Characterization of a plant nuclear protein that binds a specific sequence of the 780 gene promoter of T-DNA

MISSING IMAGE

Material Information

Title:
Characterization of a plant nuclear protein that binds a specific sequence of the 780 gene promoter of T-DNA
Physical Description:
vii, 139 leaves : ill., photos ; 29 cm.
Language:
English
Creator:
Adams, Eloise Christine, 1942-
Publication Date:

Subjects

Subjects / Keywords:
Promoters (Genetics)   ( lcsh )
Cauliflower -- Cytology   ( lcsh )
Plant proteins   ( lcsh )
Microbiology and Cell Science thesis Ph. D
Dissertations, Academic -- Microbiology and Cell Science -- UF
Genre:
bibliography   ( marcgt )
non-fiction   ( marcgt )

Notes

Thesis:
Thesis (Ph. D.)--University of Florida, 1993.
Bibliography:
Includes bibliographical references (leaves 122-137).
General Note:
Typescript.
General Note:
Vita.
Statement of Responsibility:
by Eloise Christine Adams.

Record Information

Source Institution:
University of Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
aleph - 001942020
oclc - 31022275
notis - AKB8212
System ID:
AA00003233:00001

Full Text










CHARACTERIZATION OF
SPECIFIC SEQUENCE


A PLANT
OF THE


NUCLEAR
780 GENE


PROTEIN THAT
PROMOTER OF


BINDS
T-DNA


ELOISE


CHRISTINE


ADAMS


A DI
OF THE


SSERTATION PRESENTED TO THE GRADUATE SCHOOL
UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY


UNIVERSITY


OF FLORIDA














ACKNOWLEDGEMENTS


wish


acknowledge


my colleagues


Gurley


their


tenure


support


and


graduate


friendship


student.


given


Special


during


thanks


goes


Barros


gave


time


expertise


beginning


thanks


end.


inspiration


mentor


mentors,


To Kevin,


and


mate,


stimulating


William


extend


conversation.


Gurley,


thanks


support,


guidance,


most


skepticism.


also


owe


debt


gratitude


committee


members,


Robert


Ferl


, Francis


Davis,


Don


McCarty


and


Robert


Schmidt,


their


support


encouragement.


husband,


Howard


daught


Stephanie,


express


loving


thanks


their


support,


inspiration


and


confidence.


And


would


like


acknowledge


McKnight


Black


Doctoral


Fellowship


making


this


possible.
















TABLE OF CONTENTS


ACKNOWLEDGEMENTS

ABBREVIATIONS .


ABSTRACT


S. a a . a a . . . ii


. .. ... . .a .. . a IV


.... . S . . . . . V I


CHAPTER 1 .... . . .. 1

INTRODUCTION
Eukaryotic Gene Promoters ... .. ........ .. .... .... 2
Plant Promoters/DNA Binding Proteins ................... 4
T-DNA Promoters .. ......... .. ... .. ... 14


CHAPTER


CHARACTERIZATION OF PROTEIN-DNA INTERACTIONS


. .. .. 27


Introduction .........
Materials and Methods


Results .. ...
Discussion ...


* S I I a S
* a I a I a S


. S . a a a a a a a a a S S . 27
. . . . . . . . a .32
. a a a a a a a a a a a . a a . . . 39
. .S. . . . . . . .S. 68


CHAPTER


. . . . a a . . . a . a a a a a a .73


PURIFICATION OF THE 780 BINDING PROTEIN (780BP)
Introduction .............. . ... .... ... ........ .. 73
Materials and Methods ... .. .... .. .. ...77


Results


Discussion


.. .. ... ... .. ..... 82
. . .... 107


CHAPTER 4 . .. .. .. .

SUMMARY AND DISCUSSION


REFERENCES


BIOGRAPHICAL SKETCH . . . . . . .. .. 138


122












ABBREVIATIONS


alcohol
agropine


as-


activation
Activation


ASF-1
ATcom


dehydrogenase


synthase


sequence
Sequence


gene


gene


Factor


compos


AT-1


nucl


ear


factor


that


binds


AT-rich


sequences
base pair


b-Zip


basic


leucine


chlorophyll
CA binding
cauliflower


CaMV


zipper
b binding


factor
mosaic


protein


gene


virus


chloramphenicol


acetyltransferase


chal


CNBr


cone


cyanogen
chicken


COUP-TF


synthase
bromide
ovalbumin


gene


upstream


promoter


transcription


factor


CPRF- 1,


Common


Plant


Regulatory


Factor


dimethyl


sulfate


DTT


dithiothreitol
ethylenediamin


EDTA
EGTA


(p-amino


etetraaceti


ethyl


acid


N'-tetraacetic


EmBP-1
GATA-1


acid
wheat
GATA


G-box


Em binding


binding


binding


protein


= embryo)


protein
factor


Gmh spl


soybean


small


molecular


weight


heat


shock


gene
binds


GT-1


light
T-rich


responsive
sequences)


element s


box


II and


B-glucuronidase


HBP-1
HEPES


wheat


stone


binding


protein


2-Hydroxyethyl)piperazine-N-


(2-ethan
histone


H4TF-1


heat
heat


esulfonic


acid)


4 transcription
ck element
ck transcription


factor


factor


kilodalton


light


responsive


soybean 1
mannopine


mas


ectin


element


gene


synthase


'Iflt--- S .... J


Adhl


~tn'LI


IT A








OCSTF


ocs-element


transcription


factor


octopine,


pal
Phy.
PMSF
rbcS


nopaline


phenylalanine
phytochrome A


sec


ammonia


retion


-lyase


gene


gene


phenylmethylsulf
ribulose-1, 5-bi


subunit


SBF-1


encer


gene
binding


onyl
spho


fluoride


sphate


carboxylase


small


factor


SV40


simian


virus


780BP
780BPE
TAF-1
T-cyt
T-DNA


binding
binding


Transcription


tmr;
tran


T-DNA


sfer


prot


ein


prote


element


Activation


cytokinin


Factor


gene


DNA


TGA


(TGACG)


tobacco


DNA-binding


protein


tumor
tumor
tumor


large
root
shoot


Tris
3AF1


tris


AT-ri
units


hydroxymethyll)


ch binding


amino


methane


prot


ons














Abstract


of Dissertation


the University
Requirements f


Presented


of Florida


Degree


to the


in Partial


of Doctor


Graduate


Fulfillment


School
of the


of Philosophy


CHARACTERIZATION


OF A PLANT


NUCLEAR


PROTEIN


THAT


BINDS


SPECIFIC


SEQUENCE


OF THE


GENE


PROMOTER


OF T-DNA


Eloise


Christine


Adams


August


1993


Chairman


Major


William


Department


B. Gurley
Microbiology


Cell


Science


base


pair


TTGAAAAATCAACGC-3


potential


been


cl-s


identified


element

d (-408


(780BPE),


to -393)


promoter


gene


T-DNA.


Using


double


stranded


oligonucleotides


synthesized


region


containing


upstream


activator


sequences


homologous


region


probe


and


nuclear


extracts


from


commercially


obtained


cauliflower,


DNA-protein


interactions


were


demonstrated


using


the


retardation


binding


assay.


This


protein


binding


780BP)


activity


Specific


designated


ases


required


binding


were


defined


using


etic


competition


studies


with


mutated


oligonucleotides,


methylation


interference


assays








different


from any plant


element


previously


characterized.


With a


series


exchange


, gel


of protein


filtration,


purification


heparin


steps


which


affinity


include


and


sequence


specific


DNA affinity


chromatography,


780 binding protein


(780BP)


and


been


characterized.


purified


780BP


from


cauliflower


represents


only


nuclear


second


extract


plant


factor


identified that


specifically


binds


a DNA sequence of


T-DNA


promoter.


780BP


was


characterized


monomer


solution


and has


molecular


weight


range


kilodaltons.


receptor


Interaction


element


780BP


implies


with


mammalian


existence


DNA


hormone


binding


domain


with


high


homology


conserved


domain


steroid/thyroid hormone


receptor


superfamily.














CHAPTER 1

INTRODUCT ION


relationship


between


Agrobacterium


tumefaci ens


and


many


dicotyledonous


naturally

evolved m


cells.


evolved


plants


genetic


Mechanisms


Upon


infect


infection


represents


engineering.


unique


This


transform


dicotyledonous


system


bacterium


eukaryotic


plant


plant


cell by


tumefaci ens,


(tumor


integrated


transfer


inducing


into


DNA


plasmid,


plant


(T-DNA)


pTi)


genome


moves

the


from

plant


(Chilton


the b

cell


al.


,acterium


and


which


1977)


results


development


crown


gall


tumor


(Chilton


al.


1980)


The


phenomenon


wound


site


invasion,


integration


T-DNA


into


the


plant


genome


and


crown


gall


development


been


reviewed


extensively


(Bevan


Chilton,


1982;


Nester


1984;


Weising


et al.,


1988).


Genes


within


integrated


T-DNA


are


under


control


of plant


regulatory


signals.


transcriptional


controls


identified


synthase


T-DNA


element


promoters,


(ocs-element)


only


(Ellis


one,


al.,


the


octopine


1987)


been


shown


bind


plant


nuclear


proteins


Those


purified


from


tobacco


and


nuclei


have


been


designated


cC'S-


element


transcription


factor


(OCSTF)


(Singh


al.,


1989;


al








(OCSBF)


has


been


characterized


and


shown


kilodalton


(kD)


protein


with homology to members


the basic


leucine


zipper


family


(bZip)


transcription


factors


(Singh


al.,


1990) .


fact


that


T-DNA genes


are


integrated


into


plant


genome


and


are


regulated


plant


transcription


factors


dictates


that


mode


T-DNA


promoter


activation


will


parallel


that


of endogenous plant


promoters.


novel


binding


site


plant


nuclear


protein (s)


reported


assays,


here


gene


methylation


T-DNA.


interference


retardation


assays,


DNase


footprint ing,


and


competition


studies


have


been


used


define


this


site


protein-DNA


interaction.


nuclear


protein


group


proteins)


which


been


shown


to bind


specifically


this


sequence


been


purified


from nuclear


extracts


prepared


from


cauliflower


inflorescences


exchange,


filtration,


sequence-specific


DNA


affinity


chromatography.


Eukaryotic Gene Promoters


Transcriptional


control


molecular


level


results


from

RNA


interactions

polymerase,


between


and


eukaryotic


general


and


promoter


specific


elements,


transcription


factors.


Eukaryotic


promoter


structure


and


promoter


interactions


with


transcription


factors


have


been s


studied








1990)


review


This


topic


articles


also


(Ghosh


been


al.,


subject


1981;


McKnight


number


Kingsbury,


1982;


Khoury


Gruss,


1983;


Dynan


Tjian,


1985;


Serfling


al.,


1985


Sassone-Corsi


Borrelli,


1986)


A typical


animal


promoter


RNA


polymeras


contains,


with


exce


options,


following


elements


: a TATA


box,


a cap


signal,


and


a CCAAT


box.


Plant


promoters


are


very


similar


organization


with


one


exception


they


generally


contain


typical


CCAAT


box


motif


Other


upstream


promoter


sequences


such


SV40


core


enhancer


motif


'-GTGGTA/TA/TA/-3


Banerji


al.


1981;


Weiher


al.,


1983)


are


being


routinely


identified


eukaryotic


promote


rs.


TATA


motif,


fits


consensus


'-TATA


A/TAA/T-3


usually


located


itions


base


pairs


(bp)


from


transcription


initiation


site.


TATA


box


found


most


protein


enco


ding


genes


interaction


this


box


with


TATA


binding


protein


transcription


accurately

n initiation


positions

n site (S<


RNA


polymerase


awadogo


Roeder,


over


1985).


CCAAT


sequence


commonly


found


upstream


from


start


trans


cription


and


s involved


promoter


function


animals.


Other


sequence


motifs


which


appear


binding


sites


promoter


specific


transcription


factors


often


function


enhancers


and


can


found


even


further


upstr


eam.


Much


original


work


which


defined


role


of DNA








systems.


For


example,


enhancer


element


was


initially


identified


upstream


from


site


early


genes


SV40


(Benoist


Chambon,


1981;


Jones


al.


1988)


immunoglobulin


(Ig)


heavy


chain


gene


was


first


cellular


gene


found


contain


enhancer


(Banerji


al.,


1981;


Gillies

enhancer


al.,


regions


1983)

were


elements


found


to be


contained


diverse


within


sequence


as well


function.


Those


metallothionine-I


gene


were


found


to be


induced by


heavy metals,


glucocorticoid hormones,


and


bacterial


lipopolysaccharides.


Constitutive


element


were


also present


enhancer


region


this


gene.


While


some


these


their


enhancer


activity,


others


elements


have


were


been


found


shown


ubiquitous


species


tissue


specific.


Plant


Promoters/DNA Binding


Proteins


Plant

plant c


promoter


~ene


structure


expression


and

very


function

similar


the

that


regulation


animal


promoters


(Heidecker


Messing,


1986;


Kuhlemeir


al.


1987) .


For example,


zein


genes,


a representative group of


plant


genes,


TATA


homology


CCAAT


motif


animal


core


enhancer


sequences


have


been


identified


(Brown


al.,


1986) .


addition


TATA box


and


putative


promoter


CCAAT


(CaMV


box


35S)


motif,


contains


cauliflower


three


mosaic


sequence motifs,


virus


as-i








the


trans-acting


factors


ASF-1,


GATA-1,


and


CAF,


respectively.


Plant


gene


promoters


from a


variety


of species


have been


analyzed


found


contain


regulatory


sequences


and


sites


DNA-protein


interactions.


Characterized


genes


include


small


subunit


ribulose-1,5-bisphosphate


carboxylase


gene


(Herrera-Estrella,


1984;


Morelli


al.,


1985;


Timko


al.,


1985;


Fluhr


al.,


1986;


Green


1987;


Kuhlemeir


al.,


1987),


chalcone


synthase


gene


(Kaulen


al.,


1986;


Dron


al.,


1988;


Schulze-Lefert


al.,


1989;


Staiger


al.,


1989;


Lawton


al.,


1991;


Weisshaar


al.,


1991),


phenylalanine


ammonia-lyase


gene


(pal


(Lois


molecular


al.,


weight


heat


1989;


shock


al.,


gene


1990),


Gmhspl7.5-E


small


(Czarnecka


al.,1989;


Barros


1992) ,


and


alcohol


dehydrogenase


gene


(Adhl)


(Ferl


Nick,


1987;


Walker


al.,


1987;


Ferl


Laughner,


1989;


DeLisle


Ferl,


1990) .


regulatory


sites


are


varying


sizes


and


complexities.


as-


sequence


CaMV


promoter


(Lam et


1989)


among


smaller


sites


and


upstream


sequence


from


rbcS


(Kuhlemeir


larger


upstream


al.,


1987)


sequences


among


are


the


generally


larger


found


sites.


contain


number


smaller


regulatory


elements.


For


example,


within


sequence


labeled box


rbcS


and box


short


were


conserved


sequences


identified and


shown


al


al


al








found


influence


contain


gene


two


expression


smaller

n (Kauler


sequences


al.,


that

1986;


directly

Schuize-


Lefert


al.,


1989)


soybean


heat


shock


gene


promoter


(Gmhspl


5-E)


two


heat


shock


elements


HSE-1


(Pelham,


1982)


-49),


HSE-2


-103


-81)


and


two


AT-rich


regions


(-159


-120)


(-234


-201)


(Czarnecka


al.,


1989)


In


extensive


mutagenesis


analysis


HSE-1,


optimum


repeat


sequence


was


defined


either


5'-aGAAg-


5'-cTTCt-3'


(Barros


al.,


1992) .


Adhl


promoter


also


elements


complex


controlling


promoter


only


with


number


aerobically


induced


regulatory


expression,


con st itutive


expression


organ


specific


expression


well


(Howard


element


(ARE


al.,


between


1987) .


There


positions


an anaerobic


-140


regulatory


(Walker


al.


1987)


well


as G-box homology at


positions


-195


to -184


at positions


-122


to -114


(Ferl


& Nick,


1987)


In addition


to positive


elements,


negative


elements


have


also


been


characterized


illustrated


region


from


chsl5


gene


promoter


which


was


analyzed


and


functionally


characterized


transcriptional


silencer


(Dron


al.


1989) .


This


region


was


later


shown


to contain


three


regions,


and box


which


are


binding


sites


nuclear


binding


silencer


factor-i


(SBF-1)


(Lawton


al.,


1991)


Gel ret


-ardation


assays,


vivo


dimethyl


sulfate








DNA-binding


promoter


proteins


sequences.


that


Though


interact


with


number


specific


these


DNA


plant


binding


proteins


have


been


cloned,


most


still


can


definitely


classified


transcription


factors


since


direct


involvement


in transcriptional


regulation has not been demonstrated.


plant


transcription


factors


and DNA binding proteins


cloned


date


are


almost


exclusively


members


bZip


group


(Landschulz


al.,


1988;


Vinson


al.,


1989


Plant


bZip


proteins


appear


to bind


two


distinct


DNA


motifs


with


small


number


able


interact


with


both


types


elements.


DNA


classes


elements,


studied


detail


by the


Cashmore


and


the


Chua


groups,


are


the


G-box


core


hexanucleotide


(5'-CACGTG-


motif


(Williams


al.


1992)


5'-tgACGT/C-3'


motif


Schindler


et al.,


1992b).


The


core


hexanucleotide


(5'-CACGTG-3


has


been


identified

rbcS genes


wide


from pea,


variety


tobacco,


plant


soybean,


promoters


and Arabidops


including

is (Fluhr


al.,


1986;


Although


Grandbastien


original


report


al.,


(Guiliano,


1986;


1988)


Guiliano,


defined a


1988)


12 bp


sequence,


5'-GACACGTGGC-3


to be


sufficient


binding


G-box


factor


(GBF),


core


hexanucleotide


embedded


within


this


sequence


that


become


identified


G-box


element.


Wheat


nuclear protein EmBP-1


been


shown


to bind


G-box-like


sequences


found


ABA-responsive


element


wheat


promoter


and


wheat


histone


promoter








al.


1989;


1991) .


tobacco


bZip


protein,


TAF-1,


been


shown


bind


transcription


G-box-like


(Oeda


motif


1991)


and


addition


activate

nuclear


protein


extracts


from


tomato


leaves


and Arabidopsis


seedlings


(Guiliano,


1991


1988),


maize


tobacco


suspension


seedlings


culture


(Staiger


cell


al.,


(DeLisle


1989;


Ferl,


1990)


have


been


shown


bind


G-box.


Numerous


G-box


binding


proteins


have


been


cloned


include,


wheat


EmBP-1


(Guiltinan


al.,


1990),


tobacco


TAF-1


(Oeda


al.


1991),


parsley


CPRF-1,


(Weisshaar


al.


1991),


HBP-la


and HBP-


Tabata


al.,


1991),


(Schindler


al ,


1992a)


A general


analysis of


the G-box motif,


two


' bases,


bases


flanking the


hexamer


resulted


grouping


G-box


elements


into


two


classes


(Williams


al.,


1992)


oligonucleotides


study


were


Williams


synthesized


which


(1992),


contained


sixteen


intact


hexameric


two


core


and


bases


possible


flanking


combinations


both


and


nucleotides


ends


mutant


hexamer


core


5'-CAATTG-3


with


flanking


sequences


was


also


synthesized


used


probe


retardation


assays


elements


with


cauliflower


form


type


nuclear


protein-DNA


extract.


complex


Class


This


G-box


complex


characterized


large


diffuse


band


which


upon


shorter


exposure


times


seen


to have


three


components


(Al,








(Bl,


perfect


palindromic


8mer


10mer


fell


into


class


G-box-protein


interactions


described


date


have


been


classified


according


predicted binding


pattern


(Williams


al.,


1992)


One


might


infer


from


these


studies


that


in a cell


expressing


a limiting


concentration


type


A binding proteins


and abundant


type


B binding proteins,


genes


whose


promoters


have


class


binding


sites


would


preferentially


expressed


over those


with promoters


containing


class


between


sites.


This


members


phenomenon


class


differential


affinity


factors


been


postulated


play


important


role


regulation


gene


expression


(Williams


et al.,


1992).


The ACGT


core,


which


a component


the G-box element


5'-TGACGT/C


motif,


also been


identified


promoter


the


octopine


synthase


gene


the


palindrome


ocs-element


(5'-ACGTAAGCGCTTACGT-3


(Ellis


al.


1987;


Singh


al.,


1989).


consensus


ocs-


element


(5'-TGACGT/CAAGC/GG/AA/CTG/TACGT/CA/CA/C-3


defined


Bouchez


and


colleagues


also


contains


the


ACGT


core


(Bouchez


1989)


Bouchez


and


colleagues


also


identified


opine


synthase


gene


promoters


T-DNA


addition


ocs)


from


and


plasmids


and


three


plant


viral

nuclear


gene p

:prote


promoters


OCSTF


that

(Singh


contain


al.


the o

1989;


,cs-element.


Tokuhisa


The

al.,


1990)


cloned


OCSBF


(Singh


al.,


1990)


interact


with


trans-acting


al


---


"---








OCSTF


and


OCSBF


are


same


protein


determined.


DNase


footprinting


and


retardation


assays


were


used


demonstrate


that


protein


factor


ASF-1


purified


from pea whole

seedlings and


cell


extract


tobacco


and nuclear


leaves


extracts


able


bind


greer

the


as-i


sequence


(5'-TGACG-3


CaMV


promoter


(located


between


-58)


(Lam


al.,


1989)


tobacco


cDNA


clone


was


isolated


that


encodes


DNA-binding


protein


that


binds


as-i


and


was


named


TGAla


(Katagiri


al.


1989)


Because


both


proteins


specifically


interact


with


same


sequence,


and


mutations


cause


within


this


loss


sequence


as-i


abolish


function,


binding


cloned


TGAla


both


protein


purified


same


ASF-1


(Katagiri


Proteins


that


from


al.


plant


1989;


bind ACGT


core


cells


Lam et


are


al.,


motifs


believed


1989).


show


only


amino


acid


difference


basic


DNA


binding


domain


can


exhibit


different


DNA


binding


site


preferences.


This


was


demonstrated


when


amino acid


sequences


basic


region


HBP-la


(Tabata


1991)


were


compared


with


those


of GBF-


found


to differ


only two


residues


(Schindler


al.,


1992b)


GBF-1


binds


perfect


palindromic


G-box


parsley


chs


promoter


with


equal


affinity


with


the


tgACGTGG-3'


other


motif


hand,


wheat


binds to th


histone


.e wheat


promoter.


histone


HBP-la,


hexamer


a 1.








suggested


the


that


protein


hypothesis


that


regions


contribute


was


supported


converting


GBF-1


outside


DNA


when


DNA


binding


Schindler


DNA binding


binding


domain


specificity.


(1992a)


domain


This


showed


to a HBP-la


DNA


binding


domain


failed


alter


DNA binding properties


GBF-1.


Diversity


within


family


DNA


sequence


motifs


can


greatly


affect binding


affinity


of a regulatory


factor.


This


evident


colleagues


GBF


binding


(Schindler


al.


site


analysis


1992b)


high


Schindler


affinity


binding


site


was


shown


palindromic


G-box


(5'-CCACGTGG-3


high affinity


(Schindler


DNA binding


sites,


al.,


1992b)


which all


Several


shared a


other


5'-ACGTG-


core,


were


identified


using


the


random


binding


site


selection assay.

permutations of


High


the


base


affinity se

is (C,A,T,G)


quences


the


with

two


specific


most


positions


outside


ACGTG


core


are


CCACGTG,


ACACGTG,


TGACGTG,


CTACGTG,


and


TTACGTG.


sequence


5'-TGACGTXX-3


recognized by GBF


only


if the


two 3'


bp are GG or GT.


vi VO


dimethyl


sulfate


footprinting


experiments


were


used


define


sequences


within


promoters


maize


Adhl


gene


(Ferl


Nick,


1987)


Arabidopsis


Adh


gene


(Ferl


Laughner,


1989)


binding


sites


regulatory


molecules.


Four


regions


were


found


within


these


promoters


share


unique


homology.


these


regions


was


designated








suspension


cultures


leaves


also


been


characterized


these


G-box


sequences


Arabidopsi s


Adh


gene


promoter


(DeLisle


Ferl,


1990)


A synthetic oligonucleotide


including


specific


site


from


(encompassing


the


-130


region)


maize


was


used


retardation


experiments


with


whole


cell


extracts


made


from


maize


cell


suspension


cultures


to define


the ARE binding


factor


(ARF-B2


(Ferl,


1990).


pea


nuclear


factor


GT-1


when


cloned


and


analyzed


will


most


likely


member


bZip


class


DNA


binding proteins


because


cognate


binding


sequences


do not


contain


ACGT


core.


GT-1


was


identified


factor


interacting


with


light


responsive


elements


box


GTGTGGTTAATATG-


(-151


-138),


and


box


III


ATCATTTTCACT-3


(-125


to -114)


rbcS-3A promoter


(Green


al., 1987;


and box


1988)


111*


also


further


binds


upstream.


redundant


Through


sequences


substitution


mutational


found


analyses,


critical


six

for


bases

the b


within


finding


box


GT-1


(GGTTAA)


(Green


were

al.,


1988) .


GT-1


present


leaves


of both


light-grown


dark-grown


plants.


not


clear


this


time


whether this


binding


results


in positive


negative


regulation


since


positive and the


negative elements


overlap.


protein


with


binding


sequence


preference


similar


that


GT-1


been


cloned


from


rice


seedlings.


This








proline-


glutamine-rich


domain,


separate


basic and acidic


regions,


and


segment


with


potential


form


helix-


loop-helix


preference


rice


structure


cloned


(Dehesh


GT-2


phytochrome


al.,


1990)


5'-GCGGTAATT-3'


(phy


gene


Sequence


(-228


-219)


promoter.


This


protein


binds


box


element


(5'-GTGTGGTTAAT-3')


rbcS


promoter,


albeit


with


two


orders


magnitude


lower


affinity


than


rice


phyA


sequence.


binding


nuclear


factor


GT-1


box


and


box


with


high


affinity


potentially


distinguishes


nuclear


factor


GT-1


from


cloned factor GT-2.


Another


group


plant


proteins,


factors,


have


been


shown


to bind


promoters


AT-rich


AT-rich


sequences


sequences


have


present


been


numerous


reported


plant


plant


genes


that


are


developmentally


regulated


(Jofuku


al.,


1987;


1989


Jensen


al.,


Rocha-Sosa


al.,


1988;


1989;


Bustos,


1989;


Jacobsen


Jordano


al.,


1990),


al.,


light-


regulated


(Datta,


1989),


stress-regulated


(Baumann,


1987;


Czarnecka


nuclear


al.


factor


1989;


AT-1


Harrison,


binds


1991a;


specific


1991b)


AT-rich


pea


sequence


within


promoters


nuclear


genes


encoding


rbcS


and


polypeptide


component


light-harvesting


chlorophyll


protein


(cab)


complex.


This


sequence


termed


AT-1


box.


Some


these


AT-rich


sequences


have


been


shown


regulatory


nature


and


shown


bind


nuclear


prote








oligonucleotide


containing


tetramer


AT-rich


(-51


to-31


from the


promoter of


rbcS-3A gene


was


used


screen


amplified


tobacco


leaf


express


library.


partial


cDNA


clone


was


obtained,


analyzed,


and


found


contain


repeat


about


amino


acids


with


histidines


cysteines


reminiscent


zinc


finger


DNA


binding


motif


(Struhl,


1989)


Since


this


region


does


conform


exactly


well


characterized


zinc


finger


motif,


classification


of this


clone as


a zinc


finger protein


was


withheld.


evident


from


previous


discussion,


plant


promoters


contain


diverse


group of


regulatory


elements


which


interact


with


a variety


of DNA binding proteins.


promoters


DNA genes


expressed


in plants


have


also


been


shown


to contain


array


regulatory


elements


and


could


also


prove


interact


with numerous


plant


DNA binding proteins.


T-DNA Gene Promoters


Studies


utilizing


the


soil


bacterium


tumefaciens


have


given


biology


insights


(Klee


al.


into many

, 1987) .


fundamental


This


processes


bacterium can be


of plant


used as


vector


for plant


transformations;


thus,


ability


to create


transgenic


plants


presents


variety


research


opportunities.


example,


this


technology


been


used as


tool


engineering


of plant


resistance


to herbicides


ana viruses,


studying


tumorigenesis


plants,








plasmids


are


classified


according


type


opine


s their


encoded


genes


induce.


Opines


are


sugar-amino


acid


derivatives


that


Agrobacterium


metabolizes


carbon


nitrogen


source


(Holsters


al.,


1982).


most


commonly


synthase


and


studied plasmids


octopine


are


synthase.


those


T-DNA


that


encode nopaline


from


nopaline


plasmid


transferred


one


contiguous


fragment.


However,


T-DNA


from


octopine


type


plasmid


transferred


either


one


distinct


fragment


kb),


multiples


T-left


DNA


kb),


and


T-right


DNA


(7.8


Thomashow


al.,


1980;


Barker


al.,


1983)


The


presence


two


imperfect


repeats


left


right


borders,


and


similar


repeat


s within


T-DNA


region


divide


octopine


type


plasmid


pTi15955)


into


three


distinct


domains:


T-left


TL) ,


13175


T-center


(Tc) ,


1816


T-right


(TR),


7883 bp


(Barker


et al.,


1983) .


When


complete


nucleotide


sequence


pTi15955


was


determined,


open


reading


frames


were


identified


(Barker


al.,

date


1983),

(Fig.


but

1-1)


only


transcripts


(Willmitzer


al.,


have

1981;


been r

1982b;


reported

Winter


al.,


1984)


Eight


these


genes


tmr,


ons,


tini


and


ocs


are


located


on TL,


and


remaining


five


(4'),


1040


(3'),


inas


and


1'),


and


ags


(0 ')


are


located


Gene


encodes


mRNA


unknown


function.


Gene


5 modulates


auxin


response


in plants


(Korber


al.,
















T-L


T-R


S1 l U OCS
--- -*) .


ons tml


4' 3'


mas


Figure
1989]


Rectangles


octopine
denote tU


T-DNA I
i T-DNA


[Leisner,


borde


and


arrows


mndi


cate


direction


transcription.


description


individual


genes


is given


in the


text.








encodes


enzyme


biosynthesis


cytokinins.


on's


gene


encodes


a protein


involved


octopine


and nopaline


secretions


(Messens


al.,


1985).


gene


regulates


tumor


enzyme


size


that


some


synthes


plant


izes


species.


octopine


Ocs


(Hack


gene


Kemp,


encodes


1977).


780 gene and


1040 gene


(Winter


1984)


encode mRNAs


of unknown


functions.


The mas genes encode enzymes


two-


step pathway


synthesis


of mannopine,


and


ags gene


encodes


enzymes


that


cyclizes


mannopine


to yield


agropine


(Ell


al.,


1984;


Komro


al.,


1985).


genes


within


the


T-DNA


from


tumefaciens


are


transcribed


RNA


polymerase


(Willmitzer


al.,


1981)


encode


well


defined


Because


polyadenylated


promoters


transcripts


these


genes


(Koncz


possess


al.,


many


1983).


eukaryotic


characterist


and are


under the


control


of plant


regulatory


factors,


they


represent


good


models


studying


protein-DNA


interactions


involved


the


control


plant


gene


expression.


nos


(Koncz


al.,


1983;


Shaw


al.,


1984;


al.,


1986;


Ebert


al.,


1987;


Mitra


1989) ,


ma's


(Velten


al.,


Leung

1983;


1984;


al.,


Knocz


DiRita


1991;

al.,


Gelvin,


Fox

1983;


1987;


1992) ,


Ellis


al.,


Langridge


ocs (1

1987a;


al.,


DeGreve

1987b;


1989;


al.


Leisner


Gelvin,


1988),


a gs


(Ellis


1984;


Bandyopadhyay


al.


1989) ,


T-cyt


(dePater


et al.,


1987a;


1987b;


Strabala


al


al


al








characterized.


multiple


They


regulatory


have


been


regions


shown


therefore


composed


have


potential


being the


site of protein-DNA interactions.


ocs-element


been


identified


"os


promoter


(-130


-101)


al.,


1986)


and


was


shown


essential


promoter


activity.


The


"OS


promoter,


originally


thought


only


constitutively


expressed


plants


al.


1986),


subsequently


been


shown


organ


specific


developmentally


controlled


transgenic


tobacco


plants


al.


1988)


was


also


shown


that


this


promoter


wound


inducible


variety


vegetative


and


reproductive


organs


1990)


wound


response


mediated


ocs-element


nos


(nos


element)


seems


to be enhanced by auxin.


mas


two


promoter


overlapping


represents


promoters


dual


opposite


promoter


polarity


system


which


with


have


regions


that


are


distinct


others


that


are


shared


(Velten


al..


Leung


1984;

al.,


DiRita

1991)


Gelvin,


least


1987; I

three


4angridge


mas


al.,


elements


1989;


(Fox


al.,


1992


clearly


related


ocs-element


overlap many


previously


reported


regulatory


elements


Leung


and


colleagues


(Leung


al.


1991) .


mas


promoter


been


used


number


times


constructs


with


heterologous


promoters


effort


boost


transcription


levels


(Harpster


al.


1988;


Langridge


al.,


1989;


Teeri


al.,


al








promoter.


Expression


was


also


found to be


wound


inducible


leaf


and stem tissue


to be


auxin and


cytokinin responsive


in normal


and tumorous plant


tissues.


Deletion


and


substitution


mutagenesis


experiments


with


promoter


sequences


ags


gene


sunflower


crown


gall


tumors


have


revealed


five


regulatory


regions


addition


TATA


(Bandyopadhyay


al.,


1989) .


This


promoter


also


region


with


sequence


homology


ocs-element


(Barker


al.


1983;


Bouche z


al.,


1989);


however,


role


this


sequence has


to be demonstrated.


T-cyt


(tmr)


promoter


been


analyzed and


found


contain


upstream regulatory


sequences


dePater


al.


1987a;


1987b)


upstream


region


between


-442


-408


was


shown


to be


responsible


for maximum expression


roots,


other


organs


nor


tobacco


suspension-cultured


cell


line


(Strabala


al.


1993) .


effect


-185


-129


deletion


expression


T-cyt


dispute.


tumors,


decrease


al.


deletion


this


expression


1987)


region


from


tobacco


resulted


T-cyt


cell


promoter


suspension


significant


(dePater


cultures,


alteration


promoter


strength


was


observed when


this


region


was


deleted


(Strabala


al.,


1993) .


This


may


prove


not


be a discrepancy


all,


simply


a case of


tissue


specific


expression.





20





Octopine Synthase Gene Promoter


ocs


gene


located


extreme


right


border


from


octopine


type


plasmid.


codes


enzyme


octopine


synthase


(Schroder


al.


1981)


which


catalyzes


reductive


condensation


between


pyruvat e


and


arginine, 1

respectively,


ysine,


histidine,


octopine,


lysopine,


ornithine


histopine,


yield,


octopinic


acid


(Hack


Kemp,


1977)


Sequence


analyses


indicate


presence


TATA


box,


translation


from


AUG,


polyadenylation


recognition


signal,


introns,


and


content


similar


that


many


plant


genes.


This


gene


upstream


regulatory


sequences


one


the


most


well


studied


T-DNA


genes.


When


promoter


mutations


ocs


gene


were


introduced


crown


gall


tumors


study their


effects


expression,


deletions


upstream


position


-294


were


found


interfere


with


expression


(Koncz


al.,


1983)


gene


However,


deletions


expression.


upstream


promoter


region


-170


was


greatly


thus


reduced


hypothesized


to be


length


with a


125 bp control


region.


A 176 bp


(-296 to -116)


sequence


ocs


promoter was


shown


activate


maize


Adhl


promoter


transgenic


tobacco


plants


(Ellis


al.


1987b)


Because


this


element


acted


independently


of orientation,


these


authors


began


using








and at


great


distances


was


not


tested by the


same authors.


Transient


gene


expression


using


deletion


mutants


and


synthetic


oligonucleotides


maize


protoplasts


was


used


identify


palindrome


sequence,


5'-ACGTAAGCGCTTACGT-3'


(-193


to -178),


fragment


as a major


(Ellis


regulatory


al.


1987a)


component


176 bp


Chimeric


maize


Adhl/chloramphenicol


acetyl transferase


genes


with


variety


promoter


mutant


construct s


were


electroporated


into


maize


protoplasts


and


assayed


activity.


When


ocs-


element


was


positioned


-163


with


respect


transcription


start


site,


Adhl


promoter


activity


was


increased


00-fold


over


basal


levels.


Insertions


1000


bases


between


ocs-element


and


transcription


start


site


resulted


dramatic


decrease


Adhl


promoter


activity.


Thus,


influence


ocs-element


diminishes


with


increasing


strength


the


distance

element


from


was


the


also


Adhi


diminished


promoter.


The

was


when


placed


region


position.


referred


having


consequence,


this


enhancer-like


activator


properties.


Animal


enhancers


can


great


distances


and


promoter proper


(Banerji


et al.,


1981;


Fromm &


Berg,


1983) .


ocs-element


necessary


OCS


gene


expression


transformed


tobacco


calli


(Leisner


Gelvin,


1988) .


this


system,


Leisner


and


Gelvin


show


that


element


functions


independently


orientation


when


placed


upstream


ocs









does


not


function


either


orientation


when


placed


downstream


gene,


nor


does


activate


promoter


when


placed


away.


A negative


element


hypothesized


located


inhibited


between


when


-249


these


-222


sequences


since


are


promoter


activity


present


same


construct


with


ocs


palindrome.


Gene


activator


expression


region


under


(contains


control


ocs-element)


ocs


was


upstream


shown


constitutive


leaves,


roots,


stems


transgenic plants


(Otten


al.,


1981)


More


recently,


ocs-element


been


found


tissue


specific


and


developmentally


regulated


(GUS)


(Fromm


reporter


al..


gene


1989) .


Using


constructs,


glucuronidase


ocs-element


was


synthase


shown


confer


expression


confined


root


shoot


apex


transgenic


tobacco


plants.


apparent


discrepancy


constitutive


verses


organ


specific


expression


may


real


discrepancy


promoter

pattern


element


all.


(Otten


observed may


have


Otten


al.,

been


1981)

the r


used the

in which


esult


full


the


the


upstream


expression


action


combination


elements


located


elsewhere


the


promoter.


Fromm


group


used


two


smaller


promoter


sequences,


a 59 bp


fragment


and a


21 bp


fragment


from the


ocs


promoter,


both


which


contained


ocs-element


(Fromm


al. ,


1989)


was


also


shown


that


palindrome


directs


cell


specific


expression


or tne ocs


promoter


within








The existence of


sequences


homologous


to one


half


ocs


palindrome


within


-flanking


regions


of plant


genes


such


cauliflower


mosaic


virus


promoter


(Odell


al.,


1985),


potato


protease


inhibitor


gene


(Thornburg


al.,


1987),


and


soybean


lectin


(Lel)


gene


(Vodkin


al.,


1983)


suggests


only


existence


homologous


DNA


promoter


elements


plant


gene


promoters,


but


also


suggests


that


modifications


have


occurred


purposes


regulator


780 gene


control.


promoter


The


gene,


called


because


approximate


transcript


(Winter


al.,


1984),


major


focus


research


located


presented


extreme


here


left


this


dissertation.


TR-DNA


octopine


plasmid


1984)


(Fig.


.The


1-i)


promoter


(Karcher


region


1984;


has been


Winter


characterized by


al.,


series


and


Gurley,


internal


1987) .


deletions


effect


and


substitutions


transcriptional


(Bruce


activity


from


both


major


and


minor


start


sites


was


quantitated


from


sunflower


crown


gall


tumors.


Three


functional


domains,


activator,


upstream


promoter


region,


and


TATA


box,


were


defined


(Fig.


1-2) .


Within


activator(-440


to -229)


three


direct


repeats


were


identified


(Bruce


Gurley,


1987)


cluster


these


repeats


found


between


-427


v


w


w v


A


al


w -- T
















780


gene of T-right


activator

aDcO jO
. a b c a c


region


njo0


upstream region


r,-
TATA


repeats:

- TCCTTTCGAC
= CACGGA
= TTGAAAA


Figure
region
region


1-2.


(-440
(-229


Circled region


/ou gene
-229) i


-37)


denotes


promoter.
context


and


clustered


with


TATA


activator
upstream


element


repetitive


-37)


sequences








region


(-229


-37)


between


activator


and


TATA has


been


designated


1987)


internal


upstream


effect


deletions


promoter


element


transcription


(-76


(Bruce


was


-112


observe


-98)


Gurley,

.d when


resulted


dramatic


reductions


transcriptional


activity


Also within


this


region,


there


homology


CCAAT


box


consensus


(-120


minor


promoter,


and


major


promoter)


seen


upstream elements


of animal


genes


(Dynan


Tjian,


1985)


addition


various


upstream


elements,


TATA


element


was


also


shown


required


transcriptional


activity.


activator


possess


some


characteristics


typical


stimulate


animal


enhancer


transcription


evidenced


bi-directional


ability


manner


over


relatively


absence


large


other


distance


upstream


(650


bases)


elements


from


(Bruce


TATA


al.,


1988)


However,


not


stimulate


transcription


when


positioned


coding


region


gene


(200


downstream


from


poly (A)


site)


Thus,


name


"780


activator"


remains


and


term


"enhancer-like"


used


reference


activity


this


element.


may


possible


that


activator (-476


-229)


indeed


enhancer.


possible


that


when


construct


was


generated,


enough


core


promoter


("promoter


proper")


was


left


intact.


test


gene


(-37


+926)


included


only


bases








deletions


transcriptional


-76


and


activity


-112


(Bruce


result


Gurley,


reduced


1987)


When


downstream


construct


was


tested,


only


a TATA and a


enhancer.


order


definitely


classify


activator


enhancer,


repeat


this


experiment


suggested


using


construct


that


contains


more


intact


core


promoter


sequences.


Plant


DNA


binding


proteins


(putative


transcription


factors)


along


with


their


cognate


promoter


binding


sequences


have


been


presented.


T-DNA


promoters


which


have


been


shown


transcribed


RNA


polymerase


regulated


plant


nuclear


factors,


have


also


been


discussed.


cloning


plant


transcription


factor


(OCSBF)


that


regulates


specific


T-DNA


promoter


suggests


that


there


are


more.


identification


with


following


another


report


such


novel


factor


promoter


begun


site


protein-DNA


T-DNA.


interactions


process


within


continues


promoter


with


780 gene


purification


characterization


a DNA binding protein(s)


from cauliflower


nuclear


extracts


that


binds


this


specific


site


gene promoter.














CHAPTER


CHARACTERIZATION OF PROTEIN:DNA INTERACTION


Introduction


Agrobacteri um


t umefaciens


induces


abnormal


proliferation


of plant


cells


resulting


crown


gall


tumors


(for


review


see


Nester


a1.,


1984)


Crown


gall


tumors


can be


characterized


undifferentiated,


rapidly


dividing


cells.


Tumor


induction


results


from


enlistment


plant


transcription


factors


required


expression


cytokinin


gene,


auxin


genes,


and


genes


responsible


production


opines.


DNA


promoter


function


been


characterized


in meristematic


tissue


(undifferentiated


rapidly


dividing


cells)


(Leisner


Gelvin,


1989) .


regulatory


element


from


"CS


gene


been


found


to direct


tissue


specific


expression


root


tips


young


older


transgenic


seedlings


tobacco


(Fromm


seedlings


al.,


and


1989) .


shoot


highest


apex


level


OCSBF-1


differentiating


expression


cells


was


maize,


found


such


dividing


basal


and


section


developing


leaves


and


roots


and


shoots


young


plants


(Singh


al.,


1990) .


Thus,


the


choice


cauliflower


inflorescence


source


nuclear


extract


was


only








given


fact


that


abundant


source


of meristematic


tissue.


objective


this


work


identify


region


780


gene


promoter


(Fig.


that


interacts


with


sequence


mutagenesis


specific


DNA-binding


analysis


protein.


gene


deletion


promoter


Bruce


Gurley


(1987) ,


removal


region


between


-427


and


-396


resulted


decrease


in the


relative


transcription


level


which


indicative


presence


upstream


regulatory


element


within


these


Within


this


region


there


are


three


short


repetitive


sequences


that


are


clustered


together


repeated


two


three


times


within


gene


activator.


Short


repeats


this


nature


have


been


shown


only


to be


sites


of protein-DNA interactions


enhancers


upstream


elements,


also


shown


regulatory


elements


both


plant


animal


genes


(Oeda


al. ,


1991;


Cooney,


1992;

Initial


this


Schindler

studies


approach


al. ,


focused


was


1992;

these


productive.


Williams

repeat sE


While


al.


sequences;


these


1992)

however,


previously


identified


repeats


remain


great


interest,


present


study


focuses


inverted


repeat


(5'-TGAA----TTCA-3


also


found


within


this


region


Fig.


2-2)


Specific


classes


with


regulatory


inverted


factors


repeats.


have


role


been


this


shown


inverted


interact


repeat


flanking


bases


protein-DNA


interactions,


and


perhaps






















AGAATTCGTGCCAATCCATTTTGTTTTGATTGTCTTGTAAAGTTTTTCCTTTCGACCCGC



TAATCACGGTTGAAAAATCAACGCTTCACTCCTTTCGACTTTTTTAAAGCCGTTTCTAA


a


AATGAAATCTAATCTTTGAAAATGGAAATTTATGCTATATGACTTTATCGCCGTGAAT;

C
2t50
ATTAAAGGAGATTCAGACGGAACTTTAGGCGCTCATTTCGCGACTGGCCCACGGATGATG


TAAAACACTACCTAACAAATTTGAAAAAGACGCCAACCACCGATATAGCCGGTCCAAAG


CGCATCCACTGAAGTACTCATGATCTTT'GAAGGGTAAAAATGTGCTTTAGGTCC CC
d CCAAT
n w up Jte


TATA CCAAT

-50 *I
TT 4---T*TCTC,
W TTTTGGCATTGTGAGCGGACTC TATAAATAIrTAGAACCTCTGCCCTTGCACTCG


maim cp ste


CATCGAAACATCGAGCAATGAGTTATTATTGGATAGACTTAAGGCGCAAGCCCGCCGGAA


figure
Bruce,


2-1.
1987


indicated.


between


-410


Sequences
The short
Protein-DNA


-380


are


gene


repeats
interact


analyzed


promoter


are


ions


in this


.he region
work.


rb C

















780BPE


relative


to 5'


deletions


Bruce


and Gurley


(1987)


A- C --.- 780BPEAT -- -.- -
AAAGT1TTTCCTTTCGACCCGCTAATCACGG, TGAAAAATCAACG CACTCCT1-CGACT AAA


deletions


activity


activity


Figure
Bruce


780BPE


and


Gurl


relative


to 5'


(1987)


deletions


double


analyzed
strand


oligonucl


eot


(-410


-383)


was


synthesized


use


ana


retardation


a probe
lyses.


assays


and


footprint








interaction


with


factor


cauliflower


nuclear


extracts


were determined.


retardation,


methylation


interference


assays,


KMnO4


interference


assays,


DNase


footprinting,


and


competition


studies


have


been


used


characterize


DNA-protein


interactions


vitro.


observation


that


free


DNA


could


separated


from DNA-protein


complexes


on the


basis


their


electrophoretic mobilities


in polyacrylamide


gels


lead


development


retardation


assay


(Fried


Crothers,


1981;


Garner


Revzin,


1981


retardation


assay


been


used


in a quantitative


manner


Garner


Revzin,


1981


kinetic


competition


studies


define


specific


binding


sequence.


Chemical modification


of DNA has


been


exploited


various


applications


identify


specific


sites


DNA


fragment


that


are


required


for


protein


binding.


The


modification


guanine


position


with


dimethyl


sulfate


and


subsequent


cleavage


piperidine


modified


base


(Maxam,


1980)


widely


used


method


identification


significant


residues


formation


DNA-protein


complex.


Potassium


permanganate,


historically


known


ability


to oxidize


double


bonds,


been


used


reactions


which


preferentially


modifies


thymine


residues


(Rubin


al.,


1980) .


Significant


residues


formation


DNA-protein


complex


have


been


identified


using


this


chemical


modification


method.


DNase








technique


(Galas


Schmitz,


1978) .


This


technique


been


used


extensively


the


characterization


DNA-protein


interactions


both


plant


and


animal


systems


(Sawadago


Roeder,


1985;


Brenowit z


al.,


1986;


Green


al.,


1987;


Guiliano,


1988)


DNase


Double

presence


stranded


DNA


absence


partially


binding


degraded

protein.


These


single


end


-labeled


fragments


are


then


visualized


electr


ophoresi


and


autoradiography


along


side


base


specific


method.


reaction


This


product


results


Maxam-Gilbert


identification


sequencing


protected


area,


"the


footprint"


binding


protein


DNA


fragment.


Materials and Methods


Preparation


of nuclear


extract.


Nuclear


extracts


were


prepared


modifications


method


described by


(1987)


This


entire


procedure


was


performed


cold


room


temperatures


between


Florets


from


commercially


acquired


cauliflower


heads


(ca.


1000


were


cut,


then


crushed


with


mortar


and


pestle


1200


buffer


HEPES,


7.9;


sucrose;

N, N',N'

mM KC1;


'-tetr


mM ethylene

aacetic acid


glycol-bis


(EGTA),


mM dithiothreitol


(DTT);


(p-amino

7.9; 1

0.01% N


ethyl


.5

rP-40


ether) -N;


mM MgC12;


detergent)








(NEM),


mg/ml


pepstatin


(Sigma),


and


mg/ml


leupeptin


(Sigma)


tissue


was


then


divided


into


four


samples


and


each


sample


ground


of buffer


(total


volume)


with


Tekmar


Tissuemizer


full


power.


homogenate


was


filtered


through


miracloth


(Calbiochem)


wrapped


cheesecloth.


centrifugat ion


5 K rpm for


Cells


were


10 min


pelleted


pellet


was


resuspened


15 ml


of buffer


then


cells


disrupted


with


strokes

samples


were


Dounce

pooled


hand

and


homogenizer


treated


(pestle B)

one sample


All

for


four

the


remainder


extraction


protocol.


Nuclei


were


pelleted


K rpm


pellet


was


resuspened


total


16-20


buffer


HEPES,


7.9;


glycerol;


mM EGTA,


7.9;


mM MgCl2;


0.45


M KCl;


mM DTT;


.01%


NP-40;


mM PMSF;


mM NEM;


1 mg/ml


pepstatin


and


mg/ml


leupeptin)


extraction


allowed to proceed


30 min


stirring


cold


room.


nuclear


extract


was


clarified


with


one


spin


the


ultracentrifuge


(Bechman


SW55


rotor)


speed


(100,000


nuclear


extract


was


then


aliquoted,


frozen


liquid


nitrogen


and


stored


protein


concentration


was


later


determined


using


Bradford


Protein


Assay


Gel r


from BioRad.


etardation


assay.








extract


(1-3


was


incubated at


room temperature


30 min


with


poly(dI-dC)-poly(dI-dC),


yeast


tRNA


(Sigma)


, and


fill-end


oligonucl


reaction


(Sambrook


eotide


al.,


probe


1989)


3'-labeled


25 p1


binding


EGTA,


buffer


7.9;


HEPES


KC1;


7.9;


MgCl2;


glycerol;


KC1;


DTT;


0.01%


NP-40)


binding


reaction


was


loaded


polyacrylamide


30:1,


acrylamide


to bis-acrylamide


electrophoresed


10 mM Tris,


10 mM boric


acid,


30 mM EDTA buffer


(TBE)


200 volts


hrs.


The gel


was


dried


under vacuum on a


Whatman


filter


using


heated


slab


drier


and


exposed


overnight


X-ray


film


(Kodak,


PDB-1)


presence


intensifier


screen


For


quantitation


purposes,


some


gels


were exposed to a PhosphorImager


screen.


Kinetic competition


studies


series


mutant


oligonucleotides


were


annealed


used


cold


competitors


(5-fold


1000


-fold


molar


excess)


retardation


assays.


percent


activity


shifted


DNA-protein


complexes


was


calculated


using


PhosphorImager


quantified


data


and


plotted


against


fold


competition


calculated on a molar


basis.


Probe preparation








The


probes


were


prepared


either


end-labeling


with


kinase


typical


fill-in


Klenow


end-labeling


labeling reaction


with


Klenow


included


fragment.


ng of DNA,


1 mM


each of dCTP,


dGTP,


and dTTP


(except


labeled nucleotide),


of a-32p


dATP


nucleotide,


3000


units


6000


of Klenow


Ci/mmol),


fragment


appropriate


incubated


Klenow


buffer


50 mM Tris-HC1,


7.5;


10 mM MgCl2;


1 mM DTT;


mg/ml


bovine


serum


albumin,


BSA)


37 C


typical


kinase


labeling reaction


included 100


ng of DNA,


ATP


(7000


Ci/mmol,


mCi),


incubated


Kinase


buffer


Tris-HC1,


spermidine;


MgC12;


DTT;


EDTA)


The


oligonucleotide


probes


were


used


retardation


assays,


methylation


interference


assays,


thymine


specific


interference


assays,


and in kinetic competition


studies.


Methylation


interference


assay


Methylation


guanines


binding


site


DNA


binding


protein


often


interferes


with


binding


that


protein.


Thus,


DNA


probe


that


been


methylated


position


which


interferes


with


binding


will


not


retarded


retardation


assay.


This


assay


was


exploited


effort


identify


specific


guanine


residues


involved


protein-DNA interactions.


A single


end-labeled


probe


was


methylated


average


y- 32P








Approximately


(106


counts


per


minutes


(cpm))


end-


labeled


probe


was


dissolved


Tris-EDTA


(TE)


buffer


mM Tris-HC1,


8.0;


mM EDTA,


probe,


DMS


reaction


buffer


sodium


cacodylate,


EDTA)


and


non-specific


DNA,


mutant


probe,


tRNA


were


added.


Five


microliters


dimethyl


sulfate


(DMS)


were


added,


reaction


mixture


was


vortexed,


then


incubated


this


incubation


period


reaction


was


stopped


with


stop


solution


sodium


acetate,


7.0;


mercaptoethanol)


The


DNA


therein


was precipitated


times


with


ethanol,


washed


with


ethanol


and


dried


Speed-


vac vacuum drier.


DNA


was


reconstituted


binding


buffer,


nuclear


extract


added and


binding


reaction


allowed


to proceed


mm.


This


reaction


was


loaded


onto


native


polyacrylamide


was


and


exposed


electrophoresed


autoradiographic


indicated


film


above.


5-12


protein-DNA


complex


free


probe


bands


were


excised


from


gel,


placed


elution


buffer


and


eluted


overnight


while


shaking


slice


was


removed


from


buffer


precipitated,


sample


washed


with


then


phenol


ethanol,


and


extracted,


ethanol


dried.


DNA


probe


was


suspended


100 ml


piperidine


incubated


min.


This


sample


was


frozen


with


liquid


To








more


times


(approximately


each)


Cerenkov


counts


were


measured


and


cpm


determined.


Formamide


loading


buffer


(Sambrook


al.,


1989)


was


added


pellet.


sample


was


heated


mmn


quick


chilled


and


loaded


onto


fragments


10%

were


sequencing

analyzed


gel

for


(Sambrook


depleted


less


1989).

intense


bands


the complex


lane.


Thymine specific modification by KMnOQ4


Thymine


specific


DNA


modification


was


performed


des


cribed


Rubin


and


Schmid


(1980)


with


minor


modifications.


pyrimidines


KMnO4


carboxylic


oxidizes


acid


the


and/or


double


aldehyde


bond


products


resulting


ring


opening.


Precipitated


probe


(106 cpm)


was


resuspended


Tris-HCl,


8.0,


denatured


95


mmn


and


then


cooled


bucket.


Twenty


microliters


mM potassium permanganate


were


added and


samples


were


incubated


10 min


20 C.


reaction


was


stopped


with


stop


buffer


sodium acetate,


7.0;


1 M P-mercaptoethanol),


nanopure


water was


added.


After two


rounds


of ethanol


precipitation


DNA


was


dried and resuspended


of hybridization buffer


10 mM


Tris-HCl,


mM EDTA,


30mM


NaC1,


8.0),


incubated


min,


and slowly


cooled to room temperature.


The KMnO4


treated


sample


was


used


a binding


reaction


al








assay.


fragments


were


analyzed


depleted


less


intense bands.


DNase


footprinting protection


assay


Cloned


wild


type


oligonucleotide


was


digested


with


EcoRI,


labeled


with


c- 32p


dATP


described


above,


digested


with


Sal I


recovered


from


native


polyacrylamide


gel.


This


DNA


fragment


{io5


cpm)


was


used


binding


reaction


also


described


above


DNA-protein


complex


was


separated


polyacrylamide


and


exposed


autoradiographic


film


overnight


free


probe


bands


were


representing


excised and incubated


complex


of buffer


containing


CaCl2


appropriate


concentrations


DNase


(0.001,


0.01,


0.1,


pg/Jl


incubation


period,


DNase


stop


solution


was


added


terminate


reaction.


DNA


was


then


eluted


overnight


elution


buffer


shaking


buffer


containing


DNA


was


separated


from the


polyacrylamide,


extracted


with


phenol


chloroform,


ethanol


precipitated


and


dried.


DNA


was


dissolved


formamide


loading


buffer,


denatured


two


min


and


loaded


onto


sequencing


containing


M urea.





39






Results


Two complementary


37 base oligonucleotides


containing


bases


the


780


activator


region


and


bases


restriction


site


were


synthesized


used


in gel


retardation


assays.


relationship


this


oligonucleotide


within


context


activator


can


seen


Fig.


2-2.


DNA-


protein


interaction


oligonucleotide


and


was


factors


demonstrated


present


between


crude


this


nuclear


extract


made


from


cauliflower


inflorescences.


Binding


reactions


which


proteinase


(Boehringer


Mannheim)


was


included,


demonstrated


that


this


mobility


shift


was


result


of DNA-protein


interactions


(Fig.


2-3) .


A series


of oligonucleotides


with a


variety


of mutations


were


Two


synthesized


mutations,


located


within


and


M142


this


used


M144,


putative


kinetic


disrupt


regulatory


competition


inverted


region


studies.


repeat


(-408


-397)


Mutation


M142


(-407


-406)


changed


*"A.C "


Mutation M144


changed


"CA"


to "GT"


(positions


-399


and


-398)


other mutations


(M146,


M146A,


M133,


M155,


M157)


this


region


are


described


Fig.


2-4.


These


mutant


oligonucleotides


competitors


(5-fold


were

1000


used

-fold


probes


molar


and


cold

gel


excess)


rr TG "








percent


activity


protein-DNA


complex


was


plotted


against


fold


competition


(Fig.


2-9)


Results


kinetic


competition


studies


showed


that


mutations


can


divided


into


two


categories:


those


that


disrupt


binding


and


those


that


have


effect


binding.


When


bases


within


the


inverted


repeat


(mutants


M142,


M144,


M146)


were


altered,


specific


binding


activity was


inhibited.


When


four


bases


immediately


inverted


repeat


were


mutated


(M146A),


specific binding

intervening bases


was


also


(M157),


disrupted.


two


Alteration

substitution


(M155),


and


substitution


(M133)


did


not


affect


specific


binding activity.


Upon


close


analysis


wild


type


sequence,


limited


homology


Ellis


al.


well


1987),


known

G-Box


plant


regulatory


(Guiliano,


1988),


elements

AT-rich,


ocs

and


light


responsive


elements


(Box


Box


III)


(Green


al.,


1987)


observed.


ocs-element


been


identified


promoter


regions


T-DNA


genes


and


three


plant


viral


genes


(Ellis


al.


1987;


Bouche z


al.


1989;


al.,


1992)


OCSBF-1


cloned


from


maize


root


cDNA


expression


(Singh


extract,


library


al.,


been


1990)


GT-1,


A


been


shown


protein


shown


bind


factor


bind


the


from


light


ocs-element


nuclear


responsive


elements


found


promoter


pea


rbcS-3A


gene


boxes


[II (Green et


al.,


1987) .


G-box element






















crude


affinity


free


pure


probe


Figure 2-3.
oligonucleotide
Approximately 1


incubated


Gel


retardation


using


assay


cauliflower


wild


with


type


extract


nuc


probe
(lanes


wild


lear


type


extract.


105 cpm)


was


with


double-affinity


pure


protein


(lanes


Lanes


and


contain


probe


alone.


Lanes


contain
contains


proteinase
extract i


Lane


ncubated at


contains
65 C for


RNAse


lane


10 mmn.


















5'-gatccGATTGAAAAATCAACGCTTCACTCCTTTCGAg-3'


M135


5'-gatccGATTGAAAAATCAACGCTTCACTCg-3'

5'-gatccGATACAAAAATCAACGCTTCACTCg-3'


M142


M144


5'-gatccGATTGAAAAATGTACGCTTCACTCg-3'


M146


5'-gatccGATTGAAAAATCAGTATCTCACTCg-3'


M146A

M133


1.155


5'-gatccGATTGAAAAATCAATATCTCACTCg-3'

5'-gatccGATTGAAAAATCAACGCTTTGTCTg-3'


5'-gatccTCTTGAAAAATCAACGCTTCACTCg-3'
iim


M157


5'-gatccGATTGAGGGGTCAACGCTTCACTCg-3'


Figure


sequences


under


Wild


used


core


the


type


(WT)


Ln competition
mutation in


mutant
studied


each


oligonucleotide


The


bars


oligonucleotide


Complement
synthesized


of each ,
65 C for


strands


annealed


strand


mutant


by
for


heating


min


oligonucleotides


equal


then


were


concentrations


incubating


in annealing buffer.































Figure


2-5.


labeled)


competition was


Competition studies with wild type


and


M133


indicated.


competitors.


(non-
Fold


Each lane contained 0.15


wild


type


oligonucleotide


probe


and


(approximately


retardation


assays


were


crude


nuclear


performed


extract.
indicated


Materials and Methods.














fold
comp


free
probe


fold
comp


free
probe






























Figure


2-6.


Competition


competitors .


Fold


studies


with


competition


M142


was


) and M144
indicated.


Each


probe


lane
and


contained


0.15


of wild


type


(approximately


oligonucleotide


crude


nuclear


extract.


retardation


assays


were


performed


indicated in Materials and Methods.
















fold
comp














free
probe


fold
comp


free
probe


x
0


IX
.:'


















fold













free


comp













probe


Figure


2-7.


Competition


studies


with


M146


competitor.


Fold


competition


was


indicate


Each


lane


contained


wild


type


oligonucleotide


probe


(approximately


crude


nuclear


extract.


retardation


assays


were


performed


indicated in Materials and Methods.

















MUTANT


COMPETITION


STUDIES


0 200 400 600 800 1000


FOLD


1200


COMP


Figure


2-8.


Summary


mutant


competition


studies.


p
-a--'--










demonstrate


cauliflower


series


that


inflorescences


oligonucleotides


specific


indeed


representing


activity


novel

these


observed


activity,


heterologous


plant


elements


were


synthesized


(Fig.


2-9)


An AT


composite


element


(ATcom)


shown


bind


factors


from


variety


plant


nuclear


extracts


(Czarnecka


al.,


1992)


was


also


synthesized.


These


oligonucleotides


were


used as


competitors


kineti


competition


studies


described


above


(Fig.


-12)


order


assess


the


specificity


binding,


percent


activity


complex


was


quantitated


and


plotted


against


fold


competition


(Fig.


-13)


specific


780BP


binding


activity was


competed off by up


1000


fold


molar


excess


each


the


heterologous


competitors.


observation


made


result


numerous


gel


retardation


assays


was


appearance


disappearance


doublet


banding


pattern


protein-DNA


complex.


This


doublet


was


seen


when


retardation


assay


was


performed


with


freshly


prepared


with


once-thawed


nuclear


extract


The


doublet


was


observed


when


either


nuclear


extract


had


undergone


a number


of purification


steps


room


temperature,


when


extract


had


undergone


numerous


rounds


freezing


and


thawing.


This


pattern


would


suggest


that


doublet


was


result


of protein


degradation.






50





HETEROLOGOUS COMPETITORS


C-112

G-Box


A/Tcom


5'-gatcTGACGTAAGCGCTTACGTCA


- 3'


5'-GCCACGTGGC-3'


5'-tcgacAAAAATAATATTAATATTATATTGAAAg-3'


5'-GTGTGGTTAATATG-3'


5'-ACTTTATCATTTTCACTATCT-3'


(4X)


Figure


2-9.


Heterologous


oligonucleotide


sequences


used


competition


studies.


Complementary


strands


A/Tcom,


BoxIl,


BoxIll


were


synthesized


annealed


heating


equal


amounts
then i


of complementary
ncubating at 65


strands


annealing


buffer.


oligonucleotides
conditions.


were


The


self


C-112
annealed


and


the


under


G-box


same





















fold













free


comp













probe


Figure


2-10.


competition


Competition


was


indicated.


studies


Each


with
lane


A/Tcom.


Fold


contained 0.15


wild


type


oligonucleotide


probe


and


(approximately


retardation


crude


assays


were


nuclear


performed


extract.
indicated


Materials and Methods.



































Figure


2-11. Competition


G-box


studies


competitors.


with


Fold


ocs-element


competition


was


indicated.


Each


lane


contained


wild


type


oligonucleotide


probe


(approximately


crude


nuclear


extract.


retardation


assays


were


performed


indicated in Materials and Methods.















fold


free




fold


comp


probe




comp


en.l


free


probe


:"$"i( :
i- i jjj:"":"::::""































Figure


Box


2-12.
(B)


indicated.


Competition


as
Eact


studies


competitors.


1


lane


contain~


with Box


Fold
S0.15


competition
no of wild


type


oligonucleotide probe and 3 p11


(approximately 6 p.g)


crude


nuclear


extract.


retardation


assays


were


performed as indicated in Materials and Methods















fold












free


fold


free


comp












probe


comp


probe


:Ei








smaller


protein,


from


presence


two


distinct


proteins


with


affinity


probe.


this


doublet


was


result


interaction


cause


colleagues

cytoplasmic


protein-protein


should

protein

(1990)

extract


disrupted


conformational

demonstrated t


under


interaction,


biochemical

change.


hat


biochemical


then


agents

Mosser


incubation


conditions


this


known

and

HeLa


increased


hydrogen


ion,


urea,


and


nonionic


detergent


concentration


decreases


the


temperature


dependence


for


heat


shock


transcription


factor


(HSF)


activation


vitro.


Their


hypothesis


that


HSF


possesses


DNA


binding


capability


before


activation,


complex


with


another


protein,


such


HSP70,


which


block


s the


DNA


binding


domain.


Thus,


this


activation


caused


disruption


protein-protein


eractions.


incubation


disruptive


agents


with


cauliflower

protein in


nuclear


teraction


extract s3

s between


should


have


780BP


anc


eliminated

i smaller


protein-

proteins


resulting


disappearance


double


favor


single


band.


the


experiment


shown


Fig.


2-14,


binding


second


protein


780BP


can be


ruled


out


cause


the


double


bands


since


increase


the


concentration


hydrogen


ions,


urea,


NP-40,


retardation


assays


had


effect


doublet


band


formation.


same


observation


was


made


when


Ca2+


was


used


(data


shown)


possibility


separate


DNA binding proteins


the































Figure
of pH
Under


2-14.


(A),
norma


retardation


NP-40


binding


urea


conditions


assays


indicating


on double


the pH


effects


stability.
nd the NP-


concentration


is 0.01






















11


free


0 r 01 0 0 0 0
o a 0 CM O U) 0
O O O O CM C


probe


NP-40


probe


UREA


ol
r







and


change


number


bands


was


observed.


results


these


experiments


are


consistent


with


possible


explanations


doublet


pattern:


protein


degradation


one


780BP,


or two


780BPs


that


show mutually


exclusive


binding


probe.


However,


precautions


were


taken


decrease


possibility


prote


degradation


and


purification


steps


were


conducted at


results


DNase


footprinting


(Figs


2-17


methylation


interference


assay


Fig.


2-15)


and


KMn04


interference


assay


(Fig.


2-16)


further


define


780BP


binding


site.


A methylated


EcoRI/SalI


fragment


was


used


define


residues


close


contact


with


780BP.


residue


at positions


-410


-406 on


strand,


G residues


at -399,


-396,


and at


-394


the bottom strand


are


major


significance


binding


780BP.


residue


-395


on the


bottom strand was


shown


to be of minor


significance


(Fig


. 2-15)


Rubin


and


Schmid


(1980)


developed


reaction


conditions


with


KMn04 in


which


thymine


residues


single


stranded


DNA


would


preferentially


modified.


Thymine


specific


DNA


modification by


KMnO4 combined with


gel retardation assays was


used


modified


with


Truss

T's w.


and


within


binding


colleagues

the hormone

progesteror


(1990)


demonstrate


responsive element

ie receptor. This


that


interfered

technique


was


used


here


identify


specific


residues


important






























Figure 2-15.


Methylation interference assay.


Positions


of methylated G residues are
and the bottom strands. Meth


indicated on both the top
lylation interference assays


were


performed


Methods.
indicated.


Lanes


described


with


and


Materials


without


extract


and
are










Methylation


Interference


Top


Strand


Bottom


Strand


Extract


4:4~


-410
-406


as


-395


a~b


arrw


a-~.


-394
-396


-399


t^kriU


a


m












Significant


residues


Top


Strand


Bottom


Strand


-388







-400






-407
-408


4 4


Extract




-405

-401


:t3i


-390


-380


Figure


2-16.


KMnO4 interference


assay.


Significant


,r~~~~~~r.~~, eg, A ,av- %-a 4 4 n 4 a


~llh ~




























Figure


2-17.


oligonucleotide


DNase
probe


footprint


using


wild


type


The


strand


was


labeled


with


Kinase.


This


probe


(0.3


was


incubated
extract,


with


approximately


A/Tcom


crude


oligonucleotide,


nuclear


each


tRNA


and


(dI-dC)


binding


reaction.


retardation


Methods


assay
DNase


was


run


described


footprinting,


in Materials


technique


Lane


ladder;


lane


free


probe;


lane


free


probe


DNase


Lanes


lanes


I 9


and


concentration


uncomplexed


probe,


lanes


extract,


was


free


probe,


DNase


ng/fl


and in


DNAse
DNase
lanes


ng/Jl.


open


rectangle


e protected
the margin.


region


outlined


with


poly
















DNAse


Footprint


-388


* Ek a e
*^r :


-400


-408


-388






-400






-408





























Figure
probe


2-18.


DNase


footprint


probe


was


using


labeled


EcoRI/SalI


with


Klenow


fragment
Materials


was


the


and


incubated


fill-in


Methods


with


procedure


strand


described


cpm)


crude


approximately


probe


nuclear


extract,
tRNA and


added
Lg/l 1


A/Tcom


poly
final


and


(dI-dC)


oligonucleotide,


in binding


concentrations


reaction


reaction


0.001,


continued


each


DNase


was


0.1,


described


Materials


and


Lanes


concentrations


probe


and


Methods,


contain


DNase


increasing


DNase


footprinting


free
lanes


probe
6-10


and


contain


concentrations


technique
increasing


extract,


DNase


Protected
compared,
margin.


region
and i


can


seen


outlined


when


with


lanes


are


rectangle

















DNAse


Footprint


n^^_^


Barn


aMmUU~m^^.


408


-ap^


:alg


-400


4+ -3,3


a.x


am


386


-388


:-ihh :'


e|^-


eat


a.^^^......^^


e.W~~WMj.^
a*IIIBfBH'?
a.lijj^mjii.


amj^,-,


ak^^


aJJIII+^^^.


a


..Ma^*K^*M


S -


a,^--


aK.K.^


-








strand


were


shown


to be


very


significant


binding


(Fig.


16) .


residues


-392,


-393,


and


-407


strand


and


-398


bottom


strand


have


minor


significance


(Fig.


GGGG-3'


2-16)


Since


did not


inhibit


substitution


binding,


5' -AAAA-3'


apparent


with


interference of


residues


seen


here


may


have


been


result


protection


this


region


bound


factor


not


from


specific


interaction


with


the T residues.


DNAse


footprinting


perhaps


most


widely


used


method


identification


specific


protein


binding


sites


DNA


fragment


(Figs.


2-17


and


2-18)


The


demonstration


clean


DNase


footprint


proved


very


difficult


for


this


fragment.


Fig.


2-17,


oligonucleotide


probe


was


used


this


analysis.


Protection


apparent


lanes


in the


region


from


-399 to


-388.


hypersensitive


indicating


site


boundary


observed


site


area


protected


-388,


protein.


Distinct


protection


visible


between


-399


-396.


This


protection


within


the


region


shown


necessary


binding


the


methylation


interference


and


KMn04


interference


assays.


absence


DNase


cleavage


-400


was


short


length


probe


and/or


less


than


optimum


incubation


time


fragment


with


DNase


Fig.


2-18


shows


the


results


another


attempt


DNase


footprint.


this


experiment,


oligonucleotide


was








that


was


used


this


experiment.


comparison


lane


(no

seen


extract)


from


with


-388


lane


(extract


-410.


added),

with f


protection


ootprint


can


number


hypersensitivity


can be


seen near the


-388


site.


Discussion


sequence


activator


region


been


shown


bind


nuclear


protein


found


cauliflower


extracts.


site


protein


binding


complete


with


identification


significant


and


residues


presented


Fig.


2-19.


This


sequence,


5' -TTGAAAAATCAACGCT-3


located between


deletion


-408


described


-393


Bruce


disrupted by the


Gurley


-396


(1987


deletions


transcription


positions


-427


level


-396


and


resulted


55%,


relative


respectively,


when


compared


obtained by


wild


type.


deleting


sharp


sequences


drop


between


promoter


-427


-396


activity


strongly


suggests


that


within,


a transcriptional


overlaps


regulatory


with,


element


between


located


these


two


deletions


Because


this


sequence


alone


been


shown


directly


to be a regulatory


element,


binding


site


for the


780BP


located


within


this


region


will


hereafter


referred


to as the


"780 binding element"


(780BPE)


significance


cluster


"a~bc"


repeats,


also


located


within


this


region,


been


determined.








repeat


located


within


this


region,


defined


780BPE,


and


seems


significant


component


the


780BPE.


Interpretation


and


of competition


substitution


studies


mutations


with a se

resulted


;ries of


the


development


model


DNA-protein


interaction


involving


two


half


sites.


5'-AAAA-3 '


5 '-GGGG-3'


substitution


mutation


did


not


result


disruption


780BP


binding


activity.


Mutations


M142,


M144,


and M146


and


side


this


substitution


mutation


and


summarized


binding


M155,


the


did


Fig.


2-8,


780BP.


disrupt


each


other


binding.


these


mutations


mutations,


These


M133,


mutations,


disrupted


M135,


therefore,


lie outside


the defined


16 base


element


both at


end.


fact


disrupted


that


when


specific


series


DNA-protein


heterologous


interactions


plant


were not


transcription


elements


were


used


competitors


evidence


that


780BP


activity


novel


activity.


limited


homology


well


known


plant


transcription


elements


G-box


(Guiliano,


1988) ,


ocs


Ellis


al..


1987) ,


GT-1


binding


box


and box


(Green


al.,


1987),


to AT-rich


sequences


(Jensen


al.,


1988;


Czarnecka


1990;


Jacobsen


al.,


1990


proved to be of


no consequence.


Upon


initial


reading,


would


seem


that


conflicting


al








position


-410 and -409 did not affect


the binding of 780BP.


However,


methylation


interference


assay


(Fig.


2-15)


indicates that methylation of the G residue at position -410

interfered with the binding of a factor in the crude nuclear


extract.


Perhaps this latter result can be explained by the


closeness

protein


this


interaction.


residue

This


argument


site

can


specific


also


DNA-


used


explain


more


conflicting


results


observed


mutation


studies


(Fig.


2-9)


which


showed


that


M157


mutant


(5'-


GGGG-3'


substituted


5'-AAAA-3')


did not


interfere


with


binding


indicated


780BP,


that


and


corresponding


KMnO4 interference


residues


assay


bottom


strand were important for binding.


The


observation


doublet


binding


activity


periodically


raised


the


question


whether


one


two


proteins


were


interacting


with


this


binding


site.


doublet


could have resulted from the


instability of protein-


protein


interactions


between


two


proteins,


one


with


DNA


binding


capability


and


the


other


with


DNA


binding


capability.


This hypothesis was dispelled by the results of


experiments which exposed crude nuclear extract


to a series


chemical


reagents


heretofore


shown


disrupt


protein-


protein


interactions.


doublet


once


forme d


persisted


throughout


these experiments.


When binding was


affected by


these conditions,


both bands were affected uniformly.


It was








proteins


exhibiting


mutually


exclusive


binding


same


site.


The nature


sequence,


an inverted repeat


separated


four


bases,


causes


one


speculate


motif


that


might


comprise


DNA binding


domain


780BP.


The bZIP


motif


which


been


identified


most


plant


transcription


factors


consideration.


Proteins


with


bZip


DNA


binding


domain


bind


sequences


comprised


of bases


that


form a


"dyad


symmetrical


quest ion


two


binding


independent


site"


binding


(Vinson


sites


1989)


dispelled by the


results of the mutational


analysis.


al

















SIGNIFICANT G's


5'-gatccG ATTGAAAAATCAACGCTTCACTCCTTTCG Ag-3'


SIGNIFICANT T's


5'-gatccG A TTGAAAA ATCAA CG C TTCA CTC C TTTCG Ag-3'


Figure


2-19.


bases. S
protected


haded
by


780BPE


circles
780BP.


complete
indicate


Open


with
bases


circles


signicant


that


were


indicate


bas


strongly
3es that


were


weakly protected.









CHAPTER 3


PURIFICATION OF THE


780 BINDING PROTEIN


(780BP)


Introduction


Standard methods


of protein


purification


have


been


used


frequently


for the


separation


animal


transcription


factors


from


each


other


and


from


other


nuclear


proteins.


The


promoter


selective


transcription


factor


was


purified


from


human


cells


to more


than


homogeneity


sequential


column


chromatography


and


sequence-specific


DNA


affinity


chromatography


(Briggs


al.,


1986;


Kadonaga


Tjian,


1986)


The


DNA


binding


activity


was


monitored


throughout


the


purification


process


DNase


footprinting


experiments.


The


first


chromatographic


step


was


Sephacryl


S-300


filtration


followed by


DEAE


Sepharose,


heparin


agarose,


fast


performance


liquid


chromatography


(FPLC)


Mono


and


DNA


affinity.


specific


activity


increased


from


units


DNA


1,200


binding


U/mg


activity


FPLC


per


Mono


(U/mg)


nuclear


fractions.


specific


extract


activity


the DNA affinity


fractions


increased approximately


fold


over


that


the


Mono


fractions


(1,200


U/mg


100,000


U/mg)


dramatically


demonstrating


the


power


affinity


chromatography.


Three


proteins


which


bind


different


sites


mouse


immunoglobulin


heavy-chain


enhancer


were








Specific activity was monitored throughout


the purification


process


retardation


assays.


binding


sites


were


precisely mapped by methylation


footprinting,


interference,


and orthophenanthroline/copper


(OP/Cu)


DNase


chemical


nuclease footprinting.


DNA affinity chromatography was used


in a


later


report


to purify the


immunoglobulin heavy


chain


enhancer


site


(mE3)


binding


protein


homogeneity


(Peterson & Calame,


1989)


Drosophila


heat


shock


transcription


factor


(HSF)


was


purified


homogeneity


sequence


specific


affinity


chromatography


shocked


from


cells


nuclear


al.,


extract


1987)


prepared


Nuclear


from


extract


heat


was


chromatographed by heparin-Sepharose,


twice by DNA affinity,


and FPLC Mono


S chromatography.


Photo-affinity


labeling


(Uv-


crosslinking)


(Lin


Riggs,


1974)


combined


with


electrophoresis


was used to determine a molecular weight


kD for this heat HSF.


UV-crosslinking was also used to


measure


molecular


weight


adenovirus


major


late


transcription factor


(Chodosh,


1986)


Reports


the


purification


plant


DNA-binding


proteins and transcription factors are scarce.


Two reports,


one


partial


purification


G-box binding protein


from Arabidopsis suspension


culture


(DeLisle


Ferl,


1990),


and


other


purification


silencer


binding


factor


(SBF-1)


from bean suspension culture


(Harrison,


1991)








using


filtration

specific D]


series


(Sephacry.


NA affinity


ammonium

1 300),


sulfate


precipitation,


heparin-agarose


chromatography


(Harrison,


and


sequence-


1991) .


Using


tetramer


sequence


specific


binding


site,


specific


binding


activity was


monitored by


gel-retardation


analysis


fractions


weight


during


the


160-200


purification


was


process.


determined


this


molecular


protein


solution.


A subunit


molecular weight


95 kD was


determined


SDS


polyacrylamide


gel


electrophore


sis


and


UV-


crosslinking.


apparent


discrepancy


molecular


weight


suggests


that


SBF-1


exists


dimer


solution


and


may


possibly


purified


DNase


bind


dimer.


factor prohibited

protection was d


instability


DNase


demonstrated


footprinting


with


affinity


However,


heparin-agarose


partially purified protein.


Whil


expressed


purpose


purifying


this


protein


was


microsequencing


and


antibody


production,


reported


lack


discussion


stability


that


this


factor


very


make


abundance


and


impossible


obtain


enough


sequencing.


reported,


however,


that


polyclonal


serum


containing


antibodies


SBF-1


been


produced.


These


antibodies


could be


used


screening


cDNA


libraries


and


future


characterizations


this


protein


activity.


date,


cloning


SBF-1


using


antibody


approach has not been reported.








cultures


and


leaves


heparin-agarose,


gel


filtration


(Superose


Pharmacia),


and Mono-Q


chromatography


(DeLisle


Ferl,


1990)


Specifi


activity


was


monitored


with


retardation


assay.


DNase


footprint


analysis


wa s


conducted


on both


partial


crude


extract


purification


on heparin


this


binding


agarose


activity


fractions.


seems


simply


directed


characterization


this


protein


various

stated


certainly


stages


the

seem


of the purification

publication, cloning


direction


process.


of

in


this

which


Though

factor

these aul


not


would


:hors


were


headed.


series


column


chromatography


steps


been


combined


with


sequence-specific


DNA


affinity


chromatography


(Kadonaga


Tjian,


1986)


to purify


780BP


binding


activity


from


cauliflower


inflorescence


nuclear


extract


Among


them


are


heparin


Sepharose


affinity,


Mono-Q


Mono-S


exchange


chromatography.


Heparin


Sepharose


used


separate


proteins


with


affinity


negative


ligands


such


DNA


(DNA


binding


proteins)


from


those


proteins


with


affinity


for negative


ligands.


The Mono-Q column


a strong


anion


exchanger.


composed


MonoBeads-monodispersed


hydrophilic


polymer


chromatography.


particles


Mono-Q


binds


fast,


negatively


high


resolution


charged


groups


through


quaternary


amine


groups.


Mono-S


column


strong


cation


exchanger


MonoBeads


that


bind


positively








methylation


interference


(Maxam,


1980;


Gilman


al .,


1986),


DNase


footprint ing


(Galas


Schmitz,


1978),


UV-crosslinking


(Lin


Riggs,


1974;


al.,


1987) ,


polyacrylamide


electrophoresis


(Laemmli,


1970)


combined


with


silver


staining have been


employed


to characterize the


780BP.


Materials and Methods


Heparin-Sepharose affinity


chromatography


Crude


nuclear


saturation.


extract

The pr


was


ammonium


:ecipitated


sulfate


protein


was


precipitated

resuspended


buffer


and


fractionated


HiTrap


Heparin


column


(Pharmacia)


over


0.1-1


M KC1


gradient


in buffer


8.0.


fractions


containing


appropriate


activity,


indicated


retardation


assay,


were


pooled


and


dialyzed against


0.1 M KC1 buffer


Protein


concent rat ions


were


determined


(Bradford


Protein


Assay


Kit,


BioRad)


and


stored


preparation


next


round


purification.


heparin-Sepharos


purification


step


and


subsequent


steps


were performed in the


cold room


40C)


Ion-exchancre


chromatography


Heparin


pure


nuclear


extract


was


fractionated


using


Mono-Q

buffer


column


(Pharmacia)


complete


with


with


protease


0.1-1


gradient


inhibitors.


fractions


-' ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ CH aC a eaA -a- nla- 4C44- %.4 : -. -~-4, -


c!


a i


~ nC!rr!Cr


ct,


*C I.CI A ~~


~ H~


L








aliquoted


stored


further


study.


remainder


was


loaded onto a Mono-S


column


(Pharmacia)


was


resolved over


.1-1M


assay


gradient


protein


buffer


Samples


concentration,


DNA


were


aliquoted


binding


unit


determination


and


molecular


weight


determination


with


SDS-


PAGE.


filtration


chromatography


filtration


Pharmacia.


utilized


Superose


Superose


cross-linked


column


agarose


from


matrix


recommended


the


resolution


proteins


range.


protein


sample


was


loaded


equilibrated


(buffer


mM KC1)


Superose


column


and


eluted


fractions.


fractions


were


assayed


binding


activity.


identified,

determined by


the


Once


relative


comparing


fractions


molecular


elution


with


weight


profile


activity


range


that


were


was

three


molecular


weight


standards


(albumin,


carbonic


anhydrase,


29 kD;


cytochrome c,


Sigma)


Preparation


of DNA affinity resin


A 30


double-stranded


oligonucleotide


containing


wild


type


sequences


was


used


prepare


DNA-Sepharose


affinity


res


according


procedure


modified


from


Kadonaga


(1991


purified,


double


stranded,


wild


type


synthetic








7.0)


and


pCi


y-32p


dATP


(used


tracer


monitor


coupling


7.6;


Sepharose)


10 mM MgCl2;


Kinase


mM DTT;


buffer


mM Tris-HC1,


mM spermidine;


mM EDTA)


The


oligonucleotide


was


then


self


ligated


reaction


mixture


ligase,


containing


ATP


66 mM Tris-HCl


7.0),


.6),


mM Mg


Weiss


Cl2,


units


15 mM DTT,


1 mM spermidine,


and incubated overnight


at room temperature.


Coupling


DNA


to cyanogen bromide


(CNBr) -Sepharose


CL-4B


(Pharmacia)


was


performed


follows.


resin


was


washed


four


times


with


ice-cold


water


followed


two


washes


with


ice-cold


potassium


phosphate,


8.0.


Approximately


ml of


activated


resin


was


transferred


polypropylene


screw


tube


which


10 mM potassium phosphate


buffer


8.0),


was


added.


ligated DNA in


water


was


added and


reaction


incubated


rotating


wheel


overnight


room


temperature.


resin


was


then


transferred


coarse


sintered


glass


funnel


washed


times


with


100 ml


water.


final


wash


sequence


was


mM potassium


phosphate


buffer,


8.0;


M potassium phosphate


buffer,


8.0;


100 ml


M KC1;


100 ml


water,


and finally with


column


storage


buffer


Tris-HCl,


7.6;


EDTA;


reported


.3

to


NaCI;


stable


.04%

for


(w/v)


least


azide.


year


when


resin


stored












DNA Affinity Chromatography


uniformly


mixed


suspension


DNA


affinity


resin


was


added


Eppendorf


tube


equilibrat


with


binding


buffer


HEPES


, pH


glycerol;


mM EGTA pH


mM MgCl2;


.0 mM DTT;


NP-40)


sec


spin


table


swinging


bucket


centrifuge


resulted


packed


resin


volume


this


bed


volume


resin


partially


purified


nuclear


extract


binding


buffer


was


added.


Binding


was


allowed


to proceed


while


tube


was


rotating.


affinity


resin


was


pelleted


with a


sec


spin


using


medical


table


swinging


bucket


centrifuge


each


step.


The


supernatant


was


removed


and


labeled


"bindat


resin


was


then


washed


with


binding


buffer


KC1)


supernatant


was


removed


and


labeled


"100


wash"


Elution


of protein


was performed


with


400 mM,


700 mM,


and


with


binding


labeled appropriately,


frozen


with


buffer.


liquid


Fractions


nitrogen


were


stored


at -80


Protein


concentrations


were


later


determined using


the Bradford


Photoaffinitv


assay.


crosslinkinc


UV-crosslinking


probe


(wild


type


oligonucleotide)


.01%








Klenow


fragment


of DNA


polymerase


with


incorporation


of bromodeoxyuridine


(BrdU),


dATP,


dCTP,


and dGTP.


primer


extension


labeling


reaction


contained


BrdU:dTTP


(1:1


dATP


3000


Ci/mmol


(200


pCli) ,


dGTP,


dCTP,


and


U/pl


Klenow


fragment.


resulting


2P-labeled probe was used in binding


reactions


cpm/reaction)


with


nuclear


extract


indicated


results.


min


incubation


period,


binding


reaction


was


exposed


an open Eppendorf


tube


to a


nM UV


transilluminator


distance


(sample


lamp)


20 min at


analyzed


room temperature.


SDS-PAGE


sample


(Laemmli,


was


then


1970)


prepared and


was


dried


under vacuum and exposed


as described above.


Half-life determination


protein-DNA


binding


reactions


described


above


was


scaled-up


10-fold


half-life


determination.


After


incubation


binding


reaction,


1000


fold


cold


competitor


DNA


was


added


and


mixed.


Aliqouts


were


removed


various


time


intervals


and


loaded


running


polyacrylamide


gel.


percent


labeled


probe


shifted


complex


was


quantified


described


previously


and plotted against


time points as


described.


a-32p


a-32p





82



Results


purification


scheme


presented


here


was


developed


using


small


cauliflower


amount


florets.


crude


data


nuclear


presented


were


extract


derived


from


from


results


obtained


from


both


small


scale


and


large


scale preparations.


Crude


nuclear


extract


(80-90


was


ammonium


sulfate


precipitated


(70%


saturation),


resuspended


buffer


KC1),


dialyzed


against


buffer


containing


KC1.


extract


was


then


divided


into


samples


and


each


sample


was


separately


applied


Hi-Trap


heparin


Sepharose


column


and resolved by


stepwi


elution


(5 ml


fractions)


with buffer


containing 0


.6 M


M KC1,


respectively.


absorbance


(A280


was


monitored


protein


elution


fractions


were


assayed


780BP


activity


retardation


assays


shown


Fig.


3-1.


780BP


activity


eluted


between


M and


M KC1.


M eluate


was


collected


fractions,


numbers


numbers


Fraction


represented


little


less


than


total


protein


contained


780BP


binding


activity.


This


fraction


was


used


remaining purification steps.


Fraction


from


four


separate


heparin


runs


were


pooled,


ammonium

applied


sulfate


precipitated


Mono-Q


anion


(70%


exchange


saturation),


column


dialyzed


equilibrated


and

with


w








column.


DNA binding


activity was


puried by elution


with a


ml gradient

was eluted


from


0.1 M to


three


1 ml


M KC1.


fractions


Specific binding


at a salt


activity


concentration


0.28-0.46 M KC1


(Fig.


3-3)


further


purify


this


binding


activity,


a DNA affinity


resin


Two


was


prepared


different


described


techniques


were


Materials


employed


and


with


Methods.


affinity


resin.


technique


was


the batch method reported above


the


second


treatment


was


column


approach.


batch


approach


proved


the most


efficient


thus


reported here.


dialyzed


Mono-S


fraction,


which


represented


total


protein,


was


applied


the


DNA


affinity


res


equilibrat

previous


with


buffer


experiments


(0.1


that


specific


KC1)


was


binding


shown


activity


was


completely


retained


affinity


resin


eluted between


M and


M KC1.


ensure


complete


recovery


of binding


activity,

accomplished


elution


with


from

M KC1


the

(Fig.


DNA

3-4)


affinity


resin


presence


was

non-


specific


need i

second


bands


second


affinity


assay


affinity


experiment


780BP


elution.


was


activity


However,


performed,


indicated


before


affinity


first


pure


sample


was


passed


over


Superose


filtration


column.


Assay


filtration


fractions


showed


specific


binding


(Fig. 3-5


activity


Elution


present


these


13-15


fractions


fractions


corresponds




84








Heparin-Sepharose


fraction


Figure 3-1.


Heparin-Sepharose profile.


Specific


780BP


activity is eluted in fraction # 6.


The arrow indicates


780BP


activity.


The


chart


the


bottom


chromatogram showing optical density
typical heparin-Sepharose separation.


(A280) peaks from a


-~~---


...~r--- ---

















Mono 0


r OD r o


r- r- r CM


fraction


I1







"Hi:':..


-a-








-- -# -- -


Figure


3-2.


Mono-Q elution


profile.


780BP


activity did


bind


fractions


Mono


was


under
added


these


conditions


binding


reaction


and


gel


ar S ----3


NtC (OQOr


'"""


*-"-=




















Mono S


Q)

3
tjO


rr r


r-wmON0 e


40G


wr r cu


fraction


Figure
eluted


3-3.


Mono-S


fractions


elution


profile.


18,19,


and


780BP


activity


each


S ~~ ~ ~ S 1 I I


~-="=l~i


I


r 1 r I I


.1 1 1_


.I


*

































































Figure 3-4
contained


Affinity


binding


column


activity


elution


that


profile.


was


Lanes


retained


affinity


-.


res


represent


in and


eluted


different


from


which


M KC1.


demonstrates


Lanes
the


one


,


.


&


*

















Gel


filtration


CO t~ 0
(E)(13(V


0)0O


'noIr-


Fraction


A A A


L-L


t' _-$zW":J--tiir**
r t ..-..._ ., ,
K it:"-: -IWThJ f^pZ'l


flhIvh{ 11/ 1
-4 j Tr'l '- 4


-K-


"'<~'1 ~ I
4- 1
-I
U-
B- _______


C



nrO


1r


-I
+ ~tt~ *-*q I
iv"
a


o


Figure


3-5.


Superose


filtration


profile.


50 ml


concentrated


affinity


extract


was


loaded


onto


Suoerose


column


and


eluted


0.25


fractions


K-



<-1


IC:~FTL


I ----


J &


i


&IL.L


*


.


.



















TABLE 3-1


volume


(microliters)


micrograms/
microllters


Total


protein


(micrograms)


"Bind Units/


miroiter


Total Bind


units


Specific
Activity


Purification


Crude Nuclear


extract


Heparin Sepharose


15500

7000


86800

29400


15500

9800


Monlo-

hAno-S

Affinity #1I


Affinity


Aa sm mOt


divided


samples


"- estimate


Table
bindi


. S


unit


ummary or
= 1 fmol


cati


of DNA


of 780BP


.780


shifted


0.18

0.19


*1.6


352.5


"1222









resin


second


time.


Eluted


affinity


pure


protein


was


assayed,


concentrated


stored


later


use.


detailed


account


yield,


binding


units


determination,


specific


activity,


and


fold


purification


each


step


the


purification


scheme


given


Table


3-1.


Fractionation


over

total


heparin-Sepharose


protein.


resulted


Mono-Q recovery was


the removal

9% of total


protein.


purification


protein


from


Mono-Q


to Mono-S


was


which


represented


total


starting protein.


Specific


activity


fold


purification


numbers


affinity


pure


protein


were


derived


from


estimates


protein


concentration


from


SDS-PAGE.


SDS-PAGE


was


used


combination


with


the


silver


staining technique


verify the


relative


molecular


weight


the


affinity


pure


protein,


monitor


the


purification


process


to determine


purity


binding


activity


(Fig.


3-6)


Many


and


high


mobility


proteins


were


seen


disappear


with


each


step


purification


scheme.


Other


proteins


variable


molecular


weight


were


also


seen.


bands


48-50


range


were


observed


affinity


fraction


also


lane.


observed


Proteins


when


this


affinity


molecular


pure


weight


fraction


range


was


were


UV-


crosslinked to


780BP


binding


site


(Fig.


3-7)


crosslinking


experiments


with


crude


nuclear


extract


rlsmnncd- my-sri


I0Y*~~~~~r gtfll III I; PP~IU-


hi nrl-nc'


h a VP


PK; StPnrP


I 1


| -* r-%


SI I *-


m~r








crude


nuclear


extract


(Fig.


3-7B),


two


bands


50kD


were


also


observed.


Non-specific


activity


seen


with


crude extract


and


with


heparin


Sepharose


fraction


was


seen


when


affinity


pure


fractions


were


used.


The


crosslinking


experiment


was


also


used


answer


question


whether the


proteins


observed


affinity pure


lane


SDS-PAGE


interest.


stained)


this


are


indeed


experiment,


specific


mutant


activity


oligonucleotides


were


used


competitors


(Fig.


3-8)


Since


mutants


M142,


M144,


and M146


not


compete


specific


binding


activity


was


with


predicted


crude


that


nuclear


same


extract


and


specific

with a


banding


Affinity


pattern


pure


seen


protein


would


competitors.


been


observe

The


presented


when


results


these


were


previously


mutants


quite


that


were


surprising.


suggests


that


used


Evidence


doublet


seen


retardation


experiments


and


crosslinking


experiments


with


crude


nuclear


extract


could be


result


protein


degradation,


and,


thus,


same


binding


pattern


should be


observed


this


experiment.


results


from


UV crosslinking


experiments


with mutant


competitors


(Fig.


showed proteins


of different


molecular weights


binding the


wild


type


probe


the


presence


each


mutant


oligonucleotide


competitor.


With


competitor


(Fig.


3-8,


lane


typical


banding


pattern


was


seen


with


proteins


With mutant M142


competitor


(Fig.









lane


four


bands


equal


lower


mobility


were


seen


(proteins


And,


finally


with


mutant


M146


competitor


Fig.


3-8,


lane


two


bands


same


mobility


lane


with


competitor


were


present


(50 and


52 kD)


780BPE


5'-TTGAAAAATCAACGCT-3


shares


homology with


inverted repeat


element


(Fig.3-10)


bound


the


factor


chicken


(COUP-TF)


ovalbumin


COUP-TF


upstream


been


promoter


shown


transcription


member


the


steriod


Analysis


can


receptor


COUP-TF


bind


superfamily


binding


series


(Wang


specificity


naturally


al.,


shown


occurring


1989)


that


elements


COUP-


with


different


spacing


orientation


GGTCA


motif


repeat


(Fig.


3-9A)


(Cooney,


1992)


Oligonucleotides


containing


direct


repeat


inverted repeat


with


spacing


variations


from


bases


were


synthesized


and


used


test


extent


this


promiscuous


COUP-TF binding


behavior.


Because


shared


homology


between


COUP-TF


element


780BP,


hypothesis


that


780BP


factor


would


bind


COUP-TF


element


was


formulated.


test


this


hypothesis,


oligonucleotide


containing the


direct


repeat


Fig.3-10),


which


COUP-TF


had


been


shown


bind


with


high


affinity,


was


synthesized


experiments


rnrnP


used


with


ni nPrr r


competitor


780BP


nr nmlno- 0


780BPE.


h- nrfl nn


retardation


only


7RFRP ;


~rt t ~I thP


I r 1 r


f 1
















stained


SDS-PAGE


Figure
markers


3-6.


SDS-PAGE


are


lanes


and


stained


marked M.


gel.


Lanes


Protein
contained


5Ctg


of crude extract,


and Mono-S


fraction,


column


affinity
affinity


affinity


fraction),
fraction


heparin


fraction,


respectively.
ty fraction


and


that


lane


has


been


Mono-Q fraction,


contained


Lane


(different


from


contained
subjected


batch
batch


filtration.


visible
mobility


single


this


also


lane


seen


band


(arrow)


this


approximately
The band


lane


artifact


lower
which


can also be


seen


in lane


which had no protein added.