWHQW $UDELGRSVLV JHQRPLF OLEUDU\ LQ $JUREDFWHULXP %LRWHFKQRORJ\ /HH 3& %5 %RFKQHU DQG %1 $PHV $SSSS$ KHDWVKRFN VWUHVV DQG FHOO R[LGDWLRQ 3URF 1DWO $FDG 6FL 86$ /HH 6 DQG 6 5DVKHHG $ VLPSOH SURFHGXUH IRU PD[LPXP \LHOG RI KLJK TXDOLW\ SODVPLG '1$ %LRWHFKQLTXHV /HJJH 5/ &KHQJ -5 /HSRFN DQG -( 7KRPSVRQ 'LIIHUHQWLDO HIIHFWV RI VHQHVFHQFH RQ WKH PROHFXODU RUJDQL]DWLRQ RI PHPEUDQHV LQ ULSHQLQJ WRPDWR IUXLW 3ODQW 3K\VLRO /HVKHP < 3ODQW VHQHVFHQFH SURFHVVHV DQG IUHH UDGLFDOV )UHH 5DGLFDO %LRORJ\ DQG 0HGLFLQH /LQFROQ -( 6 &RUGHV ( 5HDG DQG 5/ )LVFKHU 5HJXODWLRQ RI JHQH H[SUHVVLRQ E\ HWK\OHQH GXULQJ /\FRSHUVLFRQ HVFXOHQWXP WRPDWRf IUXLW GHYHORSPHQW 3URF 1DWO $FDG 6FL 86$ /LQFROQ -( DQG 5/ )LVFKHU 'LYHUVH PHFKDQLVPV IRU WKH UHJXODWLRQ RI HWK\OHQHLQGXFLEOH JHQH H[SUHVVLRQ 0RO *HQ *HQHW /LQGHQ + 1 0LVDZD &KDPRYLW] 3HFNHU +LUVFKEHUJ DQG 6DQGPDQQ )XQFWLRQDO FRPSOHPHQWDWLRQ LQ (VFKHULFKLD FROL RI GLIIHUHQW SK\WRHQH GHVDWXUDVH JHQHV DQG DQDO\VLV RI DFFXPXODWHG FDURWHQHV = 1DWXUIRUVFK F /LQGTXLVW 6 DQG ($ &UDLJ 7KH KHDWVKRFN SURWHLQV $QQX 5HY *HQHW /LYLQH DQG 6 *HSVWHLQ $EXQGDQFH RI WKH PDMRU FKORURSODVW SRO\SHSWLGHV GXULQJ GHYHORSPHQW DQG ULSHQLQJ RI WRPDWR IUXLWV 3ODQW 3K\VLRO /RQJKXUVW 7+) 7XQJ DQG &%UDG\ 'HYHORSPHQWDO UHJXODWLRQ RI WKH H[SUHVVLRQ RI DOFRKRO GHK\GURJHQDVH LQ ULSHQLQJ WRPDWR IUXLWV RI )RRG %LRFKHP /RYHQ '3 $ UROH IRU UHGXFHG R[\JHQ VSHFLHV LQ KHDW LQGXFHG FHOO NLOOLQJ DQG WKH LQGXFWLRQ RI WKHUPRWROHUDQFH 0HGLFDO +\SRWKHVHV

PAGE 152

/XWFNH + 6 +LJK 5RPLVFK $$VKIRUG DQG % 'REEHUVWHLQ 7KH PHWKLRQLQHULFK GRPDLQ RI WKH N' VXEXQLW RI VLJQDO UHFRJQLWLRQ SDUWLFOH LV VXIILFLHQW IRU WKH LQWHUDFWLRQ ZLWK VLJQDO VHTXHQFHV 7KH (PER -RXUQDO f /XWNH%ULQNKDXV ) % /LHGYRJHO .UHX] DQG + .OHQLJ f 3K\WRHQH V\QWKDVH DQG SK\WRHQH GHK\GURJHQDVH DVVRFLDWHG ZLWK HQYHORSH PHPEUDQHV IURP VSLQDFK FKORURSODVWV 3ODQWD 0DQQVVRQ 3( +VX DQG 6WDONHU &KDUDFWHUL]DWLRQ RI IUXLW VSHFLILF F'1$V IURP WRPDWR 0RO *HQ *HQHW 0DUDR 05 DQG 1 &DULOOR &KURPRSODVW IRUPDWLRQ GXULQJ WRPDWR IUXLW ULSHQLQJ 1R HYLGHQFH IRU SODVWLG '1$ PHWK\ODWLRQ 3ODQW 0ROHFXODU %LRORJ\ 0DWLOH 3 7 'XJJHOLQ 0 6FKHOOHQEHUJ 5HQWVFK %RUWOLN & 3HLVNHU DQG + 7KRPDV +RZ DQG ZK\ LV FKORURSK\OO EURNHQ GRZQ LQ VHQHVFHQW OHDYHV 3ODQW 3K\VLRO %LRFKHP f 0DWRR $. DQG $KDURQL 1 (WK\OHQH DQG SODQW VHQHVFHQFH ,Q /' 1RRGHQ DQG $& /HRSROG HGVf 6HQHVFHQFH DQG DJLQJ LQ SODQWV $FDGHPLF 3UHVV ,QF 1HZ
PAGE 153

0F*DUYH\ '5 6LUHYDJ DQG 5( &KULVWRIIHUVHQ 5LSHQLQJUHODWHG JHQH IURP DYRFDGR IUXLW (WK\OHQHLQGXFLEOH H[SUHVVLRQ RI WKH P51$ DQG SRO\SHSWLGH 3ODQW 3K\VLRO 0HKWD 5$ 7: )DZFHWW 3RUDWK DQG $. 0DWRR 2[LGDWLYH VWUHVV FDXVHV UDSLG PHPEUDQH WUDQVORFDWLRQ DQG LQ YLYR GHJUDGDWLRQ RI ULEXORVH ELVSKRVSKDWH FDUER[\ODVHR[\JHQDVH 7KH RI %LRO &KHP f 0LVDZD 1 0 1DNDJDZD .RED\DVKL 6
PAGE 154

2HOOHU 3: / 0LQ:RQJ /3 7D\ORU '$ 3LNH DQG $ 7KHRORJLV 5HYHUVLEOH LQKLELWLRQ RI WRPDWR IUXLW VHQHVFHQFH E\ DQWLVHQVH 51$ 6FLHQFH 2OVRQ '& -$ :KLWH / (GHOPDQ U1 +DUNLQV DQG + .HQGH 'LIIHUHQWLDO H[SUHVVLRQ RI WZR JHQHV IRU DPLQRF\FORSURSDQHOFDUER[\ODWH V\QWKDVH LQ WRPDWR IUXLWV 3URF 1DWO $FDG 6FL 86$ 3DSDVWHSKDQRX & )%DUQHV $9 %ULHGLV DQG -: 3RUWHU (Q]\PDWLF V\QWKHVLV RI FDURWHQHV E\ FHOOIUHH SUHSDUDWLRQV RI IUXLW RI VHYHUDO JHQHWLF VHOHFWLRQV RI WRPDWRHV $UFKLYHV RI %LRFKHP 3HFNHU &KDPRYLW] + /LQGHQ 6DQGPDQQ DQG +LUVKEHUJ $ VLQJOH SRO\SHSWLGH FDWDO\]LQJ WKH FRQYHUVLRQ RI SK\WRHQH WR JDPPDFDURWHQH LV WUDQVFULSWLRQDOO\ UHJXODWHG GXULQJ WRPDWR IUXLW ULSHQLQJ 3URF 1DWO $FDG 6FL 86$ 3HQDUUXELD / DQG 0RUHQR ,QFUHDVHG VXVFHSWLELOLW\ RI ULEXORVH %LVSKRVSKDWH FDUER[\ODVHR[\JHQDVH WR SURWHRO\WLF GHJUDGDWLRQ FDXVHG E\ R[LGDWLYH WUHDWPHQWV $UFKLYHV RI %LRFKHP DQG %LRSK\V f 3HUO7UHYHV 5 DQG ( *DOXQ 7KH WRPDWR &X =Q VXSHUR[LGH GLVPXWDVH JHQHV DUH GHYHORSPHQWDOO\ UHJXODWHG DQG UHVSRQG WR OLJKW DQG VWUHVV 3ODQW 0ROHFXODU %LRORJ\ 3LFWRQ 6 DQG *ULHUVRQ ,QKLELWLRQ RI H[SUHVVLRQ RI WRPDWRULSHQLQJ JHQHV DW KLJK WHPSHUDWXUH 3ODQW &HOO DQG (QYLURQPHQW 3LHFKXOOD % .5 &KRQROHV DQG : *UXLVVHP 3ODVWLG JHQH H[SUHVVLRQ GXULQJ IUXLW ULSHQLQJ LQ WRPDWR 3ODQW 0ROHFXODU %LRORJ\ 3LHFKXOOD % ( 3LFKHUVN\ $5 &DVKPRUH DQG : *UXLVVHP ([SUHVVLRQ RI QXFOHDU DQG SODVWLG JHQHV IRU SKRWRV\QWKHVLVVSHFLILF SURWHLQV GXULQJ WRPDWR IUXLW GHYHORSPHQW DQG ULSHQLQJ 3ODQW 0ROHFXODU %LRORJ\ 3LHFKXOOD % 5( *OLFN + %DKO $ 0HOLV DQG : *UXLVVHP &KDQJHV LQ SKRWRV\QWKHWLF FDSDFLW\ DQG SKRWRV\QWKHWLF SURWHLQ SDWWHUQ GXULQJ WRPDWR IUXLW ULSHQLQJ 3ODQW 3K\VLRO 3RVW '$ % +RYH-HQVHQ DQG 5/ 6ZLW]HU &KDUDFWHUL]DWLRQ RI WKH KHP$ SUV UHJLRQ RI WKH (VFKHULFKLD FROL DQG 6DOPRQHOOD W\SKLPXULXP FKURPRVRPHV ,GHQWLILFDWLRQ RI WZR RSHQ UHDGLQJ IUDPHV DQG LPSOLFDWLRQV IRU SUV H[SUHVVLRQ -RXUQDO RI *HQ 0LFUR

PAGE 155

4XUHVKL $$ $* $QGUHZHV 1 4XUHVKL DQG -: 3RUWHU 7KH HQ]\PDWLF FRQYHUVLRQ RI FLV>&@3K\WRIOXHQH DQG WUDQV]HWD>&@&DURWHQH WR PRUH XQVDWXUDWHG DF\FOLF PRQRF\FOLF DQG GLF\FOLF FDURWHQHV E\ D FHOOIUHH SUHSDUDWLRQ RI UHG WRPDWR IUXLWV $UFKLYHV RI %LRFKHP DQG %LRSK\ 5DELQRZLWFK +' 6NLDQ DQG 3 %XGRZVNL 3KRWRR[LGDWLYH GDPDJH LQ WKH ULSHQLQJ WRPDWR IUXLW 3URWHFWLYH UROH RI VXSHUR[LGH GLVPXWDVH 3K\VLRO 3ODQW 5DWWDQDSDQRQH 1 6SHLUV DQG *ULHUVRQ (YLGHQFH IRU FKDQJHV LQ PHVVHQJHU 51$ FRQWHQW UHODWHG WR WRPDWR IUXLW ULSHQLQJ 3K\WRFKHPLVWU\ 5D\ 0 0DXQGHUV *ULHUVRQ DQG : 6FKXFK 6HTXHQFH RI S720 D ULSHQLQJ UHODWHG F'1$ IURP WRPDWR 1XFO $FLGV 5HV f 5LFKDUGV &0 6% +LQPDQ &' %R\HU DQG 5& +DUGLVRQ 6XUYH\ RI SODVWLG 51$ DEXQGDQFH GXULQJ WRPDWR IUXLW ULSHQLQJ WKH DPRXQWV RI 51$ IURP WKH 25) UHJLRQ LQFUHDVH LQ FKURPRSODVWV 3ODQW 0RO %LRO 5REHUWV '5 -( 7KRPSVRQ (% 'XPEURII 6 *HSVWHLQ DQG $. 0DWRR 'LIIHUHQWLDO FKDQJHV LQ WKH V\QWKHVLV DQG VWHDG\VWDWH OHYHOV RI WK\ODNRLG SURWHLQV GXULQJ EHDQ OHDI VHQHVFHQFH 3ODQW 0RO %LRO 5RELQVRQ 1/ -' +HZLWW DQG $% %HQQHWW 6LQN PHWDEROLVP LQ WRPDWR IUXLW 'HYHORSPHQWDO FKDQJHV LQ FDUERK\GUDWH PHWDEROL]LQJ HQ]\PHV 3ODQW 3K\VLRO 5RPHU 6 $ Gf+DUOLQJXH % &DPDUD 5 6FKDQW] DQG 0 .XQW] &\VWHLQH V\QWKDVH IURP &DSVLFXP DQQXXP FKURPRSODVWV FKDUDFWHUL]DWLRQ DQG F'1$ FORQLQJ DQG XSUHJXODWHG HQ]\PH GXULQJ IUXLW GHYHORSPHQW RI %LRORJLFDO &KHPLVWU\ f 5RVVR 6: 7KH XOWUDVWUXFWXUH RI FKURPRSODVW GHYHORSPHQW LQ UHG WRPDWRHV 8OWUDVWUXFWXUH 6FLHQFH 5RWKDQ & DQG 1LFRODV &KDQJHV LQ DFLGLF DQG EDVLF SHUR[LGDVH DFWLYLWLHV GXULQJ WRPDWR IUXLW ULSHQLQJ +RUWVFLHQFH f 5RWWPDQQ :+ *) 3HWHU 3: 2HOOHU -$ .HOOHU 1) 6KHQ % 3 1DJ\ /3 7D\ORU $' &DPSEHOO DQG $ 7KHRORJLV DPLQRF\FORSURSDQHOFDUER[\ODWH V\QWKDVH LQ WRPDWR LV HQFRGHG E\ D PXOWLJHQH IDPLO\ ZKRVH WUDQVFULSWLRQ LV LQGXFHG GXULQJ IUXLW DQG IORUDO VHQHVFHQFH 0RO %LRO

PAGE 156

5R\ + 5XELVFR DVVHPEO\ $ PRGHO V\VWHP IRU VWXG\LQJ WKH PHFKDQLVP RI FKDSHURQLQ DFWLRQ 7KH 3ODQW &HOO 6DPEURRN () )ULWVFK DQG 7 0DQLDWLV 0ROHFXODU &ORQLQJ D /DERUDWRU\ 0DQXDO QG HGLWLRQ &ROG 6SULQJ +DUERU /DERUDWRU\ 3UHVV 1< 6FDQGDOLRV -* 2[\JHQ VWUHVV DQG VXSHUR[LGH GLVPXWDVHV 3ODQW 3K\VLRO 6KHHK\ 5( 0 .UDPHU DQG :5 +LDWW 5HGXFWLRQ RI SRO\JDODFWXURQDVH DFWLYLW\ LQ WRPDWR IUXLW E\ DQWLVHQVH 51$ 3URF 1DWO $FDG 6FL 86$ 6LWWH 3 + )DON DQG % /LHGYRJHO &KURPRSODVWV ,Q &]\JDQ )& HGf 3LJPHQWV LQ 3ODQWV )LVFKHU 6WXWWJDUW SS 6ODWHU $ 00DXQGHUV (GZDUGV : 6FKXFK DQG *ULHUVRQ ,VRODWLRQ DQG FKDUDFWHUL]DWLRQ RI F'1$ FORQHV IRU WRPDWR SRO\JDODFWXURQDVH DQG RWKHU ULSHQLQJUHODWHG SURWHLQV 3ODQW 0ROHFXODU %LRORJ\ 6PLWK &-6 &) :DWVRQ -5D\ &5%LUG 3& 0RUULV : 6FKXFK DQG *ULHUVRQ $QWLVHQVH 51$ LQKLELWLRQ RI SRO\JDODFWXURQDVH JHQH H[SUHVVLRQ LQ WUDQVJHQLF WRPDWRHV 1DWXUH f 6PLWK &-6 &) :DWVRQ 3& 0RUULV &5 %LUG *% 6H\PRXU -( *UD\ & $UQROG *$ 7XFNHU : 6FKXFK 6 +DUGLQJ DQG *ULHUVRQ ,QKHULWDQFH DQG HIIHFW RQ ULSHQLQJ RI DQWLVHQVH SRO\JDODFWXURQDVH JHQHV LQ WUDQVJHQLF WRPDWRHV 3ODQW 0RO %LRO 6RORPRV 7 5HVSLUDWLRQ LQ VHQHVFLQJ SODQW RUJDQV ,WV QDWXUH UHJXODWLRQ DQG SK\VLRORJLFDO VLJQLILFDQFH ,Q /' 1RRGHQ DQG $& /HRSROG HGVf 6HQHVFHQFH DQG DJLQJ LQ SODQWV $FDGHPLF 3UHVV ,QF 1HZ
PAGE 157

7KHRORJLV $ 7, =DUHPELQVNL 3: 2HOOHU ; /LDQJ DQG 6 $EHO 0RGLILFDWLRQ RI IUXLW ULSHQLQJ E\ VXSSUHVVLQJ JHQH H[SUHVVLRQ 3ODQW 3K\VLRO 7KRPDV + DQG 3 +LOGLWFK 0HWDEROLVP RI WK\ODNRLG PHPEUDQH SURWHLQV GXULQJ IROLDU VHQHVFHQFH ,Q :: 7KRPVRQ ($ 1RWKQDJHO DQG 5& +XIIDNHU HGVf 3ODQW VHQHVFHQFH ,WV ELRFKHPLVWU\ DQG SK\VLRORJ\ $PHULFDQ 6RFLHW\ RI 3ODQW 3K\VLRORJLVWV 5RFNYLOOH 0DU\ODQG SS 7KRPDV + %RUWOLN 5HQWVFK 0 6FKHOOHQEHUJ DQG 3 0DWLOH &DWDEROLVP RI FKORURSK\OO LQ YLYRVLJQLILFDQFH RI SRODU FKORURSK\OO FDWDEROLWHV LQ D QRQ\HOORZLQJ VHQHVFHQFH PXWDQW RI )HVWXFD SUDWHQVLV +XGV 1HZ 3K\WRO ,OO 7KRPSVRQ -( 3DOL\DWK -+ %URZQ DQG &/ 'X[EXU\ 7KH LQYROYHPHQW RI DFWLYDWHG R[\JHQ LQ PHPEUDQH GHWHULRUDWLRQ GXULQJ VHQHVFHQFH ,Q :: 7KRPVRQ ($ 1RWKQDJHO DQG 5& +XIIDNHU HGVf 3ODQW VHQHVFHQFH ,WV ELRFKHPLVWU\ DQG SK\VLRORJ\ $PHULFDQ 6RFLHW\ RI 3ODQW 3K\VLRORJLVWV 5RFNYLOOH 0DU\ODQG SS 7KRPVRQ : : DQG .$ 3ODWW$ORLD 8OWUDVWUXFWXUDO FKDQJHV DVVRFLDWHG ZLWK VHQHVFHQFH ,Q :: 7KRPVRQ ($ 1RWKQDJHO DQG 5& +XIIDNHU HGVf 3ODQW VHQHVFHQFH ,WV ELRFKHPLVWL\ DQG SK\VLRORJ\ $PHULFDQ 6RFLHW\ RI 3ODQW 3K\VLRORJLVWV 5RFNYLOOH 0DU\ODQG SS 7LHPDQ '0 5: +DUULPDQ 5DPDPRKDQ $. +DQGD $Q DQWLVHQVH SHFWLQ PHWK\OHVWHUDVH JHQH DOWHUV SHFWLQ FKHPLVWU\ DQG VROXEOH VROLGV LQ WRPDWR IUXLW 7KH 3ODQW &HOO 7RPDWR *HQHWLF &RRSHUDWLYH 5HSRUWV &ODVVLFDO 0DS OLQNDJH PDSV 86'$$56 &RUQHOO 8QLYHUVLW\ ,WKDFD 1< 7VDQJ (:7 & %RZOHU +HURXDUW : 9DQ &DPS 5 9LOODURHO & *HQHWHOOR 0 9DQ 0RQWDJX DQG ,Q]H 'LIIHUHQWLDO UHJXODWLRQ RI VXSHUR[LGH GLVPXWDVHV LQ SODQWV H[SRVHG WR HQYLURQPHQWDO VWUHVV 7KH 3ODQW &HOO YDQ GHU .URO $ 5 10 0RO DQG $5 6WXLWMH $QWLVHQVH JHQHV LQ SODQWV DQ RYHUYLHZ *HQH 9DQ 'HU 6WUDHWHQ 5$ 5RGULJXHV 3RXVDGD *LHOHQ DQG 0 9DQ 0RQWDJX 7RPDWR DOFRKRO GHK\GURJHQDVH H[SUHVVLRQ GXULQJ IUXLW ULSHQLQJ DQG XQGHU K\SR[LF FRQGLWLRQV )HEV /HWWHUV

PAGE 158

9LHUOLQJ ( 57 1DJDR $( 'H5RFKHU DQG /0 +DUULV $ KHDW VKRFN SURWHLQ ORFDOL]HG WR FKORURSODVWV LV D PHPEHU RI D HXNDU\RWLF VXSHUIDPLO\ RI KHDW VKRFN SURWHLQV 7KH (PER f 9LHUOLQJ ( 7KH UROH RI KHDW VKRFN SURWHLQV LQ SODQWV $QQX 5HY 3ODQW 3K\VLRORJ\ 3ODQW 0RO %LRO :DGD .1 < :DGD ) ,VKLDVKL 7 *RMRERUL DQG 7 ,NHPXUD &RGRQ XVDJH WDEXODWHG IURP WKH *HQ%DQN JHQHWLF VHTXHQFH GDWD 1XFO $FLG 5HV 6XSSO :DQJ + DQG :5 :RRGVRQ $ IORZHU VHQHVFHQFHUHODWHG P51$ IURP FDUQDWLRQ VKDUHV VHTXHQFH VLPLODULW\ ZLWK IUXLW ULSHQLQJUHODWHG P51$V LQYROYHG LQ HWK\OHQH ELRV\QWKHVLV 3ODQW SK\VLRO :HEHU /$ 5HODWLRQVKLS RI KHDW VKRFN SURWHLQV DQG LQGXFHG WKHUPDO UHVLVWDQFH &HOO 3UROLI :HLVV 5% 5LERVRPDO IUDPHVKLIWLQJ MXPSLQJ DQG UHDGWKURXJK &XUU 2SLQ LQ &HOO %LRO :KLWDNHU %' *URZWK FRQGLWLRQV DQG ULSHQLQJ LQIOXHQFH SODVWLG DQG PLFURVRPDO PHPEUDQH OLSLG FRPSRVLWLRQ LQ EHOO SHSSHU IUXLW $PHU 6RF +RUW 6FL f :RROKRXVH +: 7KH ELRFKHPLVWU\ DQG UHJXODWLRQ RI VHQHVFHQFH LQ FKORURSODVWV &DQ %RW :UHQFK 30 0 2OLYH 5* +LOOHU &%UDG\ DQG 6SHLUV &KDQJHV LQ SODVWLG SURWHLQV GXULQJ ULSHQLQJ RI WRPDWR IUXLWV 3ODQW 3K\VLRO
PAGE 159

%,2*5$3+,&$/ 6.(7&+ JUHZ XS LQ 0LQQHVRWD WKLQNLQJ PRQWKV RI WRXJK VOHGGLQJ ZDV D QRUPDO ZD\ RI OLIH 0\ IDPLO\ PRYHG WR WKH 6PRN\ 0RXQWDLQV RI $VKHYLOOH 1RUWK &DUROLQD ZKHUH VSHQW WKH ODVW WZR \HDUV RI KLJK VFKRRO JUDGXDWHG IURP D YHU\ VPDOO H[SHULPHQWDO VFKRRO LQ D JUDGXDWLQJ FODVV RI VWXGHQWV 7KH H[SHULHQFH JDYH PH D IDLUO\ XWRSLDQ SHUVSHFWLYH RI HGXFDWLRQ ZKLFK ZDV DXJPHQWHG E\ P\ XQGHUJUDGXDWH HGXFDWLRQ SXUVXHG D %DFKHORU RI 6FLHQFHV GHJUHH IURP %HORLW &ROOHJH D VPDOO OLEHUDO DUWV FROOHJH LQ VRXWKHUQ :LVFRQVLQ 8SRQ JUDGXDWLRQ IURP FROOHJH WRRN D UHVHDUFK SRVLWLRQ LQ WKH 'HSDUWPHQW RI 9HWHULQDU\ 6FLHQFHV DW WKH 8QLYHUVLW\ RI :LVFRQVLQ IRU D \HDU DQG DW 0F&DUGOH /DEV IRU &DQFHU 5HVHDUFK WKH IROORZLQJ WKUHH \HDUV GHFLGHG WR JR EDFN WR VFKRRO LQ SODQW PROHFXODU ELRORJ\ 7KLV ZDV QRW UHDOO\ D FKDQJH LQ GLUHFWLRQ VLQFH P\ XQGHUJUDGXDWH HGXFDWLRQ VSHFLDOL]HG LQ ERWDQ\

PAGE 160

, FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ ‘ <9JHALD A *ORULD $ 0RRUH &KDLU 3URIHVVRU RI 3ODQW 0ROHFXODU DQG &HOOXODU %LRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ .HQQHWK &OLQH $VVRFLDWH 3URIHVVRU RI 3ODQW 0ROHFXODU DQG &HOOXODU %LRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ & (GXDUGR 9DOOHMRV $VVRFLDWH 3URIHVVRU RI 3ODQW 0ROHFXODU DQG &HOOXODU %LRORJ\

PAGE 161

, FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 'RQ +XEHUW 3URIHVVRU RI +RUWLFXOWXUDO 6FLHQFH FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ :LOOLDP *XUOH\ $VVRFLDWH 3URIHVVRU RI 3ODQW 0ROHFXODU DQG &HOOXODU %LRORJ\ 7KLV GLVVHUWDWLRQ ZDV VXEPLWWHG WR WKH *UDGXDWH )DFXOW\ RI WKH &ROOHJH RI $JULFXOWXUH DQG WR WKH *UDGXDWH 6FKRRO DQG ZDV DFFHSWHG DV SDUWLDO IXOILOOPHQW RI WKH UHTXLUHPHQWV IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 'HFHPEHU 'HDQ &ROOHJH RI $JULFXOWXUH 'HDQ *UDGXDWH 6FKRRO

PAGE 162

81,9(56,7< 2) )/25,'$ ,,, ,,, +LOO LLQL IW  QIW


xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E410YCT7K_YF1JFJ INGEST_TIME 2017-07-12T21:08:56Z PACKAGE AA00003245_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES